WorldWideScience

Sample records for techniques x-ray diffraction

  1. X-ray microimaging by diffractive techniques

    Energy Technology Data Exchange (ETDEWEB)

    Kirz, Janos; Jacobsen, Chris

    2001-07-31

    The report summarizes the development of soft x-ray microscopes at the National Synchrotron Light Source X-1A beamline. We have developed a soft x-ray microscopy beamline (X-1A) at the National Synchrotron Light Source at Brookhaven National Laboratory. This beamline has been upgraded recently to provide two endstations dedicated to microscopy experiments. One endstation hosts a brand new copy of the redesigned room temperature scanning x-ray microscope (STXM), and the other end station hosts a cryo STXM and the original redesigned room temperature microscope, which has been commissioned and has started operation. Cryo STXM and the new microscope use the same new software package, running under the LINUX operating system. The new microscope is showing improved image resolution and extends spectromicroscopy to the nitrogen, oxygen and iron edges. These microscopes are used by us, and by users of the facility, to image hydrated specimens at 50 nm or better spatial resolution and with 0.1-0.5 eV energy resolution. This allows us to carry out chemical state mapping in biological, materials science, and environmental and colloidal science specimens. In the cryo microscope, we are able to do chemical state mapping and tomography of frozen hydrated specimens, and this is of special importance for radiation-sensitive biological specimens. for spectromicroscopic analysis, and methods for obtaining real-space images from the soft x-ray diffraction patterns of non-crystalline specimens. The user program provides opportunities for collaborators and other groups to exploit the techniques available and to develop them further. We have also developed new techniques such as an automated method for acquiring ''stacks'' of images.

  2. Thin film characterisation by advanced X-ray diffraction techniques

    International Nuclear Information System (INIS)

    Cappuccio, G.; Terranova, M.L.

    1996-09-01

    The Fifth School on X-ray diffraction from polycrystalline materials was devoted to thin film characterization by advanced X-ray diffraction techniques. Twenty contributions are contained in this volume; all twenty are recorded in the INIS Database. X-ray diffraction is known to be a powerful analytical tool for characterizing materials and understanding their structural features. The aim of these articles is to illustrate the fundamental contribution of modern diffraction techniques (grazing incidence, surface analysis, standing waves, etc.) to the characterization of thin and ultra-thin films, which have become important in many advanced technologies

  3. Thin film characterisation by advanced X-ray diffraction techniques

    Energy Technology Data Exchange (ETDEWEB)

    Cappuccio, G.; Terranova, M.L. [eds.] [INFN, Laboratori Nazionali di Frascati, Rome (Italy)

    1996-09-01

    This report described the papers presented at the 5. School on X-ray diffraction from polycrystalline materials held at Frascati (Rome) in 2-5 October 1996. A separate abstract was prepared for each of the papers.

  4. Oxygen precipitation studied by x-ray diffraction techniques

    Czech Academy of Sciences Publication Activity Database

    Meduňa, M.; Caha, O.; Růžička, J.; Bernatová, S.; Svoboda, Milan; Buršík, Jiří

    178 -179, - (2011), s. 325-330 ISSN 1012-0394 R&D Projects: GA ČR(CZ) GA202/09/1013 Institutional research plan: CEZ:AV0Z20410507 Keywords : Czochralski silicon * oxygen precipitates * x-ray Laue diffraction Subject RIV: BM - Solid Matter Physics ; Magnetism

  5. Characterization of Polycrystalline Materials Using Synchrotron X-ray Imaging and Diffraction Techniques

    DEFF Research Database (Denmark)

    Ludwig, Wolfgang; King, A.; Herbig, M.

    2010-01-01

    propagation based phase contrast imaging, a 3-D imaging mode exploiting the coherence properties of third generation synchrotron beams. Furthermore, for some classes of polycrystalline materials, one may use a 3-D variant of x-ray diffraction imaging, termed x-ray diffraction contrast tomography. X-ray......The combination of synchrotron radiation x-ray imaging and diffraction techniques offers new possibilities for in-situ observation of deformation and damage mechanisms in the bulk of polycrystalline materials. Minute changes in electron density (i.e., cracks, porosities) can be detected using...... diffraction contrast tomography provides access to the 3-D shape, orientation, and elastic strain state of the individual grains from polycrystalline sample volumes containing up to thousand grains. Combining both imaging modalities, one obtains a comprehensive description of the materials microstructure...

  6. Characterization of Polycrystalline Materials Using Synchrotron X-ray Imaging and Diffraction Techniques

    DEFF Research Database (Denmark)

    Ludwig, Wolfgang; King, A.; Herbig, M.

    2010-01-01

    The combination of synchrotron radiation x-ray imaging and diffraction techniques offers new possibilities for in-situ observation of deformation and damage mechanisms in the bulk of polycrystalline materials. Minute changes in electron density (i.e., cracks, porosities) can be detected using...... propagation based phase contrast imaging, a 3-D imaging mode exploiting the coherence properties of third generation synchrotron beams. Furthermore, for some classes of polycrystalline materials, one may use a 3-D variant of x-ray diffraction imaging, termed x-ray diffraction contrast tomography. X......-ray diffraction contrast tomography provides access to the 3-D shape, orientation, and elastic strain state of the individual grains from polycrystalline sample volumes containing up to thousand grains. Combining both imaging modalities, one obtains a comprehensive description of the materials microstructure...

  7. Comparative study of macrotexture analysis using X-ray diffraction and electron backscattered diffraction techniques

    International Nuclear Information System (INIS)

    Serna, Marilene Morelli

    2002-01-01

    The macrotexture is one of the main characteristics in metallic materials, which the physical properties depend on the crystallographic direction. The analysis of the macrotexture to middles of the decade of 80 was just accomplished by the techniques of Xray diffraction and neutrons diffraction. The possibility of the analysis of the macrotexture using, the technique of electron backscattering diffraction in the scanning electronic microscope, that allowed to correlate the measure of the orientation with its location in the micro structure, was a very welcome tool in the area of engineering of materials. In this work it was studied the theoretical aspects of the two techniques and it was used of both techniques for the analysis of the macrotexture of aluminum sheets 1050 and 3003 with intensity, measured through the texture index 'J', from 2.00 to 5.00. The results obtained by the two techniques were shown reasonably similar, being considered that the statistics of the data obtained by the technique of electron backscatter diffraction is much inferior to the obtained by the X-ray diffraction. (author)

  8. Chemistry of Metal-organic Frameworks Monitored by Advanced X-ray Diffraction and Scattering Techniques.

    Science.gov (United States)

    Mazaj, Matjaž; Kaučič, Venčeslav; Zabukovec Logar, Nataša

    2016-01-01

    The research on metal-organic frameworks (MOFs) experienced rapid progress in recent years due to their structure diversity and wide range of application opportunities. Continuous progress of X-ray and neutron diffraction methods enables more and more detailed insight into MOF's structural features and significantly contributes to the understanding of their chemistry. Improved instrumentation and data processing in high-resolution X-ray diffraction methods enables the determination of new complex MOF crystal structures in powdered form. By the use of neutron diffraction techniques, a lot of knowledge about the interaction of guest molecules with crystalline framework has been gained in the past few years. Moreover, in-situ time-resolved studies by various diffraction and scattering techniques provided comprehensive information about crystallization kinetics, crystal growth mechanism and structural dynamics triggered by external physical or chemical stimuli. The review emphasizes most relevant advanced structural studies of MOFs based on powder X-ray and neutron scattering.

  9. Planar irregularities of texture and stress field in Ti detected by X-ray diffraction technique

    Science.gov (United States)

    Tarkowski, L.; Bonarski, J.; Alexandrov, I.

    2010-02-01

    Regardless of the origin of structure irregularities of materials, the recognition of their spatial distribution in a sample or constructing elements is a great research problem. One of the most effective and non-destructive tools used for this purpose is the X-ray diffraction technique, assisted by an appropriate experimental method and data processing. The work presents the results of investigations of planar distribution of crystallographic texture and stress irregularities manifested by changes of diffraction effects registered by the X-ray technique. As an example, the introduced method is tested on a titanium rod after severe plastic deformation process.

  10. X-ray diffraction

    International Nuclear Information System (INIS)

    Einstein, J.R.; Wei, C.H.

    1982-01-01

    We have been interested in structural elucidation by x-ray diffraction of compounds of biological interest. Understanding exactly how atoms are arranged in three-dimensional arrays as molecules can help explain the relationship between structure and functions. The species investigated may vary in size and shape; our recent studies included such diverse substances as antischistosomal drugs, a complex of cadmium with nucleic acid base, nitrate salts of adenine, and proteins

  11. X-ray diffraction

    International Nuclear Information System (INIS)

    Vries, J.L. de.

    1976-01-01

    The seventh edition of Philips' Review of literature on X-ray diffraction begins with a list of conference proceedings on the subject, organised by the Philips' organisation at regular intervals in various European countries. This is followed by a list of bulletins. The bibliography is divided according to the equipment (cameras, diffractometers, monochromators) and its applications. The applications are subdivided into sections for high/low temperature and pressure, effects due to the equipment, small angle scattering and a part for stress, texture and phase analyses of metals and quantitative analysis of minerals

  12. Time-resolved x-ray diffraction techniques for bulk polycrystalline materials under dynamic loading

    International Nuclear Information System (INIS)

    Lambert, P. K.; Hustedt, C. J.; Zhao, M.; Ananiadis, A. G.; Hufnagel, T. C.; Vecchio, K. S.; Huskins, E. L.; Casem, D. T.; Gruner, S. M.; Tate, M. W.; Philipp, H. T.; Purohit, P.; Weiss, J. T.; Woll, A. R.; Kannan, V.; Ramesh, K. T.; Kenesei, P.; Okasinski, J. S.; Almer, J.

    2014-01-01

    We have developed two techniques for time-resolved x-ray diffraction from bulk polycrystalline materials during dynamic loading. In the first technique, we synchronize a fast detector with loading of samples at strain rates of ∼10 3 –10 4 s −1 in a compression Kolsky bar (split Hopkinson pressure bar) apparatus to obtain in situ diffraction patterns with exposures as short as 70 ns. This approach employs moderate x-ray energies (10–20 keV) and is well suited to weakly absorbing materials such as magnesium alloys. The second technique is useful for more strongly absorbing materials, and uses high-energy x-rays (86 keV) and a fast shutter synchronized with the Kolsky bar to produce short (∼40 μs) pulses timed with the arrival of the strain pulse at the specimen, recording the diffraction pattern on a large-format amorphous silicon detector. For both techniques we present sample data demonstrating the ability of these techniques to characterize elastic strains and polycrystalline texture as a function of time during high-rate deformation

  13. Time-resolved x-ray diffraction techniques for bulk polycrystalline materials under dynamic loading

    Energy Technology Data Exchange (ETDEWEB)

    Lambert, P. K.; Hustedt, C. J.; Zhao, M.; Ananiadis, A. G.; Hufnagel, T. C. [Department of Materials Science and Engineering, Johns Hopkins University, Baltimore, Maryland 21218 (United States); Vecchio, K. S. [Department of NanoEngineering, University of California San Diego, La Jolla, California 92093 (United States); Huskins, E. L. [Oak Ridge Institute for Science and Education, Oak Ridge, Tennessee 37830 (United States); US Army Research Laboratory, Aberdeen Proving Ground, Aberdeen, Maryland 21005 (United States); Casem, D. T. [US Army Research Laboratory, Aberdeen Proving Ground, Aberdeen, Maryland 21005 (United States); Gruner, S. M. [Department of Physics, Cornell University, Ithaca, New York 14853 (United States); Cornell High Energy Synchrotron Source (CHESS), Cornell University, Ithaca, New York 14853 (United States); Kavli Institute at Cornell for Nanoscale Science, Cornell University, Ithaca, New York 14853 (United States); Tate, M. W.; Philipp, H. T.; Purohit, P.; Weiss, J. T. [Department of Physics, Cornell University, Ithaca, New York 14853 (United States); Woll, A. R. [Cornell High Energy Synchrotron Source (CHESS), Cornell University, Ithaca, New York 14853 (United States); Kannan, V.; Ramesh, K. T. [Department of Mechanical Engineering, Johns Hopkins University, Baltimore, Maryland 21218 (United States); Kenesei, P.; Okasinski, J. S.; Almer, J. [X-ray Science Division, Argonne National Laboratory, Argonne, Illinois 60439 (United States)

    2014-09-15

    We have developed two techniques for time-resolved x-ray diffraction from bulk polycrystalline materials during dynamic loading. In the first technique, we synchronize a fast detector with loading of samples at strain rates of ∼10{sup 3}–10{sup 4} s{sup −1} in a compression Kolsky bar (split Hopkinson pressure bar) apparatus to obtain in situ diffraction patterns with exposures as short as 70 ns. This approach employs moderate x-ray energies (10–20 keV) and is well suited to weakly absorbing materials such as magnesium alloys. The second technique is useful for more strongly absorbing materials, and uses high-energy x-rays (86 keV) and a fast shutter synchronized with the Kolsky bar to produce short (∼40 μs) pulses timed with the arrival of the strain pulse at the specimen, recording the diffraction pattern on a large-format amorphous silicon detector. For both techniques we present sample data demonstrating the ability of these techniques to characterize elastic strains and polycrystalline texture as a function of time during high-rate deformation.

  14. Lattice Misfit Measurement in Inconel 625 by X-Ray Diffraction Technique

    OpenAIRE

    Mukherjee, P.; Sarkar, A.; Barat, P.; Jayakumar, T.; Mahadevan, S.; Rai, Sanjay K.

    2006-01-01

    Determination of lattice misfit and microstructural parameters of the coherent precipitates in Ni based alloy Inconel-625 is a challenging problem as their peaks are completely overlapping among themselves and also with the matrix. We have used a novel X-ray diffraction technique on the bulk samples of Inconel 625 at different heat-treated conditions to determine the lattice parameters, the lattice misfit of the coherent precipitates with the matrix and their microstructural parameters like s...

  15. Residual stress characterization of welds using x-ray diffraction techniques

    International Nuclear Information System (INIS)

    Pineault, J.A.; Brauss, M.E.

    1996-01-01

    Neglect of residual stresses created during processes lead to stress corrosion cracking, distortion, fatigue cracking, premature failures in components, and instances of over design. Automated residual stress mapping and truly portable equipment have now made the characterization of residual stresses using x-ray diffraction (XRI) practical. The nondestructive nature of the x-ray diffraction technique has made the tile residual stress characterization of welds a useful tool for process optimization and failure analysis, particularly since components can be measured before and after welding and post welding processes. This paper illustrates the importance of residual stress characterization in welds and presents examples where x-ray diffraction techniques were applied in the characterization of various kinds of welds. arc welds, TIG welds, resistance welds, laser welds and electron beam welds. Numerous techniques are available to help manage potentially harmfull residual stresses created during the welding process thus, the effects of a few example post weld processes such as grinding, heat treating and shot peening are also addressed

  16. Synchrotron radiation X-ray powder diffraction techniques applied in hydrogen storage materials - A review

    Directory of Open Access Journals (Sweden)

    Honghui Cheng

    2017-02-01

    Full Text Available Synchrotron radiation is an advanced collimated light source with high intensity. It has particular advantages in structural characterization of materials on the atomic or molecular scale. Synchrotron radiation X-ray powder diffraction (SR-XRPD has been successfully exploited to various areas of hydrogen storage materials. In the paper, we will give a brief introduction on hydrogen storage materials, X-ray powder diffraction (XRPD, and synchrotron radiation light source. The applications of ex situ and in situ time-resolved SR-XRPD in hydrogen storage materials, are reviewed in detail. Future trends and proposals in the applications of the advanced XRPD techniques in hydrogen storage materials are also discussed.

  17. Atomic structure of large angle grain boundaries determined by quantitative X-ray diffraction techniques

    International Nuclear Information System (INIS)

    Fitzsimmons, M.R.; Sass, S.L.

    1988-01-01

    Quantitative X-ray diffraction techniques have been used to determine the atomic structure of the Σ = 5 and 13 [001] twist boundaries in Au with a resolution of 0.09 Angstrom or better. The reciprocal lattices of these boundaries were mapped out using synchrotron radiation. The atomic structures were obtained by testing model structures against the intensity observations with a chi square analysis. The boundary structure were modeled using polyhedra, including octahedra, special configurations of tetrahedra and Archimedian anti-prisms, interwoven together by the boundary symmetry. The results of this work point to the possibility of obtaining general rules for grain boundary structure based on X-ray diffraction observations that give the atomic positions with high resolution

  18. X-ray topography and multiple diffraction

    International Nuclear Information System (INIS)

    Chang, S.-L.

    1983-01-01

    A short summary on X-ray topography, which is based on the dynamical theory of X-ray diffraction, is made. The applications and properties related to the use of the multiple diffraction technique are analized and discussed. (L.C.) [pt

  19. Quantitative mineralogical analysis of sandstones using x-ray diffraction techniques

    International Nuclear Information System (INIS)

    Ward, C.R.; Taylor, J.C.

    1999-01-01

    Full text: X-ray diffraction has long been used as a definitive technique for mineral identification based on the measuring the internal atomic or crystal structures present in powdered rocks; soils and other mineral mixtures. Recent developments in data gathering and processing, however, have provided an improved basis for its use as a quantitative tool, determining not only the nature of the minerals but also the relative proportions of the different minerals present. The mineralogy of a series of sandstone samples from the Sydney and Bowen Basins of eastern Australia has been evaluated by X-ray diffraction (XRD) on a quantitative basis using the Australian-developed SIROQUANT data processing technique. Based on Rietveld principles, this technique generates a synthetic X-ray diffractogram by adjusting and combining full-profile patterns of minerals nominated as being present in the sample and interactively matches the synthetic diffractogram under operator instructions to the observed diffractogram of the sample being analysed. The individual mineral patterns may be refined in the process, to allow for variations in crystal structure of individual components or for factors such as preferred orientation in the sample mount. The resulting output provides mass percentages of the different minerals in the mixture, and an estimate of the error associated with each individual percentage determination. The chemical composition of the mineral mixtures indicated by SIROQUANT for each individual sandstone studied was estimated using a spreadsheet routine, and the indicated proportion of each oxide in each sample compared to the actual chemical analysis of the same sandstone as determined independently by X-ray fluorescence spectrometry. The results show a high level of agreement for all major chemical constituents, indicating consistency between the SIROQUANT XRD data and the whole-rock chemical composition. Supplementary testing with a synthetic corundum spike further

  20. Structural characterization of thin-film cadmium stearate by X-ray diffraction technique

    International Nuclear Information System (INIS)

    Mohamad Deraman; Mohd Ali Sufi; Kok Kuan Ying; Muhamad Mat Salleh; Chew Tat Tian

    1990-01-01

    X-ray diffraction measurement were carried out on thin films of cadmium stearate using an X-ray diffractometer at Unit Tenaga Nuklear. Structure characteristic obtained from the measured diffraction pattern are compared with that of thin films of manganese stearate reported earlier by Pomerantz et. al. Some of the structural similarities (such as inter-planar spacing) and differences (such as the absence of subsidiary peak between Bragg peaks) are found and discussed

  1. Synchrotron radiation X-ray powder diffraction techniques applied in hydrogen storage materials - A review

    OpenAIRE

    Honghui Cheng; Chen Lu; Jingjing Liu; Yongke Yan; Xingbo Han; Huiming Jin; Yu Wang; Yi Liu; Changle Wu

    2017-01-01

    Synchrotron radiation is an advanced collimated light source with high intensity. It has particular advantages in structural characterization of materials on the atomic or molecular scale. Synchrotron radiation X-ray powder diffraction (SR-XRPD) has been successfully exploited to various areas of hydrogen storage materials. In the paper, we will give a brief introduction on hydrogen storage materials, X-ray powder diffraction (XRPD), and synchrotron radiation light source. The applications of...

  2. X-ray diffraction computed tomography

    International Nuclear Information System (INIS)

    Harding, G.; Kosanetzky, J.; Neitzel, U.

    1987-01-01

    Coherent scattering of x-ray photons leads to the phenomenon of x-ray diffraction, which is widely used for determining atomic structure in materials science. A technique [x-ray diffraction computed tomography (CT)] is described, analogous to conventional CT, in which the x-ray diffraction properties of a stack of two-dimensional object sections may be imaged. The technique has been investigated using a first generation (single pencil beam) CT scanner to measure small angle coherent scatter, in addition to the customary transmitted radiation. Diffraction data from a standard CT performance phantom obtained with this new technique and with an x-ray diffractometer are compared. The agreement is satisfactory bearing in mind the poor momentum resolution of our apparatus. The dose and sensitivity of x-ray diffraction CT are compared with those of conventional transmission CT. Diffraction patterns of some biological tissues and plastics presented in a companion paper indicate the potential of x-ray diffraction CT for tissue discrimination and material characterization. Finally, possibilities for refinement of the technique by improving the momentum resolution are discussed

  3. Characterization of ion beam sputtered deposited W/Si multilayers by grazing incidence x-ray diffraction and x-ray reflectivity technique

    Science.gov (United States)

    Dhawan, Rajnish; Rai, Sanjay

    2016-05-01

    W/Si multilayers four samples have been deposited on silicon substrate using ion beam sputtering system. Thickness of tungsten (W) varies from around 10 Å to 40 Å while the silicon (Si) thickness remains constant at around 30 Å in multilayers [W-Si]x4. The samples have been characterized by grazing incidence X-ray diffraction (GIXRD) and X-ray reflectivity technique (XRR). GIXRD study shows the crystalline behaviour of W/Si multilayer by varying W thickness and it is found that above 20 Å the W film transform from amorphous to crystalline phase and X-ray reflectivity data shows that the roughnesses of W increases on increasing the W thicknesses in W/Si multilayers.

  4. X-ray diffraction apparatus

    International Nuclear Information System (INIS)

    Padini, F.R.

    1978-01-01

    The invention provides an x-ray diffraction apparatus permitting the rotation of the divergence sit in conjunction with the rotation of the x-ray irradiated specimen, whereby the dimensions of the x-ray irradiated portion of the specimen remain substantially constant during the rotation of the specimen. In a preferred embodiment, the divergence slit is connected to a structural element linked with a second structural element connected to the specimen such that the divergence slit rotates at a lower angular speed than the specimen

  5. Study of uniaxial nematic lyomesophases by x-ray diffraction and auxiliary techniques

    International Nuclear Information System (INIS)

    Bittencourt, D.R.S.

    1986-01-01

    The uniaxial lyotropic nematic liquid crystals made of amphiphile/water/decanol/salt have been studied. The amphiphiles sodium decyl sulphate and sodium dodecil sulphate have been used. Characterization of samples conditioned in plane and cylindrical cells has been made by orthoscopic polarized optical microscopy (OM) and X.ray diffraction (XD) by observation of orientation under surface and magnetic field effects. It was possible to determine the director orientation of uniaxial discotic (N D ) and cylindrical (N C ) samples under surface and magnetic effects by both OM and XD techniques in independent ways. The homologous amphiphilies sodium octil, decil and dodecil sulfate, in powder form, have been studied by Debye-Scherrer technique. Observed reflexions have been indexed and crystallographic parameters determined. Good agreement between calculated and measured densities has been obtained. A crysostat for temperature variation in the interval- 10 0 /60 0 has been constructed, XD diagrams has been obtained for sodium decil sulfate samples allowing determination of phase transitions of two systems. Scattering curves at room temperatures have been obtained in a small-angle X-ray diffractometer. Analysis of profiles allowed determination of short range positional order and correlation ranges. Interference function between scattering objects have been obtained using structural models for the micelles of the uniaxial nematic phases. (author) [pt

  6. Quantification of rutile in anatase by means of X-ray diffraction technique

    International Nuclear Information System (INIS)

    Macias B, L.R.; Palacios G, J.; Garcia C, R.M.

    1999-01-01

    In this work, making use of the X-ray diffraction technique, it was determined the quantification of two phases which are mixed in a crystalline sample of rutile and anatase also it is indicated the method to proceed in its evaluation, so that in the end it will be had as result of a semi-quantitative analysis of the phases that are found in the sample. The conclusion is that this method performs in samples which are presented as powders and since the different parameters with which they must be fulfilled then this should not be called quantitative but semi-quantitative and it has a margin of error in its evaluation. (Author)

  7. Study of oxide precipitates in silicon using X-ray diffraction techniques

    Czech Academy of Sciences Publication Activity Database

    Caha, O.; Bernatová, S.; Meduňa, M.; Svoboda, Milan; Buršík, Jiří

    2011-01-01

    Roč. 208, č. 11 (2011), s. 2587-2590 ISSN 1862-6300 R&D Projects: GA ČR(CZ) GA202/09/1013 Institutional research plan: CEZ:AV0Z20410507 Keywords : high-resolution X-ray diffraction * oxide precipitates * silicon Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.463, year: 2011

  8. Residual stress estimation of ceramic thin films by X-ray diffraction and indentation techniques

    International Nuclear Information System (INIS)

    Atar, Erdem; Sarioglu, Cevat; Demirler, Ugur; Sabri Kayali, E.; Cimenoglu, Huseyin

    2003-01-01

    The residual stresses in ceramic thin films obtained by the indentation method have been found to be three times higher than those of the X-ray diffraction method. This discrepancy can be eliminated by setting the geometrical factor for the Vickers pyramid indenter to 1 in the relevant equation of the indentation method

  9. Characterization of titanium silicide thin films by X-ray diffraction techniques

    International Nuclear Information System (INIS)

    Morimoto, N.J.

    1987-01-01

    This thesis deals with characterization techniques of thin films by means of X-ray diffraction. This includes phase identification and residual stress, microstress and crystallite size calculations. The techniques developed were applied on the study of the titanium silicide formation obtained by means of Rapidy Thermal Processing (RTP) pf Ti films deposited on silicon substratum. The different phases were studied in relation with processing temperature and time in one and two anneling steps. The low resistivity TiSi 2 phase was observed for temperature of 700 0 C and higher. The experimental results indicate that the residual stress of TiSi 2 films doesn't vary significantly with the annealing conditions. On the other hand, the microstress is reduced with annealing time at 800 0 C, while the crystallite size is almost not affected. For the microstress and the crystallite size determination technique, two methods were implemented and compared. The Riella's method appeared to be very efficient, while the Gangulle's method seemed to be inadequate, because the results oscillate too much [pt

  10. Kinetics of Pd2Si layer growth measured by an x-ray diffraction technique

    International Nuclear Information System (INIS)

    Coulman, B.; Chen, H.

    1986-01-01

    An x-ray diffraction approach has been developed for determination of the kinetics of growth of Pd 2 Si layers. Epitaxial Pd 2 Si films were grown on Si(111) substrates over a temperature range of 160-222 0 C by a solid-state reaction between the substrates and the Pd overlayers. The parabolic rate equation was verified and rate constants showed Arrhenius behavior with an activation energy E/sub a/ = 1.06 eV and prefactor k 0 = 7 x 10 -4 cm 2 /s. The low value of E/sub a/ suggests a short-circuit diffusion mechanism. It is reasonable to expect that impurities and microstructure may play important roles in the growth process. Impurity levels in the specimens were evaluated by analytic techniques suited to thin-film study: Rutherford backscattering spectrometry, secondary ion mass spectrometry, and Auger electron spectrometry. No impurities were present at concentrations approaching 1 at. %. Some O, C, and F were detected at the Pd 2 Si/Si interfaces. The annealing ambient was the major source of further contamination. Upon emergence of the growth interface through the sample surface (some Pd 2 Si on surface), impurity pickup was detected. Interfacial roughness was indicated by all the techniques to be on the order of 20 nm

  11. Diffractive X-ray Telescopes

    OpenAIRE

    Skinner, Gerald K.

    2010-01-01

    Diffractive X-ray telescopes using zone plates, phase Fresnel lenses, or related optical elements have the potential to provide astronomers with true imaging capability with resolution several orders of magnitude better than available in any other waveband. Lenses that would be relatively easy to fabricate could have an angular resolution of the order of micro-arc-seconds or even better, that would allow, for example, imaging of the distorted space- time in the immediate vicinity of the super...

  12. Three-Dimensional X-Ray Diffraction Technique for Metals Science

    DEFF Research Database (Denmark)

    Zhang, Yubin; Fan, Guohua

    2017-01-01

    implemented in several large synchrotron facilities, e.g. the Advanced Photon Source (APS) in USA and the Spring-8 in Japan. Another family of 3DXRD technique that utilizes white beam synchrotron X-rays has also been developed in parallel in cooperation between Oak Ridge National Laboratory and APS...

  13. Experimental coherent X-ray diffractive imaging: capabilities and limitations of the technique

    International Nuclear Information System (INIS)

    Schropp, Andreas

    2008-08-01

    The investigations pursued during this work were focused on the testing of the applicability of the coherent X-ray diffractive imaging(CXDI)-method in the hard X-ray regime and different measurements were carried out at photon energies between 7 keV and 10 keV. The samples investigated were lithographically prepared two-dimensional gold structures with a size ranging from 3 μm to 10 μm as well as a cluster of gold spheres with a lateral extension of about 3.5 μm. Continuous diffraction patterns were recorded in small angle scattering geometry. In some of the measurements a scattering signal up to the edge of the detector could be measured which corresponds to a lateral resolution of about 30 nm. For certain samples it was possible to reconstruct the object from the measured diffraction data. Since the scattered intensity of non-periodic objects is weak at large scattering angles, the available photon flux is finally the main limitation of the method with regard to the achievable resolution. The experimental data were used to get an estimate of photon flux required for sub-nanometer resolution. The ptychographic iterative phase retrieval algorithm proposed by J. M. Rodenburg et al. (2004) was implemented and tested on simulated diffraction data. Additionally, a genetic algorithm has been developed and implemented for phase retrieval. This algorithm is very different from state-of-the-art algorithms and allows to introduce further experimentally important parameters such as a certain illumination function and partial coherence of the X-ray light. (orig.)

  14. Fatigue life assessment for pipeline welds by x-ray diffraction technique

    International Nuclear Information System (INIS)

    Lee, Sang Guk; Yoo, Keun Bong

    2006-01-01

    The objective of this study is to estimate the feasibility of X-ray diffraction method application for fatigue life assessment of the high-temperature pipeline steel such as main steam pipe, re-heater pipe and header etc. in power plant. In this study, X-ray diffraction tests using various types of specimen simulated low cycle fatigue damage were performed in order to analyze fatigue properties when fatigue damage conditions become various stages such as 1/4, l/2 and 3/4 of fatigue life, respectively. As a result off-ray diffraction tests for specimens simulated fatigue damages, we conformed that the variation of the full width at half maximum intensity decreased in proportion to the increase of fatigue life ratio. And also, He ratio of the full width at half maximum intensity due to fatigue damage has linear relationship with fatigue life ratio algebraically. From this relationship, it was suggested that direct expectation of the life consumption rate was feasible.

  15. Submicron X-ray diffraction

    International Nuclear Information System (INIS)

    MacDowell, Alastair; Celestre, Richard; Tamura, Nobumichi; Spolenak, Ralph; Valek, Bryan; Brown, Walter; Bravman, John; Padmore, Howard; Batterman, Boris; Patel, Jamshed

    2000-01-01

    At the Advanced Light Source in Berkeley the authors have instrumented a beam line that is devoted exclusively to x-ray micro diffraction problems. By micro diffraction they mean those classes of problems in Physics and Materials Science that require x-ray beam sizes in the sub-micron range. The instrument is for instance, capable of probing a sub-micron size volume inside micron sized aluminum metal grains buried under a silicon dioxide insulating layer. The resulting Laue pattern is collected on a large area CCD detector and automatically indexed to yield the grain orientation and deviatoric (distortional) strain tensor of this sub-micron volume. A four-crystal monochromator is then inserted into the beam, which allows monochromatic light to illuminate the same part of the sample. Measurement of diffracted photon energy allows for the determination of d spacings. The combination of white and monochromatic beam measurements allow for the determination of the total strain/stress tensor (6 components) inside each sub-micron sized illuminated volume of the sample

  16. Quantitation of water in membranes by neutron diffraction and X-ray techniques.

    Science.gov (United States)

    Knott, R B; Schoenborn, B P

    1986-01-01

    The general principle of placing neutron and X-ray scattering density profiles on an absolute scale is being applied to an increasing number of problems in structural biology. This maximizes the information from the experiments by facilitating the identification of various molecular species. The greater detail available on the membrane water distribution has been highlighted in this chapter. The quantitative analysis of water in the headgroup region and the intermembrane water layer provides valuable information on membrane structure and function. The single most important limitation of the method is the lack of resolution. Improvements in experimental techniques will improve the resolution in a number of situations.

  17. Diffractive X-Ray Telescopes

    International Nuclear Information System (INIS)

    Skinner, G.K.; Skinner, G.K

    2010-01-01

    Diffractive X-ray telescopes using zone plates, phase Fresnel lenses, or related optical elements have the potential to provide astronomers with true imaging capability with resolution several orders of magnitude better than available in any other waveband. Lenses that would be relatively easy to fabricate could have an angular resolution of the order of micro arc seconds or even better, that would allow, for example, imaging of the distorted spacetime in the immediate vicinity of the supermassive black holes in the center of active galaxies What then is precluding their immediate adoption Extremely long focal lengths, very limited bandwidth, and difficulty stabilizing the image are the main problems. The history and status of the development of such lenses is reviewed here and the prospects for managing the challenges that they present are discussed atmospheric absorption

  18. X-ray photoelectron spectroscopy, high-resolution X-ray diffraction ...

    Indian Academy of Sciences (India)

    Powder X-ray diffraction studies were carried out on doped lithium niobate for phase identification. High-resolution X-ray diffraction technique was used to study the crystalline quality through full-width at half-maximum values. The refractive index values are more for doped samples than for pure sample as determined by ...

  19. X-ray diffraction on solids under pressure

    International Nuclear Information System (INIS)

    Holzapfel, W.B.

    1984-01-01

    In the first part, various techniques and examples for X-ray diffraction on polycrystalline samples under high pressure will be reviewed with special emphasis on a comparison between angular and energy dispersive techniques. The second part reviews X-ray diffraction techniques for single crystals under pressure and demonstrates on few examples typical applications

  20. A novel technique combining high-resolution synchrotron x-ray microtomography and x-ray diffraction for characterization of micro particulates

    International Nuclear Information System (INIS)

    Merrifield, David R; Ramachandran, Vasuki; Roberts, Kevin J; Armour, Wesley; Axford, Danny; Basham, Mark; Connolley, Thomas; Evans, Gwyndaf; McAuley, Katherine E; Owen, Robin L; Sandy, James

    2011-01-01

    The processing of solids, such as crystals, is strongly influenced by the surface properties of the material. In recent years the pharmaceutical industry has shown great interest in identifying, or chemically speciating, the molecular components of crystal faces. Formerly, characterization of the molecular identity of crystal faces was restricted to the study of large single crystals. This would have been primarily for structure determination as part of the drug registration process. Diamond Light Source in Oxfordshire is a new synchrotron facility in the UK, having 18 operational beamlines with 4 more in the construction phase. Beamlines at this medium energy light source enable the study of micron-sized objects in great detail. It is well known that x-ray microtomography (XMT) can be used to investigate the external morphology of a crystal whereas x-ray diffraction (XRD) is used to study the molecular orientation, structure and packing within the crystal. The objective of this research is to assess the feasibility of, and thereby develop a new methodology for, characterizing the molecular identity of a particular face of a crystalline particle at a scale of scrutiny of 20–50 µm by combining these two powerful techniques. This work demonstrates the application of XMT and XRD to investigate respectively the shape and crystalline phase/orientation of relevant test crystals. This research has applications in the pharmaceutical industry in that when the exact molecular nature of a particular face is known, the important physico-pharmaceutical properties stemming from that can be better understood. Some initial data are presented and discussed

  1. Extinction Phenomenon in X-Ray Diffraction Technique for Texture Analysis

    Directory of Open Access Journals (Sweden)

    Cadena-Arenas Antonio

    2014-04-01

    Full Text Available A method to correct pole densities (PD for primary and secondary extinction applied for maxima of pole figures (PF measured by X-ray diffraction, was extended to correct the whole 111 and 200 PFs for nickel samples after 75% cold rolling and subsequent annealing at 600°C during 30 minutes. The PDs were corrected, and parameters of primary and secondary extinction were calculated using the PDs obtained in PFs measured for the first order reflections with two wavelengths (Cu Kα and Co Kα - radiations and for the second order reflections with Cu Kα – radiation. Three orientation distribution functions (ODF were calculated, namely: the first one from 111, 200 and 220 PFs; the second one from 222 and 400 PFs (the second order reflections and 220 PF (440 reflection is absent for the radiations used; the third one from corrected 111 and 200 PFs and not corrected 220 PF (for lack of the second order reflection. Essential differences between the obtained ODFs indicate the necessity to take into account the extinction phenomenon in analysis of textured materials. The obtained parameters of extinction were used for the evaluation of microstructure details of textured nickel depending on grains orientation that is not easily obtained by conventional metallographic methods.

  2. Glancing angle synchrotron X-ray diffraction

    International Nuclear Information System (INIS)

    Cernik, R.J.

    1996-01-01

    This paper describes in basic detail some of the techniques that can be used to study thin films and surfaces. These are all in the X-ray region and cover reflectivity, diffraction form polycrystalline films, textured films and single crystal films. Other effects such as fluorescence and diffuse scattering are mentioned but not discussed in detail. Two examples of the reflectivity from multilayers and the diffraction from iron oxide films are discussed. The advantages of the synchrotron for these studies is stressed and the experimental geometries that can be employed are described i detail. A brief bibliography is provided at the end to accompany this part of the 1996 Frascati school

  3. Glancing angle synchrotron X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Cernik, R.J. [Daresbury Lab., Warrington, WA (United States)

    1996-09-01

    This paper describes in basic detail some of the techniques that can be used to study thin films and surfaces. These are all in the X-ray region and cover reflectivity, diffraction form polycrystalline films, textured films and single crystal films. Other effects such as fluorescence and diffuse scattering are mentioned but not discussed in detail. Two examples of the reflectivity from multilayers and the diffraction from iron oxide films are discussed. The advantages of the synchrotron for these studies is stressed and the experimental geometries that can be employed are described i detail. A brief bibliography is provided at the end to accompany this part of the 1996 Frascati school.

  4. Three-dimensional electron diffraction as a complementary technique to powder X-ray diffraction for phase identification and structure solution of powders

    Directory of Open Access Journals (Sweden)

    Yifeng Yun

    2015-03-01

    Full Text Available Phase identification and structure determination are important and widely used techniques in chemistry, physics and materials science. Recently, two methods for automated three-dimensional electron diffraction (ED data collection, namely automated diffraction tomography (ADT and rotation electron diffraction (RED, have been developed. Compared with X-ray diffraction (XRD and two-dimensional zonal ED, three-dimensional ED methods have many advantages in identifying phases and determining unknown structures. Almost complete three-dimensional ED data can be collected using the ADT and RED methods. Since each ED pattern is usually measured off the zone axes by three-dimensional ED methods, dynamic effects are much reduced compared with zonal ED patterns. Data collection is easy and fast, and can start at any arbitrary orientation of the crystal, which facilitates automation. Three-dimensional ED is a powerful technique for structure identification and structure solution from individual nano- or micron-sized particles, while powder X-ray diffraction (PXRD provides information from all phases present in a sample. ED suffers from dynamic scattering, while PXRD data are kinematic. Three-dimensional ED methods and PXRD are complementary and their combinations are promising for studying multiphase samples and complicated crystal structures. Here, two three-dimensional ED methods, ADT and RED, are described. Examples are given of combinations of three-dimensional ED methods and PXRD for phase identification and structure determination over a large number of different materials, from Ni–Se–O–Cl crystals, zeolites, germanates, metal–organic frameworks and organic compounds to intermetallics with modulated structures. It is shown that three-dimensional ED is now as feasible as X-ray diffraction for phase identification and structure solution, but still needs further development in order to be as accurate as X-ray diffraction. It is expected that three

  5. X-Ray Diffractive Optics

    Science.gov (United States)

    Dennis, Brian; Li, Mary; Skinner, Gerald

    2013-01-01

    X-ray optics were fabricated with the capability of imaging solar x-ray sources with better than 0.1 arcsecond angular resolution, over an order of magnitude finer than is currently possible. Such images would provide a new window into the little-understood energy release and particle acceleration regions in solar flares. They constitute one of the most promising ways to probe these regions in the solar atmosphere with the sensitivity and angular resolution needed to better understand the physical processes involved. A circular slit structure with widths as fine as 0.85 micron etched in a silicon wafer 8 microns thick forms a phase zone plate version of a Fresnel lens capable of focusing approx. =.6 keV x-rays. The focal length of the 3-cm diameter lenses is 100 microns, and the angular resolution capability is better than 0.1 arcsecond. Such phase zone plates were fabricated in Goddard fs Detector Development Lab. (DDL) and tested at the Goddard 600-microns x-ray test facility. The test data verified that the desired angular resolution and throughput efficiency were achieved.

  6. Two-dimensional x-ray diffraction

    CERN Document Server

    He, Bob B

    2009-01-01

    Written by one of the pioneers of 2D X-Ray Diffraction, this useful guide covers the fundamentals, experimental methods and applications of two-dimensional x-ray diffraction, including geometry convention, x-ray source and optics, two-dimensional detectors, diffraction data interpretation, and configurations for various applications, such as phase identification, texture, stress, microstructure analysis, crystallinity, thin film analysis and combinatorial screening. Experimental examples in materials research, pharmaceuticals, and forensics are also given. This presents a key resource to resea

  7. X-ray diffraction 2 - diffraction principles

    International Nuclear Information System (INIS)

    O'Connor, B.

    1999-01-01

    Full text: The computation of powder diffraction intensities is based on the principle that the powder pattern comprises the summation of the intensity contributions from each of the crystallites (or single crystals) in the material. Therefore, it is of value for powder diffractionists to appreciate the form of the expression for calculating single crystal diffraction pattern intensities. This knowledge is especially important for Rietveld analysis practitioners in terms of the (i) mathematics of the method and (ii) retrieving single crystal structure data from the literature. We consider the integrated intensity from a small single crystal being rotated at velocity ω through the Bragg angle θ for reflection (hkl).... I(hkl) = [l o /ω]. [e 4 /m 2 c 4 ]. [λ 3 δV F(hkl) 2 /υ 2 ].[(1+cos 2 2θ)/2sin2θ] where e, m and c are the usual fundamental constants; λ is the x-ray wavelength, δV is the crystallite volume; F(hkl) is the structure factor; υ is the unit cell volume; and (1+cos 2 θ)/2sin2θ] is the Lorentz-polarisation factor for an unpolarised incident beam. The expression does not include a contribution for extinction. The influence of factors λ, δV, F(hkl) and υ on the intensities should be appreciated by powder diffractionists, especially the structure factor, F(hkl), which is responsible for the fingerprint nature of diffraction patterns, such as the rise and fall of intensity from peak to peak. The structure factor expression represents the summation of the scattered waves from each of the j scattering centres (i e atoms) in the unit cell: F(hkl) Σ f j exp[2πi (h.x j +k.y i +l. z i )] T j . Symbol f is the scattering factor (representing the atom-type scattering efficiency); (x, y, z) are the fractional position coordinates of atom j within the unit cell; and T is the thermal vibration factor for the atom given by: T j = 8π 2 2 > sin 2 θ/λ 2 with 2 > being the mean-square vibration amplitude of the atom (assumed to be isotropic). The

  8. X-ray Microprobe for Fluorescence and Diffraction Analysis

    International Nuclear Information System (INIS)

    Ice, G.E.

    2005-01-01

    X-ray diffraction (see unit 1.1) and x-ray excited fluorescence analysis are powerful techniques for the nondestructive measurement of crystal structure and chemical composition. X-ray fluorescence analysis is inherently nondestructive with orders of magnitude lower power deposited for the same detectable limit as with fluorescence excited by charged particle probes (Sparks, 1980). X-ray diffraction analysis is sensitive to crystal structure with orders-of-magnitude greater sensitivity to crystallographic strain than electron probes (Rebonato, et al. 1989). When a small-area x-ray microbeam is used as the probe, chemical composition (Z>14), crystal structure, crystalline texture, and crystalline strain distributions can be determined. These distributions can be studied both at the surface of the sample and deep within the sample (Fig. 1). Current state-of-the-art can achieve an ∼1 mm-D x-ray microprobe and an ∼0.1 mm-D x-ray microprobe has been demonstrated (Bilderback, et al., 1994). Despite their great chemical and crystallographic sensitivities, x-ray microprobe techniques have until recently been restricted by inefficient x-ray focusing optics and weak x-ray sources; x-ray microbeam analysis was largely superseded by electron techniques in the 50's. However, interest in x-ray microprobe techniques has now been revived (Howells, et al., 1983; Ice and Sparks, 1984; Chevallier, et al., 1997; Riekel 1992; Thompson, el al., 1992; and Making and Using... 1997) by the development of efficient x-ray focusing optics and ultra-high intensity synchrotron x-ray sources (Buras and Tazzari, 1984; Shenoy, et al., 1988). These advances have increased the achievable microbeam flux by more than 11 orders of magnitude (Fig. 2) (Ice, 1997); the flux in a tunable 1 mm-D beam on a 'so called' 3rd-generation synchrotron source such as the APS can exceed the flux in a fixed-energy mm2 beam on a conventional source. These advances make x-ray microfluorescence and x-ray

  9. Use of X-ray diffraction technique and chemometrics to aid soil sampling strategies in traceability studies.

    Science.gov (United States)

    Bertacchini, Lucia; Durante, Caterina; Marchetti, Andrea; Sighinolfi, Simona; Silvestri, Michele; Cocchi, Marina

    2012-08-30

    Aim of this work is to assess the potentialities of the X-ray powder diffraction technique as fingerprinting technique, i.e. as a preliminary tool to assess soil samples variability, in terms of geochemical features, in the context of food geographical traceability. A correct approach to sampling procedure is always a critical issue in scientific investigation. In particular, in food geographical traceability studies, where the cause-effect relations between the soil of origin and the final foodstuff is sought, a representative sampling of the territory under investigation is certainly an imperative. This research concerns a pilot study to investigate the field homogeneity with respect to both field extension and sampling depth, taking also into account the seasonal variability. Four Lambrusco production sites of the Modena district were considered. The X-Ray diffraction spectra, collected on the powder of each soil sample, were treated as fingerprint profiles to be deciphered by multivariate and multi-way data analysis, namely PCA and PARAFAC. The differentiation pattern observed in soil samples, as obtained by this fast and non-destructive analytical approach, well matches with the results obtained by characterization with other costly analytical techniques, such as ICP/MS, GFAAS, FAAS, etc. Thus, the proposed approach furnishes a rational basis to reduce the number of soil samples to be collected for further analytical characterization, i.e. metals content, isotopic ratio of radiogenic element, etc., while maintaining an exhaustive description of the investigated production areas. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. X-Ray Focusing: Techniques and Applications

    International Nuclear Information System (INIS)

    Khounsary, A.; O'Dell, S.L.; Ice, G.

    2010-01-01

    This Special Issue of X-Ray Optics and Instrumentation comprises ten review papers and six research articles, which collectively offer a broad overview of X-ray focusing techniques and applications in laboratory measurements, in synchrotron beamlines, and in X-ray astronomy. Focusing enables not only more intense illumination for reduced exposure time and higher signal-to-noise ratio, but higher spatial resolution through true imaging. Although X-ray focusing is accomplished through the application of some basic physical principles, such as reflection (mirrors), refraction (lenses), and diffraction (crystals or zone plates), stringent performance requirements coupled with physical, mechanical, environmental, and manufacturability imperatives or limitations make the task technically challenging. The diverse X-ray focusing techniques and applications covered in this Volume provide a glimpse into the scope, challenges, and future of this expanding field.

  11. Tuning of colossal dielectric constant in gold-polypyrrole composite nanotubes using in-situ x-ray diffraction techniques

    Directory of Open Access Journals (Sweden)

    Abhisakh Sarma

    2014-09-01

    Full Text Available In-situ x-ray diffraction technique has been used to study the growth process of gold incorporated polypyrrole nanotubes that exhibit colossal dielectric constant due to existence of quasi-one-dimensional charge density wave state. These composite nanotubes were formed within nanopores of a polycarbonate membrane by flowing pyrrole monomer from one side and mixture of ferric chloride and chloroauric acid from other side in a sample cell that allows collection of x-ray data during the reaction. The size of the gold nanoparticle embedded in the walls of the nanotubes was found to be dependent on chloroauric acid concentration for nanowires having diameter more than 100 nm. For lower diameter nanotubes the nanoparticle size become independent of chloroauric acid concentration and depends on the diameter of nanotubes only. The result of this study also shows that for 50 nm gold-polypyrrole composite nanotubes obtained with 5.3 mM chloroauric acid gives colossal dielectric constant of about 107. This value remain almost constant over a frequency range from 1Hz to 106 Hz even at 80 K temperature.

  12. X-ray diffraction and microsampling techniques applied to the determination of the O/M ratio of irradiated oxides

    International Nuclear Information System (INIS)

    Trotabas, Maria.

    1980-05-01

    In order to understand the behavior of a mixed irradiated oxide in a fast neutron reactor, it is necessary to know the evolution of one of its principle parameters which is the O/M ratio. A method has been developed based on a double determination of reticular parameters; one after irradiation and the other after an oxidation-reduction heat treatment which brings the O/M ratio down to 2.00. A description is given of the X ray diffraction apparatus that was specially adapted for the examination of irradiated fuels and of the micro-sampling technique that enables spot determinations to be made according to the radius the sample [fr

  13. Grazing Incidence X-ray Scattering and Diffraction

    Indian Academy of Sciences (India)

    IAS Admin

    tion. In thia article, various aspects of surface X- ray diffraction and scattering are discussed with illustrations of some typical applications of these techniques. 1. ..... ray reflectivity. Here, X-rays are incident on the sample at very small grazing angles to the surface and below the critical angle, αc. As explained earlier, this ...

