Synthesis and novel fluorescence phenomenon of terbium(III) complex with N, N',N' -tris (2-benzimidazolmethyl) amine

International Nuclear Information System (INIS)

Yang, Tianlin; Gao, Min; Yang, Jinhui; Qin, Wenwu

2010-01-01

A benzimidazole ligand with a tripodal structure, N, N', N' -tris (2-benzimidazolmethyl) amine, and its terbium (III) complex has been synthesized. The complex has been characterized by element analysis, IR spectra, mass spectra, thermal analysis and molar conductivity. The terbium ion is found to coordinate with the nitrogen atoms (= N-) of imidazole ring and the bridgehead nitrogen atom. The fluorescence properties of the complex in aqueous solutions have been studied. Under excitation of UV light, the complex exhibits characteristic fluorescence of terbium ion. The luminescence of terbium complex in aqueous solutions is strongly enhanced by H + concentration. This phenomenon makes the new complex favorable for use in fluorescence switches and sensors. The mechanism of the fluorescence enhancement by protonation of the nitrogen atoms (-NH-) of imidazole ring is due to the suppressed photoinduced electron transfer fluorescence quenching on addition of acid. (author)

Nuclear magnetic resonance in ferromagnetic terbium metal

International Nuclear Information System (INIS)

Cha, C.L.T.

1974-01-01

The magnetic properties of terbium were studied by the method of zero field nuclear magnetic resonance at 1.5 to 4 and 85 to 160 0 K. Two unconventional experimental techniques have been employed: the swept frequency and the swept temperature technique. Near 4 0 K, triplet resonance line structures were found and interpreted in terms of the magnetic domain and wall structures of ferromagnetic terbium. In the higher temperature range, temperature dependence of the resonance frequency and the quadrupole splitting were measured. The former provides a measurement of the temperature dependence of the magnetization M, and it agrees with bulk M measurements as well as the latest spin wave theory of M(T) (Brooks 1968). The latter agrees well with a calculation using a very general single ion density matrix for collective excitations (Callen and Shtrikman 1965). In addition, the small temperature-independent contribution to the electric field gradient at the nucleus due to the lattice and conduction electrons was untangled from the P(T) data. Also an anomalous and unexplained relaxation phenomenon was also observed

Terbium nitrate luminescence quenching by eosin in he presence of lithium perchlorate in sulfolane solutions

International Nuclear Information System (INIS)

Ostakhov, S.S.; Kolosnitsyn, V.S.; Krasnogorskaya, N.N.; Kazakov, V.P.

2000-01-01

Quenching of terbium nitrate luminescence by anionic dye, eosin, in the presence of lithium perchlorate in sulfolane solutions was studied. Temperature dependence of terbium nitrate luminescence in sulfolane solutions in the presence of perchlorate anions were considered. The values of energy required for water molecular substitution in Tb 3+ ion coordination sphere for solvent molecule in electrolyte solution were ascertained [ru

Semiconductor composition containing iron, dysprosium, and terbium

Science.gov (United States)

Pooser, Raphael C.; Lawrie, Benjamin J.; Baddorf, Arthur P.; Malasi, Abhinav; Taz, Humaira; Farah, Annettee E.; Kalyanaraman, Ramakrishnan; Duscher, Gerd Josef Mansfred; Patel, Maulik K.

2017-09-26

An amorphous semiconductor composition includes 1 to 70 atomic percent iron, 15 to 65 atomic percent dysprosium, 15 to 35 atomic percent terbium, balance X, wherein X is at least one of an oxidizing element and a reducing element. The composition has an essentially amorphous microstructure, an optical transmittance of at least 50% in at least the visible spectrum and semiconductor electrical properties.

Low-temperature thermal conductivity of terbium-gallium garnet

International Nuclear Information System (INIS)

Inyushkin, A. V.; Taldenkov, A. N.

2010-01-01

Thermal conductivity of paramagnetic Tb 3 Ga 5 O 12 (TbGG) terbium-gallium garnet single crystals is investigated at temperatures from 0.4 to 300 K in magnetic fields up to 3.25 T. A minimum is observed in the temperature dependence κ(T) of thermal conductivity at T min = 0.52 K. This and other singularities on the κ(T) dependence are associated with scattering of phonons from terbium ions. The thermal conductivity at T = 5.1 K strongly depends on the magnetic field direction relative to the crystallographic axes of the crystal. Experimental data are considered using the Debye theory of thermal conductivity taking into account resonance scattering of phonons from Tb 3+ ions. Analysis of the temperature and field dependences of the thermal conductivity indicates the existence of a strong spin-phonon interaction in TbGG. The low-temperature behavior of the thermal conductivity (field and angular dependences) is mainly determined by resonance scattering of phonons at the first quasi-doublet of the electron spectrum of Tb 3+ ion.

Automated spectrofluorimetric determinations of terbium and dysprosium in rare earth mixtures

Energy Technology Data Exchange (ETDEWEB)

Lyle, S.J.; Za' tar, N. (Kent Univ., Canterbury (UK))

1983-12-01

Several methods involving the use of water-soluble binary and ternary complexes have been proposed for the spectrofluorimetric determination based on terbium(III) emission at 545 nm. These are terbium(III) with (A) ethylenediamine-N,N'-bis(o-hydroxyphenylacetic acid), (B) o-hydroxyphenyliminodiacetic acid, (C) EDTA + 5-sulphosalicylic acid, (D) EDTA + 1,2-dihydroxybenzene-3,5-disulphonic acid disodium salt (Tiron), and (E) iminodiacetic acid (IDA) + Tiron. Two of the reagent mixtures (D and E) can also be used for the fluorimetric determination of dysprosium(III) at 582 nm. A comparison has been made of these methods in order to select the most satisfactory procedure with respect to selectivity, sensitivity and suitability for adaption to automatic operation. Results are given and discussed.

Characterization of antibody-chelator conjugates: Determination of chelator content by terbium fluorescence titration

Energy Technology Data Exchange (ETDEWEB)

Brandt, K.D.; Schnobrich, K.E.; Johnson, D.K. (Abbott Laboratories, Department 90M, Abbott Park, IL (United States))

1991-01-01

Fluorescence titrations were performed by adding varying mole ratios of terbium(III) to antibody conjugates formed by benzyl isothiocyanate derivatives of three different polyaminopolycarboxylate chelators (NTA, EDTA, and DTPA) and the results compared to values for average chelator content obtained by cobalt-57 binding assays. For two different murine monoclonal antibodies, the average chelator content obtained by terbium fluorescence titration correlated closely with that measured by the cobalt-57 binding assay. It is concluded that lanthanide fluorescence titrations provide a useful alternative to radiometal binding assays for the determination of chelator content in protein-chelator conjugates.

Characterization of antibody-chelator conjugates: Determination of chelator content by terbium fluorescence titration

International Nuclear Information System (INIS)

Brandt, K.D.; Schnobrich, K.E.; Johnson, D.K.

1991-01-01

Fluorescence titrations were performed by adding varying mole ratios of terbium(III) to antibody conjugates formed by benzyl isothiocyanate derivatives of three different polyaminopolycarboxylate chelators (NTA, EDTA, and DTPA) and the results compared to values for average chelator content obtained by cobalt-57 binding assays. For two different murine monoclonal antibodies, the average chelator content obtained by terbium fluorescence titration correlated closely with that measured by the cobalt-57 binding assay. It is concluded that lanthanide fluorescence titrations provide a useful alternative to radiometal binding assays for the determination of chelator content in protein-chelator conjugates

X-ray fluorescence analysis of terbium oxide for rare earth impurities

International Nuclear Information System (INIS)

Chandola, L.C.; Machado, I.J.; Mohile, A.N.

1975-01-01

A method for the determination of Sm 2 O 3 , Eu 2 O 3 , Gd 2 O 3 , Dy 2 O 3 , Ho 2 O 3 and Y 2 O 3 in terbium oxide is described. The sample is converted to terbium oxalate, mixed with boric acid binder in the ratio 2:1, pelleted at a pressure of 20 tons over a boric acid backing pellet and irradiated with x-rays from a tungsten tube operated by Philips PW 1140 generator. The secondary x-rays thus generated are analysed by a LiF (200) crystal in Philips PW 1220 x-ray fluorescence spectrometer using suitable detectors. The minimum determination limit (MDL) is 0.01% for all rare earth oxides determined except for Y 2 O 3 for which it is 0.005%. (author)

Investigation of terbium scandate as an alternative gate dielectric in fully depleted transistors

Science.gov (United States)

Roeckerath, M.; Lopes, J. M. J.; Özben, E. Durǧun; Urban, C.; Schubert, J.; Mantl, S.; Jia, Y.; Schlom, D. G.

2010-01-01

Terbium scandate thin films were deposited by e-gun evaporation on (100) silicon substrates. Rutherford backscattering spectrometry and x-ray diffraction studies revealed homogeneous chemical compositions of the films. A dielectric constant of 26 and CV-curves with small hystereses were measured as well as low leakage current densities of <1 nA/cm2. Fully depleted n-type field-effect transistors on thin silicon-on-insulator substrates with terbium scandate gate dielectrics were fabricated with a gate-last process. The devices show inverse subthreshold slopes of 80 mV/dec and a carrier mobility for electrons of 225 cm2/V•s was extracted.

21 CFR 146.146 - Frozen concentrated orange juice.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Frozen concentrated orange juice. 146.146 Section... Fruit Juices and Beverages § 146.146 Frozen concentrated orange juice. (a) Frozen concentrated orange juice is the food prepared by removing water from the juice of mature oranges as provided in § 146.135...

Magneto-optical studies of valence instability in europium and terbium phosphors

Czech Academy of Sciences Publication Activity Database

Rodrigues, L.C.v.; Hölsä, J.; Brito, H.F.; Maryško, Miroslav; Matos, J.R.; Paturi, P.; Rodrigues, R.V.; Lastusaari, M.

2016-01-01

Roč. 170, Feb (2016), 701-706 ISSN 0022-2313 Institutional support: RVO:68378271 Keywords : valence * europium * terbium * oxysulfide and -sulfate * phosphors * paramagnetic susceptibility Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.686, year: 2016

Cross sections from 800 MeV proton irradiation of terbium

Energy Technology Data Exchange (ETDEWEB)

Engle, J.W., E-mail: jwengle@lanl.gov [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Mashnik, S.G.; Bach, H.; Couture, A.; Jackman, K.; Gritzo, R.; Ballard, B.D.; Fassbender, M.; Smith, D.M.; Bitteker, L.J.; Ullmann, J.L.; Gulley, M.S.; Pillai, C.; John, K.D.; Birnbaum, E.R. [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Nortier, F.M., E-mail: meiring@lanl.gov [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States)

2012-11-02

Terbium foils were irradiated with 800 MeV protons to ascertain the potential for production of lanthanide isotopes of interest in medical, astrophysical, and basic science research and to contribute to nuclear data repositories. Isotopes produced in the foil were quantified by gamma spectroscopy. Cross sections for 35 isotopes produced in the irradiation are reported and compared with predictions by the MCNP6 transport code using the CEM03.03, Bertini and INCL + ABLA event generators. Our results indicate the need to accurately consider fission and fragmentation of relatively light target nuclei like terbium in the modeling of nuclear reactions at 800 MeV. The predictive power of the code was found to be different for each event generator tested but was satisfactory for most of the product yields in the mass region where spallation reactions dominate. However, none of the event generators' results are in complete agreement with measured data.

Interaction of terbium group metal oxides with carbon

International Nuclear Information System (INIS)

Vodop'yanov, A.G.; Baranov, S.V.; Kozhevnikov, G.N.

1990-01-01

Mechanism of carbothermal reduction of terbium group metals from oxides is investigated using thermodynamic and kinetic analyses. Interaction of metal oxides with carbon covers dissociation of metal oxides and reduction by carbon monoxide, which contribution into general reduction depends on CO pressure. Temperatures of reaction beginning for batch initial components at P=1.3x10 -4 and P CO =0.1 MPa and of formation of oxycarbide melts are determined

Terbium oxide at high pressures

International Nuclear Information System (INIS)

Dogra, Sugandha; Sharma, Nita Dilawar; Singh, Jasveer; Bandhyopadhyay, A.K.

2011-01-01

In this work we report the behaviour of terbium oxide at high pressures. The as received sample was characterized at ambient by X-ray diffraction and Raman spectroscopy. The X-ray diffraction showed the sample to be predominantly cubic Tb 4 O 7 , although a few peaks also match closely with Tb 2 O 3 . In fact in a recent study done on the same sample, the sample has been shown to be a mixture of Tb 4 O 7 and Tb 2 O 3 . The sample was subjected to high pressures using a Mao-Bell type diamond anvil cell upto a pressure of about 42 GPa with ruby as pressure monitor

Terbium(III) ions as sensitizers of oxidation of indole and its derivatives in Fenton system

Energy Technology Data Exchange (ETDEWEB)

Kaczmarek, Małgorzata, E-mail: mkaczmar@amu.edu.pl; Staninski, Krzysztof

2017-03-15

Oxidation of indole and its derivatives in the Fenton system as a source of oxidising agents, in the presence of terbium(III) ions was studied by chemiluminescence methods to get the kinetic curves of emission decay and spectral distributions of chemiluminescence. Terbium(III) ions acted as a sensitizer of the mixtures Tb(III)-Fe(II)/Fe(III)-H{sub 2}O{sub 2}-indole or its derivative (tryptophan, tryptamine, indole-3-acetic acid and indole-3-acetyl aspartic acid). For the above indolic compounds, linear dependencies of integrated intensity of chemiluminescence on concentration of indolic compound in water and in water-acetonitrile solution were obtained. The limits of detection (LOD) and quantification (LOQ) of the indolic compounds studied were found to be by one or two orders of magnitude lower in the system with terbium(III) ions than without them. - Highlights: • Chemiluminescence emitted on oxidation of indolic compounds in Fenton system. • Tb (III) ions as sensitizers of indolic compounds oxidation in solutions. • Linear relations between CL intensity and indolic compound concentration.

Complex compounds of terbium(III) with some nonsteroidal anti-inflammatory drugs and their analytical applications

International Nuclear Information System (INIS)

Teslyuk, O.I.; Egorova, A.V.; Yagodkin, B.N.; Bel'tyukova, S.V.

2007-01-01

Luminescence properties of the complexes of terbium(III) with nonsteroidal anti-inflammatory drugs (ibuprofen and orthofen) were studied. It was demonstrated that in the presence of organic bases (2,2'-dipyridyl and 1,10-phenanthroline) mixed-ligand complexes are formed and the luminescence intensity of terbium(III) increases by a factor of up to 250. The optimum complexation conditions were determined. It was proposed to use these complexes as analytical forms for the luminescence determination of nonsteroidal anti-inflammatory drugs (ibuprofen and orthofen) in pharmaceutical dosage forms. The detection limits are 2 and 0.05 μg/ml, respectively [ru

Green light emission in aluminum oxide powders doped with different terbium concentrations

Energy Technology Data Exchange (ETDEWEB)

Mariscal B, L; Falcony, C. [IPN, Centro de Investigacion y de Estudios Avanzados, 07360 Ciudad de Mexico (Mexico); Carmona T, S.; Murrieta, H.; Sanchez A, M. A. [UNAM, Instituto de Fisica, 04510 Ciudad de Mexico (Mexico); Vazquez A, R. [IPN, Escuela Superior de Computo, 07738 Ciudad de Mexico (Mexico); Garcia R, C. M., E-mail: mariscal2005@gmail.com [UNAM, Facultad de Ciencias, 04510 Ciudad de Mexico (Mexico)

2016-11-01

Different emission intensities presented in aluminum oxide phosphors corresponding to different concentrations of doping performed with terbium are analyzed. The phosphors were synthesized by the evaporation technique and were characterized by photo and cathodoluminescence, X-ray diffraction and EDS techniques for different incorporation percentages of terbium as dopant; they show characteristic transitions in 494, 543, 587 and 622 nm, corresponding to {sup 5}D{sub 4} → {sup 7}F{sub 6}, {sup 5}D{sub 4} → {sup 7}F{sub 5}, {sup 5}D{sub 4} → {sup 7}F{sub 4} and {sup 5}D{sub 4} → {sup 7}F{sub 3}, respectively when they are excited with λ{sub exc} = 380 nm wavelength at room temperature. The results of X-ray diffraction show the presence of α-Al{sub 2}O{sub 3} phases with peaks located at 2θ = 25.78, 35.34, 37.96, 43.56, 45.8, 52.74, 57.7, 61.5, 66.74, 68.44, 77.12 and 80.94, and the δ-Al{sub 2}O-3 phase 2θ = 32.82, 45.8, 61.36 and 66.74. These compounds were heat treated for two hours at 1100 degrees Celsius. EDS analyzes indicate that these compounds have close to 60% oxygen around of 40% aluminum in the presence of terbium as dopant which indicates a stoichiometry close to the expected one for alumina. (Author)

Electroanalytical performance of a terbium(III)-selective sensor based on a neutral ionophore in environmental and medicinal samples

Energy Technology Data Exchange (ETDEWEB)

Gupta, V.K.; Singh, A.K.; Gupta, Barkha [Indian Institute of Technology-Roorkee, Department of Chemistry, Roorkee (India)

2008-04-15

A new highly selective terbium(III) electrode was prepared with a polymeric film doped using S-2-benzothiazolyl-2-amino-{alpha}-(methoxyimino)-4-thiazolethiol acetate as an electroactive material, benzyl acetate (BA) as a plasticizer, and potassium tetrakis(4-chlorophenyl) borate (KTpClPB) as an anionic site in the percentage ratio 3.17:1.58:63.4:31.7 (ionophore-KTpClPB-BA-PVC, w/w). The electrode exhibited a linear response with a near Nernstian slope of 19.5 mV/decade within the concentration range 1.5 x 10{sup -7}-1.0 x 10{sup -2} M terbium ions, with a working pH range from 2.0 to 8.0, and a fast response time of 10 s and presented satisfactory reproducibility. The limit of detection was 9.3 x 10{sup -8} M. The results show that this electrode can be used in ethanol media up to 30% (v/v) concentration without interference. It can be used for 3 months without any considerable divergence in the potentials. Selectivity coefficients for terbium(III) with respect to many cations were investigated. The electrode is highly selective for terbium(III) ions over a large number of monovalent, bivalent, and trivalent cations. This shows the valuable property of the proposed electrode. The stability constant of the ionophore towards Tb{sup 3+} ions was determined with the sandwich membrane method. It was successfully used as an indicator electrode in potentiometric determination of terbium(III) ions with EDTA and in direct determination in tap water and binary mixtures with quantitative results. The utility of the proposed electrode was also determined in the presence of ionic and nonionic surfactants and in the presence of fluoride ions in four pharmaceutical (mouthwash) preparations. (orig.)

Electroanalytical performance of a terbium(III)-selective sensor based on a neutral ionophore in environmental and medicinal samples

International Nuclear Information System (INIS)

Gupta, V.K.; Singh, A.K.; Gupta, Barkha

2008-01-01

A new highly selective terbium(III) electrode was prepared with a polymeric film doped using S-2-benzothiazolyl-2-amino-α-(methoxyimino)-4-thiazolethiol acetate as an electroactive material, benzyl acetate (BA) as a plasticizer, and potassium tetrakis(4-chlorophenyl) borate (KTpClPB) as an anionic site in the percentage ratio 3.17:1.58:63.4:31.7 (ionophore-KTpClPB-BA-PVC, w/w). The electrode exhibited a linear response with a near Nernstian slope of 19.5 mV/decade within the concentration range 1.5 x 10 -7 -1.0 x 10 -2 M terbium ions, with a working pH range from 2.0 to 8.0, and a fast response time of 10 s and presented satisfactory reproducibility. The limit of detection was 9.3 x 10 -8 M. The results show that this electrode can be used in ethanol media up to 30% (v/v) concentration without interference. It can be used for 3 months without any considerable divergence in the potentials. Selectivity coefficients for terbium(III) with respect to many cations were investigated. The electrode is highly selective for terbium(III) ions over a large number of monovalent, bivalent, and trivalent cations. This shows the valuable property of the proposed electrode. The stability constant of the ionophore towards Tb 3+ ions was determined with the sandwich membrane method. It was successfully used as an indicator electrode in potentiometric determination of terbium(III) ions with EDTA and in direct determination in tap water and binary mixtures with quantitative results. The utility of the proposed electrode was also determined in the presence of ionic and nonionic surfactants and in the presence of fluoride ions in four pharmaceutical (mouthwash) preparations. (orig.)

A terbium(III)-organic framework for highly selective sensing of cytidine triphosphate.

Science.gov (United States)

Zhao, Xi Juan; He, Rong Xing; Li, Yuan Fang

2012-11-21

Highly selective sensing of cytidine triphosphate (CTP) against other triphosphate nucleosides including ATP, GTP and UTP is successfully achieved with a luminescent terbium(III)-organic framework (TbOF) of [Tb(2)(2,3-pzdc)(2)(ox)(H(2)O)(2)](n) (2,3-pzdc(2-) = 2,3-pyrazinedicarboxylate, ox(2-) = oxalate).

Raman spectra of terbium trichloride, phosphorus pentachloride and their molten mixtures

International Nuclear Information System (INIS)

Salyulev, A.B.; Zakir'yanova, I.D.

2008-01-01

Raman spectroscopy was used to study in situ the behavior of individual terbium trichloride and phosphorus pentachloride in different aggregative states as a function of temperature, and of solutions of PCl 5 vapors in molten TbCl 3 . A conclusion is drawn about their structure and the nature of phase transformations and chemical reactions in wide ranges of temperature and saturated vapor pressures [ru

Efficient green luminescence of terbium oxalate crystals: A case study with Judd-Ofelt theory and single crystal structure analysis and the effect of dehydration on luminescence

Science.gov (United States)

Alexander, Dinu; Joy, Monu; Thomas, Kukku; Sisira, S.; Biju, P. R.; Unnikrishnan, N. V.; Sudarsanakumar, C.; Ittyachen, M. A.; Joseph, Cyriac

2018-06-01

Design and synthesis of Lanthanide based metal organic framework is a frontier area of research owing to their structural diversity enabling specific applications. The luminescence properties of rare earths, tuned by the structural features of Ln-MOFs are investigated extensively. Rare earth oxalates which can be synthesized in a facile method, ensuring the structural features of MOFs with excellent photoluminescence characteristics deserves much attention. This work is the first time report on the single crystal structure and Judd-Ofelt (JO) theoretical analysis - their correlation with the intense and sharp green luminescence of Terbium oxalate crystals. The intense green luminescence observed for Terbium oxalate crystals for a wide range of excitation from DUV to visible region despite the luminescence limiting factors are discussed. The absence of concentration quenching and lifting up of forbidden nature of f-f transitions, allowing direct excitation of Terbium ions is analysed with the help of JO theory and single crystal structure analysis. The JO analysis predicted the asymmetry of Terbium sites, allowing the electric dipole transitions and from the JO intensity parameters, promising spectroscopic parameters - emission cross section, branching ratio, gain band width and gain coefficient of the material were calculated. The single crystal structure analysis revealed the asymmetry of Tb sites and structure of Terbium oxalate is formed by the hydrogen bonded stacking of overlapped six Terbium membered rings connected by the oxalate ligands. The molecularly thick layers thus formed on the crystal surface are imaged by the atomic force microscopy. The presence of water channels in the structure and the effect of lattice water molecules on the luminescence intensity are also investigated.

Spectrofluorimetric determination of cefixime using terbium-danofloxacin probe

Directory of Open Access Journals (Sweden)

Jamshid L Manzoori

2014-04-01

Full Text Available Objective(s:Cefixime (Cfx, is a semi-synthetic third-generation oral cephalosporin antibiotic that is prescribed for the treatment of susceptible infections. There are some procedures for the determination of Cfx in pharmaceutical formulations and biological samples. Herein a spectrofluorimetric method was proposed for Cfx determination based on the fluorescence quenching of terbium-danofloxacin (Tb3+-Dano in the presence of Cfx. Materials and Methods: Cfx was detected based on fluorescence quenching of terbium-danofloxacin (Tb3+-Dano in the presence of Cfx with maximum excitation and emission wavelengths at 347 nm and 545 nm, respectively. The quenched fluorescence intensity of Tb3+- Dano system is proportional to the concentration of Cfx. The optimum conditions for the determination of Cfx were studied. Results: The maximum response was achieved under optimum conditions of [Tris buffer]= 0.008 mol/l (pH 6.5, [Tb3+]=1×10-4 mol/l  and [Dano]=1×10-4 mol/l. The developed method was evaluated in terms of accuracy, precision and limit of detection. The linear concentration ranges for quantification of Cfx were 8.8×10-8-8.8×10-7 mol/l and 1.1×10-7-8.8×10-7 mol/l in standard and human serum samples with the detection limits (S/N=3 of 2.8×10-8 mol/l and 3.9×10-8 mol/l, respectively. The Cfx was determined in pharmaceutical tablets and spiked serum samples and the results were satisfactory.   Conclusion: This method is simple, practical and relatively interference-free for determination of Cfx in pharmaceutical tablets and serum samples.

Determination of fluoxetine in pharmaceutical and biological samples based on the silver nanoparticle enhanced fluorescence of fluoxetine-terbium complex.

Science.gov (United States)

Lotfi, Ali; Manzoori, Jamshid L

2016-11-01

In this study, a simple and sensitive spectrofluorimetric method is presented for the determination of fluoxetine based on the enhancing effect of silver nanoparticles (AgNPs) on the terbium-fluoxetine fluorescence emission. The AgNPs were prepared by a simple reduction method and characterized by UV-Vis spectroscopy and transmission electron microscopy. It was indicated that these AgNPs have a remarkable amplifying effect on the terbium-sensitized fluorescence of fluoxetine. The effects of various parameters such as AgNP and Tb 3+ concentration and the pH of the media were investigated. Under obtained optimal conditions, the fluorescence intensity of the terbium-fluoxetine-AgNP system was enhanced linearly by increasing the concentration of fluoxetine in the range of 0.008 to 19 mg/L. The limit of detection (b + 3s) was 8.3 × 10 -4 mg/L. The interference effects of common species found in real samples were also studied. The method had good linearity, recovery, reproducibility and sensitivity, and was satisfactorily applied for the determination of fluoxetine in tablet formulations, human urine and plasma samples. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Determination of fluoroquinolone antibiotics by microchip capillary electrophoresis along with time-resolved sensitized luminescence of their terbium(III) complexes

International Nuclear Information System (INIS)

Sierra-Rodero, Marina; Fernández -Romero, Juan Manuel; Gómez -Hens, Agustina

2014-01-01

We report on the time-resolved detection of the three fluoroquinolone (FQs) antibiotics ciprofloxacin (CIP), enrofloxacin (ENR) and flumequine (FLU). On addition of terbium(III) ions, the terbium(III)-FQs chelates are formed in-situ in an on-capillary derivatization reaction of a microfluidic system. The laser-induced terbium(III)-sensitized luminescence of the chelates is measured at excitation/emission wavelengths of 337/545 nm. The analytes can be separated and quantified within less than 4 min. A solid phase extraction step for analyte preconcentration can be included prior to chelation and microchip capillary electrophoresis. The analytical ranges of the calibration graphs for CIP, ENR and FLU are from 10.6 to 60.0, 10.3 to 51.0, and 11.5 to 58.8 ng mL −1 , respectively, and the detection limits are 3.2, 3.1 and 3.6 ng mL −1 , respectively. The precision was established at two concentration levels of each analyte and revealed relative standard deviations in the range from 3.0 to 10.2 %. The method was applied to the analysis of FQ-spiked water samples. (author)

{alpha}-particle induced reactions on yttrium and terbium

Energy Technology Data Exchange (ETDEWEB)

Mukherjee, S.; Kumar, B.B. [School of Studies in Physics, Vikram University, Ujjain-456010 (India); Rashid, M.H. [Variable Energy Cyclotron Center, 1/AF, Bidhan Nagar, Calcutta (India); Chintalapudi, S.N. [Inter-University Consortium for DAE Facilities, 3/LB, Bidhan Nagar, Calcutta (India)

1997-05-01

The stacked foil activation technique has been employed for the investigation of {alpha}-particle induced reactions on the target elements yttrium and terbium up to 50 MeV. Six excitation functions for the ({alpha},xn) type of reactions were studied using high-resolution HPGe {gamma}-ray spectroscopy. A comparison with Blann{close_quote}s geometric dependent hybrid model has been made using the initial exciton number n{sub 0}=4(4p0h) and n{sub 0}=5(5p0h). A broad general agreement is observed between the experimental results and theoretical predictions with an initial exciton number n{sub 0}=4(4p0h). {copyright} {ital 1997} {ital The American Physical Society}

α-particle induced reactions on yttrium and terbium

International Nuclear Information System (INIS)

Mukherjee, S.; Kumar, B.B.; Rashid, M.H.; Chintalapudi, S.N.

1997-01-01

The stacked foil activation technique has been employed for the investigation of α-particle induced reactions on the target elements yttrium and terbium up to 50 MeV. Six excitation functions for the (α,xn) type of reactions were studied using high-resolution HPGe γ-ray spectroscopy. A comparison with Blann close-quote s geometric dependent hybrid model has been made using the initial exciton number n 0 =4(4p0h) and n 0 =5(5p0h). A broad general agreement is observed between the experimental results and theoretical predictions with an initial exciton number n 0 =4(4p0h). copyright 1997 The American Physical Society

Cerium(terbium, erbium)chloride-choline chloride aqueous systems

International Nuclear Information System (INIS)

Gajfutdinova, R.K.; Zhuravlev, E.F.; Bikbaeva, G.G.; Domrachev, V.N.; Vanskova, G.I.

1985-01-01

To clarify the effect of rare earth nature on mutual solubility of rare earth salts and amines the solubility of solid phases in the systems, consisting of choline chloride, water and cerium, terbium, erbium chlorides, has been studied. It is established, that solubility isotherms of all the systems, testify to the formation of new solid phases of the composition: Ce(Tb, Er)xCl 3 x2C 5 H 14 ONClx3H 2 O. Individuality of new solid phases is proved by DTA method, the composition is confirmed by chemical analysis and data of PMR spectra, for choline chloride and its complexes with rare earth chlorides of the given composition PMR and IR spectra are studied

A thermoluminescence study of Z2-centres in terbium-doped NaCl crystals

International Nuclear Information System (INIS)

Reddy, K.N.; Ahmed, I.M.; Pandaraiah, N.; Rao, U.V.S.; Babu, V.H.

1983-01-01

Thermoluminescence (TL), optical absorption are used to correlate thermal annealing of Z 2 -centres with TL peak occurring around 110 0 C in terbium-doped NaCl crystals. The TL glow peak occurring around 190 0 C is attributed to the thermal annealing of F-centres. The thermal activation parameters are calculated for both Z 2 - and F-centre peaks. (author)

22 CFR 146.310 - Recruitment.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Recruitment. 146.310 Section 146.310 Foreign... Recruitment Prohibited § 146.310 Recruitment. (a) Nondiscriminatory recruitment. A recipient to which §§ 146.300 through 146.310 apply shall not discriminate on the basis of sex in the recruitment and admission...

A hydrometallurgical process for the recovery of terbium from fluorescent lamps: Experimental design, optimization of acid leaching process and process analysis.

Science.gov (United States)

Innocenzi, Valentina; Ippolito, Nicolò Maria; De Michelis, Ida; Medici, Franco; Vegliò, Francesco

2016-12-15

Terbium and rare earths recovery from fluorescent powders of exhausted lamps by acid leaching with hydrochloric acid was the objective of this study. In order to investigate the factors affecting leaching a series of experiments was performed in according to a full factorial plan with four variables and two levels (4 2 ). The factors studied were temperature, concentration of acid, pulp density and leaching time. Experimental conditions of terbium dissolution were optimized by statistical analysis. The results showed that temperature and pulp density were significant with a positive and negative effect, respectively. The empirical mathematical model deducted by experimental data demonstrated that terbium content was completely dissolved under the following conditions: 90 °C, 2 M hydrochloric acid and 5% of pulp density; while when the pulp density was 15% an extraction of 83% could be obtained at 90 °C and 5 M hydrochloric acid. Finally a flow sheet for the recovery of rare earth elements was proposed. The process was tested and simulated by commercial software for the chemical processes. The mass balance of the process was calculated: from 1 ton of initial powder it was possible to obtain around 160 kg of a concentrate of rare earths having a purity of 99%. The main rare earths elements in the final product was yttrium oxide (86.43%) following by cerium oxide (4.11%), lanthanum oxide (3.18%), europium oxide (3.08%) and terbium oxide (2.20%). The estimated total recovery of the rare earths elements was around 70% for yttrium and europium and 80% for the other rare earths. Copyright © 2016 Elsevier Ltd. All rights reserved.

Determination of trace amounts of rare earth elements in samarium, terbium and disprosium oxides by graphite furnace atomic-absorption spectrometry

International Nuclear Information System (INIS)

Dantas, E.S.K.

1990-01-01

A graphite furnace atomic-absorption spectrometry method for the determination of neodymium, europium, terbium, dysprosium and yttrium at trace level in samarium oxide; of samarium, europium, dysprosium, holmium, erbium and yttrium in terbium oxide and of europium, terbium, holmium, erbium and yttrium in dysprosium oxide was established. The best pyrolysis and atomization temperatures were determined for each lanthanide considered. Calibration curves were obtained for the pure elements, for binary mixtures formed by the matrix and each of the lanthanides studied and, finally, for the complex mixtures constituted by the matrix and all the other lanthanide of the group under scrutiny. This study has been carried out to examine the interference of the presence of one lanthanide on the behaviour of the other, since a lack of linearity on the calibration curves has been observed in some cases. Detection and determination limits have been determined as well. The detection limits encountered were within the range 0.002 to 0.3% for different elements. The precision of the method expressed as the relative standard deviation was calculated for each element present in each of the matrices studied. The conclusion arrived at is that the method can be applied for determining the above mentioned lanthanides present in the matrices studied with purity up to 99.50%. (author)

47 CFR 80.146 - [Reserved

Science.gov (United States)

2010-10-01

... MARITIME SERVICES Operating Requirements and Procedures Shipboard General Purpose Watches § 80.146 [Reserved] ... 47 Telecommunication 5 2010-10-01 2010-10-01 false [Reserved] 80.146 Section 80.146...

7 CFR 1955.146 - Advertising.

Science.gov (United States)

2010-01-01

... 7 Agriculture 14 2010-01-01 2009-01-01 true Advertising. 1955.146 Section 1955.146 Agriculture... REGULATIONS (CONTINUED) PROPERTY MANAGEMENT Disposal of Inventory Property General § 1955.146 Advertising. (a... real estate brokers, it is the servicing official's responsibility to ensure adequate advertising of...

22 CFR 146.510 - Recruitment.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Recruitment. 146.510 Section 146.510 Foreign... Education Programs or Activities Prohibited § 146.510 Recruitment. (a) Nondiscriminatory recruitment and hiring. A recipient shall not discriminate on the basis of sex in the recruitment and hiring of employees...

22 CFR 146.500 - Employment.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Employment. 146.500 Section 146.500 Foreign... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Employment in Education Programs or Activities Prohibited § 146.500 Employment. (a) General. (1) No person shall, on the...

24 CFR 146.35 - Mediation.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Mediation. 146.35 Section 146.35... ASSISTANCE Investigation, Settlement, and Enforcement Procedures § 146.35 Mediation. (a) HUD shall refer to the Federal Mediation and Conciliation Service, a mediation agency designated by the Secretary of...

Synthesis and luminescence properties of europium and terbium complexes with pyridine- or bipyridine-linked oligothiophene ligand

International Nuclear Information System (INIS)

Liu Ping; Huang Mingsheng; Pan Wanzhang; Zhang Yamin; Hu Jianhua; Deng Wenji

2006-01-01

With an aim to develop novel luminescence materials, europium and terbium complexes of 2,5-(2-thiophene)-pyridine (TPY) and 5,5'-bis(5-(2,2'-bithiophene))-2,2'-bipyridine (B2TBPY) were synthesized, and their luminescence properties studied. The complexes exhibit ligand-sensitized emission, which is typical of Eu(III) and Tb(III) ions

22 CFR 146.540 - Advertising.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Advertising. 146.540 Section 146.540 Foreign Relations DEPARTMENT OF STATE CIVIL RIGHTS NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR... Education Programs or Activities Prohibited § 146.540 Advertising. A recipient shall not in any advertising...

22 CFR 146.405 - Housing.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Housing. 146.405 Section 146.405 Foreign... Activities Prohibited § 146.405 Housing. (a) Generally. A recipient shall not, on the basis of sex, apply... benefits related to housing, except as provided in this section (including housing provided only to married...

33 CFR 211.146 - Price.

Science.gov (United States)

2010-07-01

... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Price. 211.146 Section 211.146 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE REAL ESTATE... Industrial Facilities § 211.146 Price. No conveyance shall be made for a price less than the fair market...

21 CFR 146.141 - Canned orange juice.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Canned orange juice. 146.141 Section 146.141 Food... Beverages § 146.141 Canned orange juice. (a) Canned orange juice is the food prepared from orange juice as specified in § 146.135 or frozen orange juice as specified in § 146.137, or a combination of both, to which...

Preparation and photoluminescence enhancement in terbium(III ternary complexes with β-diketone and monodentate auxiliary ligands

Directory of Open Access Journals (Sweden)

Devender Singh

2016-12-01

Full Text Available A series of new solid ternary complexes of terbium(III ion based on β-diketone ligand acetylacetone (acac and monodentate auxiliary ligands (aqua/urea/triphenylphosphineoxide/pyridine-N-oxide had been prepared. The structural characterizations of synthesized ternary compounds were studied by means of elemental analysis, infrared (IR, and proton nuclear magnetic resonance (NMR spectral techniques. The optical characteristics were investigated with absorption as well as photoluminescence spectroscopy. Thermal behavior of compounds was examined by TGA/DTA analysis and all metal complexes were found to have good thermal stability. The luminescence decay time of complexes were also calculated by monitoring at emission wavelength corresponding to 5D4 → 7F5 transition. A comparative inspection of the luminescent behavior of prepared ternary compounds was performed in order to determine the function of auxiliary ligands in the enhancement of luminescence intensity produced by central terbium(III ion. The color coordinates values suggested that compounds showed bright green emission in visible region in electromagnetic spectrum. Complexes producing green light could play a significant role in the fabrication of efficient light conversion molecular devices for display purposes and lightning systems.

Autofluorescence-Free Live-Cell Imaging Using Terbium Nanoparticles.

Science.gov (United States)

Cardoso Dos Santos, M; Goetz, J; Bartenlian, H; Wong, K-L; Charbonnière, L J; Hildebrandt, N

2018-04-18

Fluorescent nanoparticles (NPs) have become irreplaceable tools for advanced cellular and subcellular imaging. While very bright NPs require excitation with UV or visible light, which can create strong autofluorescence of biological components, NIR-excitable NPs without autofluorescence issues exhibit much lower brightness. Here, we show the application of a new type of surface-photosensitized terbium NPs (Tb-NPs) for autofluorescence-free intracellular imaging in live HeLa cells. The combination of exceptionally high brightness, high photostability, and long photoluminecence (PL) lifetimes for highly efficient suppression of the short-lived autofluorescence allowed for time-gated PL imaging of intracellular vesicles over 72 h without toxicity and at extremely low Tb-NP concentrations down to 12 pM. Detection of highly resolved long-lifetime (ms) PL decay curves from small (∼10 μm 2 ) areas within single cells within a few seconds emphasized the unprecedented photophysical properties of Tb-NPs for live-cell imaging that extend well beyond currently available nanometric imaging agents.

Investigation of the luminescent properties of terbium-anthranilate complexes and application to the determination of anthranilic acid derivatives in aqueous solutions

Energy Technology Data Exchange (ETDEWEB)

Arnaud, N.; Georges, J

2003-01-10

The luminescent properties of terbium complexes with furosemide (FR), flufenamic (FF) acid, tolfenamic (TF) acid and mefenamic (MF) acid have been investigated in aqueous solutions. For all four compounds, complexation occurs when the carboxylic acid of the aminobenzoic group is dissociated and is greatly favoured in the presence of trioctylphosphine oxide as co-ligand and Triton X-100 as surfactant. Under optimum conditions, luminescence of the lanthanide ion is efficiently sensitised and the lifetime of the {sup 5}D{sub 4} resonance level of terbium in the complex is ranging between 1 and 1.9 ms, against 0.4 ms for the aqua ion. The sensitivity of the method for the determination of anthranilic acid derivatives is improved by one to two orders of magnitude with respect to that achieved using native fluorescence or terbium-sensitised luminescence in methanol. The limits of detection are 2x10{sup -10}, 5x10{sup -10} and 2x10{sup -9} mol l{sup -1} for flufenamic acid, furosemide and tolfenamic acid, and mefenamic acid, respectively, with within-run RSD values of less than 1%. The method has been applied to the determination of flufenamic acid in spiked calf sera with and without sample pretreatment. Depending on the method and the analyte concentration, the recovery was ranging between 83 and 113% and the lowest concentration attainable in serum samples was close to 1x10{sup -7} mol l{sup -1}.

19 CFR 146.26 - System review.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false System review. 146.26 Section 146.26 Customs... (CONTINUED) FOREIGN TRADE ZONES Inventory Control and Recordkeeping System § 146.26 System review. The operator shall perform an annual internal review of the inventory control and recordkeeping system and...

22 CFR 146.525 - Fringe benefits.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Fringe benefits. 146.525 Section 146.525... Employment in Education Programs or Activities Prohibited § 146.525 Fringe benefits. (a) “Fringe benefits” defined. For purposes of these Title IX regulations, fringe benefits means: Any medical, hospital...

21 CFR 146.140 - Pasteurized orange juice.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Pasteurized orange juice. 146.140 Section 146.140... and Beverages § 146.140 Pasteurized orange juice. (a) Pasteurized orange juice is the food prepared from unfermented juice obtained from mature oranges as specified in § 146.135, to which may be added...

Resonance energy transfer from quinolinone modified polystyrene-block-poly(styrene-alt-maleic anhydride) copolymer to terbium(III) metal ions

Czech Academy of Sciences Publication Activity Database

Výprachtický, Drahomír; Mikeš, F.; Lokaj, Jan; Pokorná, Veronika; Cimrová, Věra

2015-01-01

Roč. 160, April (2015), s. 27-34 ISSN 0022-2313 R&D Projects: GA ČR GAP106/12/0827; GA ČR(CZ) GA13-26542S Institutional support: RVO:61389013 Keywords : energy transfer * terbium luminescence * quinolinone donor Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.693, year: 2015

19 CFR 146.3 - Customs supervision.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Customs supervision. 146.3 Section 146.3 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.3 Customs supervision. (a) Assignment of Customs officers. Customs officers will be...

21 CFR 146.137 - Frozen orange juice.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Frozen orange juice. 146.137 Section 146.137 Food... Beverages § 146.137 Frozen orange juice. (a) Frozen orange juice is orange juice as defined in § 146.135, except that it is frozen. (b) The name of the food is “Frozen orange juice”. Such name may be preceded on...

21 CFR 146.145 - Orange juice from concentrate.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Orange juice from concentrate. 146.145 Section 146... Juices and Beverages § 146.145 Orange juice from concentrate. (a) Orange juice from concentrate is the food prepared by mixing water with frozen concentrated orange juice as defined in § 146.146 or with...

Detection of Bacterial Endospores in Soil by Terbium Fluorescence

Directory of Open Access Journals (Sweden)

Andrea Brandes Ammann

2011-01-01

Full Text Available Spore formation is a survival mechanism of microorganisms when facing unfavorable environmental conditions resulting in “dormant” states. We investigated the occurrence of bacterial endospores in soils from various locations including grasslands (pasture, meadow, allotment gardens, and forests, as well as fluvial sediments. Bacterial spores are characterized by their high content of dipicolinic acid (DPA. In the presence of terbium, DPA forms a complex showing a distinctive photoluminescence spectrum. DPA was released from soil by microwaving or autoclaving. The addition of aluminium chloride reduced signal quenching by interfering compounds such as phosphate. The highest spore content (up to 109 spores per gram of dry soil was found in grassland soils. Spore content is related to soil type, to soil depth, and to soil carbon-to-nitrogen ratio. Our study might provide a basis for the detection of “hot spots” of bacterial spores in soil.

Magnetoresistance in terbium and holmium single crystals

International Nuclear Information System (INIS)

Singh, R.L.; Jericho, M.H.; Geldart, D.J.W.

1976-01-01

The longitudinal magnetoresistance of single crystals of terbium and holmium metals in their low-temperature ferromagnetic phase has been investigated in magnetic fields up to 80 kOe. Typical magnetoresistance isotherms exhibit a minimum which increases in depth and moves to higher fields as the temperature increases. The magnetoresistance around 1 0 K, where inelastic scattering is negligible, has been interpreted as the sum of a negative contribution due to changes in the domain structure and a positive contribution due to normal magnetoresistance. At higher temperatures, a phenomenological approach has been developed to extract the inelastic phonon and spin-wave components from the total measured magnetoresistance. In the temperature range 4--20 0 K (approximately), the phonon resistivity varies as T 3 . 7 for all samples. Approximate upper and lower bounds have been placed on the spin-wave resistivity which is also found to be described by a simple power law in this temperature range. The implications of this result for theoretical treatments of spin-wave resistivity due to s-f exchange interactions are considered. It is concluded that the role played by the magnon energy gap is far less transparent than previously suggested

76 FR 31459 - Airworthiness Directives; BAE SYSTEMS (OPERATIONS) LIMITED Model BAe 146 and Avro 146-RJ Airplanes

Science.gov (United States)

2011-06-01

... crack was present at the time of the embodiment of M-D SB 146-32-150, Part B or Part C, it could... inspections, by embodiment of Messier-Dowty (M-D) Service Bulletin (SB) SB.146-32-150. Later, as part of an... optional closing action of EASA AD 2010-0001-E is embodiment of M-D SB 146-32-150 (polishing and shot...

Compact all-fiber optical Faraday components using 65-wt%-terbium-doped fiber with a record Verdet constant of -32 rad/(Tm).

Science.gov (United States)

Sun, L; Jiang, S; Marciante, J R

2010-06-07

A compact all-fiber Faraday isolator and a Faraday mirror are demonstrated. At the core of each of these components is an all-fiber Faraday rotator made of a 4-cm-long, 65-wt%-terbium-doped silicate fiber. The effective Verdet constant of the terbium-doped fiber is measured to be -32 rad/(Tm), which is 27 x larger than that of silica fiber. This effective Verdet constant is the largest value measured to date in any fiber and is 83% of the Verdet constant of commercially available crystal used in bulk optics-based isolators. Combining the all-fiber Faraday rotator with fiber polarizers results in a fully fusion spliced all-fiber isolator whose isolation is measured to be 19 dB. Combining the all-fiber Faraday rotator with a fiber Bragg grating results in an all-fiber Faraday mirror that rotates the polarization state of the reflected light by 88 +/- 4 degrees .

42 CFR 410.146 - Diabetes outcome measurements.

Science.gov (United States)

2010-10-01

... 42 Public Health 2 2010-10-01 2010-10-01 false Diabetes outcome measurements. 410.146 Section 410.146 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES... Training and Diabetes Outcome Measurements § 410.146 Diabetes outcome measurements. (a) Information...

21 CFR 146.150 - Canned concentrated orange juice.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Canned concentrated orange juice. 146.150 Section... Fruit Juices and Beverages § 146.150 Canned concentrated orange juice. (a) Canned concentrated orange... labeling of ingredients prescribed for frozen concentrated orange juice by § 146.146, except that it is not...

27 CFR 24.146 - Bonds.

Science.gov (United States)

2010-04-01

... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Bonds. 24.146 Section 24.146 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE.... (c) Wine vinegar plant bond. The proprietor of a wine vinegar plant who withdraws wine from a bonded...

19 CFR 146.63 - Entry for consumption.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Entry for consumption. 146.63 Section 146.63... TREASURY (CONTINUED) FOREIGN TRADE ZONES Transfer of Merchandise From a Zone § 146.63 Entry for consumption... status may be entered for consumption from a zone. (b) Zone-restricted merchandise. Merchandise in a zone...

Origin of gigantic magnetostriction and crystal field effects in terbium dititanate

International Nuclear Information System (INIS)

Aleksandrov, I.V.; Lidskij, B.V.; Mamsurova, L.G.

1985-01-01

The temperature and magnetic field dependences of the magnetostriction and magnetization and the temperature dependences of the magnetic susceptibility, specific heat and lattice parameter are investigated experimentally in a broad range of temperature and field strength for polycrystalline and single crystal Tb 2 Ti 2 O 7 . A conclusion is drawn regarding the structure of the energy levels of Tb 3+ in Tb 2 Ti 2 O 7 . A qualitative and quantitative explanation of all observed magnetic effects, and in particular of gigantic magnetostriction in Tb 2 Ti 2 O 7 , is presented which is based on the crystal field theory. It is shown that the huge magnitude of the magnetostriction in terbium dititanate is due to the specificity of the energy spectrum of Tb 3+ in Tb 2 Ti 2 O 7

21 CFR 146.187 - Canned prune juice.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Canned prune juice. 146.187 Section 146.187 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR... Beverages § 146.187 Canned prune juice. (a) Canned prune juice is the food prepared from a water extract of...

Electronic structure of surface-supported bis(phthalocyaninato) terbium(III) single molecular magnets.

Science.gov (United States)

Vitali, Lucia; Fabris, Stefano; Conte, Adriano Mosca; Brink, Susan; Ruben, Mario; Baroni, Stefano; Kern, Klaus

2008-10-01

The electronic structure of isolated bis(phthalocyaninato) terbium(III) molecules, a novel single-molecular-magnet (SMM), supported on the Cu(111) surface has been characterized by density functional theory and scanning tunneling spectroscopy. These studies reveal that the interaction with the metal surface preserves both the molecular structure and the large spin magnetic moment of the metal center. The 4f electron states are not perturbed by the adsorption while a strong molecular/metal interaction can induce the suppression of the minor spin contribution delocalized over the molecular ligands. The calculations show that the inherent spin magnetic moment of the molecule is only weakly affected by the interaction with the surface and suggest that the SMM character might be preserved.

Folate Receptor Targeted Alpha-Therapy Using Terbium-149

CERN Document Server

Müller, Cristina; Haller, Stephanie; Dorrer, Holger; Köster, Ulli; Johnston, Karl; Zhernosekov, Konstantin; Türler, Andreas; Schibli, Roger

2014-01-01

Terbium-149 is among the most interesting therapeutic nuclides for medical applications. It decays by emission of short-range α-particles (Eα = 3.967 MeV) with a half-life of 4.12 h. The goal of this study was to investigate the anticancer efficacy of a 149Tb-labeled DOTA-folate conjugate (cm09) using folate receptor (FR)-positive cancer cells in vitro and in tumor-bearing mice. 149Tb was produced at the ISOLDE facility at CERN. Radiolabeling of cm09 with purified 149Tb resulted in a specific activity of ~1.2 MBq/nmol. In vitro assays performed with 149Tb-cm09 revealed a reduced KB cell viability in a FR-specific and activity concentration-dependent manner. Tumor-bearing mice were injected with saline only (group A) or with 149Tb-cm09 (group B: 2.2 MBq; group C: 3.0 MBq). A significant tumor growth delay was found in treated animals resulting in an increased average survival time of mice which received 149Tb-cm09 (B: 30.5 d; C: 43 d) compared to untreated controls (A: 21 d). Analysis of blood parameters rev...

Crystal structures of two mononuclear complexes of terbium(III nitrate with the tripodal alcohol 1,1,1-tris(hydroxymethylpropane

Directory of Open Access Journals (Sweden)

Thaiane Gregório

2017-02-01

Full Text Available Two new mononuclear cationic complexes in which the TbIII ion is bis-chelated by the tripodal alcohol 1,1,1-tris(hydroxymethylpropane (H3LEt, C6H14O3 were prepared from Tb(NO33·5H2O and had their crystal and molecular structures solved by single-crystal X-ray diffraction analysis after data collection at 100 K. Both products were isolated in reasonable yields from the same reaction mixture by using different crystallization conditions. The higher-symmetry complex dinitratobis[1,1,1-tris(hydroxymethylpropane]terbium(III nitrate dimethoxyethane hemisolvate, [Tb(NO32(H3LEt2]NO3·0.5C4H10O2, 1, in which the lanthanide ion is 10-coordinate and adopts an s-bicapped square-antiprismatic coordination geometry, contains two bidentate nitrate ions bound to the metal atom; another nitrate ion functions as a counter-ion and a half-molecule of dimethoxyethane (completed by a crystallographic twofold rotation axis is also present. In product aquanitratobis[1,1,1-tris(hydroxymethylpropane]terbium(III dinitrate, [Tb(NO3(H3LEt2(H2O](NO32, 2, one bidentate nitrate ion and one water molecule are bound to the nine-coordinate terbium(III centre, while two free nitrate ions contribute to charge balance outside the tricapped trigonal-prismatic coordination polyhedron. No free water molecule was found in either of the crystal structures and, only in the case of 1, dimethoxyethane acts as a crystallizing solvent. In both molecular structures, the two tripodal ligands are bent to one side of the coordination sphere, leaving room for the anionic and water ligands. In complex 2, the methyl group of one of the H3LEt ligands is disordered over two alternative orientations. Strong hydrogen bonds, both intra- and intermolecular, are found in the crystal structures due to the number of different donor and acceptor groups present.

40 CFR 146.2 - Law authorizing these regulations.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Law authorizing these regulations. 146.2 Section 146.2 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM: CRITERIA AND STANDARDS General Provisions § 146.2 Law...

Chemoselective reduction of 1,4,6-cholestatrien-3-one and 1,4,6-androstatriene-3,17-dione by various hydride reagents.

Science.gov (United States)

Kim, Eunjeong; Ma, Eunsook

2007-04-01

The chemoselectivity of rigid cyclic alpha,beta-unsaturated carbonyl group on the reducing agents was influenced by the ring size and steric factor. Cholesterol (cholest-5-en-3beta-ol) and dehydroepiandrosterone (DHEA) were oxidized with 2,3-dichloro-5,6-dicyano-1,4-benzoquinone to form 1,4,6-cholestatrien-3-one and 1,4,6-androstatriene-3,17-dione. They were reduced with NaBH(4), lithium tri-sec-butylborohydride (l-Selectride), LiAlH(4), 9-borabicyclo[3.3.1]nonane (9-BBN), lithium triethylborohydride (Super-hydride), and BH(3) x (CH(3))(2)S in various conditions, respectively. Reduction of 1,4,6-cholestatrien-3-one and 1,4,6-androstatriene-3,17-dione by NaBH(4) (4 equiv.) produced 4,6-cholestadien-3beta-ol and 4,6-androstadiene-3beta,17beta-diol, respectively. Reduction by l-Selectride (12 equiv.) afforded 4,6-cholestadien-3alpha-ol and 4,6-androstadiene-3alpha,17beta-diol, chemoselectively. Reaction with Super-hydride (12 equiv.) produced 4,6-cholestadien-3-one and 3-oxo-4,6-androstadien-17beta-ol. Reduction of 1,4,6-cholestatrien-3-one by 9-BBN (14 equiv.) produced 1,4,6-cholestatrien-3alpha-ol, but 1,4,6-androstatriene-3,17-dione was not reacted with 9-BBN in the reaction conditions. Reaction of LiAlH(4) (6 equiv.) formed 4,6-cholestadien-3beta-ol and 3-oxo-1,4,6-androstatrien-17beta-ol. Reduction of 1,4,6-cholestatrien-3-one by BH(3) x (CH(3))(2)S (11 equiv.) gave cholestane as major compound and unlike reactivity of cholesterol, 1,4,6-androstatriene-3,17-dione by 8 equiv. of BH(3) x (CH(3))(2)S formed 3-oxo-1,4,6-androstatrien-17beta-ol. LiAlH(4) and BH(3) x (CH(3))(2)S showed relatively low chemoselectivity.

22 CFR 146.400 - Education programs or activities.

Science.gov (United States)

2010-04-01

... Basis of Sex in Education Programs or Activities Prohibited § 146.400 Education programs or activities... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Education programs or activities. 146.400 Section 146.400 Foreign Relations DEPARTMENT OF STATE CIVIL RIGHTS NONDISCRIMINATION ON THE BASIS OF SEX...

19 CFR 146.13 - Customs forms and procedures.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Customs forms and procedures. 146.13 Section 146.13 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.13 Customs forms and procedures...

19 CFR 146.10 - Authority to examine merchandise.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Authority to examine merchandise. 146.10 Section 146.10 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.10 Authority to examine...

19 CFR 146.51 - Customs control of merchandise.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Customs control of merchandise. 146.51 Section 146.51 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES Handling of Merchandise in a Zone § 146.51 Customs...

Hyperfine structure of the odd parity level system in the terbium atom

International Nuclear Information System (INIS)

Stefanska, D; Furmann, B

2017-01-01

Within this work new experimental results concerning the hyperfine structure ( hfs ) in the terbium atom are presented, concerning the odd parity levels system, hitherto only scarcely investigated (apart from the ground term). hfs constants A and B for 113 levels were determined for the first time, and for another 16 levels, which already occurred in our earlier works, supplementary results were obtained; additionally, our earlier results for 93 levels were compiled. The hfs of the odd parity levels was investigated using the method of laser induced fluorescence in a hollow cathode discharge. The hfs of 165 spectral lines, where the levels in question were involved as the upper levels, was recorded. Literature values of hfs constants of the even-parity lower levels (including our own earlier results) greatly facilitated the present data evaluation. (paper)

10 CFR 72.146 - Design control.

Science.gov (United States)

2010-01-01

... 10 Energy 2 2010-01-01 2010-01-01 false Design control. 72.146 Section 72.146 Energy NUCLEAR... Design control. (a) The licensee, applicant for a license, certificate holder, and applicant for a CoC... shall establish measures for the identification and control of design interfaces and for coordination...

21 CFR 146.151 - Orange juice for manufacturing.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Orange juice for manufacturing. 146.151 Section... Fruit Juices and Beverages § 146.151 Orange juice for manufacturing. (a) Orange juice for manufacturing... from oranges as provided in § 146.135, except that the oranges may deviate from the standards for...

21 CFR 146.152 - Orange juice with preservative.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Orange juice with preservative. 146.152 Section... Fruit Juices and Beverages § 146.152 Orange juice with preservative. (a) Orange juice with preservative... of orange juice for manufacturing as provided for in § 146.151, except that a preservative is added...

75 FR 38953 - Airworthiness Directives; BAE Systems (OPERATIONS) LIMITED Model BAe 146 and Avro 146-RJ Airplanes

Science.gov (United States)

2010-07-07

... oleo. The AD also provided an optional terminating action for the repetitive inspections, by embodiment... for the repetitive inspections, by embodiment of Messier-Dowty SB.146-32-150. As part of a recent... inspections, by embodiment of Messier-Dowty SB.146-32-150. As part of a recent accident investigation, the...

Terbium fluorescence as a sensitive, inexpensive probe for UV-induced damage in nucleic acids

International Nuclear Information System (INIS)

El-Yazbi, Amira F.; Loppnow, Glen R.

2013-01-01

Graphical abstract: -- Highlights: •Simple, inexpensive, mix-and-read assay for positive detection of DNA damage. •Recognition of undamaged DNA via hybridization to a hairpin probe. •Terbium(III) fluorescence reports the amount of damage by binding to ssDNA. •Tb/hairpin is a highly selective and sensitive fluorescent probe for DNA damage. -- Abstract: Much effort has been focused on developing methods for detecting damaged nucleic acids. However, almost all of the proposed methods consist of multi-step procedures, are limited, require expensive instruments, or suffer from a high level of interferences. In this paper, we present a novel simple, inexpensive, mix-and-read assay that is generally applicable to nucleic acid damage and uses the enhanced luminescence due to energy transfer from nucleic acids to terbium(III) (Tb 3+ ). Single-stranded oligonucleotides greatly enhance the Tb 3+ emission, but duplex DNA does not. With the use of a DNA hairpin probe complementary to the oligonucleotide of interest, the Tb 3+ /hairpin probe is applied to detect ultraviolet (UV)-induced DNA damage. The hairpin probe hybridizes only with the undamaged DNA. However, the damaged DNA remains single-stranded and enhances the intrinsic fluorescence of Tb 3+ , producing a detectable signal directly proportional to the amount of DNA damage. This allows the Tb 3+ /hairpin probe to be used for sensitive quantification of UV-induced DNA damage. The Tb 3+ /hairpin probe showed superior selectivity to DNA damage compared to conventional molecular beacons probes (MBs) and its sensitivity is more than 2.5 times higher than MBs with a limit of detection of 4.36 ± 1.2 nM. In addition, this probe is easier to synthesize and more than eight times cheaper than MBs, which makes its use recommended for high-throughput, quantitative analysis of DNA damage

21 CFR 146.135 - Orange juice.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Orange juice. 146.135 Section 146.135 Food and....135 Orange juice. (a) Orange juice is the unfermented juice obtained from mature oranges of the... name of the food is “orange juice”. The name “orange juice” may be preceded on the label by the...

Construction of the energy matrix for complex atoms. Part VIII: Hyperfine structure HPC calculations for terbium atom

Science.gov (United States)

Elantkowska, Magdalena; Ruczkowski, Jarosław; Sikorski, Andrzej; Dembczyński, Jerzy

2017-11-01

A parametric analysis of the hyperfine structure (hfs) for the even parity configurations of atomic terbium (Tb I) is presented in this work. We introduce the complete set of 4fN-core states in our high-performance computing (HPC) calculations. For calculations of the huge hyperfine structure matrix, requiring approximately 5000 hours when run on a single CPU, we propose the methods utilizing a personal computer cluster or, alternatively a cluster of Microsoft Azure virtual machines (VM). These methods give a factor 12 performance boost, enabling the calculations to complete in an acceptable time.

Synthesis and crystal structure of terbium(III) meta-oxoborate Tb(BO{sub 2}){sub 3} ({identical_to} TbB{sub 3}O{sub 6}); Synthese und Kristallstruktur von Terbium(III)-meta-Oxoborat Tb(BO{sub 2}){sub 3} ({identical_to} TbB{sub 3}O{sub 6})

Energy Technology Data Exchange (ETDEWEB)

Nikelski, Tanja; Schleid, Thomas [Institut fuer Anorganische Chemie der Universitaet Stuttgart (Germany)

2003-06-01

The terbium meta-oxoborate Tb(BO{sub 2}){sub 3} ({identical_to} TbB{sub 3}O{sub 6}) is obtained as single crystals by the reaction of terbium, Tb{sub 4}O{sub 7} and TbCl{sub 3} with an excess of B{sub 2}O{sub 3} in gastight sealed platinum ampoules at 950 C after three weeks. The compound appears to be air- and water-resistant and crystallizes as long, thin, colourless needles which tend to growth-twinning due to their marked fibrous habit. The crystal structure of Tb(BO{sub 2}){sub 3} (orthorhombic, Pnma; a = 1598.97(9), b = 741.39(4), c = 1229.58(7) pm; Z = 16) contains strongly corrugated oxoborate layers {sub {infinity}}{sup 2}{l_brace}(BO{sub 2}){sup -}{r_brace} built of vertex-linked [BO{sub 4}]{sup 5-} tetrahedra (d(B-O) = 143 - 154 pm, and angsph;(O-B-O) = 102-115 ) which spread out parallel (100). The four crystallographically different Tb{sup 3+} cations all exhibit coordination numbers of eight towards the oxygen atoms (d(Tb-O) = 228-287 pm). The corresponding metal cation polyhedra [TbO{sub 8}]{sup 13+} too convene to layers (composition: {sub {infinity}}{sup 2}{l_brace}(Tb{sub 2}O{sub 11}){sup 16-}{r_brace}) which are likewise oriented parallel to the (100) plane. (Abstract Copyright [2003], Wiley Periodicals, Inc.) [German] Das Terbium-meta-Oxoborat Tb(BO{sub 2}){sub 3} ({identical_to} TbB{sub 3}O{sub 6}) entsteht einkristallin bei der Reaktion von Terbium, Tb{sub 4}O{sub 7} und TbCl{sub 3} mit einem Ueberschuss von B{sub 2}O{sub 3} in gasdicht verschlossenen Platinampullen nach drei Wochen bei 950 C. Die Verbindung ist luft- und wasserstabil und faellt in langen, duennen, farblosen Nadeln an, die aufgrund ihres ausgepraegt faserigen Habitus zur Wachstumsverzwillingung neigen. Die Kristallstruktur von Tb(BO{sub 2}){sub 3} (orthorhombisch, Pnma; a = 1598, 97(9), b = 741, 39(4), c = 1229, 58(7) pm; Z = 16) enthaelt parallel (100) verlaufende, stark gewellte Oxoborat-Schichten {sub {infinity}}{sup 2}{l_brace}(BO{sub 2}){sup -}{r_brace} aus

CD146 Expression Influences Periapical Cyst Mesenchymal Stem Cell Properties.

Science.gov (United States)

Paduano, Francesco; Marrelli, Massimo; Palmieri, Francesca; Tatullo, Marco

2016-10-01

Recent studies have identified a new human dental derived progenitor cell population with multi-lineage differentiation potential referred to as human periapical cyst mesenchymal stem cells (hPCy-MSCs). In the present study, we compared two subpopulations of hPCy-MSCs characterised by the low or high expression of CD146 to establish whether this expression can regulate their stem cell properties. Using flow cytometry, we evaluated the stem cell marker profile of hPCy-MSCs during passaging. Furthermore, CD146 Low and CD146 High cells were sorted by magnetic beads and subsequently both cell populations were evaluated for differences in their proliferation, self-renewal, stem cell surface markers, stemness genes expression and osteogenic differentiation potential.We found that hPCy-MSCs possessed a stable expression of several mesenchymal stem cell surface markers, whereas CD146 expression declined during passaging.In addition, sorted CD146 Low cells proliferated significantly faster, displayed higher colony-forming unit-fibroblast capacity and showed higher expression of Klf4 when compared to the CD146 High subset. Significantly, the osteogenic potential of hPCy-MSCs was greater in the CD146 Low than in CD146 High population. These results demonstrate that CD146 is spontaneously downregulated with passaging at both mRNA and protein levels and that the high expression of CD146 reduces the proliferative, self-renewal and osteogenic differentiation potential of hPCy-MSCs. In conclusion, our study demonstrates that changes in the expression of CD146 can influence the stem cell properties of hPCy-MSCs.

Sensitive luminescent determination of DNA using the terbium(III)-difloxacin complex

International Nuclear Information System (INIS)

Yegorova, Alla V.; Scripinets, Yulia V.; Duerkop, Axel; Karasyov, Alexander A.; Antonovich, Valery P.; Wolfbeis, Otto S.

2007-01-01

The interaction of the terbium-difloxacin complex (Tb-DFX) with DNA has been examined by using UV-vis absorption and luminescence spectroscopy. The Tb-DFX complex shows an up to 85-fold enhancement of luminescence intensity upon titration with DNA. The long decay times allow additional detection schemes like time-resolved measurements in microplate readers to enhance sensitivity by off-gating short-lived background luminescence. Optimal conditions are found at equimolar concentrations of Tb 3+ and DFX (0.1 or 1 μM) at pH 7.4. Under these conditions, the luminescence intensity is linearly dependent on the concentration of ds-DNAs and ss-DNA between 1-1500 ng mL -1 and 4.5-270 ng mL -1 , respectively. The detection limit is 0.5 ng mL -1 for ds-DNAs and 2 ng mL -1 for ss-DNA. The mechanism for the luminescence enhancement was also studied

Monoxides of small terbium clusters: A density functional theory investigation

Energy Technology Data Exchange (ETDEWEB)

Zhang, G. L.; Yuan, H. K., E-mail: yhk10@swu.edu.cn; Chen, H.; Kuang, A. L.; Li, Y.; Wang, J. Z.; Chen, J. [School of Physical Science and Technology, Southwest University, Chongqing 400715 (China)

2014-12-28

To investigate the effect of oxygen atom on the geometrical structures, electronic, and magnetic properties of small terbium clusters, we carried out the first-principles calculations on Tb{sub n}O (n = 1-14) clusters. The capping of an oxygen atom on one trigonal-facet of Tb{sub n} structures is always favored energetically, which can significantly improve the structural stability. The far-infrared vibrational spectroscopies are found to be different from those of corresponding bare clusters, providing a distinct signal to detect the characteristic structures of Tb{sub n}O clusters. The primary effect of oxygen atom on magnetic properties is to change the magnetic orderings among Tb atoms and to reduce small of local magnetic moments of the O-coordinated Tb atoms, both of which serve as the key reasons for the experimental magnetic evolution of an oscillating behavior. These calculations are consistent with, and help to account for, the experimentally observed magnetic properties of monoxide Tb{sub n}O clusters [C. N. Van Dijk et al., J. Appl. Phys. 107, 09B526 (2010)].

Evaluating United States and world consumption of neodymium, dysprosium, terbium, and praseodymium in final products

Science.gov (United States)

Hart, Matthew

This paper develops scenarios of future rare-earth-magnet metal (neodymium, dysprosium, terbium, and praseodymium) consumption in the permanent magnets used in wind turbines and hybrid electric vehicles. The scenarios start with naive base-case scenarios for growth in wind-turbine and hybrid-electric-vehicle sales over the period 2011 to 2020, using historical data for each good. These naive scenarios assume that future growth follows time trends in historical data and does not depend on any exogenous variable. Specifically, growth of each technological market follows historical time trends, and the amount of rare earths used per unit of technology remains fixed. The chosen reference year is 2010. Implied consumptions of the rare earth magnet metals are calculated from these scenarios. Assumptions are made for the material composition of permanent magnets, the market share of permanent-magnet wind turbines and vehicles, and magnet weight per unit of technology. Different scenarios estimate how changes in factors like the material composition of magnets, growth of the economy, and the price of a substitute could affect future consumption. Each scenario presents a different method for reducing rare earth consumption and could be interpreted as potential policy choices. In 2010, the consumption (metric tons, rare-earth-oxide equivalent) of each rare-earth-magnet metal was as follows. Total neodymium consumption in the world for both technologies was 995 tons; dysprosium consumption was 133 tons; terbium consumption was 50 tons; praseodymium consumption was zero tons. The base scenario for wind turbines shows there could be strong, exponential growth in the global wind turbine market. New U.S. sales of hybrid vehicles would decline (in line with the current economic recession) while non-U.S. sales increase through 2020. There would be an overall increase in the total amount of magnetic rare earths consumed in the world. Total consumption of each rare earth in the short

13 CFR 146.500 - Secretary of Defense.

Science.gov (United States)

2010-01-01

... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Secretary of Defense. 146.500 Section 146.500 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW RESTRICTIONS ON LOBBYING..., a covered Federal action from the prohibition whenever the Secretary determines, in writing, that...

13 CFR 146.600 - Semi-annual compilation.

Science.gov (United States)

2010-01-01

... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Semi-annual compilation. 146.600 Section 146.600 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW RESTRICTIONS ON LOBBYING.... (c) Information that involves intelligence matters shall be reported only to the Select Committee on...

Expression patterns of miR-146a and miR-146b in mastitis infected dairy cattle.

Science.gov (United States)

Wang, Xing Ping; Luoreng, Zhuo Ma; Zan, Lin Sen; Raza, Sayed Haidar Abbas; Li, Feng; Li, Na; Liu, Shuan

2016-10-01

This study reports a significant up-regulation of bta-miR-146a and bta-miR-146b expression levels in bovine mammary tissues infected with subclinical, clinical and experimental mastitis. Potential target genes are involved in multiple immunological pathways. These results suggest a regulatory function of both miRNAs for the bovine inflammatory response in mammary tissue. Copyright © 2016 Elsevier Ltd. All rights reserved.

Determination of sertraline in pharmaceutical and biological samples using 1, 10-phenanthroline-terbium probe and silver nanoparticles enhanced fluorescence

Energy Technology Data Exchange (ETDEWEB)

Lotfi, Ali, E-mail: alilotfi67@gmail.com [Young Researchers and Elite Club, Tabriz Branch, Islamic Azad University, Tabriz (Iran, Islamic Republic of); Manzoori, Jamshid L. [Department of Chemistry, Tabriz Branch, Islamic Azad University, Tabriz (Iran, Islamic Republic of); Mohagheghi, Arash [Clinical Psychiatry Research Center, Tabriz University of Medical Sciences, Tabriz (Iran, Islamic Republic of)

2017-05-15

Sertraline is an antidepressant widely prescribed for major depressive disorders. In this contribution we report a novel, rapid and sensitive spectrofluorimetric technique, developed and validated for the determination of sertraline in pharmaceutical, human urine and human plasma samples, based on the fluorescence enhancement of the sertraline by 1, 10-phenanthroline-terbium probe with Ag nanoparticles (AgNPs). The effect of pH, buffer concentration, the order of addition of reagents, terbium and 1, 10-phenanthroline concentrations, and concentration of Ag nanoparticles (AgNPs) as well as reaction time on the fluorescence intensity were investigated and the optimum conditions were determined. The linear range for determination of sertraline was obtained as 0.001–3 mg L{sup −1}. The limit of detection (b+3s) and the limit of quantification was calculated as 2.9×10{sup −4} mg L{sup −1} and 9.8×10{sup −4} mg L{sup −1}, respectively. The interference effects of common excipients found in pharmaceutical preparations were studied. The presented technique was used to determine the sertraline in pharmaceutical samples, human urine and plasma as real samples. The presented method was indicated a comparable results with the standard analytical techniques for sertraline. Good linearity, reproducibility, recovery and limit of detection have made this method suitable for determination of sertraline in various types of samples.

Determination of sertraline in pharmaceutical and biological samples using 1, 10-phenanthroline-terbium probe and silver nanoparticles enhanced fluorescence

International Nuclear Information System (INIS)

Lotfi, Ali; Manzoori, Jamshid L.; Mohagheghi, Arash

2017-01-01

Sertraline is an antidepressant widely prescribed for major depressive disorders. In this contribution we report a novel, rapid and sensitive spectrofluorimetric technique, developed and validated for the determination of sertraline in pharmaceutical, human urine and human plasma samples, based on the fluorescence enhancement of the sertraline by 1, 10-phenanthroline-terbium probe with Ag nanoparticles (AgNPs). The effect of pH, buffer concentration, the order of addition of reagents, terbium and 1, 10-phenanthroline concentrations, and concentration of Ag nanoparticles (AgNPs) as well as reaction time on the fluorescence intensity were investigated and the optimum conditions were determined. The linear range for determination of sertraline was obtained as 0.001–3 mg L −1 . The limit of detection (b+3s) and the limit of quantification was calculated as 2.9×10 −4 mg L −1 and 9.8×10 −4 mg L −1 , respectively. The interference effects of common excipients found in pharmaceutical preparations were studied. The presented technique was used to determine the sertraline in pharmaceutical samples, human urine and plasma as real samples. The presented method was indicated a comparable results with the standard analytical techniques for sertraline. Good linearity, reproducibility, recovery and limit of detection have made this method suitable for determination of sertraline in various types of samples.

Dicty_cDB: AFO146 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available GTAACAAAAATTAGTAATTTAAAA AAAAAAAAACCAAAAAAAAAAXXXXXXXXXXTGTCGAATGTCCAGATTTCCATANA...AAAAA---------- Length of 5' end seq. 141 3' end seq. ID AFO146Z 3' end seq. >AFO146Z.Seq ----------TGTCGAATGTCCAGATTTCCATANA...AAAAAAGTTAAAATTAAATTTGTAAAATCAATTTGTAACAAAAATTAGTAATTTAAAA AAAAAAAAACCAAAAAAAAAA----------TGTCGAATGTCCAGATTTCCATANA

29 CFR 4.146 - Contract obligations after award, generally.

Science.gov (United States)

2010-07-01

... 29 Labor 1 2010-07-01 2010-07-01 true Contract obligations after award, generally. 4.146 Section 4.146 Labor Office of the Secretary of Labor LABOR STANDARDS FOR FEDERAL SERVICE CONTRACTS Application of the McNamara-O'Hara Service Contract Act Period of Coverage § 4.146 Contract obligations after...

34 CFR 300.146 - Responsibility of SEA.

Science.gov (United States)

2010-07-01

... special education and related services— (1) In conformance with an IEP that meets the requirements of... 34 Education 2 2010-07-01 2010-07-01 false Responsibility of SEA. 300.146 Section 300.146 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF SPECIAL EDUCATION...

19 CFR 146.93 - Inventory control and recordkeeping system.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Inventory control and recordkeeping system. 146.93... § 146.93 Inventory control and recordkeeping system. (a) Attribution. All final products removed from or... provided for under § 146.95(b) of this subpart. (3) Other inventory method. An operator may use the FIFO...

Self-assembly of Terbium(III)-based metal-organic complexes with two-photon absorbing active

Science.gov (United States)

Li, Dandan; Shao, Nanqi; Sun, Xianshun; Zhang, Guocui; Li, Shengli; Zhou, Hongping; Wu, Jieying; Tian, Yupeng

2014-12-01

Hybrid complexes based on D-π-A type dyes p-aminostyryl-pyridinum and Terbium(III) complex anion (1, 2) have been synthesized by ionic exchange reaction. Meanwhile two different alkyl-substituted amino groups were used as electron donors in organic dyes cations. The synthesized complexes were characterized by element analysis. In addition, the structural features of them were systematic studied by single crystal X-ray diffraction analysis. Their linear properties have been systematically investigated by absorption spectra and fluorescence, the results show that the energy transfer takes place from the trans-4-[4‧-(N,N-diethylamino)styryl]-N-methyl pyridinium (2‧) cation to Tb(III). In addition, complex 2 exhibit a large two-photon absorption coefficient β: 0.044 cm/GW at 710 nm.

New AMS method to measure the atom ratio {sup 146}Sm/{sup 147}Sm for a half-life determination of {sup 146}Sm

Energy Technology Data Exchange (ETDEWEB)

Kinoshita, N. [Tandem Accelerator Complex, Research Facility Center for Science and Technology, University of Tsukuba (Japan); Paul, M., E-mail: paul@vms.huji.ac.il [Racah Institute of Physics, Hebrew University, Jerusalem 91904 (Israel); Alcorta, M. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Bowers, M.; Collon, P. [Department of Physics, University of Notre Dame, Notre Dame, IN 46556-5670 (United States); Deibel, C.M. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Joint Institute for Nuclear Astrophysics, Michigan State University, East Lansing, MI 46624 (United States); DiGiovine, B. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Goriely, S. [Universite Libre de Bruxelles, CP-226, Brussels 1050 (Belgium); Greene, J.P.; Henderson, D.J.; Jiang, C.L. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Kashiv, Y. [Department of Physics, University of Notre Dame, Notre Dame, IN 46556-5670 (United States); Kay, B.P.; Lee, H.Y.; Marley, S.T. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Nakanishi, T. [Faculty of Chemistry, Institute of Science and Engineering, Kanazawa University (Japan); Pardo, R.C.; Patel, N.; Rehm, K.E. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Robertson, D. [Department of Physics, University of Notre Dame, Notre Dame, IN 46556-5670 (United States); and others

2013-01-15

The extinct p-process nuclide {sup 146}Sm (t{sub 1/2} = 103 {+-} 5 Myr) is known to have been present in the Early-Solar System and has been proposed as an astrophysical chronometer. {sup 146}Sm is also intensely used to date meteorite and planetary differentiation processes, enhancing the importance of an accurate knowledge of the {sup 146}Sm half-life. We are engaged in a new determination of the {sup 146}Sm half-life in which the {sup 146}Sm/{sup 147}Sm atom ratio is determined by accelerator mass spectrometry at the ATLAS facility of Argonne National Laboratory. In order to reduce systematic errors in the AMS determination of the {sup 146}Sm/{sup 147}Sm ratios (in the range of 10{sup -7}-10{sup -9}), {sup 146}Sm and {sup 147}Sm ions were alternately counted in the same detector in the focal plane of a gas-filled magnet, respectively in continuous-wave and attenuated mode. Quantitative attenuation is obtained with the 12 MHz pulsed and ns-bunched ATLAS beam by chopping beam pulses with an RF sweeper in a ratio (digitally determined) down to 1:10{sup 6}. The experiments and preliminary results are discussed.

Solid-phase synthesis of compounds of europium and terbium with nitrogen-containing heterocyclic compounds under mechanical activation

International Nuclear Information System (INIS)

Kalinovskaya, I.V.; Karasev, V.E.

2000-01-01

Effect of solvents and parameters of mechanical treatment on basic regularities of synthesis of rare earth compounds with nitrogen-containing heterocyclic compounds is studied. It is shown that interaction on europium (3) and terbium (3) nitrates with nitrogen-containing heterocyclic compounds leads to formation of compounds of Ln(NO 3 )·2D composition, where Ln=Eu, Tb; D=2,2-dipyridyl, 1,10-phenanthroline, diphenylguanidine. Effect of conditions of mechanical treatment and different additions on process and yield of products is studied. Compounds prepared are characterized by the methods of chemical element analysis, IR spectroscopy and luminescent spectroscopy [ru

Immunohistochemical Expression of MCAM/CD146 in Canine Melanoma.

Science.gov (United States)

Abou Asa, S

2017-07-01

MCAM/CD146 (melanoma cell adhesion molecule/CD146) is a transmembrane immunoglobulin superfamily cell adhesion molecule involved in transendothelial migration and signal transduction. It is expressed in melanoma, squamous cell carcinoma, prostatic, ovarian, cervical and endometrial cancers and promotes tumour growth, angiogenesis and metastasis. Melanoma is the most common malignant oral tumour of dogs and also arises in the skin, nail bed and footpad. The aim of this study was to investigate the immunohistochemical expression of MCAM/CD146 in 51 canine melanomas, including oral, cutaneous and ocular tumours. Seventeen of the 51 (33.3%) cases were negative, eight (15.7%) were weakly positive, seven (13.7%) were moderately positive and 19 (37.3%) were strongly positive. MCAM/CD146 was expressed by both oral and cutaneous melanomas; however, the intensity and the extent of the immunoreactivity was higher in oral (P = 0.009) than in cutaneous tumours (P = 0.058). Most ocular melanomas did not express MCAM/CD146 (P = 0.256). Expression of MCAM/CD146 by canine melanomas may suggest the molecule as a target for treatment, especially in oral melanomas. Copyright © 2017 Elsevier Ltd. All rights reserved.

Luminescent hybrid films obtained by covalent grafting of terbium complex to silica network

International Nuclear Information System (INIS)

Liu Fengyi; Fu Lianshe; Wang Jun; Liu Ze; Li Huanrong; Zhang Hongjie

2002-01-01

Luminescent hybrid thin films consisting of terbium complex covalently bonded to a silica-based network have been obtained in situ via a sol-gel approach. A new monomer, N-(4-benzoic acid-yl), N'-(propyltriethoxysilyl)urea (PABI), has been synthesized by grafting isocyanatopropyltriethoxysilane (ICPTES) to p-aminobenzoic acid and characterized by 1 H NMR, IR and MS. The monomer acts as a ligand for Tb 3+ ion and as a sol-gel precursor. Band emission from Tb 3+ ion due to an efficient ligand-to-metal energy transfer was observed by UV excitation. The decay curves of Tb 3+ in the hybrid films were measured. The energy difference between the triplet state energy of PABI and the 5 D 4 level of Tb 3+ ion falls in the exciting range to sensitize Tb 3+ ion fluorescence

Nanostructured Layered Terbium Hydroxide Containing NASIDs: In Vitro Physicochemical and Biological Evaluations.

Science.gov (United States)

Gu, Qing-Yang; Qiu, Xiao; Liu, Jing-Jing; Fu, Min; Chao, Jian-Ping; Ju, Rui-Jun; Li, Xue-Tao

2018-08-01

Diclofenac sodium (abrr. DS) and indomethacin (abrr. IMC) have been intercalated into the layered terbium hydroxide (LTbH) by anion exchange method. Chemical compositions, thermostability, morphology, luminescence property, release behaviors and cytotoxic effects have been investigated. The DS molecules may embed between layers with a bilayered arrangement and the IMC may correspond to a monolayered arrangement. The Tb3+ luminescence in DS-LTbH and IMC-LTbH composites were enhanced compared with LTbH precusor and the luminescence intensity increases with the deprotonation degree. Drug release was measured with HPLC, and LTbH showed sustained release behavior on both drugs. Further In Vitro evaluation were carried out on cancer cells. Cytotoxic effect of LTbH was observed with a sulforhodamine B colorimetric assay on a variety of cancer cell lines, which revealed that the LTbH showed little cytotoxic effect. Results indicate LTbH may offer a potential vehicle as an effective drug delivery system along with diagnostic integration.

Raman spectra of terbium trichloride, phosphorus pentachloride and their molten mixtures; Spektry kombinatsionnogo rasseyaniya sveta trikhlorida terbiya, pentakhlorida fosfora i ikh rasplavlennykh smesej

Energy Technology Data Exchange (ETDEWEB)

Salyulev, A B; Zakir' yanova, I D [UrO RAN, Inst. Vysokotemperaturnoj Ehlektrokhimii, Ekaterinburg (Russian Federation)

2008-03-15

Raman spectroscopy was used to study in situ the behavior of individual terbium trichloride and phosphorus pentachloride in different aggregative states as a function of temperature, and of solutions of PCl{sub 5} vapors in molten TbCl{sub 3}. A conclusion is drawn about their structure and the nature of phase transformations and chemical reactions in wide ranges of temperature and saturated vapor pressures.

Thermoluminescence of cerium and terbium -doped calcium pyrophosphate

Energy Technology Data Exchange (ETDEWEB)

Roman L, J.; Cruz Z, E. [UNAM, Instituto de Ciencias Nucleares, Circuito Exterior, Ciudad Universitaria, 04510 Mexico D. F. (Mexico); Lozano R, I. B.; Diaz G, J. A. I., E-mail: jesus.roman@nucleares.unam.mx [IPN, Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada, Av. Legaria No. 694, 11500 Mexico D. F. (Mexico)

2015-10-15

The aim of this work is to report the thermoluminescence (Tl) response of Calcium Pyrophosphate phosphor doped with Cerium and Terbium impurities (Ca{sub 2}P{sub 2}O{sub 7}:Ce{sup 3+},Tb{sup 3+}). The phosphors were synthesized using the co-precipitation method and annealed at 900 degrees C by two hours for obtain the β phase. The intentional doping with Ce and Tb ions was 1 at.% and 0.1 at.%, whereas in the EDS results the concentration of impurities was 0.39 at.% and 0.05 at.%, respectively. The superficial morphology of phosphor is mainly composed by thin wafers of different size. All samples were exposed to gamma rays from {sup 60}Co in the Gammacell-200 irradiator. The Tl response of the phosphor was measured from Rt up to 350 degrees C and under nitrogen atmosphere in a Harshaw TLD 3500 reader. The glow curves of the Ca{sub 2}P{sub 2}O{sub 7}:Ce{sup 3+},Tb{sup 3+} powders showed a broad intense Tl peak centered at 165 degrees C and a shoulder at approximate 260 degrees C was observed. A linear Tl response in the range of absorbed dose of 0.2 to 10 Gy was obtained. Tl glow curves were analyzed using the initial rise (IR)and computerized glow curve deconvolution methods to evaluate the kinetics parameters such as activation energy (E), frequency factor (s) and kinetic order (b). (Author)

CD146 positive human dental pulp stem cells promote regeneration of dentin/pulp-like structures.

Science.gov (United States)

Matsui, Mikiko; Kobayashi, Tomoko; Tsutsui, Takeo W

2018-04-01

CD146 and STRO-1 are endothelial biomarkers that are co-expressed on the cellular membranes of blood vessels within human dental pulp tissue. This study characterized the percentage of dentin-like structures produced by CD146-positive (CD146 + ) human dental pulp stem cells (DPSCs), compared with their CD146-negative (CD146 - ) counterparts. DPSC populations were enriched using magnetic-activated cell sorting (MACS), yielding CD146 + and CD146 - cells, as well as mixtures composed of 25% CD146 + cells and 75% CD146 - cells (CD146 +/- ). Cell growth assays indicated that CD146 + cells exhibit an approximate 3-4 h difference in doubling time, compared with CD146 - cells. Cell cycle distributions were determined by flow cytometry analysis. The low percentage of CD146 + cells' DNA content in G 0 /G 1 phase were compared with CD146 - and non-separated cells. In contrast to CD146 - and non-separated cells, prompt mineralization was observed in CD146 + cells. Subsequently, qRT-PCR revealed high mRNA expression of CD146 and Alkaline phosphatase in mineralization-induced CD146 + cells. CD146 + cells were also observed high adipogenic ability by Oil red O staining. Histological examinations revealed an increased area of dentin/pulp-like structures in transplanted CD146 + cells, compared with CD146 - and CD146 +/- cells. Immunohistochemical studies detected dentin matrix protein-1 (DMP1) and dentin sialophosphoprotein (DSPP), as well as human mitochondria, in transplanted DPSCs. Co-expression of CD146 and GFP indicated that CD146 was expressed in transplanted CD146 + cells. CD146 + cells may promote mineralization and generate dentin/pulp-like structures, suggesting a role in self-renewal of stem cells and dental pulp regenerative therapy.

33 CFR 146.120 - Manning of survival craft.

Science.gov (United States)

2010-07-01

... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Manning of survival craft. 146.120 Section 146.120 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... craft. The owner, the owner's agent, or the person in charge shall assign a person to each life float...

22 CFR 146.455 - Textbooks and curricular material.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Textbooks and curricular material. 146.455 Section 146.455 Foreign Relations DEPARTMENT OF STATE CIVIL RIGHTS NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Education Programs or Activities...

Effects of time on the magnetic properties of terbium-doped LaMnO3

International Nuclear Information System (INIS)

Liu Weibin; Zhang Yingtang; Guan Wen; Kinsman, William; Yuan Xinqiang; Chen Ziyu

2012-01-01

The magnetic properties of the perovskite form of LaMnO 3 have been shown strong interest in recent years due to its high potential for use in magnetic devices. In this paper, the magnetic properties of a 30% terbium-doped LaMnO 3 (LMTO) perovskite manganite synthesized by a conventional solid-state reaction were investigated. Data on these properties was recorded periodically via SQUID and VSM to reveal it to be best described magnetically as a spin glass system. Thus, the time effect must be taken into consideration in instantaneously determining this material’s spin glass state as well as the overall magnetic properties in the absence of a magnetic field. The results of this paper point to a more in-depth understanding of the change in magnetic properties associated with doped LaMnO 3 .

Levels in 146Ce and the N = 88 isotones

International Nuclear Information System (INIS)

Gowdy, G.M.; Chrien, R.E.; Chu, Y.Y.

1981-01-01

An investigation of the level structure of 146 Ce following the beta decay of the low-spin isomer of 146 La has been carried out at the ISOL facility TRISTAN at Brookhaven National Laboratory. The half-life for the low spin isomer was found to be 6.0 +- 0.4s. A partial level scheme for 146 Ce below 2 MeV is given. The level energies and some B(E2) values extracted from our data have been compared with IBA-2 calculations done entirely with extrapolated parameters from neighboring Z nuclei in order to check the predictive power of the model. Systematics of the Z = 58 isotopes and N = 88 isotones indicate that although 146 Ce is more deformed than its isotones with Z greater than or equal to 60, the transition to the well-deformed region can probably more correctly be thought to occur after 146 Ce, between N = 88 and N = 90, as it does for Z greater than or equal to 60. The abrupt onset of deformation present in the higher Z isotopes is not seen in the Ce isotopes where the trend is found to be rather smooth throughout

Excited states in 146Sm and 147Sm

International Nuclear Information System (INIS)

Kownacki, J.; Sujkowski, Z.; Hammaren, E.; Liukkonen, E.; Piiparinen, M.; Lindblad, Th.; Ryde, H.

1979-10-01

The sup(144,146)Nd(α,xn) and sup(146,148)Nd( 3 He,xn) reactions with Esub(α) = 20 - 43 MeV and E 3 sub(He) = 19 - 27 MeV are used to investigate excited states in the isotopes 146 Sm and 147 Sm. The experiments involve measurements of singles γ-ray spectra and conversion electron spectra, γ-ray angular distributions and three parameter (E sub(γ)E sub(γ) time) coincidences. From these experiments information is obtained for states with spin up to I = 13 + and I = 27/2 - , respectively, These states are interpeted within the framework of the cluster-vibration model (CVM) as well as the shell model. (author)

Influence of crystallite size and temperature on the antiferromagnetic helices of terbium and holmium metal

Energy Technology Data Exchange (ETDEWEB)

Bick, Jens-Peter; Michels, Andreas [Universitaet des Saarlandes, D-66041 Saarbruecken (Germany); University of Luxembourg, L-1511 Luxembourg (Luxembourg); Ferdinand, Adrian; Birringer, Rainer [Universitaet des Saarlandes, D-66041 Saarbruecken (Germany); Baller, Joerg; Sanctuary, Roland [University of Luxembourg, L-1511 Luxembourg (Luxembourg); Philippi, Stefan [Leibniz Institute for Solid State and Materials Research, D-01069 Dresden (Germany); Lott, Dieter [GKSS Research Center, D-21502 Geesthacht (Germany); Balog, Sandor [Paul Scherrer Institute, CH-5232 Villigen (Switzerland); Rotenberg, Eli [Lawrence Berkeley National Laboratory, California 94720 (United States); Kaindl, Guenter [Freie Universitaet Berlin, D-14195 Berlin-Dahlem (Germany); Doebrich, Kristian M. [Freie Universitaet Berlin, D-14195 Berlin-Dahlem (Germany); Max-Born-Institut, D-12489 Berlin (Germany)

2011-07-01

We report on the results of grain-size and temperature-dependent magnetization, specific-heat, neutron-scattering, and angle-resolved photoelectron spectroscopy (ARPES) experiments on the heavy rare-earth metals terbium and holmium, with particular emphasis on the temperature regions where the helical antiferromagnetic phases exist. In contrast to Ho, we find that the helical structure in Tb is relative strongly affected by microstructural disorder, specifically, it can no longer be detected for the smallest studied grain size of D=18 nm. Moreover, in coarse-grained Tb a helical structure persists even in the ferromagnetic regime, down to about T=215 K, in agreement with the ARPES data, which reveal a nesting feature of the Fermi surface at the L point of the Brillouin zone at T=210 K.

29 CFR 1990.146 - Issues to be considered in the rulemaking.

Science.gov (United States)

2010-07-01

... 29 Labor 9 2010-07-01 2010-07-01 false Issues to be considered in the rulemaking. 1990.146 Section 1990.146 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION... CARCINOGENS Regulation of Potential Occupational Carcinogens § 1990.146 Issues to be considered in the...

Dysregulation of endothelial colony-forming cell function by a negative feedback loop of circulating miR-146a and -146b in cardiovascular disease patients.

Directory of Open Access Journals (Sweden)

Ting-Yu Chang

Full Text Available Functional impairment of endothelial colony-forming cells (ECFCs, a specific cell lineage of endothelial progenitor cells (EPCs is highly associated with the severity of coronary artery disease (CAD, the most common type of cardiovascular disease (CVD. Emerging evidence show that circulating microRNAs (miRNAs in CAD patients' body fluid hold a great potential as biomarkers. However, our knowledge of the role of circulating miRNA in regulating the function of ECFCs and the progression of CAD is still in its infancy. We showed that when ECFCs from healthy volunteers were incubated with conditioned medium or purified exosomes of cultured CAD ECFCs, the secretory factors from CAD ECFCs dysregulated migration and tube formation ability of healthy ECFCs. It is known that exosomes influence the physiology of recipient cells by introducing RNAs including miRNAs. By using small RNA sequencing (smRNA-seq, we deciphered the circulating miRNome in the plasma of healthy individual and CAD patients, and found that the plasma miRNA spectrum from CAD patients was significantly different from that of healthy control. Interestingly, smRNA-seq of both healthy and CAD ECFCs showed that twelve miRNAs that had a higher expression in the plasma of CAD patients also showed higher expression in CAD ECFCs when compared with healthy control. This result suggests that these miRNAs may be involved in the regulation of ECFC functions. For identification of potential mRNA targets of the differentially expressed miRNA in CAD patients, cDNA microarray analysis was performed to identify the angiogenesis-related genes that were down-regulated in CAD ECFCs and Pearson's correlation were used to identify miRNAs that were negatively correlated with the identified angiogenesis-related genes. RT-qPCR analysis of the five miRNAs that negatively correlated with the down-regulated angiogenesis-related genes in plasma and ECFC of CAD patients showed miR-146a-5p and miR-146b-5p up

40 CFR 146.9 - Criteria for establishing permitting priorities.

Science.gov (United States)

2010-07-01

....9 Criteria for establishing permitting priorities. In determining priorities for setting times for... priorities. 146.9 Section 146.9 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER... (a), (c), (g) or § 144.22(f), the Director shall base these priorities upon consideration of the...

21 CFR 146.154 - Concentrated orange juice with preservative.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Concentrated orange juice with preservative. 146... Canned Fruit Juices and Beverages § 146.154 Concentrated orange juice with preservative. (a) Concentrated orange juice with preservative complies with the requirements for composition and labeling of optional...

7 CFR 1260.146 - Vacancies.

Science.gov (United States)

2010-01-01

... Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE BEEF PROMOTION AND RESEARCH Beef Promotion and Research Order Cattlemen's Beef Promotion and Research Board § 1260.146 Vacancies. To fill any...

Effects of time on the magnetic properties of terbium-doped LaMnO{sub 3}

Energy Technology Data Exchange (ETDEWEB)

Liu Weibin [Department of Physics, Beijing University of Aeronautics and Astronautics, Beijing 100191 (China); Zhang Yingtang, E-mail: zhangyingtang76@mail.xjtu.edu.cn [School of Material Science and Engineering, Institute of Functional Material, Shaanxi University of Technology, Hanzhong 723003 (China); State Key Laboratory of Electrical Insulation and Power Equipment and MOE Key Laboratory for Nonequilibrium Synthesis and Modulation of Condensed Matter, Xi' an Jiaotong University, Xi' an 710049 (China); Guan Wen [State Key Laboratory of Electrical Insulation and Power Equipment and MOE Key Laboratory for Nonequilibrium Synthesis and Modulation of Condensed Matter, Xi' an Jiaotong University, Xi' an 710049 (China); Kinsman, William [Department of Materials Science and Engineering, Pennsylvania State University, University Park, PA 16802 (United States); Yuan Xinqiang [School of Material Science and Engineering, Institute of Functional Material, Shaanxi University of Technology, Hanzhong 723003 (China); Chen Ziyu [Department of Physics, Beijing University of Aeronautics and Astronautics, Beijing 100191 (China)

2012-09-01

The magnetic properties of the perovskite form of LaMnO{sub 3} have been shown strong interest in recent years due to its high potential for use in magnetic devices. In this paper, the magnetic properties of a 30% terbium-doped LaMnO{sub 3} (LMTO) perovskite manganite synthesized by a conventional solid-state reaction were investigated. Data on these properties was recorded periodically via SQUID and VSM to reveal it to be best described magnetically as a spin glass system. Thus, the time effect must be taken into consideration in instantaneously determining this material's spin glass state as well as the overall magnetic properties in the absence of a magnetic field. The results of this paper point to a more in-depth understanding of the change in magnetic properties associated with doped LaMnO{sub 3}.

19 CFR 146.61 - Constructive transfer to Customs territory.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Constructive transfer to Customs territory. 146.61 Section 146.61 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY... Constructive transfer to Customs territory. The port director shall accept receipt of any entry in proper form...

9 CFR 146.33 - Terminology and classification; meat-type chicken slaughter plants.

Science.gov (United States)

2010-01-01

...-type chicken slaughter plants. 146.33 Section 146.33 Animals and Animal Products ANIMAL AND PLANT... PLAN FOR COMMERCIAL POULTRY Special Provisions for Meat-Type Chicken Slaughter Plants § 146.33 Terminology and classification; meat-type chicken slaughter plants. Participating meat-type chicken slaughter...

Sensitivity improvement of Cerenkov luminescence endoscope with terbium doped Gd{sub 2}O{sub 2}S nanoparticles

Energy Technology Data Exchange (ETDEWEB)

Cao, Xin; Chen, Xueli, E-mail: xlchen@xidian.edu.cn, E-mail: jimleung@mail.xidian.edu.cn; Cao, Xu; Zhan, Yonghua; Liang, Jimin, E-mail: xlchen@xidian.edu.cn, E-mail: jimleung@mail.xidian.edu.cn [Engineering Research Center of Molecular and Neuro Imaging of the Ministry of Education and School of Life Science and Technology, Xidian University, Xi' an, Shaanxi 710071 (China); Kang, Fei; Wang, Jing [Department of Nuclear Medicine, Xijing Hospital, Fourth Military Medical University, Xi' an, Shaanxi 710032 (China); Wu, Kaichun [Department of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi' an, Shaanxi 710032 (China)

2015-05-25

Our previous study showed a great attenuation for the Cerenkov luminescence endoscope (CLE), resulting in relatively low detection sensitivity of radiotracers. Here, a kind of radioluminescence nanoparticles (RLNPs), terbium doped Gd{sub 2}O{sub 2}S was mixed with the radionuclide {sup 68}Ga to enhance the intensity of emitted luminescence, which finally improved the detection sensitivity of the CLE by using the radioluminescence imaging technique. With the in vitro and in vivo pseudotumor experiments, we showed that the use of RLNPs mixed with the radionuclide {sup 68}Ga enabled superior sensitivity compared with the radionuclide {sup 68}Ga only, with 50-fold improvement on detection sensitivity, which guaranteed meeting the demands of the clinical diagnosis of gastrointestinal tract tumors.

22 CFR 146.105 - Definitions.

Science.gov (United States)

2010-04-01

... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Introduction § 146.105 Definitions. As used in these Title... financial assistance, or by a recipient, as a condition to becoming a recipient. Designated agency official... education, or an institution of vocational education, as defined in this section. Federal financial...

Sonochemical synthesis of terbium tungstate for developing high power supercapacitors with enhanced energy densities.

Science.gov (United States)

Sobhani-Nasab, Ali; Rahimi-Nasrabadi, Mehdi; Naderi, Hamid Reza; Pourmohamadian, Vafa; Ahmadi, Farhad; Ganjali, Mohammad Reza; Ehrlich, Hermann

2018-07-01

Sonochemically prepared nanoparticles of terbium tungstate (TWNPs) were evaluated through scanning electron microscopy (SEM), thermogravimetric analysis (TGA), X-ray diffraction (XRD) and Fourier transform infrared spectroscopy (FT-IR), UV-Vis spectroscopy, and the optimal products were further characterized in terms of their electrochemical properties using conventional and continuous cyclic voltammetry (CV, and CCV), galvanostatic charge/discharge technique, and electrochemical impedance spectroscopy (EIS). The CV studies indicated the TWNPs to have specific capacitance (SC) values of 336 and 205 F g -1 at 1 and 200 mV s -1 , and galvanostatic charge-discharge tests revealed the SC of the TWNP-based electrodes to be 300 F g -1 at 1 Ag -1 . Also continuous cyclic voltammetry evaluations proved the sample as having a capacitance retention value of 95.3% after applying 4000 potential cycles. In the light of the results TWNPs were concluded as favorable electrode materials for use in hybrid vehicle systems. Copyright © 2018 Elsevier B.V. All rights reserved.

11 CFR 100.146 - Legal or accounting services to other political committees.

Science.gov (United States)

2010-01-01

... 11 Federal Elections 1 2010-01-01 2010-01-01 false Legal or accounting services to other political committees. 100.146 Section 100.146 Federal Elections FEDERAL ELECTION COMMISSION GENERAL SCOPE AND DEFINITIONS (2 U.S.C. 431) Exceptions to Expenditures § 100.146 Legal or accounting services to other...

Synergistic Effect of MiR-146a Mimic and Cetuximab on Hepatocellular Carcinoma Cells

Directory of Open Access Journals (Sweden)

Suning Huang

2014-01-01

Full Text Available Previously, we found that the expression of microRNA-146a (miR-146a was downregulated in hepatocellular carcinoma (HCC formalin-fixed paraffin-embedded (FFPE tissues compared to the adjacent noncancerous hepatic tissues. In the current study, we have explored the in vitro effect of miR-146a on the malignant phenotypes of HCC cells. MiR-146a mimic could suppress cell growth and increase cellular apoptosis in HCC cell lines HepG2, HepB3, and SNU449, as assessed by spectrophotometry, fluorimetry, and fluorescence microscopy, respectively. Furthermore, western blot showed that miR-146a mimic downregulated EGFR, ERK1/2, and stat5 signalings. These effects were less potent compared to that of a siRNA targeting EGFR, a known target gene of miR-146a. Moreover, miR-146a mimic could enhance the cell growth inhibition and apoptosis induction impact of various EGFR targeting agents. The most potent combination was miR-146a mimic with cetuximab, presenting a synergistic effect. In conclusion, miR-146a plays a vital role in the cell growth and apoptosis of HCC cells and inducing miR-146a level might be a critical targeted molecular therapy strategy for HCC.

Synergistic effect of MiR-146a mimic and cetuximab on hepatocellular carcinoma cells.

Science.gov (United States)

Huang, Suning; He, Rongquan; Rong, Minhua; Dang, Yiwu; Chen, Gang

2014-01-01

Previously, we found that the expression of microRNA-146a (miR-146a) was downregulated in hepatocellular carcinoma (HCC) formalin-fixed paraffin-embedded (FFPE) tissues compared to the adjacent noncancerous hepatic tissues. In the current study, we have explored the in vitro effect of miR-146a on the malignant phenotypes of HCC cells. MiR-146a mimic could suppress cell growth and increase cellular apoptosis in HCC cell lines HepG2, HepB3, and SNU449, as assessed by spectrophotometry, fluorimetry, and fluorescence microscopy, respectively. Furthermore, western blot showed that miR-146a mimic downregulated EGFR, ERK1/2, and stat5 signalings. These effects were less potent compared to that of a siRNA targeting EGFR, a known target gene of miR-146a. Moreover, miR-146a mimic could enhance the cell growth inhibition and apoptosis induction impact of various EGFR targeting agents. The most potent combination was miR-146a mimic with cetuximab, presenting a synergistic effect. In conclusion, miR-146a plays a vital role in the cell growth and apoptosis of HCC cells and inducing miR-146a level might be a critical targeted molecular therapy strategy for HCC.

STUDY OF THE HIGH-SPIN STRUCTURE OF PM-146

NARCIS (Netherlands)

RZACAURBAN, T; DURELL, JL; PHILLIPS, WR; VARLEY, BJ; HESS, CP; PEARSON, CJ; VERMEER, WJ; VIEU, C; DIONISIO, JS; PAUTRAT, M; Urban, W

1995-01-01

Excited states in Pm-146 have been investigated through the Xe-136(N-15,5n) and the Nd-146(d,xn) compound-nucleus reactions. A level scheme extending up to 6.9 MeV of excitation energy and (I = 25HBAR) is proposed. Most of the high-spin levels are interpreted in terms of multi-particle-hole states

19 CFR 146.8 - Seals, authority of operator to break and affix.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Seals, authority of operator to break and affix. 146.8 Section 146.8 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.8 Seals, authority of...

14 CFR 1260.146 - Procurement records.

Science.gov (United States)

2010-01-01

... Higher Education, Hospitals, and Other Non-Profit Organizations Procurement Standards § 1260.146... of competition when competitive bids or offers are not obtained, and (c) Basis for award cost or price. ...

27 CFR 44.146 - Closing.

Science.gov (United States)

2010-04-01

... PAYMENT OF TAX, OR WITH DRAWBACK OF TAX Operations by Export Warehouse Proprietors Inventories § 44.146 Closing. A closing inventory shall be made by the export warehouse proprietor when he transfers ownership or concludes business. Where the proprietor transfers ownership the closing inventory shall be made...

Association of microRNA 146 with middle ear hyperplasia in pediatric otitis media.

Science.gov (United States)

Samuels, Tina L; Yan, Justin; Khampang, Pawjai; MacKinnon, Alexander; Hong, Wenzhou; Johnston, Nikki; Kerschner, Joseph E

2016-09-01

Toll-like receptor signaling activated by bacterial otitis media pathogens in the middle ear has been shown to play a key role in OM susceptibility, pathogenesis and recovery. Recent studies implicate microRNA 146 (miR-146) in regulation of inflammation via negative feedback of toll-like receptor signaling (TLR) in a wide variety of tissues, however its involvement in otitis media is unknown. Human middle ear epithelial cells were stimulated with proinflammatory cytokines, interleukin 1 beta or tumor necrosis factor alpha, for two to twenty-four hours. Middle ear biopsies were collected from children with otitis media with effusion (n = 20), recurrent otitis media (n = 9), and control subjects undergoing cochlear implantation (n = 10). miR-146a, miR-146b expression was assayed by quantitative PCR (qPCR). Expression of miR-146 targets involved in TLR signaling, IRAK1 and TRAF6, was assayed by qPCR in middle ear biopsies. Middle ear biopsies were cryosectioned and epithelial thickness measured by a certified pathologist. Proinflammatory cytokines induced expression of miR-146 in middle ear epithelial cells in vitro. Middle ear miR-146a and miR-146b expression was elevated in otitis media patients relative to control subjects and correlated with middle ear epithelial thickness. A trend towards inverse correlation was observed between miR-146 and TRAF6 expression in the clinical population. This report is the first to assess miRNA expression in a clinical population with OM. Findings herein suggest miR-146 may play a role in OM. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Transcriptional regulation of miR-146b by C/EBPβ LAP2 in esophageal cancer cells

International Nuclear Information System (INIS)

Li, Junxia; Shan, Fabo; Xiong, Gang; Wang, Ju-Ming; Wang, Wen-Lin; Xu, Xueqing; Bai, Yun

2014-01-01

Highlights: • MiR-146b promotes esophageal cancer cell proliferation. • MiR-146b inhibits esophageal cancer cell apoptosis. • C/EBPβ directly binds to miR-146b promoter conserved region. • MiR-146b is up-regulated by C/EBPβ LAP2 transcriptional activation. - Abstract: Recent clinical study indicated that up-regulation of miR-146b was associated with poor overall survival of patients in esophageal squamous cell carcinoma. However, the underlying mechanism of miR-146b dysregulation remains to be explored. Here we report that miR-146b promotes cell proliferation and inhibits cell apoptosis in esophageal cancer cell lines. Mechanismly, two C/EBPβ binding motifs are located in the miR-146b promoter conserved region. Among the three isoforms of C/EBPβ, C/EBPβ LAP2 positively regulated miR-146b expression and increases miR-146b levels in a dose-dependent manner through transcription activation of miR-146b gene. Together, these results suggest a miR-146b regulatory mechanism involving C/EBPβ, which may contribute to the up-regulation of miR-146b in esophageal squamous cell carcinoma

Study of the nucleotide binding site of the yeast Schizosaccharomyces pombe plasma membrane H+-ATPase using formycin triphosphate-terbium complex

International Nuclear Information System (INIS)

Ronjat, M.; Lacapere, J.J.; Dufour, J.P.; Dupont, Y.

1987-01-01

The plasma membrane of yeasts contains an H+-ATPase similar to the other cation transport ATPases of eukaryotic organisms. This enzyme has been purified and shows H+ transport in reconstituted vesicles. In the presence of Mg2+, formycin triphosphate (FTP) is hydrolyzed by the H+-ATPase and supports H+ transport. When combined with terbium ion, FTP (Tb-FTP) and ATP (Tb-ATP) are no longer hydrolyzed. Competition between Mg-ATP and Tb-FTP for ATP hydrolysis indicates that terbium-associated nucleotides bind to the catalytic site of the H+-ATPase. The fluorescent properties of the Tb-FTP complex were used to study the active site of the H+-ATPase. Fluorescence of Tb-FTP is greatly enhanced upon binding into the nucleotide site of H+-ATPase with a dissociation constant of 1 microM. Tb-ATP, Tb-ADP, and Tb-ITP are competitive inhibitors of Tb-FTP binding with Ki = 4.5, 5.0, and 6.0 microM, respectively. Binding of Tb-FTP is observed only in the presence of an excess of Tb3+ with an activation constant Ka = 25 microM for Tb3+. Analysis of the data reveals that the sites for Tb-FTP and Tb3+ binding are independent entities. In standard conditions these sites would be occupied by Mg-ATP and Mg2+, respectively. These findings suggest an important regulatory role of divalent cations on the activity of H+-ATPase. Replacement of H 2 O by D 2 O in the medium suggests the existence of two types of nucleotide binding sites differing by the hydration state of the Tb3+ ion in the bound Tb-FTP complex

UL146 variability among clinical isolates of Human Cytomegalovirus from Japan

Directory of Open Access Journals (Sweden)

Francisco Aguayo

2010-01-01

Full Text Available Human Cytomegalovirus (HCMV is a herpesvirus associated with serious diseases in immunocompromised subjects. The region between ORF UL133 and UL151 from HCMV, named ULb' is frequently deleted in attenuated AD169 and in highly passaged laboratory strains. However, this region is conserved in low-passaged and more virulent HCMV, like the Toledo strain. The UL146 gene, which is located in the ULb' region, encodes a CXC-chemokine analogue. The diversity of UL146 gene was evaluated among fifty-six clinical isolates of HCMV from Japan. Results show that UL146 gene was successfully amplified by the polymerase chain reaction (PCR in only 17/56 strains (30%, while the success rate for UL145/UL147 gene was 18/56 strains (32%. After DNA sequencing, the 35 amplified strains were classified into 8 groups. When compared, variability of UL146 ranged from 25.1% to 52.9% at the DNA level and from 34.5% to 67% at the amino acid level. Seven groups had the interleukin-8 (IL-8 motif ERL (Glu-Leu-Arg CXC and one group had only the CXC motif, suggesting the absence of the IL-8 function of UL146. In conclusion, we found that UL146 gene of HCMV is hyper-variable in clinical strains from Japan suggesting the possibility of a different function in each sequence group.

CD146/MCAM defines functionality of human bone marrow stromal stem cell populations

DEFF Research Database (Denmark)

Harkness, Linda; Zaher, Walid; Ditzel, Nicholas

2016-01-01

BACKGROUND: Identification of surface markers for prospective isolation of functionally homogenous populations of human skeletal (stromal, mesenchymal) stem cells (hMSCs) is highly relevant for cell therapy protocols. Thus, we examined the possible use of CD146 to subtype a heterogeneous hMSC...... population. METHODS: Using flow cytometry and cell sorting, we isolated two distinct hMSC-CD146(+) and hMSC-CD146(-) cell populations from the telomerized human bone marrow-derived stromal cell line (hMSC-TERT). Cells were examined for differences in their size, shape and texture by using high...... and adipocytes on the basis of gene expression and protein production of lineage-specific markers. In vivo, hMSC-CD146(+) and hMSC-CD146(-) cells formed bone and bone marrow organ when implanted subcutaneously in immune-deficient mice. Bone was enriched in hMSC-CD146(-) cells (12.6 % versus 8.1 %) and bone...

Inhibition of KLF7-Targeting MicroRNA 146b Promotes Sciatic Nerve Regeneration.

Science.gov (United States)

Li, Wen-Yuan; Zhang, Wei-Ting; Cheng, Yong-Xia; Liu, Yan-Cui; Zhai, Feng-Guo; Sun, Ping; Li, Hui-Ting; Deng, Ling-Xiao; Zhu, Xiao-Feng; Wang, Ying

2018-06-01

A previous study has indicated that Krüppel-like factor 7 (KLF7), a transcription factor that stimulates Schwann cell (SC) proliferation and axonal regeneration after peripheral nerve injury, is a promising therapeutic transcription factor in nerve injury. We aimed to identify whether inhibition of microRNA-146b (miR-146b) affected SC proliferation, migration, and myelinated axon regeneration following sciatic nerve injury by regulating its direct target KLF7. SCs were transfected with miRNA lentivirus, miRNA inhibitor lentivirus, or KLF7 siRNA lentivirus in vitro. The expression of miR146b and KLF7, as well as SC proliferation and migration, were subsequently evaluated. In vivo, an acellular nerve allograft (ANA) followed by injection of GFP control vector or a lentiviral vector encoding an miR-146b inhibitor was used to assess the repair potential in a model of sciatic nerve gap. miR-146b directly targeted KLF7 by binding to the 3'-UTR, suppressing KLF7. Up-regulation of miR-146b and KLF7 knockdown significantly reduced the proliferation and migration of SCs, whereas silencing miR-146b resulted in increased proliferation and migration. KLF7 protein was localized in SCs in which miR-146b was expressed in vivo. Similarly, 4 weeks after the ANA, anti-miR-146b increased KLF7 and its target gene nerve growth factor cascade, promoting axonal outgrowth. Closer analysis revealed improved nerve conduction and sciatic function index score, and enhanced expression of neurofilaments, P0 (anti-peripheral myelin), and myelinated axon regeneration. Our findings provide new insight into the regulation of KLF7 by miR-146b during peripheral nerve regeneration and suggest a potential therapeutic strategy for peripheral nerve injury.

Color maps of Arp 146

Science.gov (United States)

Schultz, A. B.; Spight, L. D.; Colegrove, P. T.; Disanti, M. A.; Fink, U.

1990-01-01

Four color maps of Arp 146 are given. The structure and color of the ring galaxy and its companion show evidence of a bridge of material between the companion and the remnant nucleus of the original galaxy now forming the ring. Broad band spatial coverage clearly defines regions of starburst occurrence.

19 CFR 146.23 - Accountability for merchandise in a zone.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Accountability for merchandise in a zone. 146.23 Section 146.23 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY....23 Accountability for merchandise in a zone. (a) Identification of merchandise—(1) General. A zone...

Complete Stokes polarimetry of magneto-optical Faraday effect in a terbium gallium garnet crystal at cryogenic temperatures.

Science.gov (United States)

Majeed, Hassaan; Shaheen, Amrozia; Anwar, Muhammad Sabieh

2013-10-21

We report the complete determination of the polarization changes caused in linearly polarized incident light due to propagation in a magneto-optically active terbium gallium garnet (TGG) single crystal, at temperatures ranging from 6.3 to 300 K. A 28-fold increase in the Verdet constant of the TGG crystal is seen as its temperature decreases to 6.3 K. In contrast with polarimetry of light emerging from a Faraday material at room temperature, polarimetry at cryogenic temperatures cannot be carried out using the conventional fixed polarizer-analyzer technique because the assumption that ellipticity is negligible becomes increasingly invalid as temperature is lowered. It is shown that complete determination of light polarization in such a case requires the determination of its Stokes parameters, otherwise inaccurate measurements will result with negative implications for practical devices.

22 CFR 146.440 - Health and insurance benefits and services.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Health and insurance benefits and services. 146... the Basis of Sex in Education Programs or Activities Prohibited § 146.440 Health and insurance... insurance benefit, service, policy, or plan to any of its students, a recipient shall not discriminate on...

21 CFR 146.148 - Reduced acid frozen concentrated orange juice.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Reduced acid frozen concentrated orange juice. 146... Canned Fruit Juices and Beverages § 146.148 Reduced acid frozen concentrated orange juice. (a) Reduced acid frozen concentrated orange juice is the food that complies with the requirements for composition...

21 CFR 146.3 - Definitions.

Science.gov (United States)

2010-04-01

... CONSUMPTION CANNED FRUIT JUICES General Provisions § 146.3 Definitions. For the purposes of this part: (a) The... hydrolyzed starch. (c) The term dried glucose sirup means the product obtained by drying glucose sirup. (d... following: Unless otherwise provided in a standard, a lot of canned fruits shall be deemed in compliance for...

MicroRNA-146a Deficiency Protects against Listeria monocytogenes Infection by Modulating the Gut Microbiota

Directory of Open Access Journals (Sweden)

Chong-Tao Du

2018-03-01

Full Text Available The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes. High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes, Blautia, Coprococcus_1, and Ruminococcus_1. Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes, indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.

MicroRNA-146a Deficiency Protects against Listeria monocytogenes Infection by Modulating the Gut Microbiota.

Science.gov (United States)

Du, Chong-Tao; Gao, Wei; Ma, Ke; Yu, Shui-Xing; Li, Na; Yan, Shi-Qing; Zhou, Feng-Hua; Liu, Zhen-Zhen; Chen, Wei; Lei, Lian-Cheng; Yang, Yong-Jun; Han, Wen-Yu

2018-03-26

The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes . High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes , Blautia , Coprococcus_1, and Ruminococcus_1 . Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes , indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.

Picomolar traces of americium(III) introduce drastic changes in the structural chemistry of terbium(III). A break in the ''gadolinium break''

Energy Technology Data Exchange (ETDEWEB)

Welch, Jan M. [TU Wien, Atominstitut, Vienna (Austria); Mueller, Danny; Knoll, Christian; Wilkovitsch, Martin; Weinberger, Peter [TU Wien, Institute of Applied Synthetic Chemistry, Vienna (Austria); Giester, Gerald [University of Vienna, Institute of Mineralogy and Crystallography, Vienna (Austria); Ofner, Johannes; Lendl, Bernhard [TU Wien, Institute of Chemical Technologies and Analytics, Vienna (Austria); Steinhauser, Georg [Leibniz Universitaet Hannover, Institute of Radioecology and Radiation Protection (Germany)

2017-10-16

The crystallization of terbium 5,5{sup '}-azobis[1H-tetrazol-1-ide] (ZT) in the presence of trace amounts (ca. 50 Bq, ca. 1.6 pmol) of americium results in 1) the accumulation of the americium tracer in the crystalline solid and 2) a material that adopts a different crystal structure to that formed in the absence of americium. Americium-doped [Tb(Am)(H{sub 2}O){sub 7}ZT]{sub 2} ZT.10 H{sub 2}O is isostructural to light lanthanide (Ce-Gd) 5,5{sup '}-azobis[1H-tetrazol-1-ide] compounds, rather than to the heavy lanthanide (Tb-Lu) 5,5{sup '}-azobis[1H-tetrazol-1-ide] (e.g., [Tb(H{sub 2}O){sub 8}]{sub 2}ZT{sub 3}.6 H{sub 2}O) derivatives. Traces of Am seem to force the Tb compound into a structure normally preferred by the lighter lanthanides, despite a 10{sup 8}-fold Tb excess. The americium-doped material was studied by single-crystal X-ray diffraction, vibrational spectroscopy, radiochemical neutron activation analysis, and scanning electron microscopy. In addition, the inclusion properties of terbium 5,5{sup '}-azobis[1H-tetrazol-1-ide] towards americium were quantified, and a model for the crystallization process is proposed. (copyright 2017 Wiley-VCH Verlag GmbH and Co. KGaA, Weinheim)

Solar Thermochemical Hydrogen Production via Terbium Oxide Based Redox Reactions

Directory of Open Access Journals (Sweden)

Rahul Bhosale

2016-01-01

Full Text Available The computational thermodynamic modeling of the terbium oxide based two-step solar thermochemical water splitting (Tb-WS cycle is reported. The 1st step of the Tb-WS cycle involves thermal reduction of TbO2 into Tb and O2, whereas the 2nd step corresponds to the production of H2 through Tb oxidation by water splitting reaction. Equilibrium compositions associated with the thermal reduction and water splitting steps were determined via HSC simulations. Influence of oxygen partial pressure in the inert gas on thermal reduction of TbO2 and effect of water splitting temperature (TL on Gibbs free energy related to the H2 production step were examined in detail. The cycle (ηcycle and solar-to-fuel energy conversion (ηsolar-to-fuel efficiency of the Tb-WS cycle were determined by performing the second-law thermodynamic analysis. Results obtained indicate that ηcycle and ηsolar-to-fuel increase with the decrease in oxygen partial pressure in the inert flushing gas and thermal reduction temperature (TH. It was also realized that the recuperation of the heat released by the water splitting reactor and quench unit further enhances the solar reactor efficiency. At TH=2280 K, by applying 60% heat recuperation, maximum ηcycle of 39.0% and ηsolar-to-fuel of 47.1% for the Tb-WS cycle can be attained.

Terbium(III)/gold nanocluster conjugates: the development of a novel ratiometric fluorescent probe for mercury(II) and a paper-based visual sensor.

Science.gov (United States)

Qi, Yan-Xia; Zhang, Min; Zhu, Anwei; Shi, Guoyue

2015-08-21

In this work, a novel ratiometric fluorescent probe was developed for rapid, highly accurate, sensitive and selective detection of mercury(II) (Hg(2+)) based on terbium(III)/gold nanocluster conjugates (Tb(3+)/BSA-AuNCs), in which bovine serum albumin capped gold nanoclusters (BSA-AuNCs) acted as the signal indicator and terbium(III) (Tb(3+)) was used as the build-in reference. Our proposed ratiometric fluorescent probe exhibited unique specificity toward Hg(2+) against other common environmentally and biologically important metal ions, and had high accuracy and sensitivity with a low detection limit of 1 nM. In addition, our proposed probe was effectively employed to detect Hg(2+) in the biological samples from the artificial Hg(2+)-infected rats. More significantly, an appealing paper-based visual sensor for Hg(2+) was designed by using filter paper embedded with Tb(3+)/BSA-AuNC conjugates, and we have further demonstrated its feasibility for facile fluorescent sensing of Hg(2+) in a visual format, in which only a handheld UV lamp is used. In the presence of Hg(2+), the paper-based visual sensor, illuminated by a handheld UV lamp, would undergo a distinct fluorescence color change from red to green, which can be readily observed with naked eyes even in trace Hg(2+) concentrations. The Tb(3+)/BSA-AuNC-derived paper-based visual sensor is cost-effective, portable, disposable and easy-to-use. This work unveiled a facile approach for accurate, sensitive and selective measuring of Hg(2+) with self-calibration.

19 CFR 146.21 - General requirements.

Science.gov (United States)

2010-04-01

... TREASURY (CONTINUED) FOREIGN TRADE ZONES Inventory Control and Recordkeeping System § 146.21 General requirements. (a) Systems capability. The operator shall maintain either manual or automated inventory control... English language copy of its written inventory control and recordkeeping systems procedures manual in...

38 CFR 21.146 - Independent instructor course.

Science.gov (United States)

2010-07-01

.... Chapter 31 Special Rehabilitation Services § 21.146 Independent instructor course. (a) Definition. An... the customary channels leading to employment may not be readily available to a veteran requiring an...

22 CFR 146.120 - Transfers of property.

Science.gov (United States)

2010-04-01

... PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Introduction § 146.120 Transfers of property... financial assistance to a transferee that operates any education program or activity, and the Federal share...

Preparation and luminescence properties of terbium-doped lanthanum oxide nanofibers by electrospinning

Energy Technology Data Exchange (ETDEWEB)

Song Lixin; Du Pingfan [Key Laboratory of Advanced Textile Materials and Manufacturing Technology (Zhejiang Sci-Tech University), Ministry of Education, Hangzhou 310018 (China); Xiong Jie, E-mail: jxiong@zstu.edu.cn [Key Laboratory of Advanced Textile Materials and Manufacturing Technology (Zhejiang Sci-Tech University), Ministry of Education, Hangzhou 310018 (China); Fan Xiaona; Jiao Yuxue [Key Laboratory of Advanced Textile Materials and Manufacturing Technology (Zhejiang Sci-Tech University), Ministry of Education, Hangzhou 310018 (China)

2012-01-15

Terbium-doped lanthanum oxide (La{sub 2}O{sub 3}:Tb{sup 3+}) nanofibers were prepared by electrospinning followed by calcination at high temperature. Thermogravimetric analyzer (TGA), field emission scanning electron microscopy (FE-SEM), X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FT-IR), and photoluminescence (PL) were used to characterize the obtained fibers. The results reveal that the nanofibers have an average diameter of ca. 95{+-}25 nm and are composed of pure La{sub 2}O{sub 3} phase. Under the excitation of 274 nm light, the La{sub 2}O{sub 3}:Tb{sup 3+} nanofibers exhibit the characteristic emission resulting from the {sup 5}D{sub 4}{yields}{sup 7}F{sub J} (J=3, 4, 5, 6) transitions of Tb{sup 3+} ions. And the PL emission intensity is stronger than that of their nanoparticle counterparts. - Highlights: > Tb{sup 3+}-doped La{sub 2}O{sub 3} (La{sub 2}O{sub 3}:Tb{sup 3+}) fluorescent nanofibers were prepared via a simple electrospinning technique. > Luminescent properties and other characteristics of the nanofibers were investigated in details. > Potential applications of La{sub 2}O{sub 3}:Tb{sup 3+} nanofibers and electrospinning technique described in this paper are suggested.

Sensitization effects of supramolecular assemblies on the luminescence of terbium-ion prulifloxacin complexes

Energy Technology Data Exchange (ETDEWEB)

Wang Hong; Yi Chongyue; Li Xue; Fang Fang [School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China); Yang Yajiang, E-mail: yjyang@mail.hust.edu.c [School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China)

2011-04-15

Luminescence enhancement of terbium-ion prulifloxacin complexes (Tb(III)-PUFX) in supramolecular hydrogels formed by assembly of 1,3:2,4-di-O-benzylidene-D-sorbitol (DBS) was investigated by steady-state fluorescence, varying temperature fluorescence and time-resolved fluorescence. The luminescence images show that Tb(III)-PUFX were dispersed in the DBS gels. The luminescence intensity of Tb(III)-PUFX in the DBS gels was significantly increased in comparison with that in corresponding aqueous solutions. The varying temperature fluorescent spectra show that the luminescence intensity of Tb(III)-PUFX decreased with an increase in the temperature. This implies that the luminescence enhancement of Tb(III)-PUFX is related to the dissociation and the formation of the DBS assemblies. Time-resolved fluorescence measurements show slower rotational motion in DBS gels in comparison with that in the corresponding aqueous solutions. This may be ascribed to a unique microstructure of three-dimensional network formed by DBC aggregates, resulting in deactivation of the nonradiative relaxation. The images of field emission scanning electron microscopy and polarized optical microscopy indicate that the morphology of the DBS assemblies was not influenced upon addition of Tb(III)-PUFX to the DBS gels.

21 CFR 146.185 - Pineapple juice.

Science.gov (United States)

2010-04-01

... reconstituted with water suitable for the purpose of maintaining essential composition and quality factors of... Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION CANNED FRUIT JUICES Requirements for Specific Standardized Canned Fruit Juices and Beverages § 146...

22 CFR 146.115 - Assurance required.

Science.gov (United States)

2010-04-01

... PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Introduction § 146.115 Assurance required. (a... applications for Federal financial assistance or awards of Federal financial assistance contain, be accompanied... assurance. (b) Duration of obligation. (1) In the case of Federal financial assistance extended to provide...

ImmunoPET for assessing the differential uptake of a CD146-specific monoclonal antibody in lung cancer

Energy Technology Data Exchange (ETDEWEB)

Sun, Haiyan; Kamkaew, Anyanee; Jiang, Dawei; Yang, Yunan [University of Wisconsin-Madison, Department of Radiology, Madison, WI (United States); England, Christopher G.; Hernandez, Reinier; Graves, Stephen A.; Barnhart, Todd E. [University of Wisconsin-Madison, Department of Medical Physics, Madison, WI (United States); Majewski, Rebecca L. [University of Wisconsin-Madison, Department of Biomedical Engineering, Madison, WI (United States); Cai, Weibo [University of Wisconsin-Madison, Department of Radiology, Madison, WI (United States); University of Wisconsin-Madison, Department of Medical Physics, Madison, WI (United States); University of Wisconsin-Madison, Department of Biomedical Engineering, Madison, WI (United States); University of Wisconsin Carbone Cancer Center, Madison, WI (United States)

2016-11-15

Overexpression of CD146 in solid tumors has been linked to disease progression, invasion, and metastasis. We describe the generation of a {sup 64}Cu-labeled CD146-specific antibody and its use for quantitative immunoPET imaging of CD146 expression in six lung cancer models. The anti-CD146 antibody (YY146) was conjugated to 1,4,7-triazacyclononane-triacetic acid (NOTA) and radiolabeled with {sup 64}Cu. CD146 expression was evaluated in six human lung cancer cell lines (A549, NCI-H358, NCI-H522, HCC4006, H23, and NCI-H460) by flow cytometry and quantitative western blot studies. The biodistribution and tumor uptake of {sup 64}Cu-NOTA-YY146 was assessed by sequential PET imaging in athymic nude mice bearing subcutaneous lung cancer xenografts. The correlation between CD146 expression and tumor uptake of {sup 64}Cu-NOTA-YY146 was evaluated by graphical software while ex vivo biodistribution and immunohistochemistry studies were performed to validate the accuracy of PET data and spatial expression of CD146. Flow cytometry and western blot studies showed similar findings with H460 and H23 cells showing high levels of expression of CD146. Small differences in CD146 expression levels were found among A549, H4006, H522, and H358 cells. Tumor uptake of {sup 64}Cu-NOTA-YY146 was highest in CD146-expressing H460 and H23 tumors, peaking at 20.1 ± 2.86 and 11.6 ± 2.34 %ID/g at 48 h after injection (n = 4). Tumor uptake was lowest in the H522 model (4.1 ± 0.98 %ID/g at 48 h after injection; n = 4), while H4006, A549 and H358 exhibited similar uptake of {sup 64}Cu-NOTA-YY146. A positive correlation was found between tumor uptake of {sup 64}Cu-NOTA-YY146 (%ID/g) and relative CD146 expression (r {sup 2} = 0.98, p < 0.01). Ex vivo biodistribution confirmed the accuracy of the PET data. The strong correlation between tumor uptake of {sup 64}Cu-NOTA-YY146 and CD146 expression demonstrates the potential use of this radiotracer for imaging tumors that elicit varying levels of CD146

Optical isotype shifts of 146Sm and 151Sm

International Nuclear Information System (INIS)

Eastham, D.A.; Walker, P.M.; Griffith, J.A.R.; Evans, D.E.; England, J.G.; Grant, I.S.