  14. Determination of Residual Stresses and Mechanical Properties using Neutron, X-ray Diffraction, Micro- and Nanoindentation Techniques

    Energy Technology Data Exchange (ETDEWEB)

    Larsson, Cecilia

    2003-12-01

    The existence of residual stresses in engineering materials can significantly affect subsequent lifetime by augmenting or impeding failure. Consequently, for an accurate assessment of engineering lifetimes, there is a need to quantify residual stresses. Furthermore, knowledge of the origin of these stresses in conjunction with mechanical properties such as hardness and fracture toughness, among others, can be used to improve functionality by tailoring the microstructure through processing. In this work, neutron, x-ray diffraction, micro- and nanoindentation techniques were used for residual stress determination and mechanical characterization of WC-Co functionally graded composites, a Co-based Haynes 25 alloy weld, compressed steel and compacted Fe-brass powders. The neutron and x-ray diffraction techniques were used to assess residual strains and stresses while the instrumented indentation techniques were used to determine hardness, fracture toughness and elastic modulus. In each of these engineering materials, valuable insight relating to the overall mechanical performance was obtained. X-ray diffraction was used to determine thermal residual stresses that develop in a functionally graded WC-Co composite, commonly used as tool bits. Microstresses in the graded zone were attributed to the thermal mismatch between WC and the Co phase. The compressive macrostresses were determined to be a result of the compositional gradient. Micro- and nanoindentation experiments were used to determine hardness as a function of depth in two WC-Co functionally graded materials (FGMs). A relationship between hardness and Co phase content was established and explained for the two graded and five homogeneous samples. An experimental and simulation study of residual stresses was made in the vicinity of a gas tungsten arc weld in a Co-based Haynes 25 alloy used in a satellite component. The experimental measurements were made by neutron diffraction on the recently commissioned

  15. Crystal structure analysis of LaMnO3 with x-ray diffraction technique using the Rietveld method

    International Nuclear Information System (INIS)

    Engkir Sukirman; Wisnu Ari Adi; Yustinus Purwamargapratala

    2010-01-01

    Crystal structure analysis of LaMnO 3 using the Rietveld method has been carried out. The LaMnO 3 sample was synthesized with high energy mechanical milling from the raw materials of La 2 O 3 and MnO 2 with the appropriate mol ratio. Milling were performed for 10 hours, pelletized and hereinafter sintered at 1350 °C for 6 hours. The sample characterizations covered the crystal structure and electric-magnetic properties of the materials by X-ray diffraction technique using the Rietveld method and the four point probe, respectively. The Rietveld refinement results based on the X-rays diffraction data indicate that the sample of LaMnO 3 is single phase with the crystal system: orthorhombic, the space group: Pnma No. 62 and the lattice parameters: a = 55.4405(9) Å; b = 7.717(1) Å dan c = 5.537(1) Å. The material owns Magnetic Resonance (MR) respond of 7 %, the mean value of crystallite size, D = 17 nm and lattice strain, e = - 0.5 %. So, the material go through a compressive strain, and according to the Nanda's strain model, it becomes a type G antiferromagnetic insulator. Because the insulator properties of the material does not change although being hit by the external magnetic field, hence the MR respond is only caused by the order of electron spin. Therefore at room temperature, LaMnO 3.0 just exhibits a small MR respond. (author)

  16. Development of a computational program for treatment of texture data by the X-ray diffraction technique

    International Nuclear Information System (INIS)

    Galego, Eguiberto

    2004-01-01

    In this work it has been developed a computational program for treatment of texture data by the X-ray diffraction technique using pole figures. It has been applied the resolution method by spherical harmonical series expansion for cubic and hexagonal microscopic symmetry and orthorhombic macroscopic symmetry. For yielding the microscopic symmetries it has been necessary the implementation of algorithmic for calculation the spherical harmonic of specific surface. The generation of Legendre Polynomial, based on the experimental data in relation to a and β step angles, is execution in real time. In the introduction of data, the graphical representation of pole figure is drawn in stereo graphic projection, being possible to the analyst three dimensional (3D) visualization. An internal routine verify validity of the Miller indexes, being possible to analyst the correction. The program exhibit the possible corrections applied to experimental data: defocusing, background and orientation of lamination direction (β angle). The correction of the defocusing and background is the executed automatically based on the optic used in the X-ray equipment (Schulz geometric). It has been implemented a routine of graphic manipulation of the contour iso lines for generation of the orientation distribution function (ODF), with easy manipulation of the number of lines and colors. In the ODF graphic, with the action of the mouse cursor on any section, it is visualized the values of Euler angles (φ 1 , Φ, φ 2 ) and of the respective f(g) intensity. Concomitantly, there is 3D graphic visualization of the crystal position in relation to the rolling direction. There is the possibility of graphic visualization in 3D of any section of the ODF. It is also possible the graphic visualization of the texture fiber. This program was named Texture Analysis Program (TAP). (author)

  17. On the distinction between instrumented indentation technique and x-ray diffraction method in nondestructive or semi-nondestructive surface stress measurement

    International Nuclear Information System (INIS)

    Okano, Shigetaka; Kanamaru, Daisuke; Ihara, Ryohei; Mochizuki, Masahito

    2016-01-01

    In this study, the effect of machined surface layer on stress measurement by means of instrumented indentation technique and X-ray diffraction method was comparatively investigated through the use of three weld specimens of low-carbon austenitic stainless steel with different machined surface layers; as-cutout, mechanically-polished and electrolytically-polished specimens. Tensile and compressive stresses exist respectively in the machined surface layer of as-cutout and mechanically-polished specimens. Meanwhile, no stress and no machined surface layer exist in electrolytically-polished specimen. Tungsten Inert Gas (TIG) bead-on-plate welding was performed under the same welding heat input condition to introduce the residual stress into these three specimens. Against these three specimens, firstly the X-ray diffraction method was applied, then the instrumented indentation technique was applied and finally the stress relief technique was applied to measure the distributions of residual stress after welding. Based on a comparison between these stress measurement results, the instrumented indentation technique was in good agreement with the stress relief technique rather than the X-ray diffraction method, even though both machined surface layer and penetration of indenter had almost the same depths. That is why it can be considered that the instrumented indentation technique measures the residual stress in deeper areas of material surface than penetration depth of indenter. A distinction between the instrumented indentation technique and X-ray diffraction method in surface stress measurement was thus clarified from a viewpoint of measurement depth. (author)

  18. Study of microstress state of P91 steel using complementary mechanical Barkhausen, magnetoacoustic emission, and X-ray diffraction techniques

    Energy Technology Data Exchange (ETDEWEB)

    Augustyniak, Bolesław, E-mail: bolek@mif.pg.gda.pl; Piotrowski, Leszek; Maciakowski, Paweł; Chmielewski, Marek [Faculty of Applied Physics and Mathematics, Gdansk University of Technology, 80-233 Gdansk (Poland); Lech-Grega, Marzena; Żelechowski, Janusz [The Institute of Non-Ferrous Metals, 32-050 Skawina (Poland)

    2014-05-07

    The paper deals with assessment of microstress state of martensite P91 steel using three complementary techniques: mechanical Barkhausen emission, magnetoacoustic emission (MAE), and X-ray diffraction (XRD) profile analysis. Magnetic coercivity Hc and microstructure were investigated with inductive magnetometry and magnetic force microscopy (MFM), respectively. Internal stress level of P91 steel was modified by heat treatment. Steel samples were austenitized, quenched, and then tempered at three temperatures (720 °C, 750 °C, and 780 °C) during increasing time (from 15 min up to 240 min). The microstrain level ε{sub i} was evaluated using Williamson–Hall method. It was revealed that during tempering microstrain systematically decreases from ε{sub i} = 2.5 × 10{sup −3} for as quenched state down to ε{sub i} = 0.3 × 10{sup −3} for well tempered samples. Both mechanical hardness (Vicker's HV) and magnetic hardness (coercivity) decrease almost linearly with decreasing microstrain while the MAE and MBE intensities strongly increase. Tempering leads to evident shift of the MeBN intensity maximum recorded for the first load towards lower applied strain values and to increase of MAE intensity. This indicates that the microstress state deduced by magnetic techniques is correlated with microstrains evaluated with XRD technique.

  19. X-ray filter for x-ray powder diffraction

    Science.gov (United States)

    Sinsheimer, John Jay; Conley, Raymond P.; Bouet, Nathalie C. D.; Dooryhee, Eric; Ghose, Sanjit

    2018-01-23

    Technologies are described for apparatus, methods and systems effective for filtering. The filters may comprise a first plate. The first plate may include an x-ray absorbing material and walls defining first slits. The first slits may include arc shaped openings through the first plate. The walls of the first plate may be configured to absorb at least some of first x-rays when the first x-rays are incident on the x-ray absorbing material, and to output second x-rays. The filters may comprise a second plate spaced from the first plate. The second plate may include the x-ray absorbing material and walls defining second slits. The second slits may include arc shaped openings through the second plate. The walls of the second plate may be configured to absorb at least some of second x-rays and to output third x-rays.

  20. Application of combined multivariate techniques for the description of time-resolved powder X-ray diffraction data

    Czech Academy of Sciences Publication Activity Database

    Taris, A.; Grosso, M.; Brundu, M.; Guida, V.; Viani, Alberto

    2017-01-01

    Roč. 50, č. 2 (2017), s. 451-461 ISSN 1600-5767 R&D Projects: GA MŠk(CZ) LO1219 Keywords : in situ X-ray powder diffraction * amorphous content * chemically bonded ceramics * statistical total correlation spectroscopy * multivariate curve resolution Subject RIV: JJ - Other Materials OBOR OECD: Materials engineering Impact factor: 2.495, year: 2016 http://journals.iucr.org/j/issues/2017/02/00/ap5006/index.html

  1. Reaction monitoring of cementing materials through multivariate techniques applied to time-resolved synchrotron X-Ray diffraction data

    Czech Academy of Sciences Publication Activity Database

    Taris, A.; Grosso, M.; Viani, Alberto; Brundu, M.; Guida, V.

    2015-01-01

    Roč. 43, May (2015), s. 895-900. ISBN 978-88-95608-34-1. ISSN 2283-9216 R&D Projects: GA MŠk(CZ) LO1219 Keywords : engineering controlled terms * least squares approximations * magnesium powder * multivariant analysis * potassium * reaction intermediates * X ray powder diffraction Subject RIV: AN - Psychology http://www.aidic.it/cet/15/43/150.pdf

  2. Precession X-ray diffraction chamber

    International Nuclear Information System (INIS)

    Rieder, M.

    1978-01-01

    An X-ray diffraction chamber is described whose design allows the tilting of the goniometric head 90deg along the axis normal to the axis of precession. Images may thus be made in the reverse reflexion region and of reciprocal networks in any arbitrary direction with a single adhesion of the crystal. (H.S.)

  3. Diffraction leveraged modulation of X-ray pulses using MEMS-based X-ray optics

    Energy Technology Data Exchange (ETDEWEB)

    Lopez, Daniel; Shenoy, Gopal; Wang, Jin; Walko, Donald A.; Jung, Il-Woong; Mukhopadhyay, Deepkishore

    2016-08-09

    A method and apparatus are provided for implementing Bragg-diffraction leveraged modulation of X-ray pulses using MicroElectroMechanical systems (MEMS) based diffractive optics. An oscillating crystalline MEMS device generates a controllable time-window for diffraction of the incident X-ray radiation. The Bragg-diffraction leveraged modulation of X-ray pulses includes isolating a particular pulse, spatially separating individual pulses, and spreading a single pulse from an X-ray pulse-train.

  4. Techniques for materials research with synchrotron radiation x-rays

    International Nuclear Information System (INIS)

    Bowen, D.K.

    1983-01-01

    A brief introductory survey is presented of the properties and generation of synchrotron radiation and the main techniques developed so far for its application to materials problems. Headings are:synchrotron radiation; X-ray techniques in synchrotron radiation (powder diffraction; X-ray scattering; EXAFS (Extended X-ray Absorption Fine Structure); X-ray fluorescent analysis; microradiography; white radiation topography; double crystal topography); future developments. (U.K.)

  5. Spectroscopic imaging, diffraction, and holography with x-ray photoemission

    International Nuclear Information System (INIS)

    1992-02-01

    X-ray probes are capable of determining the spatial structure of an atom in a specific chemical state, over length scales from about a micron all the way down to atomic resolution. Examples of these probes include photoemission microscopy, energy-dependent photoemission diffraction, photoelectron holography, and X-ray absorption microspectroscopy. Although the method of image formation, chemical-state sensitivity, and length scales can be very different, these X-ray techniques share a common goal of combining a capability for structure determination with chemical-state specificity. This workshop will address recent advances in holographic, diffraction, and direct imaging techniques using X-ray photoemission on both theoretical and experimental fronts. A particular emphasis will be on novel structure determinations with atomic resolution using photoelectrons

  6. Spectroscopic imaging, diffraction, and holography with x-ray photoemission

    Energy Technology Data Exchange (ETDEWEB)

    1992-02-01

    X-ray probes are capable of determining the spatial structure of an atom in a specific chemical state, over length scales from about a micron all the way down to atomic resolution. Examples of these probes include photoemission microscopy, energy-dependent photoemission diffraction, photoelectron holography, and X-ray absorption microspectroscopy. Although the method of image formation, chemical-state sensitivity, and length scales can be very different, these X-ray techniques share a common goal of combining a capability for structure determination with chemical-state specificity. This workshop will address recent advances in holographic, diffraction, and direct imaging techniques using X-ray photoemission on both theoretical and experimental fronts. A particular emphasis will be on novel structure determinations with atomic resolution using photoelectrons.

  7. High resolution X-ray diffraction studies on unirradiated

    Indian Academy of Sciences (India)

    High-resolution X-ray diffraction technique, employing a three-crystal monochromator–collimator combination is used to study the irradiation induced defects in flux grown Sr-hexaferrite crystals irradiated with 50 MeV Li3+ ion beams at room temperature with a fluence value of 1 × 1014 ions/cm2. The diffraction curves of the ...

  8. X-ray diffraction microtomography using synchrotron radiation

    CERN Document Server

    Barroso, R C; Jesus, E F O; Oliveira, L F

    2001-01-01

    The X-ray diffraction computed tomography technique is based on the interference phenomena of the coherent scatter. For low-momentum transfer, it is most probable that the scattering interaction will be coherent. A selective discrimination of a given element in a scanned specimen can be realized by fixing the Bragg angle which produces an interference peak and then, to carry out the computed tomography in the standard mode. The image reconstructed exalts the presence of this element with respect to other ones in a sample. This work reports the feasibility of a non-destructive synchrotron radiation X-ray diffraction imaging technique. This research was performed at the X-ray Diffraction beam line of the National Synchrotron Light Laboratory (LNLS) in Brazil. The coherent scattering properties of different tissue and bone substitute materials were evaluated. Furthermore, diffraction patterns of some polycrystalline solids were studied due to industrial and environmental human exposure to these metals. The obtai...

  9. X-ray photoelectron spectroscopy, high-resolution X-ray diffraction ...

    Indian Academy of Sciences (India)

    successfully grown by Czochralski technique in the automatic diameter control facility. As-grown crystal boules were oriented into (0 0 1) direction cut and optically polished for all measurements. Influence of Ti-ion incorporation into LiNbO3 was studied by core level. XPS analysis. Powder X-ray diffraction studies were ...

  10. Application of x-ray diffraction techniques to the understanding of the dry sliding wear behaviour of aluminium and titanium

    International Nuclear Information System (INIS)

    Zoheir, N.; Ahmet, T.A.; Northwood, D.O.

    1996-01-01

    Dry sliding wear tests were performed on polycrystalline f.c.c. Al and h.c.p. Ti specimens using a block-on-ring type wear machine with a rotating ring made of 52100 bearing steel. The sliding speed was 0.13 m.s sup -l and the applied normal load was 10 N. The wear tests were performed on a single specimen in ambient conditions and the texture was evaluated during wear using an X-ray diffraction inverse pole figure technique at a range of sliding distances. Pole density distributions for the [0001] and [111) poles for of Ti and Al, respectively, were then determined from the inverse pole figures. The texture evolution during sliding wear was subsequently related to the friction and wear behaviour. For the aluminum sample, a (111) texture developed parallel to the worn surface with increasing sliding distance (a 6 fold increase in the (111) pole density as the sliding distance increases from 0 to 2714 m). The titanium sample (normal section) which had a preferred orientation with the basal poles, [0001), parallel to the contact surface prior to testing, an increase in wear, i.e. sliding distance, did not change the texture. However, for the transverse section of titanium, the basal pole, [0001), density parallel to the worn surface increased with increasing sliding distance. The shape of the coefficient of friction versus sliding distance curve is strongly influenced by crystallographic texturing. A drop in the coefficient of friction with the progressive development of the [111) and [0001) texture was observed for both Al and Ti (transverse section) specimens, respectively

  11. Polarisation resonance in X-ray diffraction

    International Nuclear Information System (INIS)

    Goodman, P.; Paterson, D.; Matheson, S.

    1994-01-01

    The study of crystal structures by means of dynamic X-ray diffraction has placed a challenge to theoreticians to revise the X-ray diffraction theory based on Maxwell's equation. In this paper the feasibility of using 'polarisation resonance' as a tool in the determination of absolute configuration for asymmetric structures is investigated. Two (left- and right-handed), σ + and σ- , circular polarization states for 3-beam conditions are considered. Moreover, extending interaction into the 3 rd. dimension (normal to the beam) opens the possibility of absolute configuration determination of asymmetric structures in 3 dimensions. The computational scheme used is shown in terms of scattering diagrams. 7 refs., 1 tab., 6 figs

  12. Basic of X-ray diffraction

    International Nuclear Information System (INIS)

    Giacovazzo, C.

    1996-01-01

    The basic concepts of X-ray diffraction may be more easily understood if it is made preliminary use of a mathematical background. In these pages the authors will first define the delta function and its use for the representation of a lattice. Then the concepts of Fourier transform and convolution are given. At the end of this talk one should realize that a crystal is the convolution of the lattice with a function representing the content of the unit cell

  13. Basic of X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Giacovazzo, C. [Bari Univ. (Italy). Dip. Geomineralogico

    1996-09-01

    The basic concepts of X-ray diffraction may be more easily understood if it is made preliminary use of a mathematical background. In these pages the authors will first define the delta function and its use for the representation of a lattice. Then the concepts of Fourier transform and convolution are given. At the end of this talk one should realize that a crystal is the convolution of the lattice with a function representing the content of the unit cell.

  14. X-ray diffraction and chemical bonding

    International Nuclear Information System (INIS)

    Bats, J.W.

    1976-01-01

    Chemical bonds are investigated in sulfamic acid (H 3 N-SO 3 ), sodium sulfonlate dihydrate (H 2 NC 6 H 4 SO 3 Na.2H 2 O), 2,5-dimercaptothiadiazole (HS-C 2 N 2 S-SH), sodium cyanide dihydrate (NaCN.2H 2 O), sodium thiocyanate (NaSCN) and ammonium thiocyanate (NH 4 SCN) by X-ray diffraction, and if necessary completed with neutron diffraction. Crystal structures and electron densities are determined together with bond length and angles. Also the effects of thermal motion are discussed

  15. Gas multidetector for neutron and X-ray diffraction studies

    International Nuclear Information System (INIS)

    Allemand, R.

    1975-01-01

    In the context of nuclear imagery research the LETI is studying neutron, X-ray and γ-ray localisation detectors, the fields of application being neutron diffraction, X-ray diffraction and nuclear medicine. This report deals only with gas localisation methods, describing the physical results obtained in neutron and X-ray diffraction [fr

  16. Understanding self ion damage in FCC Ni-Cr-Fe based alloy using X-ray diffraction techniques

    Science.gov (United States)

    Halder Banerjee, R.; Sengupta, P.; Chatterjee, A.; Mishra, S. C.; Bhukta, A.; Satyam, P. V.; Samajdar, I.; Dey, G. K.

    2018-04-01

    Using X-ray diffraction line profile analysis (XRDLPA) approach the radiation response of FCC Ni-Cr-Fe based alloy 690 to 1.5 and 3 MeV Ni2+ ion damage was quantified in terms of its microstructural parameters. These microstructural parameters viz. average domain size, microstrain and dislocation density were found to vary anisotropically with fluence. The anisotropic behaviour is mainly attributable to presence of twins in pre-irradiated microstructure. After irradiation, surface roughness increases as a function of fluence attributable to change in surface and sub-surface morphology caused by displacement cascade, defects and sputtered atoms created by incident energetic ion. The radiation hardening in case of 1.5 MeV Ni2+ irradiated specimens too is a consequence of the increase in dislocation density formed by interaction of radiation induced defects with pre-existing dislocations. At highest fluence there is an initiation of saturation.

  17. Evaluation of the residual stresses in 95wt%Al2O3-5wt% SiC wear protection coating using X-Ray diffraction technique

    Science.gov (United States)

    Mahmoud, Adel K.; Hammoudi, Zaid S.; Student Samah Rasheed, M. Sc.

    2018-02-01

    This paper aims to measuring the residual stresses practically in wear protection coatings using the sin2ψ method according to X-ray diffraction technique. The wear protection coatings used in this study was composite coating 95wt% Al2O3-5wt% SiC, while bond coat was AlNi alloy produced by using flame spraying technique on the mild steel substrate. The diffraction angle, 2θ, is measured experimentally and then the lattice spacing is calculated from the diffraction angle, and the known X-ray wavelength using Bragg’s Law. Once the dspacing values are known, they can be plotted versus sin2ψ, (ψ is the tilt angle). In this paper, stress measurement of the samples that exhibit a linear behavior as in the case of a homogenous isotropic sample in a biaxial stress state is included. The plot of dspacing versus sin2ψ is a straight line which slope is proportional to stress. On the other hand, the second set of samples showed oscillatory dspacing versus sin2ψ behaviour. The oscillatory behaviour indicates the presence of inhomogeneous stress distribution. In this case the X-ray elastic constants must be used instead of Young’s modulus (E) and Poisson ratio (ν)values. These constants can be obtained from the literature for a given material and reflection combination. The value of the residual stresses for the present coating calculated was compressive stresses (-325.6758MPa).

  18. X-ray diffraction, neutron diffraction and analysis of molecular structures

    International Nuclear Information System (INIS)

    Fontecilla-Camps, J.C.

    1997-01-01

    The only method that is capable to show the atomic structure of most of macromolecules is the X ray diffraction; neutron diffraction is mostly used for the localization of hydrogen atoms, too light to be detected by X ray diffraction. With the growing number of known structures, the molecular crystallographic study may combine the molecular replacement technique and the co-crystallization method, or use the new Laue method, and leads to the functional and topological analysis of biological molecular structures

  19. X-ray diffraction imaging of material microstructures

    KAUST Repository

    Varga, Laszlo

    2016-10-20

    Various examples are provided for x-ray imaging of the microstructure of materials. In one example, a system for non-destructive material testing includes an x-ray source configured to generate a beam spot on a test item; a grid detector configured to receive x- rays diffracted from the test object; and a computing device configured to determine a microstructure image based at least in part upon a diffraction pattern of the x-rays diffracted from the test object. In another example, a method for determining a microstructure of a material includes illuminating a beam spot on the material with a beam of incident x-rays; detecting, with a grid detector, x-rays diffracted from the material; and determining, by a computing device, a microstructure image based at least in part upon a diffraction pattern of the x-rays diffracted from the material.

  20. X-ray diffraction of modulated structures

    International Nuclear Information System (INIS)

    Tsujimoto, T.; Hashimoto, K.; Saito, K.

    1977-01-01

    Modulated structures are regarded as a macrolattice, in which each lattice point is a ''unit region of concentration variation'' (abbreviated to ''unit region'') and an average lattice parameter is Qa 0 . The X-ray intensity diffracted from modulated structures, I/sub m(s) is given by I/sub m(s). I/sub d/(s). I/sub u/(s) is the scattering intensity from the ''unit region'' and I/sub u/(s) is that from the imaginary macrolattice in which each lattice point is the unit scattering factor. A region containing one zone-complex has been chosen as the ''unit region'' and the effects of the lattice spacing of the macrolattice and its disturbance on diffraction patterns have been discussed. When zone-complexes are small, I/sub m(s) is dominated by I/sub d/(s) and peaks of I/sub d/(s) are observed as side-bands or additional diffraction lines. The number of additional diffraction lines increases with an increase in Qa 0 and typical side-bands appear at a stage of this process. When the periodicity of the macrolattice is distrubed deeply or Qa 0 is large, I/sub u/(s) is observed directly as diffraction effects. The present theory explains reasonably the asymmetry of side-bands in position, the movement of main diffraction line with aging and the change of side-bands into diffraction lines of metastable phases during aging

  1. Locating and Visualizing Crystals for X-Ray Diffraction Experiments.

    Science.gov (United States)

    Becker, Michael; Kissick, David J; Ogata, Craig M

    2017-01-01

    Macromolecular crystallography has advanced from using macroscopic crystals, which might be >1 mm on a side, to crystals that are essentially invisible to the naked eye, or even under a standard laboratory microscope. As crystallography requires recognizing crystals when they are produced, and then placing them in an X-ray, electron, or neutron beam, this provides challenges, particularly in the case of advanced X-ray sources, where beams have very small cross sections and crystals may be vanishingly small. Methods for visualizing crystals are reviewed here, and examples of different types of cases are presented, including: standard crystals, crystals grown in mesophase, in situ crystallography, and crystals grown for X-ray Free Electron Laser or Micro Electron Diffraction experiments. As most techniques have limitations, it is desirable to have a range of complementary techniques available to identify and locate crystals. Ideally, a given technique should not cause sample damage, but sometimes it is necessary to use techniques where damage can only be minimized. For extreme circumstances, the act of probing location may be coincident with collecting X-ray diffraction data. Future challenges and directions are also discussed.

  2. Structural changes during contraction in vertebrate skeletal muscle as studied by time-resolved X-ray diffraction technique

    International Nuclear Information System (INIS)

    Sugi, H.; Tanaka, H.; Kobayashi, T.; Iwamoto, H.; Wakabayashi, K.; Hamanaka, T.; Mitsui, T.; Amemiya, Y.

    1986-01-01

    To obtain information about the structural changes in vertebrate skeletal muscle during contraction, time-resolved X-ray diffraction studies were performed on the intensity changes of the 59 A and 51 A actin layer lines from bullfrog sartorius muscle during the isometric force development, and the intensity changes of the 143 A and 215 A myosin meridional reflections and of the 1,0 and 1,1 equatorial reflections when isometrically contracting muscle was subjected to sinusoidal length changes (1%, 5-10Hz) with the following results. The integrated intensities of the 59 A and 51 A actin layer lines increased during the force development by 30-50% for the 59 A reflection, and by about 70% for the 51 A reflection compard to their respective resting values. These intensity changes were greater than those taking place during the transition from rest to rigor state, and observed to precede the intensity changes of the 429 A myosin off-meridional reflection and of equatorial reflections. When sinusoidal length changes were applied to the muscle generating steady isometric force, the resulting periodic intensity changes in the 1,0 and 1,1 equatorial reflections were in phase and in antiphase with the length changes, respectively. On the other hand, the 143 A myosin reflection exhibited a characteristic periodic change; its intensity reached a maximum at each boundary between the stretch and release phases of the length changes. These results are discussed in connection with the behavior of the cross-bridges during contraction. (author)

  3. X-ray diffraction using the time structure of the SRS

    International Nuclear Information System (INIS)

    Tanner, B.K.

    1983-01-01

    The subject is discussed under the headings: introduction (advances in the techniques of X-ray topography; comparison with transmission electron microscopy); stroboscopic X-ray topography; stroboscopic X-ray topography of travelling surface acoustic waves; possible general diffraction experiments. (U.K.)

  4. Analysis of local salts using x-ray spectrometric techniques | Umar ...

    African Journals Online (AJOL)

    Local salts namely: Mangul, Kantu and Manda have been analysed using x-ray diffraction and x-ray fluorescence techniques. X-ray diffraction has shown that Mangul and Kantu consist of mainly sodium chloride while Manda consists of mainly calcium potassium silicate. The major elements determined using x-ray ...

  5. Nanofabrication of Diffractive Soft X-ray Optics

    OpenAIRE

    Lindblom, Magnus

    2009-01-01

    This thesis summarizes the present status of the nanofabrication of diffractive optics, i.e. zone plates, and test objects for soft x-ray microscopy at KTH. The emphasis is on new and improved fabrication processes for nickel and germanium zone plates. A new concept in which nickel and germanium are combined in a zone plate is also presented. The main techniques used in the fabrication are electron beam lithography for the patterning, followed by plasma etching and electroplating for the stru...

  6. 100 years of discovery of X-ray diffraction

    International Nuclear Information System (INIS)

    Zhang Tao

    2012-01-01

    X-ray diffraction was discovered by Max von Laue a hundred years ago. Later, through the work of William H. Bragg and William L. Bragg, an experimental analysis method was developed to solve the structure of molecules at the atomic level. Over the past hundred years, science and technology has been dramatically changed by X-ray diffraction analysis, which has also undergone considerable development. The recent emergence of hard X-ray free electron lasers has provided a new dimension for X-ray diffraction analysis, promising even greater progress in the fields of physics, chemistry and biology. (author)

  7. Coherent X-ray diffraction from collagenous soft tissues

    Energy Technology Data Exchange (ETDEWEB)

    Berenguer de la Cuesta, Felisa; Wenger, Marco P.E.; Bean, Richard J.; Bozec, Laurent; Horton, Michael A.; Robinson, Ian K.; (UCL)

    2009-09-11

    Coherent X-ray diffraction has been applied in the imaging of inorganic materials with great success. However, its application to biological specimens has been limited to some notable exceptions, due to the induced radiation damage and the extended nature of biological samples, the last limiting the application of most part of the phasing algorithms. X-ray ptychography, still under development, is a good candidate to overcome such difficulties and become a powerful imaging method for biology. We describe herein the feasibility of applying ptychography to the imaging of biological specimens, in particular collagen rich samples. We report here speckles in diffraction patterns from soft animal tissue, obtained with an optimized small angle X-ray setup that exploits the natural coherence of the beam. By phasing these patterns, dark field images of collagen within tendon, skin, bone, or cornea will eventually be obtained with a resolution of 60-70 nm. We present simulations of the contrast mechanism in collagen based on atomic force microscope images of the samples. Simulations confirmed the 'speckled' nature of the obtained diffraction patterns. Once inverted, the patterns will show the disposition and orientation of the fibers within the tissue, by enhancing the phase contrast between protein and no protein regions of the sample. Our work affords the application of the most innovative coherent X-ray diffraction tools to the study of biological specimens, and this approach will have a significant impact in biology and medicine because it overcomes many of the limits of current microscopy techniques.

  8. X-ray diffraction from single GaAs nanowires

    Energy Technology Data Exchange (ETDEWEB)

    Biermanns, Andreas

    2012-11-12

    In recent years, developments in X-ray focussing optics have allowed to produce highly intense, coherent X-ray beams with spot sizes in the range of 100 nm and below. Together with the development of new experimental stations, X-ray diffraction techniques can now be applied to study single nanometer-sized objects. In the present work, X-ray diffraction is applied to study different aspects of the epitaxial growth of GaAs nanowires. Besides conventional diffraction methods, which employ X-ray beams with dimensions of several tens of {mu}m, special emphasis lies on the use of nanodiffraction methods which allow to study single nanowires in their as-grown state without further preparation. In particular, coherent X-ray diffraction is applied to measure simultaneously the 3-dimensional shape and lattice parameters of GaAs nanowires grown by metal-organic vapor phase epitaxy. It is observed that due to a high density of zinc-blende rotational twins within the nanowires, their lattice parameter deviates systematically from the bulk zinc-blende phase. In a second step, the initial stage in the growth of GaAs nanowires on Si (1 1 1) surfaces is studied. This nanowires, obtained by Ga-assisted growth in molecular beam epitaxy, grow predominantly in the cubic zinc-blende structure, but contain inclusions of the hexagonal wurtzite phase close to their bottom interface. Using nanodiffraction methods, the position of the different structural units along the growth axis is determined. Because the GaAs lattice is 4% larger than silicon, these nanowires release their lattice mismatch by the inclusion of dislocations at the interface. Whereas NWs with diameters below 50 nm are free of strain, a rough interface structure in nanowires with diameters above 100 nm prevents a complete plastic relaxation, leading to a residual strain at the interface that decays elastically along the growth direction. Finally, measurements on GaAs-core/InAs-shell nanowire heterostructures are presented

  9. Techniques in X-ray Astronomy

    Indian Academy of Sciences (India)

    Techniques in X-ray Astronomy. 2. Imaging Detectors. Kulinder Pal Singh is in the Department of. Astronomy and Astro- physics of the Tata. Institute of Fundamental. Research, Mumbai. His primary fields of research are X-ray studies of hot plasmas in stars, super- nova remnants, galaxies, intergalactic medium in clusters of ...

  10. X-ray diffraction contrast tomography (DCT) system, and an X-ray diffraction contrast tomography (DCT) method

    DEFF Research Database (Denmark)

    2012-01-01

    Source: US2012008736A An X-ray diffraction contrast tomography system (DCT) comprising a laboratory X-ray source (2), a staging device (5) rotating a polycrystalline material sample in the direct path of the X-ray beam, a first X-ray detector (6) detecting the direct X-ray beam being transmitted ...... in the polycrystalline sample is determined based on the two-dimensional position of extinction spots and the associated angular position of the sample for a set of extinction spots pertaining to the individual grain....

  11. Characterization of Metalloproteins and Biomaterials by X-ray Absorption Spectroscopy and X-ray Diffraction

    DEFF Research Database (Denmark)

    Frankær, Christian Grundahl

    by estimation of the water content by thermogravimetric analysis. Bone tissue from dogs treated with strontiummalonate was studied using XAS. A new approach for analysing the X-ray absorption spectra resulted in a compositional model, from which the relative distribution of strontium in the different bone......-ray crystallography and X-ray absorption spectroscopy (XAS) applied to studying different hexameric insulin conformations. (iii) The structures of polymorphs of strontium ranelate and the distribution of strontium in bone tissue. A procedure for fast identification and verification of protein powders using XRPD...... and R6) were solved by single crystal X-ray diffraction (XRD) to 1.40 Å, 1.30 Å and 1.80 Å resolution, respectively. The zinc coordination in each conformation was studied by XAS including both extended X-ray absorption fine structure (EXAFS) spectroscopy and X-ray absorption near edge structure (XANES...

  12. Modern X-ray diffraction. X-ray diffractometry for materials scientists, physicists, and chemicists. 2. rev. and enl. ed.; Moderne Roentgenbeugung. Roentgendiffraktometrie fuer Materialwissenschaftler, Physiker und Chemiker

    Energy Technology Data Exchange (ETDEWEB)

    Spiess, Lothar; Teichert, Gerd; Schwarzer, Robert; Behnken, Herfried; Genzel, Christoph

    2009-07-01

    This book offers a comprehensive survey over the applications of X-ray diffractions in fields like materials technique, metallurgy, electrotechniques, mechanical engineering, as well as micro- and nanotechniques. The necessary baic knowledges of X-ray diffraction are mediated foundedly and illustratively. Thereby new techniques and evaluation procedures are presented as well as well known methods.

  13. Diffraction peaks in x-ray spectroscopy: Friend or foe?

    International Nuclear Information System (INIS)

    Tissot, R.G.; Goehner, R.P.

    1992-01-01

    Diffraction peaks can occur as unidentifiable peaks in the energy spectrum of an x-ray spectrometric analysis. Recently, there has been increased interest in oriented polycrystalline films and epitaxial films on single crystal substrates for electronic applications. Since these materials diffract x-rays more efficiently than randomly oriented polycrystalline materials, diffraction peaks are being observed more frequently in x-ray fluorescent spectra. In addition, micro x-ray spectrometric analysis utilizes a small, intense, collimated x-ray beam that can yield well defined diffraction peaks. In some cases these diffraction peaks can occur at the same position as elemental peaks. These diffraction peaks, although a possible problem in qualitative and quantitative elemental analysis, can give very useful information about the crystallographic structure and orientation of the material being analyzed. The observed diffraction peaks are dependent on the geometry of the x-ray spectrometer, the degree of collimation and the distribution of wavelengths (energies) originating from the x-ray tube and striking the sample

  14. Tensometry technique for X-ray diffraction in applied analysis of welding; Tensometria por tecnica de difracao de raios X aplicada na analise de soldagens

    Energy Technology Data Exchange (ETDEWEB)

    Turibus, S.N.; Caldas, F.C.M.; Miranda, D.M.; Monine, V.I.; Assis, J.T., E-mail: snturibus@iprj.uerj.b [Universidade do Estado do Rio de Janeiro (IPRJ/UERJ), Nova Friburgo, RJ (Brazil). Inst. Politecnico

    2010-07-01

    This paper presents the analysis of residual stress introduced in welding process. As the stress in a material can induce damages, it is necessary to have a method to identify this residual stress state. For this it was used the non-destructive X-ray diffraction technique to analyze two plates from A36 steel jointed by metal inert gas (MIG) welding. The stress measurements were made by the sin{sup 2{psi}} method in weld region of steel plates including analysis of longitudinal and transverse residual stresses in fusion zone, heat affected zone (HAZ) and base metal. To determine the stress distribution along the depth of the welded material it was used removing of superficial layers made by electropolishing. (author)

  15. Quantification of rutile in anatase by means of X-ray diffraction technique; Cuantificacion de rutilo en anatasa por medio de la tecnica de difraccion

    Energy Technology Data Exchange (ETDEWEB)

    Macias B, L.R.; Palacios G, J.; Garcia C, R.M. [Instituto Nacional de Investigaciones Nucleares, A.P. 18-1027, 11801 Mexico D.F. (Mexico)

    1999-07-01

    In this work, making use of the X-ray diffraction technique, it was determined the quantification of two phases which are mixed in a crystalline sample of rutile and anatase also it is indicated the method to proceed in its evaluation, so that in the end it will be had as result of a semi-quantitative analysis of the phases that are found in the sample. The conclusion is that this method performs in samples which are presented as powders and since the different parameters with which they must be fulfilled then this should not be called quantitative but semi-quantitative and it has a margin of error in its evaluation. (Author)

  16. Nano structured materials studied by coherent X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Gulden, Johannes

    2013-03-15

    Structure determination with X-rays in crystallography is a rapidly evolving field. Crystallographic methods for structure determination are based on the assumptions about the crystallinity of the sample. It is vital to understand the structure of possible defects in the crystal, because they can influence the structure determination. All conventional methods to characterize defects require a modelling through simulated data. No direct methods exist to image the core of defects in crystals. Here a new method is proposed, which will enable to visualize the individual scatterers around and at defects in crystals. The method is based on coherent X-ray scattering. X-rays are perfectly suited since they can penetrate thick samples and buried structures can be investigated Recent developments increased the coherent flux of X-Ray sources such as synchrotrons by orders of magnitude. As a result, the use of the coherent properties of X-rays is emerging as a new aspect of X-ray science. New upcoming and operating X-ray laser sources will accelerate this trend. One new method which has the capacity to recover structural information from the coherently scattered photons is Coherent X-ray Diffraction Imaging (CXDI). The main focus of this thesis is the investigation of the structure and the dynamics of colloidal crystals. Colloidal crystals can be used as a model for atomic crystals in order to understand the growth and defect structure. Despite the large interest in these structures, many details are still unknown.Therefore, it is vital to develop new approaches to measure the core of defects in colloidal crystals. After an introduction into the basics of the field of coherent X-ray scattering, this thesis introduces a novel method, Small Angle Bragg Coherent Diffractive Imaging, (SAB-CDI). This new measurement technique which besides the relevance to colloidal crystals can be applied to a large variety of nano structured materials. To verify the experimental possibilities the

  17. Nano structured materials studied by coherent X-ray diffraction

    International Nuclear Information System (INIS)

    Gulden, Johannes

    2013-03-01

    Structure determination with X-rays in crystallography is a rapidly evolving field. Crystallographic methods for structure determination are based on the assumptions about the crystallinity of the sample. It is vital to understand the structure of possible defects in the crystal, because they can influence the structure determination. All conventional methods to characterize defects require a modelling through simulated data. No direct methods exist to image the core of defects in crystals. Here a new method is proposed, which will enable to visualize the individual scatterers around and at defects in crystals. The method is based on coherent X-ray scattering. X-rays are perfectly suited since they can penetrate thick samples and buried structures can be investigated Recent developments increased the coherent flux of X-Ray sources such as synchrotrons by orders of magnitude. As a result, the use of the coherent properties of X-rays is emerging as a new aspect of X-ray science. New upcoming and operating X-ray laser sources will accelerate this trend. One new method which has the capacity to recover structural information from the coherently scattered photons is Coherent X-ray Diffraction Imaging (CXDI). The main focus of this thesis is the investigation of the structure and the dynamics of colloidal crystals. Colloidal crystals can be used as a model for atomic crystals in order to understand the growth and defect structure. Despite the large interest in these structures, many details are still unknown.Therefore, it is vital to develop new approaches to measure the core of defects in colloidal crystals. After an introduction into the basics of the field of coherent X-ray scattering, this thesis introduces a novel method, Small Angle Bragg Coherent Diffractive Imaging, (SAB-CDI). This new measurement technique which besides the relevance to colloidal crystals can be applied to a large variety of nano structured materials. To verify the experimental possibilities the

  18. Preparation of specimens for analysis by: X-ray diffraction and X-ray fluorescence analysis

    International Nuclear Information System (INIS)

    Banos L, L.

    2004-01-01

    Specimen preparation is one of the most important requirements in the analysis of samples by X-ray Diffraction and X-ray Fluorescence. This statement is especially true for samples containing different types of materials. There are many forms of specimen suitable for X-ray analysis and the type of the sample as received will generally determine the method of pretreatment. It is convenient to refer to the material received for analysis as the sample, and that, which is actually analyzed as the specimen. The powder Diffraction method assumes that the particles in the specimen are ideally random orientation and that there are enough crystallites in the specimen to achieve a representative intensity distribution for these crystallites. X ray Fluorescence is essentially a comparative method of analysis, it is vital that all standards and unknowns be presented to the spectrometer in a reproducible and identical manner. (Author) 3 refs., 6 figs

  19. X-ray and neutron diffraction in the study of organic crystalline hydrates.

    OpenAIRE

    Fucke, K.; Steed, J.W.

    2010-01-01

    A review. Diffraction methods are a powerful tool to investigate the crystal structure of organic compounds in general and their hydrates in particular. The laboratory standard technique of single crystal X-ray diffraction gives information about the molecular conformation, packing and hydrogen bonding in the crystal structure, while powder X-ray diffraction on bulk material can trace hydration/dehydration processes and phase transitions under non-ambient conditions. Neutron diffraction is a ...

  20. Diffraction of X-ray beams in capillary waveguides

    International Nuclear Information System (INIS)

    Kukhlevsky, S.V.; Flora, F.; Marinai, A.; Nyitray, G.; Ritucci, A.; Palladino, L.; Reale, A.; Tomassetti, G.

    2000-01-01

    Propagation of the soft X-ray radiation generated by a small-diameter incoherent source through the capillary plane waveguide which satisfies the multimode condition is studied using the Fresnel-Kirchhoff diffraction theory. The diffraction is manifested by appearance of the diffraction fringes, dark and light bands, in the far-field zone of the capillary output. Such a behaviour of the X-ray radiation is confirmed by our experimental data. The results give explanation for the interference effect recently observed in many experiments on the grazing reflections of X-rays in single and multiple capillary optics

  1. High-resolution X-ray diffraction studies of multilayers

    DEFF Research Database (Denmark)

    Christensen, Finn Erland; Hornstrup, Allan; Schnopper, H. W.

    1988-01-01

    High-resolution X-ray diffraction studies of the perfection of state-of-the-art multilayers are presented. Data were obtained using a triple-axis perfect-crystal X-ray diffractometer. Measurements reveal large-scale figure errors in the substrate. A high-resolution triple-axis set up is required...

  2. Oxides neutron and synchrotron X-ray diffraction studies

    CERN Document Server

    Sosnowska, I M

    1999-01-01

    We review some results from several areas of oxide science in which neutron scattering and X-ray synchrotron scattering exercise a complementary role to high-resolution transmission electron microscopy. The very high-resolution time-of-flight neutron diffraction technique and its role in studies of the magnetic structure of oxides is especially reviewed. The selected topics of structural studies for the chosen oxides are: crystal and magnetic structure of the so-called cellular random systems, magnetic structure and phase transitions in ferrites and the behaviour of water in non-stoichiometric protonic conductors and in the opal silica-water system. (40 refs).

  3. Fabrication of diffraction X-ray elements

    International Nuclear Information System (INIS)

    Babin, S.V.; Erko, A.I.

    1989-01-01

    The use of focusing elements in the X-ray range shows promise for nondestructive chemical analysis of samples with spatial resolution up to fractions of a μm. This paper considers the problems of fabricating Fresnel zone plates of different types: Amplitude- and phase-transparent zone plates and reflective zone plates formed on a multilayer mirror, as well as microstructures with a specified zone profile. (orig.)

  4. Physical methods for studying minerals and solid materials: X-ray, electron and neutron diffraction; scanning and transmission electron microscopy; X-ray, electron and ion spectrometry

    International Nuclear Information System (INIS)

    Eberhart, J.-P.

    1976-01-01

    The following topics are discussed: theoretical aspects of radiation-matter interactions; production and measurement of radiations (X rays, electrons, neutrons); applications of radiation interactions to the study of crystalline materials. The following techniques are presented: X-ray and neutron diffraction, electron microscopy, electron diffraction, X-ray fluorescence analysis, electron probe microanalysis, surface analysis by electron emission spectrometry (ESCA and Auger electrons), scanning electron microscopy, secondary ion emission analysis [fr

  5. Study of deformation and fracture micro mechanisms of titanium alloy Ti-6Al-4V using electron microscopy and and X-ray diffraction techniques

    International Nuclear Information System (INIS)

    Morcelli, Aparecido Edilson

    2009-01-01

    This present work allowed the study of deformation and fracture micro mechanisms of titanium alloy Ti-6Al-4V, used commercially for the manufacture of metallic biomaterials. The techniques employed for the analysis of the material under study were: scanning electron microscopy (SEM), transmission electron microscopy (TEM) and X-ray diffraction (XRD). The study of the influence and behavior of the phases present in titanium alloys is important to evaluate the behavior of cracks in titanium alloys with high mechanical strength, which have fine alpha (α), beta (β) and (α±β) microstructure, linking the presence of the phases with the strength of the material. The evaluation in situ of deformation and fracture micro mechanisms were performed by TEM and was also a study of phase transformations during cooling in titanium alloys, using the techniques of bright field, dark field and diffraction of electrons in the selected area. After heat treatment differences were observed between the amount of in relation to the original microstructure of the β and α phases material for different conditions used in heat treatment applied to the alloy. The presence of lamellar microstructure formed during cooling in the β field was observed, promoting the conversion of part of the secondary alpha structure in β phase, which was trapped between the lamellar of alpha. (author)

  6. Theory of time-resolved inelastic x-ray diffraction

    DEFF Research Database (Denmark)

    Lorenz, Ulf; Møller, Klaus Braagaard; Henriksen, Niels Engholm

    2010-01-01

    Starting from a general theory of time-resolved x-ray scattering, we derive a convenient expression for the diffraction signal based on a careful analysis of the relevant inelastic scattering processes. We demonstrate that the resulting inelastic limit applies to a wider variety of experimental...... conditions than similar, previously derived formulas, and it directly allows the application of selection rules when interpreting diffraction signals. Furthermore, we present a simple extension to systems simultaneously illuminated by x rays and a laser beam....

  7. Synchrotron x-ray diffraction study of liquid surfaces

    DEFF Research Database (Denmark)

    Als-Nielsen, Jens Aage; Pershan, P.S.

    1983-01-01

    A spectrometer for X-ray diffraction and refraction studies of horizontal, free surfaces of liquids is described. As an illustration smetic-A layering at the surface of a liquid crystal is presented.......A spectrometer for X-ray diffraction and refraction studies of horizontal, free surfaces of liquids is described. As an illustration smetic-A layering at the surface of a liquid crystal is presented....

  8. A = Rb, K: Single crystal X-ray diffraction studies

    Indian Academy of Sciences (India)

    Unknown

    X-ray diffraction on structural phase transition. 475. Figure 2. Powder X-ray diffraction pattern of KLHS at 298 and 100 K. 3. Structure determination and refinement. 3.1 Structure of RLHS at 293 K. A crystal of size 0⋅7 × 0⋅3 × 0⋅4 mm was mounted on a BRUKER AXS SMART APEX. CCD9 diffractometer with a crystal to ...

  9. X-ray diffraction identification of clay minerals by microcomputer

    International Nuclear Information System (INIS)

    Rodrigues, S.; Imasava, F.J.

    1988-01-01

    The identification of clay minerals by X-ray powder diffraction are done by searching an unknown pattern with a file of standard X-ray diffraction patterns. For this searching done by hand is necessary a long time. This paper shows a program in ''Basic'' language to be utilized in microcomputers for the math of the unknown pattern, using the high velocity of comparison of the microcomputer. A few minutes are used for the match. (author) [pt

  10. Residual stresses analysis by X-ray and neutrons diffraction

    International Nuclear Information System (INIS)

    Lodini, A.; Perrin, M.

    1996-04-01

    This conference is composed of 17 papers grouped in 13 chapters which main themes are: advantages of neutrons and synchrotron radiation for material characterization; residual stress evaluation from micro-deformation measurements in polycrystalline materials; X-ray and neutron diffractometry; residual stress evaluation by X-ray diffraction in extreme surfaces; residual stress diffraction evaluation in monocrystalline nickel base alloys, in polyphasic materials, composite materials, thin films, multilayers and joints; application to thermonuclear reactor components

  11. Modern trends in x-ray powder diffraction

    International Nuclear Information System (INIS)

    Goebel, H.E.; Snyder, R.L.

    1985-01-01

    The revival of interest in X-ray powder diffraction, being quoted as a metamorphosis from the 'ugly duckling' to a 'beautiful swan', can be attributed to a number of modern developments in instrumentation and evaluation software. They result in faster data collection, improved accuracy and resolution, and better detectability of minor phases. The ease of data evaluation on small computers coupled direct to the instrument allows convenient execution of previously tedious and time-consuming off-line tasks like qualitative and quantitative analysis, characterization of microcrystalline properties, indexing, and lattice-constant refinements, as well as structure refinements or even exploration of new crystal structures. Powder diffraction has also progressed from an isolated analytical laboratory method to an in situ technique for analysing solid-state reactions or for the on-stream control of industrial processes. The paper surveys these developments and their real and potential applications, and tries to emphasize new trends that are regarded as important steps for the further progress of X-ray powder diffraction

  12. X-ray and neutron diffraction studies of superionic conductors: protonic compounds

    International Nuclear Information System (INIS)

    Tranqui, D.; Anne, M.

    1982-01-01

    Rapid reviews of X-ray and neutron diffraction theories and instrumentations are presented. It is shown that X-ray diffraction is a very powerful tool to determine three dimensional crystal structures. However localization of light atoms by X-ray is somewhat uncertain in compounds containing heavy atoms. In neutron diffraction the irregular but limited variation of scattering lengths of all elements within the periodic table render it possible to localize almost all atoms, especially hydrogen atoms in solids. Some recent and successful studies of protonic compounds and other by X-ray and neutron diffraction are cited. These examples demonstrate that the combined X-ray and neutron techniques should be used to obtain not only geometrical features of rigid framework in superionic conductor materials but also in an indirect way the dynamic properties of mobile ions. (author)

  13. A technique for high-throughput protein crystallization in ionically cross-linked polysaccharide gel beads for X-ray diffraction experiments.

    Directory of Open Access Journals (Sweden)

    Michihiro Sugahara

    Full Text Available A simple technique for high-throughput protein crystallization in ionically cross-linked polysaccharide gel beads has been developed for contactless handling of crystals in X-ray crystallography. The method is designed to reduce mechanical damage to crystals caused by physical contact between crystal and mount tool and by osmotic shock during various manipulations including cryoprotection, heavy-atom derivatization, ligand soaking, and diffraction experiments. For this study, protein crystallization in alginate and κ-carrageenan gel beads was performed using six test proteins, demonstrating that proteins could be successfully crystallized in gel beads. Two complete diffraction data sets from lysozyme and ID70067 protein crystals in gel beads were collected at 100 K without removing the crystals; the results showed that the crystals had low mosaicities. In addition, crystallization of glucose isomerase was carried out in alginate gel beads in the presence of synthetic zeolite molecular sieves (MS, a hetero-epitaxic nucleant; the results demonstrated that MS can reduce excess nucleation of this protein in beads. To demonstrate heavy-atom derivatization, lysozyme crystals were successfully derivatized with K2PtBr6 within alginate gel beads. These results suggest that gel beads prevent serious damage to protein crystals during such experiments.

  14. Quantification of rutile in anatase by X-ray diffraction

    International Nuclear Information System (INIS)

    Chavez R, A.

    2001-01-01

    Nowadays the discovering of new and better materials required in all areas of the industry has been lead to the human being to introduce him to this small and great world. The crystalline materials, have properties markedly directional. When it is necessary to realize a quantitative analysis to these materials the task is not easy. The main objective of this work is the research of a real problem, its solution and perfecting of a technique involving the theoretical and experimental principles which allow the quantification of crystalline phases. The chapter 1 treats about the study of crystalline state during the last century, by means of the X-ray diffraction technique. The chapter 2 studies the nature and production of X-rays, the chapter 3 expounds the principles of the diffraction technique which to carry out when it is satisfied the Bragg law studying the powder diffraction method and its applications. In the chapter 4 it is explained how the intensities of the beams diffracted are determined by the atoms positions inside of the elemental cell of the crystal. The properties of the crystalline samples of anatase and rutile are described in the chapter 5. The results of this last analysis are the information which will be processed by means of the auxiliary software: Diffrac AT, Axum and Peakfit as well as the TAFOR and CUANTI software describing this part with more detail in the chapters 6 and 7 where it is mentioned step by step the function of each software until to reach the quantification of crystalline phases, objective of this work. Finally, in the chapter 8 there are a results analysis and conclusions. The contribution of this work is for those learned institutions of limited resources which can tackle in this way the characterization of materials. (Author)

  15. Microprocessor-based system for automatic X-ray diffraction and fluorescence

    International Nuclear Information System (INIS)

    Souza, A.M. de; Carmo, L.C.S. do; Pereira, V.J.E.; Soares, E.A.