1984-01-01

We have measured the optical isotope shifts of 146 Sm and 151 Sm by laser resonance fluorescence. From these measurements the changes in the mean square nuclear radii are: delta 2 > (A=144 to 146)=0.266(10) fm 2 , and delta 2 > (A=151 to 152)=0.262(10) fm 2 . These results, together with those of the stable isotopes, show that the average nuclear expansion of samarium can be accounted for by the liquid drop model with deformations. (orig.)

10 CFR 1.46 - Office of Nuclear Security and Incident Response.

Science.gov (United States)

2010-01-01

... 10 Energy 1 2010-01-01 2010-01-01 false Office of Nuclear Security and Incident Response. 1.46... Headquarters Program Offices § 1.46 Office of Nuclear Security and Incident Response. The Office of Nuclear... evaluation and assessment of technical issues involving security at nuclear facilities, and is the agency...

Soluble CD146, an innovative and non-invasive biomarker of embryo selection for in vitro fertilization.

Directory of Open Access Journals (Sweden)

Sylvie Bouvier

Full Text Available Although progress was made in in vitro fertilization (IVF techniques, the majority of embryos transferred fail to implant. Morphology embryo scoring is the standard procedure for most of IVF centres for choosing the best embryo, but remains limited since even the embryos classified as "top quality" may not implant. As it has been shown that i CD146 is involved in embryo implantation and ii membrane form is shed to generate soluble CD146 (sCD146, we propose that sCD146 in embryo supernatants may constitute a new biomarker of embryo selection. Immunocytochemical staining showed expression of CD146 in early embryo stages and sCD146 was detected by ELISA and Western-blot in embryo supernatants from D2. We retrospectively studied 126 couples who underwent IVF attempt. The embryo culture medium from each transferred embryo (n = 222 was collected for measurement of sCD146 by ELISA. Significantly higher sCD146 concentrations were present in embryo supernatants that did not implant (n = 185 as compared to those that successfully implanted (n = 37 (1310 +/- 1152 pg.mL-1 vs. 845+/- 1173 pg.mL-1, p = 0.024. Sensitivity analysis performed on single embryo transfers (n = 71 confirmed this association (p = 0.0054. The computed ROC curve established that the optimal sCD146 concentration for embryo implantation is under 1164 pg.mL-1 (sensitivity: 76%, specificity: 48%, PPV: 25% and NPV: 92%. Over this sCD146 threshold, the implantation rate was significantly lower (9% with sCD146 levels >1164 pg.ml-1 vs. 22% with sCD146 levels ≤ 1164 pg.mL-1, p = 0.01. Among the embryos preselected by morphologic scoring, sCD146 determination could allow a better selection of the embryo(s, thus improving the success of elective single embryo transfer. This study establishes the proof of concept for the use of sCD146 as a biomarker for IVF by excluding the embryo with the highest sCD146 level. A multicentre prospective study will now be necessary to further establish its use in

microRNA-146a promotes mycobacterial survival in macrophages through suppressing nitric oxide production.

Science.gov (United States)

Li, Miao; Wang, Jinli; Fang, Yimin; Gong, Sitang; Li, Meiyu; Wu, Minhao; Lai, Xiaomin; Zeng, Gucheng; Wang, Yi; Yang, Kun; Huang, Xi

2016-03-30

Macrophages play a crucial role in host innate anti-mycobacterial defense, which is tightly regulated by multiple factors, including microRNAs. Our previous study showed that a panel of microRNAs was markedly up-regulated in macrophages upon mycobacterial infection. Here, we investigated the biological function of miR-146a during mycobacterial infection. miR-146a expression was induced both in vitro and in vivo after Mycobacterium bovis BCG infection. The inducible miR-146a could suppress the inducible nitric oxide (NO) synthase (iNOS) expression and NO generation, thus promoting mycobacterial survival in macrophages. Inhibition of endogenous miR-146a increased NO production and mycobacterial clearance. Moreover, miR-146a attenuated the activation of nuclear factor κB and mitogen-activated protein kinases signaling pathways during BCG infection, which in turn repressed iNOS expression. Mechanistically, miR-146a directly targeted tumor necrosis factor (TNF) receptor-associated factor 6 (TRAF6) at post-transcriptional level. Silencing TRAF6 decreased iNOS expression and NO production in BCG-infected macrophages, while overexpression of TRAF6 reversed miR-146a-mediated inhibition of NO production and clearance of mycobacteria. Therefore, we demonstrated a novel role of miR-146a in the modulation of host defense against mycobacterial infection by repressing NO production via targeting TRAF6, which may provide a promising therapeutic target for tuberculosis.

40 CFR 146.67 - Operating requirements.

Science.gov (United States)

2010-07-01

... serving as a water supply, place a notice in a newspaper of general circulation. (2) The Director may... 146.67 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED... steps to determine the presence or absence of a leak; and (3) Notify the Director within 24 hours after...

MicroRNA-146a Contributes to SCI Recovery via Regulating TRAF6 and IRAK1 Expression.

Science.gov (United States)

Wei, Jinsong; Wang, Jiafeng; Zhou, Yulan; Yan, Shouquan; Li, Keshen; Lin, Hongsheng

2016-01-01

MicroRNA-146a participates in spinal cord injury (SCI) recovery. Until recently, how miRNA-146a participates in SCI remained unclear. In this study, we tried to explore the roles of miRNA-146a in the recovery of SCI using a rat model. The expression of the probable target genes of miRNA-146a (including IRAK1 and TARF6) as well as proinflammation cytokines were measured until 7 days after surgery in the three groups (sham group, SCI group, and miRNA-146a antagomir injection group). Also, the animals' motivations were estimated using Basso Beattie Bresnahan (BBB) during the whole experiment. A luciferase assay was performed to demonstrate that miRNA-146a could directly target the mRNAs of IRAK1 and TRAF6 . Our experiments indicate that miRNA-146a inhibits proinflammatory cytokine secretion by suppressing IRAK1 and TRAF6 expression in the SCI model. In contrast, miRNA-146a may be upregulated by inflammatory mediators via the IRAK1 / TRAF6 pathway in the spinal cord. As a negative feedback element, miRNA-146a could make sure that the expression of IRAK1 - and TRAF6 -mediated genes was under tight control. Thus, miRNA-146a may serve as a novel therapeutic target for SCI interventions.

Fluorometric determination of proteins using the terbium (III)-2-thenoyltrifluoroacetone-sodium dodecyl benzene sulfonate-protein system

Energy Technology Data Exchange (ETDEWEB)

Jia Zhen [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Department of Chemistry, Dezhou University, Dezhou 253023 (China); Yang Jinghe [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)]. E-mail: yjh@sdu.edu.cn; Wu Xia [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang Fei [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Guo Changying [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Liu Shufang [Key Laboratory of Colloid and Interface Chemistry of Education Ministry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)

2006-12-15

It is found that in hexamethylene tetramine (HMTA)-HCl buffer of pH=8.00, proteins can enhance the fluorescence of terbium (III) (Tb{sup 3+})-2-thenoyltrifluoroacetone (TTA)-sodium dodecyl benzene sulfonate (SDBS) system. Based on this, a sensitive method for the determination of proteins is proposed. The experiments indicate that under the optimum conditions, the enhanced fluorescence intensity is in proportion to the concentration of proteins in the range of 4.0x10{sup -9}-7.5x10{sup -6}g/mL for bovine serum albumin (BSA), 5.0x10{sup -9}-1.5x10{sup -5}g/mL for human serum albumin (HSA), 1.0x10{sup -8}-7.5x10{sup -6}g/mL for egg albumin (EA). Their detection limits (S/N=3) are 0.5, 0.8 and 2.0ng/mL, respectively. The interaction mechanism is also studied.

Spectrofluorimetric determination of trace amount of coenzyme II using ciprofloxacin-terbium complex as a fluorescent probe

International Nuclear Information System (INIS)

Bian Weiwei; Wang Yusheng; Zhu Xiaojing; Jiang Chongqiu

2006-01-01

A new spectrofluorimetric method was developed for the determination of trace amount of nicotinamide adenine dinucleotide phosphate (NADP). Using terbium ion (Tb 3+ )-ciprofloxacin (CIP) complex as a fluorescent probe, in the buffer solution of pH=9.00, NADP can remarkably enhance the fluorescence intensity of the Tb 3+ -CIP complex at λ=545nm and the enhanced fluorescence intensity of Tb 3+ ion is in proportion to the concentration of NADP. Optimum conditions for the determination of NADP were also investigated. The dynamic range for the determination of NADP is 4.9x10 -7 -3.7x10 -6 molL -1 with detection limit of 1.3x10 -7 molL -1 . This method is simple, practical and relatively free interference from coexisting substances and can be successfully applied to determination of NADP in synthetic water samples. Moreover, the enhancement mechanisms of the fluorescence intensity in the Tb 3+ -CIP system and the Tb 3+ -CIP-NADP system have been also discussed

New levels and reinvestigation of octupole correlations in {sup 146,147}La

Energy Technology Data Exchange (ETDEWEB)

Wang, E.H.; Zachary, C.J.; Hamilton, J.H.; Ramayya, A.V.; Hwang, J.K.; Liu, S.H.; Brewer, N.T. [Vanderbilt University, Department of Physics and Astronomy, Nashville, TN (United States); Lewis, W. [Vanderbilt University, Department of Physics and Astronomy, Nashville, TN (United States); Furman University, Department of Physics, Greenville, SC (United States); Luo, Y.X. [Vanderbilt University, Department of Physics and Astronomy, Nashville, TN (United States); Lawrence Berkeley National Laboratory, Berkeley, CA (United States); Rasmussen, J.O. [Lawrence Berkeley National Laboratory, Berkeley, CA (United States); Zhu, S.J. [Tsinghua University, Department of Physics, Beijing (China); Ter-Akopian, G.M.; Oganessian, Yu.Ts. [Joint Institute for Nuclear Research, Dubna (Russian Federation)

2017-12-15

High spin states of neutron-rich {sup 146,147}La have been reinvestigated by γ-γ-γ and γ-γ-γ-γ coincidence data from a {sup 252}Cf spontaneous fission experiment by using Gammasphere. Thirty-two new transitions in {sup 146}La are observed. Two new bands in {sup 146}La have been established. One of them is proposed to be the octupole parity partner of the previously known band. Twenty new transitions in {sup 147}La are observed. The ground state band of {sup 147}La has been established with a proposed 5/2{sup +} band-head. Angular correlation of cascades has been used to study the spins and parities of the states. The B(E1)/B(E2) ratios and dipole moments of bands in {sup 146,} {sup 147}La have been measured. (orig.)

19 CFR 146.7 - Zone changes.

Science.gov (United States)

2010-04-01

... the risk and expense of the operator. The port director may require an accounting of all merchandise.... An operator shall make written application to the port director for approval of an alteration of an... accompanied by the supporting document requirements specified in § 146.6, as applicable. The port director may...

Octupole excitations in 146Sm

International Nuclear Information System (INIS)

Bizzeti, P.G.; Bizzetti-Sona, A.M.

1998-01-01

The mean lives of the lowest 9 - and 12 + states of 146 Sm have been measured by means of the RDM. Their (preliminary) values are r m (9 - )=0.97±0.05 ns and r m (12 + )=15±2 ps, respectively. The strengths of the collective E3 transitions of the 12 + →9 - →6 6 cascade are compared with the corresponding ones in 148 Gd

21 CFR 133.146 - Grated cheeses.

Science.gov (United States)

2010-04-01

... Products § 133.146 Grated cheeses. (a) Description. Grated cheeses is the class of foods prepared by..., and skim milk cheese for manufacturing may not be used. All cheese ingredients used are either made... ___ cheese”, the name of the cheese filling the blank. (ii) If only parmesan and romano cheeses are used and...

A search for long-lived radionuclides produced by fast-neutron irradiations of copper, silver, europium, terbium, and hafnium

International Nuclear Information System (INIS)

Meadows, J.W.; Smith, D.L.; Ikeda, Y.; Konno, C.

1990-01-01

Identical sample packets, each containing samples of elemental copper, silver, europium, terbium, and hafnium, as well as titanium, iron and nickel as dosimeters, have been irradiated in three distinct accelerator neutron fields (at Argonne National Laboratory and Los Alamos National Laboratory in the U.S.A., and Japan Atomic Energy Research Institute, Tokai, Japan) as part of an interlaboratory research collaboration to search for the production of long-lived radionuclides for fusion waste disposal applications. This paper is a progress report on this project. To date, we have detected the following activities, and have obtained preliminary experimental cross section values for several of these: Ag-106m,108m,110m; Eu-150m,152g,154; Tb-158,160; and Hf-175,178m2,179m2,181. (author). 11 refs, 1 fig., 4 tabs

MicroRNA-146a Regulates Perfusion Recovery in Response to Arterial Occlusion via Arteriogenesis

Directory of Open Access Journals (Sweden)

Joshua L. Heuslein

2018-01-01

Full Text Available The growth of endogenous collateral arteries that bypass arterial occlusion(s, or arteriogenesis, is a fundamental shear stress-induced adaptation with implications for treating peripheral arterial disease. MicroRNAs (miRs are key regulators of gene expression in response to injury and have strong therapeutic potential. In a previous study, we identified miR-146a as a candidate regulator of vascular remodeling. Here, we tested whether miR-146a regulates in vitro angiogenic endothelial cell (EC behaviors, as well as perfusion recovery, arteriogenesis, and angiogenesis in response to femoral arterial ligation (FAL in vivo. We found miR-146a inhibition impaired EC tube formation and migration in vitro. Following FAL, Balb/c mice were treated with a single, intramuscular injection of anti-miR-146a or scramble locked nucleic acid (LNA oligonucleotides directly into the non-ischemic gracilis muscles. Serial laser Doppler imaging demonstrated that anti-miR-146a treated mice exhibited significantly greater perfusion recovery (a 16% increase compared mice treated with scramble LNA. Moreover, anti-miR-146a treated mice exhibited a 22% increase in collateral artery diameter compared to controls, while there was no significant effect on in vivo angiogenesis or muscle regeneration. Despite exerting no beneficial effects on angiogenesis, the inhibition of mechanosensitive miR-146a enhances perfusion recovery after FAL via enhanced arteriogenesis.

A Terbium Sensitized Luminescence Method for the Assay of Flubiprofen in Pharmaceutical Formulations

Directory of Open Access Journals (Sweden)

Salma M.Z. Al-Kindy

2014-12-01

Full Text Available A sensitive time-resolved luminescence method for the determination of flubiprofen (FLP in methanol and in aqueous solution is described. The method is based on the luminescence sensitization of terbium (Tb3+ by the formation of a ternary complex with FLP in the presence of 4,7 diphenyl 1,10 phenanthroline (DPP as co-ligand, and Tween-20 as surfactant. The signal for Tb-FLP-DPP was monitored at λex  = 285 nm and λem  = 552 nm. Optimum conditions for the formation of the complex in an aqueous system were TRIS buffer, pH 8.0, DPP (2.5Å~10−7  M, Tween-20 (0.30% and 4Å~10-5  mol L-1  of Tb3+  which allowed the determination of 20–1000 ng mL-1  of FLP with a limit of detection (LOD of 10 ng mL-1 . The relative standard deviations of the method ranged between 0.6 and 1.4% indicating excellent reproducibility of the method. The proposed method was successfully applied for the assays of FLP in pharmaceutical formulations and spiked tap water samples with average recoveries of 87% – 95%.

22 CFR 146.100 - Purpose and effective date.

Science.gov (United States)

2010-04-01

... EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Introduction § 146.100 Purpose and... basis of sex in any education program or activity receiving Federal financial assistance, whether or not...

45 CFR 146.122 - Additional requirements prohibiting discrimination based on genetic information.

Science.gov (United States)

2010-10-01

... genetic information and should review the records to excise any genetic information. N assembles the data requested by M and, although N reviews it to delete genetic information, the data from a specific region... based on genetic information. 146.122 Section 146.122 Public Welfare DEPARTMENT OF HEALTH AND HUMAN...

76 FR 6575 - Airworthiness Directives; BAE Systems (Operations) Limited Model BAe 146 and Avro 146-RJ Airplanes

Science.gov (United States)

2011-02-07

.... * * * * * * * * * * * [I]nvestigation by M-D showed that if any undetected crack was present at the time of the embodiment... terminating action for the repetitive inspections, by embodiment of Messier-Dowty (M-D) Service Bulletin (SB... optional closing action of EASA AD 2010-0001-E is embodiment of M-D B 146-32-150 (polishing and shot...

Evidence of mass exchange between inside and outside of sonoluminescing bubble in aqueous solution of terbium chloride

Energy Technology Data Exchange (ETDEWEB)

Liang, Jinfu, E-mail: liang.shi2007@163.com [School of Physics and Electronic Science, Guizhou Normal University, Guiyang 550001 (China); Chen, Weizhong, E-mail: wzchen@nju.edu.cn [The Key Laboratory of Modern Acoustics, Ministry of Education, Institution of Acoustics, Nanjing University, Nanjing 210093 (China); Wang, Xun; Yang, Jing; Chen, Zhan [The Key Laboratory of Modern Acoustics, Ministry of Education, Institution of Acoustics, Nanjing University, Nanjing 210093 (China)

2016-12-16

Highlights: • Time-resolved spectra of SBSL were obtained for Tb{sup 3+} ions emission lines. • Mass exchange between inside and outside of SL bubble was probed via Tb{sup 3+} ions lines. • The argon rectification hypothesis was tested by time-resolved spectra of SBSL. • The rate of mass exchange inside an SBSL bubble increases with increasing sound pressure. - Abstract: Spectra of single-bubble sonoluminescence (SBSL) were obtained for Tb{sup 3+} ions emission lines from bubbles in an aqueous solution of terbium chloride (TbCl{sub 3}). The spectra provide experimental evidence to prove that an air bubble driven by strong ultrasound will not eventually become a rectified pure argon bubble, which is not as predicted by the argon rectification hypothesis. The time-resolved spectra of SBSL show a mass exchange of material such as Tb{sup 3+} ions between the inside and outside of the bubble. With increasing sound pressure, the rate of mass exchange and the SBSL intensity increases.

Experimental Demyelination and Axonal Loss Are Reduced in MicroRNA-146a Deficient Mice.

Science.gov (United States)

Martin, Nellie A; Molnar, Viktor; Szilagyi, Gabor T; Elkjaer, Maria L; Nawrocki, Arkadiusz; Okarmus, Justyna; Wlodarczyk, Agnieszka; Thygesen, Eva K; Palkovits, Miklos; Gallyas, Ferenc; Larsen, Martin R; Lassmann, Hans; Benedikz, Eirikur; Owens, Trevor; Svenningsen, Asa F; Illes, Zsolt

2018-01-01

The cuprizone (CPZ) model of multiple sclerosis (MS) was used to identify microRNAs (miRNAs) related to in vivo de- and remyelination. We further investigated the role of miR-146a in miR-146a-deficient (KO) mice: this miRNA is differentially expressed in MS lesions and promotes differentiation of oligodendrocyte precursor cells (OPCs) during remyelination, but its role has not been examined during demyelination. MicroRNAs were examined by Agilent Mouse miRNA Microarray in the corpus callosum during CPZ-induced demyelination and remyelination. Demyelination, axonal loss, changes in number of oligodendrocytes, OPCs, and macrophages/microglia was compared by histology/immunohistochemistry between KO and WT mice. Differential expression of target genes and proteins of miR-146a was analyzed in the transcriptome (4 × 44K Agilent Whole Mouse Genome Microarray) and proteome (liquid chromatography tandem mass spectrometry) of CPZ-induced de- and remyelination in WT mice. Levels of proinflammatory molecules in the corpus callosum were compared in WT versus KO mice by Meso Scale Discovery multiplex protein analysis. miR-146a was increasingly upregulated during CPZ-induced de- and remyelination. The absence of miR-146a in KO mice protected against demyelination, axonal loss, body weight loss, and atrophy of thymus and spleen. The number of CNP + oligodendrocytes was increased during demyelination in the miR-146a KO mice, while there was a trend of increased number of NG2 + OPCs in the WT mice. miR-146a target genes, SNAP25 and SMAD4, were downregulated in the proteome of demyelinating corpus callosum in WT mice. Higher levels of SNAP25 were measured by ELISA in the corpus callosum of miR-146a KO mice, but there was no difference between KO and WT mice during demyelination. Multiplex protein analysis of the corpus callosum lysate revealed upregulated TNF-RI, TNF-RII, and CCL2 in the WT mice in contrast to KO mice. The number of Mac3 + and Iba1 + macrophages/microglia was

The effect of stem cell factor on proliferation of human endometrial CD146+ cells

Directory of Open Access Journals (Sweden)

Mehri Fayazi

2016-07-01

Full Text Available Background: Stem cell factor (SCF is a transcriptional factor which plays crucial roles in normal proliferation, differentiation and survival in a range of stem cells. Objective: The aim of the present study was to examine the proliferation effect of different concentrations of SCF on expansion of human endometrial CD146+ cells. Materials and Methods: In this experimental study, total populations of isolated human endometrial suspensions after fourth passage were isolated by magnetic activated cell sorting (MACS into CD146+ cells. Human endometrial CD146+ cells were karyotyped and tested for the effect of SCF on proliferation of CD146+ cells, then different concentrations of 0, 12.5, 25, 50 and 100 ng/ml was carried out and mitogens-stimulated endometrial CD146+ cells proliferation was assessed by MTT assay. Results: Chromosomal analysis showed a normal metaphase spread and 46XX karyotype. The proliferation rate of endometrial CD146P + P cells in the presence of 0, 12.5, 25, 50 and 100 ng/ml SCF were 0.945±0.094, 0.962±0.151, 0.988±0.028, 1.679±0.012 and 1.129±0.145 respectively. There was a significant increase in stem/ stromal cell proliferation following in vitro treatment by 50 ng/ml than other concentrations of SCF (p=0.01. Conclusion: The present study suggests that SCF could have effect on the proliferation and cell survival of human endometrial CD146P+P cells and it has important implications for medical sciences and cell therapies

High power single-frequency and frequency-doubled laser with active compensation for the thermal lens effect of terbium gallium garnet crystal.

Science.gov (United States)

Yin, Qiwei; Lu, Huadong; Su, Jing; Peng, Kunchi

2016-05-01

The thermal lens effect of terbium gallium garnet (TGG) crystal in a high power single-frequency laser severely limits the output power and the beam quality of the laser. By inserting a potassium dideuterium phosphate (DKDP) slice with negative thermo-optical coefficient into the laser resonator, the harmful influence of the thermal lens effect of the TGG crystal can be effectively mitigated. Using this method, the stable range of the laser is broadened, the bistability phenomenon of the laser during the process of changing the pump power is completely eliminated, the highest output power of an all-solid-state continuous-wave intracavity-frequency-doubling single-frequency laser at 532 nm is enhanced to 30.2 W, and the beam quality of the laser is significantly improved.

Effect of solvents on relation of intensities of bands of luminescence spectra of terbium and dysprosium ions in solutions of their complexes with acetoacetic ester

International Nuclear Information System (INIS)

Kononenko, L.I.; Bel'tyukova, S.V.; Meshkova, S.B.; Kravchenko, T.B.; Poluehktov, N.S.

1978-01-01

An investigation is made of the effect of different solvents on the ratio of the intensity of luminescence spectrum bands of terbium and dysprosium ions, corresponding and not corresponding to ''supersensitive'' transitions in complex compounds with acetoacetic ether. A dependence is established between these values and the dielectric constant of the solvent, and also parallels in their changes, which indicate the similar manifestation of the effect of solvents in both elements. A correlation is observed between ratios of the intensity of luminescence spectrum bands and values of forces of neodymium complex absorption band oscillators in different solvents

Synthesis and characterization of bright green terbium coordination complex derived from 1,4-bis(carbonylmethyl)terephthalate: Structure and luminescence properties

Science.gov (United States)

Ma, Mengjiao; Li, Congcong; Shu, Dengkun; Wang, Chaohua; Xi, Peng

2018-02-01

A photoluminescent terbium (Tb) complex involving a novel benzoic-acid compound with a unique coordinated structure, namely 1,4-bis(carbonylmethyl)terephthalate (BCMT), has been designed and synthesized. The new coordinate structure and energy-transfer mechanism between the ligand and Tb(III) ions were investigated in detail. The results demonstrated that the BCMT-Tb(III) complex shows strong fluorescence intensity (4 × 106 a.u.) and long fluorescence lifetime (1.302 ms), owing to the favorable degree of energy matching between the triplet excited level of the ligand and the resonant level of Tb(III) ions. Based on the analysis of three-dimensional luminescence spectra, the as-prepared Tb(III) complex can be effectively excited in the range of 250-310 nm, and it shows high color purity, with a bright green appearance.

Promotion of Hendra Virus Replication by MicroRNA 146a

Science.gov (United States)

Marsh, Glenn A.; Jenkins, Kristie A.; Gantier, Michael P.; Tizard, Mark L.; Middleton, Deborah; Lowenthal, John W.; Haining, Jessica; Izzard, Leonard; Gough, Tamara J.; Deffrasnes, Celine; Stambas, John; Robinson, Rachel; Heine, Hans G.; Pallister, Jackie A.; Foord, Adam J.; Bean, Andrew G.; Wang, Lin-Fa

2013-01-01

Hendra virus is a highly pathogenic zoonotic paramyxovirus in the genus Henipavirus. Thirty-nine outbreaks of Hendra virus have been reported since its initial identification in Queensland, Australia, resulting in seven human infections and four fatalities. Little is known about cellular host factors impacting Hendra virus replication. In this work, we demonstrate that Hendra virus makes use of a microRNA (miRNA) designated miR-146a, an NF-κB-responsive miRNA upregulated by several innate immune ligands, to favor its replication. miR-146a is elevated in the blood of ferrets and horses infected with Hendra virus and is upregulated by Hendra virus in human cells in vitro. Blocking miR-146a reduces Hendra virus replication in vitro, suggesting a role for this miRNA in Hendra virus replication. In silico analysis of miR-146a targets identified ring finger protein (RNF)11, a member of the A20 ubiquitin editing complex that negatively regulates NF-κB activity, as a novel component of Hendra virus replication. RNA interference-mediated silencing of RNF11 promotes Hendra virus replication in vitro, suggesting that increased NF-κB activity aids Hendra virus replication. Furthermore, overexpression of the IκB superrepressor inhibits Hendra virus replication. These studies are the first to demonstrate a host miRNA response to Hendra virus infection and suggest an important role for host miRNAs in Hendra virus disease. PMID:23345523

45 CFR 146.120 - Interaction with the Family and Medical Leave Act. [Reserved

Science.gov (United States)

2010-10-01

... 45 Public Welfare 1 2010-10-01 2010-10-01 false Interaction with the Family and Medical Leave Act. [Reserved] 146.120 Section 146.120 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES REQUIREMENTS... Interaction with the Family and Medical Leave Act. [Reserved] ...

BDNF VAL66MET Polymorphism Elevates the Risk of Bladder Cancer via MiRNA-146b in Micro-Vehicles

Directory of Open Access Journals (Sweden)

Cong Li

2018-01-01

Full Text Available Background/Aims: Emerging studies on brain-derived neurotrophic factor (BDNF have shown that might be novel biomarkers and therapeutic targets for cancer. We explore the role of BDNF in the tumorigenesis of bladder cancer and the underlying molecular mechanism. Methods: 368 patients with diagnosed bladder cancer and 352 healthy controls were enrolled to evaluate the association of BDNF and the miR-146b. Bioinformatics algorithm analysis and luciferase assay were performed to identify the target genes of miR-146b. Real-time PCR and western-blot were carried out to validate the relationship between miR-146b and CRK. MTT assay and FACS were used to evaluated the proliferation and apoptosis of cancer cells. MVs were isolated and transfect into the culture cells to confirm the above observation. Results: The clinical study shows that BDNF Met/Met was significantly associated with the risk of bladder cancer. In addition, comparing with Val/Val and Val/Met, Met/Met has lower miR-146b level. Luciferase assay shows that BDNF Val/Val is apparently enhanced miR-146b promoter-luciferase, but not BDNF Met/Met. Based on luciferase assay, CRK is a direct target gene of miR-146b. MiR-146b mimics significantly inhibited the expression of CRK and activation of AKT level. The expression of CRK and the activation of AKT (p-AKT were significantly inhibited by MV-BDNF Val/Val-miR-146b or MV-BDNF Val/Met-miR-146b, but not MV-BDNF Met/Met-miR-146b. MV-BDNF Val/Val-miR-146b or Val/Met-miR-146b obviously inhibited cell proliferation, which eliminated by CRK. Meanwhile, with MV-BDNF Met/Met-miR-146b or Met/Met-miR-146b+CRK did not affect the proliferation. MV-BDNF Val/Val-miR-146b or Val/Met-miR-146b enhanced cell apoptosis, which could be eliminated by CRK. Meanwhile, MV-BDNF Met/Met-miR-146b or Met/Met-miR-146b+CRK did not promote apoptosis. Conclusion: BDNF VAL66MET polymorphism is associated with miR-146b and its target gene CRK. MiR-146b and CRK mediated BDNF VAL66

TR146 cells grown on filters as a model of human buccal epithelium

DEFF Research Database (Denmark)

Mørck Nielsen, H; Rømer Rassing, M; Nielsen, Hanne Mørck

2000-01-01

cell culture model, and human and porcine buccal epithelium were compared. The esterase activity in the intact cell culture model and in the porcine buccal mucosa was compared. Further, the TR146 cell culture model was used to study the permeability rate and metabolism of leu-enkephalin. The activity...... of the three enzymes in the TR146 homogenate supernatants was in the same range as the activity in homogenate supernatants of human buccal epithelium. In the TR146 cell culture model, the activity of aminopeptidase (13.70+/-2.10 nmol/min per mg protein) was approx. four times the activity of carboxypeptidase...

Experimental Demyelination and Axonal Loss Are Reduced in MicroRNA-146a Deficient Mice

Directory of Open Access Journals (Sweden)

Nellie A. Martin

2018-03-01

Full Text Available BackgroundThe cuprizone (CPZ model of multiple sclerosis (MS was used to identify microRNAs (miRNAs related to in vivo de- and remyelination. We further investigated the role of miR-146a in miR-146a-deficient (KO mice: this miRNA is differentially expressed in MS lesions and promotes differentiation of oligodendrocyte precursor cells (OPCs during remyelination, but its role has not been examined during demyelination.MethodsMicroRNAs were examined by Agilent Mouse miRNA Microarray in the corpus callosum during CPZ-induced demyelination and remyelination. Demyelination, axonal loss, changes in number of oligodendrocytes, OPCs, and macrophages/microglia was compared by histology/immunohistochemistry between KO and WT mice. Differential expression of target genes and proteins of miR-146a was analyzed in the transcriptome (4 × 44K Agilent Whole Mouse Genome Microarray and proteome (liquid chromatography tandem mass spectrometry of CPZ-induced de- and remyelination in WT mice. Levels of proinflammatory molecules in the corpus callosum were compared in WT versus KO mice by Meso Scale Discovery multiplex protein analysis.ResultsmiR-146a was increasingly upregulated during CPZ-induced de- and remyelination. The absence of miR-146a in KO mice protected against demyelination, axonal loss, body weight loss, and atrophy of thymus and spleen. The number of CNP+ oligodendrocytes was increased during demyelination in the miR-146a KO mice, while there was a trend of increased number of NG2+ OPCs in the WT mice. miR-146a target genes, SNAP25 and SMAD4, were downregulated in the proteome of demyelinating corpus callosum in WT mice. Higher levels of SNAP25 were measured by ELISA in the corpus callosum of miR-146a KO mice, but there was no difference between KO and WT mice during demyelination. Multiplex protein analysis of the corpus callosum lysate revealed upregulated TNF-RI, TNF-RII, and CCL2 in the WT mice in contrast to KO mice. The number of Mac3+ and

TR146 cells grown on filters as a model of human buccal epithelium

DEFF Research Database (Denmark)

Nielsen, H M; Rassing, M R; Nielsen, Hanne Mørck

2000-01-01

The objective of the present study was to evaluate the TR146 cell culture model as an in vitro model of human buccal epithelium. For this purpose, the permeability of water, mannitol and testosterone across the TR146 cell culture model was compared to the permeability across human, monkey...

Commercializing potassium terbium fluoride, KTF (KTb3F10) faraday crystals for high laser power optical isolator applications

Science.gov (United States)

Schlichting, Wolfgang; Stevens, Kevin; Foundos, Greg; Payne, Alexis

2017-10-01

Many scientific lasers and increasingly industrial laser systems operate in manufacture. However, for high-power laser applications TGG is limited by its absorption at 1064nm and its thermo-optic coefficient, dn/dT. Specifically, thermal lensing and depolarization effects become a limiting factor at high laser powers. While TGG absorption has improved significantly over the past few years, there is an intrinsic limit. Now, SYNOPTICS is commercializing the enhanced new crystal Potassium Terbium Fluoride KTF (KTb3F10) that exhibits much smaller nonlinear refractive index and thermo-optic coefficients, and still exhibits a Verdet constant near that of TGG. This cubic crystal has relatively low absorption and thermo-optic coefficients. It is now fully characterized and available for select production orders. At OPTIFAB in October 2017 we present recent results comparing the performance of KTF to TGG in optical isolators and show SYNOPTICS advances in large volume crystal growth and the production ramp up.

miR-146a modulates autoreactive Th17 cell differentiation and regulates organ-specific autoimmunity.

Science.gov (United States)

Li, Bo; Wang, Xi; Choi, In Young; Wang, Yu-Chen; Liu, Siyuan; Pham, Alexander T; Moon, Heesung; Smith, Drake J; Rao, Dinesh S; Boldin, Mark P; Yang, Lili

2017-10-02

Autoreactive CD4 T cells that differentiate into pathogenic Th17 cells can trigger autoimmune diseases. Therefore, investigating the regulatory network that modulates Th17 differentiation may yield important therapeutic insights. miR-146a has emerged as a critical modulator of immune reactions, but its role in regulating autoreactive Th17 cells and organ-specific autoimmunity remains largely unknown. Here, we have reported that miR-146a-deficient mice developed more severe experimental autoimmune encephalomyelitis (EAE), an animal model of human multiple sclerosis (MS). We bred miR-146a-deficient mice with 2D2 T cell receptor-Tg mice to generate 2D2 CD4 T cells that are deficient in miR-146a and specific for myelin oligodendrocyte glycoprotein (MOG), an autoantigen in the EAE model. miR-146a-deficient 2D2 T cells induced more severe EAE and were more prone to differentiate into Th17 cells. Microarray analysis revealed enhancements in IL-6- and IL-21-induced Th17 differentiation pathways in these T cells. Further study showed that miR-146a inhibited the production of autocrine IL-6 and IL-21 in 2D2 T cells, which in turn reduced their Th17 differentiation. Thus, our study identifies miR-146a as an important molecular brake that blocks the autocrine IL-6- and IL-21-induced Th17 differentiation pathways in autoreactive CD4 T cells, highlighting its potential as a therapeutic target for treating autoimmune diseases.

Expression of miR-146a-5p in patients with intracranial aneurysms and its association with prognosis.

Science.gov (United States)

Zhang, H-L; Li, L; Cheng, C-J; Sun, X-C

2018-02-01

The study aims to detect the association of miR-146a-5p with intracranial aneurysms (IAs). The expression of miR-146a-5p was compared from plasma samples between 72 patients with intracranial aneurysms (IAs) and 40 healthy volunteers by quantitative Real-time polymerase chain reaction (qRT-PCR). Statistical analysis was performed to analyze the relationship between miR-146a-5p expression and clinical data and overall survival (OS) time of IAs patients. Univariate and multivariate Cox proportional hazards have also been performed. Notably, higher miR-146a-5p expression was found in plasma samples from 72 patients with intracranial aneurysms (IAs) compared with 40 healthy controls. Higher miR-146a-5p expression was significantly associated with rupture and Hunt-Hess level in IAs patients. Kaplan-Meier survival analysis verified that higher miR-146a-5p expression predicted a shorter overall survival (OS) compared with lower miR-146a-5p expression in IAs patients. Univariate and multivariate Cox proportional hazards demonstrated that higher miR-146a-5p expression, rupture, and Hunt-Hess were independent risk factors of OS in patients with intracranial aneurysms (IAs). MiR-146a-5p expression may serve as a biomarker for predicting prognosis in patients with IAs.

MicroRNA-146a and AMD3100, two ways to control CXCR4 expression in acute myeloid leukemias

Energy Technology Data Exchange (ETDEWEB)

Spinello, I; Quaranta, M T; Riccioni, R; Riti, V; Pasquini, L; Boe, A; Pelosi, E [Department of Hematology, Oncology and Molecular Medicine, Istituto Superiore di Sanità, Rome (Italy); Vitale, A; Foà, R [Department of Cellular Biotechnologies and Hematology, Division of Hematology, ‘Sapienza' University, Rome (Italy); Testa, U; Labbaye, C [Department of Hematology, Oncology and Molecular Medicine, Istituto Superiore di Sanità, Rome (Italy)

2011-06-01

CXCR4 is a negative prognostic marker in acute myeloid leukemias (AMLs). Therefore, it is necessary to develop novel ways to inhibit CXCR4 expression in leukemia. AMD3100 is an inhibitor of CXCR4 currently used to mobilize cancer cells. CXCR4 is a target of microRNA (miR)-146a that may represent a new tool to inhibit CXCR4 expression. We then investigated CXCR4 regulation by miR-146a in primary AMLs and found an inverse correlation between miR-146a and CXCR4 protein expression levels in all AML subtypes. As the lowest miR-146a expression levels were observed in M5 AML, we analyzed the control of CXCR4 expression by miR-146a in normal and leukemic monocytic cells and showed that the regulatory miR-146a/CXCR4 pathway operates during monocytopoiesis, but is deregulated in AMLs. AMD3100 treatment and miR-146a overexpression were used to inhibit CXCR4 in leukemic cells. AMD3100 treatment induces the decrease of CXCR4 protein expression, associated with miR-146a increase, and increases sensitivity of leukemic blast cells to cytotoxic drugs, this effect being further enhanced by miR-146a overexpression. Altogether our data indicate that miR-146a and AMD3100, acting through different mechanism, downmodulate CXCR4 protein levels, impair leukemic cell proliferation and then may be used in combination with anti-leukemia drugs, for development of new therapeutic strategies.

MicroRNA-146a and AMD3100, two ways to control CXCR4 expression in acute myeloid leukemias

International Nuclear Information System (INIS)

Spinello, I; Quaranta, M T; Riccioni, R; Riti, V; Pasquini, L; Boe, A; Pelosi, E; Vitale, A; Foà, R; Testa, U; Labbaye, C

2011-01-01

CXCR4 is a negative prognostic marker in acute myeloid leukemias (AMLs). Therefore, it is necessary to develop novel ways to inhibit CXCR4 expression in leukemia. AMD3100 is an inhibitor of CXCR4 currently used to mobilize cancer cells. CXCR4 is a target of microRNA (miR)-146a that may represent a new tool to inhibit CXCR4 expression. We then investigated CXCR4 regulation by miR-146a in primary AMLs and found an inverse correlation between miR-146a and CXCR4 protein expression levels in all AML subtypes. As the lowest miR-146a expression levels were observed in M5 AML, we analyzed the control of CXCR4 expression by miR-146a in normal and leukemic monocytic cells and showed that the regulatory miR-146a/CXCR4 pathway operates during monocytopoiesis, but is deregulated in AMLs. AMD3100 treatment and miR-146a overexpression were used to inhibit CXCR4 in leukemic cells. AMD3100 treatment induces the decrease of CXCR4 protein expression, associated with miR-146a increase, and increases sensitivity of leukemic blast cells to cytotoxic drugs, this effect being further enhanced by miR-146a overexpression. Altogether our data indicate that miR-146a and AMD3100, acting through different mechanism, downmodulate CXCR4 protein levels, impair leukemic cell proliferation and then may be used in combination with anti-leukemia drugs, for development of new therapeutic strategies

Dioxin induces expression of hsa-miR-146b-5p in human neuroblastoma cells.

Science.gov (United States)

Xu, Tuan; Xie, Heidi Q; Li, Yunping; Xia, Yingjie; Sha, Rui; Wang, Lingyun; Chen, Yangsheng; Xu, Li; Zhao, Bin

2018-01-01

Dioxin can cause a series of neural toxicological effects. MicroRNAs (miRs) play important roles in regulating nervous system function and mediating cellular responses to environmental pollutants, such as dioxin. Hsa-miR-146b-5p appears to be involved in neurodegenerative diseases and brain tumors. However, little is known about effects of dioxin on the expression of hsa-miR-146b-5p. We found that the hsa-miR-146b-5p expression and its promoter activity were significantly increased in dioxin treated SK-N-SH cells, a human-derived neuroblastoma cell line. Potential roles of hsa-miR-146b-5p in mediating neural toxicological effects of dioxin may be due to the regulation of certain target genes. We further confirmed that hsa-miR-146b-5p significantly suppressed acetylcholinesterase (AChE) activity and targeted the 3'-untranslated region of the AChE T subunit, which has been down-regulated in dioxin treated SK-N-SH cells. Functional bioinformatic analysis showed that the known and predicted target genes of hsa-miR-146b-5p were involved in some brain functions or cyto-toxicities related to known dioxin effects, including synapse transmission, in which AChE may serve as a responsive gene for mediating the effect. Copyright © 2017. Published by Elsevier B.V.

22 CFR 146.445 - Marital or parental status.

Science.gov (United States)

2010-04-01

... EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 146.445 Marital or parental status. (a) Status..., or marital status that treats students differently on the basis of sex. (b) Pregnancy and related...

Association of MicroRNA-146a rs2910164 Gene Polymorphism with Metabolic Syndrome.

Science.gov (United States)

Mehanna, E T; Ghattas, M H; Mesbah, N M; Saleh, S M; Abo-Elmatty, D M

2015-01-01

Alteration in microRNA-146a (miRNA-146a) expression is an important event in the pathogenesis of many human diseases. MiRNA-146a rs2910164 is a functional polymorphism that showed association with several diseases. Metabolic syndrome is an aggregation of multiple risk factors including impaired glucose tolerance, increased highdensity lipoprotein, abdominal obesity, and high blood pressure. The aim of this study was to assess the relation of miRNA-146a rs2910164 with metabolic syndrome and its component traits in Egyptian women from the Suez Canal area. The study included 100 healthy female subjects and 100 metabolic syndrome patients. The component traits of metabolic syndrome were determined and the genotypes of the polymorphisms were assessed using the polymerase chain reaction-restriction fragment length polymorphism technique using the restriction enzyme Hpy188I. The rare C allele had a significantly higher frequency in metabolic syndrome patients (P = 0.013). The heterozygote GC and the rare CC genotypes showed a significant increase in body mass index, waist circumference, triglycerides, total cholesterol, low-density lipoprotein, systolic and diastolic blood pressure. The GC genotype was associated with higher fasting blood glucose, fasting serum insulin and insulin resistance. The carriers of CC genotype had significantly lower HDL compared with the GG genotype carriers. In conclusion, The C allele of miRNA-146a rs2910164 showed positive association with increased susceptibility to metabolic syndrome and its phenotypes in the study population.

MiR-146a modulates macrophage polarization by inhibiting Notch1 pathway in RAW264.7 macrophages.

Science.gov (United States)

Huang, Cheng; Liu, Xue-Jiao; QunZhou; Xie, Juan; Ma, Tao-Tao; Meng, Xiao-Ming; Li, Jun

2016-03-01

Macrophages are heterogeneous and plastic cells which are able to undergo dynamic transition between M1 and M2 polarized phenotypes in response to the microenvironment signals. However, the underlying molecular mechanisms of macrophage polarization are still obscure. In the current study, it was revealed that miR-146a might play a pivotal role in macrophage polarization. As our results indicated, miR-146a was highly expressed in M2 macrophages rather than M1 macrophages. Over-expression of miR-146a resulted in significantly decreased production of pro-inflammatory cytokines including iNOS and TNF-α in M1 macrophages, while increased production of M2 marker genes such as Arg1 and CD206 in M2 macrophages. In contrast, knockdown of miR-146a promoted M1 macrophage polarization but diminished M2 macrophage polarization. Mechanistically, it was revealed that miR-146a modulated macrophage polarization by targeting Notch1. Of note, PPARγ was responsible as another target for miR-146a-mediated macrophage polarization. Taken together, it was suggested that miR-146a might serve as a molecular regulator in macrophage polarization and is a potential therapeutic target for inflammatory diseases. Copyright © 2016 Elsevier B.V. All rights reserved.

22 CFR 146.520 - Job classification and structure.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Job classification and structure. 146.520... IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the... and structure. A recipient shall not: (a) Classify a job as being for males or for females; (b...

40 CFR 146.4 - Criteria for exempted aquifers.

Science.gov (United States)

2010-07-01

... (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM: CRITERIA AND STANDARDS General Provisions § 146.4 Criteria... of a permit application for a Class II or III operation to contain minerals or hydrocarbons that... public water system. (Clean Water Act, Safe Drinking Water Act, Clean Air Act, Resource Conservation and...

Molecular Orientation of a Terbium(III)-Phthalocyaninato Double-Decker Complex for Effective Suppression of Quantum Tunneling of the Magnetization.

Science.gov (United States)

Yamabayashi, Tsutomu; Katoh, Keiichi; Breedlove, Brian K; Yamashita, Masahiro

2017-06-15

Single-molecule magnet (SMM) properties of crystals of a terbium(III)-phthalocyaninato double-decker complex with different molecular packings ( 1 : TbPc₂, 2 : TbPc₂·CH₂Cl₂) were studied to elucidate the relationship between the molecular packing and SMM properties. From single crystal X-ray analyses, the high symmetry of the coordination environment of 2 suggested that the SMM properties were improved. Furthermore, the shorter intermolecular Tb-Tb distance and relative collinear alignment of the magnetic dipole in 2 indicated that the magnetic dipole-dipole interactions were stronger than those in 1 . This was confirmed by using direct current magnetic measurements. From alternating current magnetic measurements, the activation energy for spin reversal for 1 and 2 were similar. However, the relaxation time for 2 is three orders of magnitude slower than that for 1 in the low- T region due to effective suppression of the quantum tunneling of the magnetization. These results suggest that the SMM properties of TbPc₂ highly depend on the molecular packing.

CD146 expression on primary nonhematopoietic bone marrow stem cells is correlated with in situ localization

Science.gov (United States)

Tormin, Ariane; Li, Ou; Brune, Jan Claas; Walsh, Stuart; Schütz, Birgit; Ehinger, Mats; Ditzel, Nicholas; Kassem, Moustapha

2011-01-01

Nonhematopoietic bone marrow mesenchymal stem cells (BM-MSCs) are of central importance for bone marrow stroma and the hematopoietic environment. However, the exact phenotype and anatomical distribution of specified MSC populations in the marrow are unknown. We characterized the phenotype of primary human BM-MSCs and found that all assayable colony-forming units-fibroblast (CFU-Fs) were highly and exclusively enriched not only in the lin−/CD271+/CD45−/CD146+ stem-cell fraction, but also in lin−/CD271+/CD45−/CD146−/low cells. Both populations, regardless of CD146 expression, shared a similar phenotype and genotype, gave rise to typical cultured stromal cells, and formed bone and hematopoietic stroma in vivo. Interestingly, CD146 was up-regulated in normoxia and down-regulated in hypoxia. This was correlated with in situ localization differences, with CD146 coexpressing reticular cells located in perivascular regions, whereas bone-lining MSCs expressed CD271 alone. In both regions, CD34+ hematopoietic stem/progenitor cells were located in close proximity to MSCs. These novel findings show that the expression of CD146 differentiates between perivascular versus endosteal localization of non-hematopoietic BM-MSC populations, which may be useful for the study of the hematopoietic environment. PMID:21415267

Portland cement induces human periodontal ligament cells to differentiate by upregulating miR-146a

Directory of Open Access Journals (Sweden)

Min-Ching Wang

2018-04-01

Full Text Available Background/Purpose: Bioaggregates such as Portland cement (PC can be an economical alternative for mineral trioxide aggregate (MTA with additional benefit of less discoloration. MTA has been known to induce differentiations of several dental cells. MicroRNAs are important regulators of biological processes, including differentiation, physiologic homeostasis, and disease progression. This study is to explore how PC enhances the differentiation of periodontal ligament (PDL cells in microRNAs level. Methods: PDL cells were cultured in a regular PC- or MTA-conditioned medium or an osteoinduction medium (OIM. Alizarin red staining was used to evaluate the extent of mineralization. Transfection of microRNA mimics induced exogenous miR-31 and miR-146a expression. The expression of microRNAs and differentiation markers was assayed using reverse-transcriptase polymerase chain reaction. Results: PC enhanced the mineralization of PDL cells in a dose-dependent manner in the OIM. Exogenous miR-31 and miR-146a expression upregulated alkaline phosphatase (ALP, bone morphogenic protein (BMP, and dentin matrix protein 1 (DMP1 expression. However, miR-31 and miR-146a modulates cementum protein 1 (CEMP1 expression in different ways. PC also enhanced ALP and BMP but attenuated CEMP1 in the OIM. Although the OIM or PC treatment upregulated miR-21, miR-29b, and miR-146a, only miR-146a was able to be induced by PC in combination with OIM. Conclusion: This study demonstrated that PC enhances the differentiation of PDL cells, especially osteogenic through miR-146a upregulation. In order to control the ankylosis after regenerative endodontics with the usage of bioaggregates, further investigations to explore these differentiation mechanisms in the miRNA level may be needed. Keywords: Portland cement, Bioaggregate, miR-146a, Osteogenic differentiation, Periodontal ligament (PDL

A single nucleotide polymorphism in primary-microRNA-146a reduces the expression of mature microRNA-146a in patients with Alzheimer's disease and is associated with the pathogenesis of Alzheimer's disease.

Science.gov (United States)

Zhang, Bin; Wang, Aihong; Xia, Cuiping; Lin, Qunfeng; Chen, Chunfu

2015-09-01

Alzheimer's disease (AD) is a progressive neurodegenerative disorder and is the most common form of dementia among the aging population. Although the incidence of the disease continues to increase, no cure has been developed. Effective treatment is restricted not only due to the lack of curative medicine, but also due to limited understanding of the underlying mechanisms and the difficulties in accurately diagnosing AD in its earliest stages prior to clinical symptoms. Micro (mi) RNAs (miR) have gained increasing attention in the investigation of neurodegenerative diseases. Previous reports have demonstrated that deregulation of miR‑146a‑5p is associated with the pathogenesis of human AD. In the present study, the coding region of primary (pri)‑miR‑146a in patients with AD was scanned and the rare C allele of rs2910164 was found to be associated with AD. Using reverse transcription quantitative polymerase chain reaction, it was demonstrated that site variation reduced the expression of mature miR‑146a‑5p. Notably, a reduction in the expression of miR‑146a‑5p led to less efficient inhibition of target genes, including Toll‑like receptor (TLR)2, which is important in the pathogenesis of AD. Biological function investigations in RAW264.7 cells indicated that, compared with the G allele, the rare C allele upregulated the expression of tumor necrosis factor‑α following stimulation with β‑amyloid. These findings suggested that one common polymorphism in pri‑miR‑146a may contribute to the genetic predisposition to AD by disrupting the production of miR‑146a‑5p and affecting the expression and function of TLR2.

miR-146a Suppresses Invasion of Pancreatic Cancer Cells

Science.gov (United States)

Li, Yiwei; VandenBoom, Timothy G.; Wang, Zhiwei; Kong, Dejuan; Ali, Shadan; Philip, Philip A.; Sarkar, Fazlul H.

2010-01-01

The aggressive course of pancreatic cancer is believed to reflect its unusually invasive and metastatic nature, which is associated with epidermal growth factor receptor (EGFR) overexpression and NF-κB activation. MicroRNAs (miRNA) have been implicated in the regulation of various pathobiological processes in cancer, including metastasis in pancreatic cancer and in other human malignancies. In this study, we report lower expression of miR-146a in pancreatic cancer cells compared with normal human pancreatic duct epithelial cells. Reexpression of miR-146a inhibited the invasive capacity of pancreatic cancer cells with concomitant downregulation of EGFR and the NF-κB regulatory kinase interleukin 1 receptor–associated kinase 1 (IRAK-1). Cellular mechanism studies revealed crosstalk between EGFR, IRAK-1, IκBα, NF-κB, and MTA-2, a transcription factor that regulates metastasis. Treatment of pancreatic cancer cells with the natural products 3,3′-diinodolylmethane (DIM) or isoflavone, which increased miR-146a expression, caused a downregulation of EGFR, MTA-2, IRAK-1, and NF-κB, resulting in an inhibition of pancreatic cancer cell invasion. Our findings reveal DIM and isoflavone as nontoxic activators of a miRNA that can block pancreatic cancer cell invasion and metastasis, offering starting points to design novel anticancer agents. PMID:20124483

146----10 Dec indd [ FINAL VERSION].indd

African Journals Online (AJOL)

23 Sep 2009 ... e o lo g ic a l S tu d ie s http://www.hts.org.za. HTS. Original Research. A ... phronēsis and Paul Ricoeur's movement from mimēsis1 ... It is not only pastors' knowledge of the Bible, theological tradition and ...... way that we are led into the truth and life (John 14:6). ..... human brain, Harper Collins, New York.

miR-146a negatively regulates the induction of proinflammatory cytokines in response to Japanese encephalitis virus infection in microglial cells.

Science.gov (United States)

Deng, Minnan; Du, Ganqin; Zhao, Jiegang; Du, Xiaowei

2017-06-01

Increasing evidence confirms the involvement of virus infection and miRNA, such as miR-146a, in neuroinflammation-associated epilepsy. In the present study, we investigated the upregulation of miR-146a with RT-qPCR and in situ hybridization methods in a mice infection model of Japanese encephalitis virus (JEV) and in vitro. Subsequently we investigated the involvement of miR-146a in modulating JEV-induced neuroinflammation. It was demonstrated that JEV infection promoted miR-146a production in BALB/c mice brain and in cultured mouse microglial C8-B4 cells, along with pro-inflammatory cytokines, such as IL-1β, IL-6, TNF-α, IFN-β and IFN-α. We also found that miR-146a exerted negative regulatory effects upon IL-1β, IL-6, TNF-α, IFN-β and IFN-α in C8-B4 cells. Accordingly, miR-146a downregulation with a miR-146a inhibitor promoted the upregulation of IL-1β, IL-6, TNF-α, IFN-β and IFN-α, whereas miR-146a upregulation with miR-146a mimics reduced the upregulation of these cytokines. Moreover, miR-146a exerted no regulation upon JEV growth in C8-B4 cells. In conclusion, JEV infection upregulated miR-146a and pro-inflammatory cytokine production, in mice brain and in cultured C8-B4 cells. Furthermore, miR-146a negatively regulated the production of JEV-induced pro-inflammatory cytokines, in virus growth independent fashion, identifying miR-146a as a negative feedback regulator in JEV-induced neuroinflammation, and possibly in epilepsy.

MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer

Science.gov (United States)

2015-09-01

determined whether miR-146a inhibitor promotes CRPC phenotype by upregulating SIAH2 in LNCaP and MDAPCa2b cells. First we determined the effect of DHT (5α...dihydrotestosterone) on proliferation of these cells grown in the presence of charcoal stripped calf serum. The results indicated that DHT increased...proliferation of both parental LNCaP and MDAPCa2b cells but DHT did not increase proliferation of miR-146a inhibitor expressing cell lines (Fig. 6

Experimental demyelination and axonal loss are reduced in MicroRNA-146a deficient mice

DEFF Research Database (Denmark)

Martin, Nellie A.; Molnar, Viktor; Szilagyi, Gabor T.

2018-01-01

Background: The cuprizone (CPZ) model of multiple sclerosis (MS) was used to identify microRNAs (miRNAs) related to in vivo de- and remyelination. We further investigated the role of miR-146a in miR-146a-deficient (KO) mice: this miRNA is differentially expressed in MS lesions and promotes differ...

Studies of binary cerium(IV)-praseodymium(IV) and cerium(IV)-terbium(IV) oxides as pigments for ceramic applications

International Nuclear Information System (INIS)

Furtado, L.M.L.

1991-01-01

It was investigated a series of pigments of general composition Ce 1-x Pr x O 2 , and Ce x Tb y O 2 , exhibiting radish and brown colors, respectively, and high temperature stability. The pigments were obtained by dissolving appropriate amounts of the pure lanthanide oxides in acids and precipitating the rare earths as mixed oxalates, which were isolated and calcined under air, at 1000 0 C. X-Ray powder diffractograms were consistent with a cubic structure for the pigments. Magnetic susceptibility measurements, using Gouy method, indicated the presence of Pr(IV) ions in the Ce 1-x Pr x O 2 pigments and of Terbium predominantly as Tb(III) ions in the Ce-tb mixed oxides. A new method, based on suspension of solid samples in PVA-STB gels (STB = sodium tetradecaborate), was employed for the measurements of the electronic spectra of the pigments. The thermal behaviour the pigments was investigated by the calcination of the oxalates in the temperature range of 500 to 1200 O C, from 10 to 60 minutes. (author)

The E3 ubiquitin ligase RNF146 promotes colorectal cancer by activating the Wnt/β-catenin pathway via ubiquitination of Axin1.

Science.gov (United States)

Shen, Jiangli; Yu, Zhaohui; Li, Na

2018-06-20

The E3 ubiquitin ligase ring finger protein 146 (RNF146) has been implicated in tumor development. However, the role and clinical significance of RNF146 in colorectal cancer (CRC) remain unknown. In this study, we reported for the first time that RNF146 was upregulated in CRC tissues as well as in cell lines. Further, RNF146 expression was independent prognostic factor for poor outcome of CRC patients. RNF146 knockdown in cell lines inhibited cell growth, promoted cell apoptosis in vitro and suppressed colorectal tumor growth in vivo. Mechanistic investigations revealed that RNF146 exerted oncogenic role through ubiquitination of Axin1 to activate β-catenin signalling. In addition, RNF146 expression was positively correlated with β-catenin expression in CRC tissues. Collectively, our data suggest that RNF146 might function as a oncogene in human CRC, and represent a promising prognostic factor and a valuable therapeutic target for CRC. Copyright © 2018. Published by Elsevier Inc.

Targeted delivery of microRNA 146b mimic to hepatocytes by lactosylated PDMAEMA nanoparticles for the treatment of NAFLD.

Science.gov (United States)

He, Shuying; Guo, Weihong; Deng, Feihong; Chen, Kequan; Jiang, Yonghong; Dong, Minyu; Peng, Liang; Chen, Xueqing

2018-03-21

Non-alcoholic fatty liver disease (NAFLD) is one of the most common chronic liver diseases worldwide, and precision therapeutic will be a benefit for the NAFLD regression. In this study, we observed low microRNA 146 b (miR-146 b) expression in NAFLD mice model induced by methionine-choline-deficient diet (MCD) compared with control group. Furthermore, miR-146b -/- mice induced MCD exhibited severe liver steatosis and hepatitis. A bio-distribution study showed that novel Lactosylated PDMAEMA nanoparticles effectively targeted hepatocytes Lac-PDMAEMA. We coupled miR-146b mimic with Lac-PDMAEMA and then were administrated to NAFLD mice model, which could obviously alleviate the hepatic steatosis. Lac-PDMAEMA effectively delivered miR-146b mimic to hepatocytes with a ∼8-fold upregulation of miR-146b mimic targeting MyD88 and IRAK1, and in turn suppressed the expression of PPARγ. Meanwhile, TNF-α and IL-6 mRNA levels were decreased after administration of Lac-PDMAEMA/miR-146b mimic. So, we made a conclusion that targeted delivering miR-146b mimic to the hepatocytes by, coupling Lac-PDMAEMA nanoparticles could effectively alleviate the hepatic steatosis in NAFLD mice, which maybe bring a new and effective way to intervene and therapy the NAFLD.

Inhibition of miR-146b expression increases radioiodine-sensitivity in poorly differential thyroid carcinoma via positively regulating NIS expression

Energy Technology Data Exchange (ETDEWEB)

Li, Luchuan; Lv, Bin; Chen, Bo [Department of General Surgery, Shandong University Qilu Hospital, Jinan, Shandong 250012 (China); Guan, Ming [Department of General Surgery, Qihe People' s Hospital, Qihe, Shandong 251100 (China); Sun, Yongfeng [Department of General Surgery, Licheng District People' s Hospital, Jinan, Shandong 250115 (China); Li, Haipeng [Department of General Surgery, Caoxian People' s Hospital, Caoxian, Shandong 274400 (China); Zhang, Binbin; Ding, Changyuan; He, Shan [Department of General Surgery, Shandong University Qilu Hospital, Jinan, Shandong 250012 (China); Zeng, Qingdong, E-mail: qingdz0201@163.com [Department of General Surgery, Shandong University Qilu Hospital, Jinan, Shandong 250012 (China)

2015-07-10

Dedifferentiated thyroid carcinoma (DTC) with the loss of radioiodine uptake (RAIU) is often observed in clinical practice under radioiodine therapy, indicating the challenge for poor prognosis. MicroRNA (miRNA) has emerged as a promising therapeutic target in many diseases; yet, the role of miRNAs in RAIU has not been generally investigated. Based on recent studies about miRNA expression in papillary or follicular thyroid carcinomas, the expression profiles of several thyroid relative miRNAs were investigated in one DTC cell line, derived from normal DTC cells by radioiodine treatment. The top candidate miR-146b, with the most significant overexpression profiles in dedifferentiated cells, was picked up. Further research found that miR-146b could be negatively regulated by histone deacetylase 3 (HDAC3) in normal cells, indicating the correlation between miR-146b and Na{sup +}/I{sup −} symporter (NIS)-mediated RAIU. Fortunately, it was confirmed that miR-146b could regulate NIS expression/activity; what is more important, miR-146b interference would contribute to the recovery of radioiodine-sensitivity in dedifferentiated cells via positively regulating NIS. In the present study, it was concluded that NIS-mediated RAIU could be modulated by miR-146b; accordingly, miR-146b might serve as one of targets to enhance efficacy of radioactive therapy against poorly differential thyroid carcinoma (PDTC). - Highlights: • Significant upregulated miR-146b was picked up from thyroid relative miRNAs in DTC. • MiR-146b was negatively regulated by HDAC3 in normal thyroid carcinoma cells. • NIS activity and expression could be regulated by miR-146b in thyroid carcinoma. • MiR-146b inhibition could recover the decreased radioiodine-sensitivity of DTC cells.

Study of nano - second isomers near 146Gd

International Nuclear Information System (INIS)

Pramanik, Dibyadyuti; Sarkar, S.; Bisoi, Abhijit; Ray, Sudatta; Ray, I.; Pradhan, M.K.; Goswami, A.; Banerjee, P.; Mukherjee, A.; Bhattacharya, S.; Saha Sarkar, M.; Chakraborty, A.; Dey, Gautam; Krishichayan; Kshetri, R.; Ganguly, S.; Raut, R.; Ray Basu, M.; Ganguly, G.; Ghugre, S.S.; Sinha, A.K.; Basu, S.K.

2010-01-01

The nuclei near 146 Gd show rich variety in their excitation spectra. Spectra exhibiting characteristics of extreme single particle, multi-particle-hole excitation, magnetic bands to strong collectivity manifested through superdeformation, and triaxial superdeformation have been widely studied. In the present work, a few isomers in the mass ≅150 region using the RF - gamma coincidence data are studied

Evaluation of σ-1 receptor radioligand 18F-FTC-146 in rats and squirrel monkeys using PET

DEFF Research Database (Denmark)

James, Michelle L; Shen, Bin; Nielsen, Carsten Haagen

2014-01-01

. Pretreatment with known S1R compounds, haloperidol, or BD1047, before radioligand administration, significantly attenuated (18)F-FTC-146 accumulation in all rat brain regions by approximately 85% (P ...-FTC-146 was observed in rat plasma. Preliminary monkey PET/MRI studies demonstrated specific accumulation of (18)F-FTC-146 in the brain (mainly in cortical structures, cerebellum, and vermis) that could be attenuated by pretreatment with haloperidol. HPLC of monkey plasma suggested radioligand metabolism...

Bio-functionalized dense-silica nanoparticles for MR/NIRF imaging of CD146 in gastric cancer

Directory of Open Access Journals (Sweden)

Wang P

2015-01-01

Full Text Available Pu Wang,1,* Yazhuo Qu,2,* Chuan Li,3 Li Yin,2 Caifei Shen,1 Wei Chen,3 Shiming Yang,4 Xiuwu Bian,2 Dianchun Fang11Institute of Gastroenterology, 2Institute of Pathology, 3Department of Radiology, Southwest Hospital, The Third Military Medical University, Chongqing, People’s Republic of China; 4Department of Gastroenterology, Xinqiao Hospital, The Third Military Medical University, Chongqing, People’s Republic of China*These authors contributed equally to this workPurpose: Nano dense-silica (dSiO2 has many advantages such as adjustable core–shell structure, multiple drug delivery, and controllable release behavior. Improving the gastric tumor-specific targeting efficiency based on the development of various strategies is crucial for anti-cancer drug delivery systems.Methods: Superparamagnetic iron oxide nanoparticles (SPION were coated with dSiO2 as core–shell nanoparticles, and labeled with near infra-red fluorescence (NIRF dye 800ZW (excitation wavelength: 778 nm/­emission wavelength: 806 nm and anti-CD146 monoclonal antibody YY146 for magnetic resonance (MR/NIRF imaging study in xenograft gastric cancer model. The morphology and the size of pre- and postlabeling SPION@dSiO2 core–shell nanoparticles were characterized using transmission electron microscopy. Iron content in SPION@dSiO2 nanoparticles was measured by inductively coupled plasma optical emission spectrometry. Fluorescence microscopy and fluorescence-activated cell sorter studies were carried out to confirm the binding specificity of YY146 and 800ZW–SPION@dSiO2–YY146 on MKN45 cells. In vivo and in vitro NIRF imaging, control (nanoparticles only and blocking studies, and histology were executed on MKN45 tumor-bearing nude mice to estimate the affinity of 800ZW–SPION@dSiO2–YY146 to target tumor CD146.Results: 800ZW–SPION@dSiO2–YY146 nanoparticles were uniformly spherical in shape and dispersed evenly in a cell culture medium. The diameter of the nanoparticle

31 CFR 363.146 - May a certificate of indebtedness be pledged or used as collateral?

Science.gov (United States)

2010-07-01

... pledged or used as collateral? 363.146 Section 363.146 Money and Finance: Treasury Regulations Relating to... certificate of indebtedness be pledged or used as collateral? A certificate of indebtedness may not be pledged or used as collateral for the performance of an obligation. [69 FR 50309, Aug. 16, 2004. Redesignated...

MicroRNA-146a provides feedback regulation of lyme arthritis but not carditis during infection with Borrelia burgdorferi.

Directory of Open Access Journals (Sweden)

Robert B Lochhead

2014-06-01

Full Text Available MicroRNAs have been shown to be important regulators of inflammatory and immune responses and are implicated in several immune disorders including systemic lupus erythematosus and rheumatoid arthritis, but their role in Lyme borreliosis remains unknown. We performed a microarray screen for expression of miRNAs in joint tissue from three mouse strains infected with Borrelia burgdorferi. This screen identified upregulation of miR-146a, a key negative regulator of NF-κB signaling, in all three strains, suggesting it plays an important role in the in vivo response to B. burgdorferi. Infection of B6 miR-146a-/- mice with B. burgdorferi revealed a critical nonredundant role of miR-146a in modulating Lyme arthritis without compromising host immune response or heart inflammation. The impact of miR-146a was specifically localized to the joint, and did not impact lesion development or inflammation in the heart. Furthermore, B6 miR-146a-/- mice had elevated levels of NF-κB-regulated products in joint tissue and serum late in infection. Flow cytometry analysis of various lineages isolated from infected joint tissue of mice showed that myeloid cell infiltration was significantly greater in B6 miR-146a-/- mice, compared to B6, during B. burgdorferi infection. Using bone marrow-derived macrophages, we found that TRAF6, a known target of miR-146a involved in NF-κB activation, was dysregulated in resting and B. burgdorferi-stimulated B6 miR-146a-/- macrophages, and corresponded to elevated IL-1β, IL-6 and CXCL1 production. This dysregulated protein production was also observed in macrophages treated with IL-10 prior to B. burgdorferi stimulation. Peritoneal macrophages from B6 miR-146a-/- mice also showed enhanced phagocytosis of B. burgdorferi. Together, these data show that miR-146a-mediated regulation of TRAF6 and NF-κB, and downstream targets such as IL-1β, IL-6 and CXCL1, are critical for modulation of Lyme arthritis during chronic infection with B

Effect of miR-146a-5p on proliferation and metastasis of triple-negative breast cancer via regulation of SOX5.

Science.gov (United States)

Si, Chengshuai; Yu, Qiao; Yao, Yufeng

2018-05-01

MicroRNA (miR)-146a-5p functions as a tumor suppressor in various types of cancer. However, the role of miR-146a-5p in the development of triple-negative breast cancer (TNBC) is unclear. The present study aimed to investigate the role of miR-146a-5p in TNBC. The expression level of miR-146a-5p in TNBC tissues and cell lines was initially detected using reverse transcription-quantitative polymerase chain reaction. To predict the target gene of miR-146a-5p, TargetScan software was used and a dual luciferase assay was performed to verify the prediction. Furthermore, in order to explore the role of miR-146a-5p in TNBC, miR-146a-5p was overexpressed in TNBC cells using miR-146a-5p mimics. An MTT assay was performed to detect cell proliferation, and a Transwell assay was conducted to determine cell migration and invasion. Furthermore, western blotting was performed to measure associated protein expression. It was revealed that miR-146a-5p was downregulated in TNBC tissues and cell lines. SOX5 was indicated to be a target gene of miR-146a-5p and was upregulated in TNBC cells. Additionally, miR-146a-5p could inhibit TNBC cell proliferation, migration and invasion, repress the expression of mesenchymal markers (N-cadherin, vimentin and fibronectin) and increase epithelial marker (E-cadherin) expression. Furthermore, SOX5 overexpression eliminated the effects of miR-146a-5p mimics on TNBC cells. In conclusion, the data of the present study indicated that miR-146a-5p inhibits the proliferation and metastasis of TNBC cells by regulating SOX5.

Study for the determination of samarium, europium,terbium, dysprosium and yttrium in gadolinium oxide matrix by means of atomic absorption spectrophotometry using a graphite furnace

International Nuclear Information System (INIS)

Caires, A.C.F.

1985-01-01

A study for determination of samarium, europium, terbium, dysprosium and yttrium in a gadolinium oxide matrix by atomic absorption spectrophotometry using a graphite furnace is presented. The best charrring and atomization conditions were estabilished for each element, the most convenient ressonance lines being selected as well. The study was carried out for the mentioned lanthanides both when pure and when in binary mixtures with gadolinium, besides those where all for them were together with gadolinium. The determination limits for pure lanthanides were found to be between 1.3 and 9.6 ng assuming a 20% relative standard deviation as acceptable. The detection limits were in the range 0.51 and 7.5 ng, assuming as positive any answer higher than twofold the standard deviation. (author) [pt

Sparkle/PM3 for the modeling of europium(III), gadolinium(III), and terbium(III) complexes

International Nuclear Information System (INIS)

Freire, Ricardo O.; Rocha, Gerd B.; Simas, Alfredo M.

2009-01-01

The Sparkle/PM3 model is extended to europium(III), gadolinium(III), and terbium(III) complexes. The validation procedure was carried out using only high quality crystallographic structures, for a total of ninety-six Eu(III) complexes, seventy Gd(III) complexes, and forty-two Tb(III) complexes. The Sparkle/PM3 unsigned mean error, for all interatomic distances between the trivalent lanthanide ion and the ligand atoms of the first sphere of coordination, is: 0.080 A for Eu(III); 0.063 A for Gd(III); and 0.070 A for Tb(III). These figures are similar to the Sparkle/AM1 ones of 0.082 A, 0.061 A, and 0.068 A respectively, indicating they are all comparable parameterizations. Moreover, their accuracy is similar to what can be obtained by present-day ab initio effective core potential full geometry optimization calculations on such lanthanide complexes. Finally, we report a preliminary attempt to show that Sparkle/PM3 geometry predictions are reliable. For one of the Eu(III) complexes, BAFZEO, we created hundreds of different input geometries by randomly varying the distances and angles of the ligands to the central Eu(III) ion, which were all subsequently fully optimized. A significant trend was unveiled, indicating that more accurate local minima geometries cluster at lower total energies, thus reinforcing the validity of sparkle model calculations. (author)

CDCP1 identifies a CD146 negative subset of marrow fibroblasts involved with cytokine production.

Directory of Open Access Journals (Sweden)

Mineo Iwata

Full Text Available In vitro expanded bone marrow stromal cells contain at least two populations of fibroblasts, a CD146/MCAM positive population, previously reported to be critical for establishing the stem cell niche and a CD146-negative population that expresses CUB domain-containing protein 1 (CDCP1/CD318. Immunohistochemistry of marrow biopsies shows that clusters of CDCP1+ cells are present in discrete areas distinct from areas of fibroblasts expressing CD146. Using a stromal cell line, HS5, which approximates primary CDCP1+ stromal cells, we show that binding of an activating antibody against CDCP1 results in tyrosine-phosphorylation of CDCP1, paralleled by phosphorylation of Src Family Kinases (SFKs Protein Kinase C delta (PKC-δ. When CDCP1 expression is knocked-down by siRNA, the expression and secretion of myelopoietic cytokines is increased. These data suggest CDCP1 expression can be used to identify a subset of marrow fibroblasts functionally distinct from CD146+ fibroblasts. Furthermore the CDCP1 protein may contribute to the defining function of these cells by regulating cytokine expression.

Cyclic stretch induced miR-146a upregulation delays C2C12 myogenic differentiation through inhibition of Numb

International Nuclear Information System (INIS)

Kuang Wei; Tan Jiali; Duan Yinzhong; Duan Jianmin; Wang Weijian; Jin Fang; Jin Zuolin; Yuan Xiao; Liu Yanpu

2009-01-01

Proliferation and differentiation of muscle stem cells must be tightly regulated by intrinsic and extrinsic signals for effective regeneration and adaptive response. MicroRNAs have been implicated as potent regulators in diverse biological processes at the level of posttranscriptional repression. In this study, we found that miR-146a was significantly upregulated upon a 48-h cyclic stretch of 5% elongation/10cycles/min. Importantly, miR-146 was predicted to base-pair with sequences in the 3' UTR of Numb, which promotes satellite cell differentiation towards muscle cells by inhibiting Notch signaling. Through reporter assay and exogenous expression experiment, we confirmed Numb was inhibited by miR-146a. Inhibition of miR-146a by antago-miR-146a rescued the expression of Numb and facilitated the differentiation of C2C12 at a cost of compromised proliferation. Thus, for the first time, we propose a role of miR-146a in skewing the balance of muscle differentiation and proliferation through inhibiting the expression of Numb.

VUV and UV–vis optical study on KGd2F7 luminescent host doped with terbium and co-doped with europium

International Nuclear Information System (INIS)

Lisiecki, Radosław

2013-01-01

The KGd 2 F 7 :Tb and KGd 2 F 7 :Tb,Eu samples were obtained using a solid state reaction. Excitation spectra and emission spectra are reported and analyzed within the VUV–UV–vis spectral range. The intense green luminescence is observed in the KGd 2 F 7 :Tb while the combined emission of terbium and europium in the KGd 2 F 7 :Tb,Eu covers substantially the region of white light. The materials under study can be effectively excited making use of intense f–d transitions of Tb 3+ in the VUV–UV region. Experimental lifetimes of luminescent levels have been measured and discussed. It was found that the considerable energy transfer from Tb 3+ to Eu 3+ occurs. -- Highlights: • The prospective green and white emitting phosphors. • The effective VUV and UV–vis excitation process. • The considerable energy transfer among optically active ions. • The influence of (Tb, Eu) co-doping on relaxation dynamic of excited states

22 CFR 146.110 - Remedial and affirmative action and self-evaluation.

Science.gov (United States)

2010-04-01

... THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Introduction § 146.110 Remedial and affirmative action and self-evaluation. (a) Remedial action. If the...

Structural, elastic, mechanical and thermodynamic properties of Terbium oxide: First-principles investigations

Directory of Open Access Journals (Sweden)

Samah Al-Qaisi

Full Text Available First-principles investigations of the Terbium oxide TbO are performed on structural, elastic, mechanical and thermodynamic properties. The investigations are accomplished by employing full potential augmented plane wave FP-LAPW method framed within density functional theory DFT as implemented in the WIEN2k package. The exchange-correlation energy functional, a part of the total energy functional, is treated through Perdew Burke Ernzerhof scheme of the Generalized Gradient Approximation PBEGGA. The calculations of the ground state structural parameters, like lattice constants a0, bulk moduli B and their pressure derivative B′ values, are done for the rock-salt RS, zinc-blende ZB, cesium chloride CsCl, wurtzite WZ and nickel arsenide NiAs polymorphs of the TbO compound. The elastic constants (C11, C12, C13, C33, and C44 and mechanical properties (Young’s modulus Y, Shear modulus S, Poisson’s ratio σ, Anisotropic ratio A and compressibility β, were also calculated to comprehend its potential for valuable applications. From our calculations, the RS phase of TbO compound was found strongest one mechanically amongst the studied cubic structures whereas from hexagonal phases, the NiAs type structure was found stronger than WZ phase of the TbO. To analyze the ductility of the different structures of the TbO, Pugh’s rule (B/SH and Cauchy pressure (C12–C44 approaches are used. It was found that ZB, CsCl and WZ type structures of the TbO were of ductile nature with the obvious dominance of the ionic bonding while RS and NiAs structures exhibited brittle nature with the covalent bonding dominance. Moreover, Debye temperature was calculated for both cubic and hexagonal structures of TbO in question by averaging the computed sound velocities. Keywords: DFT, TbO, Elastic properties, Thermodynamic properties

9 CFR 146.23 - Terminology and classification; flocks and products.

Science.gov (United States)

2010-01-01

... layers through routine serological surveillance of each participating commercial table-egg layer flock. A... SERVICE, DEPARTMENT OF AGRICULTURE LIVESTOCK IMPROVEMENT NATIONAL POULTRY IMPROVEMENT PLAN FOR COMMERCIAL POULTRY Special Provisions for Commercial Table-Egg Layer Flocks § 146.23 Terminology and classification...

Characterization of cleavage events in the multifunctional cilium adhesin Mhp684 (P146) reveals a mechanism by which Mycoplasma hyopneumoniae regulates surface topography.

Science.gov (United States)

Bogema, Daniel R; Deutscher, Ania T; Woolley, Lauren K; Seymour, Lisa M; Raymond, Benjamin B A; Tacchi, Jessica L; Padula, Matthew P; Dixon, Nicholas E; Minion, F Chris; Jenkins, Cheryl; Walker, Mark J; Djordjevic, Steven P

2012-01-01

Mycoplasma hyopneumoniae causes enormous economic losses to swine production worldwide by colonizing the ciliated epithelium in the porcine respiratory tract, resulting in widespread damage to the mucociliary escalator, prolonged inflammation, reduced weight gain, and secondary infections. Protein Mhp684 (P146) comprises 1,317 amino acids, and while the N-terminal 400 residues display significant sequence identity to the archetype cilium adhesin P97, the remainder of the molecule is novel and displays unusual motifs. Proteome analysis shows that P146 preprotein is endogenously cleaved into three major fragments identified here as P50(P146), P40(P146), and P85(P146) that reside on the cell surface. Liquid chromatography with tandem mass spectrometry (LC-MS/MS) identified a semitryptic peptide that delineated a major cleavage site in Mhp684. Cleavage occurred at the phenylalanine residue within sequence (672)ATEF↓QQ(677), consistent with a cleavage motif resembling S/T-X-F↓X-D/E recently identified in Mhp683 and other P97/P102 family members. Biotinylated surface proteins recovered by avidin chromatography and separated by two-dimensional gel electrophoresis (2-D GE) showed that more-extensive endoproteolytic cleavage of P146 occurs. Recombinant fragments F1(P146)-F3(P146) that mimic P50(P146), P40(P146), and P85(P146) were constructed and shown to bind porcine epithelial cilia and biotinylated heparin with physiologically relevant affinity. Recombinant versions of F3(P146) generated from M. hyopneumoniae strain J and 232 sequences strongly bind porcine plasminogen, and the removal of their respective C-terminal lysine and arginine residues significantly reduces this interaction. These data reveal that P146 is an extensively processed, multifunctional adhesin of M. hyopneumoniae. Extensive cleavage coupled with variable cleavage efficiency provides a mechanism by which M. hyopneumoniae regulates protein topography. Vaccines used to control Mycoplasma

CD146+ human umbilical cord perivascular cells maintain stemness under hypoxia and as a cell source for skeletal regeneration.

Directory of Open Access Journals (Sweden)

Wing Pui Tsang

Full Text Available The human umbilical cord perivascular cells (HUCPVCs have been considered as an alternative source of mesenchymal progenitors for cell based regenerative medicine. However, the biological properties of these cells remain to be well characterized. In the present study, HUCPVCs were isolated and sorted by CD146(+ pericyte marker. The purified CD146(+ HUCPVCs were induced to differentiate efficiently into osteoblast, chondrocyte and adipocyte lineages in vitro. Six weeks following subcutaneous transplantation of CD146(+ HUCPVCs-Gelfoam-alginate 3D complexes in severe combined immunodeficiency (SCID mice, newly formed bone matrix with embedded osteocytes of donor origin was observed. The functional engraftment of CD146(+ HUCPVCs in the new bone regenerates was further confirmed in a critical-sized bone defect model in SCID mice. Hypoxic conditions suppressed osteogenic differentiation while increased cell proliferation and colony-forming efficiency of CD146(+ HUCPVCs as compared to that under normoxic conditions. Re-oxygenation restored the multi-differentiation potential of the CD146(+ HUCPVCs. Western blot analysis revealed an upregulation of HIF-1α, HIF-2α, and OCT-4 protein expression in CD146(+ HUCPVCs under hypoxia, while there was no remarkable change in SOX2 and NANOG expression. The gene expression profiles of stem cell transcription factors between cells treated by normoxia and hypoxic conditions were compared by PCR array analysis. Intriguingly, PPAR-γ was dramatically downregulated (20-fold in mRNA expression under hypoxia, and was revealed to possess a putative binding site in the Hif-2α gene promoter region. Chromatin immunoprecipitation assays confirmed the binding of PPAR-γ protein to the Hif-2α promoter and the binding was suppressed by hypoxia treatment. Luciferase reporter assay showed that the Hif-2α promoter activity was suppressed by PPAR expression. Thus, PPAR-γ may involve in the regulation of HIF-2α for stemness

20 CFR 702.146 - Source of the special fund.

Science.gov (United States)

2010-04-01

... by the employer into the fund. Compensation orders shall be made and filed in accordance with the... during that period for compensation, and (2) the ratio of the amount of payments made by the special fund... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Source of the special fund. 702.146 Section...

9 CFR 146.14 - Diagnostic surveillance program for H5/H7 low pathogenic avian influenza.

Science.gov (United States)

2010-01-01

.../H7 low pathogenic avian influenza. 146.14 Section 146.14 Animals and Animal Products ANIMAL AND PLANT... pathogenic avian influenza. (a) The Official State Agency must develop a diagnostic surveillance program for H5/H7 low pathogenic avian influenza for all poultry in the State. The exact provisions of the...

MicroRNA-146a expression as a potential biomarker for rheumatoid ...

African Journals Online (AJOL)

MicroRNA-146a expression as a potential biomarker for rheumatoid arthritis in Egypt. Heba Mohamed Abdelkader Elsayed, Walaa Shawky Khater, Ayman Asaad Ibrahim, Maha Salah El-din Hamdy, Nashwa Aly Morshedy ...

A new luminescent terbium 4-methylsalicylate complex as a novel sensor for detecting the purity of methanol.

Science.gov (United States)

Zeng, Cheng-Hui; Yang, Yang-Yi; Zhu, Yi-Min; Wang, Hong-Ming; Chu, Tian-Shu; Ng, Seik Weng

2012-01-01

A new dinuclear terbium complex [Tb(2)(4-msal)(6)(H(2)O)(4)]·6H(2)O (1) (4-msal = 4-methylsalcylate) was synthesized. Its structure was determined by single crystal X-ray diffraction, and the complex was characterized by PXRD, FT-IR, fluorescence, TGA and DTA. Complex 1 exists as discrete molecules that are linked by extensive O-H … O hydrogen bonds into a 3D network. The luminescence lifetimes of 3 μM methanol solution and solid sample of 1 are 1.321 and 1.009 ms, respectively. The quantum yield of solid sample is 6.0%. The luminescence quenched more than 50% when 3% (vol/vol) different impurities (acetone, acetonitrile, chloroform, dichloromethane, dioxane, DMF, DMSO, ethanol, ether, ethyl acetate, glycol, H(2)O, hexane, TEA, THF and toluene or their mixture) were added. The inverse linear relationship between the Lg value of fluorescence intensity and the volume ratio of the minor component (to a maximum of 20%) is interpreted in terms of LgI = a-bX (I: luminescence intensity; X: volume ratio of impurities in methanol; a, b are constants). So 1 is a potential luminescent sensor for analyzing the purity of methanol. © 2012 Wiley Periodicals, Inc. Photochemistry and Photobiology © 2012 The American Society of Photobiology.

Expression profile of microRNA-146a along HPV-induced multistep carcinogenesis: a study in HPV16 transgenic mice.

Science.gov (United States)

Araújo, Rita; Santos, Joana M O; Fernandes, Mara; Dias, Francisca; Sousa, Hugo; Ribeiro, Joana; Bastos, Margarida M S M; Oliveira, Paula A; Carmo, Diogo; Casaca, Fátima; Silva, Sandra; Medeiros, Rui; Gil da Costa, Rui M

2018-02-01

Persistent human papillomavirus (HPV) infection is associated with the development of certain types of cancer and the dysregulation of microRNAs has been implicated in HPV-associated carcinogenesis. This is the case of microRNA-146a (miR-146a), which is thought to regulate tumor-associated inflammation. We sought to investigate the expression levels of miR-146a during HPV16-mediated carcinogenesis using skin samples from K14-HPV16 transgenic mice which develop the consecutive phases of the carcinogenesis process. Female transgenic (HPV +/- ) and wild-type (HPV -/- ) mice were sacrificed at 24-26 weeks-old or 28-30 weeks-old. Chest and ear skin samples from HPV +/- and HPV -/- mice were histologically classified and used for microRNA extraction and quantification by qPCR. Chest skin samples from 24 to 26 weeks-old HPV +/- mice presented diffuse epidermal hyperplasia and only 22.5% showed multifocal dysplasia, while at 28-30 weeks-old all (100.0%) HPV +/- animals showed epidermal dysplasia. All HPV +/- ear skin samples showed carcinoma in situ (CIS). MiR-146a expression levels were higher in HPV +/- compared to HPV -/- mice (p = 0.006). There was also an increase in miR-146a expression in dysplastic skin lesions compared with hyperplasic lesions (p = 0.011). Samples showing CIS had a significant decrease in miR-146a expression when compared to samples showing epidermal hyperplasia (p = 0.018) and epidermal dysplasia (p = 0.009). These results suggest that HPV16 induces the overexpression of miR-146a in the initial stages of carcinogenesis (hyperplasia and dysplasia), whereas decreases its expression at later stages (CIS). Taken together, these data implicate and suggest different roles of miR-146a in HPV-mediated carcinogenesis.

19 CFR 146.2 - Port director as Board representative.

Science.gov (United States)

2010-04-01

...; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.2 Port director as Board representative. The appropriate port director shall be in charge of the zone as the representative of the Board. [T.D. 86-16, 51 FR 5049, Feb. 11, 1986, as amended by T.D. 99-27, 64 FR 13676, Mar. 22, 1999] ...

40 CFR 146.73 - Financial responsibility for post-closure care.

Science.gov (United States)

2010-07-01

...-closure by using a trust fund, surety bond, letter of credit, financial test, insurance or corporate... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Financial responsibility for post... Standards Applicable to Class I Hazardous Waste Injection Wells § 146.73 Financial responsibility for post...

Siparex hits target with '146m for third mid-market fund

CERN Multimedia

2003-01-01

Sigefi Private Equity has reached its target final closing of '146m ($155m) for its third mid-market buy-out and expansion capital fund. International investors contributed 26% of the capital including commitments from CERN, Switzerland (1 paragraph).

24 CFR 146.3 - Purpose of HUD's age discrimination regulation.

Science.gov (United States)

2010-04-01

... RECEIVING FEDERAL FINANCIAL ASSISTANCE General § 146.3 Purpose of HUD's age discrimination regulation. The purpose of this part is to state HUD's policies and procedures under the Age Discrimination Act of 1975... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Purpose of HUD's age discrimination...

MicroRNA-146a modulates human bronchial epithelial cell survival in response to the cytokine-induced apoptosis

International Nuclear Information System (INIS)

Liu Xiangde; Nelson, Amy; Wang Xingqi; Kanaji, Nobuhiro; Kim, Miok; Sato, Tadashi; Nakanishi, Masanori; Li Yingji; Sun Jianhong; Michalski, Joel; Patil, Amol; Basma, Hesham; Rennard, Stephen I.

2009-01-01

MicroRNA plays an important role in cell differentiation, proliferation and cell death. The current study found that miRNA-146a was up-regulated in human bronchial epithelial cells (HBECs) in response to stimulation by TGF-ss1 plus cytomix (a mixture of IL-1ss, IFN-γ and TNF-α). TGF-ss1 plus cytomix (TCM) induced apoptosis in HBECs (3.4 ± 0.6% of control vs 83.1 ± 4.0% of TCM treated cells, p < 0.01), and this was significantly blocked by the miRNA-146a mimic (8.8 ± 1.5%, p < 0.01). In contrast, a miRNA-146a inhibitor had only a modest effect on cell survival but appeared to augment the induction of epithelial-mesenchymal transition (EMT) in response to the cytokines. The MicroRNA-146a mimic appears to modulate HBEC survival through a mechanism of up-regulating Bcl-XL and STAT3 phosphorylation, and by this mechanism it could contribute to tissue repair and remodeling.

miR-146a down-regulation alleviates H2O2-induced cytotoxicity of PC12 cells by regulating MCL1/JAK/STAT pathway : miR-146a down-regulation relieves H2O2-induced PC12 cells cytotoxicity by MCL1/JAK/STAT.

Science.gov (United States)

Yang, Xuecheng; Mao, Xin; Ding, Xuemei; Guan, Fengju; Jia, Yuefeng; Luo, Lei; Li, Bin; Tan, Hailin; Cao, Caixia

2018-02-26

Oxidative stress and miRNAs have been confirmed to play an important role in neurological diseases. The study aimed to explore the underlying effect and mechanisms of miR-146a in H 2 O 2 -induced injury of PC12 cells. Here, PC12 cells were stimulated with 200 μM of H 2 O 2 to construct oxidative injury model. Cell injury was evaluated on the basis of the changes in cell viability, migration, invasion, apoptosis, and DNA damage. Results revealed that miR-146a expression was up-regulated in H 2 O 2 -induced PC12 cells. Functional analysis showed that down-regulation of miR-146a alleviated H 2 O 2 -induced cytotoxicity in PC12 cells. Dual-luciferase reporter and western blot assay verified that MCL1 was a direct target gene of miR-146a. Moreover, anti-miR-146a-mediated suppression on cell cytotoxicity was abated following MCL1 knockdown in H 2 O 2 -induced PC12 cells. Furthermore, MCL1 activated JAK/STAT signaling pathway and MCL1 overexpression attenuated H 2 O 2 -induced cytotoxicity in PC12 cells by JAK/STAT signaling pathway. In conclusion, this study suggested that suppression of miR-146a abated H 2 O 2 -induced cytotoxicity in PC12 cells via regulating MCL1/JAK/STAT pathway.

Isolation of Single-Domain Antibody Fragments That Preferentially Detect Intact (146S Particles of Foot-and-Mouth Disease Virus for Use in Vaccine Quality Control

Directory of Open Access Journals (Sweden)

Michiel M. Harmsen

2017-08-01

Full Text Available Intact (146S foot-and-mouth disease virus (FMDVs can dissociate into specific (12S viral capsid degradation products. FMD vaccines normally consist of inactivated virions. Vaccine quality is dependent on 146S virus particles rather than 12S particles. We earlier isolated two llama single-domain antibody fragments (VHHs that specifically recognize 146S particles of FMDV strain O1 Manisa and shown their potential use in quality control of FMD vaccines during manufacturing. These 146S-specific VHHs were specific for particular O serotype strains and did not bind strains from other FMDV serotypes. Here, we describe the isolation of 146S-specific VHHs against FMDV SAT2 and Asia 1 strains by phage display selection from llama immune libraries. VHHs that bind both 12S and 146S particles were readily isolated but VHHs that bind specifically to 146S particles could only be isolated by phage display selection using prior depletion for 12S particles. We obtained one 146S-specific VHH—M332F—that binds to strain Asia 1 Shamir and several VHHs that preferentially bind 146S particles of SAT2 strain SAU/2/00, from which we selected VHH M379F for further characterization. Both M332F and M379F did not bind FMDV strains from other serotypes. In a sandwich enzyme-linked immunosorbent assay (ELISA employing unlabeled and biotinylated versions of the same VHH M332F showed high specificity for 146S particles but M379F showed lower 146S-specificity with some cross-reaction with 12S particles. These ELISAs could detect 146S particle concentrations as low as 2.3–4.6 µg/l. They can be used for FMD vaccine quality control and research and development, for example, to identify virion stabilizing excipients.

Increased risk of polycystic ovary syndrome (PCOS) associated with CC genotype of miR-146a gene variation.

Science.gov (United States)

Ebrahimi, Seyed Omar; Reiisi, Somayeh; Parchami Barjui, Shahrbanou

2018-04-11

Polycystic ovary syndrome (PCOS) is an endocrinopathy in reproductive-age women believed to be affected by several genetics and environmental factors or both. Different miRNAs are one of such genetic factors that their associations with PCOS have been implicated. For instance, miR-146a that is well known for strongly regulating the immune response and inflammation was upregulated in serum plasma, follicular fluid and granulosa cells of PCOS patients. Different studies have shown that genetic changes in pre-miRNA can cause change in the expression or biological function of mature miRNA. Therefore, the main aim of this study was to investigate the association of miR-146a gene variation (rs2910164) with the susceptibility to PCOS. This study consists of 180 patients with PCOS and 192 healthy women matched by age and geographical region. Genotyping were determined by using PCR-RFLP in all subjects. The genotype frequency and allele distributions of all subjects were evaluated using Fisher's exact test directed by SPSS v.20. The genotype and allele frequencies of the miR-146a polymorphism (rs2910164) significantly differ between PCOS and healthy controls. The frequencies of CC genotype (p = .054) and 'C' allele (p = .0001) of the miR-146a variant indicated a significant incidence in cases compared to controls. Such association was obtained in co-dominant (OR = 3.16) and dominant (OR = 2.29) models. Result of this study can be proposed that women with miR-146a variation are at a higher risk for developing PCOS, which can be due to up-regulation of miR-146a.

Development and Validation of A Spectrofluorimetric Determination of Calf Thymus DNA Using a Terbium-Danofloxacin Probe

Directory of Open Access Journals (Sweden)

Naser Soltani

2016-03-01

Full Text Available Background: Analysis of biomolecules is required in many biomedical research areas. A spectrofluorimetric method is proposed for determination of calf thymus DNA (ctDNA based on the fluorescence enhancement of terbium-danofloxacin (Tb3+-Dano in the presence of ctDNA. Methods: A probe with maximum excitation and emission wavelengths of 347 nm and 545 nm, respectively, was developed. The enhanced fluorescence intensity of Tb3+-Dano system was proportional to the concentration of ctDNA. The effective factors and the optimum conditions for the determination of ctDNA were studied. Under the optimum conditions of [Tris buffer]= 0.01 mol L-1 (pH 7.8, [ Tb3+]= 1×10-5 mol L-1 and [Dano]= 5×10-5 mol L-1, the maximum response was achieved. The developed method was evaluated in terms of accuracy, precision and limit of detection. Results: The linear concentration range for quantification of ctDNA was 36-3289 ng mL-1 and the detection limit (S/N=3 was 8 ng mL-1. The concentration of DNA extracted from Escherichia coli as an extracted sample was also determined using the developed probe. The concentration of DNA in extracted sample was determined using UV assay and developed method, the results were satisfactory. Conclusion: The proposed method is a simple, practical and relatively interference free method to follow up the concentrations of ctDNA.

9 CFR 146.53 - Terminology and classification; slaughter plants and premises.

Science.gov (United States)

2010-01-01

... from which the commercial waterfowl and commercial upland game bird industry may conduct a program to... COMMERCIAL POULTRY Special Provisions for Commercial Upland Game Birds, Commercial Waterfowl, Raised-for-Release Upland Game Birds, and Raised-for-Release Waterfowl § 146.53 Terminology and classification...

Lipopolysaccharide induces the migration of human dental pulp cells by up-regulating miR-146a.

Science.gov (United States)

Wang, Min-Ching; Hung, Pei-Shih; Tu, Hsi-Feng; Shih, Wen-Yu; Li, Wan-Chun; Chang, Kuo-Wei

2012-12-01

MicroRNAs are small noncoding RNAs that play crucial roles in regulating normal and pathologic functions. Bacterial lipopolysaccharide (LPS) is one of the key regulators of pulpal pathogenesis. This study investigated how LPS regulates microRNA expression and affects the phenotype of human dental pulp cells (DPCs). Primary DPCs were established and immortalized to achieve immortalized DPCs (I-DPCs). DPCs and I-DPCs were treated with LPS and examined to identify changes in microRNA expression, cell proliferation, and cell migration. Quantitative reverse-transcriptase polymerase chain reaction was used to detect changes in gene expression. Exogenous miR-146a expression was performed transfection with pre-mir-146a mimic. Knockdown of interleukin receptor-associated kinase (IRAK1) and tumor necrosis factor receptor-associated factor 6 (TRAF6) expression was performed by small interference oligonucleotide transfection. Western blot analysis was used to detect changes in the expression of the IRAK1 and TRAF6 proteins. The differentiation of DPCs was induced by osteogenic medium. I-DPCs had a higher level of human telomerase reverse transcriptase gene than the parental DPCs. Up-regulation of miR-146a expression and an increase in migration was induced by LPS treatment of DPCs and I-DPCs. Exogenous miR-146a expression increased the migration of DPCs and I-DPCs and down-regulated the expression of IRAK1 and TRAF6. Knockdown of IRAK1 and/or TRAF6 increased the migration of DPCs. The results suggested that LPS is able to increase the migration of DPCs by modulating the miR-146a-TRAF6/IRAK1 regulatory cascade. Copyright © 2012 American Association of Endodontists. All rights reserved.

Investigation of concentration-dependence of thermodynamic properties of lanthanum, yttrium, scandium and terbium in eutectic LiCl-KCl molten salt

Energy Technology Data Exchange (ETDEWEB)

Wang, Yafei; Zhou, Wentao; Zhang, Jinsuo, E-mail: zhang.3558@osu.edu

2016-09-15

Thermodynamic properties of rare earth metals in LiCl-KCl molten salt electrolyte are crucial to the development of electrochemical separation for the treatment of used nuclear fuels. In the present study, activity coefficient, apparent potential, and diffusion coefficient of lanthanum, yttrium, scandium, and terbium in the molten salt (58 at% LiCl and 42 at% KCl) were calculated by the method of molecular dynamics simulation up to a concentration around 3 at% at temperatures of 723 K and 773 K. It was found that the activity coefficient and the apparent potential increase with the species concentration while diffusion coefficient shows a trend of increase followed by decrease. The calculated results were validated by available measurement data of dilution cases. This research extends the range of data to a wide component and would provide further insight to the pyroprocessing design and safeguards. - Highlights: • Investigation of activity coefficient, apparent potential and diffusion coefficient at different concentrations. • MD simulation was studied for the calculation of thermodynamic properties of rare earth elements in molten salt. • The present study is a pioneering work focusing on the concentration dependence of thermodynamic properties.

Pharmacological studies of the mechanism and function of interleukin-1β-induced miRNA-146a expression in primary human airway smooth muscle

Directory of Open Access Journals (Sweden)

Jiang Xiaoying

2010-06-01

Full Text Available Abstract Background Despite the widespread induction of miR-146a during the innate immune response little is known regarding its biogenesis, function and mechanism. We have therefore examined the role of miR-146a during the interleukin (IL-1β-stimulated IL-6 and IL-8 release and proliferation in primary human airway smooth muscle (HASM cells. Methods HASM cells were isolated from human lung re-section, cultured to a maximum of 3 - 6 passages and then exposed to IL-1β. miR-146a expression were determined by qRT-PCR, IL-6 and IL-8 release by ELISA and proliferation using bromodeoxyuridine incorporation. The role of NF-κB and the MAP kinase pathways was assessed using pharmacological inhibitors of IKK2 (TPCA-1, JNK (SP600125, p38 MAP kinase (SB203580 and MEK-1/2 (PD98059. miR-146a function was determined following transfection of HASM with inhibitors and mimics using Amaxa electroporation. Results IL-1β induced a time-dependent and prolonged 100-fold induction in miR-146a expression, which correlated with release of IL-6 and IL-8. Exposure to IL-1β had no effect upon HASM proliferation. Pharmacological studies showed that expression of primary miR-146a was regulated at the transcriptional levels by NF-κB whilst post-transcriptional processing to mature miR-146a was regulated by MEK-1/2 and JNK-1/2. Functional studies indicated that IL-1β-induced miR-146a expression does not negatively regulate IL-6 and IL-8 release or basal proliferation. However, inhibition of IL-1β-induced IL-6 and IL-8 release was observed at the super-maximal intracellular miR-146a levels obtained by transfection with miR-146a mimics and indicates that studies using miRNA mimics can produce false positive results. Mechanistic studies showed that in the presence of super-maximal levels, the action of miR-146a mimics was mediated at a step following IL-6 and IL-8 mRNA transcription and not through down-regulation of IL-1 receptor associated kinase 1 (IRAK-1 and TNF

Intranasal Delivery of miR-146a Mimics Delayed Seizure Onset in the Lithium-Pilocarpine Mouse Model

Directory of Open Access Journals (Sweden)

Hua Tao

2017-01-01

Full Text Available Unveiling the key mechanism of temporal lobe epilepsy (TLE for the development of novel treatments is of increasing interest, and anti-inflammatory miR-146a is now considered a promising molecular target for TLE. In the current study, a C57BL/6 TLE mouse model was established using the lithium-pilocarpine protocol. The seizure degree was evaluated according to the Racine scale, and level 5 was considered the threshold for generalized convulsions. Animals were sacrificed to analyze the hippocampus at three time points (2 h and 4 and 8 weeks after pilocarpine administration to evaluate the acute, latent, and chronic phases, resp.. After intranasal delivery of miR-146a mimics (30 min before pilocarpine injection, the percent of animals with no induced seizures increased by 6.7%, the latency to generalized convulsions was extended, and seizure severity was reduced. Additionally, hippocampal damage was alleviated. While the relative miR-146a levels significantly increased, the expression of its target mRNAs (IRAK-1 and TRAF-6 and typical inflammatory modulators (NF-κB, TNF-α, IL-1β, and IL-6 decreased, supporting an anti-inflammatory role of miR-146a via the TLR pathway. This study is the first to demonstrate that intranasal delivery of miR-146a mimics can improve seizure onset and hippocampal damage in the acute phase of lithium-pilocarpine-induced seizures, which provides inflammation-based clues for the development of novel TLE treatments.

Determination of terbium in phosphate rock by Tb{sup 3+}-selective fluorimetric optode based on dansyl derivative as a neutral fluorogenic ionophore

Energy Technology Data Exchange (ETDEWEB)

Hosseini, Morteza, E-mail: smhosseini@khayam.ut.ac.ir [Department of Chemistry, Islamic Azad University, Savadkooh Branch, Savadkooh (Iran, Islamic Republic of); Ganjali, Mohammad Reza [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Endocrinology and Metabolism Research Center, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Veismohammadi, Bahareh [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Faridbod, Farnoush [Endocrinology and Metabolism Research Center, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Abkenar, Shiva Dehghan [Department of Chemistry, Islamic Azad University, Savadkooh Branch, Savadkooh (Iran, Islamic Republic of); Norouzi, Parviz [Endocrinology and Metabolism Research Center, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of)

2010-04-07

For the first time a highly sensitive and selective fluorimetric optode membrane was prepared for determination of trace amounts of Tb(III) ions in phosphate rock samples. The Tb(III) sensing system was constructed by incorporating 5-(dimethylamino)-N'-(2-hydroxy-1-naphthoyl) naphthalene-1-sulfonohydrazine (L) as a neutral Tb(III)-selective fluoroionophore, in the plasticized PVC membrane containing sodium tetraphenyl borate as a liphophilic anionic additive. The response of the optode is based on the strong fluorescence quenching of L by Tb{sup 3+} ions. At a pH value of 5.0, the optode displays a wide concentration range of 1.0 x 10{sup -7} to 1.0 x 10{sup -2} M, with a relatively fast response time of less than 45 s. In addition, to high stability and reproducibility, the sensor shows a unique selectivity towards Tb{sup 3+} ion with respect to common cations. The optode was applied successfully to the trace determination of terbium ion in binary mixture and water samples and the determination of Tb{sup 3+} in phosphate rock samples.

Alteration in Inflammation-related miR-146a Expression in NF-KB Signaling Pathway in Diabetic Rat Hippocampus.

Science.gov (United States)

Habibi, Fatemeh; Ghadiri Soufi, Farhad; Ghiasi, Rafighe; Khamaneh, Amir Mahdi; Alipour, Mohammad Reza

2016-03-01

The purpose of the present study is to evaluate the expression of miR-146a gene, its adaptor genes (TRAF6, NF-KB, and IRAK1), and possible changes in the cellular signaling pathway in diabetic hippocampus tissue. Male Sprague-Dawley rats are randomly selected and divided into control and diabetic (n=6) groups. Diabetes induced by the single-dose injection of nicotinamide [110 mg/kg, (i.p.)], 15 min before streptozotocin (50 mg/kg; i.p.) in 12-h fasted rats. The rats are kept at the laboratory for two months. After anaesthetization, hippocampus of the rats was removed in order to measure the expression of miR-146a, NFK-B, IRAK1, and TRAF6 genes using real-time PCR and activity of NF-KB as well as amount of apoptosis rate using ELISA. The results indicated a reduction in expression of miR-146a and an increase in expression of IRAK1, NF-KB, and TRAF6 genes in the hippocampus of diabetic rats compared to control. Also it reveals an increase in the activity of NF-KB and apoptosis rate in the hippocampus of diabetic rats. Our results report the probability that reduction of miR-146a expression in the negative feedback loop between miR-146a and NF-KB increases NF-kB expression and thus intensifies inflammation and apoptosis in hippocampus.

Nicotine permeability across the buccal TR146 cell culture model and porcine buccal mucosa in vitro

DEFF Research Database (Denmark)

Nielsen, Hanne Mørck; Rassing, Margrethe Rømer

2002-01-01

The present study was conducted to investigate and compare the effect of pH and drug concentration on nicotine permeability across the TR146 cell culture model and porcine buccal mucosa in vitro. As a further characterization of the TR146 cell culture model, it was explored whether the results were...... comparable for bi-directional and uni-directional transport in the presence of a transmembrane pH gradient. Nicotine concentrations between 10(-5) and 10(-2) M were applied to the apical side of the TR146 cell culture model or the mucosal side of porcine buccal mucosa. Buffers with pH values of 5.5, 7.......4 and 8.1 were used to obtain different fractions of non- and mono-ionized nicotine. The apparent permeability (P(app)) of nicotine across both models increased significantly with increasing pH, and the P(app) values obtained with the two models could be correlated in a linear manner. With increasing...

Up-regulation of miR-146a contributes to the inhibition of invasion of pancreatic cancer cells

Science.gov (United States)

Li, Yiwei; VandenBoom, Timothy G.; Wang, Zhiwei; Kong, Dejuan; Ali, Shadan; Philip, Philip A.; Sarkar, Fazlul H.

2009-01-01

Pancreatic cancer (PC) is an aggressive malignancy with high mortality and is believed to be in part due to its highly invasive and metastatic behavior, which is associated with over-expression of EGFR and activation of NF-κB. Emerging evidence also suggest critical roles of microRNAs (miRNAs) in the regulation of various pathobiological processes including metastasis in PC and in other human malignancies. In the present study, we found lower expression of miR-146a in PC cells compared to normal human pancreatic duct epithelial (HPDE) cells. Interestingly, re-expression of miR-146a inhibited the invasive capacity of Colo357 and Panc-1 PC cells with concomitant down-regulation of EGFR and IRAK-1. Mechanistic studies including miR-146a re-expression, anti-miR-146 transfection, and EGFR knock-down experiment showed that there was a crosstalk between EGFR, MTA-2, IRAK-1, IκBα and NF-κB. Most importantly, we found that the treatment of PC cells with “natural agents” [3,3′-diinodolylmethane (DIM) or isoflavone] led to an increase in the expression of miR-146a and consequently down-regulated the expression of EGFR, MTA-2, IRAK-1 and NF-κB, resulting in the inhibition of invasion of Colo357 and Panc-1 cells. These results provide experimental evidence in support of the role of DIM and isoflavone as potential non-toxic agents as regulators of miRNA, which could be useful for the inhibition of cancer cell invasion and metastasis, and further suggesting that these agents could be important for designing novel targeted strategy for the treatment of PC. PMID:25242818

Terbium to Quantum Dot FRET Bioconjugates for Clinical Diagnostics: Influence of Human Plasma on Optical and Assembly Properties

Directory of Open Access Journals (Sweden)

Niko Hildebrandt

2011-10-01

Full Text Available Förster resonance energy transfer (FRET from luminescent terbium complexes (LTC as donors to semiconductor quantum dots (QDs as acceptors allows extraordinary large FRET efficiencies due to the long Förster distances afforded. Moreover, time-gated detection permits an efficient suppression of autofluorescent background leading to sub-picomolar detection limits even within multiplexed detection formats. These characteristics make FRET-systems with LTC and QDs excellent candidates for clinical diagnostics. So far, such proofs of principle for highly sensitive multiplexed biosensing have only been performed under optimized buffer conditions and interactions between real-life clinical media such as human serum or plasma and LTC-QD-FRET-systems have not yet been taken into account. Here we present an extensive spectroscopic analysis of absorption, excitation and emission spectra along with the luminescence decay times of both the single components as well as the assembled FRET-systems in TRIS-buffer, TRIS-buffer with 2% bovine serum albumin, and fresh human plasma. Moreover, we evaluated homogeneous LTC-QD FRET assays in QD conjugates assembled with either the well-known, specific biotin-streptavidin biological interaction or, alternatively, the metal-affinity coordination of histidine to zinc. In the case of conjugates assembled with biotin-streptavidin no significant interference with the optical and binding properties occurs whereas the histidine-zinc system appears to be affected by human plasma.

12 CFR 563.146 - Will the OTS permit my capital distribution?

Science.gov (United States)

2010-01-01

... under 12 U.S.C. 1831o(d)(1)(B). (b) Your proposed capital distribution raises safety or soundness... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Will the OTS permit my capital distribution... SAVINGS ASSOCIATIONS-OPERATIONS Capital Distributions § 563.146 Will the OTS permit my capital...

27 CFR 70.146 - 45-day period for making disbursements.

Science.gov (United States)

2010-04-01

... tax lien filing, to the lien imposed by 26 U.S.C. 6321 if, and to the extent, a right to payment has... Collection of Excise and Special (Occupational) Tax Lien for Taxes § 70.146 45-day period for making disbursements. Even though a notice of a lien imposed by 26 U.S.C. 6321 is filed in accordance with § 70.149 of...

Determination of terbium in phosphate rock by Tb3+-selective fluorimetric optode based on dansyl derivative as a neutral fluorogenic ionophore.

Science.gov (United States)

Hosseini, Morteza; Ganjali, Mohammad Reza; Veismohammadi, Bahareh; Faridbod, Farnoush; Abkenar, Shiva Dehghan; Norouzi, Parviz

2010-04-07

For the first time a highly sensitive and selective fluorimetric optode membrane was prepared for determination of trace amounts of Tb(III) ions in phosphate rock samples. The Tb(III) sensing system was constructed by incorporating 5-(dimethylamino)-N'-(2-hydroxy-1-naphthoyl) naphthalene-1-sulfonohydrazine (L) as a neutral Tb(III)-selective fluoroionophore, in the plasticized PVC membrane containing sodium tetraphenyl borate as a liphophilic anionic additive. The response of the optode is based on the strong fluorescence quenching of L by Tb(3+) ions. At a pH value of 5.0, the optode displays a wide concentration range of 1.0 x 10(-7) to 1.0 x 10(-2)M, with a relatively fast response time of less than 45 s. In addition, to high stability and reproducibility, the sensor shows a unique selectivity towards Tb(3+) ion with respect to common cations. The optode was applied successfully to the trace determination of terbium ion in binary mixture and water samples and the determination of Tb(3+) in phosphate rock samples. Crown Copyright 2010. Published by Elsevier B.V. All rights reserved.

Preparation of transparent sol-gel films containing europium, terbium, and ytterbium cations from 4-(3'-triethoxysilylpropylimino)pent-2-en-2-ol

International Nuclear Information System (INIS)

Semenov, V.V.; Cherepennikova, N.F.; Kuznetsova, O.V.; Melenskova, N.V.; Bushuk, B.A.; Bushuk, S.B.; Kal'vinkovskaya, Yu.A.; Duglas, V.E.

2007-01-01

A reaction of 3-aminopropyl(triethoxy)silane with acetylacetone gave a mixture of two isomeric carbon-functionalized organosilicon compounds capable of complexation and sol-gel polymerization. These were 4-(3'-triethoxysilylpropylimino)pent-2-en-2-ol (EtO) 3 Si-CH 2 CH 2 CH 2 -N=C(Me)CH=C(Me)OH (Ia, 83%) and 4-(3'-triethoxysilylpropylamino)pent-3-en-2-one (EtO) 3 Si-CH 2 CH 2 CH 2 -NH-C(Me)=CH-C(O)Me (Ib, 17%). With acetylacetone trimethylsilyl ether instead of acetylacetone itself, compound Ia and silylated derivatives (Me 3 SiO) n (EtO) 3-n Si-CH 2 CH 2 CH 2 -N=C(Me)CH=C(Me)OH were obtained as admixture in 84 and 16% yields, respectively. Reactions of ligands Ia and Ib with europium and terbium propan-2-olates afforded the corresponding complexes. Formulations of lanthanide complexes, oligodimethylsiloxanediols, and 3-aminopropyl(triethoxy)silane were used to prepare transparent sol-gel films. The photoluminescence spectra of the films show narrow bands due to Eu 3+ or Tb 3+ emission. Emission from the organosilicon matrix appears as a broad band at 430 to 435 nm [ru

MicroRNA-146 protects A549 and H1975 cells from LPS-induced ...

Indian Academy of Sciences (India)

Qiang Wang

2017-10-26

Oct 26, 2017 ... States, pneumonia is the sixth most common cause of dis- ease-related deaths. In addition, pneumonia is the most common hospital-acquired fatal infections. ... 146 targets the messengers of bacterial lipopolysaccharide.

Inner-sphere and outer-sphere complexes of yttrium(III), lanthanum (III), neodymium(III), terbium(III) and thulium(III) with halide ions in N,N-dimethylformamide

International Nuclear Information System (INIS)

Takahashi, Ryouta; Ishiguro, Shin-ichi

1991-01-01

The formation of chloro, bromo and iodo complexes of yttrium(III), and bromo and iodo complexes of lanthanum(III), neodymium(III), terbium(III) and thulium(III) has been studied by precise titration calorimetry in N,N-dimethylformamide (DMF) at 25 o C. The formation of [YCl] 2+ , [YCl 2 ] + , [YCl 3 ] and [YCl 4 ] - , and [MBr] 2+ and [MBr 2 ] + (M = Y, La, Nd, Tb, Tm) was revealed, and their formation constants, enthalpies and entropies were determined. It is found that the formation enthalpies change in the sequence ΔH o (Cl) > ΔH o (l), which is unusual for hard metal (III) ions. This implies that, unlike the chloride ion, the bromide ion forms outer-sphere complexes with the lanthanide(III) and yttrium(III) ions in DMF. Evidence for either an inner- or outer-sphere complex was obtained from 89 Y NMR spectra for Y(ClO 4 ) 3 , YCl 3 and YBr 3 DMF solutions at room temperature. (author)

Declining Physical Performance Associates with Serum FasL, miR-21, and miR-146a in Aging Sprinters

Directory of Open Access Journals (Sweden)

Reeta Kangas

2017-01-01

Full Text Available Aging is associated with systemic inflammation and cellular apoptosis accelerating physiological dysfunctions. Whether physically active way of life affects these associations is unclear. This study measured the levels of serum inflammatory and apoptotic molecules, their change over 10 years, and their associations with physical performance in sprint-trained male athletes. HsCRP, cell counts, HGB, FasL, miR-21, and miR-146a were measured cross-sectionally (n=67, 18–90 yrs and serum FasL, miR-21, and miR-146a and their aging-related associations with physical performance were assessed over a 10-year follow-up (n=49, 50–90 yrs. The cross-sectional study showed positive age correlations for neutrophils and negative for lymphocytes, red blood cells, HGB, FasL, and miR-146a. During the 10-year follow-up, FasL decreased (P=0.017 and miR-21 (P<0.001 and miR-146a (P=0.005 levels increased. When combining the molecule levels, aging, and physical performance, FasL associated with countermovement jump and bench press (P<0.001, miR-21 and miR-146a with knee flexion (P=0.023; P<0.001, and bench press (P=0.004; P<0.001 and miR-146a with sprint performance (P<0.001. The studied serum molecules changed in an age-dependent manner and were associated with declining physical performance. They have potential as biomarkers of aging-related processes influencing the development of physiological dysfunctions. Further research is needed focusing on the origins and targets of circulating microRNAs to clarify their function in various tissues with aging.

Evaluation of the miRNA-146a and miRNA-155 Expression Levels in Patients with Oral Lichen Planus.

Science.gov (United States)

Ahmadi-Motamayel, Fatemeh; Bayat, Zeynab; Hajilooi, Mehrdad; Shahryar-Hesami, Soroosh; Mahdavinezhad, Ali; Samie, Lida; Solgi, Ghasem

2017-12-01

Oral Lichen Planus (OLP) is a chronic autoimmune disease that could be considered as a potential premalignant status. To evaluate the miRNA-146a and miRNA-155 expression levels in patients with oral Lichen planus lesions compared to healthy subjects with normal oral mucosa. Forty patients with oral lichen planus and 18 healthy age and gender-matched controls were recruited in this case-control study. Oral lichen planus was diagnosed clinically and pathologically. The expression levels of two miRNAs in peripheral blood samples were determined using commercial TaqMan MicroRNA Assays. Relative quantification of gene expression was calculated by the 2-ΔΔct method. The expression levels of miRNA-146a and miRNA-155 in patients with oral Lichen planus were significantly higher than those of healthy controls. Also, a direct but insignificant correlation was found between miRNA-155 and miRNA-146a expression levels among the patient group. Our findings indicate that miRNA-146a and miRNA-155 could be potential biomarkers for the immunopathogenesis of oral lichen planus.

Downregulation of Melanoma Cell Adhesion Molecule (MCAM/CD146) Accelerates Cellular Senescence in Human Umbilical Cord Blood-Derived Mesenchymal Stem Cells.

Science.gov (United States)

Jin, Hye Jin; Kwon, Ji Hye; Kim, Miyeon; Bae, Yun Kyung; Choi, Soo Jin; Oh, Wonil; Yang, Yoon Sun; Jeon, Hong Bae

2016-04-01

Therapeutic applications of mesenchymal stem cells (MSCs) for treating various diseases have increased in recent years. To ensure that treatment is effective, an adequate MSC dosage should be determined before these cells are used for therapeutic purposes. To obtain a sufficient number of cells for therapeutic applications, MSCs must be expanded in long-term cell culture, which inevitably triggers cellular senescence. In this study, we investigated the surface markers of human umbilical cord blood-derived MSCs (hUCB-MSCs) associated with cellular senescence using fluorescence-activated cell sorting analysis and 242 cell surface-marker antibodies. Among these surface proteins, we selected the melanoma cell adhesion molecule (MCAM/CD146) for further study with the aim of validating observed expression differences and investigating the associated implications in hUCB-MSCs during cellular senescence. We observed that CD146 expression markedly decreased in hUCB-MSCs following prolonged in vitro expansion. Using preparative sorting, we found that hUCB-MSCs with high CD146 expression displayed high growth rates, multilineage differentiation, expression of stemness markers, and telomerase activity, as well as significantly lower expression of the senescence markers p16, p21, p53, and senescence-associated β-galactosidase, compared with that observed in hUCB-MSCs with low-level CD146 expression. In contrast, CD146 downregulation with small interfering RNAs enhanced the senescence phenotype. In addition, CD146 suppression in hUCB-MSCs caused downregulation of other cellular senescence regulators, including Bmi-1, Id1, and Twist1. Collectively, our results suggest that CD146 regulates cellular senescence; thus, it could be used as a therapeutic marker to identify senescent hUCB-MSCs. One of the fundamental requirements for mesenchymal stem cell (MSC)-based therapies is the expansion of MSCs during long-term culture because a sufficient number of functional cells is required

24 CFR 146.1 - Purpose of the Age Discrimination Act of 1975.

Science.gov (United States)

2010-04-01

... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE General § 146.1 Purpose of the Age Discrimination Act of... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Purpose of the Age Discrimination... programs or activities receiving Federal financial assistance. The Act, however, permits federally assisted...

19 CFR 146.52 - Manipulation, manufacture, exhibition or destruction; Customs Form 216.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Manipulation, manufacture, exhibition or... Merchandise in a Zone § 146.52 Manipulation, manufacture, exhibition or destruction; Customs Form 216. (a... application) on Customs Form 216 for permission to manipulate, manufacture, exhibit, or destroy merchandise in...

Increased Expression of miR-146a in Children With Allergic Rhinitis After Allergen-Specific Immunotherapy.

Science.gov (United States)

Luo, Xi; Hong, Haiyu; Tang, Jun; Wu, Xingmei; Lin, Zhibin; Ma, Renqiang; Fan, Yunping; Xu, Geng; Liu, Dabo; Li, Huabin

2016-03-01

MicroRNAs (miRs) were recently recognized to be important for immune cell differentiation and immune regulation. However, whether miRs were involved in allergen-specific immunotherapy (SIT) remains largely unknown. This study sought to examine changes in miR-146a and T regulatory cells in children with persistent allergic rhinitis (AR) after 3 months of subcutaneous immunotherapy (SCIT) and sublingual immunotherapy (SLIT). Twenty-four HDM-sensitized children with persistent AR were enrolled and treated with SCIT (n=13) or SLIT (n=11) for 3 months. Relative miR-146a and Foxp3 mRNA expression, the TRAF6 protein level, and the ratio of post-treatment to baseline IL-10+CD4+ T cells between the SCIT and SLIT groups were examined in the peripheral blood mononuclear cells (PBMCs) of AR patients using quantitative reverse transcription polymerase chain reaction (qRT-PCR), flow cytometry, and Western blot analysis, respectively. Serum levels of IL-5 and IL-10 were determined using ELISA. After 3 months of SIT, both the TNSS and INSS scores were significantly decreased compared to the baseline value (P<0.01). The relative expression of miR-146a and Foxp3 mRNA was significantly increased after both SCIT and SLIT (P<0.01). The ratio of post-treatment to baseline IL-10⁺CD4⁺ T cells and the serum IL-10 level were significantly increased in both the SCIT and SLIT groups (P<0.01), whereas the TRAF6 protein level and serum IL-5 level were significantly decreased (P<0.01). No significant differences in these biomarkers were observed between the SCIT and SLIT groups. Our findings suggest that miR-146a and its related biomarkers may be comparably modulated after both SCIT and SLIT, highlighting miR-146a as a potential therapeutic target for the improved management of AR.

Spallation of terbium by 170 MeV protons. First part: qualitative study

International Nuclear Information System (INIS)

Olkowsky, J.; Le Pape, M.; Gratot, I.; Cohen, L.

1959-01-01

The products of the reaction Tb+p (170 MeV) have been studied by radiochemical methods. For each element, α, β, γ and X rays have been studied and results compared to literature data. The cross sections will be given in a further work. We observe a new alpha emitter of gadolinium, half-life 7 h, with the following γ-rays: X (43 keV), 220 keV, 340 keV, 550 keV, 720 keV. New γ-rays are given: 155 Tb: 480 keV; 880 keV 146 Eu (38 h): 125 keV; 570 keV 147 Eu: 570 keV 145 Eu: 180 keV. Reprint of a paper published in 'Le journal de physique et le radium', tome 20, N. 5, may 1959, p. 549-556 [fr

MicroED Structure of Au146(p-MBA)57 at Subatomic Resolution Reveals a Twinned FCC Cluster.

Science.gov (United States)

Vergara, Sandra; Lukes, Dylan A; Martynowycz, Michael W; Santiago, Ulises; Plascencia-Villa, Germán; Weiss, Simon C; de la Cruz, M Jason; Black, David M; Alvarez, Marcos M; López-Lozano, Xochitl; Barnes, Christopher O; Lin, Guowu; Weissker, Hans-Christian; Whetten, Robert L; Gonen, Tamir; Yacaman, Miguel Jose; Calero, Guillermo

2017-11-16

Solving the atomic structure of metallic clusters is fundamental to understanding their optical, electronic, and chemical properties. Herein we present the structure of the largest aqueous gold cluster, Au 146 (p-MBA) 57 (p-MBA: para-mercaptobenzoic acid), solved by electron micro-diffraction (MicroED) to subatomic resolution (0.85 Å) and by X-ray diffraction at atomic resolution (1.3 Å). The 146 gold atoms may be decomposed into two constituent sets consisting of 119 core and 27 peripheral atoms. The core atoms are organized in a twinned FCC structure, whereas the surface gold atoms follow a C 2 rotational symmetry about an axis bisecting the twinning plane. The protective layer of 57 p-MBAs fully encloses the cluster and comprises bridging, monomeric, and dimeric staple motifs. Au 146 (p-MBA) 57 is the largest cluster observed exhibiting a bulk-like FCC structure as well as the smallest gold particle exhibiting a stacking fault.

A functional polymorphism of the microRNA-146a gene is associated with susceptibility to drug-resistant epilepsy and seizures frequency.

Science.gov (United States)

Cui, Lili; Tao, Hua; Wang, Yan; Liu, Zhou; Xu, Zhien; Zhou, Haihong; Cai, Yujie; Yao, Lifen; Chen, Beichu; Liang, Wandong; Liu, Yu; Cheng, Wanwen; Liu, Tingting; Ma, Guoda; Li, You; Zhao, Bin; Li, Keshen

2015-04-01

Epilepsy is the third most common chronic brain disorder and is characterized by an enduring predisposition for seizures. Recently, a growing body of evidence has suggested that microRNA-146a (miR-146a) is upregulated in the brains of epilepsy patients and of mouse models; furthermore, miR-146a may be involved in the development and progression of seizures through the regulation of inflammation and immune responses. In this report, we performed a case-control study to analyze the relationship between the two potentially functional single nucleotide polymorphisms (SNPs) of the miR-146a gene (rs2910464 and rs57095329) and the risk of epilepsy in a Chinese population comprising 249 cases and 249 healthy controls. Our study comprised 249 epilepsy patients and 249 healthy controls in two regions of China. The DNA was genotyped using the ABI PRISM SNapShot method. The statistical analysis was estimated using the chi-square test or Fisher's exact test. Our results indicated a significant association between the rs57095329 SNP of the miR-146a gene and the risk of drug resistant epilepsy (DRE) (genotypes, p = 0.0258 and alleles, p = 0.0108). Moreover, the rs57095329 A allele was found to be associated with a reduced risk of seizures frequency in DRE patients (all p epilepsy. Our data indicate that the rs57095329 polymorphism in the promoter region of miR-146a is involved in the genetic susceptibility to DRE and the seizures frequency. Copyright © 2015 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

Multiple Myeloma-Derived Exosomes Regulate the Functions of Mesenchymal Stem Cells Partially via Modulating miR-21 and miR-146a

Directory of Open Access Journals (Sweden)

Qian Cheng

2017-01-01

Full Text Available Exosomes derived from cancer cells can affect various functions of mesenchymal stem cells (MSCs via conveying microRNAs (miRs. miR-21 and miR-146a have been demonstrated to regulate MSC proliferation and transformation. Interleukin-6 (IL-6 secreted from transformed MSCs in turn favors the survival of multiple myeloma (MM cells. However, the effects of MM exosomes on MSC functions remain largely unclear. In this study, we investigated the effects of OPM2 (a MM cell line exosomes (OPM2-exo on regulating the proliferation, cancer-associated fibroblast (CAF transformation, and IL-6 secretion of MSCs and determined the role of miR-21 and miR-146a in these effects. We found that OPM2-exo harbored high levels of miR-21 and miR-146a and that OPM2-exo coculture significantly increased MSC proliferation with upregulation of miR-21 and miR-146a. Moreover, OPM2-exo induced CAF transformation of MSCs, which was evidenced by increased fibroblast-activated protein (FAP, α-smooth muscle actin (α-SMA, and stromal-derived factor 1 (SDF-1 expressions and IL-6 secretion. Inhibition of miR-21 or miR-146a reduced these effects of OPM2-exo on MSCs. In conclusion, MM could promote the proliferation, CAF transformation, and IL-6 secretion of MSCs partially through regulating miR21 and miR146a.

Study of quantum dot based on tin/yttrium mixed oxide doped with terbium to be used as biomarker

International Nuclear Information System (INIS)

Paganini, Paula P.; Felinto, Maria Claudia F.C.; Kodaira, Claudia A.; Brito, Hermi F.; Nunes, Luiz Antonio O.

2009-01-01

Quantum dots (semiconductors nanocrystals) have brought a promising field to develop a new generation of luminescent biomarkers. The use of lanthanides ions as luminescent markers has many advantages, for example a security method, low cost, high specificity and also the luminescence can be promptly measured with high sensibility and accuracy. These luminescent dots are functionalized with biomolecules. For the luminophore particle to be connect with biologicals molecules (for example covalent antibody) is necessary a previous chemical treatment to modify luminophore particle surface and this process is called functionalization. A prior chemical treatment with changes on the surface luminophore particle is necessary to couple the luminophore to biological molecules. This process can be used as coating which can protect these particles from being dissolved by acid as well as provide functional groups for biological conjugation. This work presents a photoluminescence study of nanoparticles based on tin/yttrium mixed oxides doped with terbium (SnO 2 /Y 2 O 3 :Tb 3+ ), synthesized by coprecipitation method. The nanoparticles were submitted to thermal treatment and characterized by X-Ray Powder Diffraction (XRD) that showed cassiterite phase formation and the influence of thermal treatment on nanoparticles structures. These nanoparticles going to be functionalized with a natural polysaccharide (chitosan) in order to form microspheres. These microspheres going to be irradiated with gamma radiation to sterilization and it can be evaluated if the nanoparticles are resistant to irradiation and they do not lose functionality with this process. (author)

Pre-miR-146a (rs2910164 G>C single nucleotide polymorphism is genetically and functionally associated with leprosy.