    1984-01-01

    A data acquisition and processing device appropriate for X-ray analysis and goniometer control was built. The Z-80 based system as well as the whole architeture is described. The advantages and new possibilities of the automated instrument as compared to the traditional ones are listed. The X-ray diffraction and fluorescence techniques can take advantage of the automation. (Author) [pt

  16. X-ray diffraction analysis of InAs nanowires

    International Nuclear Information System (INIS)

    Davydok, Anton

    2013-01-01

    Semiconductor nanowires have attracted great interest as building blocks for future electronic and optoelectronic devices. The variability of the growth process opens the opportunity to control and combine the various properties tailoring for specific application. It was shown that the electrical and optical characteristics of the nanowires are strongly connected with their structure. Despite intensive research in this field, the growth process is still not fully understood. In particular, extensive real structure investigations are required. Most of the reports dedicated on the structural researches are based on the results of scanning electron microscopy (SEM) or transmission electron microscopy (TEM). SEM provides an image of the surface with nanostructures and is mainly used to describe the morphology of the sample, but it does not bring information about the internal structure, phase composition and defect structure. At the same time, the internal structure can be examined by TEM down to atomic scale. TEM image of good quality are very expensive due to the efforts in sample preparation and in localisation of a single object. All these aspects make the statistical structural analysis difficult. In the present work, X-ray diffraction analysis has been applied for structural investigation of InAs nanowires grown by different techniques. Using various X-ray diffraction geometries, the nanowire systems were investigated in terms of the lattice parameters, phase composition, strains and displacement fields and stacking defects. In particular, realizing grazing incidence diffraction and controlling the penetration depth of X-ray beam, we characterized sample series grown by Au-assisted metal organic phase epitaxy on GaAs [111]B substrate with different growth time. According to the results of SEM and X-ray investigations, a model of the growth process has been proposed. A more detailed analysis was performed on InAs nanowires grown by molecular beam epitaxy (MBE) on

  17. Residual stress analysis in Co-based laser clad layers by laboratory X-rays and synchrotron diffraction techniques

    NARCIS (Netherlands)

    de Oliveira, U.; Ocelik, V.; De Hosson, J. Th. M.

    2006-01-01

    Thick Co-based coatings were prepared by laser cladding technique on C45 steel substrates with different geometries. Microstructural observations were realized using optical, scanning electron and orientation imaging microscopy. The residual strain state on the surface of a clad layer was determined

  18. In situ electrochemical impedance spectroscopy/synchrotron radiation grazing incidence X-ray diffraction-A powerful new technique for the characterization of electrochemical surfaces and interfaces

    International Nuclear Information System (INIS)

    De Marco, Roland; Jiang, Z.-T.; Martizano, Jay; Lowe, Alex; Pejcic, Bobby; Riessen, Arie van

    2006-01-01

    A marriage of electrochemical impedance spectroscopy (EIS) and in situ synchrotron radiation grazing incidence X-ray diffraction (SR-GIXRD) has provided a powerful new technique for the elucidation of the mechanistic chemistry of electrochemical systems. In this study, EIS/SR-GIXRD has been used to investigate the influence of metal ion buffer calibration ligands, along with natural organic ligands in seawater, on the behaviour of the iron chalcogenide glass ion-selective electrode (ISE). The SR-GIXRD data demonstrated that citrate - a previously reported poor iron calibration ligand for the analysis of seawater - induced an instantaneous and total dissolution of crystalline GeSe and Sb 2 Se 3 in the modified surface layer (MSL) of the ISE, while natural organic ligands in seawater and a mixture of ligands in a mimetic seawater ligand system protected the MSL's crystalline inclusions of GeSe and Sb 2 Se 3 from oxidative attack. Expectedly, the EIS data showed that citrate induced a loss in the medium frequency time constant for the MSL of the ISE, while seawater's natural organic ligands and the mimetic ligand system preserved the medium frequency EIS response characteristics of the ISE's MSL. The new EIS/SR-GIXRD technique has provided insights into the suitability of iron calibration ligands for the analysis of iron in seawater

  19. Quantitation of cefepime.2HCl dihydrate in cefepime.2HCl monohydrate by diffuse reflectance IR and powder X-ray diffraction techniques.

    Science.gov (United States)

    Bugay, D E; Newman, A W; Findlay, W P

    1996-10-01

    The identification, characterization and quantitation of crystal forms is becoming increasingly important within the pharmaceutical industry. Multi-disciplinary, physical analytical techniques are necessary for this task. In this work, diffuse reflectance mid-infrared (IR) and powder X-ray diffraction (XRD) analyses were used to identify two different hydrated forms of cefepime.2HCl, a cephalosporin. Characterization of the mono- and dihydrate forms led to separate IR and XRD quantitative assays for the determination of dihydrate content in cefepime.2HCl monohydrate bulk material. For the IR assay, a working range of 1.0-8% (w/w) was established with a minimum quantifiable level (MQL) of 1.0% (w/w) and a limit of detection (LD) of 0.3% (w/w) dihydrate in monohydrate material. The XRD assay displayed a working range of 2.5-15% (w/w) with an MQL of 2.5% (w/w) and an LD of 0.75% (w/w). Cross validation was performed between the two techniques, with a good correlation displayed for each assay as compared with the known concentrations and as compared with each other. In addition, a full evaluation of potential assay errors was made.

  20. Bone diagnosis by X-ray techniques

    Energy Technology Data Exchange (ETDEWEB)

    Lima, I. [Nuclear Engineering Program/COPPE/UFRJ, P.O. Box 68509, Av. Horacio Macedo, 2030, Sala I-133, Cidade Universitaria, Zip Code: 21941-972 Rio de Janeiro, RJ (Brazil)], E-mail: inaya@lin.ufrj.br; Anjos, M.J. [Nuclear Engineering Program/COPPE/UFRJ, P.O. Box 68509, Av. Horacio Macedo, 2030, Sala I-133, Cidade Universitaria, Zip Code: 21941-972 Rio de Janeiro, RJ (Brazil); Physics Institute, UERJ (Brazil); Farias, M.L.F. [University Hospital, UFRJ (Brazil); Parcegoni, N.; Rosenthal, D. [Biophysics Institute, UFRJ (Brazil); Duarte, M.E.L. [Histologic and Embriology Department, UFRJ (Brazil); Lopes, R.T. [Nuclear Engineering Program/COPPE/UFRJ, P.O. Box 68509, Av. Horacio Macedo, 2030, Sala I-133, Cidade Universitaria, Zip Code: 21941-972 Rio de Janeiro, RJ (Brazil)

    2008-12-15

    In this work, two X-ray techniques used were 3D microcomputed tomography (micro-CT) and X-ray microfluorescence (micro-XRF) in order to investigate the internal structure of the bone samples. Those two techniques work together, e.g. as a complement to each other, to characterize bones structure and composition. Initially, the specimens were used to do the scan procedure in the microcomputer tomography system and the second step consists of doing the X-ray microfluorescence analysis. The results show that both techniques are powerful methods for analyzing, inspecting and characterizing bone samples: they are alternative procedures for examining bone structures and compositions and they are complementary.

  1. High-energy X-ray diffraction of disordered materials in high-energy X-ray diffraction beamline BL04B2 at SPring-8

    International Nuclear Information System (INIS)

    Kohara, Shinji; Suzuya, Kentaro

    2001-01-01

    The high-energy (E≥30 keV) X-ray diffraction with the latest generation synchrotron sources as well as the introduction of advanced insertion devices has created new approaches to the quantitative study of the structure of non-crystalline materials because of several improvements: higher resolution in real space due to a wide range of Q, smaller correction terms (especially for absorption correction), reduction of truncation errors, the feasibility of running under extreme environments, including low- and high-temperatures, and of obtaining a direct comparison between X-ray and neutron diffraction data. Recently, this technique has been combined with neutron diffraction with a pulsed source to provide more detailed and reliable structural information not previously available. This article reviews and summarizes a horizontal two-axis diffractometer for non-crystalline materials, installed at the high-energy X-ray diffraction beamline BL04B2 of SPring-8, and recent results obtained from the high-energy X-ray diffraction on several oxide glasses: SiO 2 and GeO 2 . In particular, it addresses the structural models of oxide glasses obtained by the reverse Monte Carlo (RMC) modelling technique using both the high-energy X-ray and neutron diffraction data. (author)

  2. Structural and preferential orientation characterization of the new pan fibres, used as carbon fiber precursors, by x-ray diffraction techniques

    International Nuclear Information System (INIS)

    Pence, I.; Tidba, G.

    2000-01-01

    In this paper it is presented a complementary method to certificate polyacrylonitrile (PAN) fibres as carbon fibre precursors by X-ray diffraction investigations. There are shown the structural parameters (d [200] , d [311] , L [200] , X c ) and the preferred orientation parameters (Z, 2 Φ>, P 2 ( 2 Φ>)), of the two new kinds of PAN fibers and of the Courtella PAN fibres. (authors)

  3. A short note on physical properties to irradiated nuclear fuel by means of X-ray diffraction and neutron scattering techniques

    Science.gov (United States)

    Abdullah, Yusof; Husain, Hishamuddin; Hak, Cik Rohaida Che; Alias, Nor Hayati; Yusof, Mohd Reusmaazran; Kasim, Norasiah Ab; Zali, Nurazila Mat; Mohamed, Abdul Aziz

    2015-04-01

    For nuclear reactor applications, understanding the evolution of the fuel materials microstructure during irradiation are of great importance. This paper reviews the physical properties of irradiated nuclear fuel analysis which are considered to be of most importance in determining the performance behavior of fuel. X-rays diffraction was recognize as important tool to investigate the phase identification while neutron scattering analyses the interaction between uranium and other materials and also investigation of the defect structure.

  4. A short note on physical properties to irradiated nuclear fuel by means of X-ray diffraction and neutron scattering techniques

    Energy Technology Data Exchange (ETDEWEB)

    Abdullah, Yusof, E-mail: yusofabd@nuclearmalaysia.gov.my; Husain, Hishamuddin; Hak, Cik Rohaida Che; Alias, Nor Hayati; Yusof, Mohd Reusmaazran; Kasim, Norasiah Ab; Zali, Nurazila Mat [Malaysian Nuclear Agency, Bangi, Kajang 43000, Selangor (Malaysia); Mohamed, Abdul Aziz [College of Engineering, Universiti Tenaga National, Jalan Ikram-Uniten, 43000 Kajang, Selangor (Malaysia)

    2015-04-29

    For nuclear reactor applications, understanding the evolution of the fuel materials microstructure during irradiation are of great importance. This paper reviews the physical properties of irradiated nuclear fuel analysis which are considered to be of most importance in determining the performance behavior of fuel. X-rays diffraction was recognize as important tool to investigate the phase identification while neutron scattering analyses the interaction between uranium and other materials and also investigation of the defect structure.

  5. Reflectivity and diffraction of X rays applied to organic thin films

    International Nuclear Information System (INIS)

    Rieutord, Francois

    1987-01-01

    This research thesis reports the study of organic thin films by using X-ray-based technologies, and more particularly X-ray reflectivity. After some recalls on X ray diffraction, and on the fabrication of Langmuir-Blodgett films, the author shows how, by combining three X-ray-based techniques, it is possible to study a volume structure of a thin film. He describes the technique of measurement by X- ray reflexivity, its experimental implementation, and methods for result interpretation. In the next part, the author reports the study of peculiar interference effects which are noticed in reflexivity on Langmuir-Blodgett films, and then describes the nature of these films by correlating results of X ray reflexivity with direct observations performed by electronic microscopy on replica [fr

  6. High-energy X-ray diffraction studies of disordered materials

    International Nuclear Information System (INIS)

    Kohara, Shinji; Suzuya, Kentaro

    2003-01-01

    With the arrival of the latest generation of synchrotron sources and the introduction of advanced insertion devices (wigglers and undulators), the high-energy (E≥50 keV) X-ray diffraction technique has become feasible, leading to new approaches in the quantitative study of the structure of disordered materials. High-energy X-ray diffraction has several advantages: higher resolution in real space due to a wide range of scattering vector Q, smaller correction terms (especially the absorption correction), reduction of truncation errors, the feasibility of running under extreme environments, including high-temperatures and high-pressures, and the ability to make direct comparisons between X-ray and neutron diffraction data. Recently, high-energy X-ray diffraction data have been combined with neutron diffraction data from a pulsed source to provide more detailed and reliable structural information than that hitherto available

  7. Coherent X-ray diffraction studies of mesoscopic materials

    International Nuclear Information System (INIS)

    Shabalin, Anatoly

    2015-12-01

    This thesis is devoted to three separate projects, which can be considered as independent. First, the dynamical scattering effects in the Coherent X-ray Diffractive Imaging (CXDI) method are discussed. Based on the simulation results, a straightforward method for correction for the refraction and absorption artifacts in the Bragg CXDI reconstruction is suggested. The second part summarizes the results of an Coherent X-ray Diffractive Imaging experiment with a single colloidal crystal grain. A remarkable result is that positions of individual particles in the crystal lattice have been resolved in three dimensions. The third project is devoted to X-ray diffraction experimental studies of structural evolution of colloidal crystalline films upon incremental heating. Based on the results of the analysis a model of structural evolution of a colloidal crystal upon heating on nanoscopic and mesoscopic length scales is suggested.

  8. Fourier techniques in X-ray timing

    NARCIS (Netherlands)

    van der Klis, M.

    1988-01-01

    Basic principles of Fourier techniques often used in X-ray time series analysis are reviewed. The relation between the discrete Fourier transform and the continuous Fourier transform is discussed to introduce the concepts of windowing and aliasing. The relation is derived between the power spectrum

  9. Acemetacin cocrystal structures by powder X-ray diffraction

    Directory of Open Access Journals (Sweden)

    Geetha Bolla

    2017-05-01

    Full Text Available Cocrystals of acemetacin drug (ACM with nicotinamide (NAM, p-aminobenzoic acid (PABA, valerolactam (VLM and 2-pyridone (2HP were prepared by melt crystallization and their X-ray crystal structures determined by high-resolution powder X-ray diffraction. The powerful technique of structure determination from powder data (SDPD provided details of molecular packing and hydrogen bonding in pharmaceutical cocrystals of acemetacin. ACM–NAM occurs in anhydrate and hydrate forms, whereas the other structures crystallized in a single crystalline form. The carboxylic acid group of ACM forms theacid–amide dimer three-point synthon R32(9R22(8R32(9 with three different syn amides (VLM, 2HP and caprolactam. The conformations of the ACM molecule observed in the crystal structures differ mainly in the mutual orientation of chlorobenzene fragment and the neighboring methyl group, being anti (type I or syn (type II. ACM hydrate, ACM—NAM, ACM–NAM-hydrate and the piperazine salt of ACM exhibit the type I conformation, whereas ACM polymorphs and other cocrystals adopt the ACM type II conformation. Hydrogen-bond interactions in all the crystal structures were quantified by calculating their molecular electrostatic potential (MEP surfaces. Hirshfeld surface analysis of the cocrystal surfaces shows that about 50% of the contribution is due to a combination of strong and weak O...H, N...H, Cl...H and C...H interactions. The physicochemical properties of these cocrystals are under study.

  10. X-ray diffraction study of directionally grown perylene crystallites

    DEFF Research Database (Denmark)

    Breiby, Dag W.; Lemke, H. T.; Hammershøj, P.

    2008-01-01

    Using grazing incidence X-ray diffraction, perylene crystallites grown on thin highly oriented poly(tetrafluoroethylene) (PTFE) films on silicon substrates have been investigated. All the perylene crystallites are found to orient with the ab plane of the monoclinic unit cell parallel to the subst......Using grazing incidence X-ray diffraction, perylene crystallites grown on thin highly oriented poly(tetrafluoroethylene) (PTFE) films on silicon substrates have been investigated. All the perylene crystallites are found to orient with the ab plane of the monoclinic unit cell parallel...

  11. Quantitative biological imaging by ptychographic X-ray diffraction microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Giewekemeyer, Klaus; Kalbfleisch, Sebastian; Beerlink, Andre; Salditt, Tim [Institut fuer Roentgenphysik, Georg-August-Universitaet Goettingen (Germany); Thibault, Pierre; Dierolf, Martin; Pfeiffer, Franz [Department Physik (E17), Technische Universitaet Muenchen, Garching (Germany); Kewish, Cameron M. [Paul Scherrer Institut, Villigen PSI (Switzerland)

    2010-07-01

    Mesoscopic structures with specific functions are abundant in many cellular systems and have been well characterized by electron microscopy in the past. However, the quantitative study of the three-dimensional structure and density of subcellular components remains a difficult problem. In this contribution we show how these limitations could be overcome in the future by the application of recently introduced and now rapidly evolving coherent X-ray imaging techniques for quantitative biological imaging on the nanoscale. More specifically, we report on a recent scanning (ptychographic) diffraction experiment on unstained and unsliced freeze-dried cells of the bacterium Deinococcus radiourans using only a pinhole as beam defining optical element. As a result quantitative density projections well below optical resolution have been achieved.

  12. Innovative in Situ Ball Mill for X-ray Diffraction.

    Science.gov (United States)

    Ban, Voraksmy; Sadikin, Yolanda; Lange, Michael; Tumanov, Nikolay; Filinchuk, Yaroslav; Černý, Radovan; Casati, Nicola

    2017-12-19

    The renewed interest of mechanochemistry as an ecofriendly synthetic route has inspired original methodologies to probe reactions, with the aim to rationalize unknown mechanisms. Recently, Friščić et al. ( Nat. Chem. 2013 , 5 , 66 - 73 , DOI: 10.1038/nchem.1505 ) monitored the progress of milling reactions by synchrotron X-ray powder diffraction (XRPD). For the first time, it was possible to acquire directly information during a mechanochemical process. This new methodology is still in its early stages, and its development will definitively transform the fundamental understanding of mechanochemistry. A new type of in situ ball mill setup has been developed at the Materials Science beamline (Swiss Light Source, Paul Scherrer Institute, Switzerland). Its particular geometry, described here in detail, results in XRPD data displaying significantly lower background and much sharper Bragg peaks, which in turn allow more sophisticated analysis of mechanochemical processes, extending the limits of the technique.

  13. Fundamentals of powder x-ray diffraction practice

    International Nuclear Information System (INIS)

    Raftery, T.

    2002-01-01

    Full text: The goal of powder Xray diffraction is to gain information about a specimen or sample. Key aspects of this goal are 1. the sample selection, preparation and presentation; 2. the data collection process and conditions; 3. the interaction between these and the interpretation of the data. The 'ideal' powder (or polycrystalline) xray diffraction sample is fine grained, randomly orientated, homogenous and representative. There exists standard sample selection and preparation techniques for powders - sometimes however, the required information must be gained by alternate sample selection and preparation techniques. While there are few variables in the data collection process, there are some significant ones such as matching diffractometer resolution and intensity to the data collection goal whether that is phase identity, quantitative analysis or structure refinement, etc. There are also options of optical arrangement (Bragg-Brintano versus parallel beam versus Debye-Scherrer). One important aspect of the collection process is the assessment of the data quality. Powder xray diffraction has many applications from the straight-forward confirmation of phase identity and purity to structural analysis. Some of these applications will be considered and the interaction between the goal of the application and aspects of sample selection. Copyright (2002) Australian X-ray Analytical Association Inc

  14. Method for improve x-ray diffraction determinations of residual stress in nickel-base alloys

    Science.gov (United States)

    Berman, Robert M.; Cohen, Isadore

    1990-01-01

    A process for improving the technique of measuring residual stress by x-ray diffraction in pieces of nickel-base alloys which comprises covering part of a predetermined area of the surface of a nickel-base alloy with a dispersion, exposing the covered and uncovered portions of the surface of the alloy to x-rays by way of an x-ray diffractometry apparatus, making x-ray diffraction determinations of the exposed surface, and measuring the residual stress in the alloy based on these determinations. The dispersion is opaque to x-rays and serves a dual purpose since it masks off unsatisfactory signals such that only a small portion of the surface is measured, and it supplies an internal standard by providing diffractogram peaks comparable to the peaks of the nickel alloy so that the alloy peaks can be very accurately located regardless of any sources of error external to the sample.

  15. Method for improving x-ray diffraction determinations of residual stress in nickel-base alloys

    Science.gov (United States)

    Berman, R.M.; Cohen, I.

    1988-04-26

    A process for improving the technique of measuring residual stress by x-ray diffraction in pieces of nickel-base alloys is discussed. Part of a predetermined area of the surface of a nickel-base alloy is covered with a dispersion. This exposes the covered and uncovered portions of the surface of the alloy to x-rays by way of an x-ray diffractometry apparatus, making x-ray diffraction determinations of the exposed surface, and measuring the residual stress in the alloy based on these determinations. The dispersion is opaque to x-rays and serves a dual purpose, since it masks off unsatisfactory signals such that only a small portion of the surface is measured, and it supplies an internal standard by providing diffractogram peaks comparable to the peaks of the nickel alloy so that the alloy peaks can be very accurately located regardless of any sources of error external to the sample. 2 figs.

  16. X-ray and Neutron Diffraction in the Study of Organic Crystalline Hydrates

    Directory of Open Access Journals (Sweden)

    Katharina Fucke

    2010-07-01

    Full Text Available A review. Diffraction methods are a powerful tool to investigate the crystal structure of organic compounds in general and their hydrates in particular. The laboratory standard technique of single crystal X-ray diffraction gives information about the molecular conformation, packing and hydrogen bonding in the crystal structure, while powder X-ray diffraction on bulk material can trace hydration/dehydration processes and phase transitions under non-ambient conditions. Neutron diffraction is a valuable complementary technique to X-ray diffraction and gives highly accurate hydrogen atom positions due to the interaction of the radiation with the atomic nuclei. Although not yet often applied to organic hydrates, neutron single crystal and neutron powder diffraction give precise structural data on hydrogen bonding networks which will help explain why hydrates form in the first place.

  17. Neutron and x-ray diffraction studies of liquids and glasses

    International Nuclear Information System (INIS)

    Fischer, Henry E; Barnes, Adrian C; Salmon, Philip S

    2006-01-01

    The techniques of neutron diffraction and x-ray diffraction, as applied to structural studies of liquids and glasses, are reviewed. Emphasis is placed on the explanation and discussion of the experimental techniques and data analysis methods, as illustrated by the results of representative experiments. The disordered, isotropic nature of the structure of liquids and glasses leads to special considerations and certain difficulties when neutron and x-ray diffraction techniques are applied, especially when used in combination on the same system. Recent progress in experimental technique, as well as in data analysis and computer simulation, has motivated the writing of this review

  18. Use of the X-Ray diffraction technique in the assessment of air quality at Presidente Antônio Carlos Avenue, Belo Horizonte

    International Nuclear Information System (INIS)

    Cesar, Raisa Helena Sant’Ana; Barreto, Alberto Avelar; Cruz, Ananda Borjaille; Barbosa, João Batista Santos; Silva, Igor Felipe Moura

    2017-01-01

    Belo Horizonte is the sixth most populous city in Brazil, has the third largest fleet of vehicles and it is close to large mineralogical reserves, such the Quadrilátero Ferrífero. These factors, coupled with the industrial growth and civil construction, raise questions about society regarding ambient air quality. A historically problematic contaminant is the particulate matter (PM), a mixture of solid and liquid particles in suspension that generate environmental damage and human health. These particles can cause from a simple infection to death, being their dimension a fundamental factor to evaluate the impact caused. In this context, this research investigated the air quality due to PM10 (particles less than 10 microns) in a high traffic flow of Minas Gerais capital, Presidente Antônio Carlos Avenue. This avenue is one of the main accesses to the region of Pampulha, an area of great tourist and sporting relevance of the city and has undergone works of duplication and implementation of exclusive lanes for public transport buses due to the realization of the 2014 World Cup. Involved monitoring in the avenue in the year 2014 in order to collect the PM10 present in the ambient air. The characterization of PM10 occurred with the use of the X-ray diffraction technique, one of the main tools of mineralogical characterization, due to its simplicity, speed and reliability of the obtained results. The minerals detected by the analysis were evaluated for their possible origin, generating information for the evaluation of PM10 emitting sources that are fundamental for the management of air quality in the city. (author)

  19. Use of the X-Ray diffraction technique in the assessment of air quality at Presidente Antônio Carlos Avenue, Belo Horizonte

    Energy Technology Data Exchange (ETDEWEB)

    Cesar, Raisa Helena Sant’Ana; Barreto, Alberto Avelar; Cruz, Ananda Borjaille; Barbosa, João Batista Santos, E-mail: raisa.cesar@cdtn.br, E-mail: aab@cdtn.br, E-mail: abc@cdtn.br, E-mail: jbsb@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte/MG (Brazil); Silva, Igor Felipe Moura, E-mail: igorfelipedx@ufmg.br [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Departamento de Energia Nuclear

    2017-07-01

    Belo Horizonte is the sixth most populous city in Brazil, has the third largest fleet of vehicles and it is close to large mineralogical reserves, such the Quadrilátero Ferrífero. These factors, coupled with the industrial growth and civil construction, raise questions about society regarding ambient air quality. A historically problematic contaminant is the particulate matter (PM), a mixture of solid and liquid particles in suspension that generate environmental damage and human health. These particles can cause from a simple infection to death, being their dimension a fundamental factor to evaluate the impact caused. In this context, this research investigated the air quality due to PM10 (particles less than 10 microns) in a high traffic flow of Minas Gerais capital, Presidente Antônio Carlos Avenue. This avenue is one of the main accesses to the region of Pampulha, an area of great tourist and sporting relevance of the city and has undergone works of duplication and implementation of exclusive lanes for public transport buses due to the realization of the 2014 World Cup. Involved monitoring in the avenue in the year 2014 in order to collect the PM10 present in the ambient air. The characterization of PM10 occurred with the use of the X-ray diffraction technique, one of the main tools of mineralogical characterization, due to its simplicity, speed and reliability of the obtained results. The minerals detected by the analysis were evaluated for their possible origin, generating information for the evaluation of PM10 emitting sources that are fundamental for the management of air quality in the city. (author)

  20. X-Ray diffraction Investigation of Electrochemically Deposited Copper

    DEFF Research Database (Denmark)

    Pantleon, Karen; Jensen, Jens Dahl; Somers, Marcel A.J.

    2004-01-01

    by the determination of X-ray diffraction (XRD) pole figures and the calculation of the orientation distribution functions. XRD results are discussed in relation to the morphologies of the electrodeposits as investigated with light optical microscopy and correlated with the process parameters during electrodeposition....

  1. Fusion bonding of Si wafers investigated by x ray diffraction

    DEFF Research Database (Denmark)

    Weichel, Steen; Grey, Francois; Rasmussen, Kurt

    2000-01-01

    The interface structure of bonded Si(001) wafers with twist angle 6.5 degrees is studied as a function of annealing temperature. An ordered structure is observed in x-ray diffraction by monitoring a satellite reflection due to the periodic modulation near the interface, which results from...

  2. Diffractive-refractive optics: X-ray collimator

    Czech Academy of Sciences Publication Activity Database

    Hrdý, Jaromír; Oberta, Peter

    2008-01-01

    Roč. 79, č. 7 (2008), 073105/1-073105/4 ISSN 0034-6748 R&D Projects: GA AV ČR IAA100100716 Institutional research plan: CEZ:AV0Z10100522 Keywords : x-ray collimator * diffractive-refractive optics Subject RIV: BH - Optics , Masers, Lasers Impact factor: 1.738, year: 2008

  3. X-ray diffraction of iron containing samples

    NARCIS (Netherlands)

    Mos, Yvonne M.; Vermeulen, Arnold C.; Buisman, Cees J.N.; Weijma, Jan

    2017-01-01

    X-ray diffraction (XRD) is a commonly used technology to identify crystalline phases. However, care must be taken with the combination of XRD configuration and sample. Copper (most commonly used radiation source) is a poor match with iron containing materials due to induced fluorescence. Magnetite

  4. X-Ray Diffraction of Iron Containing Samples

    NARCIS (Netherlands)

    Mos, Yvonne M.; Vermeulen, Arnold C.; Buisman, Cees J.N.; Weijma, Jan

    2018-01-01

    In X-ray diffraction, a good combination of configuration and sample is essential. Copper radiation for iron containing materials leads to a high background. Although this has been recognized, many researchers still use this combination. To clearly show the unsuitability of copper radiation for iron

  5. Differential scanning calorimetric and powder X-ray diffraction ...

    Indian Academy of Sciences (India)

    The thermotropic phase transitions and supramolecular structure of NAAEs were investigated by differential scanning calorimetry (DSC) and powder X-ray diffraction (PXRD). Results obtained from DSC studies indicate that the transition temperatures (t), enthalpies ( t) and entropies ( t) exhibit odd-even alternation ...

  6. Ultra-small angle X-ray diffraction from muscle

    Energy Technology Data Exchange (ETDEWEB)

    Nave, C.; Diakun, G.P.; Bordas, J.

    1986-05-15

    An ultra-small angle X-ray scattering instrument is described. It uses two channel cut crystals, one to monochromatise and collimate the beam and the other to analyse the scattered radiation. It has been used to collect diffraction data from muscle, in which the physiological unit cell, the sarcomere, has a repeat of 2000 nm or more.

  7. Ab initio structure determination via powder X-ray diffraction

    Indian Academy of Sciences (India)

    Unknown

    Powder data is especially useful to deduce accurate cell parameters. Rietveld's refinement procedure1,2 has revolutionized the application of powder X-ray diffraction by resulting in a large number of structures being refined in the last decade. If a suitable starting model is available, it has become routine to refine structures ...

  8. Simulating X-ray diffraction of textured films

    DEFF Research Database (Denmark)

    Breiby, Dag W.; Bunk, Oliver; Andreasen, Jens Wenzel

    2008-01-01

    Computationally efficient simulations of grazing-incidence X-ray diffraction (GIXD) are discussed, with particular attention given to textured thin polycrystalline films on supporting substrates. A computer program has been developed for simulating scattering from thin films exhibiting varying...... from the totally substrate-reflected beam ( two-beam approximation) and refraction effects are also included in the program, together with the geometrical intensity corrections associated with GIXD measurements. To achieve 'user friendliness' for scientists less familiar with diffraction...

  9. Microbeam high-resolution diffraction and x-ray standing wave methods applied to semiconductor structures

    International Nuclear Information System (INIS)

    Kazimirov, A; Bilderback, D H; Huang, R; Sirenko, A; Ougazzaden, A

    2004-01-01

    A new approach to conditioning x-ray microbeams for high angular resolution x-ray diffraction and scattering techniques is introduced. We combined focusing optics (one-bounce imaging capillary) and post-focusing collimating optics (miniature Si(004) channel-cut crystal) to generate an x-ray microbeam with a size of 10 μm and ultimate angular resolution of 14 μrad. The microbeam was used to analyse the strain in sub-micron thick InGaAsP epitaxial layers grown on an InP(100) substrate by the selective area growth technique in narrow openings between the oxide stripes. For the structures for which the diffraction peaks from the substrate and the film overlap, the x-ray standing wave technique was applied for precise measurements of the strain with a Δd/d resolution of better than 10 -4 . (rapid communication)

  10. Diffraction enhanced X-ray imaging of mammals crystalline lens

    Energy Technology Data Exchange (ETDEWEB)

    Antunes, A. [Departamento de Fisica Aplicada, USP, CP 66318, 05315-970 Sao Paulo, SP (Brazil)]. E-mail: antunes@if.usp.br; Hoennicke, M.G. [LORXI, Departamento de Fisica, Universidade Federal do Parana, Curitiba (Brazil); Safatle, A.M.V. [Faculdade de Medicina Veterinaria e Zootecnia, USP, 05508-900 Sao Paulo, SP (Brazil); Cusatis, C. [LORXI, Departamento de Fisica, Universidade Federal do Parana, Curitiba (Brazil); Moraes Barros, P.S. [Faculdade de Medicina Veterinaria e Zootecnia, USP, 05508-900 Sao Paulo, SP (Brazil); Morelhao, S.L. [Departamento de Fisica Aplicada, USP, CP 66318, 05315-970 Sao Paulo, SP (Brazil)

    2005-08-15

    Crystalline lenses are transparent biological materials where the organization of the lens fibers can also be affected by changes at molecular level, and therefore the structure and morphology of the tissue can be correlated to the loss of transparency of the lens. In this work, internal structure of mammal lenses regarding the long-range ordering of the fibers are investigated by diffraction enhanced X-ray imaging (DEI) radiography. Moreover, DEI and absorption X-ray synchrotron radiographs for healthy and cataractous crystalline lenses are compared. Significant differences in healthy and cataractous crystalline lenses are observed.

  11. Diffraction enhanced X-ray imaging of mammals crystalline lens

    International Nuclear Information System (INIS)

    Antunes, A.; Hoennicke, M.G.; Safatle, A.M.V.; Cusatis, C.; Moraes Barros, P.S.; Morelhao, S.L.

    2005-01-01

    Crystalline lenses are transparent biological materials where the organization of the lens fibers can also be affected by changes at molecular level, and therefore the structure and morphology of the tissue can be correlated to the loss of transparency of the lens. In this work, internal structure of mammal lenses regarding the long-range ordering of the fibers are investigated by diffraction enhanced X-ray imaging (DEI) radiography. Moreover, DEI and absorption X-ray synchrotron radiographs for healthy and cataractous crystalline lenses are compared. Significant differences in healthy and cataractous crystalline lenses are observed

  12. Raman spectroscopy and X-ray diffraction studies on celestite

    International Nuclear Information System (INIS)

    Chen Yenhua; Yu Shucheng; Huang, Eugene; Lee, P.-L.

    2010-01-01

    High-pressure Raman spectroscopy and X-ray diffraction studies of celestite (SrSO 4 ) were carried out in a diamond anvil cell at room temperature. Variation in the Raman vibrational frequency and change of lattice parameters with pressure indicate that a transformation occurs in celestite. This transformation caused an adjustment in the Sr-O polyhedra that affected the stretching-force constant of SO 4 . Moreover, compressibilities along the crystallographic axes decreased in the order a to c to b. From the compression data, the bulk modulus of the celestite was 87 GPa. Both X-ray and Raman data show that the transition in celestite is reversible.

  13. MSL Chemistry and Mineralogy X-Ray Diffraction X-Ray Fluorescence (CheMin) Instrument

    Science.gov (United States)

    Zimmerman, Wayne; Blake, Dave; Harris, William; Morookian, John Michael; Randall, Dave; Reder, Leonard J.; Sarrazin, Phillipe

    2013-01-01

    This paper provides an overview of the Mars Science Laboratory (MSL) Chemistry and Mineralogy Xray Diffraction (XRD), X-ray Fluorescence (XRF) (CheMin) Instrument, an element of the landed Curiosity rover payload, which landed on Mars in August of 2012. The scientific goal of the MSL mission is to explore and quantitatively assess regions in Gale Crater as a potential habitat for life - past or present. The CheMin instrument will receive Martian rock and soil samples from the MSL Sample Acquisition/Sample Processing and Handling (SA/SPaH) system, and process it utilizing X-Ray spectroscopy methods to determine mineral composition. The Chemin instrument will analyze Martian soil and rocks to enable scientists to investigate geophysical processes occurring on Mars. The CheMin science objectives and proposed surface operations are described along with the CheMin hardware with an emphasis on the system engineering challenges associated with developing such a complex instrument.

  14. Determination of organic crystal structures by X ray powder diffraction

    CERN Document Server

    McBride, L

    2000-01-01

    The crystal structure of Ibuprofen has been solved from synchrotron X-ray powder diffraction data using a genetic algorithm (GA). The performance of the GA is improved by incorporating prior chemical information in the form of hard limits on the values that can be taken by the flexible torsion angles within the molecule. Powder X-ray diffraction data were collected for the anti-convulsant compounds remacemide, remacemide nitrate and remacemide acetate at 130 K on BM 16 at the X-ray European Synchrotron Radiation Facility (ESRF) at Grenoble. High quality crystal structures were obtained using data collected to a resolution of typically 1.5 A. The structure determinations were performed using a simulated annealing (SA) method and constrained Rietveld refinements for the structures converged to chi sup 2 values of 1.64, 1.84 and 1.76 for the free base, nitrate and acetate respectively. The previously unknown crystal structure of the drug famotidine Form B has been solved using X-ray powder diffraction data colle...

  15. X-ray spectrometry and X-ray microtomography techniques for soil and geological samples analysis

    Energy Technology Data Exchange (ETDEWEB)

    Kubala-Kukuś, A.; Banaś, D.; Braziewicz, J. [Institute of Physics, Jan Kochanowski University, ul. Świetokrzyska 15, 25-406 Kielce (Poland); Holycross Cancer Center, ul. Artwińskiego 3, 25-734 Kielce (Poland); Dziadowicz, M.; Kopeć, E. [Institute of Physics, Jan Kochanowski University, ul. Świetokrzyska 15, 25-406 Kielce (Poland); Majewska, U. [Institute of Physics, Jan Kochanowski University, ul. Świetokrzyska 15, 25-406 Kielce (Poland); Holycross Cancer Center, ul. Artwińskiego 3, 25-734 Kielce (Poland); Mazurek, M.; Pajek, M.; Sobisz, M.; Stabrawa, I. [Institute of Physics, Jan Kochanowski University, ul. Świetokrzyska 15, 25-406 Kielce (Poland); Wudarczyk-Moćko, J. [Holycross Cancer Center, ul. Artwińskiego 3, 25-734 Kielce (Poland); Góźdź, S. [Holycross Cancer Center, ul. Artwińskiego 3, 25-734 Kielce (Poland); Institute of Public Health, Jan Kochanowski University, IX Wieków Kielc 19, 25-317 Kielce (Poland)

    2015-12-01

    A particular subject of X-ray fluorescence analysis is its application in studies of the multielemental sample of composition in a wide range of concentrations, samples with different matrices, also inhomogeneous ones and those characterized with different grain size. Typical examples of these kinds of samples are soil or geological samples for which XRF elemental analysis may be difficult due to XRF disturbing effects. In this paper the WDXRF technique was applied in elemental analysis concerning different soil and geological samples (therapeutic mud, floral soil, brown soil, sandy soil, calcium aluminum cement). The sample morphology was analyzed using X-ray microtomography technique. The paper discusses the differences between the composition of samples, the influence of procedures with respect to the preparation of samples as regards their morphology and, finally, a quantitative analysis. The results of the studies were statistically tested (one-way ANOVA and correlation coefficients). For lead concentration determination in samples of sandy soil and cement-like matrix, the WDXRF spectrometer calibration was performed. The elemental analysis of the samples was complemented with knowledge of chemical composition obtained by X-ray powder diffraction.

  16. Instrument and method for X-ray diffraction, fluorescence, and crystal texture analysis without sample preparation

    Science.gov (United States)

    Gendreau, Keith (Inventor); Martins, Jose Vanderlei (Inventor); Arzoumanian, Zaven (Inventor)

    2010-01-01

    An X-ray diffraction and X-ray fluorescence instrument for analyzing samples having no sample preparation includes a X-ray source configured to output a collimated X-ray beam comprising a continuum spectrum of X-rays to a predetermined coordinate and a photon-counting X-ray imaging spectrometer disposed to receive X-rays output from an unprepared sample disposed at the predetermined coordinate upon exposure of the unprepared sample to the collimated X-ray beam. The X-ray source and the photon-counting X-ray imaging spectrometer are arranged in a reflection geometry relative to the predetermined coordinate.

  17. Characterization of Gas-Solid Reactions using In Situ Powder X-ray Diffraction

    DEFF Research Database (Denmark)

    Møller, Kasper Trans; Hansen, Bjarne Rosenlund Søndertoft; Dippel, Ann-Christin

    2014-01-01

    X-ray diffraction is a superior technique for structural characterization of crystalline matter. Here we review the use of in situ powder X-ray diffraction (PXD) mainly for real-time studies of solid/gas reactions, data analysis and the extraction of valuable knowledge of structural, chemical...... by diffraction techniques, e.g. crystallite size. The aim of this review is to provide new inspiration for utilization of in situ PXD for characterization of a wide range of properties beyond the scope of crystal structure solution....

  18. Single-pulse x-ray diffraction using polycapillary optics for in situ dynamic diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Maddox, B. R., E-mail: maddox3@llnl.gov; Akin, M. C., E-mail: akin1@llnl.gov; Teruya, A.; Hunt, D.; Hahn, D.; Cradick, J. [Lawrence Livermore National Laboratory, Livermore, California 94550 (United States); Morgan, D. V. [National Security Technologies LLC, Los Alamos, New Mexico 87544 (United States)

    2016-08-15

    Diagnostic use of single-pulse x-ray diffraction (XRD) at pulsed power facilities can be challenging due to factors such as the high flux and brightness requirements for diffraction and the geometric constraints of experimental platforms. By necessity, the x-ray source is usually positioned very close, within a few inches of the sample. On dynamic compression platforms, this puts the x-ray source in the debris field. We coupled x-ray polycapillary optics to a single-shot needle-and-washer x-ray diode source using a laser-based alignment scheme to obtain high-quality x-ray diffraction using a single 16 ns x-ray pulse with the source >1 m from the sample. The system was tested on a Mo sample in reflection geometry using 17 keV x-rays from a Mo anode. We also identified an anode conditioning effect that increased the x-ray intensity by 180%. Quantitative measurements of the x-ray focal spot produced by the polycapillary yielded a total x-ray flux on the sample of 3.3 ± 0.5 × 10{sup 7} molybdenum Kα photons.

  19. Multiple x-ray diffraction simulation and applications

    International Nuclear Information System (INIS)

    Costa, C.A.B.S. da.

    1989-09-01

    A computer program (MULTX) was implemented for simulation X-ray multiple diffraction diagrams in Renninger geometries. The program uses the X-ray multiple diffraction theory for imperfect crystals. The iterative calculation of the intensities is based on the Taylor series general term, and the primary beam power expansion is given as function of the beam x penetration in the crystal surface. This development allows to consider the simultaneous interaction of the beams involved in the multiple diffraction phenomenon. The simulated diagrams are calculated point-to-point and the tests for the Si and GaAs presented good reproduction of the experimental diagrams for different primary reflections. (L.C.J.A.)

  20. Extinction correction in white X-ray and neutron diffraction

    International Nuclear Information System (INIS)

    Tomiyoshi, S.; Yamada, M.; Watanabe, H.

    1980-01-01

    Extinction effects in white-beam X-ray and neutron diffraction are considered. In white-beam diffraction, a small deviation of the wavelength from the Bragg condition Δlambda is a variable which represents the line profile of the diffraction peaks, so that by using the new parameter Δlambda the theory is converted to one in white-beam diffraction. It is shown that for a convex crystal, primary extinction agrees with the results calculated already for monochromatic diffraction. The same relation is shown to hold in secondary extinction. It is concluded that extinction theory derived for monochromatic diffraction is applicable without any modification in white-beam diffraction. (Auth.)

  1. IL 12: Femtosecond x-ray powder diffraction

    International Nuclear Information System (INIS)

    Woerner, M.; Zamponi, F.; Rothhardt, P.; Ansari, Z.; Dreyer, J.; Freyer, B.; Premont-Schwarz, M.; Elsaesser, T.

    2010-01-01

    A chemical reaction generates new compounds out of one or more initial species. On a molecular level, the spatial arrangement of electrons and nuclei changes. While the structure of the initial and the product molecules can be measured routinely, the transient structures and molecular motions during a reaction have remained unknown in most cases. This knowledge, however, is a key element for the exact understanding of the reaction. The ultimate dream is a 'reaction microscope' which allows for an in situ imaging of the molecules during a reaction. We report on the first femtosecond x-ray powder diffraction experiment in which we directly map the transient electronic charge density in the unit cell of a crystalline solid with 30 pico-meter spatial and 100 femtosecond temporal resolution. X-ray diffraction from polycrystalline powder samples, the Debye Scherrer diffraction technique, is a standard method for determining equilibrium structures. The intensity of the Debye Scherrer rings is determined by the respective x-ray structure factor which represents the Fourier transform of the spatial electron density. In our experiments, the transient intensity and angular positions of up to 20 Debye Scherrer reactions from a polycrystalline powder are measured and unravel for the first time a concerted electron and proton transfer in hydrogen-bonded ionic (NH 4 ) 2 SO 4 crystals. Photoexcitation of ammonium sulfate induces a sub-100 fs electron transfer from the sulfate groups into a highly conned electron channel along the z-axis of the unit cell. The latter geometry is stabilized by transferring protons from the adjacent ammonium groups into the channel. Time-dependent charge density maps derived from the diffraction data display a periodic modulation of the channels charge density by low-frequency lattice motions with a concerted electron and proton motion between the channel and the initial proton binding site. A deeper insight into the underlying microscopic

  2. Diffraction anomalous fine structure using X-ray anomalous dispersion

    International Nuclear Information System (INIS)

    Soejima, Yuji; Kuwajima, Shuichiro

    1998-01-01

    A use of X-ray anomalous dispersion effects for structure investigation has recently been developed by using synchrotron radiation. One of the interesting method is the observation of anomalous fine structure which arise on diffraction intensity in energy region of incident X-ray at and higher than absorption edge. The phenomenon is so called Diffraction Anomalous Fine Structure (DAFS). DAFS originates in the same physical process an that of EXAFS: namely photoelectric effect at the corresponding atom and the interaction of photoelectron waves between the atom and neighboring atoms. In contrast with EXAFS, the method is available for only the crystalline materials, but shows effective advantages of the structure investigations by a use of diffraction: one is the site selectivity and the other is space selectivity. In the present study, demonstrations of a use of X-ray anomalous dispersion effect for the superstructure determination will be given for the case of PbZrO 3 , then recent trial investigations of DAFS in particular on the superlattice reflections will be introduced. In addition, we discuss about Forbidden Reflection near Edge Diffraction (FRED) which is more recently investigated as a new method of the structure analysis. (author)

  3. Focal construct geometry for high intensity energy dispersive x-ray diffraction based on x-ray capillary optics

    Energy Technology Data Exchange (ETDEWEB)

    Li, Fangzuo; Liu, Zhiguo; Sun, Tianxi, E-mail: stx@bnu.edu.cn; Jiang, Bowen; Zhu, Yu [The Key Laboratory of Beam Technology and Materials Modification of the Ministry of Education, Beijing Normal University, Beijing 100875 (China); College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China)

    2016-03-14

    We presented a focal construct geometry (FCG) method for high intensity energy dispersive X-ray diffraction by utilizing a home-made ellipsoidal single-bounce capillary (ESBC) and a polycapillary parallel X-ray lens (PPXRL). The ESBC was employed to focus the X-rays from a conventional laboratory source into a small focal spot and to produce an annular X-ray beam in the far-field. Additionally, diffracted polychromatic X-rays were confocally collected by the PPXRL attached to a stationary energy-resolved detector. Our FCG method based on ESBC and PPXRL had achieved relatively high intensity diffraction peaks and effectively narrowed the diffraction peak width which was helpful in improving the potential d-spacing resolution for material phase analysis.

  4. JMFA2—a graphically interactive Java program that fits microfibril angle X-ray diffraction data

    Science.gov (United States)

    Steve P. Verrill; David E. Kretschmann; Victoria L. Herian

    2006-01-01

    X-ray diffraction techniques have the potential to decrease the time required to determine microfibril angles dramatically. In this paper, we discuss the latest version of a curve-fitting toll that permits us to reduce the time required to evaluate MFA X-ray diffraction patterns. Further, because this tool reflects the underlying physics more accurately than existing...

  5. Mechanical characterisation of surface layers by x-ray diffraction -application to tribology

    International Nuclear Information System (INIS)

    Farrahi, G.H.

    1996-01-01

    The results presented in this paper show that X-ray diffraction can be employed for the characterisation of surface layer damage through residual stresses and work hardening by some tribological actions such as fretting and dry sliding. X-ray diffraction technique can also be employed for a rapid and non-destructive measurement of hardness of hardened steel. The diffraction profile analysis can offer a good indication about the materials characteristics and the microstructural evolution caused by heat treatment or by mechanical loading

  6. Synchrotron X-ray and neutron diffraction studies in solid-state chemistry

    International Nuclear Information System (INIS)

    Cheetham, A.K.; Wilkinson, A.P.

    1992-01-01

    Since the scatterers are different - X-rays are scattered by the electrons of an atom, neutrons by the nuclei - the questions addressed by the two diffraction experiments have been complementary. For example, neighboring elements of the periodic table could be distinguished formerly only by neutron diffraction. Now, however, this is also partly possible with high-energy synchrotron radiation. This review describes recent applications of X-ray and neutron diffraction methods in solid-state chemistry and how the maximal information can be extracted by a combination of techniques. (orig.)

  7. On the authenticity of eight Reales 1730 Mexican silver coins by X-ray diffraction and by energy dispersion spectroscopy techniques

    International Nuclear Information System (INIS)

    Rojas-Rodriguez, I.; Herrera, A.; Vazquez-Lopez, C.; Apolo, R.; Gonzalez-Hernandez, J.; Hernandez-Landaverde, M.A.; Rodriguez, M.E.

    2004-01-01

    Ancient silver Mexican coins made during the years 1730-1734, were analyzed non-destructively by energy dispersive spectroscopy (EDS), X-ray diffraction (XRD), and by optical microscopy. Nine coins of denomination eight Reales were studied. These coins belong to the numismatic private collection in Mexico. Six elements (copper, aluminum, magnesium, silicon, chromium and silver) were determined quantitatively. The coins reveal a uniform Ag concentration. Some of the items are covered with patina. A strong positive correlation between Al and Cu content and also a strong negative correlation between S and Ag were determined. The weight of the coins varied between 26.1344 and 26.9913 g, which is a good indicator of the authenticity of the items. The purpose of this work is to investigate by precise means if some of the coins were falsified or if really all of them are authentic

  8. Imaging nanoscale lattice variations by machine learning of x-ray diffraction microscopy data

    Science.gov (United States)

    Laanait, Nouamane; Zhang, Zhan; Schlepütz, Christian M.

    2016-09-01

    We present a novel methodology based on machine learning to extract lattice variations in crystalline materials, at the nanoscale, from an x-ray Bragg diffraction-based imaging technique. By employing a full-field microscopy setup, we capture real space images of materials, with imaging contrast determined solely by the x-ray diffracted signal. The data sets that emanate from this imaging technique are a hybrid of real space information (image spatial support) and reciprocal lattice space information (image contrast), and are intrinsically multidimensional (5D). By a judicious application of established unsupervised machine learning techniques and multivariate analysis to this multidimensional data cube, we show how to extract features that can be ascribed physical interpretations in terms of common structural distortions, such as lattice tilts and dislocation arrays. We demonstrate this ‘big data’ approach to x-ray diffraction microscopy by identifying structural defects present in an epitaxial ferroelectric thin-film of lead zirconate titanate.

  9. High Pressure X-ray Diffraction Studies on Barium.

    Science.gov (United States)

    Barnett, J D; Bennion, R B; Hall, H T

    1963-08-09

    Simultaneous x-ray diffraction and electrical resistance measurements on barium establish, with certainty, that Bridgman's 78-kb resistance transition is identical with his 59-kb volumetransition. During this transition, the bodycentered cubic structure changes to hexagonalclose packed. Lattice parameters for the latter structure at 62 kb (volume scale) are: a = 3.90 A, c = 6.15 A, and c/a = 1.58. Compression (AV/Vo) at 62 kb is 0.359 + 0.005 compared to 0.345 previously reported by Bridgman. Below the transition, at 49 kb, compression is 0.300 +/- 0.005 compared to Bridgman's 0.288. Bridgman's 17-kb volume transition was not detected by x-ray diffraction.

  10. Diffractive-refractive optics: X-ray splitter

    Czech Academy of Sciences Publication Activity Database

    Hrdý, Jaromír

    2010-01-01

    Roč. 17, č. 1 (2010), s. 129-131 ISSN 0909-0495 R&D Projects: GA MPO FR-TI1/412; GA AV ČR IAA100100716 Institutional research plan: CEZ:AV0Z10100522 Keywords : x-ray splitter * diffractive-refractive optics Subject RIV: BH - Optics, Masers, Lasers Impact factor: 2.335, year: 2010

  11. X-Ray Diffraction of Iron Containing Samples

    OpenAIRE

    Mos, Yvonne M.; Vermeulen, Arnold C.; Buisman, Cees J.N.; Weijma, Jan

    2018-01-01

    In X-ray diffraction, a good combination of configuration and sample is essential. Copper radiation for iron containing materials leads to a high background. Although this has been recognized, many researchers still use this combination. To clearly show the unsuitability of copper radiation for iron oxides, magnetite, goethite, maghemite, and hematite were analysed in different configurations using copper or cobalt radiation. Results show effects of fluorescence repressing measures and differ...

  12. In situ x-ray diffraction and in situ x-ray absorption spectroscopy for investigation of intercalation batteries

    International Nuclear Information System (INIS)

    Levy-Clement, C.; Mondoloni, C.; Godart, C.; Cortes, R.