Directory of Open Access Journals (Sweden)

Paula F T Cezar-de-Mello

2014-09-01

Full Text Available Mycobacterium leprae infects macrophages and Schwann cells inducing a gene expression program to facilitate its replication and progression to disease. MicroRNAs (miRNAs are key regulators of gene expression and could be involved during the infection. To address the genetic influence of miRNAs in leprosy, we enrolled 1,098 individuals and conducted a case-control analysis in order to study four miRNAs genes containing single nucleotide polymorphism (miRSNP. We tested miRSNP-125a (rs12975333 G>T, miRSNP-223 (rs34952329 *>T, miRSNP-196a-2 (rs11614913 C>T and miRSNP-146a (rs2910164 G>C. Amongst them, miRSNP-146a was the unique gene associated with risk to leprosy per se (GC OR = 1.44, p = 0.04; CC OR = 2.18, p = 0.0091. We replicated this finding showing that the C-allele was over-transmitted (p = 0.003 using a transmission-disequilibrium test. A functional analysis revealed that live M. leprae (MOI 100:1 was able to induce miR-146a expression in THP-1 (p<0.05. Furthermore, pure neural leprosy biopsies expressed augmented levels of that miRNA as compared to biopsy samples from neuropathies not related with leprosy (p = 0.001. Interestingly, carriers of the risk variant (C-allele produce higher levels of mature miR-146a in nerves (p = 0.04. From skin biopsies, although we observed augmented levels of miR-146a, we were not able to correlate it with a particular clinical form or neither host genotype. MiR-146a is known to modulate TNF levels, thus we assessed TNF expression (nerve biopsies and released by peripheral blood mononuclear cells infected with BCG Moreau. In both cases lower TNF levels correlates with subjects carrying the risk C-allele, (p = 0.0453 and p = 0.0352; respectively, which is consistent with an immunomodulatory role of this miRNA in leprosy.

22 CFR 146.425 - Counseling and use of appraisal and counseling materials.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Counseling and use of appraisal and counseling... Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 146.425 Counseling and use of appraisal and counseling materials. (a) Counseling. A recipient shall not discriminate against any person on...

The N=82 gap in /sup 146/Gd from beta -decay studies of Tb isotopes

CERN Document Server

Styczen, J; Kleinheinz, P; Piiparinen, M

1981-01-01

The beta -decay study of 23 s /sup 146/Tb suggests a ( pi h/sub 11/2/ nu d/sup -1//sub 3/2/) 5/sup -/ configuration for this activity. In its decay the authors have identified a pi h/sub 11/2/ to nu h/sub 9/2 / GT decay branch which populates neutron particle-hole states in /sup 146/Gd. Hence the N=82 single particle energy gap is less than 4 MeV. Neutron one-particle two-hole and two-particle one-hole states in /sup 145/Gd and /sup 147/Gd were identified in the beta -decays of 29 s /sup 145/Tb and 1.6 h /sup 147/Tb. (11 refs).

Preparation of a novel fluorescence probe of terbium-europium co-luminescence composite nanoparticles and its application in the determination of proteins

Energy Technology Data Exchange (ETDEWEB)

Gao Feng [College of Chemistry and Materials Science, Anhui Key Laboratory of Chemo/Biosensing, Anhui Normal University, Wuhu 241000 (China)], E-mail: summit8848cn@hotmail.com; Luo Fabao; Tang Lijuan; Dai Lu [College of Chemistry and Materials Science, Anhui Key Laboratory of Chemo/Biosensing, Anhui Normal University, Wuhu 241000 (China); Wang Lun [College of Chemistry and Materials Science, Anhui Key Laboratory of Chemo/Biosensing, Anhui Normal University, Wuhu 241000 (China)], E-mail: wanglun@mail.ahnu.edu.cn

2008-03-15

Terbium-europium Tb-Eu/acetylacetone(acac)/poly(acrylamide) (PAM) co-luminescence composite nanoparticles were successfully prepared using the ultrasonic approach. The as-prepared composite nanoparticles show the characteristic emission spectra of Tb{sup 3+}, located at 496 and 549 nm. Furthermore, the nanoparticles are water soluble, stable and have extremely narrow emission bands and high internal fluorescence quantum yield due to the co-luminescence effect. Further studies indicate that proteins can interact with the nanoparticles and induce the fluorescence quenching of the nanoparticles. Based on the fluorescence quenching of nanopaticles in the presence of proteins, a novel method for the sensitive determination of trace amounts of proteins was proposed. Under the optimal experimental conditions, the linear ranges of calibration curves are 0-3.5 {mu}g mL{sup -1} for human serum albumin (HSA) and 0-4.0 {mu}g mL{sup -1} for {gamma}-globulin ({gamma}-IgG), respectively. The limits of detection are 7.1 for HSA and 6.7ng mL{sup -1} for {gamma}-IgG, respectively. The method was applied to the quantification of proteins in synthetic samples and actual human serum samples with satisfactory results. This proposed method is sensitive, simple and has potential application in the clinical assay of proteins.

Studies on the rare earth complexes with pyridine derivatives and their N-oxide(II) - Synthesis and properties of fluorescent solid complexes of samarium, europium, gadolium and terbium chlorides with 2,2'-bipyridine-N,N'-dioxide

International Nuclear Information System (INIS)

Minyu, T.; Ning, T.; Yingli, Z.; Jiyuan, B.

1985-01-01

The solid complexes of rare earth nitrates perchlorates and thiocyanates with 2,2'-bipyridine-N,N'-dioxide (bipyO/sub 2/) have been reported. However, the corresponding complexes of other rear earth chlorides have not been investigated except lanthanum, cerium and yttrium. As an extension of our previous work on the synthesis of complexes of praseodymium and neodymium chlorides wiht bipoyO/sub 2/, the authors have now prepared fluorescent solid complexes of samarium, europium, gadolium and terbium chlorides with biphyO/sub 2/, using methanol as a reaction medium. The new synthesized compounds have been identified by means of elemental analysis, infrared spectrometry, conductometry, differential thermal analysis (DTA), thermogravimetry (TG) and X-ray powder diffraction

Expression of MicroRNA-146a and MicroRNA-155 in Placental Villi in Early- and Late-Onset Preeclampsia.

Science.gov (United States)

Nizyaeva, N V; Kulikova, G V; Nagovitsyna, M N; Kan, N E; Prozorovskaya, K N; Shchegolev, A I; Sukhikh, G T

2017-07-01

We studied the expression of microRNA-146a and microRNA-155 in placental villi from 18 women (26-39 weeks of gestation) of reproductive age with early- or late-onset preeclampsia. The reference group consisted of women with physiological pregnancy and full-term gestation and with preterm birth after caesarian section on gestation week 26-31. MicroRNA-146a and microRNA-155 were detected by in situ hybridization with digoxigenin on paraffin sections. It was found that the expression of microRNA-146a in both syncytiotrophoblast of the intermediate villi and syncytial knots was lower at late-onset preeclampsia than at physiologic pregnancy of full-term period (p=0.037 and p=0.001 respectively). The expression of microRNA-155 in syncytiotrophoblast of intermediate placental villi in early-onset preeclampsia was higher than in group with preterm delivery (p=0.003). However, in syncytiotrophoblast of intermediate villi and in syncytial knots, the expression of microRNA-155 was lower at late-onset preeclampsia in comparison with full-term physiological pregnancy (p=0.005). In addition, the expression of microRNA-146a and microRNA-155 did not increase in the later terms in preeclampsia, while in the reference groups demonstrating gradual increase in the expression of these markers with increasing gestational age. Expression microRNA-146a and microRNA-155 little differed in early- and late-onset preeclampsia. These findings suggest that different variants of preeclampsia are probably characterized by common pathogenetic pathways. Damaged trophoblast cannot maintain of microRNAs synthesis at the required level, which determines the formation of a vicious circle in preeclampsia and further progression of the disease.

Relationship between miR-146a rs2910164 (G>C) Polymorphism and Digestive System Cancer Susceptibility: A Meta-Analysis.

Science.gov (United States)

Xiong, Xin; Yan, Junfeng; Li, Linghua; Li, Yun; Cao, Yi; Tu, Yi; Mei, Jinhong

2017-08-01

MicroRNAs (miRNAs) are identified negatively regulating gene expression and acting as oncogenes or tumor suppressors in tumorigenesis. The association between miR-146a rs2910164 (G>C) polymorphism and susceptibility to digestive system cancers was contradictory and inconsistent in previously published studies. Presently, we performed a comprehensive literature retrieve on PubMed, Web of Science, Embase, Wanfang and CNKI databases to identify all relevant studies published before July 30, 2016. Odds ratio (OR) and 95% confidential interval (95%CI) were used to calculate the relationship between miR-146a rs2910164 (G>C) polymorphism and digestive system cancers susceptibility. Finally, a total of 45 publications comprising 47 separate case-control studies were enrolled in the present updated meta-analysis including 20,281 cases and 26,099 controls. However, no significant association was uncovered for miR-146a rs2910164 polymorphism and digestive system cancers susceptibility in all the genetic models. Moreover, in the stratification analyses by cancer type, the source of control, ethnicity and Hardy-Weinberg Equilibrium (HWE) status, we also revealed a negative result. To conclude, our work suggests that miR-146a rs2910164 (G>C) polymorphism is not a susceptibility factor for digestive system cancers. © 2017 by the Association of Clinical Scientists, Inc.

Antiphospholipid antibody-induced miR-146a-3p drives trophoblast interleukin-8 secretion through activation of Toll-like receptor 8.

Science.gov (United States)

Gysler, Stefan M; Mulla, Melissa J; Guerra, Marta; Brosens, Jan J; Salmon, Jane E; Chamley, Lawrence W; Abrahams, Vikki M

2016-07-01

What is the role of microRNAs (miRs) in antiphospholipid antibody (aPL)-induced trophoblast inflammation? aPL-induced up-regulation of trophoblast miR-146a-3p is mediated by Toll-like receptor 4 (TLR4), and miR-146a-3p in turn drives the cells to secrete interleukin (IL)-8 by activating the RNA sensor, TLR8. Obstetric antiphospholipid syndrome (APS) is an autoimmune disorder characterized by circulating aPL and an increased risk of pregnancy complications. We previously showed that aPL recognizing beta2 glycoprotein I (β2GPI) elicit human first trimester trophoblast secretion of IL-8 by activating TLR4. Since some miRs control TLR responses, their regulation in trophoblast cells by aPL and functional role in the aPL-mediated inflammatory response was investigated. miRs can be released from cells via exosomes, and therefore, miR exosome expression was also examined. A panel of miRs was selected based on their involvement with TLR signaling: miR-9; miR-146a-5p and its isomiR, miR-146a-3p; miR-155, miR-210; and Let-7c. Since certain miRs can activate the RNA sensor, TLR8, this was also investigated. For in vitro studies, the human first trimester extravillous trophoblast cell line, HTR8 was studied. HTR8 cells transfected to express a TLR8 dominant negative (DN) were also used. Plasma was evaluated from pregnant women who have aPL, either with or without systemic lupus erythematous (SLE) (n = 39); SLE patients without aPL (n = 30); and healthy pregnant controls (n = 20). Trophoblast HTR8 wildtype and TLR8-DN cells were incubated with or without aPL (mouse anti-human β2GPI mAb) for 48-72 h. HTR8 cells were also treated with or without aPL in the presence and the absence of a TLR4 antagonist (lipopolysaccharide from Rhodobacter sphaeroides; LPS-RS), specific miR inhibitors or specific miR mimics. miR expression levels in trophoblast cells, trophoblast-derived exosomes and exosomes isolated from patient plasma were measured by qPCR. Trophoblast IL-8 secretion was

Study of the role of complete fusion in the reaction of 48Ca and 56Fe with cerium and terbium

International Nuclear Information System (INIS)

Morrissey, D.J.

1978-05-01

48 Ca and 56 Fe beams from the Super HILAC accelerator were used to irradiate thick metal foils of cerium and terbium. Product gamma ray activities were detected offline and individual products were identified by half-life, gamma ray energy and gamma ray abundances. The production cross sections were iteratively fit to charge and mass dispersions to allow correction for parent decay and calculation of mass yields. From the mass yield curves contributions from quasielastic transfer, deep inelastic transfer and complete fusion reaction mechanisms were interred. Complete fusion was made up on contributions from both evaporation residue and fusion-fission products for the 48 Ca induced reactions. However, only fusion-fission products were detected in the 56 Fe induced reactions. Critical angular momenta for fusion were found to be 82 +- 8 h for 48 Ca + 159 Tb and 34 +- 5 h for 56 Fe + 140 Ce, which can be compared with 53 +- 8 h for 12 C + 197 Au (Natowitz, 1970) and 86 +- 5 h for 40 Ar + 165 Ho (Hanappe, 1973). All of these reactions lead to essentially the same compound nucleus and seem to show the dramatic decline in complete fusion for heavy ions larger than 40 Ar. The prediction of this decline was found to be beyond the model calculations of Bass and the critical distance approach of Glas and Mosel

MS2 VLP-based delivery of microRNA-146a inhibits autoantibody production in lupus-prone mice

Directory of Open Access Journals (Sweden)

Pan Y

2012-12-01

Full Text Available Yang Pan,1,2 Tingting Jia,1,2 Yuan Zhang,1,2 Kuo Zhang,1 Rui Zhang,1 Jinming Li,1 Lunan Wang11National Center for Clinical Laboratories, Beijing Hospital of the Ministry of Health, Beijing, People’s Republic of China; 2Graduate School, Peking Union Medical College, Chinese Academy of Medical Sciences, Beijing, People’s Republic of ChinaBackground: Systemic lupus erythematosus (SLE is a chronic autoimmune disease characterized by the presence of pathogenic autoantibodies. Recent studies suggest that microRNAs (miRNAs play an essential role in immunoregulation and may be involved in the pathogenesis of SLE. Therefore, it was of interest to investigate the potential therapeutic application of miRNAs in SLE, a concept that has not been thoroughly investigated thus far. Virus-like particles (VLPs are a type of recombinant nanoparticle enveloped by certain proteins derived from the outer coat of a virus. Herein, we describe a novel miRNA-delivery approach via bacteriophage MS2 VLPs and investigate the therapeutic effects of miR-146a, a well-studied and SLE-related miRNA, in BXSB lupus-prone mice.Methods: VLPs containing miR-146a, and the control VLPs, were prepared using an Escherichia coli expression system and then administered to lupus-prone mice over a 12-day period. We performed an enzyme-linked immunosorbent assay to evaluate the anti-dsDNA antibody, autoantibody to nuclear antigen (ANA, total IgG and total IgM levels in serum. The expression of miR-146a was analyzed by qRT-PCR. SLE-related cytokines as well as some toll-like receptor signaling pathway molecules were also measured.Results: Treatment with MS2-miR146a VLP showed profound effects on lupus-prone BXSB mice, including an increased level of mature miR-146a, which led to a significant reduction in the expression of autoantibodies and total IgG. Remarkably, these mice also exhibited reduced levels of proinflammatorycytokines, including IFN-Interferon-α (IFN-α, Interleukin-1β (Il-1

TR146 cells grown on filters as a model of human buccal epithelium

DEFF Research Database (Denmark)

Nielsen, Hanne Mørck; Rassing, M R

1999-01-01

The aim of the present study was to evaluate the TR146 cell culture model as an in vitro model of human buccal epithelium with respect to the permeability enhancement by different pH values, different osmolality values or bile salts. For this purpose, the increase in the apparent permeability (P...

Generation of induced pluripotent stem cells (iPSCs) from an Alzheimer's disease patient carrying a M146I mutation in PSEN1

DEFF Research Database (Denmark)

Li, Tong; Pires, Carlota; Nielsen, Troels Tolstrup

2016-01-01

Skin fibroblasts were obtained from a 46-year-old symptomatic man carrying a M146I mutation in the presenilin 1 gene (PSEN1), responsible for causing Alzheimer's disease (AD). Induced pluripotent stem cells (iPSCs) were derived via transfection with episomal vectors carrying hOCT4, hSOX2, hKLF2, h......L-MYC, hLIN28 and shTP53 genes. M146I-iPSCs were free of genomically integrated reprogramming genes, had the specific mutation but no additional genomic aberrancies, expressed the expected pluripotency markers and displayed in vitro differentiation potential to the three germ layers. The reported M146I...

MicroRNA-146a expression as a potential biomarker for rheumatoid ...

African Journals Online (AJOL)

Heba Mohamed Abdelkader Elsayed

2016-07-26

Jul 26, 2016 ... lows; enzyme activation at 95 °C, followed by 40 cycles of denaturation at 94 °C for 15s annealing at 55 °C for 30 s and extension at 70 °C for 30 s. The expression of the U6B small nuclear RNA (RNU6B) was used as endogenous control for data normalization. The RQ level (fold change) for miR-146a was ...

MicroR-146 blocks the activation of M1 macrophage by targeting signal transducer and activator of transcription 1 in hepatic schistosomiasis

Directory of Open Access Journals (Sweden)

Xing He

2016-11-01

Full Text Available Schistosomiasis is a chronic disease caused by the parasite of the Schistosoma genus and is characterized by egg-induced hepatic granulomas and fibrosis. Macrophages play a central role in schistosomiasis with several studies highlighting their differentiation into M2 cells involved in the survival of infected mice through limitation of immunopathology. However, little is known regarding the mechanisms of regulating macrophage differentiation. Here, we showed that the early stage of infection by Schistosoma japonicum induced expression of type 1 T-helper-cell (Th1 cytokine, interferon-γ (IFN-γ, leading to increase in M1 cells. However, the presence of liver-trapped eggs induced the expression of Th2 cytokines including interleukin-4 (IL-4, IL-10, and IL-13 that upregulated the transcription of miR-146b by activating signal transducer and activator of transcription 3/6 (STAT3/6 that bind to the promoter of the pre-miR-146b gene. We found that the miR-146a/b was significantly upregulated in macrophages during the progression of hepatic schistosomiasis. The elevated miR-146a/b inhibited the IFN-γ-induced differentiation of macrophages to M1 cells through targeting STAT1. Our data indicate the protective roles of miR-146a/b in hepatic schistosomiasis through regulating the differentiation of macrophages into M2 cells.

29 CFR 780.146 - Importance of relationship of the practice to farming generally.

Science.gov (United States)

2010-07-01

... to include typical factory workers or industrial operations, and the sponsors of the bill made it clear that the erection and operation on a farm by a farmer of a factory, even one using raw materials... in Conjunction Withâ the Farming Operations § 780.146 Importance of relationship of the practice to...

45 CFR 146.136 - Parity in mental health and substance use disorder benefits.

Science.gov (United States)

2010-10-01

... 45 Public Welfare 1 2010-10-01 2010-10-01 false Parity in mental health and substance use disorder... Benefits § 146.136 Parity in mental health and substance use disorder benefits. (a) Meaning of terms. For... benefits and mental health or substance use disorder benefits must comply with paragraph (b)(2), (b)(3), or...

Roles of the β 146 histidyl residue in the molecular basis of the Bohr Effect of hemoglobin: A proton nuclear magnetic resonance study

International Nuclear Information System (INIS)

Busch, M.R.; Mace, J.E.; Ho, N.T.; Ho, Chien

1991-01-01

Assessment of the roles of the carboxyl-terminal β146 histidyl residues in the alkaline Bohr effect in human and normal adult hemoglobin by high-resolution proton nuclear magnetic resonance spectroscopy requires assignment of the resonances corresponding to these residues. By a careful spectroscopic study of human normal adult hemoglobin, enzymatically prepared des(His146β)-hemoglobin, and the mutant hemoglobins Cowtown (β146His → Leu) and York (β146His → Pro), the authors have resolved some of these conflicting results. By a close incremental variation of pH over a wide range in chloride-free 0.1 M N-(2-hydroxyethyl)piperazine-N'-2-ethanesulfonic acid buffer, a single resonance has been found to be consistently missing in the proton nuclear magnetic resonance spectra of these hemoglobin variants. The results indicate that the contribution of the β146 histidyl residues is 0.52 H + /hemoglobin tetramer at pH 7.6, markedly less than 0.8 H + /hemoglobin tetramer estimated by study of the mutant hemoglobin Cowtown (β146His → Leu) by Shih and Perutz. They have found that at least two histidyl residues in the carbonmonoxy form of this mutant have pK values that are perturbed, and they suggest that these pK differences may in part account for this discrepancy. The results show that the pK values of β146 histidyl residues in the carbonmonoxy form of hemoglobin are substantially affected by the presence of chloride and other anions in the solvent, and thus, the contribution of this amino acid residue to the alkaline Bohr effect can be shown to vary widely in magnitude, depending on the solvent composition. These results demonstrate that the detailed molecular mechanisms of the alkaline Bohr effect are not unique but are affected both by the hemoglobin structure and by the interactions with the solvent components in which the hemoglobin molecule resides

A functional polymorphism in the promoter region of microRNA-146a is associated with the risk of Alzheimer disease and the rate of cognitive decline in patients.

Directory of Open Access Journals (Sweden)

Lili Cui

Full Text Available miR146a is well known for its regulatory role in the immune response and inflammation. Recent studies have demonstrated the links between miR146a and Alzheimer disease (AD and suggested that miR146a may be involved in neuroinflammation and the metabolism of amyloid-β (Aβ, which are critical events in AD pathology. Although genetic studies have focused on the association between the miR146a gene and susceptibility to several diseases, no association study of miR146a variability with AD has been conducted. In this report, we performed a case-control association study to analyze the genotype and allele distributions of the miR146a, rs2910464 and rs57095329 polymorphisms in a Chinese population consisting of 292 AD cases and 300 healthy controls. We found a significant difference in the genotypes and allele frequencies of rs57095329 between the AD cases and the controls (p = 0.0147 and p = 0.0184, respectively, where the AA genotype of rs57095329 was associated with an increased risk of AD as well the cognitive decline in AD patients. Additionally, the AA genotype of rs57095329 exhibited significantly higher miR146a expression than the GG+GA genotypes of rs2910164 in the peripheral blood cells (PBMCs of healthy individuals and had a stronger effect on the production of IL-6 and IL-1β when the cells were stimulated with LPS. Our data provide preliminary evidence that the rs57095329 polymorphism in the miR146a promoter is involved in the genetic susceptibility to AD, and this risk AA genotype may increase the expression of miR146a and influence certain proinflammatory cytokines, thus playing a role in the pathogenesis of AD.

Neutral V production with 14.6 x A GeV/c silicon beams

International Nuclear Information System (INIS)

Eiseman, S.E.; Etkin, A.; Foley, K.J.; Hackenburg, R.W.; Longacre, R.S.; Love, W.A.; Morris, T.W.; Platner, E.D.; Saulys, A.C.; Lindenbaum, S.J.; Chan, C.S.; Kramer, M.A.; Zhao, K.; Hallman, T.J.; Madansky, L.; Bonner, B.E.; Buchanan, J.A.; Chiou, C.N.; Clement, J.M.; Corcoran, M.D.; Kruk, J.W.; Mutchler, G.S.; Nessi-Tedaldi, F.; Nessi, M.; Roberts, J.B.

1990-01-01

We present the results of a measurement of neutral V production with 14.6xA GeV/c Si beams on Au and Cu targets. The Λ and K s 0 yields were measured as a function of negative particle multiplicity. Effective temperatures were determined from an exponential fit to the transverse mass distributions. (orig.)

Effect of miR-146a/bFGF/PEG-PEI Nanoparticles on Inflammation Response and Tissue Regeneration of Human Dental Pulp Cells

Directory of Open Access Journals (Sweden)

Lu Liu

2016-01-01

Full Text Available Introduction. Inflammation in dental pulp cells (DPCs initiated by Lipopolysaccharide (LPS results in dental pulp necrosis. So far, whether there is a common system regulating inflammation response and tissue regeneration remains unknown. miR-146a is closely related to inflammation. Basic fibroblast growth factor (bFGF is an important regulator for differentiation. Methods. To explore the effect of miR-146a/bFGF on inflammation and tissue regeneration, polyethylene glycol-polyethyleneimine (PEG-PEI was synthesized, and physical characteristics were analyzed by dynamic light scattering and gel retardation analysis. Cell absorption, transfection efficiency, and cytotoxicity were assessed. Alginate gel was combined with miR-146a/PEG-PEI nanoparticles and bFGF. Drug release ratio was measured by ultraviolet spectrophotography. Proliferation and odontogenic differentiation of DPCs with 1 μg/mL LPS treatment were determined. Results. PEG-PEI prepared at N/P 2 showed complete gel retardation and smallest particle size and zeta potential. Transfection efficiency of PEG-PEI was higher than lipo2000. Cell viability decreased as N/P ratio increased. Drug release rate amounted to 70% at the first 12 h and then maintained slow release afterwards. Proliferation and differentiation decreased in DPCs with LPS treatment, whereas they increased in miR-146a/bFGF gel group. Conclusions. PEG-PEI is a promising vector for gene therapy. miR-146a and bFGF play critical roles in inflammation response and tissue regeneration of DPCs.

Expression of Toll-Like Receptor 2 by Dendritic Cells Is Essential for the DnaJ-ΔA146Ply-Mediated Th1 Immune Response against Streptococcus pneumoniae.

Science.gov (United States)

Wang, Xiaofang; Yuan, Taixian; Yuan, Jun; Su, Yufeng; Sun, Xiaoyu; Wu, Jingwen; Zhang, Hong; Min, Xun; Zhang, Xuemei; Yin, Yibing

2018-03-01

The fusion protein DnaJ-ΔA146Ply could induce cross-protective immunity against pneumococcal infection via mucosal and subcutaneous immunization in mice in the absence of additional adjuvants. DnaJ and Ply are both Toll-like receptor 4 (TLR4) but not TLR2 ligands. However, we found that TLR2 -/- mice immunized subcutaneously with DnaJ-ΔA146Ply showed significantly lower survival rates and higher bacterial loads in nasal washes than did wild-type (WT) mice after being challenged with pneumococcal strain D39 or 19F. The gamma interferon (IFN-γ) level in splenocytes decreased in TLR2 -/- mice, indicating that Th1 immunity elicited by DnaJ-ΔA146Ply was impaired in these mice. We explored the mechanism of protective immunity conferred by DnaJ-ΔA146Ply and the role of TLR2 in this process. DnaJ-ΔA146Ply effectively promoted dendritic cell (DC) maturation via TLR4 but not the TLR2 signaling pathway. In a DnaJ-ΔA146Ply-treated DC and naive CD4 + T cell coculture system, the deficiency of TLR2 in DCs resulted in a significant decline of IFN-γ production and Th1 subset differentiation. The same effect was observed in adoptive-transfer experiments. In addition, TLR2 -/- DCs showed remarkably lower levels of the Th1-polarizing cytokine IL-12p70 than did WT DCs, suggesting that TLR2 was indispensable for DnaJ-ΔA146Ply-induced IL-12 production and Th1 proliferation. Thus, our findings illustrate that dendritic cell expression of TLR2 is essential for optimal Th1 immune response against pneumococci in mice immunized subcutaneously with DnaJ-ΔA146Ply. Copyright © 2018 American Society for Microbiology.

MiR-146a regulates PM1 -induced inflammation via NF-κB signaling pathway in BEAS-2B cells.

Science.gov (United States)

Liu, Limin; Wan, Chong; Zhang, Wei; Guan, Longfei; Tian, Guoxiong; Zhang, Fang; Ding, Wenjun

2018-04-18

Exposure to particulate matter (PM) leads to kinds of cardiopulmonary diseases, such as asthma, COPD, arrhythmias, lung cancer, etc., which are related to PM-induced inflammation. We have found that PM 2.5 (aerodynamics diameter <2.5 µm) exposure induces inflammatory response both in vivo and in vitro. Since the toxicity of PM is tightly associated with its size and components, PM 1 (aerodynamics diameter <1.0 µm) is supposed to be more toxic than PM 2.5 . However, the mechanism of PM 1 -induced inflammation is not clear. Recently, emerging evidences prove that microRNAs play a vital role in regulating inflammation. Therefore, we studied the regulation of miR-146a in PM 1 -induced inflammation in human lung bronchial epithelial BEAS-2B cells. The results show that PM 1 induces the increase of IL-6 and IL-8 in BEAS-2B cells and up-regulates the miR-146a expression by activating NF-κB signaling pathway. Overexpressed miR-146a prevents the nuclear translocation of p65 through inhibiting the IRAK1/TRAF6 expression, and downregulates the expression of IL-6 and IL-8. Taken together, these results demonstrate that miR-146a can negatively feedback regulate PM 1 -induced inflammation via NF-κB signaling pathway in BEAS-2B cells. © 2018 Wiley Periodicals, Inc.

Selection of HLA-B57-associated Gag A146P mutant by HLA-B∗48:01-restricted Gag140-147-specific CTLs in chronically HIV-1-infected Japanese.

Science.gov (United States)

Naruto, Takuya; Murakoshi, Hayato; Chikata, Takayuki; Koyanagi, Madoka; Kawashima, Yuka; Gatanaga, Hiroyuki; Oka, Shinichi; Takiguchi, Masafumi

2011-08-01

We previously showed the possibility that Gag A146P, which is an escape mutant from HLA-B∗57-restricted CTLs, was selected by HLA-B∗48:01-restricted Gag138-147(LI10)-specific CTLs in a Japanese cohort in which HLA-B∗57 individuals were not detected. We herein demonstrated Gag140-147(GI8) to be the optimal epitope rather than LI10 and that GI8-specific T cells failed to recognize the A146P mutant virus-infected cells. The sequence analysis of Gag146 in 261 chronically HIV-1-infected Japanese showed the accumulation of the A146P mutation in HLA-B∗48:01(+) individuals. These findings together indicate that the A146P mutant is accumulating in Japanese by selection by GI8-specific CTLs. Copyright © 2011 Institut Pasteur. Published by Elsevier SAS. All rights reserved.

Search for hyperdeformation in 146Gd using the microball and gammasphere

International Nuclear Information System (INIS)

Hua, P.F.; LaFosse, D.; Korolija, M.; Sarantites, D.G.; Baktash, C.; Cross, C.; Cederwall, B.; Fallon, P.; Lee, I.Y.; Machiavelli, A.

1994-01-01

Results from the first attempt to observe hyperdeformation in 146 Gd by the 100 Mo( 51 V, p4n) reaction are presented. The γ-ray spectra were recorded with Gammasphere. The Microball was used to select protons with an efficiency of 90%. A total of 2 x 10 9 proton selected triple events were obtained. The pxn channels comprised ∼25% of the total events. The proton gating decreased the background from competing xn, αxn and fission by a factor of 4

The purification of the rare earth metals. II

International Nuclear Information System (INIS)

Jordan, R.G.; Jones, D.W.; Hems, V.J.

1975-01-01

Solid-state electrotransport processing has been demonstrated as a technique for purifying terbium. The results show that both oxygen and nitrogen migrate rapidly in the same direction as the electron flow. Although hydrogen contamination occurs on contact with air, terbium of better than 99.9 at. % has been prepared from commercially available starting material. The preparation and characterisation of high-quality single-crystal terbium specimens is also described. (Auth.)

microRNA-146a inhibits G protein-coupled receptor-mediated activation of NF-κB by targeting CARD10 and COPS8 in gastric cancer

DEFF Research Database (Denmark)

Crone, Stephanie Geisler; Jacobsen, Anders; Federspiel, Birgitte

2012-01-01

Gastric cancer is the second most common cause of cancer-related death in the world. Inflammatory signals originating from gastric cancer cells are important for recruiting inflammatory cells and regulation of metastasis of gastric cancer. Several microRNAs (miRNA) have been shown to be involved...... in development and progression of gastric cancer. miRNA-146a (miR-146a) is a modulator of inflammatory signals, but little is known about its importance in gastric cancer. We therefore wanted to identify targets of miR-146a in gastric cancer and examine its biological roles....

Measurement and Evaluation of the Activation Resonance Integral of 146Nd, 148Nd and 150Nd

International Nuclear Information System (INIS)

Ricabarra, M. D.; Turjanski, R.; Ricabarra, G. H.

2012-01-01

Values of the ratio of the reduced activation resonance integral to the thermal cross section, I'/σ 0 of 146 Nd, 148 Nd and 150 Nd were determined relative to gold by measuring cadmium ratios. A lithium-drifted germanium gamma ray spectrometer was used to resolve the activities of the irradiated samples. The results are for 146 Nd I'/σ 0 = 1.42±0.1 0 and with an assumed σ 0 = 1.4 barn, I' = 1 .99±0.20; for 148 Nd I'/ σ 0 = 4.22±0.1 4 and with an assumed σ 0 = 2.5 barn, I' = 10.5±0. 9 barn, and for 150 Nd I'/σ 0 = 13.7±0. 8 and with an assumed σ 0 = 1.2 barn, I' = 16.4±2.8. The resolved and unresolved epithermal integrals of 146 Nd, 148 Nd and 150 Nd were calculated. Values of the spectral correction factor were also calculated, so the resonance integral could be obtained from the epithermal integral data measured in our reactor spectrum in this experiment. Epithermal integral and spectral correction factors are listed in the text. The most important result of this investigation is that the 148 Nd activation reduced resonance integral is about half of the previously recommended value and consequently the radiative width for 148 Nd is also about half of the previously accepted value. (author)

Structure of the neutral capsular polysaccharide of Acinetobacter baumannii NIPH146 that carries the KL37 capsule gene cluster.

Science.gov (United States)

Arbatsky, Nikolay P; Shneider, Mikhail M; Kenyon, Johanna J; Shashkov, Alexander S; Popova, Anastasiya V; Miroshnikov, Konstantin A; Volozhantsev, Nikolay V; Knirel, Yuriy A

2015-09-02

Capsular polysaccharide (CPS) was isolated from Acinetobacter baumannii NIPH146, and the following structure of branched pentasaccharide repeating unit was established by sugar analyses along with 1D and 2D NMR spectroscopy: In comparison to most other known capsular polysaccharides of A. baumannii, the CPS studied is neutral and lacks any specific monosaccharide component. The synthesis, assembly and export of this structure could be attributed to genes in a novel capsule biosynthesis gene cluster, designated KL37, which was found in the NIPH146 genome. The CPS of A. baumannii NIPH146 shares the α-d-Galp-(1→6)-β-d-Glcp-(1→3)-d-GalpNAc-(1→ trisaccharide fragment with the CPS units of several A. baumannii strains, including ATCC 17978 and LUH 5537 that carry the KL3 and KL22 gene clusters, respectively. KL37 contains two genes for glycosyltransferases that are related to two glycosyltransferase genes present in both KL3 and KL22, and the encoded proteins could be tentatively assigned to linkages between sugars in the CPS repeat. Copyright © 2015 Elsevier Ltd. All rights reserved.

Decrease of miR-146b-5p in monocytes during obesity is associated with loss of the anti-inflammatory but not insulin signaling action of adiponectin.

Directory of Open Access Journals (Sweden)

Maarten Hulsmans

Full Text Available BACKGROUND: Low adiponectin, a well-recognized antidiabetic adipokine, has been associated with obesity-related inflammation, oxidative stress and insulin resistance. Globular adiponectin is an important regulator of the interleukin-1 receptor-associated kinase (IRAK/NFκB pathway in monocytes of obese subjects. It protects against inflammation and oxidative stress by inducing IRAK3. microRNA (miR-146b-5p inhibits NFκB-mediated inflammation by targeted repression of IRAK1 and TNF receptor-associated factor-6 (TRAF6. Therefore, we measured the expression of miR-146b-5p in monocytes of obese subjects. Because it was low we determined the involvement of this miR in the anti-inflammatory, antioxidative and insulin signaling action of globular adiponectin. METHODS: miR-146b-5p expression in monocytes of obese subjects was determined by qRT-PCR. The effect of miR-146b-5p silencing on molecular markers of inflammation, oxidative stress and insulin signaling and the association with globular adiponectin was assessed in human THP-1 monocytes. RESULTS: miR-146b-5p was downregulated in monocytes of obese persons. Low globular adiponectin decreased miR-146b-5p and IRAK3 in THP-1 monocytes, associated with increased mitochondrial reactive oxygen species (ROS. Intracellular ROS and insulin receptor substrate-1 (IRS1 protein were unchanged. Silencing of miR-146b-5p with an antisense inhibitor resulted in increased expression of IRAK1 and TRAF6 leading to more NFκB p65 DNA binding activity and TNFα. As a response IRAK3 and IRS1 protein increased. Mitochondrial and intracellular ROS production did not increase despite more inflammation. In addition, exposure of miR-146b-5p-depleted THP-1 monocytes to high levels of globular adiponectin resulted in an increased production of TNFα and intracellular ROS. Still, they did not lose their potential to increase IRAK3 and IRS1 protein and to decrease mitochondrial ROS. CONCLUSION: miR-146b-5p, decreased in monocytes

42 CFR 84.146 - Method of measuring the power and torque required to operate blowers.

Science.gov (United States)

2010-10-01

... 42 Public Health 1 2010-10-01 2010-10-01 false Method of measuring the power and torque required... RESPIRATORY PROTECTIVE DEVICES Supplied-Air Respirators § 84.146 Method of measuring the power and torque.... These are used to facilitate timing. To determine the torque or horsepower required to operate the...

The potential of chitosan in enhancing peptide and protein absorption across the TR146 cell culture model-an in vitro model of the buccal epithelium

DEFF Research Database (Denmark)

Portero, Ana; Remuñán-López, Carmen; Nielsen, Hanne Mørck

2002-01-01

To investigate the potential of chitosan (CS) to enhance buccal peptide and protein absorption, the TR146 cell culture model, a model of the buccal epithelium, was used.......To investigate the potential of chitosan (CS) to enhance buccal peptide and protein absorption, the TR146 cell culture model, a model of the buccal epithelium, was used....

The NF-κB family member RelB regulates microRNA miR-146a to suppress cigarette smoke-induced COX-2 protein expression in lung fibroblasts.

Science.gov (United States)

Zago, Michela; Rico de Souza, Angela; Hecht, Emelia; Rousseau, Simon; Hamid, Qutayba; Eidelman, David H; Baglole, Carolyn J

2014-04-21

Diseases due to cigarette smoke exposure, including chronic obstructive pulmonary disease (COPD) and lung cancer, are associated with chronic inflammation typified by the increased expression of cyclooxygenase-2 (COX-2) protein. RelB is an NF-κB family member that suppresses cigarette smoke induction of COX-2 through an unknown mechanism. The ability of RelB to regulate COX-2 expression may be via miR-146a, a miRNA that attenuates COX-2 in lung fibroblasts. In this study we tested whether RelB attenuation of cigarette smoke-induced COX-2 protein is due to miR-146a. Utilizing pulmonary fibroblasts deficient in RelB expression, together with siRNA knock-down of RelB, we show the essential role of RelB in diminishing smoke-induced COX-2 protein expression despite robust activation of the canonical NF-κB pathway and subsequent induction of Cox-2 mRNA. RelB did not regulate COX-2 protein expression at the level of mRNA stability. Basal levels of miR-146a were significantly lower in Relb-deficient cells and cigarette smoke increased miR-146a expression only in Relb-expressing cells. Inhibition of miR-146a had no effects on Relb expression or induction of Cox-2 mRNA by cigarette smoke but significantly increased COX-2 protein. These data highlight the potential of a RelB-miR-146a axis as a novel regulatory pathway that attenuates inflammation in response to respiratory toxicants. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

The assessment of CD146-based cell sorting and telomere length analysis for establishing the identity of mesenchymal stem cells in human umbilical cord [v2; ref status: indexed, http://f1000r.es/48d

Directory of Open Access Journals (Sweden)

Dimitrios Kouroupis

2014-08-01

Full Text Available Adult stem cells are characterised by longer telomeres compared to mature cells from the same tissue. In this study, candidate CD146+ umbilical cord (UC mesenchymal stem cells (MSCs were purified by cell sorting from UC tissue digests and their telomere lengths were measured in comparison to donor-matched CD146-negative fraction.   UC tissue fragments were enzymatically treated with collagenase and the cells were used for cell sorting, colony-forming fibroblast (CFU-F assay or for long-term MSC cultivation. Telomere lengths were measured by qPCR in both culture-expanded MSCs and candidate native UC MSCs. Immunohistochemistry was undertaken to study the topography of CD146+ cells.   Culture-expanded UC MSCs had a stable expression of CD73, CD90 and CD105, whereas CD146 declined in later passages which correlated with the shortening of telomeres in the same cultures. In five out of seven donors, telomeres in candidate native UC MSCs (CD45-CD235α-CD31-CD146+ were longer compared to donor-matched CD146- population (CD45-CD235α-CD31-CD146-. The frequency of CD45-CD235α-CD31-CD146+ cells measured by flow cytometry was ~1000-fold above that of CFU-Fs (means 10.4% and 0.01%, respectively. CD146+ cells were also abundant in situ having a broad topography including high levels of positivity in muscle areas in addition to vessels.   Although qPCR-based telomere length analysis in sorted populations could be limited in its sensitivity, very high frequency of CD146+ cells in UC tissue suggests that CD146 expression alone is unlikely to be sufficient to identify and purify native MSCs from the UC tissue.

Comparison of inclusive particle production in 14.6 GeV/c proton-nucleus collisions with simulation

International Nuclear Information System (INIS)

Jaffe, D.E.; Lo, K.H.; Comfort, J.R.; Sivertz, M.

2006-01-01

Inclusive charged pion, kaon, proton and deuteron production in 14.6 GeV/c proton-nucleus collisions measured by BNL experiment E802 is compared with results from the GEANT3, GEANT4 and FLUKA simulation packages. The FLUKA package is found to have the best overall agreement

Particle production in Si + A and p + A collisions at 14.6 A·GeV/c

International Nuclear Information System (INIS)

Miake, Y.

1990-01-01

Particle production (π ± , K ± , p) has been measured in both Si+A and p+A collisions at 14.6 A·GeV/c. Comparisons of m t and dn/dy distributions between p+Be, p+Au and central Si+Au collisions are discussed. 8 refs., 3 figs

Increasing of miR-148a 0061nd Decreasing of miR-146a Gene Expression in the Stomach with Ageing in Men

Directory of Open Access Journals (Sweden)

Shirin Abdolvand

2017-06-01

Full Text Available Abstract Background: The incidence of gastric cancer is different in two sexes with ratio 2 to 1 that it is more common in men. The most important biologically reason is sexual hormones between two sexes that lead to sexual dimorphism and in turn can cause a sex bias in incidence of disease between two sexes. Recently, studies have shown that microRNA is involved in sexual dimorphism in gene expression. Given the sexual dimorphism in the incidence of gastric cancer and sex hormones response elements in the regulatory regions of miR-146a and miR-148a genes, in this study, the expression of these two genes in the stomach of healthy men and women at different age groups were compared. Materials and Methods: Using endoscopy, gastric antrum tissues of 35 healthy women and 35 healthy men were collected. After RNA extraction and synthesis of cDNA, the expression of miR-146a and miR-148a genes were compared between sexes by Real time RT-PCR and data were analyzed using independent sample t and ANOVA tests. Results: There was no difference between men and women in genes expression of miR-146a and miR-148a. However, expression of miR-146a gene was significantly more in men under 45 years than men over 45 years (p= 0.017, df= 14, t= 1.47. Also, expression of miR-148a gene was significantly more in men over 45 years than men under 45 years (p=0.001, df= 12, t= 1.28. But the expression of both genes had no significant difference between women under 45 years and women over 45 years. Conclusion: Expression of miR-146a and miR-148a genes in the stomach is increased and decreased with aging in men, respectively.

Development of frequency step tunable 1 MW gyrotron at 131 to 146.5 GHz

Energy Technology Data Exchange (ETDEWEB)

Samartsev, A.; Gantenbein, G.; Dammertz, G.; Illy, S.; Kern, S.; Leonhardt, W.; Schlaich, A.; Schmid, M.; Thumm, M., E-mail: andrey.samartsev@kit.edu [Karlsruhe Institute of Technology, Association EURATOM-KIT, Karlsruhe (Germany)

2011-07-01

Effective control of power absorption in tokamaks and stellarators could be achieved by the frequency tuning of ECH and CD power delivered by high-power gyrotrons. In this report some results of the development of a frequency tunable gyrotron with fused-silica Brewster window are presented. Excitation of several modes at 1 MW power level in the range of frequencies from 131 to 146.5 GHz is achieved. (author)

Effect of Polymorphisms at Codon 146 of the Goat PRNP Gene on Susceptibility to Challenge with Classical Scrapie by Different Routes.

Science.gov (United States)

Papasavva-Stylianou, Penelope; Simmons, Marion Mathieson; Ortiz-Pelaez, Angel; Windl, Otto; Spiropoulos, John; Georgiadou, Soteria

2017-11-15

This report presents the results of experimental challenges of goats with scrapie by both the intracerebral (i.c.) and oral routes, exploring the effects of polymorphisms at codon 146 of the goat PRNP gene on resistance to disease. The results of these studies illustrate that while goats of all genotypes can be infected by i.c. challenge, the survival distribution of the animals homozygous for asparagine at codon 146 was significantly shorter than those of animals of all other genotypes (chi-square value, 10.8; P = 0.001). In contrast, only those animals homozygous for asparagine at codon 146 (NN animals) succumbed to oral challenge. The results also indicate that any cases of infection in non-NN animals can be detected by the current confirmatory test (immunohistochemistry), although successful detection with the rapid enzyme-linked immunosorbent assay (ELISA) was more variable and dependent on the polymorphism. Together with data from previous studies of goats exposed to infection in the field, these data support the previously reported observations that polymorphisms at this codon have a profound effect on susceptibility to disease. It is concluded that only animals homozygous for asparagine at codon 146 succumb to scrapie under natural conditions. IMPORTANCE In goats, like in sheep, there are PRNP polymorphisms that are associated with susceptibility or resistance to scrapie. However, in contrast to the polymorphisms in sheep, they are more numerous in goats and may be restricted to certain breeds or geographical regions. Therefore, eradication programs must be specifically designed depending on the identification of suitable polymorphisms. An initial analysis of surveillance data suggested that such a polymorphism in Cypriot goats may lie in codon 146. In this study, we demonstrate experimentally that NN animals are highly susceptible after i.c. inoculation. The presence of a D or S residue prolonged incubation periods significantly, and prions were detected

Altered spinal microRNA-146a and the microRNA-183 cluster contribute to osteoarthritic pain in knee joints.

Science.gov (United States)

Li, Xin; Kroin, Jeffrey S; Kc, Ranjan; Gibson, Gary; Chen, Di; Corbett, Grant T; Pahan, Kalipada; Fayyaz, Sana; Kim, Jae-Sung; van Wijnen, Andre J; Suh, Joon; Kim, Su-Gwan; Im, Hee-Jeong

2013-12-01

The objective of this study was to examine whether altered expression of microRNAs in central nervous system components is pathologically linked to chronic knee joint pain in osteoarthritis. A surgical animal model for knee joint OA was generated by medial meniscus transection in rats followed by behavioral pain tests. Relationships between pathological changes in knee joint and development of chronic joint pain were examined by histology and imaging analyses. Alterations in microRNAs associated with OA-evoked pain sensation were determined in bilateral lumbar dorsal root ganglia (DRG) and the spinal dorsal horn by microRNA array followed by individual microRNA analyses. Gain- and loss-of-function studies of selected microRNAs (miR-146a and miR-183 cluster) were conducted to identify target pain mediators regulated by these selective microRNAs in glial cells. The ipsilateral hind leg displayed significantly increased hyperalgesia after 4 weeks of surgery, and sensitivity was sustained for the remainder of the 8-week experimental period (F = 341, p pain was correlated with pathological changes in the knee joints as assessed by histological and imaging analyses. MicroRNA analyses showed that miR-146a and the miR-183 cluster were markedly reduced in the sensory neurons in DRG (L4/L5) and spinal cord from animals experiencing knee joint OA pain. The downregulation of miR-146a and/or the miR-183 cluster in the central compartments (DRG and spinal cord) are closely associated with the upregulation of inflammatory pain mediators. The corroboration between decreases in these signature microRNAs and their specific target pain mediators were further confirmed by gain- and loss-of-function analyses in glia, the major cellular component of the central nervous system (CNS). MicroRNA therapy using miR-146a and the miR-183 cluster could be powerful therapeutic intervention for OA in alleviating joint pain and concomitantly regenerating peripheral knee joint cartilage. © 2013

Physico-chemical characterization of terbium-161-chloride (161TbCl3) radioisotope from irradiated natural gadolinium oxide target

International Nuclear Information System (INIS)

Azmairit Aziz; Nana Suherman

2015-01-01

Currently cancer patients are increasing every year in Indonesia and become the third leading cause of death after heart disease and high blood pressure. Terbium-161 ( 161 Tb) is a low β- emitter (E β - = 0.155 MeV, T 1/2 = 6.9 d) and very similar to 177 Lu in terms of half-life, E β - energy and chemical properties.However, 161 Tb also ejects internal conversion electrons and Auger electrons which can provide a greater therapeutic effect than 177 Lu. Radioisotope of 161 Tb can be produced as a carrier-free for use in labeling of biomolecules as a targeted radiopharmaceutical for cancer therapy. 161 Tb was obtained through 160 Gd(n,γ) 161 Tb nuclear reaction by thermal neutron bombardment on 100 mg of natural gadolinium oxide target in RSG-G.A. Siwabessy at a thermal neutron flux of ~10 14 n.cm -2 .s -1 and followed by radiochemical separation of 161 Tb from Gd isotopes using extraction chromatography method. The physico-chemical characterization of 161 TbCl 3 solution was studied by determination of its radionuclide purity by means of a γ-rays spectrometry with HP-Ge detector coupled to a multichannel analyzer (MCA). Radiochemical purity was determined using paper chromatography and paper electrophoresis methods. The results showed that 161 TbCl 3 radioisotope has a pH of 2, radiochemical purity of 99.64 ± 0.34%, radionuclide purity of 99.69 ± 0.20%, specific activity and radioactive concentration at the end of irradiation (EOI) of 2.26 – 5.31 Ci/mg and 3.84 – 9.03 mCi/mL, respectively. 161 TbCl 3 solution stable for 3 weeks at room temperature with a radiochemical purity of 98.41 ± 0.42%. 161 TbCl 3 solution from irradiated natural gadolinium oxide target has the physico-chemical characteristic that meets the requirements for use as a precursor in preparation of radiopharmaceuticals. (author)

Association of MiRNA-146a, MiRNA-499, IRAK1 and PADI4 Polymorphisms with Rheumatoid Arthritis in Egyptian Population

Directory of Open Access Journals (Sweden)

Olfat Gamil Shaker

2018-05-01

Full Text Available Background/Aims: Rheumatoid arthritis (RA is a systemic autoimmune disease affecting up to 1% of the population worldwide. The aim of the present study was to investigate whether miRNA-146a rs2910164, miRNA-499 rs3746444, IRAK1 rs3027898 and PADI4 rs1748033 polymorphisms are associated with susceptibility to RA in Egyptians and whether they influence disease severity and activity. Methods: The study was performed on 104 unrelated RA patients and 112 healthy subjects. RA patients were further subdivided into active and inactive RA groups. Polymorphisms were genotyped by using real-time polymerase chain reaction with TaqMan allelic discrimination assay. Results: Significant differences in the frequency of miRNA-146a rs2910164, miRNA-499 rs3746444, IRAK1 rs3027898 and PADI4 rs1748033 alleles and genotypes were observed between RA patients and controls. Only CA and AA genotypes of IRAK1 rs3027898 shows a significant difference between active and inactive subgroups. MiRNA-146a rs2910164 and IRAK1 rs3027898 polymorphisms were a risk factor for predisposition to RA in codominant and dominant tested inheritance models, while, the miRNA-499 rs3746444 and PADI4 rs1748033 polymorphisms were a risk factor in codominant and recessive one. CG and GG genotypes of miRNA-146a rs2910164 were associated with positive erosions. CA genotype of IRAK1 rs3027898 was associated with low disease activity and negative erosions, while, the AA genotype was associated with high disease activity. CC genotype of PADI4 rs1748033 was associated with negative rheumatoid factor. Conclusion: The 4 studied SNPs were likely to play an important role in the susceptibility to RA and can influence disease severity and activity in Egyptian population.

Natural killer cells inhibit oxaliplatin-resistant colorectal cancer by repressing WBSCR22 via upregulating microRNA-146b-5p.

Science.gov (United States)

Zhao, Haiyan; Su, Wuyun; Kang, Qingmei; Xing, Ze; Lin, Xue; Wu, Zhongjun

2018-01-01

Natural killer (NK) cells have exhibited promising efficacy in inhibiting cancer growth. We aimed to explorer the effect of NK cells on oxaliplatin-resistant colorectal cancer and the underlying molecular mechanism. Oxaliplatin-resistant colorectal cancer cell lines were co-cultured with NK cells to evaluate the effect on viability, proliferation, migration and invasion in vitro . Oxaliplatin-resistant colorectal cancer cells were also co-injected with NK cells into mice to establish xenograft tumor model, to assess the in vivo effect of NK cells on tumorigenesis of the oxaliplatin-resistant colorectal cancer cells. Expression of WBSCR22 gene was assessed in the oxaliplatin-resistant colorectal cancer cells following NK cell treatment to elucidate the mechanism. NK cell treatment significantly reduces growth of oxaliplatin-resistant colorectal cancer cells both in vitro and in vivo , as well as reduced WBSCR22 expression. MicroRNAs potentially targeting WBSCR22 were analyzed, and microRNA-146b-5p was found to be significantly upregulated following NK cell treatment. MicroRNA-146b-5p directly targeted WBSCR22 mRNA 3'-UTR to inhibit its expression, which was required for NK cell-induced inhibition of oxaliplatin-resistant colorectal cancer cell lines. NK cells inhibit oxaliplatin-resistant colorectal cancer by repressing WBSCR22 via upregulating microRNA-146b-5p, both of which could serve as candidates for targeted therapy against oxaliplatin-resistant colorectal cancer.

A Broad G Protein-Coupled Receptor Internalization Assay that Combines SNAP-Tag Labeling, Diffusion-Enhanced Resonance Energy Transfer, and a Highly Emissive Terbium Cryptate.

Science.gov (United States)

Levoye, Angélique; Zwier, Jurriaan M; Jaracz-Ros, Agnieszka; Klipfel, Laurence; Cottet, Martin; Maurel, Damien; Bdioui, Sara; Balabanian, Karl; Prézeau, Laurent; Trinquet, Eric; Durroux, Thierry; Bachelerie, Françoise

2015-01-01

Although G protein-coupled receptor (GPCR) internalization has long been considered as a major aspect of the desensitization process that tunes ligand responsiveness, internalization is also involved in receptor resensitization and signaling, as well as the ligand scavenging function of some atypical receptors. Internalization thus contributes to the diversity of GPCR-dependent signaling, and its dynamics and quantification in living cells has generated considerable interest. We developed a robust and sensitive assay to follow and quantify ligand-induced and constitutive-induced GPCR internalization but also receptor recycling in living cells. This assay is based on diffusion-enhanced resonance energy transfer (DERET) between cell surface GPCRs labeled with a luminescent terbium cryptate donor and a fluorescein acceptor present in the culture medium. GPCR internalization results in a quantifiable reduction of energy transfer. This method yields a high signal-to-noise ratio due to time-resolved measurements. For various GPCRs belonging to different classes, we demonstrated that constitutive and ligand-induced internalization could be monitored as a function of time and ligand concentration, thus allowing accurate quantitative determination of kinetics of receptor internalization but also half-maximal effective or inhibitory concentrations of compounds. In addition to its selectivity and sensitivity, we provided evidence that DERET-based internalization assay is particularly suitable for characterizing biased ligands. Furthermore, the determination of a Z'-factor value of 0.45 indicates the quality and suitability of DERET-based internalization assay for high-throughput screening (HTS) of compounds that may modulate GPCRs internalization.

Therapeutic use of radioactive isotopes

CERN Document Server

Caroline Duc

2013-01-01

In December, researchers from ISOLDE-CERN, the Paul Scherrer Institute (PSI) and the Institut Laue-Langevin (ILL) published the results of an in vivo study which successfully proved the effectiveness of four terbium isotopes for diagnosing and treating cancerous tumours.   Four terbium isotopes suitable for clinical purposes. “ISOLDE is the only installation capable of supplying terbium isotopes of such purity and intensity in the case of three out of the four types used in this study,” explains Karl Johnson, a physicist at ISOLDE.  “Producing over a thousand different isotopes, our equipment offers the widest choice of isotopes in the world!” Initially intended for fundamental physics research, ISOLDE has diversified its activities over time to invest in various projects in the materials science, biochemistry and nuclear medicine fields. The proof-of-concept study has confirmed that the four terbium isotopes 149Tb, 152Tb, 155Tb produ...

Genetic profile of scrapie codons 146, 211 and 222 in the PRNP gene locus in three breeds of dairy goats.

Science.gov (United States)

Vouraki, Sotiria; Gelasakis, Athanasios I; Alexandri, Panoraia; Boukouvala, Evridiki; Ekateriniadou, Loukia V; Banos, Georgios; Arsenos, Georgios

2018-01-01

Polymorphisms at PRNP gene locus have been associated with resistance against classical scrapie in goats. Genetic selection on this gene within appropriate breeding programs may contribute to the control of the disease. The present study characterized the genetic profile of codons 146, 211 and 222 in three dairy goat breeds in Greece. A total of 766 dairy goats from seven farms were used. Animals belonged to two indigenous Greek, Eghoria (n = 264) and Skopelos (n = 287) and a foreign breed, Damascus (n = 215). Genomic DNA was extracted from blood samples from individual animals. Polymorphisms were detected in these codons using Real-Time PCR analysis and four different Custom TaqMan® SNP Genotyping Assays. Genotypic, allelic and haplotypic frequencies were calculated based on individual animal genotypes. Chi-square tests were used to examine Hardy-Weinberg equilibrium state and compare genotypic distribution across breeds. Genetic distances among the three breeds, and between these and 30 breeds reared in other countries were estimated based on haplotypic frequencies using fixation index FST with Arlequin v3.1 software; a Neighbor-Joining tree was created using PHYLIP package v3.695. Level of statistical significance was set at P = 0.01. All scrapie resistance-associated alleles (146S, 146D, 211Q and 222K) were detected in the studied population. Significant frequency differences were observed between the indigenous Greek and Damascus breeds. Alleles 222K and 146S had the highest frequency in the two indigenous and the Damascus breed, respectively (ca. 6.0%). The studied breeds shared similar haplotypic frequencies with most South Italian and Turkish breeds but differed significantly from North-Western European, Far East and some USA goat breeds. Results suggest there is adequate variation in the PRNP gene locus to support breeding programs for enhanced scrapie resistance in goats reared in Greece. Genetic comparisons among goat breeds indicate that separate

40 CFR 264.146 - Use of a mechanism for financial assurance of both closure and post-closure care.

Science.gov (United States)

2010-07-01

... facilities by using a trust fund, surety bond, letter of credit, insurance, financial test, or corporate... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Use of a mechanism for financial... HAZARDOUS WASTE TREATMENT, STORAGE, AND DISPOSAL FACILITIES Financial Requirements § 264.146 Use of a...

TR146 cells grown on filters as a model of human buccal epithelium

DEFF Research Database (Denmark)

Nielsen, Hanne Mørck; Verhoef, J C; Ponec, M

1999-01-01

The aim of the present study was to characterize the TR146 cell culture model as an in vitro model of human buccal epithelium with respect to the permeability of test substances with different molecular weights (M(w)). For this purpose, the apparent permeability (P(app)) values for mannitol...... and for fluorescein isothiocyanate (FITC)-labelled dextrans (FD) with various M(w) (4000-40000) were compared to the P(app) values obtained using porcine buccal mucosa as an in vitro model of the human buccal epithelium. The effect of 10 mM sodium glycocholate (GC) on the P(app) values was examined. To identify...

Function of miR-146a-5p in Tumor Cells As a Regulatory Switch between Cell Death and Angiogenesis: Macrophage Therapy Revisited

Directory of Open Access Journals (Sweden)

Elina Simanovich

2018-01-01

Full Text Available Tumors survive and progress by evading killing mechanisms of the immune system, and by generating a tumor microenvironment (TME that reprograms macrophages in situ to produce factors that support tumor growth, angiogenesis, and metastasis. We have previously shown that by blocking the translation of the enzyme inducible nitric oxide synthase (iNOS, miR-146a-5p inhibits nitric oxide (NO production in a mouse renal carcinoma cell line (RENCA, thereby endowing RENCA cells with resistance to macrophage-induced cell death. Here, we expand these findings to the mouse colon carcinoma CT26 cell line and demonstrate that neutralizing miR-146a-5p’s activity by transfecting both RENCA and CT26 cells with its antagomir restored iNOS expression and NO production and enhanced susceptibility to macrophage-induced cell death (by 48 and 25%, respectively, p < 0.001. Moreover, miR-146a-5p suppression simultaneously inhibited the expression of the pro-angiogenic protein EMMPRIN (threefolds, p < 0.001, leading to reduced MMP-9 and vascular endothelial growth factor secretion (twofolds and threefolds, respectively, p < 0.05, and reduced angiogenesis, as estimated by in vitro tube formation and scratch assays. When we injected tumors with pro-inflammatory-stimulated RAW 264.7 macrophages together with i.v. injection of the miR-146a-5p antagomir, we found inhibited tumor growth (sixfolds, p < 0.001 and angiogenesis (twofolds, p < 0.01, and increased apoptosis (twofolds, p < 0.01. This combination therapy increased nitrites and reduced TGFβ concentrations in tumor lysates, alleviated immune suppression, and allowed enhanced infiltration of cytotoxic CD8+ T cells. Thus, miR-146a-5p functions as a control switch between angiogenesis and cell death, and its neutralization can manipulate the crosstalk between tumor cells and macrophages and profoundly change the TME. This strategy can be therapeutically utilized in combination with the macrophage

MiR-146b-5p overexpression attenuates stemness and radioresistance of glioma stem cells by targeting HuR/lincRNA-p21/β-catenin pathway

Science.gov (United States)

Yang, Wei; Yu, Hongquan; Shen, Yueming; Liu, Yingying; Yang, Zhanshan; Sun, Ting

2016-01-01

A stem-like subpopulation existed in GBM cells, called glioma stem cells (GSCs), might contribute to cancer invasion, angiogenesis, immune evasion, and therapeutic resistance, providing a rationale to eliminate GSCs population and their supporting niche for successful GBM treatment. LincRNA-p21, a novel regulator of cell proliferation, apoptosis and DNA damage response, is found to be downregulated in several types of tumor. However, little is known about the role of lincRNA-p21 in stemness and radioresistance of GSCs and its regulating mechanisms. In this study, we found that lincRNA-p21 negatively regulated the expression and activity of β-catenin in GSCs. Downregulation of lincRNA-p21 in GSCs was resulted from upregulation of Hu antigen R (HuR) expression caused by miR-146b-5p downregulation. MiR-146b-5p overexpression increased apoptosis and radiosensitivity, decreased cell viability, neurosphere formation capacity and stem cell marker expression, and induced differentiation in GSCs. Moreover, knock-down lincRNA-p21 or HuR and β-catenin overexpression could rescue the phenotypic changes resulted from miR-146b-5p overexpression in GSCs. These findings suggest that targeting the miR-146b-5p/HuR/lincRNA-p21/β-catenin signaling pathway may be valuable therapeutic strategies against glioma. PMID:27166258

A broad G protein-coupled receptor internalization assay that combines SNAP-tag labeling, diffusion-enhanced resonance energy transfer, and a highly emissive terbium cryptate acceptor

Directory of Open Access Journals (Sweden)

Angélique eLEVOYE

2015-11-01

Full Text Available Although G protein-coupled receptor (GPCR internalization has long been considered a major aspect of the desensitization process that tunes ligand responsiveness, internalization is also involved in receptor resensitization and signaling, as well as the ligand scavenging function of some atypical receptors. Internalization thus contributes to the diversity of GPCR-dependent signaling, and its dynamics and quantification in living cells has generated considerable interest. We developed a robust and sensitive assay to follow and quantify ligand-induced and constitutive GPCR internalization but also receptor recycling in living cells. This assay is based on diffusion-enhanced resonance energy transfer (DERET between cell surface GPCRs labeled with a luminescent terbium cryptate donor and a fluorescein acceptor present in the culture medium. GPCR internalization results in a quantifiable reduction of energy transfer. This method yields a high signal-to-noise ratio due to time-resolved measurements. For various GPCRs belonging to different classes, we demonstrated that constitutive and ligand-induced internalization could be monitored as a function of time and ligand concentration, thus allowing accurate quantitative determination of kinetics of receptor internalization but also half-maximal effective or inhibitory concentrations of compounds. In addition to its selectivity and sensitivity, we provided evidence that DERET-based internalization assay is particularly suitable for characterizing biased ligands. Furthermore, the determination of a Z’-factor value of 0.45 indicates the quality and suitability of DERET-based internalization assay for high-throughput screening (HTS of compounds that may modulate GPCRs internalization.

Multi-element analysis of crude-oil samples by 14.6 MeV neutron activation

International Nuclear Information System (INIS)

Cam, N.F.; Cigeroglu, F.; Erduran, M.N.

1997-01-01

The instrumental neutron activation technique, using the SAMEST T-400 neutron generator with 14.6 MeV neutrons produced from 3 H(d,n) 4 He reaction, is demonstrated for multi-element analysis of Saudi-Arabian crude-oil samples. The system parameters for the absolute method (e.g., the counting solid-angle, intrinsic efficiency of the γ-ray detector, effective neutron flux, activation cross sections, etc.)were determined and the results of elemental concentrations were presented with the corrections for all possible interferences having been carefully considered. (author)

Analysis of pion production data from E-802 at 14.6 GeV/c using ARC

International Nuclear Information System (INIS)

Kahana, D.; Torun, Yagmur

1995-07-01

We compared the invariant cross sections for pion production by a 14.6 GeV/c proton beam on Be, Al, Cu and Au targets from the measurements of Abbott et.al. with predictions of the ARC program. The agreement was found to be good in the region where data exists. Most pions are found at low momenta in the lab frame. Unfortunately very little data exists for low momentum pions

An ICP AES method for determination of dysprosium and terbium in high purity yttrium oxide

International Nuclear Information System (INIS)

Rupawate, V.H.; Hareendran, K.N.; Roy, S.B.

2011-01-01

High purity yttrium finds interesting application in astronavigation, luminescence, nuclear energy and metallurgical industries. Most of these applications require yttrium oxide of highest purity. Consequently there is a need for production of high purity yttrium oxide. Separation and purification of yttrium from other rare earths is a challenging task due to their close chemical properties. Liquid-liquid extraction and ion exchange have been widely used in the production of yttrium oxide of highest purity. Determination of impurities, especially other rare earths, in ppm level is required for process development and chemical characterization of the high purity Y 2 O 3 . Many methods have been described in literature. However since the advent of ICP AES much work in this area has been carried out by this technique. This paper describes the work done for determination of dysprosium (Dy) and terbium (Tb) in yttrium oxide using a high resolution sequential ICP AES. Emission spectra of rare earth elements are very complex and due to this complexity it is important to select spectral interference free analyte lines for determination of rare earths in rare earth matrix. For the determination of Dy and Tb in Y 2 O 3 , sensitive lines of Dy and Tb are selected from the instrument wavelength table and spectral interference free emission lines for the determination is selected by scanning around the selected wavelengths using 5 g/L Y solution and 5 mg/L standard solutions of Dy and Tb prepared in 4% nitric acid. It is found 353.170 nm line of Dy and 350.917 nm line Tb is suitable for quantitative determination. The signal to background ratio increases with increase in matrix concentration, i.e. from 1 to 5 mg/L. The optimum forward power is determined and it is found to be 1100W for Dy and 1000W for Tb. The instrument is calibrated using matrix matched standards containing 5g/L of Y matrix. Samples are dissolved in nitric acid and Y concentration is maintained at 5g/L. Two

24 CFR 943.146 - What impact does the use of a subsidiary, affiliate, or joint venture have on financial...

Science.gov (United States)

2010-04-01

... subsidiary, affiliate, or joint venture have on financial accountability to HUD and the Federal government... URBAN DEVELOPMENT PUBLIC HOUSING AGENCY CONSORTIA AND JOINT VENTURES Subsidiaries, Affiliates, Joint Ventures in Public Housing § 943.146 What impact does the use of a subsidiary, affiliate, or joint venture...

Study of intermittency of target fragments in the interactions of 28Si-Em collisions at 14.6 A GeV

International Nuclear Information System (INIS)

Ayaz Ahmad, M.; Ashraf T, M.; Ahmad, Shafiq

2008-01-01

An attempt has been made to investigate the intermittent behaviour and fractal properties of emission spectra of fast and slow target associated particles from 28 Si-emulsion interactions at 14.6 A GeV using nuclear emulsion in cosθ phase space

MiR-146a rs2910164 polymorphism increases the risk of digestive system cancer: A meta-analysis.

Science.gov (United States)

Xie, Wen Qun; Wang, Xiao Fan

2017-02-01

There is merging evidence suggesting that the miR-146a polymorphism might be associated with susceptibility to digestive system cancer. However, previous published studies have failed to achieve a definitive conclusion. To address this issue, an updated meta-analysis was performed. A comprehensive electronic search was conducted using the following source to identify the eligible studies: PubMed, Embase, China BioMedicine, the Cochrane Library, and Google Scholar. Odds ratios and its corresponding 95% confidence interval (CI) was used in the quantitative synthesis. The database search identified 1344 eligible studies, of which 32 (comprising 12,541 cases and 15,925 controls) were included. The results indicate that the miR-146a rs2910164 polymorphism was significantly associated with increased risk of digestive system cancer in heterozygote comparison (GC vs. CC: OR=1.15, 95% CI: 1.02-1.30, P=0.02), and recessive model (GG vs. GC+CC: OR=1.11, 95% CI: 1.04-1.17, P=0.006). Subgroup analysis by cancer site revealed increased risk in gastric cancer above heterozygote comparison (GG vs. GC: OR=1.13, 95% CI: 1.02-1.25, P=0.02), and recessive model (GG vs. GC+CC: OR=1.15, 95% CI: 1.04-1.26, P=0.006). Similarly, increased cancer risk was observed in hepatocellular carcinoma when compared with homozygote comparison (GG vs. CC: OR=1.21, 95% CI: 1.04-1.42, P=0.02), heterozygote comparison (GC vs. CC: OR=1.15, 95% CI: 1.02-1.29, P=0.02), and dominant model (GG+GC vs. CC: OR=1.16, 95% CI: 1.04-1.29, P=0.009). When stratified by ethnicity and quality score, increased cancer risks were also observed among Asians, Caucasians and high quality studies subgroup. The current study revealed that miR-146a G/C genetic polymorphism was more likely to be associated with digestive system cancer risk. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Evidence for an Opportunistic and Endophytic Lifestyle of the Bursaphelenchus xylophilus-Associated Bacteria Serratia marcescens PWN146 Isolated from Wilting Pinus pinaster.

Science.gov (United States)

Vicente, Cláudia S L; Nascimento, Francisco X; Barbosa, Pedro; Ke, Huei-Mien; Tsai, Isheng J; Hirao, Tomonori; Cock, Peter J A; Kikuchi, Taisei; Hasegawa, Koichi; Mota, Manuel

2016-10-01

Pine wilt disease (PWD) results from the interaction of three elements: the pathogenic nematode, Bursaphelenchus xylophilus; the insect-vector, Monochamus sp.; and the host tree, mostly Pinus species. Bacteria isolated from B. xylophilus may be a fourth element in this complex disease. However, the precise role of bacteria in this interaction is unclear as both plant-beneficial and as plant-pathogenic bacteria may be associated with PWD. Using whole genome sequencing and phenotypic characterization, we were able to investigate in more detail the genetic repertoire of Serratia marcescens PWN146, a bacterium associated with B. xylophilus. We show clear evidence that S. marcescens PWN146 is able to withstand and colonize the plant environment, without having any deleterious effects towards a susceptible host (Pinus thunbergii), B. xylophilus nor to the nematode model C. elegans. This bacterium is able to tolerate growth in presence of xenobiotic/organic compounds, and use phenylacetic acid as carbon source. Furthermore, we present a detailed list of S. marcescens PWN146 potentials to interfere with plant metabolism via hormonal pathways and/or nutritional acquisition, and to be competitive against other bacteria and/or fungi in terms of resource acquisition or production of antimicrobial compounds. Further investigation is required to understand the role of bacteria in PWD. We have now reinforced the theory that B. xylophilus-associated bacteria may have a plant origin.

Capillary electrophoresis fingerprinting, quantification and mass-identification of various 9-aminopyrene-1,4,6-trisulfonate-derivatized oligomers derived from plant polysaccharides

NARCIS (Netherlands)

Kabel, M.A.; Heijnis, W.H.; Bakx, E.J.; Kuijpers, I.J.; Voragen, A.G.J.; Schols, H.A.

2006-01-01

Various plant polysaccharide derived mono- and oligosaccharides were derivatized with the fluorescent 9-aminopyrene-1,4,6-trisulfonate (APTS) and subjected to capillary electrophoresis (CE) in combination with laser induced fluorescence (LIF) detection. CE-LIF was suitable for mol-based

Study of reaction mechanisms in 40Ar+68Zn interaction at 14.6 and 27.6 MeV/N

International Nuclear Information System (INIS)

Rami, F.

1985-01-01

The competing mechanisms in the 40 Ar+ 68 Zn reaction have been investigated at two bombarding energies: 14.6 and 27.6 MeV/nucleon. Mass, charge and energy spectra of the reaction products have been measured in a large angular range (3 0 0 ). The results show that important changes occur in this energy region. At 14.6 MeV/nucleon the production of the projectile-like fragments results mainly from deep inelastic and direct nucleon transfer reactions; while at 27.6 MeV/nucleon a strong component corresponding to process similar to projectile fragmentation is also observed. A distinction between the fragmentation process and direct transfer of few nucleons has been possible by analysing the linear momentum distributions of the detected fragments. The energy dependance of the fusion cross section indicates that this process should disappear for incident energies E/A > approximately 30 MeV/nucleon. The maximum temperature reached by the compound nucleus has been deduced i.e. Tmax approximately equal 7 MeV; this value is in agreement with recent theoretical predictions [fr

Aneurysm-Specific miR-221 and miR-146a Participates in Human Thoracic and Abdominal Aortic Aneurysms

Directory of Open Access Journals (Sweden)

Premakumari Venkatesh

2017-04-01

Full Text Available Altered microRNA expression is implicated in cardiovascular diseases. Our objective was to determine microRNA signatures in thoracic aortic aneurysms (TAAs and abdominal aortic aneurysms (AAAs compared with control non-aneurysmal aortic specimens. We evaluated the expression of fifteen selected microRNA in human TAA and AAA operative specimens compared to controls. We observed significant upregulation of miR-221 and downregulation of miR-1 and -133 in TAA specimens. In contrast, upregulation of miR-146a and downregulation of miR-145 and -331-3p were found only for AAA specimens. Upregulation of miR-126 and -486-5p and downregulation of miR-30c-2*, -155, and -204 were observed in specimens of TAAs and AAAs. The data reveal microRNA expression signatures unique to aneurysm location and common to both thoracic and abdominal pathologies. Thus, changes in miR-1, -29a, -133a, and -221 are involved in TAAs and miR-145, -146, and -331-3p impact AAAs. This work validates prior studies on microRNA expression in aneurysmal diseases.

Is the largest aqueous gold cluster a superatom complex? Electronic structure & optical response of the structurally determined Au146(p-MBA)57.

Science.gov (United States)

López-Lozano, Xóchitl; Plascencia-Villa, G; Calero, G; Whetten, R L; Weissker, Hans-Christian

2017-12-07

The new water-soluble gold cluster Au 146 (p-MBA) 57 , the structure of which has been recently determined at sub-atomic resolution by Vergara et al., is the largest aqueous gold cluster ever structurally determined and likewise the smallest cluster with a stacking fault. The core presents a twinned truncated octahedron, while additional peripheral gold atoms follow a C 2 rotational symmetry. According to the usual counting rules of the superatom complex (SAC) model, the compound attains a number of 92 SAC electrons if the overall net charge is 3- (three additional electrons). As this is the number of electrons required for a major shell closing, the question arises of whether Au 146 (p-MBA) 57 should be regarded as a superatom complex. Starting from the experimental coordinates we have analyzed the structure using density-functional theory. The optimized (relaxed) structure retains all the connectivity of the experimental coordinates, while removing much of its irregularities in interatomic distances, thereby enhancing the C 2 -symmetry feature. On analyzing the angular-momentum-projected states, we show that, despite a small gap, the electronic structure does not exhibit SAC model character. In addition, optical absorption spectra are found to be relatively smooth compared to the example of the Au 144 (SR) 60 cluster. The Au 146 (SR) 57 does not derive its stability from SAC character; it cannot be considered as a superatom complex.

Study of the role of complete fusion in the reaction of /sup 48/Ca and /sup 56/Fe with cerium and terbium. [Cross sections, yield curves, tables

Energy Technology Data Exchange (ETDEWEB)

Morrissey, D.J.

1978-05-01

/sup 48/Ca and /sup 56/Fe beams from the Super HILAC accelerator were used to irradiate thick metal foils of cerium and terbium. Product gamma ray activities were detected offline and individual products were identified by half-life, gamma ray energy and gamma ray abundances. The production cross sections were iteratively fit to charge and mass dispersions to allow correction for parent decay and calculation of mass yields. From the mass yield curves contributions from quasielastic transfer, deep inelastic transfer and complete fusion reaction mechanisms were interred. Complete fusion was made up on contributions from both evaporation residue and fusion-fission products for the /sup 48/Ca induced reactions. However, only fusion-fission products were detected in the /sup 56/Fe induced reactions. Critical angular momenta for fusion were found to be 82 +- 8 h for /sup 48/Ca + /sup 159/Tb and 34 +- 5 h for /sup 56/Fe + /sup 140/Ce, which can be compared with 53 +- 8 h for /sup 12/C + /sup 197/Au (Natowitz, 1970) and 86 +- 5 h for /sup 40/Ar + /sup 165/Ho (Hanappe, 1973). All of these reactions lead to essentially the same compound nucleus and seem to show the dramatic decline in complete fusion for heavy ions larger than /sup 40/Ar. The prediction of this decline was found to be beyond the model calculations of Bass and the critical distance approach of Glas and Mosel.

Intensities of two-quanta cascades at different excitation energies of compound nuclei 146Nd, 174Yb, 183W

International Nuclear Information System (INIS)

Boneva, S.T.; Khitrov, V.A.; Sukhovoj, A.M.; Vojnov, A.V.

1990-01-01

Intensities of two-quanta cascades are obtained for 2-3 final low-lying levels of the following nuclei 146 Nd, 174 Yb and 183 W. These measured intensities are compared with the intensities calculated in the frame of various models at primary transition energies ranging from 0.5 MeV to the neutron binding energy. Some excitation energy intervals are revealed, experimentally obtained intensities of cascade are inconsistent with model calculations. 15 refs.; 7 figs

Global observables in Si + nucleus collisions at 14.6 GeV per nucleon

International Nuclear Information System (INIS)

Shivakumar, B.; Greene, S.V.; Hemmick, T.K.; Majka, R.; Mitchell, J.T.; Rotondo, F.; Sandweiss, J.; Barrette, J.; Mark, S.K.; Pruneau, C.; Bellwied, R.; Braun-Munzinger, P.; David, G.; Herrmann, N.; Ingold, G.; Llope, W.J.; Muthuswamy, M.; Stachel, J.; Waters, L.; Cleland, W.E.; Jayananda, K.; Kraus, D.; Sonnadara, U.; Fatyga, M.; Hogue, R.W.; Lissauer, D.; Ludlam, T.; Makowiecki, D.; O'Brien, E.; Polychronakos, V.; Takai, H.; Throwe, T.; Woody, C.; Fox, D.; Sunier, J.; Van Hecke, H.; Hall, J.; Wolfe, D.; Heifetz, R.; Rawool-Sullivan, M.; Simon, J.; Sullivan, J.P.; Wolf, K.

1990-01-01

A simultaneous determination of the transverse energy produced, and the multiplicity of beam rapidity nucleons surviving nucleus interactions provides an effective way to quantify the extent of stopping achieved therein. The authors have studied collisions between 28 Si projectiles with energies E lab /A = 14.6 GeV and targets of Al, Cu, and Pb. Transverse energy production has been measured calorimetrically in a pseudorapidity interval -0.5 < η < 0.8, and correlated with the multiplicity of beam rapidity protons and neutrons detected in a 0.8 degree cone centered on the beam direction. Theoretical calculations have been performed to describe the data, and demonstrate quantitatively the large amount of nuclear stopping in these collisions. They also indicate the importance of rescattering in the production of transverse energy

Results of the radiological survey at 146 W. Central Avenue, Maywood, New Jersey (MJ034)

International Nuclear Information System (INIS)

Foley, R.D.; Carrier, R.F.

1989-11-01

Maywood Chemical Works (MCW) of Maywood, New Jersey, generated process wastes and residues associated with the production and reining of thorium and thorium compounds from monazite ores from 1916 to 1956. MCW supplied rare earth metals and thorium compounds to the Atomic Energy Commission and various other government agencies from the late 1940s to the mid-1950s. Area residents used the sandlike waste from this thorium extraction process mixed with tea and cocoa leaves as mulch in their yards. Some of these contaminated wastes were also eroded from the site into Lodi Brook. At the request of the US Department of Energy (DOE), a group from OaK Ridge National Laboratory conducts investigative radiological surveys of properties in the vicinity of MCW to determine whether a property is contaminated with radioactive residues, principally 232 Th, derived from the MCW site. These surveys typically include direct measurement of gamma radiation levels and soil sampling for radionuclide analyses. The survey of this site, a private property at 146 West Central Avenue, Maywood, New Jersey (MJ034), was conducted during 1987 and 1988. While some measurements at this property were greater than background levels typically encountered in the New jersey area, no radiation levels nor radionuclide concentrations exceeded the guidelines established by the DOE for the Maywood, New Jersey, area remedial action plan. However, because of the proximity of the railroad property, which will be remediated, and the DOE's ALARA (As Low As Reasonably Achievable) policy, concurrent removal of the slightly elevated soil layers at 146 W. Central Avenue may be justified. 6 refs., 6 figs., 3 tabs

Radiochemical separation of Tb-149 after tandem accelerator production

International Nuclear Information System (INIS)

Sarkar, S.R.

1996-01-01

Full text: Terbium-149 is produced by the heavy ion induced reaction of the type 142 Nd( 12 C,5n) 149 Dy→ 149 Tb. This work concerns the separation of terbium from neodymium target, and other lanthanides produced by secondary reactions on neodymium target. Firstly, anion-exchange separation is carried out at room temperature using acid-alcohol media (90% methanol-10% 5M nitric acid) as eluent. But the separation is not satisfactory. To achieve satisfactory separation, cation exchange separation is performed under pressure at room temperature using 0.1 6M α-hydroxyisobutyric acid of pH 5 as eluent. The pressure is exerted from a nitrogen gas cylinder. The simplicity and efficacy of this method for the separation of terbium are discussed in comparison with the commercially available high performance liquid chromatography system

Investigation of the chemistry of the dielectric/FeCoTb interface by x-ray photoelectron spectroscopy and Auger electron spectroscopy

International Nuclear Information System (INIS)

Stickle, W.F.; Coulman, D.

1987-01-01

The interfacial chemistry of magneto-optic structures of sputter deposited SiO, SiO 2 , Si 3 N 4 /FeCoTb/SiO, SiO 2 , and Si 3 N 4 was studied in detail by x-ray photoelectron spectroscopy (XPS) and Auger electron spectroscopy (AES). XPS and AES depth profiles have revealed a substantial amount of redox chemistry at the dielectric/rare-earth transition metal interfaces. The chemical reactions occur preferentially with the terbium as revealed in the XPS portion of the study by the formation of terbium oxide and terbium silicide. In the case of Si 3 N 4 evidence of TbN/sub x/ has also been observed. ''As deposited'' and annealed samples of the magneto-optic structures are compared and contrasted. It is concluded that Si 3 N 4 is a superior dielectric for magneto-optic media

Inositol-Requiring Enzyme 1-Mediated Downregulation of MicroRNA (miR)-146a and miR-155 in Primary Dermal Fibroblasts across Three TNFRSF1A Mutations Results in Hyperresponsiveness to Lipopolysaccharide.

Science.gov (United States)

Harrison, Stephanie R; Scambler, Thomas; Oubussad, Lylia; Wong, Chi; Wittmann, Miriam; McDermott, Michael F; Savic, Sinisa

2018-01-01

Tumor necrosis factor (TNF)-receptor-associated periodic fever syndrome (TRAPS) is a rare monogenic autoinflammatory disorder characterized by mutations in the TNFRSF1A gene, causing TNF-receptor 1 (TNFR1) misfolding, increased cellular stress, activation of the unfolded protein response (UPR), and hyperresponsiveness to lipopolysaccharide (LPS). Both microRNA (miR)-146a and miR-155 provide negative feedback for LPS-toll-like receptor 2/4 signaling and cytokine production, through regulation of nuclear factor kappa B (NF-κB). In this study, we hypothesized that proinflammatory cytokine signaling in TRAPS downregulates these two miRs, resulting in LPS-induced hyperresponsiveness in TRAPS dermal fibroblasts (DFs), irrespective of the underlying genetic mutation. Primary DF were isolated from skin biopsies of TRAPS patients and healthy controls (HC). TNFR1 cell surface expression was measured using immunofluorescence. DF were stimulated with LPS, interleukin (IL)-1β, thapsigargin, or TNF, with and without inositol-requiring enzyme 1 (IRE1) inhibitor (4u8C), following which miR-146a and miR-155 expression was measured by RT-qPCR. IL-1β, IL-6, and TNF secretion was measured by enzyme-linked immunosorbent assays, and baseline expression of 384 different miRs was assessed using microfluidics assays. TNFR1 was found to be expressed on the surface of HC DF but expression was deficient in all samples with TRAPS-associated mutations. HC DF showed significant dose-dependent increases in both miR-146a and miR-155 expression levels in response to LPS; however, TRAPS DF failed to upregulate either miR-146a or miR-155 under the same conditions. This lack of miR-146a and miR-155 upregulation was associated with increased proinflammatory cytokine production in TRAPS DF in response to LPS challenge, which was abrogated by 4u8C. Incubation of HC DF with IL-1β led to downregulation of miR-146a and miR-155 expression, which was dependent on IRE1 enzyme. We observed global

Structure-activity relationship studies of 1,7-diheteroarylhepta-1,4,6-trien-3-ones with two different terminal rings in prostate epithelial cell models.

Science.gov (United States)

Wang, Rubing; Zhang, Xiaojie; Chen, Chengsheng; Chen, Guanglin; Sarabia, Cristian; Zhang, Qiang; Zheng, Shilong; Wang, Guangdi; Chen, Qiao-Hong

2017-06-16

To systematically investigate the structure-activity relationships of 1,7-diheteroarylhepta-1,4,6-trien-3-ones in three human prostate cancer cell models and one human prostate non-neoplastic epithelial cell model, thirty five 1,7-diarylhepta-1,4,6-trien-3-ones with different terminal heteroaromatic rings have been designed for evaluation of their anti-proliferative potency in vitro. These target compounds have been successfully synthesized through two sequential Horner-Wadsworth-Emmons reactions starting from the appropriate aldehydes and tetraethyl (2-oxopropane-1,3-diyl)bis(phosphonate). Their anti-proliferative potency against PC-3, DU-145 and LNCaP human prostate cancer cell lines can be significantly enhanced by the manipulation of the terminal heteroaromatic rings, further demonstrating the utility of 1,7-diarylhepta-1,4,6-trien-3-one as a potential scaffold for the development of anti-prostate cancer agents. The optimal analog 40 is 82-, 67-, and 39-fold more potent than curcumin toward the three prostate cancer cell lines, respectively. The experimental data also reveal that the trienones with two different terminal aromatic rings possess greater potency toward three prostate cancer cell lines, but also have greater capability of suppressing the proliferation of PWR-1E benign human prostate epithelial cells, as compared to the corresponding counterparts with two identical terminal rings and curcumin. The terminal aromatic rings also affect the cell apoptosis perturbation. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Vascular Cell Adhesion Molecule 1, Intercellular Adhesion Molecule 1, and Cluster of Differentiation 146 Levels in Patients with Type 2 Diabetes with Complications.

Science.gov (United States)

Hocaoglu-Emre, F Sinem; Saribal, Devrim; Yenmis, Guven; Guvenen, Guvenc

2017-03-01

Type 2 diabetes mellitus (T2DM) is a multisystemic, chronic disease accompanied by microvascular complications involving various complicated mechanisms. Intercellular adhesion molecule 1 (ICAM-1), vascular cell adhesion molecule 1 (VCAM-1), and cluster of differentiation-146 (CD146) are mainly expressed by endothelial cells, and facilitate the adhesion and transmigration of immune cells, leading to inflammation. In the present study, we evaluated the levels of soluble adhesion molecules in patients with microvascular complications of T2DM. Serum and whole blood samples were collected from 58 T2DM patients with microvascular complications and 20 age-matched healthy subjects. Levels of soluble ICAM-1 (sICAM-1) and soluble VCAM-1 (sVCAM-1) were assessed using enzyme-linked immunosorbent assay, while flow cytometry was used to determine CD146 levels. Serum sICAM-1 levels were lower in T2DM patients with microvascular complications than in healthy controls (Pmolecule levels were not correlated with the complication type. In the study group, most of the patients were on insulin therapy (76%), and 95% of them were receiving angiotensin-converting enzyme (ACE)-inhibitor agents. Insulin and ACE-inhibitors have been shown to decrease soluble adhesion molecule levels via various mechanisms, so we suggest that the decreased or unchanged levels of soluble forms of cellular adhesion molecules in our study group may have resulted from insulin and ACE-inhibitor therapy, as well as tissue-localized inflammation in patients with T2DM. Copyright © 2017 Korean Endocrine Society

Two Distinct Interferon-γ in the Orange-Spotted Grouper (Epinephelus coioides: Molecular Cloning, Functional Characterization, and Regulation in Toll-Like Receptor Pathway by Induction of miR-146a

Directory of Open Access Journals (Sweden)

Wan Peng

2018-02-01

Full Text Available Interferon gamma (IFNγ is a Th1 cytokine that is critical for innate and adaptive immunity. Toll-like receptors (TLRs signaling pathways are critical in early host defense against invading pathogens. miR-146a has been reported to participate in the regulation of host immunity. The known mechanisms of integrations between the IFNγ and TLR signaling pathways are incompletely understood, especially in teleosts. In this study, orange-spotted grouper (Epinephelus coioides IFNγ1 and IFNγ2, their biological activities, especially their involvements in TLR pathway, were explored. We identified and cloned two IFNγ genes of E. coioides, namely EcIFNγ1 and EcIFNγ2. The produced recombinant E. coioides IFNγ1 (rEcIFNγ1 and IFNγ2 (rEcIFNγ2 proteins showed functions, which are similar to those of other bony fishes, such as enhancing nitric oxide responses and respiratory burst response. rEcIFNγ2 could regulate TLR pathway by enhancing the promoter activity of miR-146a upstream sequence and thus increasing the expression level of miR-146a, which possibly targets TNF receptor-associated factor 6 (TRAF6, a key adapter molecule in TLR signaling pathway. Taken together, these findings unravel a novel regulatory mechanism of anti-inflammatory response by IFNγ2, which could mediate TLR pathway through IFNγ2–miR-146a–TRAF6 negative regulation loop. It is suggested that IFNγ2 may provide a promising therapeutic, which may help to fine tune the immune response.

Hyperfine structure and isotope shift of the neutron-rich barium isotopes 139-146Ba and 148Ba

International Nuclear Information System (INIS)

Wendt, K.; Ahmad, S.A.; Klempt, W.; Neugart, R.; Otten, E.W.

1988-01-01

The hyperfine structure and isotope shift in the 6s 2 S 1/2 -6p 2 P 3/2 line of Ba II (455.4 nm) have been measured by collinear fast-beam laser spectroscopy for the neutron-rich isotopes 139-146 Ba and 148 Ba. Nuclear moments and mean square charge radii of these isotopes have been recalculated. The isotope shift of the isotope 148 Ba (T 1/2 = 0.64 s) could be studied for the first time, yielding δ 2 > 138,148 = 1.245(3) fm 2 . (orig.)

Bose-Einstein correlations in Si + Al and Si + Au collisions at 14.6A GeV/c

Science.gov (United States)

Abbott, T.; Akiba, Y.; Beavis, D.; Bloomer, M. A.; Bond, P. D.; Chasman, C.; Chen, Z.; Chu, Y. Y.; Cole, B. A.; Costales, J. B.

1992-01-01

The E802 Spectrometer at the Brookhaven Alternating Gradient Synchrotron has been used to measure the correlation in relative momentum between like-sign pions emitted in central Si + Al and Si + Au collisions at 14.6A GeV/c. Data are presented in terms of the correlation function for both identified pi(-) and pi(+) pairs near the nucleon-nucleon center-of-mass rapidity. All parametrizations of the correlation function are consistent with a spherically symmetric source of rms radius 3.5 +/- 0.4 fm and lifetime fm/c.

Luminescent materials based on Tb, Eu-containing layered double hydroxides

International Nuclear Information System (INIS)

Zhuravleva, N.G.; Eliseev, A.A.; Lukashin, A.V.; Kinast, U.; Tret'yakov, Yu.D.

2004-01-01

Luminescent materials on the basis of magnesium-aluminium layered double hydroxides with intercalated anionic complexes of terbium and europium picolinates were synthesized. Relying on data of spectroscopy, elementary and X-ray phase analyses, the change in the rare earth complex structure and metal/ligand ratio, depending on the hydroxide layer charge, determined by Mg/Al ratio in the double hydroxide, were ascertained. The values of quantum yields of luminescence for terbium-containing samples amounted to 30-50% [ru

Reactive Chemical Vapor Deposition Method as New Approach for Obtaining Electroluminescent Thin Film Materials

Directory of Open Access Journals (Sweden)

Valentina V. Utochnikova

2012-01-01

Full Text Available The new reactive chemical vapor deposition (RCVD method has been proposed for thin film deposition of luminescent nonvolatile lanthanide aromatic carboxylates. This method is based on metathesis reaction between the vapors of volatile lanthanide dipivaloylmethanate (Ln(dpm3 and carboxylic acid (HCarb orH2Carb′ and was successfully used in case of HCarb. Advantages of the method were demonstrated on example of terbium benzoate (Tb(bz3 and o-phenoxybenzoate thin films, and Tb(bz3 thin films were successfully examined in the OLED with the following structure glass/ITO/PEDOT:PSS/TPD/Tb(bz3/Ca/Al. Electroluminescence spectra of Tb(bz3 showed only typical luminescent bands, originated from transitions of the terbium ion. Method peculiarities for deposition of compounds of dibasic acids H2Carb′ are established on example of terbium and europium terephtalates and europium 2,6-naphtalenedicarboxylate.

A Novel Approach to Reinstating Tolerance in Experimental Autoimmune Myasthenia Gravis Using a Targeted Fusion Protein, mCTA1–T146

Directory of Open Access Journals (Sweden)

Alessandra Consonni

2017-09-01

Full Text Available Reinstating tissue-specific tolerance has attracted much attention as a means to treat autoimmune diseases. However, despite promising results in rodent models of autoimmune diseases, no established tolerogenic therapy is clinically available yet. In the experimental autoimmune myasthenia gravis (EAMG model several protocols have been reported that induce tolerance against the prime disease-associated antigen, the acetylcholine receptor (AChR at the neuromuscular junction. Using the whole AChR, the extracellular part or peptides derived from the receptor, investigators have reported variable success with their treatments, though, usually relatively large amounts of antigen has been required. Hence, there is a need for better formulations and strategies to improve on the efficacy of the tolerance-inducing therapies. Here, we report on a novel targeted fusion protein carrying the immunodominant peptide from AChR, mCTA1–T146, which given intranasally in repeated microgram doses strongly suppressed induction as well as ongoing EAMG disease in mice. The results corroborate our previous findings, using the same fusion protein approach, in the collagen-induced arthritis model showing dramatic suppressive effects on Th1 and Th17 autoaggressive CD4 T cells and upregulated regulatory T cell activities with enhanced IL10 production. A suppressive gene signature with upregulated expression of mRNA for TGFβ, IL10, IL27, and Foxp3 was clearly detectable in lymph node and spleen following intranasal treatment with mCTA1–T146. Amelioration of EAMG disease was accompanied by reduced loss of muscle AChR and lower levels of anti-AChR serum antibodies. We believe this targeted highly effective fusion protein mCTA1–T146 is a promising candidate for clinical evaluation in myasthenia gravis patients.

Bose-Einstein correlation of kaons in Si + Au collisions at 14.6 A GeV/c

Science.gov (United States)

Akiba, Y.; Beavis, D.; Beery, P.; Britt, H. C.; Budick, B.; Chasman, C.; Chen, Z.; Chi, C. Y.; Chu, Y. Y.; Cianciolo, V.

1993-01-01

The E-802 spectrometer at the Brookhaven Alternating Gradient Synchrotron, enhanced by a trigger for selection of events with one or more specified particles, has been used to measure the momentum-space correlation between pairs of K(+)s emitted in central Si + Au collisions at 14.6 A GeV/c. This correlation has been projected onto the Lorentz-invariant relative four-momentum axis. Fits to this correlation function yield a size for the kaon source that is comparable to that found using pi(+) pairs from a similar rapidity range, once a transformation from the particle-pair frames to a single source frame is made.

Scanning Electron Microscope-Cathodoluminescence Analysis of Rare-Earth Elements in Magnets.

Science.gov (United States)

Imashuku, Susumu; Wagatsuma, Kazuaki; Kawai, Jun

2016-02-01

Scanning electron microscope-cathodoluminescence (SEM-CL) analysis was performed for neodymium-iron-boron (NdFeB) and samarium-cobalt (Sm-Co) magnets to analyze the rare-earth elements present in the magnets. We examined the advantages of SEM-CL analysis over conventional analytical methods such as SEM-energy-dispersive X-ray (EDX) spectroscopy and SEM-wavelength-dispersive X-ray (WDX) spectroscopy for elemental analysis of rare-earth elements in NdFeB magnets. Luminescence spectra of chloride compounds of elements in the magnets were measured by the SEM-CL method. Chloride compounds were obtained by the dropwise addition of hydrochloric acid on the magnets followed by drying in vacuum. Neodymium, praseodymium, terbium, and dysprosium were separately detected in the NdFeB magnets, and samarium was detected in the Sm-Co magnet by the SEM-CL method. In contrast, it was difficult to distinguish terbium and dysprosium in the NdFeB magnet with a dysprosium concentration of 1.05 wt% by conventional SEM-EDX analysis. Terbium with a concentration of 0.02 wt% in an NdFeB magnet was detected by SEM-CL analysis, but not by conventional SEM-WDX analysis. SEM-CL analysis is advantageous over conventional SEM-EDX and SEM-WDX analyses for detecting trace rare-earth elements in NdFeB magnets, particularly dysprosium and terbium.

Cermet electrode

Science.gov (United States)

Maskalick, Nicholas J.

1988-08-30

Disclosed is a cermet electrode consisting of metal particles of nickel, cobalt, iron, or alloys or mixtures thereof immobilized by zirconia stabilized in cubic form which contains discrete deposits of about 0.1 to about 5% by weight of praseodymium, dysprosium, terbium, or a mixture thereof. The solid oxide electrode can be made by covering a substrate with particles of nickel, cobalt, iron, or mixtures thereof, growing a stabilized zirconia solid oxide skeleton around the particles thereby immobilizing them, contacting the skeleton with a compound of praseodymium, dysprosium, terbium, or a mixture thereof, and heating the skeleton to a temperature of at least 500.degree. C. The electrode can also be made by preparing a slurry of nickel, cobalt, iron, or mixture and a compound of praseodymium, dysprosium, terbium, or a mixture thereof, depositing the slurry on a substrate, heating the slurry to dryness, and growing a stabilized zirconia skeleton around the metal particles.

Evaluation of a Panel of Single-Nucleotide Polymorphisms in miR-146a and miR-196a2 Genomic Regions in Patients with Chronic Periodontitis.

Science.gov (United States)

Venugopal, Priyanka; Lavu, Vamsi; RangaRao, Suresh; Venkatesan, Vettriselvi

2017-04-01

Periodontitis is an inflammatory disease caused by bacterial triggering of the host immune-inflammatory response, which in turn is regulated by microRNAs (miRNA). Polymorphisms in the miRNA pathways affect the expression of several target genes such as tumor necrosis factor-α and interleukins, which are associated with progression of disease. The objective of this study was to identify the association between the MiR-146a single nucleotide polymorphisms (SNPs) (rs2910164, rs57095329, and rs73318382), the MiR-196a2 (rs11614913) SNP and chronic periodontitis. Genotyping was performed for the MiR-146a (rs2910164, rs57095329, and rs73318382) and the MiR-196a2 (rs11614913) polymorphisms in 180 healthy controls and 190 cases of chronic periodontitis by the direct Sanger sequencing technique. The strength of the association between the polymorphisms and chronic periodontitis was evaluated using logistic regression analysis. Haplotype and linkage analyses among the polymorphisms was performed. Multifactorial dimensionality reduction was performed to determine epistatic interaction among the polymorphisms. The MiR-196a2 polymorphism revealed a significant inverse association with chronic periodontitis. Haplotype analysis of MiR-146a and MiR-196a2 polymorphisms revealed 13 different combinations, of which 5 were found to have an inverse association with chronic periodontitis. The present study has demonstrated a significant inverse association of MiR-196a2 polymorphism with chronic periodontitis.

Systematics of (n,t) reactions in medium and heavy mass nuclei at 14.6 MeV

International Nuclear Information System (INIS)

Woo, T.T.

1979-01-01

The production cross sections for (n,t) reactions of 14.6-MeV neutrons with isotopes of the natural elements Ca, Ti, Cr, Fe, Ni, Y, Mo, Pd, Cd, Sn, Pb, La, and with the enriched isotopes 86 Sr, 114 Cd, 130 Te, 205 Tl were measured by the activation technique using high-energy resolution gamma-ray spectrometry. The systematics for the (n,t) reactions were investigated as a function of the relative neutron excess. The experimentally determined values of the cross sections are in good agreement with values calculated by an empirical equation. The cross section ratios (n,t) and (n,p) reactions were calculated on the basis of the statistical model

Preparation and photoluminescence characteristics of In(OH){sub 3}:xTb{sup 3+} obtained by Microwave-Assisted Hydrothermal method

Energy Technology Data Exchange (ETDEWEB)

Motta, F.V., E-mail: fabiana@ct.ufrn.br [DEMAT, CT, UFRN, Av. Sen. Salgado Filho 3000, CEP 59072-970 Natal, RN (Brazil); Marques, A.P.A. [UNIFESP, Rua Prof. Artur Riedel 275, CEP 09972-270 Diadema, SP (Brazil); Li, M.S. [IFSC, USP, Av. Trabalhador São Carlense 400, CEP 13566-590 São Carlos, SP (Brazil); Abreu, M.F.C. [LIEC, DQ, UFSCar, Via Washington Luiz, km 235, CEP 13565-905 São Carlos, SP (Brazil); Paskocimas, C.A.; Bomio, M.R.D. [DEMAT, CT, UFRN, Av. Sen. Salgado Filho 3000, CEP 59072-970 Natal, RN (Brazil); Souza, R.P. [DEP, CT, UFRN, Av. Sen. Salgado Filho 3000, CEP 59072-970 Natal, RN (Brazil); Varela, J.A. [LIEC, IQ, UNESP, Rua Francisco Degni s/n, CEP 14801-907 Araraquara, SP (Brazil); Longo, E. [LIEC, DQ, UFSCar, Via Washington Luiz, km 235, CEP 13565-905 São Carlos, SP (Brazil)

2013-03-15

Highlights: ► We report the preparation by Microwave-Hydrothermal method of In(OH){sub 3}:xTb{sup 3+}. ► Nanostructures were obtained at a low temperature. ► The crystallite size decreased with terbium doping level. ► The nucleation–dissolution–recrystallization mechanism is promoted by processing. ► This material is a highly promising candidate for photoluminescent applications. -- Abstract: Crystalline terbium-doped indium hydroxide structures were prepared by a rapid and efficient Microwave-Assisted Hydrothermal (MAH) method. Nanostructures were obtained at a low temperature. FE-SEM images confirm that these samples are composed of 3D nanostructures. XRD, optical diffuse reflectance and photoluminescence (PL) measurements were used to characterize the products. Emission spectra of terbium-doped indium hydroxide (In(OH){sub 3}:xTb{sup 3+}) samples under excitation (350.7 nm) presented broad band emission referent to the indium hydroxide matrix and {sup 5}D{sub 4} → {sup 7}F{sub 6}, {sup 5}D{sub 4} → {sup 7}F{sub 5}, {sup 5}D{sub 4} → {sup 7}F{sub 4}, and {sup 5}D{sub 4} → {sup 7}F{sub 3} terbium transitions at 495, 550, 590 and 627 nm, respectively. Relative intensities of the Tb{sup 3+} emissions increased as the concentration of this ion increased from 0, 1, 2, 4 and 8 mol%, of Tb{sup 3+}, but the luminescence is drastically quenched for the In(OH){sub 3} matrix.

Extraction of nitrates of lanthanoids (3) of the yttrium group and yttrium (3) by trialkylbenzylammonium nitrate in toluene

International Nuclear Information System (INIS)

Pyartman, A.K.; Kovalev, S.V.; Keskinov, V.A.; Kopyrin, A.A.

1997-01-01

A study was made on extraction of nitrates of lanthanoids (3) of the yttrium group (terbium-lutetium) and yttrium (3) by trialkylbensylammonium nitrate in toluene at T=298.15 K pH 2. Extraction isotherms are described with account of formation of compound of (R 4 N) 2 [Ln(NO 3 ) 5 ] composition in organic phase. Values of extraction constants decreasing in terbium (3)-lutetium (3) series, were calculated. Value of extraction constant for yttrium (3) is close to the value of extraction constant for ytterbium (3). 13 refs., 2 figs., 3 tabs

Kinetic study of Tb/sup 3 +/(/sup 5/D/sub 3/) luminescence in phosphate glasses

Energy Technology Data Exchange (ETDEWEB)

Anisimov, V.A.; Dmitryuk, A.V.; Karapetyan, G.O.

1986-01-01

This paper presents precise determinations of the kinetics of terbium luminescence over a broad dynamic range, in order to refine the mechanism of concentration quenching of the Tb/sup 3 +/(/sup 5/D/sub 3/) luminescence in glasses. After establishing the mechanism of Tb/sup 3 +/(/sup 5/D/sub 3/) luminescence quenching by the iteration method, the authors determine the value of the parameter for an arbitrary concentration of the activator. Results of this study show that the mechanism of concentration quenching of luminescence is static dipole-dipole interaction of terbium ions.

miR-146a C/G polymorphism increased the risk of head and neck cancer, but overall cancer risk: an analysis of 89 studies.

Science.gov (United States)

Sun, Dezhong; Zhang, Xiaoyan; Zhang, Xiaolei

2018-02-28

Several studies have evaluated the association of miR-146a C/G with head and neck cancer (HNC) susceptibility, and overall cancer risk, but with inconclusive outcomes. To drive a more precise estimation, we carried out this meta-analysis. The literature was searched from MEDLINE (mainly PubMed), Embase, the Cochrane Library, and Google Scholar databases to identify eligible studies. A total of 89 studies were included. The results showed that miR-146a C/G was significantly associated with increased HNC risk in dominant model ( I 2 =15.6%, P heterogeneity =0.282, odds ratio (OR) =1.088, 95% confidence interval (CI) =1.002-1.182, P =0.044). However, no cancer risk was detected under all genetic models. By further stratified analysis, we found that rs4919510 mutation contributed to the risk of HNC amongst Asians under homozygote model ( I 2 =0, P heterogeneity =0.541, OR =1.189, 95% CI =1.025-1.378, P =0.022), and dominant model ( I 2 =0, P heterogeneity =0.959, OR =1.155, 95% CI =1.016-1.312, P =0.028). Simultaneously, in the stratified analysis by source of controls, a significantly increased cancer risk amongst population-based studies was found under homozygote model, dominant model, recessive model, and allele comparison model. However, no significant association was found in the stratified analysis by ethnicity and source of control. The results indicated that miR-146a C/G polymorphism may contribute to the increased HNC susceptibility and could be a promising target to forecast cancer risk for clinical practice. However, no significant association was found in subgroup analysis by ethnicity and source of control. To further confirm these results, well-designed large-scale case-control studies are needed in the future. © 2018 The Author(s).

Synthesis of Tb_4O_7 complexed with reduced graphene oxide for Rhodamine-B absorption

International Nuclear Information System (INIS)

Gao, Hui; Zhou, Yang; Chen, Keqin; Li, Xiaolong

2016-01-01

Highlights: • Tb–rGO composite was fabricated via a facile thermally reduction process. • The green and blue emissions were both observed in the composite. • The composite exhibited efficient absorption capability for Rhodamine-B. - Abstract: Tb_4O_7 complexed with reduced graphene oxide composite (Tb–rGO) had been designed and fabricated by a facile thermal reduction method. The formation of Tb_4O_7 particles and reduction of graphene oxide (GO) occurred simultaneously, and partial terbium ions would be complexed with rGO via oxygen-containing function groups on rGO sheets. Introducing of terbium ions could effectively tune the photoluminescence properties of rGO, and the composite exhibited the typical green emission of terbium ions as well as the blue self-luminescence of graphene entered at 440 nm. Moreover, Tb–rGO had demonstrated its high capability as an organic dye (Rhodamine-B) scavenger with high speed and efficiency. The findings showed the promising applications for large-scale removal of organic dye contaminants, especially in the field of waste water treatment.

Synthesis of Tb{sub 4}O{sub 7} complexed with reduced graphene oxide for Rhodamine-B absorption

Energy Technology Data Exchange (ETDEWEB)

Gao, Hui, E-mail: hope@lzu.edu.cn [School of Physical Science and Technology, Key Laboratory for Magnetism and Magnetic Materials of Ministry of Education, Lanzhou University, Lanzhou 730000 (China); Zhou, Yang; Chen, Keqin [School of Physical Science and Technology, Key Laboratory for Magnetism and Magnetic Materials of Ministry of Education, Lanzhou University, Lanzhou 730000 (China); Li, Xiaolong, E-mail: lixiaolong@sinap.ac.cn [Shanghai Synchrotron Radiation Facility, Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201204 (China)

2016-05-15

Highlights: • Tb–rGO composite was fabricated via a facile thermally reduction process. • The green and blue emissions were both observed in the composite. • The composite exhibited efficient absorption capability for Rhodamine-B. - Abstract: Tb{sub 4}O{sub 7} complexed with reduced graphene oxide composite (Tb–rGO) had been designed and fabricated by a facile thermal reduction method. The formation of Tb{sub 4}O{sub 7} particles and reduction of graphene oxide (GO) occurred simultaneously, and partial terbium ions would be complexed with rGO via oxygen-containing function groups on rGO sheets. Introducing of terbium ions could effectively tune the photoluminescence properties of rGO, and the composite exhibited the typical green emission of terbium ions as well as the blue self-luminescence of graphene entered at 440 nm. Moreover, Tb–rGO had demonstrated its high capability as an organic dye (Rhodamine-B) scavenger with high speed and efficiency. The findings showed the promising applications for large-scale removal of organic dye contaminants, especially in the field of waste water treatment.

The crystal structure and luminescence quenching of poly- and single-crystalline KYW{sub 2}O{sub 8}:Tb{sup 3+}

Energy Technology Data Exchange (ETDEWEB)

Schwung, Sebastian [Fachbereich Chemieingenieurwesen, Fachhochschule Münster, Stegerwaldstraße 39, 48565 Steinfurt (Germany); Rytz, Daniel, E-mail: rytz@fee-io.de [Forschungsinstitut für mineralische und metallische Werkstoffe-Edelsteine/ Edelmetalle-GmbH (FEE), Struthstraße 2, 55743 Idar-Oberstein (Germany); Heying, Birgit; Rodewald, Ute Ch.; Niehaus, Oliver [Institut für Anorganische und Analytische Chemie, Universität Münster, Corrensstrasse 30 48149 Münster (Germany); Enseling, David [Fachbereich Chemieingenieurwesen, Fachhochschule Münster, Stegerwaldstraße 39, 48565 Steinfurt (Germany); Jüstel, Thomas, E-mail: tj@fh-muenster.de [Fachbereich Chemieingenieurwesen, Fachhochschule Münster, Stegerwaldstraße 39, 48565 Steinfurt (Germany); Pöttgen, Rainer, E-mail: pottgen@uni-muenster.de [Institut für Anorganische und Analytische Chemie, Universität Münster, Corrensstrasse 30 48149 Münster (Germany)

2015-10-15

Terbium-substituted KYW{sub 2}O{sub 8} single crystals of high optical quality were grown by the top seeded solution growth technique. The degree of yttrium–terbium mixed occupancy was determined for two samples through structure refinements on the basis of single crystal X-ray diffractometer data. Temperature dependent magnetic susceptibility data underline the paramagnetic nature of terbium doped crystals. No magnetic ordering is evident down to 2 K. Luminescence measurements yield the typical excitation and emission spectra as expected for Tb{sup 3+} activated materials. The decay time of Tb{sup 3+} decreases linearly with the Tb{sup 3+} concentration, while the excess of thermal quenching does not change significantly. At about 405 K the decay time is reduced by roughly 50% relative to the low-temperature value, both for the powders as for the single crystals. - Highlights: • Single crystalline and powder series of K(Y,Tb)W{sub 2}O{sub 8.} • Refined XRD data of high quality crystals. • Linear decrease of the decay time with Tb{sup 3+} content.

Scattering of 14.6 MeV neutrons from Fe and evidence for structure in the emitted neutron spectra

International Nuclear Information System (INIS)

Gul, K.; Anwar, M.; Ahmad, M.; Saleem, S.M.; Khan, N.A.

1984-06-01

Structure in the spectra of neutrons emitted from iron on bombardment with 14.6 MeV neutrons has been investigated and explained in terms of excitation of levels in iron 56. The energies of scattered neutrons have been measured by the time-of-flight technique based on the associated particle method. The observed excitations have been correlated with the reported levels in a satisfactory manner. Evidence for new excitations at 8.8 +- 0.02, 9.8 +- 0.1, 10.2 +- 0.1, 12.44 +- 0.03 and 12.52 +- 0.03 MeV has been obtained. The excitation of possible components of Ml giant resonance in iron 56 is discussed. (author)

Applicability of IBAMA normative instruction 146-2007 to pipeline environmental licensing

Energy Technology Data Exchange (ETDEWEB)

Basbaum, Marcos A.; Fonseca, Renata A.A. [Servicos de Engenharia Emilio Baumgart Ltda. (SEEBLA), Rio de Janeiro, RJ(Brazil)], e-mail: mbasbaum.seebla@petrobras.com.br, e-mail: renataamorim.seebla@petrobras.com.br; Torggler, Bianca F.; Fernandes, Renato; Guimaraes, Ricardo Z.P. [Petroleo do Brasil S.A. (PETROBRAS), Rio de Janeiro, RJ (Brazil)], e-mail: torggler@petrobras.com.br, e-mail: renatofer@petrobras.com.br, e-mail: rzaluar@petrobras.com.br

2009-07-01

PETROBRAS has been conducting several wildlife programs in response to environmental licensing requirements from IBAMA (Brazilian environmental agency). Since 2007, IBAMA has been requiring the application of the Normative Instruction n. 146 (NI), which establishes criteria for wildlife management in the influence areas of new enterprises. However, experience from PETROBRAS has shown that many of the NI articles are not applicable to pipelines. Thus, a critical analysis of this NI was done based on data from company's wildlife programs. Our analysis indicated that the main NI items that do not apply to pipelines are: 1 - Animal rescue programs in deforested areas and selection of release areas, 2 - More than two fauna monitoring campaigns a year, 3 - Monitoring programs involving all groups of terrestrial vertebrates and also invertebrate classes. The non-applicability of these items is due to: 1 - The majority of pipelines are built in areas without significant native vegetation or with small fragments only, which are usually in secondary stage of ecological succession. Most pipelines scarcely involve removal of primary vegetation, 2 - Pipelines have an influence area restricted to a range of 800 m and the construction directly affects only strips from 20 m to 30 m, 3 - The most relevant impacts associated with pipelines are temporary, and do not persist during their operation. (author)

Measurement of the Neutron Slowing-Down Time Distribution at 1.46 eV and its Space Dependence in Water

Energy Technology Data Exchange (ETDEWEB)

Moeller, E

1965-12-15

The use of the time dependent reaction rate method for the measurement of neutron slowing-down time distributions in hydrogen has been analyzed and applied to the case of sloping down in water. Neutrons with energies of about 1 MeV were slowed down, and the time-dependent neutron density at 1.46 eV and its space dependence was measured with a time resolution of 0.042 {mu}s. The results confirm the well known theory for time-dependent slowing down in hydrogen. The space dependence of the distributions is well described by the P{sub 1}-calculations by Claesson.

Measurement of the Neutron Slowing-Down Time Distribution at 1.46 eV and its Space Dependence in Water

International Nuclear Information System (INIS)

Moeller, E.

1965-12-01

The use of the time dependent reaction rate method for the measurement of neutron slowing-down time distributions in hydrogen has been analyzed and applied to the case of sloping down in water. Neutrons with energies of about 1 MeV were slowed down, and the time-dependent neutron density at 1.46 eV and its space dependence was measured with a time resolution of 0.042 μs. The results confirm the well known theory for time-dependent slowing down in hydrogen. The space dependence of the distributions is well described by the P 1 -calculations by Claesson

Polymorphisms in STAT-4, IL-10, PSORS1C1, PTPN2 and MIR146A genes are associated differently with prognostic factors in Italian patients affected by rheumatoid arthritis.

Science.gov (United States)

Ciccacci, C; Conigliaro, P; Perricone, C; Rufini, S; Triggianese, P; Politi, C; Novelli, G; Perricone, R; Borgiani, P

2016-11-01

Rheumatoid arthritis (RA) is a systemic autoimmune disease resulting in chronic inflammation of the synovium and consequent cartilage and bone erosion. RA is associated strongly with the presence of rheumatoid factor (RF), and consists of clinical subsets of anti-citrullinated protein antibody (ACPA)-positive and -negative patients. This study was designed to evaluate whether relevant single nucleotide polymorphisms (SNPs) associated with RA and other autoimmune disorders are related to RF, ACPA and clinical phenotype in a cohort of biologic drugs naive Italian RA patients; 192 RA patients and 278 age-matched healthy controls were included. Clinical and laboratory data were registered. We analysed a total of 12 single nucleotide polymorphisms (SNPs) in signal transducer and activator of transcription-4 (STAT-4), interleukin (IL)-10, psoriasis susceptibility 1 candidate 1 (PSORS1C1), protein tyrosine phosphatase, non-receptor type 2 (PTPN2), endoplasmic reticulum aminopeptidase 1 (ERAP1), tumour necrosis factor receptor-associated 3 interacting protein 2 (TRAF3IP2) and microRNA 146a (MIR146A) genes by allelic discrimination assays. Case-control association studies and genotype/phenotype correlation analyses were performed. A higher risk to develop RA was observed for rs7574865 in the STAT-4 gene, while the rs1800872 in the IL-10 gene showed a protective effect. The presence of RF was associated significantly with rs1800872 variant in IL-10, while rs2910164 in MIR146A was protective. ACPA were associated significantly with rs7574865 in STAT-4. The SNP rs2233945 in the PSORS1C1 gene was protective regarding the presence of bone erosions, while rs2542151 in PTPN2 gene was associated with joint damage. Our results confirm that polymorphisms in STAT-4 and IL-10 genes confer susceptibility to RA. For the first time, we described that SNPs in PSORS1C1, PTPN2 and MIR146A genes were associated differently with a severe disease phenotype in terms of autoantibody status and

Polymorphisms in STAT‐4, IL‐10, PSORS1C1, PTPN2 and MIR146A genes are associated differently with prognostic factors in Italian patients affected by rheumatoid arthritis

Science.gov (United States)

Ciccacci, C.; Conigliaro, P.; Rufini, S.; Triggianese, P.; Politi, C.; Novelli, G.; Perricone, R.; Borgiani, P.

2016-01-01

Summary Rheumatoid arthritis (RA) is a systemic autoimmune disease resulting in chronic inflammation of the synovium and consequent cartilage and bone erosion. RA is associated strongly with the presence of rheumatoid factor (RF), and consists of clinical subsets of anti‐citrullinated protein antibody (ACPA)‐positive and ‐negative patients. This study was designed to evaluate whether relevant single nucleotide polymorphisms (SNPs) associated with RA and other autoimmune disorders are related to RF, ACPA and clinical phenotype in a cohort of biologic drugs naive Italian RA patients; 192 RA patients and 278 age‐matched healthy controls were included. Clinical and laboratory data were registered. We analysed a total of 12 single nucleotide polymorphisms (SNPs) in signal transducer and activator of transcription‐4 (STAT‐4), interleukin (IL)‐10, psoriasis susceptibility 1 candidate 1 (PSORS1C1), protein tyrosine phosphatase, non‐receptor type 2 (PTPN2), endoplasmic reticulum aminopeptidase 1 (ERAP1), tumour necrosis factor receptor‐associated 3 interacting protein 2 (TRAF3IP2) and microRNA 146a (MIR146A) genes by allelic discrimination assays. Case‐control association studies and genotype/phenotype correlation analyses were performed. A higher risk to develop RA was observed for rs7574865 in the STAT‐4 gene, while the rs1800872 in the IL‐10 gene showed a protective effect. The presence of RF was associated significantly with rs1800872 variant in IL‐10, while rs2910164 in MIR146A was protective. ACPA were associated significantly with rs7574865 in STAT‐4. The SNP rs2233945 in the PSORS1C1 gene was protective regarding the presence of bone erosions, while rs2542151 in PTPN2 gene was associated with joint damage. Our results confirm that polymorphisms in STAT‐4 and IL‐10 genes confer susceptibility to RA. For the first time, we described that SNPs in PSORS1C1, PTPN2 and MIR146A genes were associated differently with a severe disease

The Politics of Deception and the French Lais in the Roman de Fauvel, Manuscript Paris, Bibliothèque nationale de France, fonds français 146

NARCIS (Netherlands)

Marinescu, R.C.I.

2014-01-01

The interpolated version of the French allegorical satire, the Roman de Fauvel, transmitted in manuscript Paris, Bibliothèque nationale de France, fonds français 146 (produced in Paris ca. 1317), targets the corruption within the French royal court in the last years of the rule of King Philip IV of

Combustion of Corn Stover Bales in a Small 146-kW Boiler

Directory of Open Access Journals (Sweden)

Joey Villeneuve

2011-07-01

Full Text Available Spring harvested corn stover was used for direct combustion in a 146 kW dual chamber boiler designed for wood logs. Stover had a very low moisture content (6.83 ± 0.17%, a gross calorific value (GCV of 18.57 MJ/kg of dry matter (±0.32 MJ/kg DM and an ash content of 5.88% (±1.15%. Small stover bales (8.83 ± 0.90 kg were placed manually in the upper combustion chamber at a rate of 10.5 to 12.8 kg/h over a 24-h period, with three replications, and compared to a control wood combustion trial (12.1 kg/h during 24 h. The overall heat transfer efficiency for stover was lower than for wood (57% vs. 77%. Stover bales produced on average 7.5% ash which included about 2% of unburned residues while wood produced 1.7% ash. CO gas emissions averaged 1324 mg/m³ for stover (118 mg/m³ for wood. The corn stover showed a good calorific potential, but it would have to be densified and the boiler should be modified to improve airflow, completeness of combustion and handling of the large amount of ash formed.

Influence of intramolecular f-f interactions on nuclear spin driven quantum tunneling of magnetizations in quadruple-decker phthalocyanine complexes containing two terbium or dysprosium magnetic centers.

Science.gov (United States)

Fukuda, Takamitsu; Matsumura, Kazuya; Ishikawa, Naoto

2013-10-10

Nuclear spin driven quantum tunneling of magnetization (QTM) phenomena, which arise from admixture of more than two orthogonal electronic spin wave functions through the couplings with those of the nuclear spins, are one of the important magnetic relaxation processes in lanthanide single molecule magnets (SMMs) in the low temperature range. Although recent experimental studies have indicated that the presence of the intramolecular f-f interactions affects their magnetic relaxation processes, little attention has been given to their mechanisms and, to the best of our knowledge, no rational theoretical models have been proposed for the interpretations of how the nuclear spin driven QTMs are influenced by the f-f interactions. Since quadruple-decker phthalocyanine complexes with two terbium or dysprosium ions as the magnetic centers show moderate f-f interactions, these are appropriate to investigate the influence of the f-f interactions on the dynamic magnetic relaxation processes. In the present paper, a theoretical model including ligand field (LF) potentials, hyperfine, nuclear quadrupole, magnetic dipolar, and the Zeeman interactions has been constructed to understand the roles of the nuclear spins for the QTM processes, and the resultant Zeeman plots are obtained. The ac susceptibility measurements of the magnetically diluted quadruple-decker monoterbium and diterbium phthalocyanine complexes, [Tb-Y] and [Tb-Tb], have indicated that the presence of the f-f interactions suppresses the QTMs in the absence of the external magnetic field (H(dc)) being consistent with previous reports. On the contrary, the faster magnetic relaxation processes are observed for [Tb-Tb] than [Tb-Y] at H(dc) = 1000 Oe, clearly demonstrating that the QTMs are rather enhanced in the presence of the external magnetic field. Based on the calculated Zeeman diagrams, these observations can be attributed to the enhanced nuclear spin driven QTMs for [Tb-Tb]. At the H(dc) higher than 2000 Oe, the

Investigation of nuclei near N = 82 and Z = 64 VIA radioactive decay of high-spin isomers

International Nuclear Information System (INIS)

Toth, K.S.

1979-01-01

An island of very high spin isomers was found recently in neutron-deficient Gd-Lu nuclei near the N = 82 closed shell in (H.I.,xn) measurements. This exciting discovery has led to a large number of experiments trying to identify the structures of these isomers and the nuclei in which they occur. These attempts have been helped in many instances by available spectroscopic information at low excitation energies. A systematic investigation of the low-lying structure of nuclei near N = 82 and Z greater than or equal to 64 was carried out. Heavy-ion beams were used to produce proton-rich isotopes which were then transported, with the use of gas-jet systems, to shielded areas where singles and coincidence γ-ray measurements could be made. Earlier investigations dealt with the decay of terbium ( 146-149 Tb) and dysprosium ( 147-152 Dy) nuclei. During the past two years the research program was extended to holmium nuclides (A less than or equal to 152) produced in 10 B bombardments of samarium. Two new isotopes, 149 Ho and 148 Ho, were identified. The decay data of 21-s 149 Ho supplement in-beam results and locate the hg/ 2 neutron state in 149 Dy to be at 1091 keV. The most intense γ-ray associated with 9-s 148 Ho has an energy of 1688 keV. It is possibly the first-excited to ground-state transition in 148 Dy. Recent in-beam measurements have shown that the first-excited state in 146 Gd is, unespectedly, 3 - in contrast to doubly evenN = 82 nuclei below gadolinium where it is 2 + . It would be interesting to determine whether the 1688-keV level in 148 Dy, the next nucleus in this isotonic series, is 2reverse arrow or 3 - in character. 12 references

Enhanced E3 Excitations in 144,146Ba and the Evolution of Octupole Collectivity

Science.gov (United States)

Bucher, B.; Zhu, S.; ANL, LLNL, LBNL, INL, UAM, Rochester, Maryland Collaboration

2017-09-01

Recent Coulomb excitation studies on 144,146Ba using the GRETINA-CHICO2 detection system with post-accelerated CARIBU beams have confirmed the existence of enhanced E3 transitions in these isotopes which are centered in a region that has long been predicted to exhibit stable octupole-deformed shapes. Furthermore, the widely-varying E1 strength observed between these isotopes is well-accounted for by models having octupole-deformed potentials, and the variation has been linked to increased occupancies of specific single-particle orbitals in the reflection-asymmetric potential. This talk will summarize the most recent experimental and theoretical results. In addition, data on octupole-related properties in the surrounding isotopes will be discussed in an attempt to better understand the origin and evolution of octupole collectivity in this mass region. This work is supported by the U.S. Department of Energy, Office of Nuclear Physics, under Contract No. DE-AC02-06CH11357 (ANL), DE-AC02-05CH11231 (LBNL, GRETINA), DOE DE-AC52-07NA27344 (LLNL), DE-AC07-05ID14517 (INL), and MINECO (Spain).

A comparative study of superdeformation in 146,147,148Gd. Possible manifestations of the pseudo-SU3 symmetry, octupole shape susceptibility and superdeformed deep-hole excitations

International Nuclear Information System (INIS)

Zuber, K.; Balouka, D.; Beck, F.A.; Byrski, T.; Curien, D.; France, G. de; Duchene, G.; Gehringer, C.; Haas, B.; Merdinger, J.C.; Romain, P.; Santos, D.; Styczen, J.; Vivien, J.P.; Dudek, J.; Szymanski, Z.; Werner, T.R.

1991-01-01

Two discrete superdeformed (SD) bands have been identified in the nucleus 147 Gd and the twin-band mechanism studied by comparison with SD results for 146,148 Gd. Theoretical interprettion in terms of nucleonic orbitals with the Woods-Saxon potential is consistent with the pseudo-spin symmetry picture and the octupole susceptibility mechanism predicted by theory. (orig.)

The (146,147)Sm-(142,143)Nd systematics of early terrestrial differentiation and the lost continents of the early Earth

Science.gov (United States)

Harper, Charles L., Jr.; Jacobsen, Stein B.

1992-01-01

The very early history of the Earth has been one of the great enduring puzzles in the history of geology. We report evidence which clearly can be described as a vestige of a beginning, because the evidence that we report cannot be interpreted in any other way except as a geochemical signal of processes active in the very early history of the Earth. The evidence itself is a very small anomaly in the abundance of SM-146. The primary aims of this study were to: (1) verify the existence of the 'lost continents' of the Hadean era; and (2) determine their mean age.

Scaling properties of charged particle multiplicity distributions in oxygen induced emulsion interactions at 14.6, 60 and 200 A GeV

International Nuclear Information System (INIS)

Adamovich, M.I.; Aggarwal, M.M.; Arora, R.

1988-12-01

The multiplicity distributions of shower particles (n s ) are measured in inclusive inelastic oxygen emulsion interactions. Scaling in observed in the normalized variable n s / ave.(n s ) for 14.6, 60 and 200 A GeV. The dependence of ave. (n s ) on the charge flow in the forward direction (Q ZD ) and the distribution of the number of participating projectile protons is examined. The normalized multiplicities as a function of Q ZD seem also to be independent of incident energies. A comparison with the Lund Model Fritiof yields satisfactory agreement. (authors)

Synthesis, Photoluminescence Behavior of Green Light Emitting Tb(III) Complexes and Mechanistic Investigation of Energy Transfer Process.

Science.gov (United States)

Bala, Manju; Kumar, Satish; Devi, Rekha; Khatkar, Avni; Taxak, V B; Boora, Priti; Khatkar, S P

2018-06-04

A series of five new terbium(III) ion complexes with 4,4-difluoro-1-phenylbutane-1,3-dione (HDPBD) and anciliary ligands was synthesized. The composition and properties of complexes were analyzed by elemental analysis, IR, NMR, powder X-ray diffaraction, TG-DTG and photoluminescence spectroscopy. These complexes exhibited ligand sensitized green emission at 546 nm associated with 5 D 4  →  7 F 5 transitions of terbium ion in the emission spectra. The photoluminescence study manifested that the organic ligands act as antenna and facilitate the absorbed energy to emitting levels of Tb(III) ion efficiently. The enhanced luminescence intensity and decay time of ternary C2-C5 complexes observed due to synergistic effect of anciliary ligands. The CIE color coordinates of complexes came under the green region of chromaticity diagram. The mechanistic investigation of intramolecular energy transfer in the complexes was discussed in detail. These terbium(III) complexes can be thrivingly used as one of the green component in light emitting material and in display devices. Graphical Abstract Illustrate the sensitization process of the Tb ion and intramolecular energy transfer process in the Tb 3+ complex.

Synthesis, structure and photoluminescence of novel lanthanide (Tb(III), Gd(III)) complexes with 6-diphenylamine carbonyl 2-pyridine carboxylate

International Nuclear Information System (INIS)

An Baoli; Gong Menglian; Cheah, Kok-Wai; Wong, Wai-Kwok; Zhang Jiming

2004-01-01

A novel organic ligand, 6-diphenylamine carbonyl 2-pyridine carboxylic acid (HDPAP), and the corresponding lanthanide complexes, tris(6-diphenylamine carbonyl 2-pyridine carboxylato) terbium(III) (Tb-DPAP) and tris(6-diphenylamine carbonyl 2-pyridine carboxylato) gadolinium(III) (Gd-DPAP) have been designed and synthesized. The crystal structure and photoluminescence of Tb-DPAP and Gd-DPAP have been studied. The results showed that the lanthanide complexes have electroneutral structures, and the solid terbium complex emits characteristic green fluorescence of Tb(III) ions at room temperature while the gadolinium complex emits the DPAP ligand phosphorescence. The lowest triplet level of DPAP ligand was calculated from the phosphorescence spectrum of Gd-DPAP in N,N-dimethyl formamide (DMF) dilute solution determined at 77 K, and the energy transfer mechanisms in the lanthanide complexes were discussed. The lifetimes of the 5 D 4 levels of Tb 3+ ions in the terbium complex were examined using time-resolved spectroscopy, and the values are 0.0153±0.0001 ms for solid Tb(DPAP) 3 ·11.5H 2 O and 0.074±0.007 ms for 2.5x10 -5 mol/l Tb-DPAP ethanol solution

Analysis of Patients' X-ray Exposure in 146 Percutaneous Radiologic Gastrostomies.