    1991-01-01

    This paper presents applications of in situ X-ray diffraction and absorption techniques to the study of H + /MnO 2 alkaline batteries. The two complementary in situ techniques are described. Investigation of the electrochemical insertion and deinsertion of H + has been made through its influence on the evolution of the crystallographic structure of γ-MnO 2 , while investigation of the transfer of e - has been undertaken through the variation of the oxidation state of the manganese during the discharging and charging process of a battery. New insights in the understanding of the mechanisms of proton insertion and charge transfer into γ-MnO 2 are discussed

  13. Materials identification using a small-scale pixellated x-ray diffraction system

    Science.gov (United States)

    O'Flynn, D.; Crews, C.; Drakos, I.; Christodoulou, C.; Wilson, M. D.; Veale, M. C.; Seller, P.; Speller, R. D.

    2016-05-01

    A transmission x-ray diffraction system has been developed using a pixellated, energy-resolving detector (HEXITEC) and a small-scale, mains operated x-ray source (Amptek Mini-X). HEXITEC enables diffraction to be measured without the requirement of incident spectrum filtration, or collimation of the scatter from the sample, preserving a large proportion of the useful signal compared with other diffraction techniques. Due to this efficiency, sufficient molecular information for material identification can be obtained within 5 s despite the relatively low x-ray source power. Diffraction data are presented from caffeine, hexamine, paracetamol, plastic explosives and narcotics. The capability to determine molecular information from aspirin tablets inside their packaging is demonstrated. Material selectivity and the potential for a sample classification model is shown with principal component analysis, through which each different material can be clearly resolved.

  14. New structural studies of liquid crystal by reflectivity and resonant X-ray diffraction

    International Nuclear Information System (INIS)

    Fernandes, P.

    2007-04-01

    This memory presents three structural studies of smectic Liquid Crystals by reflectivity and resonant diffraction of X-rays. It is divided in five chapters. In the first a short introduction to Liquid Crystals is given. In particular, the smectic phases that are the object of this study are presented. The second chapter is consecrated to the X-ray experimental techniques that were used in this work. The three last chapters present the works on which this thesis can be divided. Chapter three demonstrates on free-standing films of MHPOBC (historic liquid crystal that possesses the antiferroelectric sub-phases) the possibility to extend the technique of resonant X-ray diffraction to liquid crystals without resonant element. In the fourth chapter the structure of the B 2 liquid crystal phase of bent-core molecules (or banana molecules) is elucidated by using resonant X-ray diffraction combined with polarization analysis of the diffracted beam. A model of the polarization of the resonant beam diffracted by four different structures proposed for the B 2 phase is developed in this chapter. In the fifth chapter a smectic binary mixture presenting a very original critical point of phase separation is studied by X-ray reflectivity and optical microscopy. A concentration gradient in the direction perpendicular to the plane of the film seems to be induced by the free-standing film geometry. The results of a simplified model of the system are compatible with this interpretation

  15. The structure of liquid semiconductors, superionic conductors and glasses by neutron scattering, X-ray diffraction and extended X-ray absorption fine structure

    International Nuclear Information System (INIS)

    Buchanan, P.

    2001-09-01

    A study of the applicability of modern X-ray and neutron scattering techniques to the study of the structure of liquid semiconductors and glasses has been made. The results demonstrate how neutron scattering with isotopic substitution (NDIS), anomalous X-ray scattering and Extended X-ray Absorption Fine Structure (EXAFS) can be successfully used to elucidate the structure of materials that cannot be studied by NDIS alone. The local coordination structure of Ag 2 Se in its room temperature, superionic and liquid phases has been determined using the EXAFS technique. This EXAFS data have been combined with previously available neutron diffraction data to provide a refinement of the structure obtained through neutron diffraction alone. The structure of GeO 2 has been determined to the full partial structure factor level using a combination of anomalous X-ray scattering and neutron diffraction measurements. The data are in good agreement with previously obtained results. The partial structure factors of P 40 Se 60 and P 50 Se 50 have been determined to the first order difference level using the anomalous X-ray diffraction technique. The structure of liquid Ga 2 Te 3 has been determined to the partial structure factor level using combined neutron diffraction with isotopic substitution (NDIS) and anomalous X-ray diffraction. The structure of liquid FeSe 2 has been determined to the first order difference level using the NDIS technique alone. The structure of liquid FeTe 2 was determined at the total structure factor level using neutron diffraction in order to estimate the effect of chalcogenide ion size on the structure. The results demonstrate the feasibility of the additional structural determination techniques for disordered materials made possible through the development of third generation X-ray synchrotron sources. (author)

  16. Data processing software suite SITENNO for coherent X-ray diffraction imaging using the X-ray free-electron laser SACLA

    Energy Technology Data Exchange (ETDEWEB)

    Sekiguchi, Yuki; Oroguchi, Tomotaka; Takayama, Yuki; Nakasako, Masayoshi, E-mail: nakasako@phys.keio.ac.jp [Keio University, 3-14-1 Hiyoshi, Kohoku-ku, Yokohama 223-8522 (Japan); RIKEN SPring-8 Center, 1-1-1 Kohto, Sayo, Sayo-gun, Hyogo 679-5148 (Japan)

    2014-03-15

    The software suite SITENNO is developed for processing diffraction data collected in coherent X-ray diffraction imaging experiments of non-crystalline particles using an X-ray free-electron laser. Coherent X-ray diffraction imaging is a promising technique for visualizing the structures of non-crystalline particles with dimensions of micrometers to sub-micrometers. Recently, X-ray free-electron laser sources have enabled efficient experiments in the ‘diffraction before destruction’ scheme. Diffraction experiments have been conducted at SPring-8 Angstrom Compact free-electron LAser (SACLA) using the custom-made diffraction apparatus KOTOBUKI-1 and two multiport CCD detectors. In the experiments, ten thousands of single-shot diffraction patterns can be collected within several hours. Then, diffraction patterns with significant levels of intensity suitable for structural analysis must be found, direct-beam positions in diffraction patterns determined, diffraction patterns from the two CCD detectors merged, and phase-retrieval calculations for structural analyses performed. A software suite named SITENNO has been developed to semi-automatically apply the four-step processing to a huge number of diffraction data. Here, details of the algorithm used in the suite are described and the performance for approximately 9000 diffraction patterns collected from cuboid-shaped copper oxide particles reported. Using the SITENNO suite, it is possible to conduct experiments with data processing immediately after the data collection, and to characterize the size distribution and internal structures of the non-crystalline particles.

  17. Data processing software suite SITENNO for coherent X-ray diffraction imaging using the X-ray free-electron laser SACLA

    International Nuclear Information System (INIS)

    Sekiguchi, Yuki; Oroguchi, Tomotaka; Takayama, Yuki; Nakasako, Masayoshi

    2014-01-01

    The software suite SITENNO is developed for processing diffraction data collected in coherent X-ray diffraction imaging experiments of non-crystalline particles using an X-ray free-electron laser. Coherent X-ray diffraction imaging is a promising technique for visualizing the structures of non-crystalline particles with dimensions of micrometers to sub-micrometers. Recently, X-ray free-electron laser sources have enabled efficient experiments in the ‘diffraction before destruction’ scheme. Diffraction experiments have been conducted at SPring-8 Angstrom Compact free-electron LAser (SACLA) using the custom-made diffraction apparatus KOTOBUKI-1 and two multiport CCD detectors. In the experiments, ten thousands of single-shot diffraction patterns can be collected within several hours. Then, diffraction patterns with significant levels of intensity suitable for structural analysis must be found, direct-beam positions in diffraction patterns determined, diffraction patterns from the two CCD detectors merged, and phase-retrieval calculations for structural analyses performed. A software suite named SITENNO has been developed to semi-automatically apply the four-step processing to a huge number of diffraction data. Here, details of the algorithm used in the suite are described and the performance for approximately 9000 diffraction patterns collected from cuboid-shaped copper oxide particles reported. Using the SITENNO suite, it is possible to conduct experiments with data processing immediately after the data collection, and to characterize the size distribution and internal structures of the non-crystalline particles

  18. Note: Application of a pixel-array area detector to simultaneous single crystal x-ray diffraction and x-ray absorption spectroscopy measurements

    International Nuclear Information System (INIS)

    Sun, Cheng-Jun; Brewe, Dale L.; Heald, Steve M.; Zhang, Bangmin; Chen, Jing-Sheng; Chow, G. M.; Venkatesan, T.

    2014-01-01

    X-ray diffraction (XRD) and X-ray absorption spectroscopy (XAS) are two main x-ray techniques in synchrotron radiation facilities. In this Note, we present an experimental setup capable of performing simultaneous XRD and XAS measurements by the application of a pixel-array area detector. For XRD, the momentum transfer in specular diffraction was measured by scanning the X-ray energy with fixed incoming and outgoing x-ray angles. By selecting a small fixed region of the detector to collect the XRD signal, the rest of the area was available for collecting the x-ray fluorescence for XAS measurements. The simultaneous measurement of XRD and X-ray absorption near edge structure for Pr 0.67 Sr 0.33 MnO 3 film was demonstrated as a proof of principle for future time-resolved pump-probe measurements. A static sample makes it easy to maintain an accurate overlap of the X-ray spot and laser pump beam

  19. X-ray diffraction at Bragg angles around π/2

    International Nuclear Information System (INIS)

    Mayolo, C.M.G. de.

    1991-01-01

    X-ray diffraction at Bragg angles around π/2 is studied from the theoretical and experimental points of view. The proposed corrections to the dynamical theory in the θ β ≅ π/2 cases, has been reviewed showing the equivalence between two formalisms leading to a corrected expression for the dependence of the angular parameter y with the angle of incidence. An expression for y valid in the conventional and θ β ≅ π/2 cases has been obtained. A general expression for Bragg law and for energy resolution after a Bragg diffraction was also deduced. (author)

  20. Coherent x-ray diffraction imaging of paint pigment particles by scanning a phase plate modulator

    International Nuclear Information System (INIS)

    Chen Bo; Berenguer, Felisa; Bean, Richard J; Robinson, Ian K; Zhang Fucai; Rodenburg, John M; Kewish, Cameron M; Vila-Comamala, Joan; Chu, Yong S

    2011-01-01

    We have implemented a coherent x-ray diffraction imaging technique that scans a phase plate to modulate wave-fronts of the x-ray beam transmitted by samples. The method was applied to measure a decorative alkyd paint containing iron oxide red pigment particles. By employing an iterative algorithm for wave-front modulation phase retrieval, we obtained an image of the paint sample that shows the distribution of the pigment particles and is consistent with the result obtained from a transmission x-ray microscope. The technique has been experimentally proven to be a feasible coherent x-ray imaging method with about 120 nm spatial resolution and was shown to work well with industrially relevant specimens. (paper)

  1. Coherent x-ray diffraction imaging of paint pigment particles by scanning a phase plate modulator

    International Nuclear Information System (INIS)

    Chu, Y.S.; Chen, B.; Zhang, F.; Berenguer, F.; Bean, R.; Kewish, C.; Vila-Comamala, J.; Rodenburg, J.; Robinson, I.

    2011-01-01

    We have implemented a coherent x-ray diffraction imaging technique that scans a phase plate to modulate wave-fronts of the x-ray beam transmitted by samples. The method was applied to measure a decorative alkyd paint containing iron oxide red pigment particles. By employing an iterative algorithm for wave-front modulation phase retrieval, we obtained an image of the paint sample that shows the distribution of the pigment particles and is consistent with the result obtained from a transmission x-ray microscope. The technique has been experimentally proven to be a feasible coherent x-ray imaging method with about 120 nm spatial resolution and was shown to work well with industrially relevant specimens.

  2. Evaluation via multivariate techniques of scale factor variability in the rietveld method applied to quantitative phase analysis with X ray powder diffraction

    Directory of Open Access Journals (Sweden)

    Terezinha Ferreira de Oliveira

    2006-12-01

    Full Text Available The present work uses multivariate statistical analysis as a form of establishing the main sources of error in the Quantitative Phase Analysis (QPA using the Rietveld method. The quantitative determination of crystalline phases using x ray powder diffraction is a complex measurement process whose results are influenced by several factors. Ternary mixtures of Al2O3, MgO and NiO were prepared under controlled conditions and the diffractions were obtained using the Bragg-Brentano geometric arrangement. It was possible to establish four sources of critical variations: the experimental absorption and the scale factor of NiO, which is the phase with the greatest linear absorption coefficient of the ternary mixture; the instrumental characteristics represented by mechanical errors of the goniometer and sample displacement; the other two phases (Al2O3 and MgO; and the temperature and relative humidity of the air in the laboratory. The error sources excessively impair the QPA with the Rietveld method. Therefore it becomes necessary to control them during the measurement procedure.

  3. Design and fabrication of micro X-ray diffraction system

    Energy Technology Data Exchange (ETDEWEB)

    Park, Yang Soon; Han, Sun Ho; Kim, Jong Goo; Jee, Kwang Yong

    2006-10-15

    It has been observed that microstructure changes occur at the pellet periphery(rim) of the fuel at very high burn-up. Despite its narrow range (below some hundreds microns in depth), this peripheral region(rim) determines the behaviour of nuclear fuel. To determine lattice parameter with XRD at intervals as small as 30-50 {mu} m in radial direction of irradiated fuel samples, a micro X-ray diffraction system was designed and fabricated. This report describes the micro X-ray diffraction system consisted of an X-ray microbeam alignment system and a sample micro translation system, its characterization, and its performance test through the analysis for the micro region of some specimens. This system will be set in a radiation shielded glove box, and then used for analysis of lattice parameter change and the phase change at intervals as small as 30-50 {mu} m in radial direction of the rim of an irradiated fuel sample and a fuel cladding.

  4. Serial femtosecond X-ray diffraction of enveloped virus microcrystals

    Directory of Open Access Journals (Sweden)

    Robert M. Lawrence

    2015-07-01

    Full Text Available Serial femtosecond crystallography (SFX using X-ray free-electron lasers has produced high-resolution, room temperature, time-resolved protein structures. We report preliminary SFX of Sindbis virus, an enveloped icosahedral RNA virus with ∼700 Å diameter. Microcrystals delivered in viscous agarose medium diffracted to ∼40 Å resolution. Small-angle diffuse X-ray scattering overlaid Bragg peaks and analysis suggests this results from molecular transforms of individual particles. Viral proteins undergo structural changes during entry and infection, which could, in principle, be studied with SFX. This is an important step toward determining room temperature structures from virus microcrystals that may enable time-resolved studies of enveloped viruses.

  5. X-ray diffraction and imaging with a coherent beam: application to X-ray optical elements and to crystals exhibiting phase inhomogeneities

    International Nuclear Information System (INIS)

    Masiello, F.

    2011-05-01

    The exceptional properties of synchrotron light sources have been exploited in very different disciplines, from archaeology to chemistry, from material science to biology, from medicine to physics. Among these properties it is important to mention the high brilliance, continuum spectrum, high degree of polarization, time structure, small source size and divergence of the beam, the last resulting in a high transversal coherence of the produced radiation. This high transversal coherence of the synchrotron sources has permitted the development of new techniques, e.g. phase contrast imaging, X-ray photon correlation spectroscopy and coherent X-ray diffraction imaging (CXDI). This thesis work will consist essentially of three parts. In the first part it will be presented the work done as a member of the X-ray Optics Group of ESRF in the characterization of high quality diamond crystals foreseen as X-ray optical elements. The characterization has been done using different complementary X-ray techniques, such as high resolution diffraction, topography, grazing incidence diffraction, reflectivity and measurements of the coherence preservation using the Talbot effect. In the second part, I will show the result obtained in the study of the temperature behaviours of the domain in periodically poled ferroelectrics crystals. This type of measurements, based on Bragg-Fresnel diffraction, are possible only thanks to the high degree of coherence of the beam. In the third part, I will present the results obtained in the characterization of diamonds foreseen for applications other than X-ray optical elements. (author)

  6. Identifications studies of Lauha Bhasma by X-ray diffraction and X-ray fluorescence.

    Science.gov (United States)

    Bhargava, S C; Reddy, K R C; Sastry, G V S

    2012-01-01

    Procedures for preparation of Lauha Bhasma are described in ancient texts of Ayurveda. These procedures also begin with different source material for iron such as Teekshna Lauha and Kanta Lauha etc. In the present study, we have selected different source materials viz. magnetite iron ore for Kanta Lauha and pure (Armco grade) iron turnings for Teekshna Lauha. The standard procedures of preparation of Lauha Bhasma are carried out in identical conditions for these two raw materials. The final product from the Puta are characterized by using X-ray diffraction and X-ray fluorescence spectroscopy to understanding the crystallographic form or forms of iron oxides and their composition at the end of each Puta. The iron content at the end of repeated Putas (18 for Kanta Lauha and 20 for Teekshna Lauha) have shown a decrease in case of Teekshna Lauha since the starting material is pure iron while it showed only marginal decreases in the case of Kanta Lauha because the Fe(3)O(4) of magnetite is undergoing oxidation to Fe(2)O(3). The trace elements remain within the Bhasma in the form of various oxides of Si, Al, Ca, etc.

  7. Surface analysis of dental amalgams by X-ray photoelectron spectroscopy and X-ray diffraction.

    Science.gov (United States)

    Uo, Motohiro; Berglund, Anders; Cardenas, Juan; Pohl, Lars; Watari, Fumio; Bergman, Maud; Sjöberg, Staffan

    2003-11-01

    It is important to characterize the surface of dental amalgam in order to understand the process of mercury release from amalgam restorations in the oral cavity. The mercury evaporation occurs not only from the newly made restoration but also from the set material. The surfaces of four different types of amalgams, which had been well set, were analyzed with X-ray photoelectron spectroscopy (XPS) and X-ray diffraction (XRD) and the relationship between surface compositions and mercury release was studied. Fresh amalgam surfaces as well as aged surfaces, which were stored for 30 days in air, were investigated using XPS and the chemical states of amalgam components and oxygen were studied. The aged surfaces were also characterized with XRD and grazing angle XRD. With increased oxidation, the surface contents of tin and oxygen were increased in all amalgams. In contrast, the surface contents of copper and mercury were decreased. An increase of zinc or indium content were observed in zinc or indium containing amalgams, respectively. A surface layer enriched with indium and oxygen was clearly detected by XPS but not with grazing angle XRD. The thickness of the enriched surface layer is estimated to be in the order of few nanometer, which is approximately equal to the analysis depth of XPS. In addition, the presence of metallic elements, like tin and zinc, that readily form a stable oxide layer at the surface suppress the release of mercury.

  8. Determination of the strain hardening rate of metals and alloys by X ray diffraction

    International Nuclear Information System (INIS)

    Cadalbert, Robert

    1977-01-01

    This report for engineering graduation is based on the study of X ray diffraction line profile which varies with the plastic strain rate of the metal. After some generalities of strain hardening (consequence of a plastic deformation on the structure of a polycrystalline metal, means to study a strain hardened structure, use of X ray diffraction to analyse the strain hardened crystalline structure), the author reports the strain hardening rate measurement by using X ray diffraction. Several aspects are addressed: principles, experimental technique, apparatus, automation and programming of the measurement cycle, method sensitivity and precision. In the next part, the author reports applications: measurement of the strain hardening rate in different materials (tubes with hexagonal profile, cylindrical tubes in austenitic steel), and study of the evolution of strain hardening with temperature [fr

  9. X-ray diffraction imaging of biological cells

    CERN Document Server

    Nakasako, Masayoshi

    2018-01-01

    In this book, the author describes the development of the experimental diffraction setup and structural analysis of non-crystalline particles from material science and biology. Recent advances in X-ray free electron laser (XFEL)-coherent X-ray diffraction imaging (CXDI) experiments allow for the structural analysis of non-crystalline particles to a resolution of 7 nm, and to a resolution of 20 nm for biological materials. Now XFEL-CXDI marks the dawn of a new era in structural analys of non-crystalline particles with dimensions larger than 100 nm, which was quite impossible in the 20th century. To conduct CXDI experiments in both synchrotron and XFEL facilities, the author has developed apparatuses, named KOTOBUKI-1 and TAKASAGO-6 for cryogenic diffraction experiments on frozen-hydrated non-crystalline particles at around 66 K. At the synchrotron facility, cryogenic diffraction experiments dramatically reduce radiation damage of specimen particles and allow tomography CXDI experiments. In addition, in XFEL ex...

  10. Combined resistive and laser heating technique for in situ radial X-ray diffraction in the diamond anvil cell at high pressure and temperature

    Energy Technology Data Exchange (ETDEWEB)

    Miyagi, Lowell [Department of Geology and Geophysics, University of Utah, Salt Lake City, Utah 84112 (United States); Department of Earth Sciences, Montana State University, Bozeman, Montana 59717 (United States); Kanitpanyacharoen, Waruntorn; Kaercher, Pamela; Wenk, Hans-Rudolf; Alarcon, Eloisa Zepeda [Department of Earth and Planetary Science, University of California, Berkeley, California 94720 (United States); Raju, Selva Vennila [Advanced Light Source, Lawrence Berkeley Laboratory, Berkeley, California 94720 (United States); HiPSEC, Department of Physics, University of Nevada, Las Vegas, Nevada 89154 (United States); Knight, Jason; MacDowell, Alastair [Advanced Light Source, Lawrence Berkeley Laboratory, Berkeley, California 94720 (United States); Williams, Quentin [Department of Earth and Planetary Science, University of California, Santa Cruz, California 95064 (United States)

    2013-02-15

    To extend the range of high-temperature, high-pressure studies within the diamond anvil cell, a Liermann-type diamond anvil cell with radial diffraction geometry (rDAC) was redesigned and developed for synchrotron X-ray diffraction experiments at beamline 12.2.2 of the Advanced Light Source. The rDAC, equipped with graphite heating arrays, allows simultaneous resistive and laser heating while the material is subjected to high pressure. The goals are both to extend the temperature range of external (resistive) heating and to produce environments with lower temperature gradients in a simultaneously resistive- and laser-heated rDAC. Three different geomaterials were used as pilot samples to calibrate and optimize conditions for combined resistive and laser heating. For example, in Run1, FeO was loaded in a boron-mica gasket and compressed to 11 GPa then gradually resistively heated to 1007 K (1073 K at the diamond side). The laser heating was further applied to FeO to raise temperature to 2273 K. In Run2, Fe-Ni alloy was compressed to 18 GPa and resistively heated to 1785 K (1973 K at the diamond side). The combined resistive and laser heating was successfully performed again on (Mg{sub 0.9}Fe{sub 0.1})O in Run3. In this instance, the sample was loaded in a boron-kapton gasket, compressed to 29 GPa, resistive-heated up to 1007 K (1073 K at the diamond side), and further simultaneously laser-heated to achieve a temperature in excess of 2273 K at the sample position. Diffraction patterns obtained from the experiments were deconvoluted using the Rietveld method and quantified for lattice preferred orientation of each material under extreme conditions and during phase transformation.

  11. Combined resistive and laser heating technique for in situ radial X-ray diffraction in the diamond anvil cell at high pressure and temperature.

    Science.gov (United States)

    Miyagi, Lowell; Kanitpanyacharoen, Waruntorn; Raju, Selva Vennila; Kaercher, Pamela; Knight, Jason; MacDowell, Alastair; Wenk, Hans-Rudolf; Williams, Quentin; Alarcon, Eloisa Zepeda

    2013-02-01

    To extend the range of high-temperature, high-pressure studies within the diamond anvil cell, a Liermann-type diamond anvil cell with radial diffraction geometry (rDAC) was redesigned and developed for synchrotron X-ray diffraction experiments at beamline 12.2.2 of the Advanced Light Source. The rDAC, equipped with graphite heating arrays, allows simultaneous resistive and laser heating while the material is subjected to high pressure. The goals are both to extend the temperature range of external (resistive) heating and to produce environments with lower temperature gradients in a simultaneously resistive- and laser-heated rDAC. Three different geomaterials were used as pilot samples to calibrate and optimize conditions for combined resistive and laser heating. For example, in Run#1, FeO was loaded in a boron-mica gasket and compressed to 11 GPa then gradually resistively heated to 1007 K (1073 K at the diamond side). The laser heating was further applied to FeO to raise temperature to 2273 K. In Run#2, Fe-Ni alloy was compressed to 18 GPa and resistively heated to 1785 K (1973 K at the diamond side). The combined resistive and laser heating was successfully performed again on (Mg0.9Fe0.1)O in Run#3. In this instance, the sample was loaded in a boron-kapton gasket, compressed to 29 GPa, resistive-heated up to 1007 K (1073 K at the diamond side), and further simultaneously laser-heated to achieve a temperature in excess of 2273 K at the sample position. Diffraction patterns obtained from the experiments were deconvoluted using the Rietveld method and quantified for lattice preferred orientation of each material under extreme conditions and during phase transformation.

  12. Characterization of Sintered and Sintered/Plasma-Nitrided Fe-1.5% Mo Alloy by SEM, X-Ray Diffraction and Electrochemical Techniques

    Directory of Open Access Journals (Sweden)

    Alves Neto José de Pinho

    2002-01-01

    Full Text Available Electrochemical experiments together with SEM and X-Ray techniques were carried out in order to evaluate the corrosion resistance, to analyze the surface condition and to characterize the nitride layer of the sintered and sintered/plasma-nitrided Fe-1.5% Mo alloy in Mg(NO32 0.5mol.L-1 solution (pH 7.0. The sintered/plasma-nitrided samples presented a higher corrosion resistance, indicating that the surface treatment improved the electrochemical properties of the sintered material. In addition, the nitride layer formed at 500 °C showed better corrosion resistance that the layers formed at higher temperatures. This difference can be ascribed to the nitrogen content in the nitride layer, which at 500°C is higher due to the formation of a phase rich in nitrogen (epsilon phase while at higher temperatures a phase poor in nitrogen (gamma' phase is formed.

  13. Synchrotron radiation X-ray microfluorescence techniques

    Indian Academy of Sciences (India)

    Synchrotron X-ray imaging systems with fluorescence techniques was developed for biomedical researches in Brazilian Synchrotron Laboratory. An X-ray fluorescence microtomography system was implemented to analyse human prostate and breast samples and an X-ray microfluorescence system was implemented to ...

  14. Synchrotron radiation X-ray microfluorescence techniques and ...

    Indian Academy of Sciences (India)

    Synchrotron X-ray imaging systems with fluorescence techniques was developed for biomedical researches in Brazilian Synchrotron Laboratory. An X-ray fluorescence microtomography system was implemented to analyse human prostate and breast samples and an X-ray microfluorescence system was implemented to ...

  15. Study of the physical phenomena in the transformation of the in vivo implanted coral, using radioactivation techniques, by means of X-ray diffraction and infrared spectrometry

    International Nuclear Information System (INIS)

    Oudadesse, H.

    1989-01-01

    By radioactivation analysis, we measured quantitatively for the first time the elementary transformation of coral in vivo. Some natural coral was implanted after having been sterilized in ovine jaws. Every month, biopsies were extracted in order to get a portion of the external cortical part, the intermediary part (initially the coral) and the internal cortical part. We measured the kinetics of the concentration of major atomic elements which constitute the biological mould such as phosphorus, calcium, magnesium, fluorine, as well as strontium of which content was abundantly found in the coral. The results show intense disturbances until the fifth month, when the mineral structure of the implanted coral becomes akin to that of bone come to maturity. In addition, with measures by diffraction by X-ray, we have followed the structural modifications by relating them to the variation in concentration of atomic elements. The coral, in the form of aragonit and stabilized by strontium as shown by neutron radioactivation crystallises in an orthorombic system. Three months after having been implanted, its structure becomes hexagonal and reaches a degree of crystallization similar to that of a bone come to maturity about the fifth month. The infrared absorption spectroscopy allowed us to fine the structure by specifying the mineral of the bone and of the implanted coral. Three months after having been implanted, the coral has become an apatite with deposit of organic substances. Moreover, a calcination at high temperature revealed a supply of phosphorus ions from the first month until the fifth month [fr

  16. Direct observation of ultrafast atomic motion using time-resolved X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Shymanovich, U.

    2007-11-13

    This thesis is dedicated to the study of the atomic motion in laser irradiated solids on a picosecond to subpicosecond time-scale using the time-resolved X-ray diffraction technique. In the second chapter, the laser system, the laser-plasma based X-ray source and the experimental setup for optical pump / X-ray probe measurements were presented. Chapter 3 is devoted to the characterization and comparison of different types of X-ray optics. Chapter 4 presented the time-resolved X-ray diffraction experiments performed for this thesis. The first two sections of this chapter discuss the measurements of initially unexpected strain-induced transient changes of the integrated reflectivity of the X-ray probe beam. The elimination of the strain-induced transient changes of the integrated reflectivity represented an important prerequisite to perform the study of lattice heating in Germanium after femtosecond optical excitation by measuring the transient Debye-Waller effect. The third section describes the investigations of acoustic waves upon ultrafast optical excitation and discusses the two different pressure contributions driving them: the thermal and the electronic ones. (orig.)

  17. Software system for X-ray diffraction quantitative phase analysis

    International Nuclear Information System (INIS)

    Fuentes, L.; Herrera, V.; Rubio, E.

    1989-01-01

    A system of experimental methods and computer programs for X-ray diffraction analysis is presented. The most important cases occurring in practice are considered. Program MARIA for spectral analysis is described. The external standard method for powder analysis is presented. Program STANDEXT calculates the sample absorption coefficient, the concentrations and standard deviations by a least squares method. For the case of partly identified samples, the internal standard method is developed. All measured peak are considered in the calculations. Program STANDINT solves the concentrations of the identified phases, their errors and the sample's absorption coefficient. A modification is introduced in the so-called direct method for massive sample analysis. The effect of texture is characterized by model representation of the inverse pole figure associated to the sample diffracting surface. Program DIREC is proposed for titting texture-modulated theoretical diffraction patterns to experimental ones, thus calculating phase concentrations and corresponding errors. Examples are given in some applications

  18. Qualitative analysis of powder x-ray diffraction data

    International Nuclear Information System (INIS)

    Raftery, T.

    1999-01-01

    based methods of considering significant lines such as with the Hanawalt, Fink and alphabetical index; computer based search-match based on FOM and the more recent graphically based full pattern methods of phase identification. No single approach is foolproof. a range of techniques is recommended if a high level of success is required. Copyright (1999) Australian X-ray Analytical Association Inc

  19. Automation of a Guinier camera for X-ray diffraction

    International Nuclear Information System (INIS)

    Duijn, J.H.

    1988-01-01

    The automation of a Guinier X-ray diffraction camera is discussed. The photographic plate in the conventional setup has been replaced by a curved proportional counter (CPC) which has an electronic readout system. As a result the recording time has been reduced from a few hours to a few minutes. The construction and optimum dimensions of the CPC are discussed and the most essential parts of the readout electronics are highlighted. A linewidth of 200 μm FWHM and an accuracy of 30 μm are achieved. 45 refs.; 53 figs.; 4 tabs

  20. Ultrafast X-Ray Diffraction of Heterogeneous Solid Hydrogen

    Energy Technology Data Exchange (ETDEWEB)

    Levitan, Abraham [Olin College of Engineering, Needham, MA (United States)

    2015-08-19

    Angularly resolved x-ray diffraction at 5.5 keV establishes the structure of a 5 µm diameter solid hydrogen jet, providing a foundation for analysis of hydrogen in a warm dense matter state. The jet was composed of approximately 65 % ± 5% HCP and 35 % ± 5% FCC by volume with an average crystallite size on the order of hundreds of nanometers. Broadening in the angularly resolved spectrum provided strong evidence for anisotropic strain up to approximately 3 % in the HCP lattice. Finally, we found no evidence for orientational ordering of the crystal domains.

  1. X-ray diffraction analysis device with electronic photon counter

    International Nuclear Information System (INIS)

    Fillit, R.Y.; Bruyas, H.; Patay, F.

    1985-01-01

    The means provided to control the movements around the three axes are composed of step-by-step motors related to exits control logic which is connected to the calculation and monitored by a clock. The clock monitors also the calculator so as that the calculator controls, together with the programmable clock and control logic, the coordination of the whole rotation movements, along the three rotation axes, their velocity, their duration and the acquisition of the measured intensities of the diffracted X-ray beam [fr

  2. Synchrotron X-ray diffraction using triple-axis spectrometry

    International Nuclear Information System (INIS)

    Als-Nielsen, J.

    1980-12-01

    High resolution X-ray diffraction studies of (i) monolayers of the noble gases Kr and Ar physiosorbed on graphite (ii) smectic A fluctuations in the nematic and the smectic A phases of liquid crystals are described. The apparatus used is a triple axis spectrometer situated at the storage ring DORIS at Hasylab, DESY, Hamburg. A monochromatic, well collimated beam is extracted from the synchrotron radiation spectrum by Bragg reflection from perfect Si or Ge crystals. The direction of the beam scattered from the sample is determined by Bragg reflection from a perfect Si or Ge crystal. High intensities even with resolution extending beyond the wavelength of visible light can be obtained. (Auth.)

  3. Powder X-ray diffraction study af alkali alanates

    DEFF Research Database (Denmark)

    Cao, Thao; Mosegaard Arnbjerg, Lene; Jensen, Torben René

    Powder X-ray diffraction study of alkali alanates Thao Cao, Lene Arnbjerg, Torben R. Jensen. Center for Materials Crystallography (CMC), Center for Energy Materials (CEM), iNANO and Department of Chemistry, Aarhus University, DK-8000, Denmark. Abstract: To meet the energy demand in the future...... for mobile applications, new materials with high gravimetric and volumetric storage capacity of hydrogen have to be developed. Alkali alanates are promising for hydrogen storage materials. Sodium alanate stores hydrogen reversibly at moderate conditions when catalysed with, e.g. titanium, whereas potassium...

  4. New progress on monolithic X-ray lens in diffraction application

    International Nuclear Information System (INIS)

    Li Yude; He Yejun; Chen Jun; Luo Ping; Wang Dachun; Yan Yiming

    1999-12-01

    The basic physical properties for monolithic X-ray lens are introduced. The X-ray diffraction for macromolecular crystallography using monolithic X-ray lens were investigated. The experimental results show that in the same X-ray source power the diffracted intensity in the condition with X-ray lens was increased about 7 times, and the resolution was improved by 0.2 x 10 -10 -0.6 x 10 -10 m. The signal to noise ratio was also improved, and the time of measurement was reduced. The X-ray diffraction of Au thin films on the Si(100) single crystal substrates were investigated in a X-ray powder diffractometer. The experimental results show that in the same X-ray source power the diffracted intensity in the condition with X-ray lens was increased about 2 times, and the angular resolution of the diffractometer was enhanced

  5. Mössbauer effect studies and X-ray diffraction analysis of cobalt ...

    Indian Academy of Sciences (India)

    Unknown

    Abstract. Cobalt ferrite (CoxFe3–xO4) is prepared in powder form by thermal decomposition of iron and cobalt salts and is analysed by X-ray diffraction and Mössbauer spectroscopic techniques. The variation of. Mössbauer parameters, lattice parameters and crystallite size of the products formed with variation in the.

  6. An introduction to three-dimensional X-ray diffraction microscopy

    DEFF Research Database (Denmark)

    Poulsen, Henning Friis

    2012-01-01

    Three-dimensional X-ray diffraction microscopy is a fast and nondestructive structural characterization technique aimed at studies of the individual crystalline elements (grains or subgrains) within millimetre-sized polycrystalline specimens. It is based on two principles: the use of highly...

  7. An X-ray diffraction study of direct-bonded silicon interfaces

    DEFF Research Database (Denmark)

    Howes, P.B.; Benamara, M.; Grey, F.

    1998-01-01

    Semiconductor wafer bonding techniques have been used to create a giant twist grain boundary from two Si(001) wafers. We show, using X-ray diffraction measurements that after annealing the interface forms a highly ordered superstructure with relaxations extending to many layers into the crystals ...

  8. In situ X-ray diffraction environments for high-pressure reactions

    DEFF Research Database (Denmark)

    R. S. Hansen, Bjarne; Møller, Kasper Trans; Paskevicius, Mark

    2015-01-01

    New sample environments and techniques specifically designed for in situ powder X-ray diffraction studies up to 1000 bar (1 bar = 105 Pa) gas pressure are reported and discussed. The cells can be utilized for multiple purposes in a range of research fields. Specifically, investigations of gas–sol...

  9. Revealing stacking sequences in inverse opals by microradian X-ray diffraction

    NARCIS (Netherlands)

    Sinitskii, A.; Abramova, V.; Grigorieva, N.; Grigoriev, S.; Snigirev, A.; Byelov, D.; Petukhov, A.V.

    2010-01-01

    We present the results of the structural analysis of inverse opal photonic crystals by microradian X-ray diffraction. Inverse opals based on different oxide materials (TiO2, SiO2 and Fe2O3) were fabricated by templating polystyrene colloidal crystal films grown by the vertical deposition technique.

  10. Variable-metric diffraction crystals for x-ray optics

    International Nuclear Information System (INIS)

    Smither, R.K.

    1992-01-01

    The term open-quote Variable-Metricclose quotes (V-M) when applied to diffraction crystals refers to a crystal in which the spacing between crystalline planes varies with the position in the crystal. This variation can be either parallel to the crystalline planes or perpendicular to the crystalline planes. The variation in the crystalline spacing of a V-M crystal can be produced by introducing a thermal gradient in the crystal. This approach works well when the over-all percentage change in the lattice spacing is small (less than 0.1 %). For V-M crystals where the over-all change in spacing is the order of 0.1 percent or larger, it is more practical to produce the change in crystal spacing by growing a crystal made of two or more elements and changing the relative percentages of the two elements as the crystal is grown. One of the simplest applications of this type of crystal diffraction optics is to use V-M crystals to increase the number of photon per unit bandwidth in a diffracted x-ray beam. Typical enhancement factors of 3 to 20 are possible with wiggler sources. For near perfect silicon crystals the rocking curve for (111) planes is typically 8.5 arc seconds at 8 keV and 2.6 arc seconds at 20 keV. If one changes the crystalline spacing to match the change in the incident angle of the beam on the crystalline planes, then the full surface of the diffraction crystal will diffract the same wavelength x-ray. The increase in flux per unit bandwidth in the diffracted beam is 6 to 1 and 20 to 1 for the 8 keV and 20 keV x-rays, respectively, for the NSLS example. In most of the experiments the changes in crystalline spacings were generated with thermal gradients. One set of experiments used a V-M crystal grown with a variable percentage of germanium and silicon. This crystal had a 0.1 percent change in crystal spacing in 1 mm of distance in the crystal

  11. Controlled molecules for X-ray diffraction experiments at free-electron lasers

    International Nuclear Information System (INIS)

    Stern, Stephan

    2013-12-01

    performed on a gas-phase ensemble of the prototypical molecule 2,5-diiodobenzonitrile (C 7 H 3 I 2 N, DIBN) at the X-ray free-electron laser LCLS. The target molecules were laser-aligned along a common axis in the laboratory frame by a Nd:YAG laser. Reaching a strong degree of molecular alignment, was an important step in this experiment. Therefore, a significant part of the work was dedicated to gaining control of the molecular degrees of freedom. In order to reach a high degree of alignment, the target molecules were prepared in low rotational quantum states by means of efficient cooling in a supersonic expansion from a pulsed valve followed by spatial quantum-state selection in an electrostatic deflector. Utilization of the deflector significantly improved alignment of the DIBN molecules. Further applications of the deection technique such as, e.g., the spatial separation of several species of molecular complexes/clusters are presented in this thesis as well. The quantum-state selected and strongly laser-aligned samples were probed by the X-ray pulses of LCLS and the obtained diffraction patterns show a significant difference when comparing diffraction from aligned and isotropically-distributed DIBN which agrees well with theory. The results represent an important step in the effort of pushing diffractive imaging of non-crystalline samples at XFELs towards the single-molecule limit. Concepts and experimental requirements for future experiments of this kind are discussed, involving, e.g., the step towards imaging of laser-aligned large (bio)macromolecules or imaging of ultrafast fragmentation dynamics in femtosecond pump-probe experiments at XFELs.

  12. Controlled molecules for X-ray diffraction experiments at free-electron lasers

    Energy Technology Data Exchange (ETDEWEB)

    Stern, Stephan

    2013-12-15

    performed on a gas-phase ensemble of the prototypical molecule 2,5-diiodobenzonitrile (C{sub 7}H{sub 3}I{sub 2}N, DIBN) at the X-ray free-electron laser LCLS. The target molecules were laser-aligned along a common axis in the laboratory frame by a Nd:YAG laser. Reaching a strong degree of molecular alignment, was an important step in this experiment. Therefore, a significant part of the work was dedicated to gaining control of the molecular degrees of freedom. In order to reach a high degree of alignment, the target molecules were prepared in low rotational quantum states by means of efficient cooling in a supersonic expansion from a pulsed valve followed by spatial quantum-state selection in an electrostatic deflector. Utilization of the deflector significantly improved alignment of the DIBN molecules. Further applications of the deection technique such as, e.g., the spatial separation of several species of molecular complexes/clusters are presented in this thesis as well. The quantum-state selected and strongly laser-aligned samples were probed by the X-ray pulses of LCLS and the obtained diffraction patterns show a significant difference when comparing diffraction from aligned and isotropically-distributed DIBN which agrees well with theory. The results represent an important step in the effort of pushing diffractive imaging of non-crystalline samples at XFELs towards the single-molecule limit. Concepts and experimental requirements for future experiments of this kind are discussed, involving, e.g., the step towards imaging of laser-aligned large (bio)macromolecules or imaging of ultrafast fragmentation dynamics in femtosecond pump-probe experiments at XFELs.

  13. Fig .1. X-ray diffraction (XRD) patterns of Ag2Se-G-TiO2 composites.

    Indian Academy of Sciences (India)

    32

    Abstract. The present work deals with the development of a new ternary composite, Ag2Se-G -TiO2, using ultrasonic techniques as well as X-ray diffraction (XRD), scanning electron microscopy (SEM), high transmission electron microscopy (HTEM), X-ray photoelectron spectroscopy (XPS),. Raman spectroscopy, and UV-vis ...

  14. Energy-scanning X-ray diffraction of synthetic multilayer structure

    International Nuclear Information System (INIS)

    Malaurent, J.C.; Duval, H.; Fert, A.

    1987-01-01

    An energy-scanning X-ray diffraction technique is used to study a synthetic periodic multilayer structure with two amorphous components. The source was the Bremsstrahlung from the X-ray tube, and the detector was a silicon-lithium diode. Experimental results obtained for a multilayer PdSi/MgCu with large period show a deviation from the classical Bragg's law. The deviation is produced by the variation of the refractive index of the multilayer with the wavelength of the incident X-ray. The period d was determined to within 1%. A measure of the refraction index enabled an estimate to be made of the width of each layer. It was also possible to estimate the fluctuation of the period along the multilayer from the full widths of the diffracted Bragg peaks at maximum intensities. The limits of the method are discussed. (orig.)

  15. Characterization of Brazilian asphalt using X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Cardoso, Edson R.; Pinto, Nivia G.V.; Almeida, Ana P.G.; Braz, Delson; Lopes, Ricardo T. [Universidade Federal do Rio de Janeiro (UFRJ), RJ (Brazil). Coordenacao dos Programas de Pos-graduacao de Engenharia (COPPE). Lab. de Instrumentacao Nuclear], E-mail: ecardoso@lin.ufrj.br; Barroso, Regina C. [Universidade do Estado do Rio de Janeiro (UERJ), Rio de Janeiro, RJ (Brazil). Inst. de Fisica], E-mail: cely@uerj.br; Motta, Laura M.G. [Universidade Federal do Rio de Janeiro (UFRJ), RJ (Brazil). Coordenacao dos Programas de Pos-graduacao de Engenharia (COPPE). Lab. de Geotecnia], E-mail: laura@coc.ufrj.br

    2007-07-01

    Asphalt is a sticky, black and highly viscous liquid or semi-solid that is presented in most crude petroleum and in some natural deposits. The X ray diffraction can give valuable information over the characteristics of a material. Thus, the X-ray diffraction (XRD) method was employed to investigate parameters that characterize and differentiate asphalt groups (Boscan, CAP20, CAP40, CAP50/60, CAP50/70 and CAP85/100). The scattering measurements were carried out in {theta}-2{theta} reflection geometry using a powder diffractometer Shimadzu XRD-6000 at the Nuclear Instrumentation Laboratory, Brazil. Scans were typically done from 8 deg to 28 deg every 0.05. The parameters analyzed were: FWHM, peak area, peak center, peak height, left half width and right half width. Thus, in this study, scattering profiles from different asphalt groups were carefully measured in order to establish characteristic signatures of these materials. The results indicate that by using three parameters (peak centroid, peak area and peak intensity) it is possible to characterize and differentiate the asphalt. (author)

  16. X-ray Diffraction Study of Arsenopyrite at High Pressure

    Energy Technology Data Exchange (ETDEWEB)

    D Fan; M Ma; W Zhou; S Wei; Z Chen; H Xie

    2011-12-31

    The high-pressure X-ray diffraction study of a natural arsenopyrite was investigated up to 28.2 GPa using in situ angle-dispersive X-ray diffraction and a diamond anvil cell at National Synchrotron Light Source, Brookhaven National Laboratory. The 16:3:1 methanol-ethanol-water mixture was used as a pressure-transmitting medium. Pressures were measured using the ruby-fluorescence method. No phase change has been observed up to 28.2 GPa. The isothermal equation of state (EOS) was determined. The values of K{sub 0}, and K'{sub 0} refined with a third-order Birch-Murnaghan EOS are K{sub 0} = 123(9) GPa, and K'{sub 0} = 5.2(8). Furthermore, we confirm that the linear compressibilities ({beta}) along a, b and c directions of arsenopyrite is elastically isotropic ({beta}{sub a} = 6.82 x 10{sup -4}, {beta}{sub b} = 6.17 x 10{sup -4} and {beta}{sub c} = 6.57 x 10{sup -4} GPa{sup -1}).

  17. Evaluation of the efficiency of clay stabilizers using X-ray diffraction

    International Nuclear Information System (INIS)

    Oliveira, Milena Ferreira de Siqueira; Lopes, Ricardo Tadeu

    2008-01-01

    The aim of this work was evaluate the effectiveness of six clay stabilizers polymeric cationic in inhibiting osmotic swelling in clays of montmorillonite group.Using the humid X-ray diffraction technique is possible to quantify the swelling clay by interlayer spacing that was obtained through survey of the diffraction trace of the clay in solution with stabilizer. The technique of efficiency analysis of the stabilizers using X-ray diffraction is done performing the diffraction trace of a sodium bentonite in solution with different concentrations of stabilizer, diluted in distilled water. The experimental results have shown that six stabilizers were analyzed, and only one was not efficient in the control of the osmotic swelling.The others were efficient, although in different concentration because of differences of chemical composition of each stabilizer. (author)

  18. Exploring the nanoworld in real and reciprocal space. Part 1 x-ray and electron diffractions

    International Nuclear Information System (INIS)

    Ng Inn Khuan; Kok Kuan Ying

    2003-01-01

    The articles highlight two of the main characterization techniques that are widely used in materials characterization laboratories, namely, X-ray Diffractometry (XRD) and Transmission Electron Microscopy (TEM). Part 1 of the article focuses on the diffraction while part 2 on imaging aspects of these techniques. The theoretical background for each technique is briefly covered and examples are given to illustrate the use of the techniques in solving some materials-related problem, particularly, for nanostructured systems. (Author)

  19. Effect of ionic strength on crossbridge kinetics as studied by sinusoidal analysis, ATP hydrolysis rate and X-ray diffraction techniques in chemically skinned rabbit psoas fibres.

    Science.gov (United States)

    Kawai, M; Wray, J S; Güth, K

    1990-10-01

    In order to identify which steps in the crossbridge are affected by changes in ionic strength, we studied the effect of ionic strength on the rate constants and magnitudes of three exponential processes, the ATP hydrolysis rate and isometric tension during maximal activation (pCa 4.52, 5 mM MgATP). Equatorial X-ray diffraction measurements were also carried out in both relaxing and rigor conditions to examine whether the distance between thick and thin filaments changes with ionic strength (range: 100-300 mM). All experiments were carried out at 20 degrees C and at pH 7.0 on chemically skinned rabbit psoas muscle fibres. Isometric tension and muscle stiffness declined significantly as the ionic strength was increased from 150 mM to 300 mM. The concomitant decrease in the ATP hydrolysis rate was much less than tension, resulting in a large increase in the tension cost. Three rate constants of exponential processes, deduced from sinusoidal analysis, did not change appreciably. The magnitude parameters of all three processes diminished as the ionic strength was increased. During relaxation the filament spacing increased by 5% when the ionic strength was increased from 150 mM to 300 mM. After rigor induction, the spacing did not change with ionic strength. We conclude that a change in ionic strength modifies the rapid equilibrium between the detached state and the 'weakly attached' state, and that this causes considerable effect on isometric tension. We also conclude that other steps in the crossbridge cycle are less sensitive to ionic strength, and that the lattice spacing change is unable to account for the considerable effect of ionic strength on isometric tension.

  20. X-Ray Diffraction and Fluorescence Instrument for Mineralogical Analysis at the Lunar Surface, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — We propose to develop a compact and lightweight X-Ray Diffraction (XRD) / X-Ray Fluorescence (XRF) instrument for analysis of mineralogical composition of regolith,...

  1. X-Ray Diffraction and Fluorescence Instrument for Mineralogical Analysis at the Lunar Surface, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — We propose to develop LUNA, a compact and lightweight X-Ray Diffraction (XRD) / X-Ray Fluorescence (XRF) instrument for mineralogical analysis of regolith, rock...

  2. Preliminary small-angle X-ray scattering and X-ray diffraction studies of the BTB domain of lola protein from Drosophila melanogaster

    Science.gov (United States)

    Boyko, K. M.; Nikolaeva, A. Yu.; Kachalova, G. S.; Bonchuk, A. N.; Dorovatovskii, P. V.; Popov, V. O.

    2017-11-01

    The Drosophila genome has several dozens of transcription factors (TTK group) containing BTB domains assembled into octamers. The LOLA protein belongs to this family. The purification, crystallization, and preliminary X-ray diffraction and small-angle X-ray scattering (SAXS) studies of the BTB domain of this protein are reported. The crystallization conditions were found by the vapor-diffusion technique. A very low diffraction resolution (8.7 Å resolution) of the crystals was insufficient for the determination of the threedimensional structure of the BTB domain. The SAXS study demonstrated that the BTB domain of the LOLA protein exists as an octamer in solution.

  3. Moessbauer spectroscopy and X-ray diffraction study of 304 L stainless steel thin films

    International Nuclear Information System (INIS)

    Boubeker, B.; Eymery, J.P.; Goudeau, P.; Sayouty, E.H.

    1994-01-01

    304 L stainless steel films (SS) were elaborated using an ion-beam sputtering technique. The target material was a sheet of commercial grade 304 L SS. The starting material was first analysed by both conversion electron Moessbauer spectroscopy (CEMS) and X-ray diffraction. The nonmagnetic state and f.c.c. structure of this material were confirmed. The films were deposited on various substrates with thicknesses in the 175-800 nm range. The films are found to have both b.c.c. structure and ferromagnetic character. X-ray diffraction technique was also used in order to determine the residual stresses developed during the deposition process. The second stage of the work is devoted to the evolution of the film structure as a function of annealing treatments. So isochronal and isothermal kinetics at temperatures higher than 913 K have allowed to follow the alpha --> gamma phase transformation using X-ray diffraction and CEMS technique.The X-ray diffractograms reveal the existence of both b.c.c. and f.c.c. phases. Similar results can be deduced from Moessbauer spectra due to the single line coming from the non-magnetic phase and the sextet coming from the ferromagnetic phase. In addition the CEMS spectra reveal that the ferromagnetic component is split into two parts which indicates the existence of two iron sites. 1 fig., 4 refs.(author)

  4. Variable-metric diffraction crystals for x-ray optics

    International Nuclear Information System (INIS)

    Smither, R.K.; Fernandez, P.B.