Science.gov (United States)

Petersen, Tim-Ole; Reinhardt, Martin; Fuchs, Jochen; Gosch, Dieter; Surov, Alexey; Stumpp, Patrick; Kahn, Thomas; Moche, Michael

2017-09-01

Purpose  Analysis of patient´s X-ray exposure during percutaneous radiologic gastrostomies (PRG) in a larger population. Materials and Methods  Data of primary successful PRG-procedures, performed between 2004 and 2015 in 146 patients, were analyzed regarding the exposition to X-ray. Dose-area-product (DAP), dose-length-product (DLP) respectively, and fluoroscopy time (FT) were correlated with the used x-ray systems (Flatpanel Detector (FD) vs. Image Itensifier (BV)) and the necessity for periprocedural placement of a nasogastric tube. Additionally, the effective X-ray dose for PRG placement using fluoroscopy (DL), computed tomography (CT), and cone beam CT (CBCT) was estimated using a conversion factor. Results  The median DFP of PRG-placements under fluoroscopy was 163 cGy*cm 2 (flat panel detector systems: 155 cGy*cm 2 ; X-ray image intensifier: 175 cGy*cm 2 ). The median DLZ was 2.2 min. Intraprocedural placement of a naso- or orogastric probe (n = 68) resulted in a significant prolongation of the median DLZ to 2.5 min versus 2 min in patients with an already existing probe. In addition, dose values were analyzed in smaller samples of patients in which the PRG was placed under CBCT (n = 7, median DFP = 2635 cGy*cm 2 ), or using CT (n = 4, median DLP = 657 mGy*cm). Estimates of the median DFP and DLP showed effective doses of 0.3 mSv for DL-assisted placements (flat panel detector 0.3 mSv, X-ray image converter 0.4 mSv), 7.9 mSv using a CBCT - flat detector, and 9.9 mSv using CT. This corresponds to a factor 26 of DL versus CBCT, or a factor 33 of DL versus CT. Conclusion  In order to minimize X-ray exposure during PRG-procedures for patients and staff, fluoroscopically-guided interventions should employ flat detector systems with short transmittance sequences in low dose mode and with slow image frequency. Series recordings can be dispensed with. The intraprocedural placement of a naso- or orogastric probe

Direct two-photon excitation of Sm3+, Eu3+, Tb3+, Tb.DOTA-, and Tb.propargylDO3A in solution

Science.gov (United States)

Sørensen, Thomas Just; Blackburn, Octavia A.; Tropiano, Manuel; Faulkner, Stephen

2012-07-01

We have observed direct two-photon excitation of samarium, europium and terbium ions in solution upon near IR excitation using a tuneable pulsed light source, and have also studied two-photon processes in a pair of related terbium complexes, namely [Tb.DOTA]- and Tb.propargylDO3A. Direct two-photon excitation of lanthanides is observed in simple systems in the absence of sensitizing chromophores. Where even simple chromophores such as a triple bond are present in the complex, then single and two-photon excitation of chromophore excited states competes with direct two-photon excitation of the ions and is the dominant pathway for sensitizing formation of the lanthanide excited state.

A scanning tunneling microscopy study of the electronic and spin states of bis(phthalocyaninato)terbium(iii) (TbPc2) molecules on Ag(111).

Science.gov (United States)

Ara, Ferdous; Qi, Zhi Kun; Hou, Jie; Komeda, Tadahiro; Katoh, Keiichi; Yamashita, Masahiro

2016-10-25

In this article, we investigate a single molecule magnet bis(phthalocyaninato)terbium(iii) (TbPc 2 ) molecule film by using low temperature STM. In order to investigate the effect of molecule-substrate interaction on the electronic and spin properties of the adsorbed molecule, we tune the molecule-substrate coupling by switching the substrate between Au(111) and Ag(111), the latter of which provides stronger interaction with the molecule than the former. Despite the enhanced chemical reactivity of the Ag(111) surface compared with Au(111), a well-organized pseudo-square film is formed. In addition, a checker-board type contrast variation is identified, which is well explained by the existence of two types of molecules whose rotational angle between the top and bottom Pc is θ = 45° (bright molecule) and θ = 30° (dark molecule). The expected stronger molecule-substrate interaction, however, appears as an intriguing dI/dV mapping image which reveals the spatial distribution of the density of states (DOS). We identify the contrast reversal in the dI/dV mapping for the molecules of θ = 45° and θ = 30° at the sample voltages of V = 0.7 eV and 1.1 eV. Combined with the density functional theory (DFT) calculation, we attribute this change to the shift of an electronic state due to the rotation of the mutual angle between the top and bottom Pc. For the spin behavior, we previously observed a Kondo resonance for the TbPc 2 molecule adsorbed on the Au(111) surface. On the Ag(111) surface, the Kondo resonance is hardly observed, which is due to the annihilation of the π radical spin by the charge transfer from the substrate to the molecule. Instead we observe a Kondo peak for the molecule on the second layer, for which the spin recovers due to the reduction of the coupling with the substrate. In addition, when a magnetic field of 2 T normal to the surface is applied, the second layer molecule shows a sharp dip at the Fermi level. We attribute this to the inelastic

Geology of the Terre Adélie Craton (135 – 146˚ E)

Science.gov (United States)

Ménot, R.P.; Duclaux, G.; Peucat, J.J.; Rolland, Y.; Guillot, S.; Fanning, M.; Bascou, J.; Gapais, D.; Pêcher, A.

2007-01-01

More than 15 years of field and laboratory investigations on samples from Terre Adélie to the western part of George Vth Land (135 to 146°E) during the GEOLETA program allow a reassessment of the Terre Adélie Craton (TAC) geology. The TAC represents the largest exposed fragment of the East Antarctic Shield preserved from both Grenville and Ross tectono-metamorphic events. Therefore it corresponds to a well-preserved continental segment that developed from the Neoarchean to the Paleoproterozoic. Together with the Gawler Craton in South Australia, the TAC is considered as part of the Mawson continent, i.e. a striking piece of the Rodinia Supercontinent. However, this craton represents one of the less studied parts of the East Antarctic Shield. The three maps presented here clearly point out the extent of two distinct domains within the Terre Adélie Craton and suggest that the TAC was built up through a polyphased evolution during the Neoarchean-Siderian (c.a. 2.5Ga) and the Statherian (c.a. 1.7Ga) periods. These data support a complete re-assessment of the TAC geology and represent a valuable base for the understanding of global geodynamics changes during Paleoproterozoic times.

Remaining Sites Verification Package for the 100-F-33, 146-F Aquatic Biology Fish Ponds, Waste Site Reclassification Form 2006-021

Energy Technology Data Exchange (ETDEWEB)

L. M. Dittmer

2006-08-25

The 100-F-33, 146-F Aquatice Biology Fish Ponds waste site was an area with six small rectangular ponds and one large circular pond used to conduct tests on fish using various mixtures of river and reactor effluent water. The current site conditions achieve the remedial action objectives specified in the Remaining Sites ROD. The results of verification and applicable confirmatory sampling show that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also demonstrate that residual contaminant concentrations are protective of groundwater and the Columbia River.

Magnon Interactions in Terbium

DEFF Research Database (Denmark)

Nielsen, Mourits; Bjerrum Møller, Hans; Mackintosh, Allan

1970-01-01

Magnon energies and lifetimes have been studied in Tb and Tb-10% Ho single crystals by inelastic neutron scattering. The lifetimes of magnons propagating in the c-direction have been measured in the ferromagnetic phase of Tb, and are found to decrease with increasing temperature and wave......-vector, probably principally due to magnon-magnon interactions. The interaction of magnons with phonons has also been observed and the effect of Ho impurities on this interaction studied. In addition, excitations which are ascribed to local modes associated with the Ho ions have been observed. The dependence...... of the indirect exchange interaction on temperature in the alloy gives information on the mechanisms responsible for the transition from the helical to ferromagnetic structures. The dependence of the magnon energies on magnetic field at low temperatures gives detailed information on the role of magnetoelastic...

Spin Waves in Terbium

DEFF Research Database (Denmark)

Jensen, J.; Houmann, Jens Christian Gylden; Bjerrum Møller, Hans

1975-01-01

with the symmetry, we deduce the dispersion relation for the spin waves in a basal-plane ferromagnet. This phenomenological spin-wave theory accounts for the observed behavior of the magnon energies in Tb. The two q⃗-dependent Bogoliubov components of the magnon energies are derived from the experimental results......, which are corrected for the effect of the direct coupling between the magnons and the phonons, and for the field dependence of the relative magnetization at finite temperatures. A large q⃗-dependent difference between the two energy components is observed, showing that the anisotropy of the two...

Spin Waves in Terbium

DEFF Research Database (Denmark)

Jensen, J.; Houmann, Jens Christian Gylden

1975-01-01

The selection rules for the linear couplings between magnons and phonons propagating in the c direction of a simple basal-plane hcp ferromagnet are determined by general symmetry considerations. The acoustic-optical magnon-phonon interactions observed in the heavy-rare-earth metals have been...... explained by Liu as originating from the mixing of the spin states of the conduction electrons due to the spin-orbit coupling. We find that this coupling mechanism introduces interactions which violate the selection rules for a simple ferromagnet. The interactions between the magnons and phonons propagating...... in the c direction of Tb have been studied experimentally by means of inelastic neutron scattering. The magnons are coupled to both the acoustic- and optical-transverse phonons. By studying the behavior of the acoustic-optical coupling, we conclude that it is a spin-mixed-induced coupling as proposed...

A comparative study of superdeformation in sup 146,147,148 Gd. Possible manifestations of the pseudo-SU sub 3 symmetry, octupole shape susceptibility and superdeformed deep-hole excitations

Energy Technology Data Exchange (ETDEWEB)

Zuber, K.; Balouka, D.; Beck, F.A.; Byrski, T.; Curien, D.; France, G. de; Duchene, G.; Gehringer, C.; Haas, B.; Merdinger, J.C.; Romain, P.; Santos, D.; Styczen, J.; Vivien, J.P.; Dudek, J.; Szymanski, Z.; Werner, T.R. (Strasbourg-1 Univ., 67 (France). Centre de Recherches Nucleaires)

1991-01-24

Two discrete superdeformed (SD) bands have been identified in the nucleus {sup 147}Gd and the twin-band mechanism studied by comparison with SD results for {sup 146,148}Gd. Theoretical interprettion in terms of nucleonic orbitals with the Woods-Saxon potential is consistent with the pseudo-spin symmetry picture and the octupole susceptibility mechanism predicted by theory. (orig.).

Molecular Gas Reservoirs in Cluster Galaxies at z = 1.46

Science.gov (United States)

Hayashi, Masao; Tadaki, Ken-ichi; Kodama, Tadayuki; Kohno, Kotaro; Yamaguchi, Yuki; Hatsukade, Bunyo; Koyama, Yusei; Shimakawa, Rhythm; Tamura, Yoichi; Suzuki, Tomoko L.

2018-04-01

We present molecular gas reservoirs of 18 galaxies associated with the XMMXCS J2215.9–1738 cluster at z = 1.46. From Band 7 and Band 3 data of the Atacama Large Millimeter/submillimeter Array, we detect dust continuum emission at 870 μm and the CO J = 2–1 emission line from 8 and 17 member galaxies, respectively, within a clustercentric radius of R 200. The molecular gas masses derived from the CO and/or dust continuum luminosities show that the fraction of molecular gas mass and the depletion timescale for the cluster galaxies are larger than expected from the scaling relations of molecular gas on stellar mass and offset from the main sequence of star-forming galaxies in general fields. The galaxies closer to the cluster center in terms of both projected position and accretion phase seem to show a larger deviation from the scaling relations. We speculate that the environment of the galaxy cluster helps feed the gas through inflow to the member galaxies and reduce the efficiency of star formation. The stacked Band 3 spectrum of 12 quiescent galaxies with M stellar ∼ 1011 M ⊙ within 0.5R 200 shows no detection of a CO emission line, giving the upper limit of molecular gas mass and molecular gas fraction to be ≲1010 M ⊙ and ≲10%, respectively. Therefore, the massive galaxies in the cluster core quench the star formation activity while consuming most of the gas reservoirs.

Combination of photosensitive elements for use in radiography

International Nuclear Information System (INIS)

Bollen, R.H.; Vandenabeele, H.

1976-01-01

A new and improved combination of photosensitive elements is proposed that can be used in radiography. The combination according to the invention is composed of an X-ray fluorescence intensifying screen and a photographic halide of silver containing a color coupler. The color coupler causes a negative silver image and a color image to be formed in the material. The fluorescent layer of the fluorescence screen contains a mixture of lanthanum oxychloride or lanthanum oxybromide activated with terbium or terbium and ytterbium. Detailed information about variants in the composition of the fluorescent substance, the grain sizes of the silver halides, variations of the color couplers and about the coating of the single layers is given. (UWI) [de

The Cytomegalovirus UL146 Gene Product vCXCL1 Targets Both CXCR1 and CXCR2 as an Agonist

DEFF Research Database (Denmark)

Luttichau, H.R.

2010-01-01

Large DNA viruses, such as herpesvirus and poxvirus, encode proteins that target and exploit the chemokine system of their host. UL146 and UL147 in the cytomegalovirus (CMV) genome encode the two CXC chemokines vCXCL1 and vCXCL2. In this study, vCXCL1 was probed against a panel of the 18 classified...... human chemokine receptors. In calcium mobilization assays vCXCL1 acted as an agonist on both CXCR1 and CXCR2 but did not activate or block any of the other 16 chemokine receptors. vCXCL1 was characterized and compared with CXCL1/GRO alpha, CXCL2/GRO beta, CXCL3/GRO gamma, CXCL5/ENA-78, CXCL6/GCP2, CXCL7...

Early mantle differentiation: constraint from {sup 146}Sm-{sup 142}Nd systematics; Radioactivite eteinte du {sup 146}Sm et differenciation precoce du manteau terrestre

Energy Technology Data Exchange (ETDEWEB)

Caro, G

2005-07-15

We present new ultra-high precision {sup 142}Nd/{sup 144}Nd measurements of early Archaean rocks using the new generation thermal ionization mass spectrometer TRITON. Repeated measurements of the Ames Nd standard demonstrate that the {sup 142}Nd/{sup 144}Nd ratio can be determined with external precision of 2 ppm (2s), allowing confident resolution of anomalies as small as 5 ppm. A major analytical improvement lies in the elimination of the double normalization procedure required to correct our former measurements from a secondary mass fractionation effect. Our new results indicate that metasediments, meta-basalts and orthogneisses from the 3.6 - 3.8 Ga West Greenland craton display positive {sup 142}Nd anomalies ranging from 8 to 15 ppm. Using a simple two-stage model with initial e{sup 143}Nd value of 1.9 {+-} 0.6 e-units, coupled {sup 147}Sm-{sup 143}Nd and {sup 146}Sm-{sup 142}Nd chronometry constrains mantle differentiation to 50 to 200 Ma after formation of the solar system. This chronological constraint is consistent with differentiation of the Earth's mantle during the late stage of crystallization of a magma ocean. We have developed a two-box model describing {sup 142}Nd and {sup 143}Nd isotopic evolution of depleted mantle during the subsequent evolution of the crust-mantle system. Our results indicate that early terrestrial proto-crust had a lifetime of ca. 500 Ma in order to produce the observed Nd isotope signature of Archaean rocks. In the context of this two box mantle-crust system, we model the evolution of isotopic and chemical heterogeneity of depleted mantle as a function of the mantle stirring time. Using the dispersion of {sup 142}Nd/{sup 144}Nd and {sup 143}Nd/{sup 144}Nd ratios observed in early Archaean rocks, we constrain the stirring time of early Earth's mantle to 100 - 150 Ma, a factor of 5 to 10 shorter than stirring time inferred from modern oceanic basalts. (author)

Syntheses of optically efficient (La{sub 1-x-y}Ce{sub x}Tb{sub y})F{sub 3} nanocrystals via a hydrothermal method

Energy Technology Data Exchange (ETDEWEB)

Wang Qiang [Department of Mechanical and Aerospace Engineering, Princeton University, Princeton, NJ 08544 (United States); You Yumin; Ludescher, Richard D. [Department of Food Science, Rutgers University, New Brunswick, NJ 08901 (United States); Ju Yiguang, E-mail: yju@princeton.ed [Department of Mechanical and Aerospace Engineering, Princeton University, Princeton, NJ 08544 (United States)

2010-06-15

Optically efficient cerium and terbium doped lanthanide fluoride (La{sub 1-x-y}Ce{sub x}Tb{sub y})F{sub 3} nanocrystals with different doping concentrations have been synthesized by a hydrothermal route in the presence of ethylenediamine tetraacetic acid disodium salt (EDTA). The results showed that the formation of nanocrystals with different morphologies depends on terbium ion Tb{sup 3+} doping concentration, but independent of cerium ion Ce{sup 3+} doping concentration. With increase in Tb{sup 3+} doping concentration, the morphologies of nanocrystals evolved from a spherical shape to a plated-like one. In addition, both the photoluminescence quantum yield (PL QY) and the fluorescence lifetime of nanocrystals increased with the increase in Ce{sup 3+} doping concentration in cerium and terbium co-doped system. The PL QY reached up to 55%, and the lifetime up to 7.3 ms. Transmission electron microscopy (TEM), X-ray diffraction (XRD), selected area electron diffraction (SAED), X-ray fluorescence (XRF), energy dispersive spectroscopy (EDS), ultraviolet-visible (UV-vis) absorption, photoluminescence (PL) and infrared (IR) spectroscopies were employed to characterize the properties of nanocrystals. The growth mechanism of nanocrystals with different morphologies and optical properties of nanocrystals with different doping concentrations were investigated.

Local particle densities and global multiplicities in central heavy ion interactions at 3.7, 14.6, 60 and 200 A GeV

International Nuclear Information System (INIS)

Adamovich, M.I.; Alexandrov, Y.A.; Aggarwal, M.M.

1992-03-01

The energy and centrality dependence of local particle pseudorapidity densities as well as validity of various parametrizations of the distributions are examined. The dispersion, σ, of the rapidity density distribution of produced particles varies slowly with centrality and is 0.80, 0.98, 1.21 and 1.41 for central interactions at 3.7, 14.6, 60 and 200 A GeV incident energy, respectively. σ is found to be independent of the size of the interacting system at fixed energy. A novel way of representing the window dependence of the multiplicity as normalized variance versus inverse average multiplicity is outlined. (au)

Local particle densities and global multiplicities in central heavy ion interactions at 3.7, 14.6, 60 and 200 A GeV

International Nuclear Information System (INIS)

Adamovich, M.I.; Alexandrov, Y.A.; Chernyavsky, M.M.; Gerassimov, S.G.; Larionova, V.G.; Maslennikova, N.V.; Orlova, G.I.; Peresadko, N.G.; Rappoport, V.M.; Salmanova, N.A.; Tretyakova, M.I.; Aggarwal, M.M.; Arora, R.; Bhatia, V.S.; Mittra, I.S.; Andreeva, N.P.; Anson, Z.V.; Bubnov, V.I.; Chasnikov, I.Y.; Eligbaeva, G.Z.; Eremenko, L.E.; Gaitinov, A.S.; Kalyachkina, G.S.; Kanygina, E.K.; Lepetan, V.N.; Shakhova, T.I.; Avetyan, F.A.; Marutyan, N.A.; Sarkisova, L.G.; Sarkisyan, V.R.; Badyal, S.K.; Bhasin, A.; Gupta, V.K.; Kachroo, S.; Kaul, G.L.; Kitroo, S.; Mangotra, L.K.; Rao, N.K.; Basova, E.; Nasrulaeva, H.; Nasyrov, S.H.; Petrov, N.V.; Qarshiev, D.A.; Trofimova, T.P.; Tuleeva, U.; Bhalla, K.B.; Gupta, S.K.; Kumar, V.; Lal, P.; Lokanathan, S.; Mookerjee, S.; Palsania, H.S.; Raniwala, R.; Raniwala, S.; Bogdanaov, V.G.; Plyushchev, V.A.; Solovjeva, Z.I.; Burnett, T.H.; Grote, J.; Lord, J.; Skelding, D.; Wilkes, R.J.; Chernova, L.P.; Gulamov, K.G.; Lukicheva, N.S.; Navotny, V.S.; Saidkhanov, N.; Shpilev, S.N.; Surin, E.L.; Svechnikova, L.N.; Zhochova, S.I.; Ganssauge, E.R.; Rhee, J.T.; Garpman, S.; Jakobsson, B.; Nystrand, J.; Otterlund, I.; Soederstroem, K.; Stenlund, E.; Heckman, H.H.; Cai, X.; Huang, H.; Liu, L.S.; Qian, W.Y.; Wang, H.Q.; Zhou, D.C.; Judek, B.; Just, L.; Tothova, M.; Karabova, M.; Vokal, S.; Krasnov, S.A.; Kulikova, S.; Maksimkina, T.N.; Shabratova, G.S.; Tolstov, K.D.; Luo, S.B.; Qin, Y.M.; Zhang, D.H.; Weng, Z.Q.; Xia, Y.L.; Xu, G.F.; Zheng, P.Y.

1992-01-01

The energy and centrality dependence of local particle pseudorapidity densities as well as validity of various parameterizations of the distributions are examined. The dispersion, σ, of the rapidity density distribution of produced particles varies slowly with centrality and is 0.80, 0.98, 1.21 and 1.41 for central interactions at 3.7, 14.6, 60 and 200 A GeV incident energy, respectively, σ is found to be independent of the size of the interacting system at fixed energy. A novel, way of representing the window dependence of the multiplicity as normalized variance versus inverse average multiplicity is outlined. (orig.)

Enhancing Sm{sup 3+} red emission via energy transfer from Bi{sup 3+}→Sm{sup 3+} based on terbium bridge mechanism in Ca{sub 2}Al{sub 2}SiO{sub 7} phosphors

Energy Technology Data Exchange (ETDEWEB)

Li, Minhong; Wang, LiLi; Ran, Weiguang; Ren, Chunyan; Song, Zeling; Shi, Jinsheng, E-mail: jsshiqn@aliyun.com

2017-04-15

Currently, the key change for white-LED is to improve the luminescence efficiency of red phosphor. Sm{sup 3+} activated phosphor was considered due to suitable emission position of red light. However, the luminescence intensity in the red region is weak. For enhancing red-emitting of Sm{sup 3+}, Bi{sup 3+} and Tb{sup 3+} ions were introduced into Ca{sub 2}Al{sub 2}SiO{sub 7}:Sm{sup 3+} phosphors based on the concept of energy transfer. For Ca{sub 2}Al{sub 2}SiO{sub 7}:Bi{sup 3+}, Sm{sup 3+} samples, it can be observed that the energy transfer process was blocked. Hence, Tb{sup 3+} was introduced into Ca{sub 2}Al{sub 2}SiO{sub 7}:Bi{sup 3+}, Sm{sup 3+} samples to increase Sm{sup 3+} luminescence intensity based on Bi{sup 3+}→Tb{sup 3+}→Sm{sup 3+} energy transfer process. Compared with Sm{sup 3+} single-doped Ca{sub 2}Al{sub 2}SiO{sub 7} phosphor, the luminescence intensity of Sm{sup 3+} was enhanced by 2.6 times. It can be found that Tb{sup 3+} ions play a role of storing the energy or transfer bridge from Bi{sup 3+}→ Sm{sup 3+} by investigating the Ca{sub 2}Al{sub 2}SiO{sub 7}:Bi{sup 3+}, Tb{sup 3+} and Ca{sub 2}Al{sub 2}SiO{sub 7}:Tb{sup 3+}, Sm{sup 3+} energy transfer mechanism. All these results suggest that terbium branch mechanism plays an important role on enhancing activators luminescence intensity.

Early mantle differentiation: constraint from 146Sm-142Nd systematics

International Nuclear Information System (INIS)

Caro, G.

2005-07-01

We present new ultra-high precision 142 Nd/ 144 Nd measurements of early Archaean rocks using the new generation thermal ionization mass spectrometer TRITON. Repeated measurements of the Ames Nd standard demonstrate that the 142 Nd/ 144 Nd ratio can be determined with external precision of 2 ppm (2s), allowing confident resolution of anomalies as small as 5 ppm. A major analytical improvement lies in the elimination of the double normalization procedure required to correct our former measurements from a secondary mass fractionation effect. Our new results indicate that metasediments, meta-basalts and orthogneisses from the 3.6 - 3.8 Ga West Greenland craton display positive 142 Nd anomalies ranging from 8 to 15 ppm. Using a simple two-stage model with initial e 143 Nd value of 1.9 ± 0.6 e-units, coupled 147 Sm- 143 Nd and 146 Sm- 142 Nd chronometry constrains mantle differentiation to 50 to 200 Ma after formation of the solar system. This chronological constraint is consistent with differentiation of the Earth's mantle during the late stage of crystallization of a magma ocean. We have developed a two-box model describing 142 Nd and 143 Nd isotopic evolution of depleted mantle during the subsequent evolution of the crust-mantle system. Our results indicate that early terrestrial proto-crust had a lifetime of ca. 500 Ma in order to produce the observed Nd isotope signature of Archaean rocks. In the context of this two box mantle-crust system, we model the evolution of isotopic and chemical heterogeneity of depleted mantle as a function of the mantle stirring time. Using the dispersion of 142 Nd/ 144 Nd and 143 Nd/ 144 Nd ratios observed in early Archaean rocks, we constrain the stirring time of early Earth's mantle to 100 - 150 Ma, a factor of 5 to 10 shorter than stirring time inferred from modern oceanic basalts. (author)

Ultrasound-guided percutaneous transhepatic biliary drainage: Experiences in 146 patients

Energy Technology Data Exchange (ETDEWEB)

Kim, Jai Keun [Sohwa Children' s Hospital, Seoul(Korea, Republic of); Yu, Jeong Sik; Kim, Ki Whang; Chung, Soo Yoon; Jeong, Mi Gyoung [Yonsei University College of Medicine, Seoul (Korea, Republic of); Choi, Deuk Lin; Kwon, Gui Hyang; Lee, Hae Kyung [Soonchunhyang University College of Medicine, Seoul (Korea, Republic of)

1999-03-15

Percutaneous biliary drainage is an important technique for palliative therapy of obstructive biliary disease and diagnostic information. The purpose of this study is to review and evaluate the experiences of ultrasound-guided percutaneous transhepatic biliary drainage. Ultrasound-guided percutaneous transhepatic biliary drainage was performed on 146 occasions in 134 patients. The causes of biliary obstruction were: benign diseases (19 cases, 14.2%) such as bile duct stones or stricture, cholangiocarcinoma (37 cases, 27.6%), pancreatic carcinoma (35 cases, 26.1%), metastasis (22 cases, 16.5%), gall bladder cancer (14 cases, 10.4%), ampulla of Vater cancer (4 cases, 3.0%), hepatocellular carcinoma (3 cases, 2.2%). Retrospectively reviewing medical records, we found out frequency of external or external/internal biliary drainages, puncture of left or right hepatic duct, and presence of bileinfection. Ultrasound-guided percutaneous transhepatic biliary drainage was compared with conventional biliary drainage of previous reports on the basis of frequency of complications. External (124 procedures, 84.9%) and external/internal biliary drainage (22 procedures, 15.1%) were carried out by puncture of dilated right (59.6%) or left (40.4%) intrahepatic duct. Sixty-nine complications occurred in 47 patients. Catheter related complications (33/69, 47.8%) were most common: catheter dislodgement (17/69, 24.6%), malfunction (9/69, 13.1%), leakage (7/69, 10.1%). Other minor complications such as simple fever (16/69, 23.2%), cholangitis (7/69, 10.1%), hemobilia (4/69, 5.8%), biloma (2/69, 2.9%) and wound infection (1/69, 1.5%) occurred. Major complications including sepsis (4/69, 5.8%) and bile peritonitis (2/69, 2.9%) were also noted. Puncture-related complications such as hemobilia, biloma and bile peritonitis occurred in 8 cases (5.5%). Comparing with conventional X-ray guided drainage, ultrasound-guided percutaneous transhepatic biliary drainage is a safe procedure for

Transverse energy and charged particle multiplicity in 14.6 GeV/c proton-nucleus collisions

International Nuclear Information System (INIS)

Wang, Gang

1995-01-01

Transverse energy and charged particle multiplicity produced in 14.6 GeV/c p + Al and p + Pb collisions have been studied using the E814 set-up at the BNL-AGS. Measurements of dσ/dE T , dE T /dη,dσ/dN c , and dN c /dη are presented. From the present data the mean transverse energy per particle is obtained and it is compared to values observed in Si induced collisions at the same energy In contrast to what is observed in nucleus-nucleus collisions, a very weak correlation is found between the transverse energy and the charged particle multiplicity. These results are compared to the predictions of various theoretical models used to describe heavy-ion collisions. The event generators RQMD and HIJET reproduce well the pseudorapidity distribution of both the transverse energy and charged particle multiplicity, whereas FRITIOF fails to reproduce the measured distributions. Contrary to what had been suggested previously in a Si + A study, the present study shows that the pseudorapidity dependence of charged particle multiplicity distributions do not follow KNO scaling. (author)

Structure and luminescence spectra of lutetium and yttrium borates synthesized from ammonium nitrate melt

International Nuclear Information System (INIS)

Klassen, Nikolay V.; Shmurak, Semion Z.; Shmyt'ko, Ivan M.; Strukova, Galina K.; Derenzo, Stephen E.; Weber, Marvin J.

2005-01-01

Lutetium and yttrium borates doped with europium, terbium, gadolinium, etc. have been synthesized by dissolving initial oxides and nitrates in ammonium nitrate melt and thermal decomposition of the solvent. Annealings in the range of 500-1100 deg. C modified the dimensions of the grains from 2 to 3 nm to more than 100 nm. Significant dependence of the structure of lutetium borate on slight doping with rare earth ions has been found: terbium makes high-temperature vaterite phase preferential at room temperature, whereas europium stabilizes low-temperature calcite phase. Influence of the structure of the borates on the pattern of the luminescence spectra of europium dopant was observed. Possibilities for manufacturing of scintillating lutetium borate ceramics by means of this method of synthesis are discussed

Structure and luminescence spectra of lutetium and yttrium borates synthesized from ammonium nitrate melt

Science.gov (United States)

Klassen, Nikolay V.; Shmurak, Semion Z.; Shmyt'ko, Ivan M.; Strukova, Galina K.; Derenzo, Stephen E.; Weber, Marvin J.

2005-01-01

Lutetium and yttrium borates doped with europium, terbium, gadolinium, etc. have been synthesized by dissolving initial oxides and nitrates in ammonium nitrate melt and thermal decomposition of the solvent. Annealings in the range of 500-1100°C modified the dimensions of the grains from 2 to 3 nm to more than 100 nm. Significant dependence of the structure of lutetium borate on slight doping with rare earth ions has been found: terbium makes high-temperature vaterite phase preferential at room temperature, whereas europium stabilizes low-temperature calcite phase. Influence of the structure of the borates on the pattern of the luminescence spectra of europium dopant was observed. Possibilities for manufacturing of scintillating lutetium borate ceramics by means of this method of synthesis are discussed.

Remaining Sites Verification Package for the 100-F-33, 146-F Aquatic Biology Fish Ponds. Attachment to Waste Site Reclassification Form 2006-021

International Nuclear Information System (INIS)

Dittmer, L.M.

2006-01-01

The 100-F-33, 146-F Aquatice Biology Fish Ponds waste site was an area with six small rectangular ponds and one large circular pond used to conduct tests on fish using various mixtures of river and reactor effluent water. The current site conditions achieve the remedial action objectives specified in the Remaining Sites ROD. The results of verification and applicable confirmatory sampling show that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also demonstrate that residual contaminant concentrations are protective of groundwater and the Columbia River

1-(4-(6-Fluorobenzo [d] isoxazol-3-yl) piperidin-1-yl)-2-(4-(hydroxymethyl)-1H-1,2,3-triazol-1-yl) ethanone: Synthesis, spectroscopic characterization, Hirshfeld surface analysis, cytotoxic studies and docking studies

Science.gov (United States)

Govindhan, M.; Viswanathan, V.; Karthikeyan, S.; Subramanian, K.; Velmurugan, D.

2017-08-01

Compound 1-(4-(6-fluorobenzo[d] isoxazol-3-yl) piperidin-1-yl)-2-(4-(hydroxymethyl)-1H-1, 2,3-triazol-1-yl) ethanone was synthesized in good yield by using click chemistry approach with 2-azido-1-(4-(6-flurobenzo[d]isooxazol-3-yl)piperidin-1-yl)ethanone as a starting material. The synthesized compound was characterized using IR, NMR and MS studies. Thermal stability of the compound was analyzed by using TGA and DSC technique. The single crystal XRD analysis was taken part, to confirm the structure of the compound. The intercontacts in the crystal structure are analyzed using Hirshfeld surfaces computational method. Cytotoxicity of the synthesized compound was evaluated and the results were reported. The binding analysis carried out between the newly synthesized molecule with human serum albumin using fluorescence spectroscopy technique to understand the pharmacokinetics nature of the compound for further biological application. The molecular docking studies were evaluated for the compound to elucidate insights of new molecules in carrier protein.

Study of fractal behaviour of target fragments produced in 28Si and 32S emulsion collisions at 14.6 and 200 AGeV

International Nuclear Information System (INIS)

Rasool, Mir Hashim; Ahmad, Shafiq; Ahmad, M. Ayaz

2013-01-01

The experimental data based on 951 and 380 events of 28 Si-emulsion and 32 S-emulsion interactions at 14.6 and 200 AGeV/c respectively have been analysed to investigate intermittent behaviour and fractal properties of emission spectra of fast and slow target associated particles. The observed increasing trend in the values of fractal moments, Fqcorr and modified Gq-moments with decreasing bin size clearly reflects the evaporation model and gives an evidence for an intermittency pattern of fluctuations. The experimental data have been compared with randomly generated uncorrelated Monte Carlo of 10,000 events to check the presence of the statistical fluctuations in the target fragmentation region

Hyperfine interactions measured by nuclear orientation technique

International Nuclear Information System (INIS)

Brenier, R.

1982-01-01

This report concerns the use of hyperfine interaction to magnetism measurements and to the determination of the nuclear structure of Terbium isotopes by the low temperature nuclear orientation technique. In the first part we show that the rhodium atom does not support any localized moment in the chromium matrix. The hyperfine magnetic field at the rhodium nuclear site follows the Overhauser distribution, and the external applied magnetic field supports a negative Knight shift of 16%. In the second part we consider the structure of neutron deficient Terbium isotopes. We introduce a coherent way of evaluation and elaborate a new nuclear thermometer. The magnetic moments allows to strike on the studied states configuration. The analysis of our results shows a decrease of the nuclear deformation for the lighter isotopes [fr

Quantitative Detection of the Foot-And-Mouth Disease Virus Serotype O 146S Antigen for Vaccine Production Using a Double-Antibody Sandwich ELISA and Nonlinear Standard Curves.

Directory of Open Access Journals (Sweden)

Xia Feng

Full Text Available The efficacy of an inactivated foot-and-mouth disease (FMD vaccine is mainly dependent on the integrity of the foot-and-mouth disease virus (FMDV particles. At present, the standard method to quantify the active component, the 146S antigen, of FMD vaccines is sucrose density gradient (SDG analysis. However, this method is highly operator dependent and difficult to automate. In contrast, the enzyme-linked immunosorbent assay (ELISA is a time-saving technique that provides greater simplicity and sensitivity. To establish a valid method to detect and quantify the 146S antigen of a serotype O FMD vaccine, a double-antibody sandwich (DAS ELISA was compared with an SDG analysis. The DAS ELISA was highly correlated with the SDG method (R2 = 0.9215, P<0.01. In contrast to the SDG method, the DAS ELISA was rapid, robust, repeatable and highly sensitive, with a minimum quantification limit of 0.06 μg/mL. This method can be used to determine the effective antigen yields in inactivated vaccines and thus represents an alternative for assessing the potency of FMD vaccines in vitro. But it still needs to be prospectively validated by analyzing a new vaccine preparation and determining the proper protective dose followed by an in vivo vaccination-challenge study to confirm the ELISA findings.

Quantitative Detection of the Foot-And-Mouth Disease Virus Serotype O 146S Antigen for Vaccine Production Using a Double-Antibody Sandwich ELISA and Nonlinear Standard Curves

Science.gov (United States)

Feng, Xia; Ma, Jun-Wu; Sun, Shi-Qi; Guo, Hui-Chen; Yang, Ya-Min; Jin, Ye; Zhou, Guang-Qing; He, Ji-Jun; Guo, Jian-Hong; Qi, Shu-yun; Lin, Mi; Cai, Hu; Liu, Xiang-Tao

2016-01-01

The efficacy of an inactivated foot-and-mouth disease (FMD) vaccine is mainly dependent on the integrity of the foot-and-mouth disease virus (FMDV) particles. At present, the standard method to quantify the active component, the 146S antigen, of FMD vaccines is sucrose density gradient (SDG) analysis. However, this method is highly operator dependent and difficult to automate. In contrast, the enzyme-linked immunosorbent assay (ELISA) is a time-saving technique that provides greater simplicity and sensitivity. To establish a valid method to detect and quantify the 146S antigen of a serotype O FMD vaccine, a double-antibody sandwich (DAS) ELISA was compared with an SDG analysis. The DAS ELISA was highly correlated with the SDG method (R2 = 0.9215, P<0.01). In contrast to the SDG method, the DAS ELISA was rapid, robust, repeatable and highly sensitive, with a minimum quantification limit of 0.06 μg/mL. This method can be used to determine the effective antigen yields in inactivated vaccines and thus represents an alternative for assessing the potency of FMD vaccines in vitro. But it still needs to be prospectively validated by analyzing a new vaccine preparation and determining the proper protective dose followed by an in vivo vaccination-challenge study to confirm the ELISA findings. PMID:26930597

Late bone and soft tissue sequelae of childhood radiotherapy. Relevance of treatment age and radiation dose in 146 children treated between 1970 and 1997

Energy Technology Data Exchange (ETDEWEB)

Doerr, W. [Technical Univ. of Dresden (Germany). Dept. of Radiotherapy and Radiation Oncology; Medical University / AKH Vienna (Austria). Dept. of Radiation Oncology; Kallfels, S. [Technical Univ. of Dresden (Germany). Dept. of Radiotherapy and Radiation Oncology; Kinder- und Jugendmedizin, Chemnitz [Germany; Herrmann, T. [Technical Univ. of Dresden (Germany). Dept. of Radiotherapy and Radiation Oncology

2013-07-15

Purpose: The present retrospective study was initiated to characterize the effect of oncological treatments in children and adolescents on bone and soft tissues, and to assess their dependence on radiation dose and age at exposure. Patients and methods: The study included 146 patients treated between 1970 and 1997. All patients received external beam radiotherapy to the trunk or extremities, but no cranial irradiation. Median age at treatment was 8.8 years. Patients were screened at 18 years (median time interval since treatment 9.2 years, range 0.9-17.7 years) for pathological changes in the skeletal system and soft tissues (scoliosis, kyphosis, bony hypoplasia, soft tissue defects, asymmetries), which were classified as minor/moderate (grade 1) or substantial (grade 2). Results: Pathological findings were recorded in 75/146 patients (51 %). These were scored as minor in 44 (59 %) and substantial in 31 patients (41 %). Most pathological changes occurred in children treated under the age of 6 years. At 6 years and older, only doses > 35 Gy caused an effect, and no substantial changes were seen for treatment ages exceeding 12 years. Significant effects of radiation dose and age at exposure were observed for kyphoscoliosis (with vertebral body dose gradients < 35 Gy), hypoplasia and soft tissue defects and asymmetrical growth. Conclusion: Tolerance doses of 20 Gy need to be respected for growing bone, particularly in children treated under the age of 6 years. The late treatment sequelae analysed in the present study are largely avoided with the use of current therapeutic protocols. However, the systematic evaluation, documentation and continuous analysis of adverse events in paediatric oncology remains essential, as does the evaluation of novel radio(chemo)therapeutic approaches. (orig.)

Wavelet signatures of K-splitting of the Isoscalar Giant Quadrupole Resonance in deformed nuclei from high-resolution (p,p‧) scattering off 146, 148, 150Nd

Science.gov (United States)

Kureba, C. O.; Buthelezi, Z.; Carter, J.; Cooper, G. R. J.; Fearick, R. W.; Förtsch, S. V.; Jingo, M.; Kleinig, W.; Krugmann, A.; Krumbolz, A. M.; Kvasil, J.; Mabiala, J.; Mira, J. P.; Nesterenko, V. O.; von Neumann-Cosel, P.; Neveling, R.; Papka, P.; Reinhard, P.-G.; Richter, A.; Sideras-Haddad, E.; Smit, F. D.; Steyn, G. F.; Swartz, J. A.; Tamii, A.; Usman, I. T.

2018-04-01

The phenomenon of fine structure of the Isoscalar Giant Quadrupole Resonance (ISGQR) has been studied with high energy-resolution proton inelastic scattering at iThemba LABS in the chain of stable even-mass Nd isotopes covering the transition from spherical to deformed ground states. A wavelet analysis of the background-subtracted spectra in the deformed 146, 148, 150Nd isotopes reveals characteristic scales in correspondence with scales obtained from a Skyrme RPA calculation using the SVmas10 parameterization. A semblance analysis shows that these scales arise from the energy shift between the main fragments of the K = 0 , 1 and K = 2 components.

Operation of resonant-tunneling diodes with strong back injection from the collector at frequencies up to 1.46 THz

International Nuclear Information System (INIS)

Feiginov, Michael; Kanaya, Hidetoshi; Suzuki, Safumi; Asada, Masahiro

2014-01-01

In search for possibilities to increase the operating frequencies of resonant-tunneling diodes (RTDs), we are studying RTDs working in an unusual regime. The collector side of our diodes is so heavily doped that the collector depletion region is fully eliminated in our RTDs and the ground quantum-well subband stays immersed under (or stays close to) the collector quasi-Fermi level. The electron injection from the collector into the RTD quantum well is very strong in our diodes and stays comparable to that from the emitter in the whole range of RTD operating biases. Our RTDs exhibit well pronounced negative-differential-conductance region and peak-to-valley current ratio around 1.8. We demonstrate operation of our diodes in RTD oscillators up to 1.46 THz. We also observe a fine structure in the emission spectra of our RTD oscillators, when they are working in the regime close to the onset of oscillations.

President Barack Obama addresses the 146th annual meeting of the National Academy of Sciences.

Science.gov (United States)

2009-06-16

On April 27, 2009, President Barack Obama addressed members of the National Academy of Sciences (NAS) gathered at its 146th annual meeting in Washington, D.C. In his speech, the president shared his plans to give science and technology a central role in the nation's future and an immediate place in America's economic renewal. He outlined steps he is taking to increase research spending, achieve energy independence, and improve science education. Included was what Mr. Obama cited as the largest commitment to scientific research in American history-devoting more than 3% of our gross domestic product to research and development. "Next, we are restoring science to its rightful place," Mr. Obama told a packed NAS auditorium audience. "Under my administration, the days of science taking a backseat to ideology are over." He appealed to scientists' sense of personal responsibility to reach and educate young Americans: "I want to challenge you to use your love and knowledge of science to spark a sense of wonder and excitement in a new generation." President Obama was welcomed to the National Academy of Sciences by President Ralph J. Cicerone and John P. Holdren, Assistant to the President for Science and Technology and Director of the White House Office of Science and Technology Policy. The following is a transcript of that speech.

Neutron and X-ray small angle scattering (S.A.S.) study of the amorphous alloy Tbsub(.25)Cusub(.75)

International Nuclear Information System (INIS)

Boucher, B.

1980-07-01

The magnetic properties of amorphous alloys REsub(x) Msub(x-1) (R.E.=heavy rare earths, M=Cu, Ag, Au) have been widely studied. They are of the speromagnetic type for x>=0.33 and are mictomagnetic for x -12 cm). Also the atomic volume of Terbium (approximately 33 A 3 ) is almost three times that of Copper (11.8 A 3 ) and Cu is less absorbant than Ag or Au. Tb alloys exhibit high magnetic ordering temperatures and important moments in contrast to the majority of other alloys of the same family. One inconvenience with Terbium, however, is the large (X-ray) fluorescence (lambda Cu). In order to confirm some interpretations of S.A.S., we were obliged to determine some physical parameters such as the density and porosity and to examine the sample with microscope. These results are also given here

Luminescent properties of Al{sub 2}O{sub 3}: Tb powders; Propiedades luminiscentes de polvos de Al{sub 2}O{sub 3}: Tb

Energy Technology Data Exchange (ETDEWEB)

Esparza G, A.E.; Garcia, M.; Falcony, C.; Azorin N, J. [CICATA-IPN, Legaria 694, Col. Irrigacion, 11500 Mexico D.F. (Mexico)

2000-07-01

In this work the photo luminescent and cathode luminescent characteristics of aluminium oxide (Al{sub 2}O{sub 3}) powders impurified with terbium (Tb) were studied for their use in dosimetry. The optical, structural, morphological characteristics of the powders as function of variation in the impurity concentration and the annealing temperature will be presented. As regards the optical properties of powders (photoluminescence and cathode luminescence) it was observed a characteristic emission associated with radiative transitions between electron energy levels of terbium, the spectra associated with this emission consists of several peaks associated with such transitions. In the structural and morphological characterization (X-ray diffraction and scanning electron microscopy) it was appreciated that in accordance the annealing temperature of powders is augmented it is evident the apparition of certain crystalline phases. The results show that this is a promissory material for radiation dosimetry. (Author)

Luminescent properties of Al2O3: Tb powders

International Nuclear Information System (INIS)

Esparza G, A.E.; Garcia, M.; Falcony, C.; Azorin N, J.

2000-01-01

In this work the photo luminescent and cathode luminescent characteristics of aluminium oxide (Al 2 O 3 ) powders impurified with terbium (Tb) were studied for their use in dosimetry. The optical, structural, morphological characteristics of the powders as function of variation in the impurity concentration and the annealing temperature will be presented. As regards the optical properties of powders (photoluminescence and cathode luminescence) it was observed a characteristic emission associated with radiative transitions between electron energy levels of terbium, the spectra associated with this emission consists of several peaks associated with such transitions. In the structural and morphological characterization (X-ray diffraction and scanning electron microscopy) it was appreciated that in accordance the annealing temperature of powders is augmented it is evident the apparition of certain crystalline phases. The results show that this is a promissory material for radiation dosimetry. (Author)

Are LOD and LOQ Reliable Parameters for Sensitivity Evaluation of Spectroscopic Methods?

Science.gov (United States)

Ershadi, Saba; Shayanfar, Ali

2018-03-22

The limit of detection (LOD) and the limit of quantification (LOQ) are common parameters to assess the sensitivity of analytical methods. In this study, the LOD and LOQ of previously reported terbium sensitized analysis methods were calculated by different methods, and the results were compared with sensitivity parameters [lower limit of quantification (LLOQ)] of U.S. Food and Drug Administration guidelines. The details of the calibration curve and standard deviation of blank samples of three different terbium-sensitized luminescence methods for the quantification of mycophenolic acid, enrofloxacin, and silibinin were used for the calculation of LOD and LOQ. A comparison of LOD and LOQ values calculated by various methods and LLOQ shows a considerable difference. The significant difference of the calculated LOD and LOQ with various methods and LLOQ should be considered in the sensitivity evaluation of spectroscopic methods.

On possibility of transuranium element by the method of transport reactions

International Nuclear Information System (INIS)

Sinitsyna, G.S.; Krashenitsyn, G.N.; Shestakov, B.I.

1983-01-01

A possibility to use chemical transport reaction for separation of uranium, plutonium and some transplutonium elements is shown. The method is based on the use of the known plutonium property to form tetrachloride existing only in the gaseous phase in chlorine atmosphere, which is transported ever the temperature gradiept. Two ways of transport reaction realization - the method of flow and the method of diffusion in closed volume are tested. The experiments are made using specially synthesized plutonium dioxide, containing uranium, americium, curium, lanthanum, terbium, barium. Chlorination is realized by the mixture of chlorine and carbon tetrachloride at temperatures 723-953 K. Plutonium trichloride is deposited in the range 613-653 K, uranium - in the range 473-523 K, curium, americium, lanthanum, terbium, barium remain in the start zone if its temperature does not exceed 873 K

Radio-luminescence efficiency and rare-earth dispersion in Tb-doped silica glasses

Czech Academy of Sciences Publication Activity Database

Fasoli, M.; Moretti, F.; Lauria, A.; Chiodini, N.; Vedda, A.; Nikl, Martin

2007-01-01

Roč. 42, - (2007), s. 784-787 ISSN 1350-4487 Institutional research plan: CEZ:AV0Z10100521 Keywords : sol-gel * scintillators * silica * rare earths * terbium Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.054, year: 2007

Genetic polymorphisms of miR-146a and miR-27a, H. pylori infection, and risk of gastric lesions in a Chinese population.

Directory of Open Access Journals (Sweden)

Ming-yang Song

Full Text Available BACKGROUND: MicroRNAs (miRNAs have been implicated in various human diseases. Single nucleotide polymorphisms (SNPs in inflammation-related miRNA may play an important role in Helicobacter pylori (H. pylori-induced gastric lesions. To evaluate the associations between miRNA SNPs, H. pylori and gastric lesions, a population-based study was conducted in Linqu County, China. METHODOLOGY/PRINCIPAL FINDINGS: Based on serum miRNA array conducted in this population, two SNP loci (miR-146a rs2910164: G>C and miR-27a rs895819: T>C were determined by polymerase chain reaction-restriction fragment length polymorphism in 2,380 participants with diverse gastric lesions. Using participants with superficial gastritis and mild chronic atrophic gastritis as the reference group, we found that rs2910164 CC carriers had a significantly increased risk of intestinal metaplasia [adjusted odds ratio (OR, 1.42; 95% confidence interval (CI, 1.03-1.97] and dysplasia (OR, 1.54; 95% CI, 1.05-2.25 compared to GG carriers, whereas no significant association was observed for rs895819. Stratified analysis by H. pylori infection indicated that rs2910164 C allele was associated with an increased risk of intestinal metaplasia and dysplasia only among individuals infected with H. pylori (CC vs. GG: OR, 1.53; 95% CI, 1.12-2.08, P for trend = 0.004. Participants who simultaneously carried variant alleles and H. pylori infection were more likely to develop intestinal metaplasia and dysplasia, although the interaction between genetic variants and H. pylori infection was not significant (P for interaction = 0.35 for rs2910164 and 0.92 for rs895819. CONCLUSIONS/SIGNIFICANCE: These findings suggest that miR-146a rs2910164 polymorphism may contribute to the evolution of H. pylori-associated gastric lesions in this high-risk population.

Performance of 20 Ci 137Cs γ-ray Compton spectrometer for the ...

Indian Academy of Sciences (India)

of the machine is assessed using aluminum, terbium and mercury samples and the exper- imental data from ... keV) are used. This is particularly true in the case of heavy elements ... In this paper, a design with optimum choice of experimental.

Analysis of patients' X-ray exposure in 146 percutaneous radiologic gastrostomies; Analyse der Strahlenexposition fuer Patienten bei 146 perkutanen radiologischen Gastrostomien

Energy Technology Data Exchange (ETDEWEB)

Petersen, Tim-Ole; Reinhardt, Martin; Fuchs, Jochen; Gosch, Dieter; Surov, Alexey; Stumpp, Patrick; Kahn, Thomas; Moche, Michael [Univ. Hospital Leipzig (Germany). Dept. of Diagnostic and Interventional Radiology

2017-09-15

Analysis of patient's X-ray exposure during percutaneous radiologic gastrostomies (PRG) in a larger population. Data of primary successful PRG-procedures, performed between 2004 and 2015 in 146 patients, were analyzed regarding the exposition to X-ray. Dose-area-product (DAP), dose-length-product (DLP) respectively, and fluoroscopy time (FT) were correlated with the used x-ray systems (Flatpanel Detector (FD) vs. Image Itensifier (BV)) and the necessity for periprocedural placement of a nasogastric tube. Additionally, the effective X-ray dose for PRG placement using fluoroscopy (DL), computed tomography (CT), and cone beam CT (CBCT) was estimated using a conversion factor. The median DFP of PRG-placements under fluoroscopy was 163 cGy{sup *}cm{sup 2} (flat panel detector systems: 155 cGy{sup *}cm{sup 2}; X-ray image intensifier: 175 cGy{sup *}cm{sup 2}). The median DLZ was 2.2min. Intraprocedural placement of a naso- or orogastric probe (n=68) resulted in a significant prolongation of the median DLZ to 2.5min versus 2min in patients with an already existing probe. In addition, dose values were analyzed in smaller samples of patients in which the PRG was placed under CBCT (n=7, median DFP=2635 cGy{sup *}cm{sup 2}), or using CT (n=4, median DLP=657mGy{sup *}cm). Estimates of the median DFP and DLP showed effective doses of 0.3mSv for DL-assisted placements (flat panel detector 0.3mSv, X-ray image converter 0.4mSv), 7.9mSv using a CBCT - flat detector, and 9.9mSv using CT. This corresponds to a factor 26 of DL versus CBCT, or a factor 33 of DL versus CT. In order to minimize X-ray exposure during PRG-procedures for patients and staff, fluoroscopically-guided interventions should employ flat detector systems with short transmittance sequences in low dose mode and with slow image frequency. Series recordings can be dispensed with. The intraprocedural placement of a naso- or orogastric probe significantly extends FT, but has little effect on the overall dose of the

Remaining Sites Verification Package for the 100-F-52, 146-FR Radioecology and Aquatic Biology Laboratory Soil, Waste Site Reclassification Form 2008-022

Energy Technology Data Exchange (ETDEWEB)

J. M. Capron

2008-06-27

The 100-F-52 waste site consisted of the soil under and around the former 146-FR Radioecology and Aquatic Biology Laboratory. The laboratory was used for studies of the effects of pre-reactor and post-reactor process water on fish eggs, young fish, and other small river creatures of interest. In accordance with this evaluation, the confirmatory sampling results support a reclassification of this site to No Action. The current site conditions achieve the remedial action objectives and the corresponding remedial action goals established in the Remaining Sites ROD. The results of confirmatory sampling show that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also demonstrate that residual contaminant concentrations are protective of groundwater and the Columbia River.

The association between methacholine challenge test and respiratory symptoms: a study on 146 patients

Directory of Open Access Journals (Sweden)

Paknejad O

2011-02-01

Full Text Available "nBackground: Asthma is a life-threatening disease that can cause death due to bronchospasm. In addition to clinical symptoms such as wheezing, acute paroxysmal dyspnea, chronic cough after exposure to cold air or cough after exercise, spirometry is also necessary for the diagnosis of asthma. The association between respiratory symptoms and a positive methacholine challenge test (MCT is still controversial. The aim of this study was to determine the association between methacholine test results and respiratory symptoms and allergy."n "nMethods: One hundred and forty-six patients with respiratory symptoms and normal baseline pulmonary function tests were enrolled in this cross-sectional study. The participants were divided into two groups according to their positive or negative response to MCT. The association between MCT and the clinical symptoms and allergy was later evaluated statistically."n "nResults: Out of 146 participants of the study 59 (40.4% were female and 87 (59.6% were male. The mean age of the participants was 33.8±13.8 years. Sixty-one patients (41.8% had positive results for the test. There was an association between a history of allergy, wheezing and age with positive MCT results. The other clinical signs had no association with the test."n "nConclusion: Methacholine challenge test is the best diagnostic test for ruling out asthma in patients with normal pulmonary function tests in whom we cannot definitely rule out asthma based solely on clinical symptoms. Nevertheless, in adults with a history of allergy, wheezing and also in patients below 30, the probability for a positive MCT is high.

Enstatite chondrites EL3 as building blocks for the Earth: The debate over the 146Sm-142Nd systematics

Science.gov (United States)

Boyet, M.; Bouvier, A.; Frossard, P.; Hammouda, T.; Garçon, M.; Gannoun, A.

2018-04-01

The 146Sm-142Nd extinct decay scheme (146Sm half-life of 103 My) is a powerful tool to trace early Earth silicate differentiation. Differences in 142Nd abundance measured between different chondrite meteorite groups and the modern Earth challenges the interpretation of the 142Nd isotopic variations found in terrestrial samples because the origin of the Earth and the nature of its building blocks is still an ongoing debate. As bulk meteorites, the enstatite chondrites (EC) have isotope signatures that are the closest to the Earth value with an average small deficit of ∼10 ppm in 142Nd relative to modern terrestrial samples. Here we review all the Nd isotope data measured on EC so far, and present the first measurements on an observed meteorite fall Almahata Sitta containing pristine fragments of an unmetamorphosed enstatite chondrite belonging to the EL3 subgroup. Once 142Nd/144Nd ratios are normalized to a common chondritic evolution, samples from the EC group (both EL and EH) have a deficit in 142Nd but the dispersion is important (μ142 Nd = - 10 ± 12 (2SD) ppm). This scatter reflects their unique mineralogy associated to their formation in reduced conditions (low fO2 or high C/O). Rare-earth elements are mainly carried by the sulfide phase oldhamite (CaS) that is more easily altered than silicates by weathering since most of the EC meteorites are desert finds. The EL6 have fractionated rare-earth element patterns with depletion in the most incompatible elements. Deviations in Nd mass independent stable isotope ratios in enstatite chondrites relative to terrestrial standard are not resolved with the level of analytical precision achieved by modern mass spectrometry techniques. Here we show that enstatite chondrites from the EL3 and EL6 subgroups may come from different parent bodies. Samples from the EL3 subgroup have Nd (μ142 Nd = - 0.8 ± 7.0, 2SD) and Ru isotope ratios undistinguishable from that of the Bulk Silicate Earth. EL3 samples have never been

The temperature dependence of thermooptical properties of magnetooptical TAG ceramics doped with silicon and titanium

Science.gov (United States)

Starobor, Aleksey; Palashov, Oleg

2018-04-01

Thermal effects in terbium aluminum garnet (TAG) ceramics (thermal lens and thermally induced depolarization) doped with silicon and titanium were investigated in temperature range of 79-293K. Samples with low dopant concentrations shows decreasing of negative thermal effects with cooling to 79 K. However for most part of samples thermal depolarization starts increasing after initial decreasing with cooling. Apparently it is connected with defects in media. Best sample (0.4 at% of Si) as pure TAG shows monotonous decreasing of thermally induced depolarization and 3.5 times Verdet constant increasing with cooling to 79 K, that leads to 1.8-times advantage over common magnetooptical media - terbium gallium garnet. It allows to provide an isolation of 30 dB at a radiation power of more than 6 kW as estimated. However, the procedure for creating ceramics samples obviously needs improvement because of the large scatter in the quality of the samples.

Cerium fluoride nanoparticles protect cells against oxidative stress

International Nuclear Information System (INIS)

Shcherbakov, Alexander B.; Zholobak, Nadezhda M.; Baranchikov, Alexander E.; Ryabova, Anastasia V.; Ivanov, Vladimir K.

2015-01-01

A novel facile method of non-doped and fluorescent terbium-doped cerium fluoride stable aqueous sols synthesis is proposed. Intense green luminescence of CeF 3 :Tb nanoparticles can be used to visualize these nanoparticles' accumulation in cells using confocal laser scanning microscopy. Cerium fluoride nanoparticles are shown for the first time to protect both organic molecules and living cells from the oxidative action of hydrogen peroxide. Both non-doped and terbium-doped CeF 3 nanoparticles are shown to provide noteworthy protection to cells against the vesicular stomatitis virus. - Highlights: • Facile method of CeF 3 and CeF 3 :Tb stable aqueous sols synthesis is proposed. • Naked CeF 3 nanoparticles are shown to be non-toxic and to protect cells from the action of H 2 O 2 . • CeF 3 and CeF 3 :Tb nanoparticles are shown to protect living cells against the vesicular stomatitis virus

The use of rare earth radiotracers in the study of solvent extraction kinetics

International Nuclear Information System (INIS)

Lim, T.M.; Tran, T.

1993-01-01

The suitability of rare earth radionuclides as tracers in research and industry are assessed. In general, the most desirable characteristics of radiotracers for process studies are a half-life in the range 5-200 days, a high yield, high energy γ-emission and low cost of production. The majority of rare earths have at least one radionuclide with acceptable characteristics. The application of radiotracers to the study of kinetics of rare earth solvent extraction have been studied using a modified Lewis cell. Terbium-160 was selected as the most suitable rare earth radionuclide for our experiments. Samples of both aqueous and organic phases were continuous withdrawn, monitored using an automated γ-counting system based on two sodium iodide detectors and then pumped back to the Lewis cell. Excellent results were obtained and the rate of extraction was shown to be first order with respect to the terbium concentration. 6 refs., 1 tab., 7 figs

Lyoluminescence sensitisation

International Nuclear Information System (INIS)

Galand, E.; Niezette, J.; Vanderschueren, J.

1993-01-01

Lyoluminescence (LL) of several carbohydrates and amino acids has been measured in water for a γ dose of respectively, 20 Gy and 50 Gy. It has been demonstrated that the LL yield depends markedly not only on the nature of the LL material but also on its commercial origin. By using solutions of organic dyes such as eosin B, rhodamine B or fluorescein, a substantial enhancement of LL has been observed with carbohydrates. Concentration effect has been investigated and maximum LL yields have been observed in the range 10 -5 -10 -4 mol. On the other hand, LL of amino acids has been increased by the use of rare earth ion solutions. Dysprosium, europium and terbium solutions have been used, but it has been proved that terbium nitrate is the most appropriate solution. Concentration effect has been studied for several amino acids and dosimetric response of glutamine has been investigated with different rare earth ions solutions. (Author)

Cerium fluoride nanoparticles protect cells against oxidative stress

Energy Technology Data Exchange (ETDEWEB)

Shcherbakov, Alexander B.; Zholobak, Nadezhda M. [Zabolotny Institute of Microbiology and Virology, National Academy of Sciences of Ukraine, Kyiv D0368 (Ukraine); Baranchikov, Alexander E. [Kurnakov Institute of General and Inorganic Chemistry of the Russian Academy of Sciences, Moscow 119991 (Russian Federation); Ryabova, Anastasia V. [Prokhorov General Physics Institute of the Russian Academy of Sciences, Moscow 119991 (Russian Federation); National Research Nuclear University MEPhI (Moscow Engineering Physics Institute), Moscow 115409 (Russian Federation); Ivanov, Vladimir K., E-mail: van@igic.ras.ru [Kurnakov Institute of General and Inorganic Chemistry of the Russian Academy of Sciences, Moscow 119991 (Russian Federation); National Research Tomsk State University, Tomsk 634050 (Russian Federation)

2015-05-01

A novel facile method of non-doped and fluorescent terbium-doped cerium fluoride stable aqueous sols synthesis is proposed. Intense green luminescence of CeF{sub 3}:Tb nanoparticles can be used to visualize these nanoparticles' accumulation in cells using confocal laser scanning microscopy. Cerium fluoride nanoparticles are shown for the first time to protect both organic molecules and living cells from the oxidative action of hydrogen peroxide. Both non-doped and terbium-doped CeF{sub 3} nanoparticles are shown to provide noteworthy protection to cells against the vesicular stomatitis virus. - Highlights: • Facile method of CeF{sub 3} and CeF{sub 3}:Tb stable aqueous sols synthesis is proposed. • Naked CeF{sub 3} nanoparticles are shown to be non-toxic and to protect cells from the action of H{sub 2}O{sub 2}. • CeF{sub 3} and CeF{sub 3}:Tb nanoparticles are shown to protect living cells against the vesicular stomatitis virus.

Analysis of miR-146a and miR-142-3p as Potential Markers of Freshly Isolated or In Vitro-Expanded Human Treg cells

DEFF Research Database (Denmark)

Holmstrøm, K; Pedersen, A E; Gad, M

2017-01-01

Regulatory CD4(+) T cells (Tregs) are pivotal for prevention of autoimmunity. The use of Tregs is therefore of increasing interest in in vitro drug screening assays as well as for a cytotherapy per se against autoimmune disorders. For both purposes, in vitro expansion of peripheral blood Tregs...... in the same markers in activated tTregs as opposed to naïve tTregs. In vitro-expanded Tregs could be identified based on FOXP3 expression, but with loss of a discriminate profile for miRNA candidates and a decline in FOXP3 when activated tTregs were expanded. Our data demonstrate miR-146a and 142-3p...... and cytotherapy as FOXP3 is pivotal for suppressive function....

Radiological re-survey results at 146 West Central Avenue, Maywood, New Jersey (MJ034)

International Nuclear Information System (INIS)

Murray, M.E.; Johnson, C.A.

1994-05-01

Maywood Chemical Works (MCW) of Maywood, New Jersey, generated process wastes and residues associated with the production and refining of thorium and thorium compounds from 1916 to 1959. During the early years of operation, MCW stored wastes and residues in low-lying areas west of the processing facilities and consequently some of the residuals containing radioactive materials migrated offsite to the surrounding area. Subsequently, the U.S. Department of Energy (DOE) designated for remedial action the old MCW property and several vicinity properties. Additionally, in 1984, the property at 146 West Central Ave., Maywood, New Jersey and properties in its vicinity were included as a decontamination research and development project under the DOE Formerly Utilized Sites Remedial Action Program. In 1987 and 1988, at the request of DOE, Oak Ridge National Laboratory (ORNL) conducted a radiological survey on this property. A report describing this survey was published in 1989. A second radiological survey by ORNL was conducted on this property in May 1993 at the request of DOE after an ad hoc radiological survey, requested by the property owner and conducted by Bechtel National, Inc. (BNI), identified some contamination not previously found by ORNL. The purpose of the second ORNL survey was to determine whether radioactive materials from the old MCW were present on the property, and if so, if radioactive materials present were above guidelines. A certified civil survey was requisitioned by ORNL to determine actual property boundaries before beginning the radiological re-survey. The re-survey included a surface gamma scan and the collection of a large number of soil samples for radionuclide analyses. Results of this survey demonstrated that although elevated residual thorium-232 contamination was present in a few isolated spots on the southern end of the backyard, it did not exceed DOE guidelines

Tuning the activity of Pt alloy electrocatalysts by means of the lanthanide contraction

DEFF Research Database (Denmark)

Escribano, Maria Escudero; Malacrida, Paolo; Hansen, Martin Hangaard

2016-01-01

is lanthanum, cerium, samarium, gadolinium, terbium, dysprosium, thulium, or calcium. The materials are among the most active polycrystalline Pt-based catalysts reported, presenting activity enhancement by a factor of 3 to 6 over Pt. The active phase consists of a Pt overlayer formed by acid leaching. The ORR...

Gastrointestinal stromal tumor: analysis of 146 cases of the center of reference of the National Cancer Institute--INCA.

Science.gov (United States)

Linhares, Eduardo; Gonçalves, Rinaldo; Valadão, Marcus; Vilhena, Bruno; Herchenhorn, Daniel; Romano, Sergio; Ferreira, Maria Aparecida; Ferreira, Carlos Gil; Ramos, Cintia de Araujo; de Jesus, José Paulo

2011-01-01

To evaluate the treatment of GIST in INCA. We conducted a retrospective analysis of all cases of GIST treated at INCA in the period from 1997 to 2009. We analyzed 146 patients with a mean age of 44.5 years and female predominance. The main symptom was abdominal pain. We observed the occurrence of a second primary tumor in 22% of cases and 92% of the immunohistochemistry exams were positive for CD117. The most frequent location was in the stomach and the high-risk group was predominant. Surgery was considered R0 (extensive) in 70% of the cases and the main sites of metastases were liver and peritoneum. Overall survival in two and five years was, respectively, 86% and 59%. There was a significant difference between overall survival (p = 0.29) of the high-risk group versus the other. Our patients presented mainly in the form of high-risk disease, with obvious impact on survival. The use of imatinib improved survival of patients with recurrent and metastatic disease. We should study its use in the setting of adjuvant and neoadjuvant therapy to improve results of the high risk group. The creation of reference centers is a need for the study of rare diseases.

Spin-glass transition in disordered terbium

International Nuclear Information System (INIS)

Hauser, J.J.

1985-01-01

While crystalline Tb is a helix antiferromagnet with a Neel temperature of 229 K which becomes ferromagnetic at 222 K, disordered Tb exhibits a spin-glass transition. The spin-glass freezing temperature ranges from 183 to 53 K, the lowest temperatures corresponding to the greatest degree of atomic disorder. These experiments constitute the first evidence for an elemental spin-glass. (author)

Spectroscopic analysis of lithium terbium tetrafluoride

DEFF Research Database (Denmark)

Christensen, H.P.

1978-01-01

The absorption spectra of Tb3+ in LiTbF4 have been recorded in the spectral interval from 4000 to 25000 cm-1 and for temperatures between 2.3 and 150 K. This covers the transitions from the ground multiplet 7F6 to the multiplets 7F3, 7F2, 7F1, 7F0, and 5D4. The transitions were predominantly of e...

Negative binomial fits to multiplicity distributions from central collisions of 16O + Cu at 14.6A GeV/c and intermittency

International Nuclear Information System (INIS)

Tannenbaum, M.J.

1994-01-01

An 'intermittency' analysis of charged particle multiplicity data from the target multiplicy array (TMA) in central collisions of 16 O+Cu at 14.6 AxGeV/c has been published by the AGS-E802 collaboration. The centrality cut was made using the Zero degree Calorimeter and requiring that the forward energy be less than one projectile nucleon (i.e. T ZCAL 16 O+Cu collisions is found to exhibit an apparently linear increase with the δη interval, albeit with a much steeper slope than for the other reactions, and a non-zero intercept, k(0)≠0. True intermittency, ξ→0, would occur if the intercept k(0)→0, which is not observed in any experiment. The correlation length for central 16 O+Cu collisions, although smaller than expected, is quite finite and can be measured - which means that a length scale exists in these collisions and therefore there is no intermittency in the multiplicity fluctuations

Chemical ordering around open-volume regions in bulk metallic glass Zr52.5Ti5Al10Cu17.9Ni14.6

International Nuclear Information System (INIS)

Asoka-Kumar, P.; Hartley, J.; Howell, R.; Sterne, P. A.; Nieh, T. G.

2000-01-01

We provide direct experimental evidence for a nonrandom distribution of atomic constituents in Zr 52.5 Ti 5 Al 10 Cu 17.9 Ni 14.6 bulk metallic glass using positron annihilation spectroscopy. The Ti content around the open-volume regions is significantly enhanced at the expense of Ni and Cu. Our results indicate that Ni and Cu atoms closely occupy the volume bounded by their neighboring atoms while Al, Ti, and Zr are less closely packed, and more likely to be associated with the open-volume regions. The overall distribution of elements seen by the positron is not significantly altered by annealing or by crystallization. Theoretical calculations indicate that the observed elemental distribution is not consistent with the known crystalline phases Zr 2 Cu and NiZr 2 , while Al 3 Zr 4 shows some of the characteristics seen in the experiment. (c) 2000 American Institute of Physics

Untitled

Indian Academy of Sciences (India)

Recently there has been a spurt in studies on heavy rare earth metals because of the magnon-phonon interactions observed in them. The phonon dispersion relations in terbium have been investigated by Houmann and Nicklow (1970) and by Menon and. Rao (1972). The magnon dispersion relations have been measured ...

Rare earth oxyhalogenide base thermoluminescent material

International Nuclear Information System (INIS)

Rabatin, J.G.

1976-01-01

A process is described that consists to expose a thermoluminescent material to ionizing radiations, the material being a rare earth oxyhalogenide with terbium additions, to heat this material up to the emission of visible radiations and to measure the emitted radiations which are proportional to the ionizing radiation dose [fr

Remaining Sites Verification Package for the 100-F-52, 146-FR Radioecology and Aquatic Biology Laboratory Soil. Attachment to Waste Site Reclassification Form 2008-022

International Nuclear Information System (INIS)

Capron, J.M.

2008-01-01

The 100-F-52 waste site consisted of the soil under and around the former 146-FR Radioecology and Aquatic Biology Laboratory. The laboratory was used for studies of the effects of pre-reactor and post-reactor process water on fish eggs, young fish, and other small river creatures of interest. In accordance with this evaluation, the confirmatory sampling results support a reclassification of this site to No Action. The current site conditions achieve the remedial action objectives and the corresponding remedial action goals established in the Remaining Sites ROD. The results of confirmatory sampling show that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also demonstrate that residual contaminant concentrations are protective of groundwater and the Columbia River

System, centrality, and transverse mass dependence of two-pion correlation radii in heavy ion collisions at 11.6A and 14.6A GeV/c

International Nuclear Information System (INIS)

Ahle, L.; Baker, M.D.; Cianciolo, V.; Costales, J.B.; Dunlop, J.C.; Heintzelman, G.; Judd, E.; Kehoe, W.L.; Ledoux, R.J.; Morrison, D.P.; Morse, R.J.; Ogilvie, C.A.; Parsons, C.G.; Rothschild, P.; Soltz, R.A.; Steadman, S.G.; Stephans, G.S.F.; Sung, T.W.; Vutsadakis, V.; Woodruff, D.

2002-01-01

Two-pion correlation functions are analyzed at midrapidity for three systems (14.6A GeV/c Si+Al, Si+Au, and 11.6A GeV/c Au+Au), seven distinct centrality conditions, and different k T bins in the range 0.1-0.5 GeV/c. Source reference frames are determined from fits to the Yano-Koonin source parametrization. Bertsch-Pratt radius parameters are shown to scale linearly with both number of projectile and total participants as obtained from a Glauber model calculation. A finite lifetime parameter that increases linearly with system/centrality is also reported. The m T dependences of the Bertsch-Pratt radii for the central Si+Au and central Au+Au systems differ only by an overall normalization factor given by the measured system/centrality dependence

Viscosity measurements of molten refractory metals using an electrostatic levitator

International Nuclear Information System (INIS)

Ishikawa, Takehiko; Paradis, Paul-François; Okada, Junpei T; Watanabe, Yuki

2012-01-01

Viscosities of several refractory metals (titanium, nickel, zirconium, niobium, ruthenium, rhodium, hafnium, iridium and platinum) and terbium have been measured by the oscillation drop method with an improved procedure. The measured data were less scattered than our previous measurements. Viscosities at their melting temperatures showed good agreement with literature values and some predicted values. (paper)

Structural Characterization and Absolute Luminescence Efficiency Evaluation of Gd2O2S High Packing Density Ceramic Screens Doped with Tb3+ and Eu3+ for further Applications in Radiology

Science.gov (United States)

Dezi, Anna; Monachesi, Elenasophie; D'Ignazio, Michela; Scalise, Lorenzo; Montalto, Luigi; Paone, Nicola; Rinaldi, Daniele; Mengucci, Paolo; Loudos, George; Bakas, Athanasios; Michail, Christos; Valais, Ioannis; Fountzoula, Christine; Fountos, George; David, Stratos

2017-11-01

Rare earth activators are impurities added in the phosphor material to enhance probability of visible photon emission during the luminescence process. The main activators employed are rare earth trivalent ions such as Ce+3, Tb+3, Pr3+ and Eu+3. In this work, four terbium-activated Gd2O2S (GOS) powder screens with different thicknesses (1049 mg/cm2, 425.41 mg/cm2, 313 mg/cm2 and 187.36 mg/cm2) and one europium-activated GOS powder screen (232.18 mg/cm2) were studied to investigate possible applications for general radiology detectors. Results presented relevant differences in crystallinity between the GOS:Tb doped screens and GOS:Eu screens in respect to the dopant agent present. The AE (Absolute efficiency) was found to rise (i) with the increase of the X-ray tube voltage with the highest peaking at 110kVp and (ii) with the decrease of the thickness among the four GOS:Tb. Comparing similar thickness values, the europium-activated powder screen showed lower AE than the corresponding terbium-activated.

Magnetic measurements of the transuranium elements. Progress report, January 1, 1984-December 31, 1984

International Nuclear Information System (INIS)

Huray, P.G.; Nave, S.E.

1984-01-01

Measurements of the magnetic properties of dhcp californium-249 metal indicated the presence of three regions of differing magnetic character. Additional measurements are also reported. Magnetic moments and valence states of terbium in TbF 3 , BaTbO 3 , and TbO 1 8 are discussed. Progress on high-field operation of the micro-magnetic susceptometer is reported

Charge Carrier Trapping Processes in RE2O2S (RE = La, Gd, Y, and Lu)

NARCIS (Netherlands)

Luo, H.; Bos, A.J.J.; Dorenbos, P.

2017-01-01

Two different charge carrier trapping processes have been investigated in RE2O2S:Ln3+ (RE = La, Gd, Y, and Lu; Ln = Ce, Pr, and Tb) and RE2O2S:M (M = Ti4+ and Eu3+). Cerium, praseodymium and terbium act as recombination centers and hole trapping centers while host intrinsic defects provide the

Nonlinear elastic properties of bulk metallic glasses Zr52.5Ti5Cu17.9Ni14.6Al10 and Pd40Cu30Ni10P20

International Nuclear Information System (INIS)

Kobelev, N.P.; Kolyvanov, E.L.; Khonik, V.A.

2005-01-01

The influence of uniaxial compression on the propagation of ultrasonic vibrations in Zr 52.5 Ti 5 Cu 17.9 Ni 14.6 Al 10 and Pd 40 Cu 30 Ni 10 P 20 bulk metallic glasses produced by melt quenching at a rate of 100 K/s is investigated. Elastic deformation was realized by compression of the samples along their long axis up to strains of about 1 GPa. Deriving of major ratios used during the calculation of the third-order elastic moduli of the glasses is described in brief, the results of the calculations being provided. A qualitative agreement between the calculated results and available data on the influence of the uniform pressure on the sound wave propagation rate was obtained [ru

Coherent magnetic structures in terbium/holmium superlattices

DEFF Research Database (Denmark)

Bryn-Jacobsen, C.; Cowley, R.A.; McMorrow, D.F.

1997-01-01

to 230 K, two samples retain this magnetic structure while the third undergoes a transition first to a mixed phase of helically and ferromagnetically ordered Tb moments, then to a phase with only helically ordered To moments. Ln all cases, the magnetic ordering is found to be long ranged, with coherence...

Magnon energies and exchange interactions in terbium

DEFF Research Database (Denmark)

Houmann, Jens Christian Gylden

1968-01-01

The magnon density of states, and hence the magnetic contribution to the specific heat, and also the exchange interaction between ions in the same sublattice have been calculated for Tb at 90°K, using experimental results obtained by inelastic neutron scattering.......The magnon density of states, and hence the magnetic contribution to the specific heat, and also the exchange interaction between ions in the same sublattice have been calculated for Tb at 90°K, using experimental results obtained by inelastic neutron scattering....

Magnon lifetimes in terbium at low temperatures

International Nuclear Information System (INIS)

Bjerrum Moeller, H.; Mackintosh, A.R.

1979-01-01

The lifetimes of magnons propagating in the c-direction of Tb at 4.2 K have been measured by inelastic neutron scattering. In contrast to the behaviour at higher temperatures, where magnon-magnon scattering predominates, the broadening of the magnons increases towards the boundary of the single Brillouin zone, both in the acoustic and optical branches. This suggests that the scattering of the magnons by conduction electrons is important, and the observed lifetimes are consistent with a recent estimate of the magnitude of this effect. The acoustic magnons of very long wavelength behave anomalously, presumably due to dipolar interactions

Test plan for air monitoring during the Cryogenic Retrieval Demonstration

International Nuclear Information System (INIS)

Yokuda, E.

1992-06-01

This report presents a test plan for air monitoring during the Cryogenic Retrieval Demonstration (CRD). Air monitors will be used to sample for the tracer elements neodymium, terbium, and ytterbium, and dysprosium. The results from this air monitoring will be used to determine if the CRD is successful in controlling dust and minimizing contamination. Procedures and equipment specifications for the test are included

Thermoluminescent coactivated rare earth oxyhalide phosphors and x-ray image converters utilizing said phosphors

International Nuclear Information System (INIS)

Rabatin, J.G.

1984-01-01

Oxyhalides of lanthanum, gadolinium and lutetium coactivated with a first activator selected from bismuth and samarium to provide the color of light emission and a second coactivator (e.g. terbium or praseodymium) which increases the amount of stored energy in a stored radiographic latent image are found to be superior in their conversion efficiency of x-rays to visible light. (author)

High Harvest Yield, High Expansion, and Phenotype Stability of CD146 Mesenchymal Stromal Cells from Whole Primitive Human Umbilical Cord Tissue

Directory of Open Access Journals (Sweden)

Rebecca C. Schugar

2009-01-01

Full Text Available Human umbilical cord blood is an excellent primitive source of noncontroversial stem cells for treatment of hematologic disorders; meanwhile, new stem cell candidates in the umbilical cord (UC tissue could provide therapeutic cells for nonhematologic disorders. We show novel in situ characterization to identify and localize a panel of some markers expressed by mesenchymal stromal cells (MSCs; CD44, CD105, CD73, CD90 and CD146 in the UC. We describe enzymatic isolation and purification methods of different UC cell populations that do not require manual separation of the vessels and stroma of the coiled, helical-like UC tissue. Unique quantitation of in situ cell frequency and stromal cell counts upon harvest illustrate the potential to obtain high numerical yields with these methods. UC stromal cells can differentiate to the osteogenic and chondrogenic lineages and, under specific culturing conditions, they exhibit high expandability with unique long-term stability of their phenotype. The remarkable stability of the phenotype represents a novel finding for human MSCs, from any source, and supports the use of these cells as highly accessible stromal cells for both basic studies and potentially therapeutic applications such as allogeneic clinical use for musculoskeletal disorders.

Synthesis and characterization of Tin / Titanium mixed oxide nanoparticles doped with lanthanide for biomarking

International Nuclear Information System (INIS)

Paganini, Paula Pinheiro

2012-01-01

This work presents the synthesis, characterization and photo luminescent study of tin and titanium mixed oxide nanoparticles doped with europium, terbium and neodymium to be used with luminescent markers on biological systems. The syntheses were done by co-precipitation, protein sol-gel and Pechini methods and the nanoparticles were characterized by infrared spectroscopy, thermogravimetric analysis, scanning electron microscopy, X-ray diffraction and X-ray absorption spectroscopy. The photo luminescent properties studies were conducted for luminophores doped with europium, terbium and neodymium synthesized by coprecipitation method. For luminophore doped with europium it was possible to calculate the intensity parameters and quantum yield and it showed satisfactory results. In the case of biological system marking it was necessary the functionalization of these particles to allow them to bind to the biological part to be studied. So the nanoparticles were functionalized by microwave and Stöber methods and characterized by infrared spectroscopy, scanning electron microscopy, energy dispersive X-ray spectroscopy and X-ray diffraction obtaining qualitative response of functionalization efficacy. The ninhydrin spectroscopic method was used for quantification of luminophores functionalization. The photo luminescent studies of functionalized particles demonstrate the potential applying of these luminophores as luminescent markers. (author)

Fabrication of Tb3Al5O12 transparent ceramics using co-precipitated nanopowders

Science.gov (United States)

Dai, Jiawei; Pan, Yubai; Wang, Wei; Luo, Wei; Xie, Tengfei; Kou, Huamin; Li, Jiang

2017-11-01

Terbium aluminum garnet (TAG) precursor was synthesized by a co-precipitation method from a mixed solution of terbium and aluminum nitrates using ammonium hydrogen carbonate (AHC) as the precipitant. The powders calcined at different temperatures were investigated by XRD, FTIR and FESEM in order to choose the optimal calcination temperature. Fine and low-agglomerated TAG powders with average particle size of 88 nm were obtained by calcining the precursor at 1100 °C for 4 h. Using this powder as starting material, TAG transparent ceramics were fabricated by vacuum sintering combined with hot isostatic pressing (HIP) sintering. For the sample pre-sintered at 1700 °C for 20 h with HIP post-treated at 1700 °C for 3 h, the average grain size is about 3.9 μm and the in-line transmittance is beyond 55% in the region of 500-1600 nm, reaching a maximum transmittance of 64.2% at the wavelength of 1450 nm. The Verdet constant at 633 nm is measured to be -178.9 rad T-1 m-1, which is 33% larger than that of the commercial TGG single crystal (-134 rad T-1 m-1).

Synthesis and characterization of Tin / Titanium mixed oxide nanoparticles doped with lanthanide for biomarking; Sintese e caracterizacao de nanoparticulas de oxido misto de estanho/titanio dopadas com lantanideos para marcacao biologica

Energy Technology Data Exchange (ETDEWEB)

Paganini, Paula Pinheiro

2012-07-01

This work presents the synthesis, characterization and photo luminescent study of tin and titanium mixed oxide nanoparticles doped with europium, terbium and neodymium to be used with luminescent markers on biological systems. The syntheses were done by co-precipitation, protein sol-gel and Pechini methods and the nanoparticles were characterized by infrared spectroscopy, thermogravimetric analysis, scanning electron microscopy, X-ray diffraction and X-ray absorption spectroscopy. The photo luminescent properties studies were conducted for luminophores doped with europium, terbium and neodymium synthesized by coprecipitation method. For luminophore doped with europium it was possible to calculate the intensity parameters and quantum yield and it showed satisfactory results. In the case of biological system marking it was necessary the functionalization of these particles to allow them to bind to the biological part to be studied. So the nanoparticles were functionalized by microwave and Stoeber methods and characterized by infrared spectroscopy, scanning electron microscopy, energy dispersive X-ray spectroscopy and X-ray diffraction obtaining qualitative response of functionalization efficacy. The ninhydrin spectroscopic method was used for quantification of luminophores functionalization. The photo luminescent studies of functionalized particles demonstrate the potential applying of these luminophores as luminescent markers. (author)

Luminescence and energy transfer processes in (Lu,Tb).sub.3./sub.Al.sub.5./sub.O.sub.12./sub. single crystalline films doped with Ce.sup.3+./sup.

Czech Academy of Sciences Publication Activity Database

Bartosiewicz, Karol; Babin, Vladimir; Nikl, Martin; Mareš, Jiří A.; Zorenko, Yu.; Gorbenko, V.

2016-01-01

Roč. 173, May (2016), s. 141-148 ISSN 0022-2313 R&D Projects: GA ČR GA16-15569S; GA ČR GAP204/12/0805 EU Projects: European Commission(XE) 316906 - LUMINET Institutional support: RVO:68378271 Keywords : lutetium terbium aluminum garnets * Ce 3+ * energy transfer * luminescence * single crystalline films Subject RIV: BH - Optics, Masers, Lasers Impact factor: 2.686, year: 2016

Factors Affecting the Efficiency of Excited-States Interactions of Complexes between Some Visible Light-Emitting Lanthanide Ions and Cyclophanes Containing Spirobiindanol Phosphonates

Directory of Open Access Journals (Sweden)

M. S. Attia

2007-01-01

Full Text Available The efficiency of excited-states interactions between lanthanide ions Tb3+ and Eu3+ and some new cyclophanes (I, II, and III has been studied in different media. High luminescence quantum yield values for terbium and europium complexes in DMSO and PMMA were obtained. The photophysical properties of the green and red emissive Tb3+ and Eu3+ complexes have been elucidated, respectively.

Preparation of thermoluminescent materials

International Nuclear Information System (INIS)

1976-01-01

Thermoluminescent materials have been found to be suitable for measuring long term exposures to low level ionizing radiation. Oxyhalides of lanthanum, gadolinium and yttrium, including the oxychlorides and oxybromides are activated with terbium and have been found to be most efficient oxygendominated phosphors having thermoradiant efficiencies with excitation by low level ionizing radiation. Thermoluminescence response increases when the previous materials have hafnium and zirconium additives

Synthesis of NCA 11,17β-dihydroxy-6-methyl-17α-(3-[18F]fluoroprop-1-ynyl)androsta-1,4,6-trien-3-one as a potential glucocorticoid receptor ligand for neuro-PET studies

International Nuclear Information System (INIS)

DaSilva, J.N.; Crouzel, C.

1990-01-01

Glucocorticoids appear to exert physiologic, biochemical and behavioral effects on the central nervous system (1). The presence of glucocorticoid binding sites have been demonstrated in human brain by autoradiographic studies (2). In order to visualize the brain glucocorticoid binding sites by PET, the authors have synthesized n.c.a. 11,17β-dihydroxy-6-methyl-17α-(3-[ 18 F]fluoroprop-1-ynyl)androsta-1,4,6-trien-3-one, a fluorine-18 analog of the selective type II glucocorticoid receptor agonist RU 28362 (3). Biodistribution studies in mature male rats and in vivo distribution of 2 by PET on a baboon are in progress

Cross sections for Discrete γ ray production in interactions of 14.6 MeV neutrons with light and medium heavy nuclei

International Nuclear Information System (INIS)

Hlavac, S.; Benovic, M.; Betak, E.; Dostal, L.; Turzo, I.; Simakov, S.P.

1999-01-01

We measured cross section of prompt discrete γ ray transitions produced in 14.6 MeV neutron interactions with 23 Na, 27 Al, 28 Si, 31 P 39 K, 51 V, 55 Mn and nat Mo. Cross sections were measured relative to reference cross sections with low uncertainties using a dedicated experimental setup with a 244 cm 3 HPGe photon detector and associated α particle timing. In addition to photons from inelastic scattering we observed discrete transitions from (n,p), (n,n'p), (n,α), and (n,2n) reactions. Discrete γ transitions in 28 Si(n,n'p) 27 Al, the majority of transitions in Mn+n, and all transitions in Mo+n reactions were observed for the first time. Where available, our experimental data are compared with existing data. This comparison shows that existing data are in disagreement with present data in many cases, a finding which stresses the necessity of standardization of measurement procedure. For some reactions we compared our results with statistical model predictions, calculated with the advanced code GNASH as well as with a technically simpler code DEGAS, developed in our lab. In several instances, mostly in reactions where only a single nucleon is emitted, the statistical model calculations describe the observed cross sections well. In other cases, where several nucleons are emitted sequentially or in a cluster, the agreement is less satisfactory. (author)

Modeled Neutron Induced Nuclear Reaction Cross Sections for Radiochemsitry in the region of Thulium, Lutetium, and Tantalum I. Results of Built in Spherical Symmetry in a Deformed Region

Energy Technology Data Exchange (ETDEWEB)

Hoffman, R. D. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

2013-09-06

We have developed a set of modeled nuclear reaction cross sections for use in radiochemical diagnostics. Systematics for the input parameters required by the Hauser-Feshbach statistical model were developed and used to calculate neutron induced nuclear reaction cross sections for targets ranging from Terbium (Z = 65) to Rhenium (Z = 75). Of particular interest are the cross sections on Tm, Lu, and Ta including reactions on isomeric targets.

Luminescence and energy transfer processes in Ce.sup.3+./sup. activated (Gd,Tb).sub.3./sub.Al.sub.5./sub.O.sub.12./sub. single crystalline films

Czech Academy of Sciences Publication Activity Database

Bartosiewicz, Karol; Babin, Vladimir; Mareš, Jiří A.; Beitlerová, Alena; Zorenko, Yu.; Iskaliyeva, A.; Gorbenko, V.; Bryknar, Z.; Nikl, Martin

2017-01-01

Roč. 188, Aug (2017), s. 60-66 ISSN 0022-2313 R&D Projects: GA ČR GA16-15569S; GA MŠk LO1409 EU Projects: European Commission(XE) 316906 - LUMINET Institutional support: RVO:68378271 Keywords : gadolinium terbium aluminum garnets * Ce 3+ * energy transfer * luminescence * single crystalline flms Subject RIV: BH - Optics, Masers, Lasers OBOR OECD: Optics (including laser optics and quantum optics) Impact factor: 2.686, year: 2016

Neutron resonance spins of 159Tb from experiments with polarized neutrons and polarized nuclei

International Nuclear Information System (INIS)

Alfimenkov, V.P.; Ivanenko, A.I.; Lason', L.; Mareev, Yu.D.; Ovchinnikov, O.N.; Pikel'ner, L.B.; Sharapov, Eh.I.

1976-01-01

Spins of 27 neutron resonances of 159 Tb with energies up to 114 eV have been measured using polarized neutrons and nuclei beams in the modernized time-of-flight spectrometer of the IBR-30 pulse reator. The direct measurements of the terbium resonances spins performed using polarized neutrons reaffirm the conclusion that there are no unstationary effects in the behaviour of 159 Tb neutron resonances in the energy range

Giant onsite electronic entropy enhances the performance of ceria for water splitting

DEFF Research Database (Denmark)

Naghavi, S. Shahab; Emery, Antoine A.; Hansen, Heine Anton

2017-01-01

lanthanides, and reaches a maximum value of ≈4.7 kB per oxygen vacancy for Ce4+/Ce3+ reduction. This unique and large positive entropy source in ceria explains its excellent performance for high-temperature catalytic redox reactions such as water splitting. Our calculations also show that terbium dioxide has...... a high electronic entropy and thus could also be a potential candidate for solar thermochemical reactions....

Synthesis of novel fluorescent probe Tb(III)-7-carboxymethoxy-4-methylcoumarin complex for sensing of DNA

International Nuclear Information System (INIS)

Hussein, Belal H.M.; Azab, Hassan A.; Fathalla, Walid; Ali, Sherin A.M.

2013-01-01

New fluorescent probe Tb(III) (7-carboxymethoxy-4-methylcoumarin)2(SCN) (C2H5OH)(H2O) was synthesized and characterized by spectroscopy and thermal analysis. The absorption and fluorescence spectra of 7-carboxymethoxy-4-methylcoumarin (CMMC) and Tb(III)–CMMC complex have been measured in different solvents. The interactions of Tb(III)–CMMC complex with calf thymus nucleic acid (CT-DNA) have been investigated using steady state fluorescence measurements. The changes in the fluorescence intensity have been used for the quantitative determination of DNA with LOD of 3.45 ng in methanol–water (9:1, v/v). The association constants of DNA with Tb(III)–CMMC complex was found to be 2.62×1010 M −1 . - Highlights: ► New fluorescent probe Terbium (III)-7-carboxy methoxy-4-methylcoumarin complex has been synthesized and characterized. ► FTIR spectrum of Tb(III)-complex shows a characteristic band for thiocyanate group. ► DNA interaction with Terbium (III)-7-carboxy methoxy-4-methylcoumarin has been studied by fluorescence techniques. ► The change in the fluorescence intensity has been used for the quantitative determination of DNA. ► The result was better than most of the well-known methods including the ethidium bromide method.

Fabrication and properties of highly luminescent materials from Tb(OH)3-SiO2 and Tb(OH)3-SiO2:Eu3+ nanotubes

International Nuclear Information System (INIS)

Tran Thu Huong; Tran Kim Anh; Le Quoc Minh

2009-01-01

Luminescent nanomaterials with one-dimensional (1D) structures have attracted much attention due to their unique properties and potential applications in nanophotonics and nanobiophotonics. In this paper, we report a synthesis of terbium - hydroxide - at - silica Tb(OH) 3 -SiO 2 and Tb(OH) 3 -SiO 2 :Eu 3+ nanotubes. Terbium - hydroxide tubes were synthesized by soft template method. The size of the tubes can be controlled precisely and have outer diameters ranging from 80 to 120 nm, wall thickness of about 30 nm, and lengths ranging from 300 to 800 nm. To fabricate core/shell materials, the seed growth method is used. FESEM, X-ray diffraction, Raman spectra of Tb(OH) 3 and Tb(OH) 3 -SiO 2 nanotubes were investigated. The photoluminescence (PL) spectrum of Tb(OH) 3 under 325 nm excitation consists of four main peaks at 488, 542, 582, and 618 nm. Furthermore, a preliminary suggestion for the mechanism of growth of the Tb(OH) 3 nanotubes using the soft - template synthesis technique has been proposed. The PL intensity from Tb(OH) 3 -SiO 2 or Tb(OH) 3 -SiO 2 :Eu 3+ nanotubes is much stronger than that of Tb(OH) 3 .

Simulation of the magnetocaloric effect in Tb nanofilms

Energy Technology Data Exchange (ETDEWEB)

Anselmo, Dory Hélio A. L., E-mail: doryh@dfte.ufrn.br [Departamento de Física Teórica e Experimental (DFTE), Universidade Federal do Rio Grande do Norte (UFRN), Natal-RN (Brazil); Mello, Vamberto D. [Departamento de Física,Universidade do Estado do Rio Grande do Norte (UERN), Mossoró-RN (Brazil); Vasconcelos, Manoel S. [Escola de Ciência e Tecnologia (ECT), Universidade Federal do Rio Grande do Norte (UFRN), Natal-RN (Brazil)

2014-03-31

Rare-earth (RE) metals have different magnetic structures resulting from the competition between the crystal-field and exchange interactions. When a magnetic field is applied it creates a third interaction and the magnetic structures are more complicated. In thin films, it is expected that even the magnetic arrangement itself can be strongly modified. Rare-earth helimagnets such as Terbium (Tb), Holmium (Ho) and Dysprosium (Dy) represent the best candidates to evidence such finite-size effects. This finite-size effect is caused by the reduced number of atoms in the direction perpendicular to the film plane that leads to a decrease of the total magnetic exchange energy. We report this contribution to the investigation of magnetocaloric effect (MCE) of thin Terbium films in the helimagnetic temperature range, from T{sub C} = 219 K to T{sub N} = 231 K, for external fields of the order of 1 kOe. We find that for strong fields, H = 50 kOe, the adiabatic temperature change ΔT near the Néel temperature is around 15 K for any thickness of Tb films. However large thickness effects are found for small values of the magnetic field. For field strength of the order of a few kOe, the thermocaloric efficiency increases significantly for ultrathin (nanomagnetic) films.

Line emissions from sonoluminescence in aqueous solutions of halide salts without noble gases

Energy Technology Data Exchange (ETDEWEB)

Liang, Jinfu, E-mail: liang.shi2007@163.com [The Key Laboratory of Modern Acoustics, Ministry of Education, Institution of Acoustics, Nanjing University, Nanjing 210093 (China); School of Physics and Electronic Science, Guizhou Normal University, Guiyang 550001 (China); Chen, Weizhong, E-mail: wzchen@nju.edu.cn [The Key Laboratory of Modern Acoustics, Ministry of Education, Institution of Acoustics, Nanjing University, Nanjing 210093 (China); Zhou, Chao; Cui, Weicheng; Chen, Zhan [The Key Laboratory of Modern Acoustics, Ministry of Education, Institution of Acoustics, Nanjing University, Nanjing 210093 (China)

2015-02-20

Line emissions of trivalent terbium (Tb{sup 3+}) ion were observed from single-bubble sonoluminescence (SL) in an aqueous solution of terbium chloride (TbCl{sub 3}) that contained no noble gas. In addition, sodium (Na) lines were observed in multi-bubble SL in aqueous solutions of various halide salts that contained no noble gas. These observations show that the halide ions, such as Cl{sup −}, Br{sup −}, and I{sup −}, help for line emissions as the noble gases. The intensity of a line emission depends on both the chemical species produced by cavitation bubbles and the temperature of SL bubble that responds to the driving ultrasound pressure. With the increase of driving pressure, some line emissions attached to the continuous spectrum may become increasingly clear, while other line emissions gradually become indistinct. - Highlights: • Line emissions of Tb(III) ions were observed without the presence of noble gases. • The halide ions help to generate a line emission during sonoluminescence. • The intensity of a line emission mainly depends on the bubble's temperature. • The definition of a line emission is related to the temperature of caviation bubble and the kind of host liquid.

75 FR 27419 - Airworthiness Directives; BAE Systems (Operations) Limited Model BAe 146 and Avro 146-RJ70A, 146...

Science.gov (United States)

2010-05-17

... visual inspection and a visual inspection; Method 2 is a detailed visual inspection. You may obtain.... registry. We also estimate that it will take about 12 work-hours per product to comply with the basic... inspection methods: Method 1 is a combination of a detailed visual inspection and a visual inspection; Method...

75 FR 1560 - Airworthiness Directives; BAE Systems (Operations) Limited Model BAe 146 and Avro 146-RJ70A, 146...

Science.gov (United States)

2010-01-12

... alternative inspection methods: Method 1 is a combination of a detailed visual inspection and a visual inspection; Method 2 is a detailed visual inspection. You may obtain further information by examining the... would take about 12 work-hours per product to comply with the basic requirements of this proposed AD...

Preparation of extractive resins for producing terbium-161

International Nuclear Information System (INIS)

De la Cruz B, C. C.; Monroy G, F.

2009-10-01

This paper presents the development of a methodology for extractive resins preparation to base of HDEHP, which allows to separation of Tb from Gd generating an own technology of preparation of these resins. The study included the extractive resins preparation from 6 different supports: kieselguhr Dg, alumina, red volcanic rock, chiluca, quarry and fluorite; two treatment types of of supports and varied concentrations of HDEHP extractant (di(2-etil hexyl) orthophosphoric acid), in order to determine which resin has improved efficiency of Gd and Tb separation, and radionuclide purity of 161 Tb. Resins were prepared to base of kieselguhr to determine the most appropriate silicon deposition process. Two silicon deposition treatments were realized: treatment I , by contact with silicon deposition solution (dimethyldichlorosilane / heptane 1:30) and treatment II by contact with vapors of dimethyldichlorosilane in vacuum. The extractant retention was carried out to different concentrations of HDEHP / acetone: 1:4, 1:8, 1:15, 1:20, 1:30 and 1:40. According to the results, there is not direct relation of HDEHP concentration used in extractive resins preparation to base of kieselguhr over the efficiency of Gd and Tb separation and of radionuclide purity of 161 Tb. The effect of support in the efficiency of Gd and Tb separation was studied to prepare resins with the supports kieselguhr, alumina, quarry, chiluca, volcanic rock and fluorite, using the silicon deposition treatment II for the supports and a concentration of HDEHP / acetone 1:20, for extractant retention. Only resins based on kieselguhr could separate to Gd from Tb quantitatively, the resin at a concentration of HDEHP / Acetone 1:20 was the best results obtained in Gd and Tb separation, achieving a separation efficiency greater than 90% and a radionuclide purity higher than 99%. (Author)

The systems terbium (holmium) nitrate-piperidine nitrate-water

International Nuclear Information System (INIS)

Khisaeva, D.A.; Zhuravlev, E.F.; Semenova, Eh.B.

1982-01-01

Using the method of cross sections at 25 and 50 deg C solubility in the systems Tb(NO 3 ) 2 -C 5 H 10 NHxHNO 3 -H 2 O and Ho(NO 3 ) 3 -C 5 H 10 NHxHNO 3 -H 2 O has been studied. The systems are characterized by chemical interaction of components. Solubility isotherms have crystallization fields of solid phases of the composition Tb(NO 3 ) 3 x3[C 5 H 10 NHxHNO 3 ]x3H 2 O and Ho(NO 3 ) 3 x2[C 5 H 10 NHxHNO 3 ]. The compounds detected are singled out preparatively, their IR spectra are studied, their thermogravimetric analysis is carried out. Investigation results are compared with similar systems formed by nitrates of other representatives of rare earth group

Spin waves in terbium. II. Magnon-phonon interaction

International Nuclear Information System (INIS)

Jensen, J.; Houmann, J.G.

1975-01-01

The selection rules for the linear couplings between magnons and phonons propagating in the c direction of a simple basal-plane hcp ferromagnet are determined by general symmetry considerations. The acoustic-optical magnon-phonon interactions observed in the heavy-rare-earth metals have been explained by Liu as originating from the mixing of the spin states of the conduction electrons due to the spin-orbit coupling. We find that this coupling mechanism introduces interactions which violate the selection rules for a simple ferromagnet. The interactions between the magnons and phonons propagating in the c direction of Tb have been studied experimentally by means of inelastic neutron scatttering. The magnons are coupled to both the acoustic- and optical-transverse phonons. By studying the behavior of the acoustic-optical coupling, we conclude that it is a spin-mixed-induced coupling as proposed by Liu. The coupled magnon--transverse-phonon system for the c direction of Tb is analyzed in detail, and the strengths of the couplings are deduced as a function of wave vector by combining the experimental studies with the theory

Voltammetric determination of zirconium using azo compounds

International Nuclear Information System (INIS)

Orshulyak, O.O.; Levitskaya, G.D.

2008-01-01

The optimum conditions for zirconium complexation with azo compounds are found. The applicability of Eriochrome Red B, Calcon, and Calcion to the voltammetric determination of zirconium, total Zr(IV) and Hf(IV), and Zr(IV) in the presence of Zn(II), Cu(II), Cd(II), Ni(II), or Ti(IV) is demonstrated. The developed procedures are used to determine zirconium in a terbium alloy and in an alloy for airplane wheel drums [ru

In vitro, ex vivo and in vivo examination of buccal absorption of metoprolol with varying pH in TR146 cell culture, porcine buccal mucosa and Göttingen minipigs

DEFF Research Database (Denmark)

Holm, René; Meng-Lund, Emil; Andersen, Morten B.

2013-01-01

This work studied the buccal absorption of metoprolol in vitro, ex vivo and in vivo as a function of buffered pH at 7.4, 8.5, 9.0 and 9.5. Permeability studies showed a correlation (r(2)=0.92) between in vitro TR146 cell culture and ex vivo porcine buccal mucosa in a modified Ussing chamber...... was obtained after buccal dosing (58-107%) compared to oral (3%) administration, ranging 58-107% and 3%, respectively. Macroscopically, no local toxic effects were observed by visual inspection of mini-pig cheeks. A very clear level C in vitro in vivo correlation (r(2)=0.98) was obtained between the observed....... A higher apparent permeability was observed at higher pH values, i.e. the more compound that was unionised the higher the permeability. In vivo studies were conducted in anaesthetised Göttingen mini-pigs. A clear influence of pH on the absorption was seen and a significant higher absolute bioavailability...

Factors Contributing to Maternal and Child Mortality Reductions in 146 Low- and Middle-Income Countries between 1990 and 2010.

Science.gov (United States)

Bishai, David M; Cohen, Robert; Alfonso, Y Natalia; Adam, Taghreed; Kuruvilla, Shyama; Schweitzer, Julian

2016-01-01

From 1990-2010, worldwide child mortality declined by 43%, and maternal mortality declined by 40%. This paper compares two sources of progress: improvements in societal coverage of health determinants versus improvements in the impact of health determinants as a result of technical change. This paper decomposes the progress made by 146 low- and middle-income countries (LMICs) in lowering childhood and maternal mortality into one component due to better health determinants like literacy, income, and health coverage and a second component due to changes in the impact of these health determinants. Health determinants were selected from eight distinct health-impacting sectors. Health determinants were selected from eight distinct health-impacting sectors. Regression models are used to estimate impact size in 1990 and again in 2010. Changes in the levels of health determinants were measured using secondary data. The model shows that respectively 100% and 89% of the reductions in maternal and child mortality since 1990 were due to improvements in nationwide coverage of health determinants. The relative share of overall improvement attributable to any single determinant varies by country and by model specification. However, in aggregate, approximately 50% of the mortality reductions were due to improvements in the health sector, and the other 50% of the mortality reductions were due to gains outside the health sector. Overall, countries improved maternal and child health (MCH) from 1990 to 2010 mainly through improvements in the societal coverage of a broad array of health system, social, economic and environmental determinants of child health. These findings vindicate efforts by the global community to obtain such improvements, and align with the post-2015 development agenda that builds on the lessons from the MDGs and highlights the importance of promoting health and sustainable development in a more integrated manner across sectors.

Factors Contributing to Maternal and Child Mortality Reductions in 146 Low- and Middle-Income Countries between 1990 and 2010.

Directory of Open Access Journals (Sweden)

David M Bishai

Full Text Available From 1990-2010, worldwide child mortality declined by 43%, and maternal mortality declined by 40%. This paper compares two sources of progress: improvements in societal coverage of health determinants versus improvements in the impact of health determinants as a result of technical change.This paper decomposes the progress made by 146 low- and middle-income countries (LMICs in lowering childhood and maternal mortality into one component due to better health determinants like literacy, income, and health coverage and a second component due to changes in the impact of these health determinants. Health determinants were selected from eight distinct health-impacting sectors. Health determinants were selected from eight distinct health-impacting sectors. Regression models are used to estimate impact size in 1990 and again in 2010. Changes in the levels of health determinants were measured using secondary data.The model shows that respectively 100% and 89% of the reductions in maternal and child mortality since 1990 were due to improvements in nationwide coverage of health determinants. The relative share of overall improvement attributable to any single determinant varies by country and by model specification. However, in aggregate, approximately 50% of the mortality reductions were due to improvements in the health sector, and the other 50% of the mortality reductions were due to gains outside the health sector.Overall, countries improved maternal and child health (MCH from 1990 to 2010 mainly through improvements in the societal coverage of a broad array of health system, social, economic and environmental determinants of child health. These findings vindicate efforts by the global community to obtain such improvements, and align with the post-2015 development agenda that builds on the lessons from the MDGs and highlights the importance of promoting health and sustainable development in a more integrated manner across sectors.

Segond fracture: an MR evaluation of 146 patients with emphasis on the avulsed bone fragment and what attaches to it

Energy Technology Data Exchange (ETDEWEB)

Flores, Dyan V.; Smitaman, Edward; Huang, Brady K.; Resnick, Donald L. [University of California San Diego Medical Center, Department of Radiology, San Diego, CA (United States)

2016-12-15

To re-evaluate the Segond fragment emphasizing those structures that attach to the fragment in patients with reported acute/subacute anterior cruciate ligament (ACL) injuries, and to clarify the nomenclature used to describe these structures. A search of databases of knee MR examinations over 4.5 years with reported ACL tears yielded 19,726 studies. Using strict exclusion criteria, a total of 146 MR studies with acute/subacute ACL tears were re-assessed with respect to the Segond fragment's size, shape, orientation, location, displacement, attaching soft tissue structures, and associated osseous and/or soft tissue injuries. Segond fractures were present in 1.25 % of reported acute/subacute ACL tears. The fragment measured 11.9 x 7.3 x 3.27 mm, being thin, ovoid, vertically oriented, situated anterolaterally along the proximal tibial epiphysis, posterior to Gerdy's tubercle and inferior to the lateral tibial plateau, and displaced up to 6 mm laterally. The attached structures were the meniscotibial component of the mid-third lateral capsular ligament (mt-MTLCL) in 58.9 %, both the mt-MTLCL and the posterior fibers of the ITB (pf-ITB) in 35.6 %, and the pf-ITB in 5.48 % of cases. In no case was there an additional attaching structure that did not meet criteria for the mt-MTLCL or the pf-ITB. The mt-MTLCL most commonly attaches to the Segond fragment, but the pf-ITB can also attach to this fragment. In no case was there an additional attaching structure that did not meet criteria for the mt-MTLCL or the pf-ITB. (orig.)

146Sm-142Nd systematics measured in enstatite chondrites reveals a heterogeneous distribution of 142Nd in the solar nebula.

Science.gov (United States)

Gannoun, Abdelmouhcine; Boyet, Maud; Rizo, Hanika; El Goresy, Ahmed

2011-05-10

The short-lived (146)Sm-(142)Nd chronometer (T(1/2) = 103 Ma) is used to constrain the early silicate evolution of planetary bodies. The composition of bulk terrestrial planets is then considered to be similar to that of primitive chondrites that represent the building blocks of rocky planets. However for many elements chondrites preserve small isotope differences. In this case it is not always clear to what extent these variations reflect the isotope heterogeneity of the protosolar nebula rather than being produced by the decay of parent isotopes. Here we present Sm-Nd isotopes data measured in a comprehensive suite of enstatite chondrites (EC). The EC preserve (142)Nd/(144)Nd ratios that range from those of ordinary chondrites to values similar to terrestrial samples. The EC having terrestrial (142)Nd/(144)Nd ratios are also characterized by small (144)Sm excesses, which is a pure p-process nuclide. The correlation between (144)Sm and (142)Nd for chondrites may indicate a heterogeneous distribution in the solar nebula of p-process matter synthesized in supernovae. However to explain the difference in (142)Nd/(144)Nd ratios, 20% of the p-process contribution to (142)Nd is required, at odds with the value of 4% currently proposed in stellar models. This study highlights the necessity of obtaining high-precision (144)Sm measurements to interpret properly measured (142)Nd signatures. Another explanation could be that the chondrites sample material formed in different pulses of the lifetime of asymptotic giant branch stars. Then the isotope signature measured in SiC presolar would not represent the unique s-process signature of the material present in the solar nebula during accretion.

THE SLOAN DIGITAL SKY SURVEY REVERBERATION MAPPING PROJECT: BIASES IN z  > 1.46 REDSHIFTS DUE TO QUASAR DIVERSITY

Energy Technology Data Exchange (ETDEWEB)

Denney, K. D.; Peterson, B. M. [Department of Astronomy, The Ohio State University, 140 West 18th Avenue, Columbus, OH 43210 (United States); Horne, Keith [SUPA Physics and Astronomy, University of St. Andrews, St. Andrews KY16 9SS (United Kingdom); Brandt, W. N.; Grier, C. J.; Trump, J. R. [Department of Astronomy and Astrophysics, 525 Davey Lab, The Pennsylvania State University, University Park, PA 16802 (United States); Ho, Luis C. [Kavli Institute for Astronomy and Astrophysics, Peking University, Beijing 100871 (China); Ge, J., E-mail: denney@astronomy.ohio-state.edu [Astronomy Department University of Florida 211 Bryant Space Science Center P.O. Box 112055 Gainesville, FL 32611-2055 (United States)

2016-12-10

We use the coadded spectra of 32 epochs of Sloan Digital Sky Survey (SDSS) Reverberation Mapping Project observations of 482 quasars with z  > 1.46 to highlight systematic biases in the SDSS- and Baryon Oscillation Spectroscopic Survey (BOSS)-pipeline redshifts due to the natural diversity of quasar properties. We investigate the characteristics of this bias by comparing the BOSS-pipeline redshifts to an estimate from the centroid of He ii λ 1640. He ii has a low equivalent width but is often well-defined in high-S/N spectra, does not suffer from self-absorption, and has a narrow component which, when present (the case for about half of our sources), produces a redshift estimate that, on average, is consistent with that determined from [O ii] to within the He ii and [O ii] centroid measurement uncertainties. The large redshift differences of ∼1000 km s{sup −1}, on average, between the BOSS-pipeline and He ii-centroid redshifts, suggest there are significant biases in a portion of BOSS quasar redshift measurements. Adopting the He ii-based redshifts shows that C iv does not exhibit a ubiquitous blueshift for all quasars, given the precision probed by our measurements. Instead, we find a distribution of C iv-centroid blueshifts across our sample, with a dynamic range that (i) is wider than that previously reported for this line, and (ii) spans C iv centroids from those consistent with the systemic redshift to those with significant blueshifts of thousands of kilometers per second. These results have significant implications for measurement and use of high-redshift quasar properties and redshifts, and studies based thereon.

THE SLOAN DIGITAL SKY SURVEY REVERBERATION MAPPING PROJECT: BIASES IN z  > 1.46 REDSHIFTS DUE TO QUASAR DIVERSITY

International Nuclear Information System (INIS)

Denney, K. D.; Peterson, B. M.; Horne, Keith; Brandt, W. N.; Grier, C. J.; Trump, J. R.; Ho, Luis C.; Ge, J.

2016-01-01

We use the coadded spectra of 32 epochs of Sloan Digital Sky Survey (SDSS) Reverberation Mapping Project observations of 482 quasars with z  > 1.46 to highlight systematic biases in the SDSS- and Baryon Oscillation Spectroscopic Survey (BOSS)-pipeline redshifts due to the natural diversity of quasar properties. We investigate the characteristics of this bias by comparing the BOSS-pipeline redshifts to an estimate from the centroid of He ii λ 1640. He ii has a low equivalent width but is often well-defined in high-S/N spectra, does not suffer from self-absorption, and has a narrow component which, when present (the case for about half of our sources), produces a redshift estimate that, on average, is consistent with that determined from [O ii] to within the He ii and [O ii] centroid measurement uncertainties. The large redshift differences of ∼1000 km s −1 , on average, between the BOSS-pipeline and He ii-centroid redshifts, suggest there are significant biases in a portion of BOSS quasar redshift measurements. Adopting the He ii-based redshifts shows that C iv does not exhibit a ubiquitous blueshift for all quasars, given the precision probed by our measurements. Instead, we find a distribution of C iv-centroid blueshifts across our sample, with a dynamic range that (i) is wider than that previously reported for this line, and (ii) spans C iv centroids from those consistent with the systemic redshift to those with significant blueshifts of thousands of kilometers per second. These results have significant implications for measurement and use of high-redshift quasar properties and redshifts, and studies based thereon.

Tumor estromal gastrointestinal: análise de 146 casos do centro de referência do Instituto Nacional do Câncer - INCA

Directory of Open Access Journals (Sweden)

Eduardo Linhares

Full Text Available OBJETIVO: Avaliar os resultados do tratamento de GIST no INCA. MÉTODOS: Análise retrospectiva de todos os casos de GIST tratados no INCA no período de 1997 a 2009. RESULTADOS: Analisamos 146 pacientes, com média de idade de 44,5 anos e predomínio do sexo feminino. O principal sintoma foi dor abdominal. Tivemos ocorrência de segundo primário em 22% dos casos e na imuno-histoquímica, 92% foram positivos para CD117. A localização mais frequente foi estômago e predominou o grupo de alto risco. A cirurgia foi R0 (extenso em 70% e os principais sítios de metástases foram fígado e peritônio. A sobrevida global foi, respectivamente, em dois e cinco anos de 86% e 59%. Houve significante diferença entre a sobrevida global (p=0,29 do grupo de alto risco versus os demais. CONCLUSÃO: Os nossos pacientes apresentam-se principalmente sob forma de doença de alto risco com repercussão óbvia na sobrevida. O uso de Imatinib melhorou a sobrevida dos pacientes com doença metastática e recidivada. Devemos estudar seu uso no cenário de adjuvância e neoadjuvancia visando melhorar os índices do grupo de alto risco. A criação de centros referenciais é uma necessidade para o estudo de doenças pouco frequentes.

Structure, magnetic behavior, and anisotropy of homoleptic trinuclear lanthanoid 8-quinolinolate complexes.

Science.gov (United States)

Chilton, Nicholas F; Deacon, Glen B; Gazukin, Olga; Junk, Peter C; Kersting, Berthold; Langley, Stuart K; Moubaraki, Boujemaa; Murray, Keith S; Schleife, Frederik; Shome, Mahasish; Turner, David R; Walker, Julia A

2014-03-03

Three complexes of the form [Ln(III)3(OQ)9] (Ln = Gd, Tb, Dy; OQ = 8-quinolinolate) have been synthesized and their magnetic properties studied. The trinuclear complexes adopt V-shaped geometries with three bridging 8-quinolinolate oxygen atoms between the central and peripheral eight-coordinate metal atoms. The magnetic properties of these three complexes differ greatly. Variable-temperature direct-current (dc) magnetic susceptibility measurements reveal that the gadolinium and terbium complexes display weak antiferromagnetic nearest-neighbor magnetic exchange interactions. This was quantified in the isotropic gadolinium case with an exchangecoupling parameter of J = -0.068(2) cm(-1). The dysprosium compound displays weak ferromagnetic exchange. Variable-frequency and -temperature alternating-current magnetic susceptibility measurements on the anisotropic cases reveal that the dysprosium complex displays single-molecule-magnet behavior, in zero dc field, with two distinct relaxation modes of differing time scales within the same molecule. Analysis of the data revealed anisotropy barriers of Ueff = 92 and 48 K for the two processes. The terbium complex, on the other hand, displays no such behavior in zero dc field, but upon application of a static dc field, slow magnetic relaxation can be observed. Ab initio and electrostatic calculations were used in an attempt to explain the origin of the experimentally observed slow relaxation of the magnetization for the dysprosium complex.

Synthesis of novel fluorescent probe Tb(III)-7-carboxymethoxy-4-methylcoumarin complex for sensing of DNA

Energy Technology Data Exchange (ETDEWEB)

Hussein, Belal H.M., E-mail: belalhussein102@yahoo.com [Department of Chemistry, Faculty of Science, Suez Canal University, Ismailia (Egypt); Azab, Hassan A. [Department of Chemistry, Faculty of Science, Suez Canal University, Ismailia (Egypt); Fathalla, Walid [Department of Mathematical and Physical Sciences, Faculty of Engineering, Port-Said University, Port-Said (Egypt); Ali, Sherin A.M. [Department of Mathematical and Physical Sciences, Faculty of Engineering, Suez Canal University, Ismailia (Egypt)

2013-02-15

New fluorescent probe Tb(III) (7-carboxymethoxy-4-methylcoumarin)2(SCN) (C2H5OH)(H2O) was synthesized and characterized by spectroscopy and thermal analysis. The absorption and fluorescence spectra of 7-carboxymethoxy-4-methylcoumarin (CMMC) and Tb(III)-CMMC complex have been measured in different solvents. The interactions of Tb(III)-CMMC complex with calf thymus nucleic acid (CT-DNA) have been investigated using steady state fluorescence measurements. The changes in the fluorescence intensity have been used for the quantitative determination of DNA with LOD of 3.45 ng in methanol-water (9:1, v/v). The association constants of DNA with Tb(III)-CMMC complex was found to be 2.62 Multiplication-Sign 1010 M{sup -1}. - Highlights: Black-Right-Pointing-Pointer New fluorescent probe Terbium (III)-7-carboxy methoxy-4-methylcoumarin complex has been synthesized and characterized. Black-Right-Pointing-Pointer FTIR spectrum of Tb(III)-complex shows a characteristic band for thiocyanate group. Black-Right-Pointing-Pointer DNA interaction with Terbium (III)-7-carboxy methoxy-4-methylcoumarin has been studied by fluorescence techniques. Black-Right-Pointing-Pointer The change in the fluorescence intensity has been used for the quantitative determination of DNA. Black-Right-Pointing-Pointer The result was better than most of the well-known methods including the ethidium bromide method.

Origin of the p-process radionuclides 92Nb and 146Sm in the early solar system and inferences on the birth of the Sun.

Science.gov (United States)

Lugaro, Maria; Pignatari, Marco; Ott, Ulrich; Zuber, Kai; Travaglio, Claudia; Gyürky, György; Fülöp, Zsolt

2016-01-26

The abundances of (92)Nb and (146)Sm in the early solar system are determined from meteoritic analysis, and their stellar production is attributed to the p process. We investigate if their origin from thermonuclear supernovae deriving from the explosion of white dwarfs with mass above the Chandrasekhar limit is in agreement with the abundance of (53)Mn, another radionuclide present in the early solar system and produced in the same events. A consistent solution for (92)Nb and (53)Mn cannot be found within the current uncertainties and requires the (92)Nb/(92)Mo ratio in the early solar system to be at least 50% lower than the current nominal value, which is outside its present error bars. A different solution is to invoke another production site for (92)Nb, which we find in the α-rich freezeout during core-collapse supernovae from massive stars. Whichever scenario we consider, we find that a relatively long time interval of at least ∼ 10 My must have elapsed from when the star-forming region where the Sun was born was isolated from the interstellar medium and the birth of the Sun. This is in agreement with results obtained from radionuclides heavier than iron produced by neutron captures and lends further support to the idea that the Sun was born in a massive star-forming region together with many thousands of stellar siblings.

Tb3O2Cl[SeO3]2 and Tb5O4Cl3[SeO3]2: Oxide Chloride Oxoselenates(IV) of Trivalent Terbium with ''Lone-Pair'' Channel or Layer Structures

International Nuclear Information System (INIS)

Wontcheu, Joseph; Schleid, Thomas

2005-01-01

Orthorhombic Tb 3 O 2 Cl[SeO 3 ] 2 (Pnma; a = 535.16(4), b = 1530.51(9), c = 1081.72(7) pm; Z = 4) is formed by reacting a stoichiometric mixture of Tb 4 O 7 , Tb, TbCl 3 , and SeO 2 in a suitable molar ratio (12: 8: 7: 42) within seven days in an evacuated sealed silica tube at 850 C. The needle-shaped, colourless single crystals (light, water and air stable) exhibit one-dimensional strands [(Tb1) 3/3 (Tb2) 2/1 O 4/2 ] 5+ [O 2 Tb 3 ] 5+ along [100] formed by two parallel chains [OTb 4/2 ] 4+ of trans-edge connected [OTb 4 ] 10+ tetrahedra (d(O-Tb) = 220 - 231 pm) which share an extra edge per chain link. The crystal structure contains two crystallographically different Tb 3+ cations: Tb1 is coordinated as bicapped trigonal prism, while Tb2 resides in square antiprismatic coordination. The Se 4+ coordination is best described as Ψ 1 tetrahedral ([SeO 3 E] 2- ; E: non-binding electron pair). The non-binding ''lone-pair'' electrons of four [SeO 3 ] 2- groups and two Cl - anions form pseudo-hexagonal empty channels along [100] between four cationic double chains. Tb 5 O 4 Cl 3 [SeO 3 ] 2 was prepared likewise as plate-like, colourless single crystals by solid-state reaction of an admixture of Tb 4 O 7 , Tb, TbOCl, TbCl 3 , and SeO 2 (molar ratio: 9: 6: 21: 7: 28) in an evacuated sealed silica tube during seven days at 850 C. This compound crystallizes in the monoclinic system (C2/m; a = 1229.13(9), b = 546.17(4), c = 978.79(7) pm, β = 90.485(6) ; Z = 2) and contains three crystallographically different Tb 3+ cations in seven- and eightfold coordination of O 2- and Cl - anions, respectively. The crystal structure of Tb 5 O 4 Cl 3 [SeO 3 ] 2 is layered and built up of corrugated terbium-oxygen sheets [O 4 Tb 5 ] 7+ formed by edge- and vertex-shared [OTb 4 ] 10+ tetrahedra (d(O-Tb) = 226-232 pm) spreading parallel (001). The structure is strongly related to the ''lone-pair'' channel structures of Tb 2 O[SeO 3 ] 2 and Tb 3 O 2 Cl[SeO 3 ] 2 , where single ([OTb 2 ] 4

Green fluorescence of terbium ions in lithium fluoroborate glasses ...

Indian Academy of Sciences (India)

tion and solid-state lasers attracted remarkable attention in the last few decades. .... Figure 1. Vis absorption spectrum of 1.0 mol% Tb3+-doped. LBZLFB glass. Figure 2. .... both ions quickly decay non-radiatively to the ground level. The energy ...

Analysis of the fourth spectrum of terbium (Tb IV)

International Nuclear Information System (INIS)

Spector, N.; Sugar, J.

1976-01-01

The low-energy level structure of Tb 3+ has been derived from spectra obtained with a sliding spark light source. The 7 F ground term of the 4f 8 configuration was found as well as all levels of the configurations 4f 7 5d, 6s, and 6p built on the 8 S 7 / 2 core state of 4f 7 . Of the possible 51 lines connecting these levels, 48 were observed. Optimized radial parameters are given for the observed configurations. A value for the ionization energy of 39.37(0.10) eV is derived for Tb 3+

Inelastic scattering of neutrons by spin waves in terbium

DEFF Research Database (Denmark)

Bjerrum Møller, Hans; Houmann, Jens Christian Gylden

1966-01-01

Measurements of spin-wave dispersion relations for magnons propagating in symmetry directions in ferromagnetic Tb; it is first experiment to give detailed information on magnetic excitations in heavy rare earths; Tb was chosen for these measurements because it is one of few rare-earth metals which...... does not have very high thermal-neutron capture cross section, so that inelastic neutron scattering experiments can give satisfactory information on magnon dispersion relations....

Tumor specific lung cancer diagnostics with multiplexed FRET immunoassays

Science.gov (United States)

Geißler, D.; Hill, D.; Löhmannsröben, H.-G.; Thomas, E.; Lavigne, A.; Darbouret, B.; Bois, E.; Charbonnière, L. J.; Ziessel, R. F.; Hildebrandt, N.

2010-02-01

An optical multiplexed homogeneous (liquid phase) immunoassay based on FRET from a terbium complex to eight different fluorescent dyes is presented. We achieved highly sensitive parallel detection of four different lung cancer specific tumor markers (CEA, NSE, SCC and CYFRA21-1) within a single assay and show a proof-of-principle for 5- fold multiplexing. The method is well suited for fast and low-cost miniaturized point-of-care testing as well as for highthroughput screening in a broad range of in-vitro diagnostic applications.

Design, synthesis and evaluation of carbamoyl-methyl-phosphine sulfide (CMPS)-based chelates for separation of lanthanides and actinides

Energy Technology Data Exchange (ETDEWEB)

Matlokaa, K.; Saha, A.K.; Srinivasan, P.; Scott, M.J. [Florida Univ., Dept. of Chemistry, FL (United States)

2007-10-15

C{sub 3}-symmetric tri-phenoxy-methane platforms were substituted with carbamoyl-methyl-phosphine sulfide arms and these tris-CMPS compounds were evaluated as extractants for f-element metal ions from 1 M nitric acid solution. Their properties were compared to the carbamoyl-methyl-phosphine oxide derivatives on the same tri-phenoxy-methane platform (tris-CMPO). The terbium complex of tris-CMPS was crystallized and examined via X-ray structural analysis to provide valuable insight into the binding properties of the soft tripodal chelate. (authors)

Coordination chemistry of several radius-sensitive complexones and applications to lanthanide-actinide separations

Energy Technology Data Exchange (ETDEWEB)

Potter, M.W.

1981-10-01

The relationships between the lanthanide complex formation equilibria and the lanthanide-actinide separation application of three radius sensitive ligands have been studied. The consecutive stepwise formation constants of the 1:1, 2:1, and 3:1 chelate species formed by the interaction of DHDMB and the tripositive lanthanides and yttrium were determined potentiometrically at 0.1 M ionic strength and 25/sup 0/C. Results indicate that three different coordination modes, one tridentate and two bidentate are in evidence. Tracer level /sup 241/Am - /sup 155/Eu cation-exchange experiments utilizing DHDMB eluents indicate that this dihydroxycarboxylate does not form a sufficiently strong americium complex to elute that actinide ahead of europium. The overall stability of the americium 3:1 complex appears intermediate between samarium and europium. Cation-exchange elutions of /sup 241/Am, /sup 155/Eu, and /sup 160/Tb mixtures with EEDTA solutions prove that the EEDTA ligand is capable of eluting americium ahead of all of the tripositive lanthanide cations. The minimum separation occurs with terbium, where the Am-Tb separation factor is 1.71. 1,5-diaminopentane-N,N,N',N'-tetraacetic acid (PMDTA) was synthesized using cation exchange. A mathematical method was developed for the formation constants of the protonated and unprotonated lanthanide-PMDTA complexes from potentiometry. Cation-exchange elutions of tracer quantities of Am, Eu, and Tb revealed that terbium is eluted ahead of both americium and europium.

Synthesis and characterization of magnetic nanoparticles of oxides for dual MnFe2O4 bioseparation, stabilized in fatty acid and the system chitosan - Eu(TTA)3(TPPO)2. Studies on the influence of doping with Gd3+, Tb3+, Ho3+ e Eu3+ in structural and magnetic properties

International Nuclear Information System (INIS)

Kovacs, Thelma Antunes Rodrigues

2014-01-01

This work was synthesized and characterized ferrite magnetic nanoparticles manganese, using the chemical coprecipitation method. By varying the heating time under 98°C (0, 10,20,40,60 3 80 minutes), the molar percentage of doping (1, 3, 5, 7, and 10%), gadolinium, europium, terbium and holmium. Magnetic ferrite nanoparticles and manganese ferrite doped with manganese were synthesized by coprecipitation method starting with chloride solutions of metals (iron (III), manganese (II), europium (III), gadolinium (III), terbium (III) and holmium (III)) and NaOH 5mol.L -1 as precipitating agent. The magnetic nanoparticles were characterized by scanning electron microscopy, infrared spectroscopy, X-ray diffraction, magnetization curves, and thermal analysis. Most of manganese ferrite particles showed superparamagnetic behavior. After the characterization it was found that the samples synthesized manganese ferrite with more than 40 minutes heating time, crystal structure showed the characteristic pattern of the inverted manganese ferrite spinel type. The stabilization of the samples in oleic acid nanoparticles produced with a hydrophobic outer layer and facilitated by coating chitosan biopolymer, since this has a positive charge. Among the doped samples there was no significant change in the magnetic behavior. Several techniques for characterizing these materials have been used such as X-ray diffraction spectrum in the infrared region, magnetization curves and thermal analysis. The resins were tested as magnetic material for the separation of biological materials. In this paper, are used as biological targets separation of bovine serum albumin. (author)