    1992-01-01

    A variable-metric (VM) crystal is one in which the spacing between the crystalline planes changes with position in the crystal. This variation can be either parallel to the crystalline planes or perpendicular to the crystalline planes of interest and can be produced by either introducing a thermal gradient in the crystal or by growing a crystal made of two or more elements and changing the relative percentages of the two elements as the crystal is grown. A series of experiments were performed in the laboratory to demonstrate the principle of the variable-metric crystal and its potential use in synchrotron beam lines. One of the most useful applications of the VM crystal is to increase the number of photons per unit bandwidth in a diffracted beam without losing any of the overall intensity. In a normal synchrotron beam line that uses a two-crystal monochromator, the bandwidth of the diffracted photon beam is determined by the vertical opening angle of the beam which is typically 0.10--0.30 mrad or 20--60 arcsec. When the VM crystal approach is applied, the bandwidth of the beam can be made as narrow as the rocking curve of the diffracting crystal, which is typically 0.005--0.050 mrad or 1--10 arcsec. Thus a very large increase of photons per unit bandwidth (or per unit energy) can be achieved through the use of VM crystals. When the VM principle is used with bent crystals, new kinds of x-ray optical elements can be generated that can focus and defocus x-ray beams much like simple lenses where the focal length of the lens can be changed to match its application. Thus both large magnifications and large demagnifications can be achieved as well as parallel beams with narrow bandwidths

  5. Study of properties of chemically modified samples of halloysite mineral with X-ray fluorescence and X-ray powder diffraction methods

    Science.gov (United States)

    Banaś, D.; Kubala-Kukuś, A.; Braziewicz, J.; Majewska, U.; Pajek, M.; Wudarczyk-Moćko, J.; Czech, K.; Garnuszek, M.; Słomkiewicz, P.; Szczepanik, B.

    2013-12-01

    Elemental and chemical composition of raw and activated samples of halloysite mineral using wavelength dispersive X-ray fluorescence (WDXRF), total reflection X-ray fluorescence (TXRF) and X-ray powder diffraction (XRPD) methods were determined. As the result, it has been shown that application of the complementary X-ray spectrometry techniques allows very precise observation of changes in composition of halloysite mineral samples caused by its chemical modifications. Sample preparation procedure and usability of the research methods applied are described in details. Procedure of activation of raw halloysite mineral samples by etching them in sulfuric acid of various concentrations has been described and discussed. The ability of the samples to adsorb lead from intentionally contaminated water was tested and confirmed.

  6. X-ray detectors for diffraction studies and their use with synchrotron radiation

    International Nuclear Information System (INIS)

    Milch, J.

    1976-02-01

    All techniques for X-ray diffraction studies on biological materials exhibit certain limitations. The characteristics of several X-ray detection systems, namely film, multiwire proportional counter and image intensified TV, are discussed and compared for application to specific biological studies. For the high count-rate situation existing at a synchrotron, it is shown that film is a good choice, but that the image intensified TV exhibits significant advantages. The details of such a system now being used at Princeton with a low intensity source are given and current results presented

  7. Phases quantification in titanium oxides by means of X-ray diffraction

    International Nuclear Information System (INIS)

    Macias B, L.R.; Garcia C, R.M.; Ita T, A. de; Chavez R, A.

    2001-01-01

    In this work two phases of titanium oxides are quantified which belong to the same crystalline system and by means of a computer program named Quanto created by the first author, contains the information for calculating the absorption coefficients, it can be quantified phases having one of the pure phases and the problem samples. In order to perform this work different mixtures of different titanium oxides were prepared measuring by means of the X-ray diffraction technique in the Siemens X-ray diffractometer of ININ which were processed with the Peakfit package and also they were evaluated by means of the computer program with the necessary information finding acceptable results. (Author)

  8. X-ray diffraction analysis of substructures in plastically deformed BCC materials

    International Nuclear Information System (INIS)

    Klimanek, P.

    1993-01-01

    A procedure for line-shape analysis of broadened X-ray (or neutron) diffraction peaks is presented and specified for b.c.c. materials, which takes into account the effect of interfaces, internal stress of the 2nd kind and a dislocation distribution with weak defect correlation. Application of the technique is demonstrated by the estimation of dislocation densities in plastically deformed α-iron and steel. The results confirm that X-ray line-broadening analysis is suitable for integrated substructure characterization, but it becomes also evident that local structural inhomogeneity and the texture of the sample material must carefully included into the interpretation of experimental data. (orig.)

  9. Qualitative and quantitative determination of sediments phases in Chillon River by x-ray diffraction

    International Nuclear Information System (INIS)

    Miramira Tipula, Biviano; Zeballos Velasquez, Elvira; Chui Betancur, Heber; Valencia Salazar, Edilberto; Huaypar Vasquez, Yesena; Olivera de Lescano, Paula

    2008-01-01

    With this paper, we pretend to contribute with the recovery of Chillon River from a characterization of sediments. The objectives are the identification of pollution places along the bed of the Chillon River, from the Canta Province to Lima Province (Comas) and the determination of the preponderant factors of pollution. The qualitative and semi-quantitative determination of the sediments components have been carried out using the x-ray diffraction and x-ray fluorescence techniques, both of them will allow us to identify the pollute elements, for example the lead level in the Chillon River. (author)

  10. Structural investigation of porcine stomach mucin by X-ray fiber diffraction and homology modeling

    Energy Technology Data Exchange (ETDEWEB)

    Veluraja, K., E-mail: veluraja@msuniv.ac.in [Department of Physics, Manonmaniam Sundaranar University, Tirunelveli, Tamilnadu 627012 (India); Vennila, K.N. [CAS in Crystallography and Biophysics, University of Madras, Guindy Campus, Chennai, Tamilnadu 600025 (India); Umamakeshvari, K.; Jasmine, A. [Department of Physics, Manonmaniam Sundaranar University, Tirunelveli, Tamilnadu 627012 (India); Velmurugan, D. [CAS in Crystallography and Biophysics, University of Madras, Guindy Campus, Chennai, Tamilnadu 600025 (India)

    2011-03-25

    Research highlights: {yields} Techniques to get oriented mucin fibre. {yields} X-ray fibre diffraction pattern for mucin. {yields} Molecular modeling of mucin based on X-ray fibre diffraction pattern. -- Abstract: The basic understanding of the three dimensional structure of mucin is essential to understand its physiological function. Technology has been developed to achieve orientated porcine stomach mucin molecules. X-ray fiber diffraction of partially orientated porcine stomach mucin molecules show d-spacing signals at 2.99, 4.06, 4.22, 4.7, 5.37 and 6.5 A. The high intense d-spacing signal at 4.22 A is attributed to the antiparallel {beta}-sheet structure identified in the fraction of the homology modeled mucin molecule (amino acid residues 800-980) using Nidogen-Laminin complex structure as a template. The X-ray fiber diffraction signal at 6.5 A reveals partial organization of oligosaccharides in porcine stomach mucin. This partial structure of mucin will be helpful in establishing a three dimensional structure for the whole mucin molecule.

  11. The first X-ray diffraction measurements on Mars

    Directory of Open Access Journals (Sweden)

    David Bish

    2014-11-01

    Full Text Available The Mars Science Laboratory landed in Gale crater on Mars in August 2012, and the Curiosity rover then began field studies on its drive toward Mount Sharp, a central peak made of ancient sediments. CheMin is one of ten instruments on or inside the rover, all designed to provide detailed information on the rocks, soils and atmosphere in this region. CheMin is a miniaturized X-ray diffraction/X-ray fluorescence (XRD/XRF instrument that uses transmission geometry with an energy-discriminating CCD detector. CheMin uses onboard standards for XRD and XRF calibration, and beryl:quartz mixtures constitute the primary XRD standards. Four samples have been analysed by CheMin, namely a soil sample, two samples drilled from mudstones and a sample drilled from a sandstone. Rietveld and full-pattern analysis of the XRD data reveal a complex mineralogy, with contributions from parent igneous rocks, amorphous components and several minerals relating to aqueous alteration. In particular, the mudstone samples all contain one or more phyllosilicates consistent with alteration in liquid water. In addition to quantitative mineralogy, Rietveld refinements also provide unit-cell parameters for the major phases, which can be used to infer the chemical compositions of individual minerals and, by difference, the composition of the amorphous component.

  12. [Diffraction gratings used in x-ray spectroscopy]: Final report

    International Nuclear Information System (INIS)

    Smith, H.I.

    1988-01-01

    This subcontract was initiated in order to facilitate the development at MIT of technologies for fabricating the very fine diffraction grating required in x-ray spectroscopy at Lawrence Livermore Laboratory (LLL). These gratings are generally gold transmission gratings with spatial periods of 200 nm or less. The major focus of our efforts was to develop a means of fabricating gratings of 100 nm period. We explored two approaches: e-beam fabrication of x-ray lithography masks, and achromatic holographic lithography. This work was pursued by Erik Anderson as a major component of his Ph.D. thesis. Erik was successful in both the e-beam and holographic approaches. However, the e-beam method proved to be highly impractical: exposure times of about 115 days would be required to cover an area of 1 cm 2 . The achromatic holography, on the other hand, should be capable of exposing areas well in excess of 1 cm 2 in times under 1 hour. Moreover, 100 nm-period gratings produced by achromatic holography are coherent over their entire area whereas gratings produced by e-beam lithography are coherent only over areas /approximately/100 μm. The remainder of this report consists of portions excerpted from Erik Anderson's thesis. These contain all the details of our work on 100 nm period gratings. 26 refs., 17 figs

  13. Synchrotron X-Ray Reciprocal Space Mapping, Topography and Diffraction Resolution Studies of Macromolecular Crystal Quality

    Science.gov (United States)

    Boggon, T. J.; Helliwell, J. R.; Judge, Russell A.; Siddons, D. P.; Snell, Edward H.; Stojanoff, V.

    2000-01-01

    A comprehensive study of microgravity and ground grown chicken egg white lysozyme crystals is presented using synchrotron X-ray reciprocal space mapping, topography techniques and diffraction resolution. Microgravity crystals displayed, on average, reduced intrinsic mosaicities but no differences in terms of stress over their earth grown counterparts. Topographic analysis revealed that in the microgravity case the majority of the crystal was contributing to the peak of the reflection at the appropriate Bragg angle. In the earth case at the diffraction peak only a small volume of the crystal contributed to the intensity. The techniques prove to be highly complementary with the reciprocal space mapping providing a quantitative measure of the crystal mosaicity and stress (or variation in lattice spacing) and topography providing a qualitative overall assessment of the crystal in terms of its X-ray diffraction properties. Structural data collection was also carried out both at the synchrotron and in the laboratory.

  14. X-ray diffraction applied to powder studies

    International Nuclear Information System (INIS)

    Assaf, Josiane

    1982-01-01

    the thesis starts with general definitions of x-ray: their nature, sources and production mechanism. it describesdifferent methods such as Debye-scherrer, absorption coefficient method, diffractometer method...The use of pattern-fitting techniques for the characterization of the microstructure is discussed through applications to nanocrystalline materials. Remarkable results achieved in the solution of crystal structures are presented, as well as the impact in solid-state chemistry of powder crystallography, particularly for elucidating the crystal chemistry of families of compounds for which only powders are available

  15. X-ray diffraction from single molecules at the worlds first X-ray free-electron laser source

    Energy Technology Data Exchange (ETDEWEB)

    Stern, Stephan; Kuepper, Jochen; Chapman, Henry; Rolles, Daniel [Center for Free-Electron Laser Science (CFEL), DESY, Hamburg (Germany)

    2011-07-01

    The advent of the first X-ray Free-Electron Laser, the Linac Coherent Light Source (LCLS), opens up a new approach for diffractive imaging of even single molecules that cannot be crystallized into macromolecular crystals of sufficient size necessary for conventional X-ray crystallography. Here, we present the concept, the experimental parametric space that has to be addressed together with first experimental results of X-ray diffractive imaging of single molecules in the gas phase at LCLS. We use a supersonically cooled molecular beam to provide an ensemble of test-molecules, laser-align them, and subsequently probe them with the LCLS in order to get diffraction patterns of single molecules.

  16. X-ray diffraction patterns of thermally-reduced graphenes

    International Nuclear Information System (INIS)

    Ju, Hae-Mi; Choi, Sung-Ho; Huh, Seung-Hun

    2010-01-01

    Thermally-reduced graphenes (GPs) from graphene oxides (GOs) in the range of 200 - 800 .deg. C have been investigated by using X-ray diffraction (XRD). The temperature-dependent evolutions of the (002) peaks show that exfoliation of GO sheets occurs, along with wrinkling, at ∼200 .deg. C and that high-quality GPs are produced at ∼ 600 .deg. C (GP 600 ). These phenomena are explained by the vaporization of intercalated water molecules and the effective removal of the oxide groups of GO by thermal annealing, respectively. GP 600 exhibited a clean and sharp (002) peak corresponding to an interlayer distance of 3.392 A, which is close to that of conventional graphene (∼3.4 A). The structure of GP 600 is further discussed.

  17. Powder X-ray diffraction laboratory, Reston, Virginia

    Science.gov (United States)

    Piatak, Nadine M.; Dulong, Frank T.; Jackson, John C.; Folger, Helen W.

    2014-01-01

    The powder x-ray diffraction (XRD) laboratory is managed jointly by the Eastern Mineral and Environmental Resources and Eastern Energy Resources Science Centers. Laboratory scientists collaborate on a wide variety of research problems involving other U.S. Geological Survey (USGS) science centers and government agencies, universities, and industry. Capabilities include identification and quantification of crystalline and amorphous phases, and crystallographic and atomic structure analysis for a wide variety of sample media. Customized laboratory procedures and analyses commonly are used to characterize non-routine samples including, but not limited to, organic and inorganic components in petroleum source rocks, ore and mine waste, clay minerals, and glassy phases. Procedures can be adapted to meet a variety of research objectives.

  18. X-ray diffraction study of choline chloride's β form

    International Nuclear Information System (INIS)

    Petrouleas, V.; Lemmon, R.M.; Christensen, A.

    1978-01-01

    The organic salt choline chloride exists in two crystalline polymorphs. One (the α form) is extraordinarily sensitive to ionizing radiation, the other (the β form) is not. The present report describes an x-ray diffraction study of the β form. The structure has been found to be highly disordered face centered cubic. A reasonable least-square refinement of the intensity data has been achieved in the centrosymmetric space group Fm3 or Fm3m by use of a molecular model with restrained bond lengths. The results show that in the β form the electronic density due to the choline cation is closely spaced around the N, so that hydrogen bonding to the chloride is unlikely. Comparison with infrared and NMR data indicates that the disordering is dynamic and can be ascribed to rotations of the choline ion around crystallographic symmetry axes. Possible connections of these results with the radiation stability of the β form are discussed

  19. Analysis of the corium phases by X-ray diffraction

    International Nuclear Information System (INIS)

    Trillon, G.

    2004-01-01

    In the framework of the severe accidents R and D studies led by CEA, the better knowledge of the corium behaviour, corium coming from the melting of a nuclear reactor, are fundamental stakes in order to master this kind of accident. Among the available physical properties of the corium, the nature of the final crystalline compounds which have been made during the, cooling gives information about its solidification and its stabilisation. X-Rays Diffraction is the reference method used in order to characterize the corium coming from the different facilities of the European platform PLINIUS of CEA-Cadarache. This work presents the scientific approach that has been followed in order to obtain information both qualitative and quantitative on corium, using X-Rays Diffraction. For instance, a specific method for identifying U 1-x Zr x O 2 solid solutions has been developed, and the validity of quantitative analysis of corium crystalline phases using the Rietveld method (with an internal standard), has been tested. This last method has also permitted semi-quantitative measurements of amorphous phases within corium. For these studies, analysis of prototypical corium has been conducted on samples coming from the experiences led on the different facilities of the PLINIUS platform. These analysis allowed for the first time to obtain quantitative data of the corium crystalline phases in order to validate thermodynamic databases and has been used to estimate the thereto-physical properties of the corium. New information on crystalline phases of corium has also been found, especially for the UO 2 -ZrO 2 pseudo binary system. (author)

  20. Phosphor Scanner For Imaging X-Ray Diffraction

    Science.gov (United States)

    Carter, Daniel C.; Hecht, Diana L.; Witherow, William K.

    1992-01-01

    Improved optoelectronic scanning apparatus generates digitized image of x-ray image recorded in phosphor. Scanning fiber-optic probe supplies laser light stimulating luminescence in areas of phosphor exposed to x rays. Luminescence passes through probe and fiber to integrating sphere and photomultiplier. Sensitivity and resolution exceed previously available scanners. Intended for use in x-ray crystallography, medical radiography, and molecular biology.

  1. Fabrication techniques of X-ray spiral zone plates

    International Nuclear Information System (INIS)

    Gao Nan; Zhu Xiaoli; Li Hailiang; Xie Changqing

    2010-01-01

    The techniques to make X-ray spiral zone plates using electron beam and X-ray lithography were studied. A master mask was fabricated on polyimide membrane by E-beam lithography and micro-electroplating. Spiral zone plates were efficiently replicated by X-ray lithography and micro-electroplating. By combining the techniques, spiral zone plates at 1 keV were successfully fabricate. With an outermost zone width of the 200 nm, and the gold absorbers thickness of 700 nm, the high quality zone plates can be used for X-ray phase contrast microscopy.(authors)

  2. [X-ray radiographic imaging technique with high dynamic range].

    Science.gov (United States)

    Liu, Bin; Wang, Li-Ming; Su, Xin-Yan

    2014-04-01

    In conventional X-ray radiographic imaging system with a fixed energy parameter, the acquired X-ray images are usually overexposed and have no useful information available. It is due to some constraints, like special structure of component, different attenuation coefficients of materials and dynamic range of optoelectronic devices. When maximum of transmitted X-ray luminous exceed capacity limitation of X-ray radiographic imaging system in one scene, the device up to saturate. Also when minimum of transmitted X-ray luminous is below the thermal noise level of imaging system, no useful information is available for imaging. To solve the problem of difficulties in acquiring transmitted X-ray luminous in a wide dynamic range by conventional X-ray radiographic imaging system, we put forward a new X-ray radiographic imaging technique with high dynamic range based on adjusting tube voltage. In the article, the influence by charge capacity of X-ray radiographic imaging system on effective irradiating thickness is analyzed. Through experiments of some standard samples, we gained the relationship between voltage range of X-ray tube and materials or structure of component for best testing sensitivity. Then we put forward an adjusting strategy of tube voltage and effective subgraphs extraction method from acquired raw X-ray images. By the mentioned method, we carried out X-ray radiographic imaging experiments with high dynamic range for components with thickness from 0 to 20 mm. The results show that X-ray radiographic imaging technique with high dynamic range is effective to realize imaging for some components with different thickness. It is available for us to find more detailed projection information from fusion images.

  3. Nanostructured diffractive optical devices for soft X-ray microscopes

    CERN Document Server

    Hambach, D; Schneider, G

    2001-01-01

    The new transmission X-ray microscope (TXM) installed at the BESSY II electron storage ring uses an off-axis transmission zone plate (OTZ) as diffractive and focusing element of the condenser-monochromator setup. A high resolution micro-zone plate (MZP) forms a magnified image on a CCD-detector. Both, the OTZ with an active area of up to 24 mm sup 2 and the MZP with zone widths as small as 25 nm are generated by a process including electron beam lithography (EBL), dry etching and subsequent electroplating of nickel on top of silicon membrane substrates with about 100-150 nm thickness. The combination of a larger zone width and the usage of nickel zone structures allows to increase the diffraction efficiency of the condenser element at least by a factor of 3 compared to the earlier used KZP7 condenser zone plate in the TXM at BESSY I. Groove diffraction efficiencies of 21.6% and 14.7% were measured for MZP objectives with 40 and 25 nm outermost zone width, respectively.

  4. Ultrafast time-resolved X-ray diffraction using an optimized laser-plasma based X-ray source

    International Nuclear Information System (INIS)

    Lu, Wei

    2013-01-01

    Femtosecond X-ray pulses are invaluable tools to investigate the structural dynamics triggered by a femtosecond laser pulse. These ultrashort X-ray pulses can be provided by lab-sized laser-produced plasma X-ray sources. This thesis is dedicated to optimizing the X-ray emission from the X-ray source at the University of Duisburg-Essen and using this source to investigate ultrafast structural dynamics in laser excited materials. For these purposes, detailed investigations on how the laser intensities, target thicknesses, angles of incidence and different pre-pulse/pre-plasma conditions affecting the emission of Kα-photons from Cu and Ti targets were performed. The outcomes from these studies are applied to optimize the X-ray production of the existing X-ray source for time resolved X-ray diffraction (TRXD) experiments. In the mean time, in order to improve the measurement sensitivity/accuracy, and automatize and speed up the experimental procedures, several other improvements have been implemented in the experimental setup for TRXD experiments. These improvements of the setup are essential to achieve the results of the three TRXD experiments discussed in this thesis. In the first experiment, Debye-Waller effect in a thin laser-excited Au film was observed. The drop of measured diffraction signal with a decay time constant of 4.3±1 ps was measured for high excitation fluences. This result is in good agreement with previous experimental results as well as the Two-Temperature Model (TTM) calculations at high fluences. The second experiment extends the studies of coherent optical phonons in laser-excited Bi to a higher excitation fluence range that has not been investigated previously. Large amplitude coherent atomic motion and a complete softening of the A1g phonon mode were observed. These observations represents conclusive experimental evidence that the Peierls distortion, which defines the equilibrium structure of Bi, vanishes and the material is transformed into

  5. Techniques in X-ray Astronomy

    Indian Academy of Sciences (India)

    This knowledge, or energy spectrum, helps astronomers to look for and determine the. Kulinder Pal Singh is in the Department of. Astronomy and Astro- physics of the Tata. Institute of Fundamental. Research, Mumbai. His primary fields of research are X-ray studies of hot plasmas in stars, super- nova remnants, galaxies,.

  6. Techniques in X-ray Astronomy

    Indian Academy of Sciences (India)

    Kulinder Pal Singh is in the Department of. Astronomy and Astro- physics of the Tata. Institute of Fundamental. Research, Mumbai. His primary fields of research are X-ray studies of hot plasmas in stars, super- nova remnants, galaxies, intergalactic medium in clusters of galaxies, active galactic nuclei, cataclys- mic variables ...

  7. High Pressure X-Ray Diffraction Studies on Nanocrystalline Materials

    Science.gov (United States)

    Palosz, B.; Stelmakh, S.; Grzanka, E.; Gierlotka, S.; Pielaszek, R.; Bismayer, U.; Werner, S.; Palosz, W.

    2003-01-01

    Application of in situ high pressure powder diffraction technique for examination of specific structural properties of nanocrystals based on the experimental data of SiC nanocrystalline powders of 2 to 30 nrn diameter in diameter is presented. Limitations and capabilities of the experimental techniques themselves and methods of diffraction data elaboration applied to nanocrystals with very small dimensions (nanoparticles of different grain size.

  8. Rapid, low dose X-ray diffractive imaging of the malaria parasite Plasmodium falciparum

    Energy Technology Data Exchange (ETDEWEB)

    Jones, Michael W.M., E-mail: michael.jones@latrobe.edu.au [ARC Centre of Excellence for Coherent X-Ray Science, Department of Physics, La Trobe University, Victoria 3086 (Australia); Dearnley, Megan K. [ARC Centre of Excellence for Coherent X-Ray Science, Department of Biochemistry and Molecular Biology, Bio21 Institute, The University of Melbourne, Victoria 3010 (Australia); Riessen, Grant A. van [ARC Centre of Excellence for Coherent X-Ray Science, Department of Physics, La Trobe University, Victoria 3086 (Australia); Abbey, Brian [ARC Centre of Excellence for Coherent X-Ray Science, Department of Physics, La Trobe University, Victoria 3086 (Australia); Melbourne Centre for Nanofabrication, Victoria 3168 (Australia); Putkunz, Corey T. [ARC Centre of Excellence for Coherent X-Ray Science, School of Physics, The University of Melbourne, Victoria 3010 (Australia); Junker, Mark D. [ARC Centre of Excellence for Coherent X-Ray Science, Department of Physics, La Trobe University, Victoria 3086 (Australia); Vine, David J. [Advanced Photon Source, Argonne National Laboratory, Argonne, IL 60439 (United States); McNulty, Ian [Advanced Photon Source, Argonne National Laboratory, Argonne, IL 60439 (United States); Centre for Nanoscale Materials, Argonne National Laboratory, Argonne, Illinois 60439 (United States); Nugent, Keith A. [ARC Centre of Excellence for Coherent X-Ray Science, Department of Physics, La Trobe University, Victoria 3086 (Australia); Peele, Andrew G. [ARC Centre of Excellence for Coherent X-Ray Science, Department of Physics, La Trobe University, Victoria 3086 (Australia); Australian Synchrotron, 800 Blackburn Road, Clayton 3168 (Australia); Tilley, Leann [ARC Centre of Excellence for Coherent X-Ray Science, Department of Biochemistry and Molecular Biology, Bio21 Institute, The University of Melbourne, Victoria 3010 (Australia)

    2014-08-01

    Phase-diverse X-ray coherent diffractive imaging (CDI) provides a route to high sensitivity and spatial resolution with moderate radiation dose. It also provides a robust solution to the well-known phase-problem, making on-line image reconstruction feasible. Here we apply phase-diverse CDI to a cellular sample, obtaining images of an erythrocyte infected by the sexual stage of the malaria parasite, Plasmodium falciparum, with a radiation dose significantly lower than the lowest dose previously reported for cellular imaging using CDI. The high sensitivity and resolution allow key biological features to be identified within intact cells, providing complementary information to optical and electron microscopy. This high throughput method could be used for fast tomographic imaging, or to generate multiple replicates in two-dimensions of hydrated biological systems without freezing or fixing. This work demonstrates that phase-diverse CDI is a valuable complementary imaging method for the biological sciences and ready for immediate application. - Highlights: • Phase-diverse coherent X-ray diffraction microscopy provides high-resolution and high-contrast images of intact biological samples. • Rapid nanoscale resolution imaging is demonstrated at orders of magnitude lower dose than previously possible. • Phase-diverse coherent X-ray diffraction microscopy is a robust technique for rapid, quantitative, and correlative X-ray phase imaging.

  9. X-ray diffraction studies of NbTe 2 single crystal

    Indian Academy of Sciences (India)

    The composition of the grown crystals was confirmed on the basis of energy dispersive analysis by X-ray (EDAX) and remaining structural characterization was also accomplished by X-ray diffraction (XRD) studies. Lattice parameters, volume and X-ray density have been carried out for the grown crystals. The particle size ...

  10. Sequential x-ray diffraction topography at 1-BM x-ray optics testing beamline at the advanced photon source

    Energy Technology Data Exchange (ETDEWEB)

    Stoupin, Stanislav, E-mail: sstoupin@aps.anl.gov; Shvyd’ko, Yuri; Trakhtenberg, Emil; Liu, Zunping; Lang, Keenan; Huang, Xianrong; Wieczorek, Michael; Kasman, Elina; Hammonds, John; Macrander, Albert; Assoufid, Lahsen [Advanced Photon Source, Argonne National Laboratory, Argonne, IL 60439 (United States)

    2016-07-27

    We report progress on implementation and commissioning of sequential X-ray diffraction topography at 1-BM Optics Testing Beamline of the Advanced Photon Source to accommodate growing needs of strain characterization in diffractive crystal optics and other semiconductor single crystals. The setup enables evaluation of strain in single crystals in the nearly-nondispersive double-crystal geometry. Si asymmetric collimator crystals of different crystallographic orientations were designed, fabricated and characterized using in-house capabilities. Imaging the exit beam using digital area detectors permits rapid sequential acquisition of X-ray topographs at different angular positions on the rocking curve of a crystal under investigation. Results on sensitivity and spatial resolution are reported based on experiments with high-quality Si and diamond crystals. The new setup complements laboratory-based X-ray topography capabilities of the Optics group at the Advanced Photon Source.

  11. An autonomous CZT module for X-ray diffraction imaging

    International Nuclear Information System (INIS)

    Montemont, G.; Monnet, O.; Stanchina, S.; Verger, L.; Kosciesza, D.; Schlomka, J.P.

    2013-01-01

    We present the development of a CZT-based detection module dedicated to X-ray diffraction imaging. This kind of application requires a good energy and spatial resolution in order to resolve Bragg peaks. In a first part, we present the detector configuration used and dimensioning constraints. As the input energy range is comprised between 20 and 150 keV, we use 5 mm thick high resistivity CZT crystals. The 660 mm 2 detection area is segmented on both sides into 192 anodes and 12 cathodes. Signals from both sides are read jointly in order to perform multi parametric event corrections (depth of interaction, charge sharing, induction sharing). In order to be integrated easily inside an X-ray imaging system, the system has been conceived to be completely autonomous: it is powered by a single 12 V supply and is interfaced with the external system by Ethernet for communication and RS485 for synchronization. In a second part, we describe the system readout architecture and then the implementation of the data processing. An FPGA circuit embeds a digital processing chain that carries out readout ASIC interfacing and advanced multi parametric data corrections. Gain, offset but also depth of interaction and charge sharing are corrected on the flow. Incoming events from different channels are clustered together by comparing their location and time of occurrence. The FPGA also embeds a processor running an operating system that controls the system, carries out all calibrations, automated tests and acquisitions. Eventually, we show the results obtained and demonstrate the relative influence of depth of interaction and charge sharing. Homogeneity of detector behavior is also discussed and the reproducibility of the performance between modules is presented. The average energy resolution at 25 C is 2.4 % FWHM at 122 keV and 3.8 % FWHM at 60 keV and the average efficiency is 73 %. (authors)

  12. The Use of Small-Angle X-Ray Diffraction Studies for the Analysis of Structural Features in Archaeological Samples

    DEFF Research Database (Denmark)

    Wess, T. J.; Drakopoulos, M.; Snigirev, A.

    2001-01-01

    the potential of a laboratory source is also described. Specific examples of analysis using X-ray diffraction of historic parchment, archaeological bone, a Central Mexico style pictograph and microdiffraction of calcified tissues are used to show the scope and versatility of the technique. Diffraction data......X-ray diffraction or scattering analysis provides a powerful non-destructive technique capable of providing important information about the state of archaeological samples in the nanometer length scale. Small-angle diffraction facilities are usually found at synchrotron sources, although...

  13. Correct interpretation of diffraction properties of quartz crystals for X-ray optics applications

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Xian-Rong; Gog, Thomas; Kim, Jungho; Kasman, Elina; Said, Ayman H.; Casa, Diego M.; Wieczorek, Michael; Hönnicke, Marcelo G.; Assoufid, Lahsen

    2018-02-01

    Quartz has hundreds of strong Bragg reflections that may offer a great number of choices for making fixed-angle X-ray analyzers and polarizers at virtually any hard X-ray energies with selectable resolution. However, quartz crystals, unlike silicon and germanium, are chiral and may thus appear in two different forms of handedness that are mirror images. Furthermore, because of the threefold rotational symmetry along thecaxis, the {h1h2h3L} and {h2h1h3L} Bragg reflections may have quite different Darwin bandwidth, reflectivity and angular acceptance, although they have the same Bragg angle. The design of X-ray optics from quartz crystals therefore requires unambiguous determination of the orientation, handedness and polarity of the crystals. The Laue method and single-axis diffraction technique can provide such information, but the variety of conventions used in the literature to describe quartz structures has caused widespread confusion. The current studies give detailed guidelines for design and fabrication of quartz X-ray optics, with special emphasis on the correct interpretation of Laue patterns in terms of the crystallography and diffraction properties of quartz. Meanwhile, the quartz crystals examined were confirmed by X-ray topography to have acceptably low densities of dislocations and other defects, which is the foundation for developing high-resolution quartz-based X-ray optics.

  14. Identification of inversion domains in KTiOPO{sub 4}via resonant X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Fabrizi, Federica, E-mail: federica.fabrizi@diamond.ac.uk [Diamond Light Source, Harwell Science and Innovation Campus, Didcot, OX11 0DE (United Kingdom); Thomas, Pamela A. [Department of Physics, University of Warwick, Coventry, CV4 7AL (United Kingdom); Nisbet, Gareth; Collins, Stephen P. [Diamond Light Source, Harwell Science and Innovation Campus, Didcot, OX11 0DE (United Kingdom)

    2015-05-14

    The identification and high-resolution mapping of the absolute crystallographic structure in multi-domain ferroelectric KTiOPO{sub 4} is achieved through a novel synchrotron X-ray diffraction method. On a single Bragg reflection, the intensity ratio in resonant diffraction below and above the Ti absorption K edge demonstrates a domain contrast up to a factor of ∼270, thus implementing a non-contact, non-destructive imaging technique with micrometre spatial resolution, applicable to samples of arbitrarily large dimensions. A novel method is presented for the identification of the absolute crystallographic structure in multi-domain polar materials such as ferroelectric KTiOPO{sub 4}. Resonant (or ‘anomalous’) X-ray diffraction spectra collected across the absorption K edge of Ti (4.966 keV) on a single Bragg reflection demonstrate a huge intensity ratio above and below the edge, providing a polar domain contrast of ∼270. This allows one to map the spatial domain distribution in a periodically inverted sample, with a resolution of ∼1 µm achieved with a microfocused beam. This non-contact, non-destructive technique is well suited for samples of large dimensions (in contrast with traditional resonant X-ray methods based on diffraction from Friedel pairs), and its potential is particularly relevant in the context of physical phenomena connected with an absence of inversion symmetry, which require characterization of the underlying absolute atomic structure (such as in the case of magnetoelectric coupling and multiferroics)

  15. High-Resolution Detector For X-Ray Diffraction

    Science.gov (United States)

    Carter, Daniel C.; Withrow, William K.; Pusey, Marc L.; Yost, Vaughn H.

    1988-01-01

    Proposed x-ray-sensitive imaging detector offers superior spatial resolution, counting-rate capacity, and dynamic range. Instrument based on laser-stimulated luminescence and reusable x-ray-sensitive film. Detector scans x-ray film line by line. Extracts latent image in film and simultaneously erases film for reuse. Used primarily for protein crystallography. Principle adapted to imaging detectors for electron microscopy and fluorescence spectroscopy and general use in astronomy, engineering, and medicine.

  16. Two digital X-ray imaging systems for applications in X-ray diffraction

    International Nuclear Information System (INIS)

    Bateman, J.E.; Connolly, J.F.; Stephenson, R.; Flesher, A.C.; Bryant, C.J.; Lincoln, A.D.; Tucker, P.A.; Swanton, S.W.

    1986-08-01

    Two digital X-ray imaging systems developed at the Rutherford Appleton Laboratory are described:- the Mark I and the Mark II. Both use a bidimensionally sensitive Multiwire proportional counter as the basic X-ray image transducer coupled to a digital microcomputer system. The Mark I system provides the advantages of high speed, high sensitivity digital imaging directly into the computer with the potential for software control of the sample orientation and environment. The Mark II system adds the novel features of signal averaging and multi-frame exposures. (author)

  17. Qualitative mineralogical characterization of the sinter by X-ray diffraction

    International Nuclear Information System (INIS)

    Greca, M.C.; Pietroluongo, L.R.V.; Baliza, S.V.; Costa Pereira, E.A. da

    1987-01-01

    This paper aims the qualitative mineralogical characterization of sinters and raw materials employed on its fabrication, via X-ray diffraction technique. Thus, sample with constant coke breeze content and variable contents of sand, limestone, dunite and dolomite were prepared to obtain current sinter compositions, with variable basicity. The tests were performed at the research of the following institutions: Companhia Siderurgica Nacional, Centro de Tecnologia Mineral and Instituto Nacional de Tecnologia. (author) [pt

  18. Diamond Thermal Expansion Measurement Using Transmitted X-ray Back-diffraction.

    OpenAIRE

    Giles, Carlos; Adriano, Cris; Lubambo, Adriana Freire; Cusatis, Cesar; Mazzaro, Irineu; Hönnicke, Marcelo Goncalves

    2015-01-01

    The linear thermal expansion coefficient of diamond has been measured using forward-diffracted profiles in X-ray backscattering. This experimental technique is presented as an alternative way of measuring thermal expansion coefficients of solids in the high-resolution Bragg backscattering geometry without the intrinsic difficulty of detecting the reflected beam. The temperature dependence of the lattice parameter is obtained from the high sensitivity of the transmitted profiles to the Bragg a...

  19. High resolution X-ray diffraction studies on unirradiated and ...

    Indian Academy of Sciences (India)

    ray diffraction techniques are widely used as non- destructive direct methods for analysing defects and dislo- cations in nearly perfect crystals (Lang 1958, 1970; Kato. 1992; Bowen and Tanner 1998). Crystallography has become an integral part ...

  20. The CCP14 project: software for x-ray diffraction analysts

    International Nuclear Information System (INIS)

    Cranswick, L.

    2002-01-01

    Full text: The primary role of the UK EPSRC funded Collaborative Computational Project No 14 for Single Crystal and Powder Diffraction (CCP14) is to provide freely available crystallographic software to academics and students. While the CCP14 routinely concentrates on crystallographic applications (crystal structure solution and structure refinement), there is still a variety of software useful and freely available to X-ray analysts. As it is routinely important for X-ray analysts to keep up to date with effective new methods and time saving improvements, this presentation will concentrate on techniques relevant to most X-ray analysts - from data conversion to unit cell refinement to quantitative analysis and some structure refinement tools. Emphasis will also be put on the fact that crystallographic and powder diffraction programs are best not used as a black box. While point and click software tools are available, it can be very important to understand the theory behind what they are doing. Mentioned software can be downloaded via the CCP14 website in the UK (www.ccp14.ac.uk/mirror/), with full regional mirrors in the USA, Canada and Australia. Copyright (2002) Australian X-ray Analytical Association Inc

  1. Introduction to the application and limits of anomalous X-ray diffraction in the determination of partial structure factors

    International Nuclear Information System (INIS)

    Bienenstock, A.

    1993-01-01

    The use of anomalous X-ray scattering to obtain the first differences and partial structure factors normally obtained with isotopic substitution neutron diffraction is described and compared with the neutron technique. Both the problems associated with the X-ray technique (low-Z problems, scattering factor problems, Compton scattering problems, fluorescence problems, storage ring stability problems) and the situations in which it is highly valuable are discussed. 12 refs

  2. Influence of preferred orientation of minerals in the mineralogical identification process by X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Amanda Luzia da; Oliveira, Arno H. de [Universidade Federal de Minas Gerais (DEN/UFMG), Belo Horizonte, MG (Brazil). Dept. de Engenharia Nuclear; Fernandes, Maria Lourdes Souza, E-mail: lourdesfernandes@ufmg.b [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Inst. de GeoCiencias. Centro de Pesquisa Professor Manoel Teixeira da Costa

    2011-07-01

    The X-ray diffraction corresponds to one of the main techniques for characterization of microstructures in crystalline materials, widely used in the identification of minerals in samples of geological materials. Some minerals have a property called preferred orientation which corresponds to the orientation tendency of the crystals of ground minerals to orient themselves in certain directions according to a preferred crystallographic plane. This property affects the analysis by X-ray diffraction and this fact can generates erroneous results in the characterization. The purpose of this study is to identify the negative influence of the preferred orientation of a mineral in the generation of diffraction patterns obtained in the X-ray diffraction analysis. For this, a sample of muscovite, a mineral of mica group, was prepared by two different methods: the frontal method and the back loading method. In the analysis using the frontal method there was displacement of the XRD pattern in the abscissa axis, where it was observed changes in interplanar distance and angle 2{theta} values, which are essential information for characterization and identification of a mineral. In the analysis using the back loading method, the generated XRD pattern showed no displacement in the axis of abscissas and showed interplanar distance and angle 2{theta} values closer to the real values for the muscovite. The results showed that one can only make improvements to the process of sample preparation minimizing the effect of preferred orientation in the analysis. There is no need to change conditions of diffractometer measurements. (author)

  3. Apparatus development for high-pressure X-ray diffraction using synchrotron radiation

    International Nuclear Information System (INIS)

    Martinez, L.G.; Orlando, M.T.D.; Rossi, J.L.; Passamai Junior, J.L.; Melo, F.C.L.; Ferreira, F.F.

    2006-01-01

    Some phenomena in the field of condensed matter physics can be studied when the matter is submitted to extreme conditions of pressure, magnetic fields or temperatures. Once submitted to these conditions it is generally necessary to measure the properties of the matter in situ. The existence of a synchrotron light laboratory in Brazil opens up the chance of studying materials in extreme conditions by techniques like X-ray diffraction and absorption. However, when compared to high-energy synchrotrons accelerators, the Brazilian source offers a narrower energy range and lower flux. These facts impose limitation to perform diffraction experiments by energy dispersion and, consequently, the use of pressure cells with denser anvils like diamond. However, for a lower-pressure range, preliminary studies showed the viability of measurements in an angular dispersion configuration. This allows the use of silicon carbide anvils B 4C . In this work it is described the development of a hydrostatic pressure cell suitable for X-rays diffraction measurements in the Brazilian Synchrotron Light Laboratory using materials and technologies developed by the institutions and researchers involved in this project (IPEN, UFES, CTA and LNLS). This development can provide the scientific community with the possibility of performing X-ray diffraction measurements under hydrostatic pressure, initially up to 2 GPa, with possibilities of increasing the maximum pressure to higher values, with or without application of magnetic fields and high or low temperatures. (author)

  4. Influence of preferred orientation of minerals in the mineralogical identification process by X-ray diffraction

    International Nuclear Information System (INIS)

    Silva, Amanda Luzia da; Oliveira, Arno H. de; Fernandes, Maria Lourdes Souza

    2011-01-01

    The X-ray diffraction corresponds to one of the main techniques for characterization of microstructures in crystalline materials, widely used in the identification of minerals in samples of geological materials. Some minerals have a property called preferred orientation which corresponds to the orientation tendency of the crystals of ground minerals to orient themselves in certain directions according to a preferred crystallographic plane. This property affects the analysis by X-ray diffraction and this fact can generates erroneous results in the characterization. The purpose of this study is to identify the negative influence of the preferred orientation of a mineral in the generation of diffraction patterns obtained in the X-ray diffraction analysis. For this, a sample of muscovite, a mineral of mica group, was prepared by two different methods: the frontal method and the back loading method. In the analysis using the frontal method there was displacement of the XRD pattern in the abscissa axis, where it was observed changes in interplanar distance and angle 2θ values, which are essential information for characterization and identification of a mineral. In the analysis using the back loading method, the generated XRD pattern showed no displacement in the axis of abscissas and showed interplanar distance and angle 2θ values closer to the real values for the muscovite. The results showed that one can only make improvements to the process of sample preparation minimizing the effect of preferred orientation in the analysis. There is no need to change conditions of diffractometer measurements. (author)

  5. Spectral feature variations in x-ray diffraction imaging systems

    Science.gov (United States)

    Wolter, Scott D.; Greenberg, Joel A.

    2016-05-01

    Materials with different atomic or molecular structures give rise to unique scatter spectra when measured by X-ray diffraction. The details of these spectra, though, can vary based on both intrinsic (e.g., degree of crystallinity or doping) and extrinsic (e.g., pressure or temperature) conditions. While this sensitivity is useful for detailed characterizations of the material properties, these dependences make it difficult to perform more general classification tasks, such as explosives threat detection in aviation security. A number of challenges, therefore, currently exist for reliable substance detection including the similarity in spectral features among some categories of materials combined with spectral feature variations from materials processing and environmental factors. These factors complicate the creation of a material dictionary and the implementation of conventional classification and detection algorithms. Herein, we report on two prominent factors that lead to variations in spectral features: crystalline texture and temperature variations. Spectral feature comparisons between materials categories will be described for solid metallic sheet, aqueous liquids, polymer sheet, and metallic, organic, and inorganic powder specimens. While liquids are largely immune to texture effects, they are susceptible to temperature changes that can modify their density or produce phase changes. We will describe in situ temperature-dependent measurement of aqueous-based commercial goods in the temperature range of -20°C to 35°C.

  6. Federated repositories of X-ray diffraction images.

    Science.gov (United States)

    Androulakis, Steve; Schmidberger, Jason; Bate, Mark A; DeGori, Ross; Beitz, Anthony; Keong, Cyrus; Cameron, Bob; McGowan, Sheena; Porter, Corrine J; Harrison, Andrew; Hunter, Jane; Martin, Jennifer L; Kobe, Bostjan; Dobson, Renwick C J; Parker, Michael W; Whisstock, James C; Gray, Joan; Treloar, Andrew; Groenewegen, David; Dickson, Neil; Buckle, Ashley M

    2008-07-01

    There is a pressing need for the archiving and curation of raw X-ray diffraction data. This information is critical for validation, methods development and improvement of archived structures. However, the relatively large size of these data sets has presented challenges for storage in a single worldwide repository such as the Protein Data Bank archive. This problem can be avoided by using a federated approach, where each institution utilizes its institutional repository for storage, with a discovery service overlaid. Institutional repositories are relatively stable and adequately funded, ensuring persistence. Here, a simple repository solution is described, utilizing Fedora open-source database software and data-annotation and deposition tools that can be deployed at any site cheaply and easily. Data sets and associated metadata from federated repositories are given a unique and persistent handle, providing a simple mechanism for search and retrieval via web interfaces. In addition to ensuring that valuable data is not lost, the provision of raw data has several uses for the crystallographic community. Most importantly, structure determination can only be truly repeated or verified when the raw data are available. Moreover, the availability of raw data is extremely useful for the development of improved methods of image analysis and data processing.

  7. X-Ray Powder Diffraction with Guinier - Haegg Focusing Cameras

    International Nuclear Information System (INIS)

    Brown, Allan

    1970-12-01

    The Guinier - Haegg focusing camera is discussed with reference to its use as an instrument for rapid phase analysis. An actual camera and the alignment procedure employed in its setting up are described. The results obtained with the instrument are compared with those obtained with Debye - Scherrer cameras and powder diffractometers. Exposure times of 15 - 30 minutes with compounds of simple structure are roughly one-sixth of those required for Debye - Scherrer patterns. Coupled with the lower background resulting from the use of a monochromatic X-ray beam, the shorter exposure time gives a ten-fold increase in sensitivity for the detection of minor phases as compared with the Debye - Scherrer camera. Attention is paid to the precautions taken to obtain reliable Bragg angles from Guinier - Haegg film measurements, with particular reference to calibration procedures. The evaluation of unit cell parameters from Guinier - Haegg data is discussed together with the application of tests for the presence of angle-dependent systematic errors. It is concluded that with proper calibration procedures and least squares treatment of the data, accuracies of the order of 0.005% are attainable. A compilation of diffraction data for a number of compounds examined in the Active Central Laboratory at Studsvik is presented to exemplify the scope of this type of powder camera

  8. Power X-ray diffraction under extreme conditions of pressure and temperature

    International Nuclear Information System (INIS)

    Fiquet, G.; Andrault, D.

    1999-01-01

    An important work has been carried out in the field of X-ray diffraction in obtaining accurate structure information from materials at extreme conditions of pressure and temperature. An experimental set-up combining a diamond-anvil high-pressure cell and a laser-heating technique has been installed at the high-pressure beamline ID30 at the ESRF (Grenoble) to study two major constituents of the Earth's deep interior: MgSiO 3 perovskite and iron. Experiments carried out on MgSiO 3 perovskite up to 86 GPa and over 2000 K yielded detailed structural information on this compound under these conditions and thus important constraints for the lower mantle mineralogical model, favouring a mixture of perovskite and magnesiowuestite. X-ray diffraction patterns recorded on imaging plates with micro-focused monochromatic radiation revealed a new high-temperature structure of iron above 40 GPa. (au)

  9. Quantitative strain analysis of surfaces and interfaces using extremely asymmetric x-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Akimoto, Koichi [Graduate School of Engineering, Nagoya University, Nagoya, 464-8603 (Japan); Emoto, Takashi, E-mail: akimoto@nagoya-u.j [Toyota National College of Technology, Toyota, Aichi 471-8525 (Japan)

    2010-12-01

    Strain can reduce carrier mobility and the reliability of electronic devices and affect the growth mode of thin films and the stability of nanometer-scale crystals. To control lattice strain, a technique for measuring the minute lattice strain at surfaces and interfaces is needed. Recently, an extremely asymmetric x-ray diffraction method has been developed for this purpose. By employing Darwin's dynamical x-ray diffraction theory, quantitative evaluation of strain at surfaces and interfaces becomes possible. In this paper, we review our quantitative strain analysis studies on native SiO{sub 2}/Si interfaces, reconstructed Si surfaces, Ni/Si(111)-H interfaces, sputtered III-V compound semiconductor surfaces, high-k/Si interfaces, and Au ion-implanted Si. (topical review)

  10. Medical X-ray techniques in diagnostic radiography. 4. ed.

    International Nuclear Information System (INIS)

    Plaats, G.J. van der; Vijlbrief, P.

    1980-01-01

    A step by step account is given of every aspect of the technical factors involved in the production of X-ray images. Chapter titles include, methods of image formation and laws of projection, sharpness and unsharpness, contrast, perceptibility of detail in the radiographic image-image quality, properties of fluoroscopic screens, radiographic films, intensifying screens and cassettes, image intensification and X-ray television, processing technique, fluoroscopy and radiographic technique in general, special radiographic techniques, radiographic examinations using contrast media, exposure and exposure tables and automatic density control, diagnostic X-ray apparatus, and diagnostic stands and accessories. (C.F.)

  11. Novel spectroscopic techniques with using soft x-ray

    International Nuclear Information System (INIS)

    Gejo, Tatsuo

    2010-01-01

    Recent progress of experimental techniques related to synchrotron radiation makes possible of detail investigation of molecular dynamics after irradiation of soft X-ray. We introduce several novel spectroscopic techniques with using soft X-ray: Symmetry-resolved zero kinetic energy electron spectroscopy, symmetry-resolved metastable photofragment spectroscopy, soft X-ray emission spectroscopy, time-resolved fluorescence spectroscopy, and time-resolved-fluorescence mass-selected-ion coincidence spectroscopy. We also show new techniques performed by other groups at BL27SU in SPring-8. (author)

  12. X-ray streak and framing camera techniques

    International Nuclear Information System (INIS)

    Coleman, L.W.; Attwood, D.T.

    1975-01-01

    This paper reviews recent developments and applications of ultrafast diagnostic techniques for x-ray measurements. These techniques, based on applications of image converter devices, are already capable of significantly important resolution capabilities. Techniques capable of time resolution in the sub-nanosecond regime are being considered. Mechanical cameras are excluded from considerations as are devices using phosphors or fluors as x-ray converters

  13. Study of properties of chemically modified samples of halloysite mineral with X-ray fluorescence and X-ray powder diffraction methods

    International Nuclear Information System (INIS)

    Banaś, D.; Kubala-Kukuś, A.; Braziewicz, J.; Majewska, U.; Pajek, M.; Wudarczyk-Moćko, J.; Czech, K.; Garnuszek, M.; Słomkiewicz, P.; Szczepanik, B.

    2013-01-01

    Elemental and chemical composition of raw and activated samples of halloysite mineral using wavelength dispersive X-ray fluorescence (WDXRF), total reflection X-ray fluorescence (TXRF) and X-ray powder diffraction (XRPD) methods were determined. As the result, it has been shown that application of the complementary X-ray spectrometry techniques allows very precise observation of changes in composition of halloysite mineral samples caused by its chemical modifications. Sample preparation procedure and usability of the research methods applied are described in details. Procedure of activation of raw halloysite mineral samples by etching them in sulfuric acid of various concentrations has been described and discussed. The ability of the samples to adsorb lead from intentionally contaminated water was tested and confirmed. - Author-Highlights: • We measured elemental and chemical composition of raw and activated halloysite mineral samples. • We showed that X-ray techniques allow precise study of changes in the sample composition. • We describe procedure of activation of the samples by etching them in sulfuric acid. • We tested ability of halloysite mineral to absorb lead from contaminated water

  14. PIXE and X-ray diffraction studies in ceramics of the Cuitzeo basin

    International Nuclear Information System (INIS)

    Bucio, L.; Ruvalcaba, J.L.; Filini, A.

    2005-01-01

    The methodology used to carry out the characterization of the ceramic material is based on the employment of two analytical techniques. The first one, X-ray diffraction (XRD), it is used to determine the composition of the present minerals and the general composition of the pastes. The second, X-ray emission induced by protons (PIXE), it is used to determine the composition of trace elements and bigger elements. The combined use of these techniques even allows to differ among ceramic pastes of very similar compositions. Although these techniques can be used in a non destructive way, in the case of ceramic studies it is required of taking a small quantity of sample of the potsherd, this is pulverized to homogenize the material and to carry out the XRD analysis. The same powder can be used to prepare a pellet and to carry out the PIXE analysis. (Author)

  15. X-Ray Diffraction and the Discovery of the Structure of DNA

    Science.gov (United States)

    Crouse, David T.

    2007-01-01

    A method is described for teaching the analysis of X-ray diffraction of DNA through a series of steps utilizing the original methods used by James Watson, Francis Crick, Maurice Wilkins and Rosalind Franklin. The X-ray diffraction pattern led to the conclusion of the basic helical structure of DNA and its dimensions while basic chemical principles…

  16. Modelling the X-ray powder diffraction of nitrogen-expanded austenite using the Debye formula

    DEFF Research Database (Denmark)

    Oddershede, Jette; Christiansen, Thomas; Ståhl, Kenny

    2008-01-01

    Stress-free and homogeneous samples of nitrogen-expanded austenite, a defect-rich f.c.c. structure with a high interstitial nitrogen occupancy (between 0.36 and 0.61), have been studied using X-ray powder diffraction and Debye simulations. The simulations confirm the presence of deformation...... to be indistinguishable to X-ray powder diffraction....

  17. Optimization of an X-ray diffraction imaging system for medical and security applications

    International Nuclear Information System (INIS)

    Marticke, Fanny

    2016-01-01

    X-ray diffraction imaging is a powerful noninvasive technique to identify or characterize different materials. Compared to traditional techniques using X-ray transmission, it allows to extract more material characteristic information, such as the Bragg peak positions for crystalline materials as well as the molecular form factor for amorphous materials. The potential of this technique has been recognized by many researchers and numerous applications such as luggage inspection, nondestructive testing, drug detection and biological tissue characterization have been proposed. The method of energy dispersive X-ray diffraction (EDXRD) is particularly suited for this type of applications as it allows the use of a conventional X-ray tube, the acquisition of the whole spectrum at the same time and parallelized architectures to inspect an entire object in a reasonable time. The purpose of the present work is to optimize the whole material characterization chain. Optimization comprises two aspects: optimization of the acquisition system and of data processing. The last one concerns especially the correction of diffraction pattern degraded by acquisition process. Reconstruction methods are proposed and validated on simulated and experimental spectra. System optimization is realized using figures of merit such as detective quantum efficiency (DQE), contrast to noise ratio (CNR) and receiver operating characteristic (ROC) curves.The first chosen application is XRD based breast imaging which aims to distinguish cancerous tissues from healthy tissues. Two non-multiplexed collimation configurations combining EDXRD and ADXRD are proposed after optimization procedure. A simulation study of the whole system and a breast phantom was realized to determine the required dose to detect a 4 mm carcinoma nodule. The second application concerns detection of illicit materials during security check. The possible benefit of a multiplexed collimation system was examined. (author) [fr

  18. Portable flash X-ray systems: applications and techniques

    International Nuclear Information System (INIS)

    Bryant, L.E.

    1976-01-01

    Three portable flash x-ray equipments are described, and applications such as jet and high explosive studies, bullet impact and lead casting experiments are given as well as techniques for triggering and protection of equipment and film

  19. Use of overlapped reflection for determining the retained austenite by X-ray diffraction

    International Nuclear Information System (INIS)

    Garin, J.L.; Gonzalez, C.F.

    1988-01-01

    Retainec austenite in high-carbon steels has been determined by means of new computation techniques applied to the processing of X-ray diffraction data. Instead of using the traditional procedure based on the weak (200) reflections of martensite and austenite, intensity measurements of the overlapped (110) peak of martensite and (111) peak of austenite were performed. The separation of the peaks was based on a Pearson VII function, which is capable of describing all diffraction profiles. The accuracy of integrated intensities was then improved with the beneficial effects of higher precision in the calculation of the amount of retained austenite. (author) [pt

  20. On the theory of time-resolved x-ray diffraction

    DEFF Research Database (Denmark)

    Henriksen, Niels Engholm; Møller, Klaus Braagaard

    2008-01-01

    We derive the basic theoretical formulation for X-ray diffraction with pulsed fields, using a fully quantized description of light and matter. Relevant time scales are discussed for coherent as well as incoherent X-ray pulses, and we provide expressions to be used for calculation of the experimen......We derive the basic theoretical formulation for X-ray diffraction with pulsed fields, using a fully quantized description of light and matter. Relevant time scales are discussed for coherent as well as incoherent X-ray pulses, and we provide expressions to be used for calculation...... of the experimental diffraction signal for both types of X-ray sources. We present a simple analysis of time-resolved X-ray scattering for direct bond breaking in diatomic molecules. This essentially analytical approach highlights the relation between the signal and the time-dependent quantum distribution...

  1. Investigation of electronic order using resonant soft X-ray diffraction

    International Nuclear Information System (INIS)

    Schlappa, J.

    2006-01-01

    The aim of this PhD work was the application of resonant soft X-ray diffraction technique for the investigation of electronic order in transition metal oxides at the TM L 2,3 -edge, trying to obtain a quantitative understanding of the data. The method was first systematically explored through application to a model system in order to test the feasibility of the technique and to understand of how X-ray optical effects have to be taken into account. Two more complex systems were investigated; stripe order in La 1.8 Sr 0.2 NiO 4 and charge and orbital order in Fe 3 O 4 . The main focus of the work was on the spectroscopic potential of the technique, trying to obtain a level of quantitative description of the data. For X-ray absorption spectroscopy (XAS) from transition metal oxides, cluster configuration interaction calculation provides a powerful and realistic microscopic theory. In the frame work of this thesis cluster theory, considering explicit hybridization effects between the TM-ion and the surrounding oxygen ligands, has been applied for the first time to describe resonant diffraction data. (orig.)

  2. Quantitative determination of minerals in Nevada Test Site samples by x-ray diffraction

    International Nuclear Information System (INIS)

    Pawloski, G.A.

    1983-07-01

    The external standard intensity ratio technique has been developed into a routine procedure for quantitatively determining mineralogic compositions of Nevada Test Site (NTS) samples by x-ray diffraction. This technique used ratios of x-ray intensity peaks from the same run which eliminates many possible errors. Constants have been determined for each of thirteen minerals commonly found in NTS samples - quartz, montmorillonite, illite, clinoptilolite, cristobalite, feldspars, calcite, dolomite, hornblende, kaolinite, muscovite, biotite, and amorphous glass. Ratios of the highest intensity peak of each mineral to be quantified in the sample and the highest intensity peak of quartz are used to calculate sample composition. The technique has been tested on samples with three to eleven components representative of geologic environments at NTS, and is accurate to 7.0 wt % of the total sample. The minimum amount of each of these minerals detectable by x-ray diffraction has also been determined. QUANTS is a computer code that calculates mineral contents and produces a report sheet. Constants for minerals in NTS samples other than those listed above can easily be determined, and added to QUANTS at any time

  3. Investigation of electronic order using resonant soft X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Schlappa, J.

    2006-12-01

    The aim of this PhD work was the application of resonant soft X-ray diffraction technique for the investigation of electronic order in transition metal oxides at the TM L{sub 2,3}-edge, trying to obtain a quantitative understanding of the data. The method was first systematically explored through application to a model system in order to test the feasibility of the technique and to understand of how X-ray optical effects have to be taken into account. Two more complex systems were investigated; stripe order in La{sub 1.8}Sr{sub 0.2}NiO{sub 4} and charge and orbital order in Fe{sub 3}O{sub 4}. The main focus of the work was on the spectroscopic potential of the technique, trying to obtain a level of quantitative description of the data. For X-ray absorption spectroscopy (XAS) from transition metal oxides, cluster configuration interaction calculation provides a powerful and realistic microscopic theory. In the frame work of this thesis cluster theory, considering explicit hybridization effects between the TM-ion and the surrounding oxygen ligands, has been applied for the first time to describe resonant diffraction data. (orig.)

  4. Quantitative firing transformations of a triaxial ceramic by X-ray diffraction methods

    Directory of Open Access Journals (Sweden)

    M. S. Conconi

    2014-12-01

    Full Text Available The firing transformations of traditional (clay based ceramics are of technological and archeological interest, and are usually reported qualitatively or semiquantitatively. These kinds of systems present an important complexity, especially for X-ray diffraction techniques, due to the presence of fully crystalline, low crystalline and amorphous phases. In this article we present the results of a qualitative and quantitative X-ray diffraction Rietveld analysis of the fully crystalline (kaolinite, quartz, cristobalite, feldspars and/or mullite, the low crystalline (metakaolinite and/or spinel type pre-mullite and glassy phases evolution of a triaxial (clay-quartz-feldspar ceramic fired in a wide temperature range between 900 and 1300 ºC. The employed methodology to determine low crystalline and glassy phase abundances is based in a combination of the internal standard method and the use of a nanocrystalline model where the long-range order is lost, respectively. A preliminary sintering characterization was carried out by contraction, density and porosity evolution with the firing temperature. Simultaneous thermo-gravimetric and differential thermal analysis was carried out to elucidate the actual temperature at which the chemical changes occur. Finally, the quantitative analysis based on the Rietveld refinement of the X-ray diffraction patterns was performed. The kaolinite decomposition into metakaolinite was determined quantitatively; the intermediate (980 ºC spinel type alumino-silicate formation was also quantified; the incongruent fusion of the potash feldspar was observed and quantified together with the final mullitization and the amorphous (glassy phase formation.The methodology used to analyze the X-ray diffraction patterns proved to be suitable to evaluate quantitatively the thermal transformations that occur in a complex system like the triaxial ceramics. The evaluated phases can be easily correlated with the processing variables and

  5. Quantitative firing transformations of a triaxial ceramic by X-ray diffraction methods

    Energy Technology Data Exchange (ETDEWEB)

    Conconi, M.S.; Gauna, M.R.; Serra, M.F. [Centro de Tecnologia de Recursos Minerales y Ceramica (CETMIC), Buenos Aires (Argentina); Suarez, G.; Aglietti, E.F.; Rendtorff, N.M., E-mail: rendtorff@cetmic.unlp.edu.ar [Universidad Nacional de La Plata (UNLP), Buenos Aires (Argentina). Fac. de Ciencias Exactas. Dept. de Quimica

    2014-10-15

    The firing transformations of traditional (clay based) ceramics are of technological and archaeological interest, and are usually reported qualitatively or semi quantitatively. These kinds of systems present an important complexity, especially for X-ray diffraction techniques, due to the presence of fully crystalline, low crystalline and amorphous phases. In this article we present the results of a qualitative and quantitative X-ray diffraction Rietveld analysis of the fully crystalline (kaolinite, quartz, cristobalite, feldspars and/or mullite), the low crystalline (metakaolinite and/or spinel type pre-mullite) and glassy phases evolution of a triaxial (clay-quartz-feldspar) ceramic fired in a wide temperature range between 900 and 1300 deg C. The employed methodology to determine low crystalline and glassy phase abundances is based in a combination of the internal standard method and the use of a nanocrystalline model where the long-range order is lost, respectively. A preliminary sintering characterization was carried out by contraction, density and porosity evolution with the firing temperature. Simultaneous thermo-gravimetric and differential thermal analysis was carried out to elucidate the actual temperature at which the chemical changes occur. Finally, the quantitative analysis based on the Rietveld refinement of the X-ray diffraction patterns was performed. The kaolinite decomposition into metakaolinite was determined quantitatively; the intermediate (980 deg C) spinel type alumino-silicate formation was also quantified; the incongruent fusion of the potash feldspar was observed and quantified together with the final mullitization and the amorphous (glassy) phase formation.The methodology used to analyze the X-ray diffraction patterns proved to be suitable to evaluate quantitatively the thermal transformations that occur in a complex system like the triaxial ceramics. The evaluated phases can be easily correlated with the processing variables and materials

  6. Quantitative firing transformations of a triaxial ceramic by X-ray diffraction methods

    International Nuclear Information System (INIS)

    Conconi, M.S.; Gauna, M.R.; Serra, M.F.; Suarez, G.; Aglietti, E.F.; Rendtorff, N.M.

    2014-01-01

    The firing transformations of traditional (clay based) ceramics are of technological and archaeological interest, and are usually reported qualitatively or semi quantitatively. These kinds of systems present an important complexity, especially for X-ray diffraction techniques, due to the presence of fully crystalline, low crystalline and amorphous phases. In this article we present the results of a qualitative and quantitative X-ray diffraction Rietveld analysis of the fully crystalline (kaolinite, quartz, cristobalite, feldspars and/or mullite), the low crystalline (metakaolinite and/or spinel type pre-mullite) and glassy phases evolution of a triaxial (clay-quartz-feldspar) ceramic fired in a wide temperature range between 900 and 1300 deg C. The employed methodology to determine low crystalline and glassy phase abundances is based in a combination of the internal standard method and the use of a nanocrystalline model where the long-range order is lost, respectively. A preliminary sintering characterization was carried out by contraction, density and porosity evolution with the firing temperature. Simultaneous thermo-gravimetric and differential thermal analysis was carried out to elucidate the actual temperature at which the chemical changes occur. Finally, the quantitative analysis based on the Rietveld refinement of the X-ray diffraction patterns was performed. The kaolinite decomposition into metakaolinite was determined quantitatively; the intermediate (980 deg C) spinel type alumino-silicate formation was also quantified; the incongruent fusion of the potash feldspar was observed and quantified together with the final mullitization and the amorphous (glassy) phase formation.The methodology used to analyze the X-ray diffraction patterns proved to be suitable to evaluate quantitatively the thermal transformations that occur in a complex system like the triaxial ceramics. The evaluated phases can be easily correlated with the processing variables and materials

  7. Measuring the X-ray Resolving Power of Bent Potassium Acid Phthalate Diffraction Crystals

    Energy Technology Data Exchange (ETDEWEB)

    Haugh, M. J. [NSTec; Wu, M. [SNL; Jacoby, K. D. [NSTec; Loisel, G. P. [SNL

    2014-11-01

    This report presents the results from measuring the X-ray resolving power of a curved potassium acid phthalate (KAP(001)) spectrometer crystal using two independent methods. It is part of a continuing effort to measure the fundamental diffraction properties of bent crystals that are used to study various characteristics of high temperature plasmas. Bent crystals like KAP(001) do not usually have the same diffraction properties as corresponding flat crystals. Models that do exist to calculate the effect of bending the crystal on the diffraction properties have simplifying assumptions and their accuracy limits have not been adequately determined. The type of crystals that we measured is being used in a spectrometer on the Z machine at Sandia National Laboratories (SNL) in Albuquerque, NM. The first technique for measuring the crystal resolving power measures the X-ray spectral line width of the characteristic lines from several metal anodes. The second method uses a diode X-ray source and a dual goniometer arrangement to measure the reflectivity curve of the KAP(001) crystal. The width of that curve is inversely proportional to the crystal resolving power. The measurement results are analyzed and discussed.

  8. Standard test method for determining the effective elastic parameter for X-ray diffraction measurements of residual stress

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1998-01-01

    1.1 This test method covers a procedure for experimentally determining the effective elastic parameter, Eeff, for the evaluation of residual and applied stresses by X-ray diffraction techniques. The effective elastic parameter relates macroscopic stress to the strain measured in a particular crystallographic direction in polycrystalline samples. Eeff should not be confused with E, the modulus of elasticity. Rather, it is nominally equivalent to E/(1 + ν) for the particular crystallographic direction, where ν is Poisson's ratio. The effective elastic parameter is influenced by elastic anisotropy and preferred orientation of the sample material. 1.2 This test method is applicable to all X-ray diffraction instruments intended for measurements of macroscopic residual stress that use measurements of the positions of the diffraction peaks in the high back-reflection region to determine changes in lattice spacing. 1.3 This test method is applicable to all X-ray diffraction techniques for residual stress measurem...

  9. Ultra-high resolution zone-doubled diffractive X-ray optics for the multi-keV regime.

    Science.gov (United States)

    Vila-Comamala, Joan; Gorelick, Sergey; Färm, Elina; Kewish, Cameron M; Diaz, Ana; Barrett, Ray; Guzenko, Vitaliy A; Ritala, Mikko; David, Christian

    2011-01-03

    X-ray microscopy based on Fresnel zone plates is a powerful technique for sub-100 nm resolution imaging of biological and inorganic materials. Here, we report on the modeling, fabrication and characterization of zone-doubled Fresnel zone plates for the multi-keV regime (4-12 keV). We demonstrate unprecedented spatial resolution by resolving 15 nm lines and spaces in scanning transmission X-ray microscopy, and focusing diffraction efficiencies of 7.5% at 6.2 keV photon energy. These developments represent a significant step towards 10 nm spatial resolution for hard X-ray energies of up to 12 keV.

  10. Computer simulation tools for X-ray analysis scattering and diffraction methods

    CERN Document Server

    Morelhão, Sérgio Luiz

    2016-01-01

    The main goal of this book is to break down the huge barrier of difficulties faced by beginners from many fields (Engineering, Physics, Chemistry, Biology, Medicine, Material Science, etc.) in using X-rays as an analytical tool in their research. Besides fundamental concepts, MatLab routines are provided, showing how to test and implement the concepts. The major difficult in analyzing materials by X-ray techniques is that it strongly depends on simulation software. This book teaches the users on how to construct a library of routines to simulate scattering and diffraction by almost any kind of samples. It provides to a young student the knowledge that would take more than 20 years to acquire by working on X-rays and relying on the available textbooks. In this book, fundamental concepts in applied X-ray physics are demonstrated through available computer simulation tools. Using MatLab, more than eighty routines are developed for solving the proposed exercises, most of which can be directly used in experimental...

  11. Fast X-ray microdiffraction techniques for studying irreversible transformations in materials.

    Science.gov (United States)

    Kelly, Stephen T; Trenkle, Jonathan C; Koerner, Lucas J; Barron, Sara C; Walker, Nöel; Pouliquen, Philippe O; Tate, Mark W; Gruner, Sol M; Dufresne, Eric M; Weihs, Timothy P; Hufnagel, Todd C

    2011-05-01

    A pair of techniques have been developed for performing time-resolved X-ray microdiffraction on irreversible phase transformations. In one technique capillary optics are used to focus a high-flux broad-spectrum X-ray beam to a 60 µm spot size and a fast pixel array detector is used to achieve temporal resolution of 55 µs. In the second technique the X-rays are focused with Kirkpatrick-Baez mirrors to achieve a spatial resolution better than 10 µm and a fast shutter is used to provide temporal resolution better than 20 µs while recording the diffraction pattern on a (relatively slow) X-ray CCD camera. Example data from experiments are presented where these techniques are used to study self-propagating high-temperature synthesis reactions in metal laminate foils.

  12. A standardless method of quantitative ceramic analysis using X-ray powder diffraction

    International Nuclear Information System (INIS)

    Mazumdar, S.

    1999-01-01

    A new procedure using X-ray powder diffraction data for quantitative estimation of the crystalline as well as the amorphous phase in ceramics is described. Classification of the crystalline and amorphous X-ray scattering was achieved by comparison of the slopes at two successive points of the powder pattern at scattering angles at which the crystalline and amorphous phases superimpose. If the second slope exceeds the first by a stipulated value, the intensity is taken as crystalline; otherwise the scattering is considered as amorphous. Crystalline phase analysis is obtained by linear programming techniques using the concept that each observed X-ray diffraction peak has contributions from n component phases, the proportionate analysis of which is required. The method does not require the measurement of calibration data for use as an internal standard, but knowledge of the approximate crystal structure of each phase of interest in the mixture is necessary. The technique is also helpful in qualitative analysis because each suspected phase is characterized by the probability that it will be present when a reflection zone is considered in which the suspected crystalline phase could contribute. The amorphous phases are determined prior to the crystalline ones. The method is applied to ceramic materials and some results are presented. (orig.)

  13. Investigating the Defect Structures in Transparent Conducting Oxides Using X-ray and Neutron Scattering Techniques.

    Science.gov (United States)

    González, Gabriela B

    2012-05-11

    Transparent conducting oxide (TCO) materials are implemented into a wide variety of commercial devices because they possess a unique combination of high optical transparency and high electrical conductivity. Created during the processing of the TCOs, defects within the atomic-scale structure are responsible for their desirable optical and electrical properties. Therefore, studying the defect structure is essential to a better understanding of the behavior of transparent conductors. X-ray and neutron scattering techniques are powerful tools to investigate the atomic lattice structural defects in these materials. This review paper presents some of the current developments in the study of structural defects in n-type TCOs using x-ray diffraction (XRD), neutron diffraction, extended x-ray absorption fine structure (EXAFS), pair distribution functions (PDFs), and x-ray fluorescence (XRF).

  14. Investigating the Defect Structures in Transparent Conducting Oxides Using X-ray and Neutron Scattering Techniques

    Directory of Open Access Journals (Sweden)

    Gabriela B. González

    2012-05-01

    Full Text Available Transparent conducting oxide (TCO materials are implemented into a wide variety of commercial devices because they possess a unique combination of high optical transparency and high electrical conductivity. Created during the processing of the TCOs, defects within the atomic-scale structure are responsible for their desirable optical and electrical properties. Therefore, studying the defect structure is essential to a better understanding of the behavior of transparent conductors. X-ray and neutron scattering techniques are powerful tools to investigate the atomic lattice structural defects in these materials. This review paper presents some of the current developments in the study of structural defects in n-type TCOs using x-ray diffraction (XRD, neutron diffraction, extended x-ray absorption fine structure (EXAFS, pair distribution functions (PDFs, and x-ray fluorescence (XRF.

  15. Application of x-ray techniques in precision farming

    International Nuclear Information System (INIS)

    Arslan, Selcuk; Colvin, Thomas S.; Inanc, Feyzi; Gray, Joseph N.

    2000-01-01

    The precision farming is a relatively new concept basing farming upon quantitative determination of various parameters in the farming practices. One of these parameters is accurate measurement of grain flow rates on real time basis. Although there are various techniques already available for this purpose, x-rays provide a very competitive alternative to the current state of art. In this work, the use of low energy bremsstrahlung x-ray, up to 30 keV, densitometry is demonstrated for grain flow rate measurements. Mass flow rates for corn are related to measured x-ray intensity in gray scale units with a 0.99 correlation coefficient for flow rates ranging from 2 kg/s to 6 kg/s. Higher flow rate values can be measured by using slightly more energetic x-rays or a higher tube current. Measurements were done in real time at a 30 Hz sampling rate. Flow rate measurements are independent of grain moisture due to a negligible change in the x-ray attenuation coefficients at typical moisture content values from 15% to 25%. Grain flow profile changes do not affect measurement accuracy. X-rays easily capture variations in the corn stream. Due to the low energy of the x-ray photons, biological shielding can easily be accomplished with 2 mm thick lead foil or 5 mm of steel

  16. Two digital X-ray imaging systems for applications in X-ray diffraction

    International Nuclear Information System (INIS)

    Bateman, J.E.; Connolly, J.F.; Stephenson, R.; Flesher, A.C.; Tucker, P.A.; Swanton, S.W.

    1987-01-01

    Two digital X-ray imaging systems developed at the Rutherford Appleton Laboratory are described: the Mark I and the Mark II. Both use a bidimensionally sensitive multiwire proportional counter (MWPC) as the basic X-ray image transducer coupled, in the case of the Mark I to a Digital LSI 11-23 microcomputer system via CAMAC, and in the case of the Mark II to a Digital LSI 11-73 microcomputer system via custom-built data acquisition hardware mounted directly on the Q-bus of the microcomputer. The Mark I system provides the advantages of high speed, high sensitivity digital imaging directly into the computer with the potential for software control of the sample orientation and environment. The Mark II system adds the novel features of signal averaging and multiframe exposures. The dedicated digital memories have a resolution of 512x512 pixels of 16 bits, matching well to the spatial resolution of the xenon-filled MWPC (0.5 mm fwhm over an aperture of 200 mm x 200 mm). A 512x512x4 bit video graphics system displays the images in grey scales or colour. (orig.)

  17. Ultrafast lattice dynamics in photoexcited nanostructures. Femtosecond X-ray diffraction with optimized evaluation schemes

    International Nuclear Information System (INIS)

    Schick, Daniel

    2013-01-01

    Within the course of this thesis, I have investigated the complex interplay between electron and lattice dynamics in nanostructures of perovskite oxides. Femtosecond hard X-ray pulses were utilized to probe the evolution of atomic rearrangement directly, which is driven by ultrafast optical excitation of electrons. The physics of complex materials with a large number of degrees of freedom can be interpreted once the exact fingerprint of ultrafast lattice dynamics in time-resolved X-ray diffraction experiments for a simple model system is well known. The motion of atoms in a crystal can be probed directly and in real-time by femtosecond pulses of hard X-ray radiation in a pump-probe scheme. In order to provide such ultrashort X-ray pulses, I have built up a laser-driven plasma X-ray source. The setup was extended by a stable goniometer, a two-dimensional X-ray detector and a cryogen-free cryostat. The data acquisition routines of the diffractometer for these ultrafast X-ray diffraction experiments were further improved in terms of signal-to-noise ratio and angular resolution. The implementation of a high-speed reciprocal-space mapping technique allowed for a two-dimensional structural analysis with femtosecond temporal resolution. I have studied the ultrafast lattice dynamics, namely the excitation and propagation of coherent phonons, in photoexcited thin films and superlattice structures of the metallic perovskite SrRuO 3 . Due to the quasi-instantaneous coupling of the lattice to the optically excited electrons in this material a spatially and temporally well-defined thermal stress profile is generated in SrRuO 3 . This enables understanding the effect of the resulting coherent lattice dynamics in time-resolved X-ray diffraction data in great detail, e.g. the appearance of a transient Bragg peak splitting in both thin films and superlattice structures of SrRuO 3 . In addition, a comprehensive simulation toolbox to calculate the ultrafast lattice dynamics and the

  18. Evaluation of residual stresses in metal matrix composite materials, by the means of neutron and X-ray diffraction

    International Nuclear Information System (INIS)

    Ceretti, M.; Braham, C.

    1996-01-01

    Thermally- as well as mechanically-induced residual stresses in metal matrix composites have been analyzed by the means of two complementary techniques: X-ray diffraction for surface analysis, and neutron diffraction for volume analysis. The residual stress relaxation is examined through in-situ measurements with neutron diffraction. Results from both techniques are well correlated, on condition that the same basic assumptions are used

  19. Single shot diffraction of picosecond 8.7-keV x-ray pulses

    Directory of Open Access Journals (Sweden)

    F. H. O’Shea

    2012-02-01

    Full Text Available We demonstrate multiphoton, single shot diffraction images of x rays produced by inverse Compton scattering a high-power CO_{2} laser from a relativistic electron beam, creating a pulse of 8.7 keV x rays. The tightly focused, relatively high peak brightness electron beam and high photon density from the 2 J CO_{2} laser yielded 6×10^{7} x-ray photons over the full opening angle in a single shot. Single shot x-ray diffraction is performed by passing the x rays though a vertical slit and on to a flat silicon (111 crystal. 10^{2} diffracted photons were detected. The spectrum of the detected x rays is compared to simulation. The diffraction and detection of 10^{2} x rays is a key step to a more efficient time resolved diagnostic in which the number of observed x rays might reach 10^{4}; enabling a unique, flexible x-ray source as a sub-ps resolution diagnostic for studying the evolution of chemical reactions, lattice deformation and melting, and magnetism.

  20. A conical-type X-ray guide tube for diffraction experiments with small crystals

    International Nuclear Information System (INIS)

    Nozaki, Hiroshi; Nakazawa, Hiromoto

    1986-01-01

    The divergence and intensity distribution of X-rays transported through a conical-type X-ray guide tube (XGT) were measured. Diverging X-rays from a point source were condensed by use of the conical-type XGT. The parallelism of X-rays through the XGT was better than that encountered for a cylindrical-type XGT proposed previously. The intensity of the X-ray beam around the central axis of the conical-type XGT was exceedingly high in comparison with that measured without the tube and almost uniform over a cross-sectional area 60 μm in diameter. The high intensity provides the possibility of performing diffraction experiments with crystals as small as 20 μm in diameter with a conventional X-ray diffraction system. (orig.)

  1. 3rd International Conference on X-ray Technique

    Science.gov (United States)

    Potrakhov, N. N.; Gryaznov, A. Yu; Lisenkov, A. A.; Kostrin, D. K.

    2017-02-01

    In this preface a brief history, modern aspects and future tendencies in development of the X-ray technique as seen from the 3rd International Conference on X-ray Technique that was held on 24-25 November 2016 in Saint Petersburg, Russia are described On 24-25 November 2016 in Saint Petersburg on the basis of Saint Petersburg State Electrotechnical University “LETI” n. a. V. I. Ulyanov (Lenin) was held the 3rd International Conference on X-ray Technique. The tradition to hold a similar conference in our country was laid in Soviet times. The last of them, the All-Union Conference on the Prospects of X-ray Tubes and Equipment was organized and held more than a quarter century ago - on 21-23 November 1999, at the initiative and under the leadership of the chief engineer of the Leningrad association of electronic industry “Svetlana” Borovsky Alexander Ivanovich and the chief of special design bureau of X-ray devices of “Svetlana” Shchukin Gennady Anatolievich. The most active part in the organization and work of the conference played members of the department of X-ray and electron beam instruments of Leningrad Electrotechnical Institute “LETI” (the former name of Saint Petersburg State Electrotechnical University “LETI”), represented by head of the department professor Ivanov Stanislav Alekseevich.

  2. Applicability study of x-ray computed tomography technique

    International Nuclear Information System (INIS)

    Tanai, Kenji

    2003-03-01

    Several experiments on the study of high level radioactive waste disposal indirectly measured various physical quantity in the closed test vessel by various sensor. This measurement technique on closed-system cause limit of understanding of mechanisms. Therefore, new observation technique by nondestructive technique such a X-ray computed tomography is necessary for HLW disposal study. In this work, the objective of this study are as follows; (1) to clarify the relationship between dry density of bentonite and CT number, (2) to observed infiltration behaviour of liquid in bentonite specimen using X-ray CT (3) to observed gas migration behaviour in bentonite specimen using X-ray CT. The major conclusions obtained in this study are as follows; (1) CT number of X-ray increases linearly with degree of saturation and density of bentonite specimen. (2) Infiltration behaviour of liquid in bentonite specimen can be observed by X-ray CT. (3) Gas permeability of bentonite with a dry density of 1.6 Mg/m3 is approximately 6 x 10 -20 m 2 . And, this result was almost the same with the other experimental results. But, significant difference of breakthrough phenomena was observed between this test and other experiments results. In visualization study of gas migration through bentonite, gas migration behavior through bentonite was not observed by X-ray CT. (author)

  3. Combined neutron and X-ray diffraction studies of DNA in crystals and solutions.

    Science.gov (United States)

    Leal, Ricardo M F; Callow, Shirley; Callow, Phil; Blakeley, Matthew P; Cardin, Christine J; Denny, William A; Teixeira, Susana C M; Mitchell, Edward P; Forsyth, V Trevor

    2010-11-01

    Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)(2), showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

  4. X-Ray Diffraction Study of Plasma Exposed and Annealed AlSb Bilayer Thin Film

    International Nuclear Information System (INIS)

    Kareem, T. Abdul; Kaliani, A. Anu

    2013-01-01

    Aluminum antimony seems to be a promising semiconducting material for high temperature applications, especially for transistors and P-N junction diodes. Additionally, it is a highly efficient solar material. This paper discusses the plasma induced bilayer diffusion of AlSb bilayer thin films using X-ray diffractogram. AlSb bilayer thin films were prepared on a glass substrate by vacuum evaporation technique. The effect of plasma exposure time and annealing temperature on the micro-structural parameters were investigated. X-ray diffraction studies show that the cubic crystals of Al orient along the (111) plane and the hexagonal crystals of Sb orient along the (003) plane. Newly formed cubic crystals of AlSb are oriented along the (200) plane and they are formed due to the simultaneous growth of Al and Sb crystals during plasma exposure. (plasma technology)

  5. X-ray diffraction studies on single and mixed confectionery fats using synchrotron radiation

    Energy Technology Data Exchange (ETDEWEB)

    MacMillan, S.C.; Roberts, K.J.; Wells, M.; Polgreen, M.; Smith, I. [Heriot-Watt University, Edinburgh, (United Kingdom). Department of Mechanical and Chemical Engineering, Centre for Molecular and Interface Engineering

    1999-12-01

    Full text: Understanding and refining the molecular-scale processes involved in the manufacture of structured materials such as long-chain hydrocarbon compounds is important in many commercial areas such as the petrochemical, biochemical, food, pharmaceutical and soap industries. In such processes crystallisation is an important separation, purification and preparation technique. Despite this our knowledge of the crystallisation process itself is surprisingly limited. In order to improve the crystallisation of confectionery fats, the crystallisation of it`s main component, cocoa butter fat, must be properly understood. Cocoa butter fat can exhibit up to 6 polymorphic forms of different crystallographic structures with melting points varying from 17.3 deg C to 36.3 deg C. During the production of chocolate it is essential to control the polymorphic form of fats present, in order to produce a final product with the correct physical and rheological properties. Both shear rate and temperature are thought to play a crucial role in this process. The most widely used method for studying polymorphism is X-ray diffraction. Typical X-ray diffraction patterns of fats exhibit two groups of diffraction lines corresponding to the long and short spacings. The long spacings correspond to the planes formed by the methyl end groups and are dependent on the chain length and the angle of tilt of the component fatty acids of the glyceride molecules. The short spacings refer to the cross sectional packing of the hydrocarbon chain and are independent of the chain length. The relationship between crystallisation rate, polymorphic form, shear and the fat composition has for the first time been quantified, which will enable more accurate control of the polymorhic form in chocolate production. This has been achieved by developing an improved in-situ cell for X-ray studies. The X-ray studies are necessary for the examination of on-line studies under well controlled conditions of temperature

  6. X-ray diffraction studies on single and mixed confectionery fats using synchrotron radiation

    International Nuclear Information System (INIS)

    MacMillan, S.C.; Roberts, K.J.; Wells, M.; Polgreen, M.; Smith, I.

    1999-01-01

    Full text: Understanding and refining the molecular-scale processes involved in the manufacture of structured materials such as long-chain hydrocarbon compounds is important in many commercial areas such as the petrochemical, biochemical, food, pharmaceutical and soap industries. In such processes crystallisation is an important separation, purification and preparation technique. Despite this our knowledge of the crystallisation process itself is surprisingly limited. In order to improve the crystallisation of confectionery fats, the crystallisation of it's main component, cocoa butter fat, must be properly understood. Cocoa butter fat can exhibit up to 6 polymorphic forms of different crystallographic structures with melting points varying from 17.3 deg C to 36.3 deg C. During the production of chocolate it is essential to control the polymorphic form of fats present, in order to produce a final product with the correct physical and rheological properties. Both shear rate and temperature are thought to play a crucial role in this process. The most widely used method for studying polymorphism is X-ray diffraction. Typical X-ray diffraction patterns of fats exhibit two groups of diffraction lines corresponding to the long and short spacings. The long spacings correspond to the planes formed by the methyl end groups and are dependent on the chain length and the angle of tilt of the component fatty acids of the glyceride molecules. The short spacings refer to the cross sectional packing of the hydrocarbon chain and are independent of the chain length. The relationship between crystallisation rate, polymorphic form, shear and the fat composition has for the first time been quantified, which will enable more accurate control of the polymorhic form in chocolate production. This has been achieved by developing an improved in-situ cell for X-ray studies. The X-ray studies are necessary for the examination of on-line studies under well controlled conditions of temperature

  7. Measurement of thickness of thin films by the X-ray diffraction method

    International Nuclear Information System (INIS)

    Srinivasan, C.; Balasingh, C.; Singh, A.K.

    1979-07-01

    X-ray diffraction method can be used to measure the thickness of thin films (coatings). The principle and the experimental details of the x-ray diffraction methods are described. The intensities of the diffracted beams are derived assuming a random orientation of the crystallites in the diffracting medium. Consequently, the expressions are not valid when the sample has preferred orientation. To check the performance of the method, thicknesses of nickel deposits on mild steel plates were determined by the x-ray diffraction method and the results compared with those obtained by the weighing method and metallographic examination. The weighing method which gives an accuracy of +- 0.1 micron is taken as the standard. The x-ray diffraction methods and the metallographic examinations give values within +- 1 micron of the value obtained by the weighing method. (author)

  8. Investigation of hepatic fibrosis in rats with x-ray diffraction enhanced imaging

    International Nuclear Information System (INIS)

    Li Hui; Zhang Lu; Wang Xueyan; Luo Shuqian; Wang Tailing; Wang Baoen; Zhao Xinyan

    2009-01-01

    X-ray diffraction enhanced imaging (DEI) is a phase contrast technique that generates excellent contrast of biological soft tissues compared to conventional absorption radiography. We explore the application of DEI in the diagnosis of hepatic fibrosis. The produced refraction contrast images of fibrous rat liver samples show clearly abnormal liver architectures. Moreover, by comparing to histological pictures, different stages of fibrosis are discriminated, and the corresponding morphological features are analyzed. Besides, quantitative analyses of texture features are presented. The results reported herein show that DEI can be a potential noninvasive technique to diagnose and stage hepatic fibrosis

  9. A three-dimensional X-ray diffraction microscope for deformation studies of polycrystals

    DEFF Research Database (Denmark)

    Fæster Nielsen, Søren; Lauridsen, E.M.; Juul Jensen, D.

    2001-01-01

    -dimensional X-ray diffraction (3DXRD) microscope installed at the European Synchrotron Radiation Facility in Grenoble provides a fast and non-destructive technique for mapping the embedded grains within thick samples in three dimensions. All essential features like the position, volume, orientation, stress......-state of the grains can be determined, including the morphology of the grain boundaries. The accuracy of this novel tracking technique is compared with electron microscopy (EBSP), and its 3-D capacity is demonstrated. (C) 2001 Elsevier Science B.V. All rights reserved....

  10. An x-ray technique for precision laser beam synchronization

    International Nuclear Information System (INIS)

    Landen, O.L.; Lerche, R.A.; Hay, R.G.; Hammel, B.A.; Kalantar, D.; Cable, M.D.

    1994-01-01

    A new x-ray technique for recording the relative arrival times of multiple laser beams at a common target with better than ± 10 ps accuracy has been implemented at the Nova laser facility. 100 ps, 3ω Nova beam are focused to separate locations on a gold ribbon target viewed from the side. The measurement consists of using well characterized re-entrant x-ray streak cameras for 1-dimensional streaked imaging of the > 3 keV x-rays emanating from these isolated laser plasmas. After making the necessary correction for the differential laser, x-ray and electron transit times involved, timing offsets as low as ± 7 ps are resolved, and on subsequent shots, corrected for, verified and independently checked. This level of synchronization proved critical in meeting the power balance requirements for indirectly-driven pulse-shaped Nova implosions

  11. High Pressure X-Ray Diffraction Studies of Nanocrystalline Materials

    Science.gov (United States)

    Palosz, B.; Stel'makh, S.; Grzanka, E.; Gierlotka, S.; Palosz, W.

    2004-01-01

    Experimental evidence obtained for a variety of nanocrystalline materials suggest that the crystallographic structure of a very small size particle deviates from that in the bulk crystals. In this paper we show the effect of the surface of nanocrystals on their structure by the analysis of generation and distribution of macro- and micro-strains at high pressures and their dependence on the grain size in nanocrystalline powders of Sic. We studied the structure of Sic nanocrystals by in-situ high-pressure powder diffraction technique using synchrotron and neutron sources and hydrostatic or isostatic pressure conditions. The diffraction measurements were done in HASYLAB at DESY using a Diamond Anvil Cell (DAC) in the energy dispersive geometry in the diffraction vector range up to 3.5 - 4/A and under pressures up to 50 GPa at room temperature. In-situ high pressure neutron diffraction measurements were done at LANSCE in Los Alamos National Laboratory using the HIPD and HIPPO diffractometers with the Paris-Edinburgh and TAP-98 cells, respectively, in the diffraction vector range up to 26 Examination of the response of the material to external stresses requires nonstandard methodology of the materials characterization and description. Although every diffraction pattern contains a complete information on macro- and micro-strains, a high pressure experiment can reveal only those factors which contribute to the characteristic diffraction patterns of the crystalline phases present in the sample. The elastic properties of powders with the grain size from several nm to micrometers were examined using three methodologies: (l), the analysis of positions and widths of individual Bragg reflections (used for calculating macro- and micro-strains generated during densification) [I], (2). the analysis of the dependence of the experimental apparent lattice parameter, alp, on the diffraction vector Q [2], and (3), the atomic Pair Distribution Function (PDF) technique [3]. The results

  12. X-ray micro diffraction study on mesostructured silica thin films

    CERN Document Server

    Noma, T; Miyata, H; Iida, A

    2001-01-01

    The local structure of highly ordered mesostructured silica films was investigated by using a synchrotron X-ray microbeam and a CCD X-ray detector. Two-dimensional X-ray diffraction patterns clearly showed the detailed arrangement of the mesostructures, in which the hexagonal mesochannels aligned uniaxially in the mesostructured silica films formed on a silica glass substrate with a rubbing-treated thin polyimide coating. The alignment direction was shown to be perpendicular to the rubbing direction. The grazing incidence condition revealed the structural anisotropy of the mesostructures, while normal incidence X-ray diffraction data indicated the in-plane structural uniformity of the films. Extra spots were observed in the diffraction patterns. This suggested that the X-ray beam reflected at the boundary of the mesostructured silica film and the substrate.

  13. Structural Investigations of Nanowires Using X-Ray Diffraction

    DEFF Research Database (Denmark)

    Stankevic, Tomas

    Advancements in growth of the nanowire-based devices opened another dimension of possible structures and material combinations, which nd their applications in a wide variety of elds, including everyday life. Characterization of such devices brings its own challenges and here we show that X-rays oer...

  14. (X-ray diffraction experiments with condenser matter)

    Energy Technology Data Exchange (ETDEWEB)

    Coppens, P.

    1990-01-01

    This report discusses research on the following topics: high-{Tc} superconductors; The response of crystal to an applied electric field; quasicrystals; surface structure and kinetics of surface layer formation; EXAFS studies of superconductors and heterostructures; effect of iron on the crystal structure of perovskite; x-ray detector development; and SAXS experiments. (LSP)

  15. Characterization of Japanese color sticks by energy dispersive X-ray fluorescence, X-ray diffraction and Fourier transform infrared analysis

    International Nuclear Information System (INIS)

    Manso, M.; Valadas, S.; Pessanha, S.; Guilherme, A.; Queralt, I.; Candeias, A.E.; Carvalho, M.L.

    2010-01-01

    This work comprises the use of energy dispersive X-ray fluorescence (EDXRF), X-ray diffraction (XRD) and Fourier transformed infrared (FTIR) techniques for the study of the composition of twentieth century traditional Japanese color sticks. By using the combination of analytical techniques it was possible to obtain information on inorganic and organic pigments, binders and fillers present in the sticks. The colorant materials identified in the sticks were zinc and titanium white, chrome yellow, yellow and red ochre, vermillion, alizarin, indigo, Prussian and synthetic ultramarine blue. The results also showed that calcite and barite were used as inorganic mineral fillers while Arabic gum was the medium used. EDXRF offered great potential for such investigations since it allowed the identification of the elements present in the sample preserving its integrity. However, this information alone was not enough to clearly identify some of the materials in study and therefore it was necessary to use XRD and FTIR techniques.

  16. Electronic structure of nanoscale Cu/Pt alloys: A combined X-ray diffraction and X-ray absorption investigations

    International Nuclear Information System (INIS)

    Chen Xing; Chu Wangsheng; Cai Quan; Xia Dingguo; Wu Zhonghua; Wu Ziyu

    2006-01-01

    PVP-protected Cu/Pt clusters were prepared by glycol/water reduction method and characterized with transmission electron microscopy (TEM), X-ray diffraction (XRD) and absorption spectra. TEM and XRD analysis show that the Cu/Pt clusters with different molar ratio have fcc structure with particle size of about 4 nm, while the lattice parameters in these clusters reduce with increasing Cu concentration. From the X-ray absorption near edge structure (XANES) at Cu-K edge and Pt-L 2,3 edge, we demonstrate that the d-electronic states of Cu and Pt are affected by the local environment as a function of Cu/Pt molar ratio. With increasing Cu concentration, Pt loses a fraction of 5d electrons and the hybridization between p- and d-states at Cu sites is enhanced

  17. Electronic structure of nanoscale Cu/Pt alloys: A combined X-ray diffraction and X-ray absorption investigations

    Energy Technology Data Exchange (ETDEWEB)

    Chen Xing [Beijing Synchrotron Radiation Facility, Institute of High Energy Physics, CAS, Beijing (China); Graduate School of the Chinese Academy of Sciences, 100864 Beijing (China); Chu Wangsheng [Beijing Synchrotron Radiation Facility, Institute of High Energy Physics, CAS, Beijing (China); University of Science and Technology of China, Hefei, 230036 (China); Cai Quan [Beijing Synchrotron Radiation Facility, Institute of High Energy Physics, CAS, Beijing (China); Graduate School of the Chinese Academy of Sciences, 100864 Beijing (China); Xia Dingguo [College of Environmental and Energy Engineering, Beijing University of Technology, 100022 Beijing (China); Wu Zhonghua [Beijing Synchrotron Radiation Facility, Institute of High Energy Physics, CAS, Beijing (China); Wu Ziyu [Beijing Synchrotron Radiation Facility, Institute of High Energy Physics, CAS, Beijing (China) and National Center for Nanoscience and Technology (China)]. E-mail: wuzy@ihep.ac.cn

    2006-11-15

    PVP-protected Cu/Pt clusters were prepared by glycol/water reduction method and characterized with transmission electron microscopy (TEM), X-ray diffraction (XRD) and absorption spectra. TEM and XRD analysis show that the Cu/Pt clusters with different molar ratio have fcc structure with particle size of about 4 nm, while the lattice parameters in these clusters reduce with increasing Cu concentration. From the X-ray absorption near edge structure (XANES) at Cu-K edge and Pt-L{sub 2,3} edge, we demonstrate that the d-electronic states of Cu and Pt are affected by the local environment as a function of Cu/Pt molar ratio. With increasing Cu concentration, Pt loses a fraction of 5d electrons and the hybridization between p- and d-states at Cu sites is enhanced.

  18. X-ray Diffraction Crystal Calibration and Characterization

    International Nuclear Information System (INIS)

    Haugh, Michael J.; Stewart, Richard; Kugland, Nathan

    2009-01-01

    National Security Technologies X-ray Laboratory is comprised of a multi-anode Manson type source and a Henke type source that incorporates a dual goniometer and XYZ translation stage. The first goniometer is used to isolate a particular spectral band. The Manson operates up to 10 kV and the Henke up to 20 kV. The Henke rotation stages and translation stages are automated. Procedures have been developed to characterize and calibrate various NIF diagnostics and their components. The diagnostics include X-ray cameras, gated imagers, streak cameras, and other X-ray imaging systems. Components that have been analyzed include filters, filter arrays, grazing incidence mirrors, and various crystals, both flat and curved. Recent efforts on the Henke system are aimed at characterizing and calibrating imaging crystals and curved crystals used as the major component of an X-ray spectrometer. The presentation will concentrate on these results. The work has been done at energies ranging from 3 keV to 16 keV. The major goal was to evaluate the performance quality of the crystal for its intended application. For the imaging crystals we measured the laser beam reflection offset from the X-ray beam and the reflectivity curves. For the curved spectrometer crystal, which was a natural crystal, resolving power was critical. It was first necessary to find sources of crystals that had sufficiently narrow reflectivity curves. It was then necessary to determine which crystals retained their resolving power after being thinned and glued to a curved substrate

  19. Interaction between lipid monolayers and poloxamer 188: An X-ray reflectivity and diffraction study

    DEFF Research Database (Denmark)

    Wu, G.H.; Majewski, J.; Ege, C.

    2005-01-01

    The mechanism by which poloxamer 188 (P188) seals a damaged cell membrane is examined using the lipid monolayer as a model system. X-ray reflectivity and grazing-incidence x-ray diffraction results show that at low nominal lipid density, P188, by physically occupying the available area and phase ...

  20. X-ray diffraction studies of NbTe2 single crystal

    Indian Academy of Sciences (India)

    Unknown

    X-ray (EDAX) and remaining structural characterization was also accomplished by X-ray diffraction (XRD) studies. Lattice parameters, volume and ... The layered structure compound, NbTe2, is one of the typical materials which lead to charge .... financial assistance to carry out this work. References. Brown B E 1966 Acta ...

  1. Impact of sub-pixelation within CdZnTe detectors for x-ray diffraction imaging systems

    Science.gov (United States)

    Tabary, J.; Paulus, C.; Montémont, G.; Verger, L.

    2017-05-01

    X-ray diffraction is known to be an effective technique for illicit materials detection in baggage screening, as it can reveal molecular structural information of any solid substances but also of liquids, aerosols and gels. Some X-ray diffraction systems using 2D pixelated spectrometric detectors, such as CdZnTe detectors, are then able to perform 3D baggage scanning in time compatible with bag throughput constraints of airports. However, X-ray diffraction systems designed for baggage screening generally suffer from poor photon count statistics and bad spatial resolution, because of the tight collimations and the small scattering angle. To improve these factors, techniques of sub-pixelation can be implemented in CdZnTe detectors. Indeed, sub-pixelation enables to open the collimation without angular resolution degradation and also to segment the inspected volume in several sub-volumes, inducing a better spatial resolution in the X-ray beam direction. In this paper, we present some experiments demonstrating the interest of sub-pixelation within CdZnTe detectors for X-ray diffraction imaging systems. In particular, an experimental demonstration is presented with a 2D XRD image of a realistic baggage performed with only one single pixel from our own CdZnTe based imager.

  2. Calculated efficiencies of three-material low stress coatings for diffractive x-ray transmission optics

    International Nuclear Information System (INIS)

    Kubec, Adam; Braun, Stefan; Gawlitza, Peter; Menzel, Maik; Leson, Andreas

    2016-01-01

    Diffractive X-ray optical elements made by thin film coating techniques such as multilayer Laue lenses (MLL) and multilayer zone plates (MZP) are promising approaches to achieve resolutions in hard X-ray microscopy applications of less than 10 nm. The challenge is to make a lens with a large numerical aperture on the one hand and a decent working distance on the other hand. One of the limiting factors with the coated structures is the internal stress in the films, which can lead to significant bending of the substrate and various types of unwanted diffraction effects. Several approaches have been discussed to overcome this challenge. One of these is a three-material combination such as Mo/MoSi 2 /Si, where four single layers per period are deposited. Mo and Si represent the absorber and spacer in this case while MoSi 2 forms a diffusion barrier; in addition the thicknesses of absorber and spacer are chosen to minimize residual stress of the overall coating. Here the diffraction efficiency as well as the profile of the beam in the focal plane are discussed in order to find a tradeoff between lowest residual stress and best diffraction properties.

  3. Calculated efficiencies of three-material low stress coatings for diffractive x-ray transmission optics

    Energy Technology Data Exchange (ETDEWEB)

    Kubec, Adam, E-mail: adam.kubec@iws.fraunhofer.de; Braun, Stefan; Gawlitza, Peter; Menzel, Maik; Leson, Andreas [Fraunhofer IWS Dresden, Winterbergstr. 28, 01277 Dresden (Germany)

    2016-07-27

    Diffractive X-ray optical elements made by thin film coating techniques such as multilayer Laue lenses (MLL) and multilayer zone plates (MZP) are promising approaches to achieve resolutions in hard X-ray microscopy applications of less than 10 nm. The challenge is to make a lens with a large numerical aperture on the one hand and a decent working distance on the other hand. One of the limiting factors with the coated structures is the internal stress in the films, which can lead to significant bending of the substrate and various types of unwanted diffraction effects. Several approaches have been discussed to overcome this challenge. One of these is a three-material combination such as Mo/MoSi{sub 2}/Si, where four single layers per period are deposited. Mo and Si represent the absorber and spacer in this case while MoSi{sub 2} forms a diffusion barrier; in addition the thicknesses of absorber and spacer are chosen to minimize residual stress of the overall coating. Here the diffraction efficiency as well as the profile of the beam in the focal plane are discussed in order to find a tradeoff between lowest residual stress and best diffraction properties.

  4. Simultaneous X-ray imaging and diffraction study of shock propagation and phase transition in silicon

    Science.gov (United States)

    Galtier, Eric

    2017-06-01

    X-ray phase contrast imaging technique using a free electron laser have observed the propagation of laser-driven shock waves directly inside materials. While providing images with few hundred nanometers spatial resolution, access to more quantitative information like the material density and the various shock front speeds remain challenging due to imperfections in the images limiting the convergence in the reconstruction algorithm. Alternatively, pump-probe X-ray diffraction (XRD) is a robust technique to extract atomic crystalline structure of compressed matter, providing insight into the kinetics of phase transformation and material response to stress. However, XRD by itself is not sufficient to extract the equation of state of the material under study. Here we report on the use of the LCLS free electron laser as a source of a high-resolution X-ray microscopy enabling the direct imaging of shock waves and phase transitions in optically opaque silicon. In this configuration, no algorithm is necessary to extract the material density and the position of the shock fronts. Simultaneously, we probed the crystalline structure via XRD of the various phases in laser compressed silicon. E. Galtier, B. Nagler, H. J. Lee, S. Brown, E. Granados, A. Hashim, E. McBride, A. Mackinnon, I. Nam, J. Zimmerman (SLAC) A. Gleason (Stanford, LANL) A. Higginbotham (University of York) A. Schropp, F. Seiboth (DESY).

  5. Depth-selective structural analysis of thin films using total-external-reflection x-ray diffraction.

    Science.gov (United States)

    Kawamura, Tomoaki; Omi, Hiroo

    2010-12-01

    Total-external-reflection (TER) x-ray diffraction is the depth-sensitive technique for evaluating layered structures, including epitaxial heterostructures, ion-doped bulk crystals and several quantum-well structures. This technique can control the depth of observation by changing both incident and exit angles of x-rays from the surface. In this review, the principle of the TER technique and measurement apparatus are briefly described, and applications of layered-semiconductor samples evaluated using the TER technique are introduced.

  6. The microscopic structure of liquid mercury from neutron and x-ray diffraction

    International Nuclear Information System (INIS)

    Bafile, U.

    1999-01-01

    Complete text of publication follows. New neutron and X-ray diffraction investigations of the microscopic structure of liquid mercury were recently carried out. The direct comparison of the structure factors S(Q) measured with the two techniques showing a very good agreement, is reported here. It is also shown that, by exploiting the very good stability of the D20 neutron diffractometer at ILL, Grenoble, the very small density effects due to pressurization of mercury up to 2 kbar can be detected to obtain the first neutron measurement of the isothermal density derivative of S(Q), which is a very sensitive probe of the interaction law in liquid systems. (author)

  7. A CMOS active pixel sensor system for laboratory- based x-ray diffraction studies of biological tissue

    International Nuclear Information System (INIS)

    Bohndiek, Sarah E; Cook, Emily J; Arvanitis, Costas D; Olivo, Alessandro; Royle, Gary J; Clark, Andy T; Prydderch, Mark L; Turchetta, Renato; Speller, Robert D

    2008-01-01

    X-ray diffraction studies give material-specific information about biological tissue. Ideally, a large area, low noise, wide dynamic range digital x-ray detector is required for laboratory-based x-ray diffraction studies. The goal of this work is to introduce a novel imaging technology, the CMOS active pixel sensor (APS) that has the potential to fulfil all these requirements, and demonstrate its feasibility for coherent scatter imaging. A prototype CMOS APS has been included in an x-ray diffraction demonstration system. An industrial x-ray source with appropriate beam filtration is used to perform angle dispersive x-ray diffraction (ADXRD). Optimization of the experimental set-up is detailed including collimator options and detector operating parameters. Scatter signatures are measured for 11 different materials, covering three medical applications: breast cancer diagnosis, kidney stone identification and bone mineral density calculations. Scatter signatures are also recorded for three mixed samples of known composition. Results are verified using two independent models for predicting the APS scatter signature: (1) a linear systems model of the APS and (2) a linear superposition integral combining known monochromatic scatter signatures with the input polychromatic spectrum used in this case. Cross validation of experimental, modelled and literature results proves that APS are able to record biologically relevant scatter signatures. Coherent scatter signatures are sensitive to multiple materials present in a sample and provide a means to quantify composition. In the future, production of a bespoke APS imager for x-ray diffraction studies could enable simultaneous collection of the transmitted beam and scattered radiation in a laboratory-based coherent scatter system, making clinical transfer of the technique attainable

  8. X-ray grazing incidence diffraction from multilayers

    Energy Technology Data Exchange (ETDEWEB)

    Tixier, S.; Boeni, P.; Swygenhoven, H. van; Horisberger, M. [Paul Scherrer Inst. (PSI), Villigen (Switzerland)

    1997-09-01

    Grazing incidence scattering geometries using synchrotron radiation have been applied in order to characterise the roughness profiles and the structural coherence of multilayers. The lateral correlation length of the roughness profiles was evaluated using diffuse reflectivity in the `out of plane` geometry. This type of measurement is the only diffuse reflectivity technique allowing large lateral momentum transfer. It is typically suitable for correlation lengths smaller than 1000 A. The lateral structural coherence length of Ni{sub 3}Al/Ni multilayers as a function of the layer thickness was obtained by grazing incidence diffraction (GID). 3 figs., 1 ref.

  9. Application of the X-ray fluorescence analysis and X-ray diffraction in geochemical studies of the Pleistocene tills from Holy Cross Mountains

    Science.gov (United States)

    Kubala-Kukuś, A.; Ludwikowska-Kȩdzia, M.; Banaś, D.; Braziewicz, J.; Majewska, U.; Pajek, M.; Wudarczyk-Moćko, J.

    2013-12-01

    X-ray fluorescence analysis methods (wavelength dispersive X-ray fluorescence analysis (WDXRF) and total reflection X-ray fluorescence (TXRF)) and X-ray powder diffraction (XRPD) have been applied in complementary geochemical studies of the Pleistocene till samples. The XRPD technique gave information about the mineral composition of the analyzed samples while the WDXRF and TXRF studies allowed the fast elemental analysis. The till samples were collected from different regions of Holy Cross Mountains (located in central Poland) which are still not unambiguously described in the context of the geochemical studies of the Quaternary sediments. The analysis was concentrated on the geochemical composition of the till samples both for materials occurring on the surface (characterized by continuous weathering processes) and for samples taken from core borehole. The overriding purpose of these studies is determination of the local lithotype of the tills and its lithologic and petrographic diagnostic properties, including the chemical composition of clay and minerals found in the clay. In the presented work the experimental sets up, sample preparation procedure and measurements programme will be discussed in details. Finally, the elemental and mineral compositions will be presented for studied different groups of the samples.

  10. X-ray diffraction analysis of residual stress in zirconia dental composites

    Science.gov (United States)

    Allahkarami, Masoud

    Dental restoration ceramic is a complex system to be characterized. Beside its essential biocompatibility, and pleasant appearance, it requires being mechanically strong in a catastrophic loading environment. Any design is restricted with geometry boundary and material property limits. Inspired by natural teeth, a multilayer ceramic is a smart way of achieving an enhanced restoration. Bi-layers of zirconia core covered by porcelain are known as one of the best multilayer restorations. Residual stresses may be introduced into a bi-layer dental ceramic restoration during its entire manufacturing process due to thermal expansion and elastic property mismatch. It is impossible to achieve a free of residual stresses bi-layer zirconia-porcelain restoration. The idea is to take the advantage of residual stress in design in such a way to prevent the crack initiation and progression. The hypothesis is a compressive residual stress at external contact surface would be enabling the restoration to endure a greater tensile stress. Optimizing the layers thickness, manufacturing process, and validating 3D simulations require development of new techniques of thickness, residual stresses and phase transformation measurement. In the present work, a combined mirco-tomography and finite element based method were adapted for thickness measurement. Two new 2D X-ray diffraction based techniques were adapted for phase transformation area mapping and combined phase transformation and residual stress measurement. Concerning the complex geometry of crown, an efficient method for X-ray diffraction data collection mapping on a given curved surface was developed. Finally a novel method for 3D dimensional x-ray diffraction data collection and visualization were introduced.

  11. Comparison of dissimilarity measures for cluster analysis of X-ray diffraction data from combinatorial libraries

    Science.gov (United States)

    Iwasaki, Yuma; Kusne, A. Gilad; Takeuchi, Ichiro

    2017-12-01

    Machine learning techniques have proven invaluable to manage the ever growing volume of materials research data produced as developments continue in high-throughput materials simulation, fabrication, and characterization. In particular, machine learning techniques have been demonstrated for their utility in rapidly and automatically identifying potential composition-phase maps from structural data characterization of composition spread libraries, enabling rapid materials fabrication-structure-property analysis and functional materials discovery. A key issue in development of an automated phase-diagram determination method is the choice of dissimilarity measure, or kernel function. The desired measure reduces the impact of confounding structural data issues on analysis performance. The issues include peak height changes and peak shifting due to lattice constant change as a function of composition. In this work, we investigate the choice of dissimilarity measure in X-ray diffraction-based structure analysis and the choice of measure's performance impact on automatic composition-phase map determination. Nine dissimilarity measures are investigated for their impact in analyzing X-ray diffraction patterns for a Fe-Co-Ni ternary alloy composition spread. The cosine, Pearson correlation coefficient, and Jensen-Shannon divergence measures are shown to provide the best performance in the presence of peak height change and peak shifting (due to lattice constant change) when the magnitude of peak shifting is unknown. With prior knowledge of the maximum peak shifting, dynamic time warping in a normalized constrained mode provides the best performance. This work also serves to demonstrate a strategy for rapid analysis of a large number of X-ray diffraction patterns in general beyond data from combinatorial libraries.

  12. High-k Gate Dielectric Films Studied by Extremely Asymmetric X-ray Diffraction and X-ray Photoelectron Spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Ito, Yuki [Graduate School of Engineering, Nagoya University, Nagoya, 464-8603 (Japan); Akimoto, Koichi [Graduate School of Engineering, Nagoya University, Nagoya, 464-8603 (Japan); Yoshida, Hironori [Graduate School of Engineering, Nagoya University, Nagoya, 464-8603 (Japan); Emoto, Takashi [Toyota National College of Technology, Toyota, Aichi 471-8525 (Japan); Kobayashi, Daisuke [Institute of Space and Astronautical Science, Sagamihara, Kanagawa 229-8510 (Japan); Hirose, Kazuyuki [Institute of Space and Astronautical Science, Sagamihara, Kanagawa 229-8510 (Japan)

    2007-10-15

    We studied HfAlO{sub x}(N)/SiO{sub 2}/Si films which were fabricated by the layer-by-layer deposition and annealing (LL-D and A) method with different annealing conditions. In this time, in-situ annealing was performed at various temperatures in an NH{sub 3} ambient. In addition, post-deposition annealing (PDA) was performed for some samples. For each sample, the interfacial lattice strain was evaluated using extremely asymmetric X-ray diffraction and the local dielectric constant near the Al atoms was measured by X-ray photoelectron spectroscopy (XPS). Observation of the strain field was done by measuring the X-ray rocking curve of the Si 113 reflection of the Si (001) substrate under grazing incidence conditions. It was found that in the case of the samples without PDA, for higher in-situ annealing temperatures compressive strain is introduced and the local dielectric constant becomes lower. For the samples with PDA, the differences of the lattice strain and the local dielectric constant are small for different in-situ annealing temperatures.

  13. Powder Handling Device for X-ray Diffraction Analysis with Minimal Sample Preparation, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — This project consists of developing a Vibrating Sample Holder (VSH) for planetary X-Ray Diffraction (XRD) instruments. The principle of this novel sample handling...

  14. Powder Handling Device for X-ray Diffraction Analysis with Minimal Sample Preparation, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — This project consists in developing a Vibrating Powder Handling System for planetary X-Ray Diffraction instruments. The principle of this novel sample handling...

  15. State-of-the-art and problems of X-ray diffraction analysis of biomacromolecules

    International Nuclear Information System (INIS)

    Andreeva, N. S.

    2006-01-01

    The state-of-the-art of X-ray diffraction studies of biomacromolecules is briefly characterized, and the challenge imposed by science is discussed. These studies are characterized by a wide scope and extensive use. This field of science is of great interest and is developed in many countries. The main purpose is to solve practical problems in medicine consisting in the design of drugs against various diseases. X-ray diffraction analysis of enzymes brought the pharmaceutical industry to a new level, thus allowing the rational design of drugs against formerly untreatable diseases. Modern X-ray diffraction studies of biomacromolecules laid the basis for a new science called structural biology. This method allows one to solve fundamental problems of physical chemistry for a new state of matter existing in living systems. Here, science poses numerous problems in analysis of X-ray diffraction data on biological macromolecules. Many of theses problems are in their infancy

  16. X-ray and neutron techniques for nanomaterials characterization

    CERN Document Server

    2016-01-01

    Fifth volume of a 40 volume series on nanoscience and nanotechnology, edited by the renowned scientist Challa S.S.R. Kumar. This handbook gives a comprehensive overview about X-ray and Neutron Techniques for Nanomaterials Characterization. Modern applications and state-of-the-art techniques are covered and make this volume an essential reading for research scientists in academia and industry.

  17. Analysis of diatomaceous earth by x-ray fluorescence techniques

    International Nuclear Information System (INIS)

    Parker, J.

    1985-01-01

    The use of diatomaceous earth in industry as filtering aids, mineral fillers, catalyst carriers, chromatographic supports, and paint additives is well documented. The diatomite matrix is well suited to x-ray analysis, but this application has not been cited in the literature. In our laboratory, x-ray fluorescence spectrometry has been used to support the analytical needs of diatomite product development. Lithium borate fusion and pressed powder techniques have been used to determine major, minor, and trace elements in diatomite and synthetic silicate samples. Conventional matrix correction models and fundamental parameters have been used to reduce x-ray measurements to accurate chemical analyses. Described are sample and standard preparation techniques, data reduction methods, applications, and results

  18. Study of polymorphism of Atenolol and Captopril antihypertensives using x-ray powder diffraction and Rietveld refinement

    Science.gov (United States)

    Sato, Juliana; Ferreira, Fabio

    2013-03-01

    Characterization of bulk drugs has become increasingly important in the pharmaceutical industry. X-ray powder diffractometry is an effective technique for the identification of crystalline solid-phase drugs. The technique is unique, since it combines specificity with a high degree of accuracy for the characterization of pharmaceuticals in solid state and is an especially useful method to describe the possible polymorphic behavior of drugs substances. In this work X-ray diffraction data have been obtained for two well-known antihypertensive drugs currently being administered in tablet form. They include atenolol and captopril. Atenolol and captopril were purchased from drugstore. The characterizations of the atenolol and captopril samples were carried out by FTIR spectroscopy and X-ray powder diffraction (XRPD). We would like to thank the Brazilian agencies CNPq and FAPESP for their financial support.

  19. Crystallization and preliminary X-ray diffraction study of phosphoribosyl pyrophosphate synthetase from E. Coli

    Energy Technology Data Exchange (ETDEWEB)

    Timofeev, V. I., E-mail: inna@ns.crys.ras.ru; Abramchik, Yu. A., E-mail: tostars@mail.ru; Zhukhlistova, N. E., E-mail: ugama@yandex.ru; Kuranova, I. P. [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation)

    2015-09-15

    Enzymes of the phosphoribosyl pyrophosphate synthetase family (PRPPS, EC 2.7.6.1) catalyze the formation of 5-phosphoribosyl pyrophosphate (5-PRPP) from adenosine triphosphate and ribose 5-phosphate. 5-Phosphoribosyl pyrophosphate is an important intermediate in the synthesis of purine, pyrimidine, and pyridine nucleotides, as well as of the amino acids histidine and tryptophan. The crystallization conditions for E. coli PRPPS were found by the vapor-diffusion technique and were optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals grown by the counter-diffusion technique using a synchrotron radiation source to 3.1-Å resolution. The crystals of PRPPS belong to sp. gr. P6{sub 3}22 and have the following unit-cell parameters: a = b = 104.44 Å, c = 124.98 Å, α = β = 90°, γ = 120°. The collected X-ray diffraction data set is suitable for the solution of the three-dimensional structure of PRPPS at 3.1-Å resolution.

  20. Analysis of synchrotron X-ray diffraction patterns from fluorotic enamel samples

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, Ana P.G.; Braz, Delson, E-mail: anapaulagalmeida@gmail.co [Coordenacao dos Programas de Pos-graduacao de Engenharia (COPPE/UFRJ), Rio de Janeiro, RJ (Brazil). Lab. de Instrumentacao Nuclear; Colaco, Marcos V.; Barroso, Regina C., E-mail: cely@uerj.b [Universidade do Estado do Rio de Janeiro (UERJ), RJ (Brazil). Inst. de Fisica; Porto, Isabel M., E-mail: belporto@ig.com.b [Universidade Estadual de Campinas (UNICAMP), Piracicaba, SP (Brazil). Faculdade de Odontologia; Gerlach, Raquel F., E-mail: rfgerlach@forp.usp.b [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Odontologia; Droppa Junior, Roosevelt, E-mail: rdroppa@lnls.b [Associacao Brasileira de Tecnologia de Luz Sincrotron (ABTLuS), Campinas, SP (Brazil)

    2009-07-01

    With the introduction of fluoride as the main anticaries agent used in preventive dentistry, and perhaps an increase in fluoride in our food chain, dental fluorosis has become an increasing world-wide problem. Visible signs of fluorosis begin to become obvious on the enamel surface as opacities, implying some porosity in the tissue. The mechanisms that conduct the formation of fluorotic enamel are unknown, but should involve modifications in the basics physical-chemistry reactions of demineralisation and remineralisation of the enamel of the teeth, which is the same reaction of formation of the enamel's hydroxyapatite (HAp) in the maturation phase. The increase of the amount of fluoride inside of the apatite will result in gradual increase of the lattice parameters. The hexagonal symmetry seems to work well with the powder diffraction data, and the crystal structure of HAp is usually described in space group P63/m. The aim of this work is to characterize the healthy and fluorotic enamel in human tooth using technique Synchrotron X-ray diffraction in order to determine the crystal structure and crystallinity of on fluoroapatite (FAp) crystal present in fluoritic enamel. All the scattering profile measurements was carried out at the X-ray diffraction beamline (XRD1) at the National Synchrotron Light Laboratory - LNLS, Campinas, Brazil. (author)

  1. X-ray diffraction of mineralogical composition of mudstones from eastern Gadaref area, Sudan

    International Nuclear Information System (INIS)

    Karimeldin, Yassin Ahmed A.

    1996-09-01

    This study reviews the theoretical and experimental aspects of X-ray diffraction (XRD) technique. Moreover, the mineralogical composition of some mudstones from Gadarif region has been investigated using DIFFRAC-AT software package, by means of searching and matching procedure in the standard XRD patterns edited by International Center for Diffraction Data (ICDD). The X-ray diffraction analysis of the Gadarif mudstones revealed that quartz, kaolinite and tridymite are the major mineral constitutes of these rocks. Whereas other minerals like alunite, coalingate, cristabolite, gutsvechite, hematite, meta-alungen, minamite, monteponite, samarskite, chlorie, illite and smectite represent minor constituents in some samples. Most of the mudstone samples investigated have kaolinite content between 71-100%. This most properly indicates that these rocks were subjected to intense weathering and leaching under warm humid climate. These conditions seems to be less favourable for the formation of clay minerals chlorite, illite and smectite. Generally, the clay mineral types, abundances and distribution appear to be influenced mainly by source rock geology, local environment and climate. Moreover, the high silica content of mudstones reflects the influence of both hydrothermal and weathering process. The high haolinite of these mudstone might suggest a good potential for economic exploitation of the kaoline deposits. Further studies, however, might be needed to investigate other technical properties. Suggestions for further work by XRD are given, and include further additions to the refinement procedures and the purchasing of new computer facilities.(Author)

  2. Quantitative 3D imaging of whole, unstained cells by using X-ray diffraction microscopy.

    Science.gov (United States)

    Jiang, Huaidong; Song, Changyong; Chen, Chien-Chun; Xu, Rui; Raines, Kevin S; Fahimian, Benjamin P; Lu, Chien-Hung; Lee, Ting-Kuo; Nakashima, Akio; Urano, Jun; Ishikawa, Tetsuya; Tamanoi, Fuyuhiko; Miao, Jianwei

    2010-06-22

    Microscopy has greatly advanced our understanding of biology. Although significant progress has recently been made in optical microscopy to break the diffraction-limit barrier, reliance of such techniques on fluorescent labeling technologies prohibits quantitative 3D imaging of the entire contents of cells. Cryoelectron microscopy can image pleomorphic structures at a resolution of 3-5 nm, but is only applicable to thin or sectioned specimens. Here, we report quantitative 3D imaging of a whole, unstained cell at a resolution of 50-60 nm by X-ray diffraction microscopy. We identified the 3D morphology and structure of cellular organelles including cell wall, vacuole, endoplasmic reticulum, mitochondria, granules, nucleus, and nucleolus inside a yeast spore cell. Furthermore, we observed a 3D structure protruding from the reconstructed yeast spore, suggesting the spore germination process. Using cryogenic technologies, a 3D resolution of 5-10 nm should be achievable by X-ray diffraction microscopy. This work hence paves a way for quantitative 3D imaging of a wide range of biological specimens at nanometer-scale resolutions that are too thick for electron microscopy.

  3. Three-dimensional grain structure of sintered bulk strontium titanate from X-ray diffraction contrast tomography

    DEFF Research Database (Denmark)

    Syha, M.; Rheinheimer, W.; Bäurer, M.

    2012-01-01

    The three-dimensional grain boundary network of sintered bulk strontium titanate is reconstructed using X-ray diffraction contrast tomography, a non-destructive technique for determining the grain shape and crystallographic orientation in polycrystals that is ideally suited for detailed studies...

  4. Hydrogen bond nature of ferroelectric material studied by X-ray and neutron diffraction. Electric dipole moment and proton tunneling

    International Nuclear Information System (INIS)

    Noda, Yukio; Kiyanagi, Ryoji; Mochida, Tomoyuki; Sugawara, Tadashi

    2006-01-01

    Hydrogen bond nature of MeHPLN and BrHPLN is studied using x-ray and neutron diffraction technique. We found that electric dipole moment of hydrogen atom plays an important role for the phase transition, and proton tunneling model is confirmed on this isolated hydrogen bond system. (author)

  5. Neutron and X-ray diffraction from modulated structures

    International Nuclear Information System (INIS)

    Harris, P.

    1994-07-01

    This thesis describes X-ray and neutron scattering experiments performed on two examples of modulated structures. After an introduction to the subject of modulated structures, the thesis is divided in three parts. A single crystal elastic neutron scattering experiment between 4.2 and 115 Κ has been performed and four-circle X-ray data have been collected at 8 Κ for the monoclinic low-temperature phase of the layered perovskite PAMC. The results from the neutron scattering experiment indicate that magnetoelastic effects influence the ordering of the crystal. The X-ray experiments have made it possible to determine the crystal structure in the low-temperature phase. The superspace group is P2 1 /b(β-30)Os, with β = 1/3. A small-angle neutron scattering experiment has been performed on the magnetic structure of manganese silicide. When a magnetic field is applied, the modulation vectors turn towards the field direction, showing domain growth and diverging peak widths as they approach the field direction. Phase 'A' is established to have the modulation vectors directed perpendicular to the field direction. Cooling in zero field shows increasing peak widths at low temperatures, indicating a lock-in transition below the lowest reached temperature. To be able to analyse the data of the magnetic order in MnSi, and analytical calculation of the three dimensional resolution function for a small-angle neutron scattering spectrometer has been performed. The calculation is done by application of a combination of phase space analysis and Gaussian approximations for the neutron distribution as well as for the transmission functions of the different apertures. A finite mosaic spread of the crystal and finite correlation widths of the Bragg reflections have been included in the cross section. (au) (3 tabs., 48 ills., 100 refs.)

  6. New structural studies of liquid crystal by reflectivity and resonant X-ray diffraction; Nouvelles etudes structurales de cristaux liquides par reflectivite et diffraction resonante des rayons X

    Energy Technology Data Exchange (ETDEWEB)

    Fernandes, P

    2007-04-15

    This memory presents three structural studies of smectic Liquid Crystals by reflectivity and resonant diffraction of X-rays. It is divided in five chapters. In the first a short introduction to Liquid Crystals is given. In particular, the smectic phases that are the object of this study are presented. The second chapter is consecrated to the X-ray experimental techniques that were used in this work. The three last chapters present the works on which this thesis can be divided. Chapter three demonstrates on free-standing films of MHPOBC (historic liquid crystal that possesses the antiferroelectric sub-phases) the possibility to extend the technique of resonant X-ray diffraction to liquid crystals without resonant element. In the fourth chapter the structure of the B{sub 2} liquid crystal phase of bent-core molecules (or banana molecules) is elucidated by using resonant X-ray diffraction combined with polarization analysis of the diffracted beam. A model of the polarization of the resonant beam diffracted by four different structures proposed for the B{sub 2} phase is developed in this chapter. In the fifth chapter a smectic binary mixture presenting a very original critical point of phase separation is studied by X-ray reflectivity and optical microscopy. A concentration gradient in the direction perpendicular to the plane of the film seems to be induced by the free-standing film geometry. The results of a simplified model of the system are compatible with this interpretation.

  7. Combination of Raman, infrared, and X-ray energy-dispersion spectroscopies and X-ray d diffraction to study a fossilization process

    Energy Technology Data Exchange (ETDEWEB)

    Sousa Filho, Francisco Eduardo de [Departamento de Fisica, Universidade Regional do Cariri, Crato, CE (Brazil); Joao Herminio da Silva [Universidade Federal do Ceara, Cariri, Juazeiro do Norte, CE (Brazil); Saraiva, Antonio Alamo Feitosa; Brito, Deyvid Dennys S. [Departamento de Ciencias Biologicas, Universidade Regional do Cariri, Crato, CE (Brazil); Viana, Bartolomeu Cruz [Departamento de Fisica, Universidade Federal do Piaui, Teresina, PI, (Brazil); Abagaro, Bruno Tavares de Oliveira; Freire, Paulo de Tarso Cavalcante, E-mail: tarso@fisica.ufc.br [Departamento de Fisica, Universidade Federal do Ceara, Fortaleza, CE (Brazil)

    2011-12-15

    X-ray diffraction was combined with X-ray energy-dispersion, Fourier-transform infrared, and Raman spectroscopies to study the fossilization of a Cretaceous specimen of the plant Brachyphyllum castilhoi, a fossil from the Ipubi Formation, in the Araripe Sedimentary Basin, Northeastern Brazil. Among the possible fossilization processes, which could involve pyrite, silicon oxide, calcium oxide, or other minerals, we were able to single out pyritization as the central mechanism producing the fossil, more than 100 million years ago. In addition to expanding the knowledge of the Ipubi Formation, this study shows that, when combined with other experimental techniques, Raman spectroscopy is a valuable tool at the paleontologist's disposal. (author)

  8. The complementary nature of x-ray photoelectron spectroscopy and angle-resolved x-ray diffraction part II: Analysis of oxides on dental alloys

    Science.gov (United States)

    Kerber, S. J.; Barr, T. L.; Mann, G. P.; Brantley, W. A.; Papazoglou, E.; Mitchell, J. C.

    1998-06-01

    X-ray photoelectron spectroscopy (XPS) and angle-resolved x-ray diffraction (ARXRD) were used to analyze the oxide layer on three palladium-gallium-based dental casting alloys. The oxide layers were approximately 10 Μm thick. The use of the techniques helped to determine which mechanism was responsible for oxide formation—either (a) oxide layer growth via diffusion of oxygen through the scale to the metal, causing the scale to grow at the metal-oxide interface, or (b) an oxide layer formed by metal ions diffusing through the scale to the surface and reacting with oxygen, causing the scale to grow at the oxide-air interface. The oxide growth mechanisms were correlated to previous layer adhesion results determined with biaxial flexure testing.

  9. Investigation of Pink Tourmalines by X-ray Fluorescent Technique

    International Nuclear Information System (INIS)

    Sangariyavanich, A.; Na Songkhla, S.; Pimjum, S.

    1998-01-01

    X-ray fluorescent technique has been employed in the study of trace elements in six samples of gamma irradiated pink tourmalines, namely, red-pink (rubellite), light-pink, orange-pink, brownish orange-pink, purple red and purple orange-pink. The analysis of their characteristic X-ray indicated the existence of manganese in all samples. Trace amounts of iron, zinc, lead, bismuth or gallium were also investigated in certain samples. Since these elements were not present in red-pink tourmaline, therefore, we believed that manganese is the major cause of pink color in tourmaline while other elements produce various types of pink color

  10. Evaluation of In-Vacuum Imaging Plate Detector for X-Ray Diffraction Microscopy

    International Nuclear Information System (INIS)

    Nishino, Yoshinori; Takahashi, Yukio; Yamamoto, Masaki; Ishikawa, Tetsuya

    2007-01-01

    We performed evaluation tests of a newly developed in-vacuum imaging plate (IP) detector for x-ray diffraction microscopy. IP detectors have advantages over direct x-ray detection charge-coupled device (CCD) detectors, which have been commonly used in x-ray diffraction microscopy experiments, in the capabilities for a high photon count and for a wide area. The detector system contains two IPs to make measurement efficient by recording data with the one while reading or erasing the other. We compared speckled diffraction patterns of single particles taken with the IP and a direct x-ray detection CCD. The IP was inferior to the CCD in spatial resolution and in signal-to-noise ratio at a low photon count

  11. Progress in X-ray synchrotron diffraction studies of muscle contraction. Ch. 19

    International Nuclear Information System (INIS)

    Wakabayashi, Katsuzo

    1991-01-01

    This chapter provides a review of applications of synchrotron radiation (SR) to X-ray diffraction studies on the dynamic aspects of muscle contraction and is, at the same time, a progress report on the technical developments specifically related to muscle research. The introduction of SR as an intense X-ray source and the development of high ability detectors have led to enormous improvement in the quality of data from time-resolved X-ray diffraction studies of muscle contraction. The X-ray diffraction pattern taken during contraction shows that the force generation of a muscle proceeds upon interaction of the incommensurate structures of the thin and thick filaments. In this framework a distinct intensity change of the weaker reflections from the thin filaments was detected. However, there was still no strong evidence of direct physical attachment of myosin heads to actin during contraction. (author). 170 refs.; 52 figs.; 3 tabs

  12. Background removal in X-ray fiber diffraction patterns

    International Nuclear Information System (INIS)

    Millane, R.P.; Arnott, S.

    1985-01-01

    Background can be a major source of error in measurement of diffracted intensities in fiber diffraction patterns. Errors can be large when poorly oriented less-crystalline specimens give diffraction patterns with little uncontaminated background. A method for estimating and removing a general global background in such cases is described and illustrated with an example. (orig.)

  13. Neutron and X-ray diffraction measurements on micro- and nano-sized precipitates embedded in a Ni-based superalloy and after their extraction from the alloy

    International Nuclear Information System (INIS)

    Gilles, R.; Mukherji, D.; Hoelzel, M.; Strunz, P.; Toebbens, D.M.; Barbier, B.

    2006-01-01

    Neutron and X-ray diffraction are eminently suitable techniques to determine lattice misfit in nickel-based superalloys. Due to the different measuring techniques and sensitivities of the probes, sometimes one method is preferable to the other. This paper demonstrates how the use of neutrons allows a better determination of the misfit value in a bulk single-crystal tungsten-rich nickel superalloy with oriented precipitates than the use of X-rays, although the resolution in neutron diffraction is generally inferior to that in X-ray diffraction. It also yields more accurate results when the precipitates are at the nanoscale. The neutron measurements were carried out using a special technique to detect a larger number of reflections in single-crystal samples than observed in standard diffraction geometry. A comparison of the measurements by neutron and X-ray diffraction of precipitates separated from the bulk is also included in the investigation

  14. Probing deformation substructure by synchrotron X-ray diffraction and dislocation dynamics modelling.

    Science.gov (United States)

    Korsunsky, Alexander M; Hofmann, Felix; Song, Xu; Eve, Sophie; Collins, Steve P

    2010-09-01

    Materials characterization at the nano-scale is motivated by the desire to resolve the structural aspects and deformation behavior at length scales relevant to those mechanisms that define the novel and unusual properties of nano-structured materials. A range of novel techniques has recently become accessible with the help of synchrotron X-ray beams that can be focused down to spot sizes of less than a few microns on the sample. The unique combination of tunability (energy selection), parallelism and brightness of synchrotron X-ray beams allows their use for high resolution diffraction (determination of crystal structure and transformations, analysis of dislocation sub-structures, orientation and texture analysis, strain mapping); small angle X-ray scattering (analysis of nano-scale voids and defects; orientation analysis) and imaging (radiography and tomography). After a brief review of the state-of-the-art capabilities for monochromatic and white beam synchrotron diffraction, we consider the usefulness of these techniques for the task of bridging the gap between experiment and modeling. Namely, we discuss how the experiments can be configured to provide information relevant to the validation and improvement of modeling approaches, and also how the results of various simulations can be post-processed to improve the possibility of (more or less) direct comparison with experiments. Using the example of some recent experiments carried out on beamline 116 at Diamond Light Source near Oxford, we discuss how such experimental results can be interpreted in view and in conjunction with numerical deformation models, particularly those incorporating dislocation effects, e.g., finite-element based pseudo-continuum strain gradient formulations, and discrete dislocation simulations. Post-processing of FE and discrete dislocation simulations is described, illustrating the kind of information that can be extracted from comparisons between modeling and experimental data.

  15. Portable flash x-ray systems: applications and techniques

    International Nuclear Information System (INIS)

    Bryant, L.E. Jr.

    1976-01-01

    Three energies of portable flash x-ray equipment are described, and applications such as jetting and high explosive studies, bullet impact and casting of lead experiments are given as well as techniques for triggering and protection of equipment and film

  16. Colloquium on X-ray gamma and positron tomographic techniques

    International Nuclear Information System (INIS)

    During this colloquium a new aera concerning the γ and β + radiation emission tomography is explored. This technique of slower development than X-ray tomography will not exclude in a near future news instruments for physiologic and pathologic studies. Sixteen papers are presented on this topic [fr

  17. Determination of precise X-ray diffraction angles by fast Fourier transform

    International Nuclear Information System (INIS)

    Tokita, S.; Kojima, T.

    1987-01-01

    A new analytical method is presented for the separation of two or more closely overlapping X-ray diffraction lines using the narrowly distributed Gaussian function and one-dimensional fast Fourier transform pair. To test the method, the diffraction lines associated with characteristic Kα 1 and Kα 2 rays are measured by an X-ray diffractometer using a Brazilian quartz powder as a standard sample. It is found that the observed diffraction lines can be completely separated into Kα 1 and Kα 2 lines and that the accuracy of those diffraction angles is better than 2x10 -4 . (orig.)

  18. Characterization of nanowires by coherent X-ray diffractive imaging and ptychography

    International Nuclear Information System (INIS)

    Dzhigaev, Dmitry

    2017-03-01

    Imaging techniques are of paramount importance for our understanding of the universe. From galaxies and stars explored by huge telescopes down to micro and nanostructures studied by microscopes, imaging systems provide invaluable scientific information. When an object under investigation has a size of about 100 nanometers, X-rays become a perfect probe for non-destructive imaging. The manufacturing process of image forming lenses for X-rays becomes much more complicated comparing to optical ones. Therefore, ''lensless'' techniques which rely on the coherent properties of radiation were developed. With third generation of synchrotron sources highly coherent and intense X-ray beams became widely accessible. They are used in new imaging methods such as coherent X-ray diffractive imaging (CXDI) and X-ray ptychography. Modern nanotechnology opens a wide spectrum of possible applications in different branches of physics, chemistry, biology and engineering. At the nanoscale, matter has different physical and chemical properties compared to the macroscale bulk material. The continuing trend of miniaturization of functional components in semiconductor industry brings new challenges both in growth and characterization methods. This Thesis is focused on application of coherent diffractive imaging methods to reveal the structure of single semiconductor nanowires (NWs). They have been attracting significant attention for a couple of decades due to their efficient strain relaxation properties. And since the strain plays a significant role in NW performance the projects carried out in this work are oriented on Bragg CXDI approaches. Three distinct projects were carried out during my research activity at DESY research center of the Helmholtz Association. Experimental work was performed at P06 and P10 beamlines at PETRA III synchrotron. The first part of this Thesis extends the application of the three-dimensional (3D) Bragg CXDI to strain field mapping in a

  19. Characterization of nanowires by coherent X-ray diffractive imaging and ptychography

    Energy Technology Data Exchange (ETDEWEB)

    Dzhigaev, Dmitry

    2017-03-15

    Imaging techniques are of paramount importance for our understanding of the universe. From galaxies and stars explored by huge telescopes down to micro and nanostructures studied by microscopes, imaging systems provide invaluable scientific information. When an object under investigation has a size of about 100 nanometers, X-rays become a perfect probe for non-destructive imaging. The manufacturing process of image forming lenses for X-rays becomes much more complicated comparing to optical ones. Therefore, ''lensless'' techniques which rely on the coherent properties of radiation were developed. With third generation of synchrotron sources highly coherent and intense X-ray beams became widely accessible. They are used in new imaging methods such as coherent X-ray diffractive imaging (CXDI) and X-ray ptychography. Modern nanotechnology opens a wide spectrum of possible applications in different branches of physics, chemistry, biology and engineering. At the nanoscale, matter has different physical and chemical properties compared to the macroscale bulk material. The continuing trend of miniaturization of functional components in semiconductor industry brings new challenges both in growth and characterization methods. This Thesis is focused on application of coherent diffractive imaging methods to reveal the structure of single semiconductor nanowires (NWs). They have been attracting significant attention for a couple of decades due to their efficient strain relaxation properties. And since the strain plays a significant role in NW performance the projects carried out in this work are oriented on Bragg CXDI approaches. Three distinct projects were carried out during my research activity at DESY research center of the Helmholtz Association. Experimental work was performed at P06 and P10 beamlines at PETRA III synchrotron. The first part of this Thesis extends the application of the three-dimensional (3D) Bragg CXDI to strain field mapping in a

  20. Determination of austenite vs. α-ferrite in steel by neutron and X-ray diffraction

    International Nuclear Information System (INIS)

    Als-Nielsen, J.; Clausen, K.

    1984-06-01

    Neutron and X-ray diffraction studies for determining the relative content of fcc (austenite) and bcc (α-ferrite) phases in steel samples are reported. In addition to determine the relative content of phases the diffraction method also provides information about the strain fields in the sample by the concomitant broadening of diffraction peaks. Neutron diffraction has the advantage that large sample volumes (several cc) are probed, and the effect of texture can thus be eliminated. X-ray diffraction patterns can be registered in a short time thus allowing kinetic studies of phase changes during heat treatment or mechanical treatment. In addition it is possible to probe different surface thickness by utilizing different X-ray wavelengths. Measurements of this type can be carried out on a commercial contract basis in the Solid State Physics Division at Risoe National Laboratory. (author)

  1. X-ray and neutron diffraction studies of crystallinity in hydroxyapatite coatings.

    Science.gov (United States)

    Girardin, E; Millet, P; Lodini, A

    2000-02-01

    To standardize industrial implant production and make comparisons between different experimental results, we have to be able to quantify the crystallinity of hydroxyapatite. Methods of measuring crystallinity ratio were developed for various HA samples before and after plasma spraying. The first series of methods uses X-ray diffraction. The advantage of these methods is that X-ray diffraction equipment is used widely in science and industry. In the second series, a neutron diffraction method is developed and the results recorded are similar to those obtained by the modified X-ray diffraction methods. The advantage of neutron diffraction is the ability to obtain measurements deep inside a component. It is a nondestructive method, owing to the very low absorption of neutrons in most materials. Copyright 2000 John Wiley & Sons, Inc.

  2. Diffraction enhanced imaging and x-ray fluorescence microtomography for analyzing biological samples

    Energy Technology Data Exchange (ETDEWEB)

    Rocha, H.S.; Pereira, G.R.; Lopes, R.T. [Laboratorio de Instrumentacao Nuclear-COPPE/UFRJ-RJ (Brazil); Anjos, M.J. [Instituto de Fisica-UERJ-RJ (Brazil); Faria, P. [Instituto Nacional do Cancer-INCa-RJ (Brazil); Kellermann, G.; Perez, C.A. [Laboratorio Nacional de Luz Sincrotron-Campinas-SP (Brazil); Tirao, G. [Faculdad de Mat. Astronomia y Fisica (FAMAF), UNC. Cordoba (Argentina); Mazzaro, I. [Laboratorio de Optica de Raios X e Instrumentacao-UFPR-Curitiba-PR (Brazil); Giles, C. [Laboratorio de Cristalografia Aplicada e Raios X-UNICAMP-Campinas-SP (Brazil)

    2007-07-15

    In this work, breast tissue samples were investigated in order to verify the distribution of certain elements by x-ray fluorescence computed tomography (XRFCT) correlated with the characteristics and pathology of each tissue observed by diffraction enhanced imaging (DEI). The DEI system can show details in low attenuation tissues. It is based on the contrast imaging obtained by extinction, diffraction and refraction characteristics and can improve reduction in false positive and false negative diagnoses. XRFCT allows mapping of all elements within the sample, since even a minute fluorescence signal can be detected. DEI imaging techniques revealed the complex structure of the disease, confirmed by the histological section, and showed microstructures in all planes of the sample. The XRFCT showed the distribution of Zn, Cu and Fe at higher concentration. (authors)

  3. Dehydration reactions of gypsum: A neutron and X-ray diffraction study

    Science.gov (United States)

    Abriel, W.; Reisdorf, K.; Pannetier, J.

    1990-03-01

    The kinetics of the dehydration of gypsum was investigated by powder diffraction methods. Using the incoherent scattering effect of H with the neutron beam, the background intensity as a measure of the water content was checked in the temperature range 295-623 K. The superposed Bragg peaks yielded four major phases: Gypsum, subhydratesCaSO 4(H 2O) x (1 > x > 0),AIII-CaSO 4, AII-CaSO 4. For the subhydrates a maximum water content of x > = 0.74was determined. A different kinetic was found using Guinier X-ray technique with the heated sample prepared on a thin foil. Only with high local H 2O steam pressure, produced in the comparable larger sample container of the neutron diffraction experiment, could this high H 2O occupation of the subhydrate tunnel structure be found. A topotactic mechanism can describe the phase transitions for this reaction.

  4. Multiple x-ray diffraction applied to the study of crystal impurities

    International Nuclear Information System (INIS)

    Cardoso, L.P.

    1983-06-01

    The x-ray multiple diffraction technique is used in the study of impurities concentration and localization in the crystal lattice, implemented with the fundamental observation that the impurities cannot be distributed with the same spatial group symmetry of the crystal. This fact could introduce scattered intensity in the crystal reciprocal lattice forbidden nodes. This effect was effectively observed in multiple diffraction diagrams, where a reinforcement of the scattered intensity in the pure crystal is produced, when choosing conveniently the involved reflections. The reflectivity theory was developed in the kinematic case, which take into account the scattering by the impurities atoms, and the analysis showed that, in the first approximation, the impurities can influence both in the allowed and forbidden positions for the pure crystal. (L.C.J.A.)

  5. Thermal expansion studies on Inconel-600[reg] by high temperature X-ray diffraction

    International Nuclear Information System (INIS)

    Raju, S.; Sivasubramanian, K.; Divakar, R.; Panneerselvam, G.; Banerjee, A.; Mohandas, E.; Antony, M.P.

    2004-01-01

    The lattice thermal expansion characteristics of Inconel-600[reg] have been studied by high temperature X-ray diffraction (HT-XRD) technique in the temperature range 298-1200 K. Altogether four experimental runs were conducted on thin foils of about 75-100 μm thickness. The diffraction profiles have been accurately calibrated to offset the shift in 2θ values introduced by sample buckling at elevated temperatures. The corrected lattice parameter data have been used to estimate the instantaneous and mean linear thermal expansion coefficients as a function of temperature. The thermal expansion values estimated in the present study show a fair degree of agreement with other existing dilatometer based bulk thermal expansion estimates. The lattice parameter for this alloy at 300 K is found to be 0.3549(1) nm. The mean linear thermal expansivity is found to be 11.4 x 10 -6 K -1

  6. Microscopic stress characterisation of functional iron-based alloys by white X-ray microbeam diffraction

    Science.gov (United States)

    Kwon, E. P.; Sato, S.; Fujieda, S.; Shinoda, K.; Kajiwara, K.; Sato, M.; Suzuki, S.

    2018-01-01

    Microscopic residual stress evolution in an austenite (γ) grain during a shape-memory process in an Fe-Mn-Si-Cr alloy was investigated using the white X-ray microbeam diffraction technique. The stresses were measured on a coarse grain, which had an orientation near , parallel to the tensile loading direction with a high Schmid factor for a martensitic transformation. The magnitude of the residual stresses in a grain of the sample, which was subjected to a 23 % tensile strain and subsequent shape-recovery heating, was found to be very small and comparable to that prior to tensile deformation. Measurements of the recovery strain and microstructural analyses using electron backscatter diffraction suggested that the low residual stresses could be attributed to the significant shape recovery caused by a highly reversible martensitic transformation in the grain with a particular orientation.

  7. X-ray photoelectron spectroscopy, high-resolution X-ray diffraction ...

    Indian Academy of Sciences (India)

    Congruent LiNbO3 single crystals with Ti ion dopants (2 and 5 mol%) were successfully grown by Czochralski technique in the automatic diameter control facility. As-grown crystal boules were oriented into (0 0 1) direction cut and optically polished for all measurements. Influence of Ti-ion incorporation into LiNbO3 was ...

  8. Asian conference on x-rays and related techniques in research and industry. Proceedings

    International Nuclear Information System (INIS)

    1996-01-01

    This proceedings compile the paper presented at the conference. The papers for presentation are from wide spectrum stressing the interdisciplinary nature of the conference i.e. x-ray fluorescence spectrometry (XRF), x-ray diffraction (XRD), TEM, scanning electron microscope (SEM), energy dispersive x-ray (EDX), auger electron microscopy, electron back scatter diffraction (EBSD)

  9. The possibility of using x-ray diffraction with hair to screen for pathologic conditions such as breast cancer

    International Nuclear Information System (INIS)

    James, Veronica; Cookson, David

    2000-01-01

    Mammalian hair exhibits a complex structure on length scales ranging from a few to hundreds of Angstroms. High-quality synchrotron x-ray images have yielded new insight about the structure and packing of the intermediate keratinous filaments that represent the bulk of a hair's volume. When comparing human hair diffraction patterns from healthy individuals and breast cancer patients significant differences have been seen, raising the possibility that fiber diffraction may be useful as a screening technique for certain pathologic conditions

  10. X-ray diffraction and absorption spectroscopic studies on plastic sheets used in green houses

    International Nuclear Information System (INIS)

    Braik, N.

    1987-01-01

    A study of the morphology and light-transmissivity in nine commercial samples of low-density polyethylene sheets (LDPE) was carried out. The sheets were of the qualities prepared for use in agricultural green houses and tunnels. The sheets were produced by the plastic-film extrusion process in five Jordanian plastic factories. The variations in the samples were determined in terms of crystallinity, crystallite size, crystallite orientation, heat of fusion, and melting point. X-ray diffraction, UV/visible absorption spectroscopy, and differential scanning calorimetry (DSC) techniques were used. The nine samples had relatively small x-ray crystallinity (20-41%) and low DSC crystallinity (21-29%); the crystallite size were relatively large (8.4-13.4 nm), but the crystallites were not well-oriented relative to the extrusion direction. The melting point was in the temperature range 112.7-118.9 degrees celsius, and the heat of fusion was in the range 60.3 - 83.7 J/g. There was no relation between the crystallinity, which was relatively low in all the samples, and the transmissivity of visible light. Annealing of LDPE sheets in vacuum improved the crystallinity especially at temperatures below the melting point. Free annealing resulted in better crystallization than annealing at constant length. Drawing of LDPE sheets improved the crystallinity and crystallite orientation, and samples with higher crystallinity and crystallite orientation showed better transmissivity of visible light. The UV absorption difference among the samples was not remarkable, and x-ray diffraction crystallinity revealed the variations in the morphology more sensitively than the DSC method. 56 refs., 17 figs., 12 tabs. (A.M.H.)

  11. Measurements of transient electron density distributions by femtosecond X-ray diffraction

    International Nuclear Information System (INIS)

    Freyer, Benjamin

    2013-01-01

    This thesis concerns measurements of transient charge density maps by femtosecond X-ray diffraction. Different X-ray diffraction methods will be considered, particularly with regard to their application in femtosecond X-ray diffraction. The rotation method is commonly used in stationary X-ray diffraction. In the work in hand an X-ray diffraction experiment is demonstrated, which combines the method with ultrafast X-ray pulses. This experiment is the first implementation which makes use of the rotation method to map transient intensities of a multitude of Bragg reflections. As a prototype material Bismuth is used, which previously was studied frequently by femtosecond X-ray diffraction by measuring Bragg reflections successively. The experimental results of the present work are compared with the literature data. In the second part a powder-diffraction experiment will be presented, which is used to study the dynamics of the electron-density distribution on ultrafast time scales. The experiment investigates a transition metal complex after photoexcitation of the metal to ligand charge transfer state. Besides expected results, i. e. the change of the bond length between the metal and the ligand and the transfer of electronic charge from the metal to the ligand, a strong contribution of the anion to the charge transfer was found. Furthermore, the charge transfer has predominantly a cooperative character. That is, the excitation of a single complex causes an alteration of the charge density of several neighboring units. The results show that more than 30 transition-metal complexes and 60 anions contribute to the charge transfer. This collective response is a consequence of the strong coulomb interactions of the densely packed ions.

  12. High energy white beam x-ray diffraction studies of residual strains in engineering components

    Science.gov (United States)

    Zhang, S. Y.; Vorster, W.; Jun, T. S.; Song, X.; Golshan, M.; Laundy, D.; Walsh, M. J.; Korsunsky, A. M.

    2008-09-01

    In order to predict the durability of engineering components and improve performance, it is mandatory to understand residual stresses. The last decade has witnessed a significant increase of residual stress evaluation using diffraction of penetrating radiation, such as neutrons or high energy X-rays. They provide a powerful non-destructive method for determining the level of residual stresses in engineering components through precise characterisation of interplanar crystal lattice spacing. The unique non-destructive nature of these measurement techniques is particularly beneficial in the context of engineering design, since it allows the evaluation of a variety of structural and deformational parameters inside real components without material removal, or at worst with minimal interference. However, while most real engineering components have complex shape and are often large in size, leading to measurement and interpretation difficulties, since experimental facilities usually have limited space for mounting the sample, limited sample travel range, limited loading capacity of the sample positioning system, etc. Consequently, samples often have to be sectioned, requiring appropriate corrections on measured data; or facilities must be improved. Our research group has contributed to the development of engineering applications of high-energy X-ray diffraction methods for residual stress evaluation, both at synchrotron sources and in the lab setting, including multiple detector setup, large engineering component manipulation and measurement at the UK Synchrotron Radiation Source (SRS Daresbury), and in our lab at Oxford. A nickel base superalloy combustion casing and a large MIG welded Al alloy plate were successfully studied.

  13. Quantitative description of microstructure defects in hexagonal boron nitrides using X-ray diffraction analysis

    International Nuclear Information System (INIS)

    Schimpf, C.; Motylenko, M.; Rafaja, D.

    2013-01-01

    A routine for simultaneous quantification of turbostratic disorder, amount of puckering and the dislocation and stacking fault density in hexagonal materials was proposed and tested on boron nitride powder samples that were synthesised using different methods. The routine allows the individual microstructure defects to be recognised according to their effect on the anisotropy of the X-ray diffraction line broadening. For quantification of the microstructure defects, the total line broadening is regarded as a linear combination of the contributions from the particular defects. The total line broadening is obtained from the line profile fitting. As testing material, graphitic boron nitride (h-BN) was employed in the form of hot-isostatically pressed h-BN, pyrolytic h-BN or a h-BN, which was chemically vapour deposited at a low temperature. The kind of the dominant microstructure defects determined from the broadening of the X-ray diffraction lines was verified by high resolution transmission electron microscopy. Their amount was attempted to be verified by alternative methods. - Highlights: • Reliable method for quantification of microstructure defects in BN was suggested. • The method is based on the analysis of anisotropic XRD line broadening. • This XRD line broadening is unique and characteristic of the respective defect. • Thus, the quantification of coexistent microstructure defects is possible. • The method was tested on hexagonal BN, which was produced by different techniques

  14. Time-Resolved Soft X-ray Diffraction Reveals Transient Structural Distortions of Ternary Liquid Crystals

    Directory of Open Access Journals (Sweden)

    Klaus Mann

    2009-11-01

    Full Text Available Home-based soft X-ray time-resolved scattering experiments with nanosecond time resolution (10 ns and nanometer spatial resolution were carried out at a table top soft X-ray plasma source (2.2–5.2 nm. The investigated system was the lyotropic liquid crystal C16E7/paraffin/glycerol/formamide/IR 5. Usually, major changes in physical, chemical, and/or optical properties of the sample occur as a result of structural changes and shrinking morphology. Here, these effects occur as a consequence of the energy absorption in the sample upon optical laser excitation in the IR regime. The liquid crystal shows changes in the structural response within few hundred nanoseconds showing a time decay of 182 ns. A decrease of the Bragg peak diffracted intensity of 30% and a coherent macroscopic movement of the Bragg reflection are found as a response to the optical pump. The Bragg reflection movement is established to be isotropic and diffusion controlled (1 μs. Structural processes are analyzed in the Patterson analysis framework of the time-varying diffraction peaks revealing that the inter-lamellar distance increases by 2.7 Å resulting in an elongation of the coherently expanding lamella crystallite. The present studies emphasize the possibility of applying TR-SXRD techniques for studying the mechanical dynamics of nanosystems.

  15. Development of an ultra-high resolution diffraction grating forsoft x-rays

    Energy Technology Data Exchange (ETDEWEB)

    Voronov, Dmitriy L.; Cambie, Rossana; Feshchenko, Ruslan M.; Gullikson, Eric M.; Padmore, Howard A.; Vinogradov, Alexander V.; Yashchuk, Valeriy V.

    2007-08-21

    Resonant Inelastic X-ray Scattering (RIXS) is the one of themost powerful methods for investigation of the electronic structure ofmaterials, specifically of excitations in correlated electron systems.However the potential of the RIXS technique has not been fully exploitedbecause conventional grating spectrometers have not been capable ofachieving the extreme resolving powers that RIXS can utilize. State ofthe art spectrometers in the soft x-ray energy range achieve ~;0.25 eVresolution, compared to the energy scales of soft excitations andsuperconducting gap openings down to a few meV. Development ofdiffraction gratings with super high resolving power is necessary tosolve this problem. In this paper we study the possibilities offabrication of gratings of resolving power of up to 106 for the 0.5 1.5KeV energy range. This energy range corresponds to all or most of theuseful dipole transitions for elements of interest in most correlatedelectronic systems, i.e., oxygen K-edge of relevance to all oxides, thetransition metal L2,3 edges, and the M4,5 edges of the rare earths.Various approaches based on different kinds of diffraction gratings suchas deep-etched multilayer gratings, and multilayer coated echelettes arediscussed. We also present simulations of diffraction efficiency for suchgratings, and investigate the necessary fabricationtolerances.

  16. Characterization of the Roraima savanna across of X-ray diffraction, thermomagnetic analysis and Moessbauer spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Gilmar A.; Araujo, R.C.; Sergio, C.S. [Universidade Federal de Roraima (UFRR), Boa Vista, RR (Brazil)

    2012-07-01

    Full text: The technique of X-ray diffraction has great resolving power to determine the phases present in crystalline material, thereby enabling it to determine the elements present in the materials as well as changes in structure that they can suffer when subjected to various physical processes and/or chemical means. The research had as objective to characterize the mineralogy of iron oxides, silicon, aluminum and other minerals in the soil of five points of the Roraima savannah. The points where samples were collected are five municipalities in the state of Roraima. The area of sampling is part of the savanna in Roraima. The samples were collected. We analyzed samples from five points from the collection of natural soil in the locations listed. The samples were placed in a mill to a uniform grain size. After the milling process, the magnetic material was separated using a permanent magnet. Then the samples were analyzed by x-ray diffraction, thermomagnetic analysis and Moessbauer spectroscopy. Preliminary results of XRD showed the occurrence of phases of oxides of iron, silicon, aluminum and other phases less. Thermomagnetic analysis show that the magnetic phases are magnetite and hematite. The results of the Moessbauer spectroscopy indicates the reliability in the two prior art and confirmed the presence of the phases of oxides of iron present in the soil analyzed. (author)

  17. Determination of equilibrium humidities using temperature and humidity controlled X-ray diffraction (RH-XRD)

    International Nuclear Information System (INIS)

    Linnow, Kirsten; Steiger, Michael

    2007-01-01

    Confined growth of crystals in porous building materials is generally considered to be a major cause of damage. We report on the use of X-ray diffraction under controlled conditions of temperature and relative humidity (RH-XRD) for the investigation of potentially deleterious phase transition reactions. An improved procedure based on rate measurements is used for the accurate and reproducible determination of equilibrium humidities of deliquescence and hydration reactions. The deliquescence humidities of NaCl (75.4 ± 0.5% RH) and Ca(NO 3 ) 2 .4H 2 O (50.8 ± 0.7% RH) at 25 deg. C determined with this improved RH-XRD technique are in excellent agreement with available literature data. Measurement of the hydration of anhydrous Ca(NO 3 ) 2 to form Ca(NO 3 ) 2 .2H 2 O revealed an equilibrium humidity of 10.2 ± 0.3%, which is also in reasonable agreement with available data. In conclusion, dynamic X-ray diffraction measurements are an appropriate method for the accurate and precise determination of equilibrium humidities with a number of interesting future applications

  18. Non-conventional applications of a noninvasive portable X-ray diffraction/fluorescence instrument

    Energy Technology Data Exchange (ETDEWEB)

    Chiari, Giacomo [Getty Conservation Institute, Science Department, Los Angeles, CA (United States); Sarrazin, Philippe [Examinart LLC, Sunnyvale, CA (United States); Heginbotham, Arlen [The J. Paul Getty Museum, Sculpture and Decorative Arts Conservation, Los Angeles, CA (United States)

    2016-11-15

    Noninvasive techniques have become widespread in the cultural heritage analytical domain. The popular handheld X-ray fluorescence (XRF) devices give the elemental composition of all the layers that X-rays can penetrate, but no information on how atoms are bound together or at which depth they are located. A noninvasive portable X-ray powder diffraction/X-ray fluorescence (XRD/XRF) device may offer a solution to these limitations, since it can provide information on the composition of crystalline materials. This paper introduces applications of XRD beyond simple phase recognition. The two fundamental principles for XRD are: (1) the crystallites should be randomly oriented, to ensure proper intensity to all the diffraction peaks, and (2) the material should be positioned exactly in the focal plane of the instrument, respecting its geometry, as any displacement of the sample would results in 2θ shifts of the diffraction peaks. In conventional XRD, the sample is ground and set on the properly positioned sample holder. Using a noninvasive portable instrument, these two requirements are seldom fulfilled. The position, size and orientation of a given crystallite within a layered structure depend on the object itself. Equation correlating the displacement (distance from the focal plane) versus peak shift (angular difference in 2θ from the standard value) is derived and used to determine the depth at which a given substance is located. The quantitative composition of two binary Cu/Zn alloys, simultaneously present, was determined measuring the cell volume and using Vegard's law. The analysis of the whole object gives information on the texture and possible preferred orientations of the crystallites, which influences the peak intensity. This allows for the distinction between clad and electroplated daguerreotypes in the case of silver and between ancient and modern gilding for gold. Analyses of cross sections can be carried out successfully. Finally, beeswax, used in

  19. A size-dependent sodium storage mechanism in Li4Ti5O12 investigated by a novel characterization technique combining in situ X-ray diffraction and chemical sodiation.

    Science.gov (United States)

    Yu, Xiqian; Pan, Huilin; Wan, Wang; Ma, Chao; Bai, Jianming; Meng, Qingping; Ehrlich, Steven N; Hu, Yong-Sheng; Yang, Xiao-Qing

    2013-10-09

    A novel characterization technique using the combination of chemical sodiation and synchrotron based in situ X-ray diffraction (XRD) has been detailed illustrated. The power of this novel technique was demonstrated in elucidating the structure evolution of Li4Ti5O12 upon sodium insertion. The sodium insertion behavior into Li4Ti5O12 is strongly size dependent. A solid solution reaction behavior in a wide range has been revealed during sodium insertion into the nanosized Li4Ti5O12 (~44 nm), which is quite different from the well-known two-phase reaction of Li4Ti5O12/Li7Ti5O12 system during lithium insertion, and also has not been fully addressed in the literature so far. On the basis of this in situ experiment, the apparent Na(+) ion diffusion coefficient (DNa+) of Li4Ti5O12 was estimated in the magnitude of 10(-16) cm(2) s(-1), close to the values estimated by electrochemical method, but 5 order of magnitudes smaller than the Li(+) ion diffusion coefficient (D(Li+) ~10(-11) cm(2) s(-1)), indicating a sluggish Na(+) ion diffusion kinetics in Li4Ti5O12 comparing with that of Li(+) ion. Nanosizing the Li4Ti5O12 will be critical to make it a suitable anode material for sodium-ion batteries. The application of this novel in situ chemical sodiation method reported in this work provides a facile way and a new opportunity for in situ structure investigations of various sodium-ion battery materials and other systems.

  20. Monitoring protein precipitates by in-house X-ray powder diffraction

    OpenAIRE

    Ståhl, Kenny; Frankær, Christian Grundahl; Petersen, Jakob; Harris, Pernille

    2013-01-01

    Powder diffraction from protein powders using in-house diffractometers is an effective tool for identification and monitoring of protein crystal forms and artifacts. As an alternative to conventional powder diffractometers a single crystal diffractometer equipped with an X-ray micro-source can be used to collect powder patterns from 1 l samples. Using a small-angle X-ray scattering (SAXS) camera it is possible to collect data within minutes. A streamlined program has been developed for the ca...

  1. Ultrafast Structural Dynamics in InSb Probed by Time-Resolved X-Ray Diffraction

    International Nuclear Information System (INIS)

    Chin, A.H.; Shank, C.V.; Chin, A.H.; Schoenlein, R.W.; Shank, C.V.; Glover, T.E.; Leemans, W.P.; Balling, P.

    1999-01-01

    Ultrafast structural dynamics in laser-perturbed InSb are studied using time-resolved x-ray diffraction with a novel femtosecond x-ray source. We report the first observation of a delay in the onset of lattice expansion, which we attribute to energy relaxation processes and lattice strain propagation. In addition, we observe direct indications of ultrafast disordering on a subpicosecond time scale. copyright 1999 The American Physical Society

  2. Information extracting and processing with diffraction enhanced imaging of X-ray

    International Nuclear Information System (INIS)

    Chen Bo; Chinese Academy of Science, Beijing; Chen Chunchong; Jiang Fan; Chen Jie; Ming Hai; Shu Hang; Zhu Peiping; Wang Junyue; Yuan Qingxi; Wu Ziyu

    2006-01-01

    X-ray imaging at high energies has been used for many years in many fields. Conventional X-ray imaging is based on the different absorption within a sample. It is difficult to distinguish different tissues of a biological sample because of their small difference in absorption. The authors use the diffraction enhanced imaging (DEI) method. The authors took images of absorption, extinction, scattering and refractivity. In the end, the authors presented pictures of high resolution with all these information combined. (authors)

  3. Nano-fabrication of diffractive optics for soft X-ray and atom beam focusing

    International Nuclear Information System (INIS)

    Rehbein, S.

    2002-01-01

    Nano-structuring processes are described for manufacturing diffractive optics for the condenser-monochromator set-up of the transmission X-ray microscope (TXM) and for the scanning transmission X-ray microscope (STXM) at the BESSY II electron storage ring in Berlin. Furthermore, a process for manufacturing free-standing nickel zone plates for helium atom beam focusing experiments is presented. (author)

  4. Model experiment of in vivo synchrotron X-ray diffraction of human kidney stones

    Energy Technology Data Exchange (ETDEWEB)

    Ancharov, A.I. [Institute of Solid State Chemistry and Mechanochemistry SB RAS, Novosibirsk (Russian Federation)]. E-mail: ancharov@mail.ru; Potapov, S.S. [Institute of Mineralogy UB RAS, Miass (Russian Federation); Moiseenko, T.N. [The State Regional Clinical Hospital, Novosibirsk (Russian Federation); Feofilov, I.V. [The State Regional Clinical Hospital, Novosibirsk (Russian Federation); Nizovskii, A.I. [Boreskov Institute of Catalysis SB RAS, Novosibirsk (Russian Federation)

    2007-05-21

    The diffraction of synchrotron radiation (SR) was used to explore the phase composition of kidney stones placed into a specific object phantom, which imitated the human body. As an imitation of the patient breath, the kidney stone was moved vertically and rotated to an angle of 15{sup o} during the recording of the X-ray pattern. It was shown that rotation and displacement did not distort the X-ray pattern.

  5. Diffractive-refractive optics: (+,-,-,+) X-ray crystal monochromator with harmonics separation

    Czech Academy of Sciences Publication Activity Database

    Hrdý, Jaromír; Mikulík, P.; Oberta, Peter

    2011-01-01

    Roč. 18, č. 2 (2011), s. 299-301 ISSN 0909-0495 R&D Projects: GA MPO FR-TI1/412 Institutional research plan: CEZ:AV0Z10100522 Keywords : diffractive-refractive optics * x-ray synchrotron radiation monochromator * x-ray crystal monochromator * harmonics separation Subject RIV: BH - Optics, Masers, Lasers Impact factor: 2.726, year: 2011

  6. X-ray diffraction from intact tau aggregates in human brain tissue

    Energy Technology Data Exchange (ETDEWEB)

    Landahl, Eric C.; Antipova, Olga; Bongaarts, Angela; Barrea, Raul; Berry, Robert; Binder, Lester I.; Irving, Thomas; Orgel, Joseph; Vana, Laurel; Rice, Sarah E. (DePaul); (IIT); (NWU)

    2011-09-15

    We describe an instrument to record X-ray diffraction patterns from diseased regions of human brain tissue by combining an in-line visible light fluorescence microscope with an X-ray diffraction microprobe. We use thiazine red fluorescence to specifically label and detect the filamentous tau protein pathology associated with Pick's disease, as several laboratories have done previously. We demonstrate that thiazine red-enhanced regions within the tissue show periodic structure in X-ray diffraction, which is not observed in healthy tissue. One observed periodicity (4.2 {angstrom}) is characteristic of cross-beta sheet structure, consistent with previous results from powder diffraction studies performed on purified, dried tau protein.

  7. X-ray diffraction from intact tau aggregates in human brain tissue

    Energy Technology Data Exchange (ETDEWEB)

    Landahl, Eric C. [DePaul University, Department of Physics, 2219 N. Kenmore Ave., IL 60614, Chicago (United States); Antipova, Olga [Illinois Institute of Technology, Department of Biological Chemical and Physical Sciences, 3101 South Dearborn St., IL 60616, Chicago (United States); Bongaarts, Angela [Northwestern University, Department of Cell and Molecular Biology, 303 E. Chicago Ave., IL 60611, Chicago (United States); Barrea, Raul [Illinois Institute of Technology, Department of Biological Chemical and Physical Sciences, 3101 South Dearborn St., IL 60616, Chicago (United States); Berry, Robert; Binder, Lester I. [Northwestern University, Department of Cell and Molecular Biology, 303 E. Chicago Ave., IL 60611, Chicago (United States); Irving, Thomas; Orgel, Joseph [Illinois Institute of Technology, Department of Biological Chemical and Physical Sciences, 3101 South Dearborn St., IL 60616, Chicago (United States); Vana, Laurel [Northwestern University, Department of Cell and Molecular Biology, 303 E. Chicago Ave., IL 60611, Chicago (United States); Rice, Sarah E., E-mail: s-rice@northwestern.edu [Northwestern University, Department of Cell and Molecular Biology, 303 E. Chicago Ave., IL 60611, Chicago (United States)

    2011-09-01

    We describe an instrument to record X-ray diffraction patterns from diseased regions of human brain tissue by combining an in-line visible light fluorescence microscope with an X-ray diffraction microprobe. We use thiazine red fluorescence to specifically label and detect the filamentous tau protein pathology associated with Pick's disease, as several laboratories have done previously. We demonstrate that thiazine red-enhanced regions within the tissue show periodic structure in X-ray diffraction, which is not observed in healthy tissue. One observed periodicity (4.2 A) is characteristic of cross-beta sheet structure, consistent with previous results from powder diffraction studies performed on purified, dried tau protein.

  8. Serial femtosecond X-ray diffraction of 30S ribosomal subunit microcrystals in liquid suspension at ambient temperature using an X-ray free-electron laser

    International Nuclear Information System (INIS)

    Demirci, Hasan; Sierra, Raymond G.; Laksmono, Hartawan; Shoeman, Robert L.; Botha, Sabine; Barends, Thomas R. M.; Nass, Karol; Schlichting, Ilme; Doak, R. Bruce; Gati, Cornelius; Williams, Garth J.; Boutet, Sébastien; Messerschmidt, Marc; Jogl, Gerwald; Dahlberg, Albert E.; Gregory, Steven T.; Bogan, Michael J.

    2013-01-01

    Serial femtosecond X-ray (SFX) diffraction extending beyond 6 Å resolution using T. thermophilus 30S ribosomal subunit crystals is reported. High-resolution ribosome structures determined by X-ray crystallography have provided important insights into the mechanism of translation. Such studies have thus far relied on large ribosome crystals kept at cryogenic temperatures to reduce radiation damage. Here, the application of serial femtosecond X-ray crystallography (SFX) using an X-ray free-electron laser (XFEL) to obtain diffraction data from ribosome microcrystals in liquid suspension at ambient temperature is described. 30S ribosomal subunit microcrystals diffracted to beyond 6 Å resolution, demonstrating the feasibility of using SFX for ribosome structural studies. The ability to collect diffraction data at near-physiological temperatures promises to provide fundamental insights into the structural dynamics of the ribosome and its functional complexes

  9. Quantitative determination of phases of X-ray reflections from three-beam diffractions. Pt. 2

    International Nuclear Information System (INIS)

    Tang Mautsu; Chang Shihlin

    1988-01-01

    The method proposed by Chang and Tang of quantitative determination of X-ray reflection phases from multiple diffraction profiles is applied to nearly perfect crystals of gallium arsenide. The detailed intensity-profile-analysis procedures are given. Multiple diffraction profiles obtained with a conventional X-ray source and synchrotron radiation are subjected to this analysis. It is found that, for this particular diffraction example, errors as small as 15 0 in phase determination are achieved. Errors due to the theoretical approximation, peak position measurement and scaling factor are also discussed. (orig.)

  10. Phase analysis of micro-alloyed steels using X-ray diffraction measurements

    International Nuclear Information System (INIS)

    Tobisch, J.; Kleinstueck, K.; Schatt, W.; Riehle, M.; Technische Univ., Dresden

    1977-01-01

    The applicability of neutron diffraction and X-ray diffraction to phase analyses of micro-alloyed steels is tested. The results show that the resolution of neutron reflexes was too low for quantitative statements. X-ray diffraction measurements of the reflex intensity permit quantitative analyses of the phase TiN, TiC, and Ti 4 C 2 S 2 in micro-alloyed steels without and after heat treatment. The values of the quantitative determination of these phases ranged from about 0.03 to 0.4 per cent by weight

  11. Optomechanical design of a high-precision detector robot arm system for x-ray nano-diffraction with x-ray nanoprobe

    Science.gov (United States)

    Shu, D.; Kalbfleisch, S.; Kearney, S.; Anton, J.; Chu, Y. S.

    2014-03-01

    Collaboration between Argonne National Laboratory and Brookhaven National Laboratory has created a design for the high-precision detector robot arm system that will be used in the x-ray nano-diffraction experimental station at the Hard X-ray Nanoprobe (HXN) beamline for the NSLS-II project. The robot arm system is designed for positioning and manipulating an x-ray detector in three-dimensional space for nano-diffraction data acquisition with the HXN x-ray microscope. It consists of the following major component groups: a granite base with air-bearing support, a 2-D horizontal base stage, a vertical axis goniometer, a 2-D vertical plane robot arm, a 3-D fast scanning stages group, and a 2-D x-ray pixel detector. The design specifications and unique optomechanical structure of this novel high-precision detector robot arm system will be presented in this paper.

  12. Main analytical techniques in quantitative determination of asbestos in complex matrices by means of X rays diffraction; Principali tecniche analitiche per la determinazione del contenuto di amianto in matrici complesse tramite diffrattometria a raggi X

    Energy Technology Data Exchange (ETDEWEB)

    De Stefano, L.; De Luca, F. [ENEL Ricerca, Brindisi (Italy). Polo Tecnico; Buccolieri, G. [Lecce Univ. (Italy). Dipt. Scienza dei Materiali

    1998-03-01

    Asbestos containing residues are classified as toxic or non toxic residues on the basis of free asbestos fibers weight content. Quantitative asbestos analysis must therefore be very careful and precise. Three analytical methods in quantitative X ray diffraction are here presented and compared. [Italiano] I rifiuti contenenti amianto sono classificati come pericolosi o non pericolosi a seconda del contenuto di fibre libere di amianto. L`analisi quantitativa dell`amianto deve pertanto essere precisa ed accurata. In quanto segue sono presentate e confrontate tre metodiche analitiche per la determinazione del contenuto di amianto in matrici complesse tramite diffrattometria a raggi X.

  13. X rays and condensed matter

    International Nuclear Information System (INIS)

    Daillant, J.

    1997-01-01

    After a historical review of the discovery and study of X rays, the various interaction processes between X rays and matter are described: Thomson scattering, Compton scattering, X-photon absorption through photoelectric effect, and magnetic scattering. X ray sources such as the European Synchrotron Radiation Facility (ESRF) are described. The various X-ray applications are presented: imagery such as X tomography, X microscopy, phase contrast; X-ray photoelectron spectroscopy and X-ray absorption spectroscopy; X-ray scattering and diffraction techniques

  14. Residual stress measurements by X-ray and neutron diffractions in heat-treated SiCw/A2014 composites

    International Nuclear Information System (INIS)

    Ohnuki, Takahisa; Fujita, Motoo; Tomota, Yo; Ono, Masayoshi

    1998-01-01

    Residual stresses due to various heat treatments in a 22 volume percent SiC whisker/A2014 metal matrix composite (MMC) were measured by using X-ray and neutron diffractions. Micro residual stresses generated from the differences in thermal expansion coefficients of the constituents and macro residual stresses associated with different cooling rates in the outer and inner regions of an MMC specimen must be distinguished in X-ray stress measurements. The conventional sin 2 ψ method under an assumption of plane stress condition has been found not to be applicable to the present MMC, because interactions among whiskers in the X-ray penetrating area yields σ 33 where the x 3 -axis is normal with respect to specimen's surface. An average value of σ 33 can be measured by X-ray diffraction technique, but does not seem enough to evaluate micro residual stresses. It is found that neutron diffraction is the most powerful method to measure micro residual stresses in the constituents. Elastic residual strains obtained by neutron diffraction in solution treated or T6 heat treated samples show good agreements with predictions calculated by using Eshelby inclusion theory coupled with the Mori-Tanaka mean field concept, indicating that the influence of stress relaxation is negligible. In addition, internal stresses relaxations during holding at room temperature, slow cooling from solution treatment temperature, or subzero cooling are discussed. (author)

  15. Phase transitions in shock compressed bismuth identified using single photon energy dispersive X-ray diffraction (SPEDX)

    Science.gov (United States)

    Briggs, R.; Suggit, MJ; Gorman, MG; Coleman, A.; Heathcote, R.; Higginbotham, A.; Patel, S.; Wark, JS; McMahon, MI

    2017-10-01

    We present evidence for phase transitions in shock-compressed bismuth using the SPEDX x-ray diffraction technique. Experiments were performed on the Vulcan laser at the Central Laser Facility, RAL, Didcot, UK. We observed diffraction from the (110) bcc peak of Bi-V, and from its calculated lattice parameter the pressure was determined to be approximately 17 GPa. Upon further compression (higher laser intensities), no further diffraction from solid phases was observed. Shock melting of bismuth is thought to occur between 18 and 27 GPa. Diffraction results at lower pressures as a function of delay time are also presented.

  16. X-ray diffraction analysis of some single crystals with special properties

    Energy Technology Data Exchange (ETDEWEB)

    Antipin, M.Yu. [Russian Academy of Sciences, Moscow (Russian Federation). Inst. of Organoelement Compounds

    1996-12-31

    New possibilities of the X-ray diffraction method for studies of some single crystals with special physical properties are analyzed. It is demonstrated that wide range temperature diffraction data, special single crystals experiments under strong electric fields, and charge density analysis in crystals might enrich the knowledge on the nature of the crystal properties.

  17. Analytic theory of soft x-ray diffraction by lamellar multilayer gratings

    NARCIS (Netherlands)

    Kozhevnikov, I.V.; van der Meer, R.; Bastiaens, Hubertus M.J.; Boller, Klaus J.; Bijkerk, Frederik

    2011-01-01

    An analytic theory describing soft x-ray diffraction by Lamellar Multilayer Gratings (LMG) has been developed. The theory is derived from a coupled waves approach for LMGs operating in the single-order regime, where an incident plane wave can only excite a single diffraction order. The results from

  18. Energy-dispersive X-ray diffraction beamline at Indus-2 synchrotron ...

    Indian Academy of Sciences (India)

    Abstract. An energy-dispersive X-ray diffraction beamline has been designed, developed and commissioned at BL-11 bending magnet port of the Indian synchrotron source, Indus-2. The performance of this beamline has been benchmarked by measuring diffraction patterns from var- ious elemental metals and standard ...

  19. Energy-dispersive X-ray diffraction beamline at Indus-2 synchrotron ...

    Indian Academy of Sciences (India)

    An energy-dispersive X-ray diffraction beamline has been designed, developed and commissioned at BL-11 bending magnet port of the Indian synchrotron source, Indus-2. The performance of this beamline has been benchmarked by measuring diffraction patterns from various elemental metals and standard inorganic ...

  20. X-ray diffraction and X-ray K absorption near edge studies of copper (II) complexes with amino acids

    Science.gov (United States)

    Sharma, P. K.; Mishra, Ashutosh; Malviya, Varsha; Kame, Rashmi; Malviya, P. K.

    2017-05-01

    Synthesis of copper (II) complexes [CuL1L2X].nH2O, where n=1, 2,3 (X=Cl,Br,NO3) (L1is 2,2’-bipyridine and L2 is L-tyrosine) by the chemical root method. The XRD data for the samples have been recorded. EXAFS spectra have also been recorded at the K-edge of Cu using the dispersive beam line BL-8 at 2.5 Gev Indus-2 Synchrotron radiation source at RRCAT, Indore, India. XRD and EXAFS data have been analysed using the computer software. X-ray diffraction studies of all complexes indicate their crystalline nature. Lattice parameter, bond length, particle size have been determined from XRD data.

  1. High-resolution X-ray diffraction with no sample preparation.

    Science.gov (United States)

    Hansford, G M; Turner, S M R; Degryse, P; Shortland, A J

    2017-07-01

    It is shown that energy-dispersive X-ray diffraction (EDXRD) implemented in a back-reflection geometry is extremely insensitive to sample morphology and positioning even in a high-resolution configuration. This technique allows high-quality X-ray diffraction analysis of samples that have not been prepared and is therefore completely non-destructive. The experimental technique was implemented on beamline B18 at the Diamond Light Source synchrotron in Oxfordshire, UK. The majority of the experiments in this study were performed with pre-characterized geological materials in order to elucidate the characteristics of this novel technique and to develop the analysis methods. Results are presented that demonstrate phase identification, the derivation of precise unit-cell parameters and extraction of microstructural information on unprepared rock samples and other sample types. A particular highlight was the identification of a specific polytype of a muscovite in an unprepared mica schist sample, avoiding the time-consuming and difficult preparation steps normally required to make this type of identification. The technique was also demonstrated in application to a small number of fossil and archaeological samples. Back-reflection EDXRD implemented in a high-resolution configuration shows great potential in the crystallographic analysis of cultural heritage artefacts for the purposes of scientific research such as provenancing, as well as contributing to the formulation of conservation strategies. Possibilities for moving the technique from the synchrotron into museums are discussed. The avoidance of the need to extract samples from high-value and rare objects is a highly significant advantage, applicable also in other potential research areas such as palaeontology, and the study of meteorites and planetary materials brought to Earth by sample-return missions.

  2. Study about uranium oxides at high temperature by X-ray diffraction

    International Nuclear Information System (INIS)

    Costa, M.I.

    1978-01-01

    In this work a technique to study the lattice parameters in the crystalline substances at hight temperature by X-rays diffraction is developed. The results obtained agree very well with the experimental data found in the literature. The crystalline structure of uranium oxide at different temperature is studied in detail by this technique. At the range of the temperature investigated, i.e., 20 0 C to 640 0 C, the following forms for uranium oxide: U 3 O 8 in its hexagonal modification, cubic UO 2 , cubic U 4 O 9 and tetragonal U 3 O 7 is observed. The appearance of two hexagonal units observed in this work is identified by Milne. A good reproducibillity is observed for measurements at the same temperature [pt

  3. Structure of drug-target proteins determined by both X-ray and neutron diffraction

    International Nuclear Information System (INIS)

    Kuroki, Ryota

    2009-01-01

    Crystallography enables us to obtain accurate atomic positions within proteins. High resolution X-ray crystallography provides information for most of the atoms comprising a protein, with the exception of hydrogens. Neutron diffraction data can provide information of the location of hydrogen atoms to the structural information determined by X-ray crystallography. Here, we show the recent of the structural determination of drug-target proteins, porcine pancreatic elastase (PPE) and human immuno-deficiency virus type-1 protease (HIV-PR) by both X-ray and neutron diffraction. The structure of porcine pancreatic elastase with its potent inhibitor (FR13080) was determined to 0.94A resolution by X-ray diffraction and 1.75 A resolution by neutron diffraction. It was found that there are two characteristic hydrogen bonding interactions in which hydrogen atoms were confirmed. One is located between a catalytic aspartate and histidine, another is involved in the inhibitor recognition site. The structure of HIV-PR with its potent inhibitor (KNI-272) was also determined to 0.93 A resolution by X-ray diffraction and 2.3 A resolution by neutron diffraction. The ionization state of the catalytic residues were clarified to show that Asp125 is protonated and Asp25 is deprotonated. The ionization state and the location of hydrogen atoms of the catalytic residue in HIV-PR were firstly determined by neutron diffraction. Furthermore, collaborative use of both X-ray and neutron to identify the location of ambiguous hydrogen atoms will be shown. (author)

  4. X-ray diffraction study on the evaluation of the damage of steel structures subjected to earthquake

    International Nuclear Information System (INIS)

    Kaneta, Kiyoshi; Nishizawa, Hidekazu; Koshika, Norihide.

    1985-01-01

    The purpose of this study is to investigate the behavior of steel structures subjected to a strong earthquake and to evaluate the damage from a microscopic point of view. For this purpose, the authors have adopted two kinds of research techniques. The first is the ''ON-LINE EARTHQUAKE RESPONSE SIMULATION SYSTEM (ON-LINE SIMULATION SYSTEM)'', which is composed of an electro-hydrauric testing machine controled by a computer and a full scale specimen. Since a term of restoring force in the equation of motion is to be substituted by the actual reaction of a specimen under test, we can obtain the non-linear response of structure without any assumption about the hysteretic characteristics. Based on this method, the dynamic behavior of simple steel structures subjected to an intense earthquakes were simulated. The second technique is the ''X-RAY DIFFRACTION METHOD''. Although this method is usually regarded an experimental technique particular to the material science, we have realized the good applicability for the study of structural engineering. Because X-ray diffraction method is advantageous in investigating the microscopic behavior of steel member such as the plastic deformation and the low cycle fatigue. From the view point stated above, we have adopted this method for the evaluation of low cycle fatigue damage of steel member subjected to an earthquake. The experiment has been performed by radiating the X-ray at several stages of the ON-LINE SIMULATION. As has been expected, the X-ray diffraction patterns have changed in a regular manner depending on the degree of fatigue damage, and the results have shown a good possibility that the X-ray diffraction approach can offer a powerful tool for the detection of the earthquake damage of steel members. (author)

  5. Diffraction Techniques in Steel Research: An Overview

    Science.gov (United States)

    Melzer, Stefan; Moerman, Jaap

    Acquiring knowledge about microstructures and textures is crucial for the improvement and development steel products, because these two characteristics are controlling factors for the properties of steel. Diffraction techniques using X-rays, electrons or neutrons are suitable to study microstructures (e.g. phase relationships) and textures (crystallographic orientations). X-ray diffraction (XRD) and electron backscatter diffraction (EBSD) are generally available techniques within an industrial research environment.

  6. Long-Wavelength X-Ray Diffraction and Its Applications in Macromolecular Crystallography.

    Science.gov (United States)

    Weiss, Manfred S

    2017-01-01

    For many years, diffraction experiments in macromolecular crystallography at X-ray wavelengths longer than that of Cu-K α (1.54 Å) have been largely underappreciated. Effects caused by increased X-ray absorption result in the fact that these experiments are more difficult than the standard diffraction experiments at short wavelengths. However, due to the also increased anomalous scattering of many biologically relevant atoms, important additional structural information can be obtained. This information, in turn, can be used for phase determination, for substructure identification, in molecular replacement approaches, as well as in structure refinement. This chapter reviews the possibilities and the difficulties associated with such experiments, and it provides a short description of two macromolecular crystallography synchrotron beam lines dedicated to long-wavelength X-ray diffraction experiments.

  7. Influence of neutron irradiation on the microstructure of nuclear graphite: An X-ray diffraction study

    Science.gov (United States)

    Zhou, Z.; Bouwman, W. G.; Schut, H.; van Staveren, T. O.; Heijna, M. C. R.; Pappas, C.

    2017-04-01

    Neutron irradiation effects on the microstructure of nuclear graphite have been investigated by X-ray diffraction on virgin and low doses (∼ 1.3 and ∼ 2.2 dpa), high temperature (750° C) irradiated samples. The diffraction patterns were interpreted using a model, which takes into account the turbostratic disorder. Besides the lattice constants, the model introduces two distinct coherent lengths in the c-axis and the basal plane, that characterise the volumes from which X-rays are scattered coherently. The methodology used in this work allows to quantify the effect of irradiation damage on the microstructure of nuclear graphite seen by X-ray diffraction. The results show that the changes of the deduced structural parameters are in agreement with previous observations from electron microscopy, but not directly related to macroscopic changes.

  8. Growth of ω inclusions in Ti alloys: An X-ray diffraction study

    International Nuclear Information System (INIS)

    Šmilauerová, J.; Harcuba, P.; Pospíšil, J.; Matěj, Z.; Holý, V.

    2013-01-01

    We investigated the size and crystal structure of nanometer-sized ω inclusions in single crystals of β-Ti alloys by X-ray diffraction pole-figure measurements and reciprocal space mapping. We studied the topotactical relation of the β and ω crystal lattices, and from the positions and shapes of the diffraction maxima of the ω lattice determined the mean size of the ω inclusions and the misfit of the inclusion lattice with respect to the host lattice, as well as their changes during ageing. The lattice of the ω inclusions exhibits a large positive misfit already before ageing and the misfit is subsequently reduced during the ageing process. Using the theories of elasticity and X-ray scattering we simulated diffuse X-ray scattering around the β diffraction maxima and demonstrated that the diffuse scattering is caused mainly by local elastic strains in the β host phase around the ω inclusions

  9. Electronic properties of crystalline materials observed in X-ray diffraction

    Science.gov (United States)

    Lovesey, S. W.; Balcar, E.; Knight, K. S.; Fernández Rodríguez, J.

    2005-05-01

    The few electrons in valence states of a material participate in many of its physical properties, including both structural and transport properties. In the diffraction of X-rays, or neutrons, valence electrons can lead to weak Bragg reflections that are extremely sensitive signatures of their charge and magnetic degrees of freedom. In this regard, diffraction instruments supplied with X-rays from a synchrotron source are particularly useful because the brightness, tuneability and polarization of the X-rays are all helpful in making valuable observations. The data obtained from Bragg diffraction can be analyzed on the basis of an atomic model, which has the virtue that it can be used as a common platform for the analysis of X-ray and neutron diffraction and, in addition, the analysis of observations made with X-ray absorption, NMR, EPR, muon and Mössbauer spectroscopies. We present the salient features for the calculation of structure factors based on an atomic model and applied to the analysis of Bragg diffraction by non-magnetic and magnetic materials, with an emphasis on resonant X-ray Bragg diffraction. The presentation contains a new treatment of parity-odd events found in the mixed electric dipole-electric quadrupole channel of scattering. In addition we discuss the complementary observation of dichroic signals, including natural circular and magnetochiral dichroism. The survey of available analytical tools is complemented by a series of worked examples demonstrating the application of the formalism to different materials with different crystal structures and resonant ions: dysprosium borocarbide ( DyB2C2), vanadium sesquioxide (V2O3), gadolinium tetraboride ( GdB4), chromium sesquioxide ( Cr2O3), haematite and perovskite-type manganites.

  10. Electronic properties of crystalline materials observed in X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Lovesey, S.W. [Diamond Light Source Ltd., ISIS Facility, RAL, Oxfordshire OX11 0QX (United Kingdom) and RIKEN Harima Institute, SPring-8, Hyogo 679-5148 (Japan)]. E-mail: s.w.lovesey@rl.ac.uk; Balcar, E. [Vienna University of Technology, Atominstitut, Stadionallee 2, A1020, Vienna (Austria); Knight, K.S. [Diamond Light Source Ltd., ISIS Facility, RAL, Oxfordshire OX11 0QX (United Kingdom); Department of Mineralogy, Natural History Museum, London SW7 5BD (United Kingdom); Fernandez Rodriguez, J. [Departamento de Fisica, Universidad de Oviedo, E-33007 Oviedo (Spain)

    2005-05-01

    The few electrons in valence states of a material participate in many of its physical properties, including both structural and transport properties. In the diffraction of X-rays, or neutrons, valence electrons can lead to weak Bragg reflections that are extremely sensitive signatures of their charge and magnetic degrees of freedom. In this regard, diffraction instruments supplied with X-rays from a synchrotron source are particularly useful because the brightness, tuneability and polarization of the X-rays are all helpful in making valuable observations. The data obtained from Bragg diffraction can be analyzed on the basis of an atomic model, which has the virtue that it can be used as a common platform for the analysis of X-ray and neutron diffraction and, in addition, the analysis of observations made with X-ray absorption, NMR, EPR, muon and Mossbauer spectroscopies. We present the salient features for the calculation of structure factors based on an atomic model and applied to the analysis of Bragg diffraction by non-magnetic and magnetic materials, with an emphasis on resonant X-ray Bragg diffraction. The presentation contains a new treatment of parity-odd events found in the mixed electric dipole-electric quadrupole channel of scattering. In addition we discuss the complementary observation of dichroic signals, including natural circular and magnetochiral dichroism. The survey of available analytical tools is complemented by a series of worked examples demonstrating the application of the formalism to different materials with different crystal structures and resonant ions: dysprosium borocarbide (DyB{sub 2}C{sub 2}), vanadium sesquioxide (V{sub 2}O{sub 3}), gadolinium tetraboride (GdB{sub 4}), chromium sesquioxide (Cr{sub 2}O{sub 3}), haematite and perovskite-type manganites.

  11. Simultaneous X-ray diffraction and phase-contrast imaging for investigating material deformation mechanisms during high-rate loading

    Energy Technology Data Exchange (ETDEWEB)

    Hudspeth, M. [Purdue University, West Lafayette, IN 47907 (United States); Sun, T. [Argonne National Laboratory, Argonne, IL 60439 (United States); Parab, N.; Guo, Z. [Purdue University, West Lafayette, IN 47907 (United States); Fezzaa, K. [Argonne National Laboratory, Argonne, IL 60439 (United States); Luo, S. [The Peac Institute of Multiscale Sciences, Chengdu, Sichuan 610207, People’s Republic of (China); Chen, W., E-mail: wchen@purdue.edu [Purdue University, West Lafayette, IN 47907 (United States)

    2015-01-01

    A simultaneous X-ray imaging and diffraction technique has been developed for studying dynamic material behaviors during high-rate tensile loading provided by a miniature Kolsky bar. Using a high-speed camera and an intensified charge-coupled device (ICCD), a simultaneous X-ray imaging and diffraction technique has been developed for studying dynamic material behaviors during high-rate tensile loading. A Kolsky tension bar has been used to pull samples at 1000 s{sup −1} and 5000 s{sup −1} strain-rates for super-elastic equiatomic NiTi and 1100-O series aluminium, respectively. By altering the ICCD gating time, temporal resolutions of 100 ps and 3.37 µs have been achieved in capturing the diffraction patterns of interest, thus equating to single-pulse and 22-pulse X-ray exposure. Furthermore, the sample through-thickness deformation process has been simultaneously imaged via phase-contrast imaging. It is also shown that adequate signal-to-noise ratios are achieved for the detected white-beam diffraction patterns, thereby allowing sufficient information to perform quantitative data analysis diffraction via in-house software (WBXRD-GUI). Of current interest is the ability to evaluate crystal d-spacing, texture evolution and material phase transitions, all of which will be established from experiments performed at the aforementioned elevated strain-rates.

  12. High resolution double-sided diffractive optics for hard X-ray microscopy.

    Science.gov (United States)

    Mohacsi, Istvan; Vartiainen, Ismo; Guizar-Sicairos, Manuel; Karvinen, Petri; Guzenko, Vitaliy A; Müller, Elisabeth; Färm, Elina; Ritala, Mikko; Kewish, Cameron M; Somogyi, Andrea; David, Christian

    2015-01-26

    The fabrication of high aspect ratio metallic nanostructures is crucial for the production of efficient diffractive X-ray optics in the hard X-ray range. We present a novel method to increase their structure height via the double-sided patterning of the support membrane. In transmission, the two Fresnel zone plates on the two sides of the substrate will act as a single zone plate with added structure height. The presented double-sided zone plates with 30 nm smallest zone width offer up to 9.9% focusing efficiency at 9 keV, that results in a factor of two improvement over their previously demonstrated single-sided counterparts. The increase in efficiency paves the way to speed up X-ray microscopy measurements and allows the more efficient utilization of the flux in full-field X-ray microscopy.

  13. FTIR spectroscopy and X-ray powder diffraction characterization of microcrystalline cellulose obtained from alfa fibers

    Directory of Open Access Journals (Sweden)

    Trache D.

    2013-07-01

    Full Text Available Many cereal straws have been used as raw materials for the preparation of microcrystalline cellulose (MCC. These raw materials were gradually replaced with wood products; nevertheless about 10% of the world overall pulp production is obtained from non-wood raw material. The main interest in pulp made from straw is that it provides excellent fibres for different industries with special properties, and that it is the major available source of fibrous raw material in some geographical areas. The aim of the present work was to characterize microcrystalline cellulose prepared from alfa fibers using the hydrolysis process. The products obtained are characterized with FTIR spectroscopy and X-ray powder diffraction. As a result, FTIR spectroscopy is an appropriate technique for studying changes occurred by any chemical treatment. The spectrum of alfa grass stems shows the presence of lignin and hemicelluloses. However, the cellulose spectrum indicates that the extraction of lignin and hemicellulose was effective. The X-ray analysis indicates that the microcrystalline cellulose is more crystalline than the source material.

  14. Crystallization and preliminary X-ray diffraction analysis of recombinant phosphoribosylpyrophosphate synthetase from the Thermophilic thermus thermophilus strain HB27

    Energy Technology Data Exchange (ETDEWEB)

    Abramchik, Yu. A. [Russian Academy of Sciences, Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry (Russian Federation); Timofeev, V. I., E-mail: tostars@mail.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography of Federal Scientific Research Centre “Crystallography and Photonics” (Russian Federation); Muravieva, T. I.; Sinitsyna, E. V.; Esipov, R. S., E-mail: esipov@mx.ibch.ru [Russian Academy of Sciences, Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry (Russian Federation); Kuranova, I. P., E-mail: inna@ns.crys.ras.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography of Federal Scientific Research Centre “Crystallography and Photonics” (Russian Federation)

    2017-01-15

    Phosphoribosylpyrophosphate synthetases (PRPP synthetases) are among the key enzymes essential for vital functions of organisms and are involved in the biosynthesis of purine and pyrimidine nucleotides, coenzymes, and the amino acids histidine and tryptophan. These enzymes are used in biotechnology for the combined chemoenzymatic synthesis of natural nucleotide analogs. Recombinant phosphoribosylpyrophosphate synthetase I from the thermophilic strain HB27 of the bacterium Thermus thermophilus (T. th HB27) has high thermal stability and shows maximum activity at 75°Ð¡, due to which this enzyme holds promise for biotechnological applications. In order to grow crystals and study them by X-ray crystallography, an enzyme sample, which was produced using a highly efficient producer strain, was purified by affinity and gel-filtration chromatography. The screening of crystallization conditions was performed by the vapor-diffusion technique. The crystals of the enzyme suitable for X-ray diffraction were grown by the counter-diffusion method through a gel layer. These crystals were used to collect the X-ray diffraction data set at the SPring-8 synchrotron radiation facility (Japan) to 3-Å resolution. The crystals belong to sp. gr. P2{sub 1} and have the following unitcell parameters: a = 107.7 Å, b = 112.6 Å, c = 110.2 Å, α = γ = 90°, β = 116.6°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the enzyme at 3.0-Å resolution.

  15. Structure solution from powder neutron and x-ray diffraction data: getting the best of both worlds

    International Nuclear Information System (INIS)

    Hunter, B.A.

    2000-01-01

    Full text: Powder diffraction methods have traditionally been used in three main areas: phase identification and quantification, lattice parameter determination and structure refinement. Until recently structure solution has been the almost exclusive domain of single crystal diffraction methods, predominantly using x-rays. The increasing use of synchrotron and neutron sources, and the unrelenting advances in computing hardware and software means that powder methods are challenging single crystal methods as a practical method for structure solution, especially when single crystal method can not be applied. It is known that structural refinements from a known starting structure using combined X-ray and neutron data sets are capable of providing highly accurate structures. Likewise, using combined x-ray and neutron powder diffraction data in the structure solution process should also be a powerful technique, although to date no one is pursuing this methodology. This paper present examples of solutions to the problem. Namely we are using high resolution powder X-ray and neutron methods to solve the structures of molecular materials and minerals, then refining the structures using both sets of data. In this way we exploit the advantages of both methods while minimising the disadvantages. We present our solution for a small amino acid structure, a metalorganic and a mineral structure

  16. Determination of densities from chemical composition and X-Ray diffraction

    International Nuclear Information System (INIS)

    Azevedo, A.L.T. de

    1980-01-01

    X-ray diffraction method applied to retained austenite measurements gives volume per cent results, whereas the same kind of measurement made by Moessbauer Effect gives iron percentages. To compare both results one needs to convert the volume % to weight % or vice-versa. This necessitates, among other things, in determining the densities of the α and #betta# phases in the steel being studied. A method for calculating the densities, based on the application of the definition of density to just one unit cell, using X-ray diffraction and chemical results, are described. (Author) [pt

  17. Transmission diffraction-tomography system using a high-energy X-ray tube.

    Science.gov (United States)

    Garrity, D J; Jenneson, P M; Crook, R; Vincent, S M

    2010-01-01

    A high-energy bench-top energy dispersive X-ray diffraction (EDXRD) system for 3-dimensional mapping of the crystalline structure and phase transformations in steel is described, for which preliminary data and system development are presented here. The use of precision tungsten slit screens with up to 225 keV X-rays allows for diffraction through samples of 304 L austenitic stainless steel of thickness 3-10 mm, while sample positioning is carried out with a precision goniometer and translation stage system. Copyright 2009 Elsevier Ltd. All rights reserved.

  18. A Furnace for Diffraction Studies using Synchrotron X-Ray Radiation

    DEFF Research Database (Denmark)

    Buras, B.; Lebech, Bente; Kofoed, W.

    1984-01-01

    A furnace for diffraction studies using synchrotron X-ray radiation is described. The furnace can be operated between ambient temperature and 1 800 °C with a temperature stability better than 5 °C for temperatures above 300 °C. Kapton windows allow almost 360° access for the X-ray beam in the hor...... in the horizontal scattering plane and the furnace may be used in both conventional monochromatic beam angle-dispersive and white-beam energy-dispersive diffraction experiments. Details of the furnace windows, heating element, thermometry and sample mount are given....

  19. X-ray diffraction studies of chitosan acetate-based polymer electrolytes

    International Nuclear Information System (INIS)

    Osman, Z.; Ibrahim, Z.A.; Abdul Kariem Arof

    2002-01-01

    Chitosan is the product when partially deacetylated chitin dissolves in dilute acetic acid. This paper presents the x-ray diffraction patterns of chitosan acetate, plasticised chitosan acetate and plasticised-salted chitosan acetate films. The results show that the chitosan acetate based polymer electrolyte films are not completely amorphous but it is partially crystalline. X-ray diffraction study also confirms the occurrence of the complexation between chitosan and the salt and the interaction between salt and plasticizer. The salt-chitosan interaction is clearly justified by infrared spectroscopy. (Author)

  20. Modification of the x-ray diffraction efficiency of lithium fluoride crystals by surface treatment

    International Nuclear Information System (INIS)

    Sellick, B.O.

    1976-01-01

    Convex-curved crystals of lithium fluoride demonstrate good dispersion and efficiency when used in reflection for x-ray spectral analysis. The crystals are stable and reasonably unaffected by harsh environments. In addition, they are mechanically strong, easily cleavable or machinable, and plastically deformable with heat. In the present study, flat crystal wafers were left either clear as cleaved or were subjected to surface treatment by sandblasting or lapping. Some wafers were then bent in a press mold to obtain convex-curved crystals of differing radii. The diffraction efficiency data presented show how surface treatment affects the efficiency of these various crystals when used as x-ray diffracting agents

  1. Crystallization and preliminary X-ray diffraction study of porcine carboxypeptidase B

    Energy Technology Data Exchange (ETDEWEB)

    Akparov, V. Kh., E-mail: valery@akparov.ru [Scientific Center of Russian Federation Research Institute for Genetics and Selection of Industrial Microorganisms (Russian Federation); Timofeev, V. I., E-mail: inna@ns.crys.ras.ru; Kuranova, I. P., E-mail: tostars@mail.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation)

    2015-05-15

    Crystals of porcine pancreatic carboxypeptidase B have been grown in microgravity by the capillary counter-diffusion method through a gel layer. The X-ray diffraction study showed that the crystals belong to sp. gr. P4{sub 1}2{sub 1}2 and have the following unit-cell parameters: a = b = 79.58 Å, c = 100.51 Å; α = β = γ = 90.00°. The X-ray diffraction data set suitable for the determination of the three-dimensional structure at atomic resolution was collected from one of the grown crystals at the SPring 8 synchrotron facility to 0.98 Å resolution.

  2. Crystallization and preliminary X-ray diffraction study of recombinant ribokinase from Thermus Species 2.9

    Energy Technology Data Exchange (ETDEWEB)

    Abramchik, Yu. A. [Russian Academy of Sciences, Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry (Russian Federation); Timofeev, V. I., E-mail: tostars@mail.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography of Federal Scientific Research Centre “Crystallography and Photonics,” (Russian Federation); Muravieva, T. I.; Esipov, R. S., E-mail: espiov@mx.ibch.ru [Russian Academy of Sciences, Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry (Russian Federation); Kuranova, I. P., E-mail: inna@ns.crys.ras.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography of Federal Scientific Research Centre “Crystallography and Photonics,” (Russian Federation)

    2016-11-15

    Ribokinase from a thermophilic strain of Thermus species 2.9 belonging to the carbohydrate ribokinase family (EC 2.7.1.15) was isolated, purified, and crystallized. The crystallization conditions were found by the vapor-diffusion technique and were then optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals, which were grown by the counter-diffusion technique, at the SPring-8 synchrotron radiation facility to 2.87 Å resolution. The crystals belong to sp. gr. P12{sub 1}1 and have the following unit-cell parameters: a = 81.613 Å, b = 156.132 Å, c = 87.714 Å, α = γ = 90°, β = 103.819°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the protein by the molecular-replacement method.

  3. Diffractive-refractive optics: (+,-,-,+) X-ray crystal monochromator with harmonics separation.

    Science.gov (United States)

    Hrdý, Jaromír; Mikulík, Petr; Oberta, Peter

    2011-03-01

    A new kind of two channel-cut crystals X-ray monochromator in dispersive (+,-,-,+) position which spatially separates harmonics is proposed. The diffracting surfaces are oriented so that the diffraction is inclined. Owing to refraction the diffracted beam is sagittally deviated. The deviation depends on wavelength and is much higher for the first harmonics than for higher harmonics. This leads to spatial harmonics separation. The idea is supported by ray-tracing simulation.

  4. Time-resolved X-ray PIV technique for diagnosing opaque biofluid flow with insufficient X-ray fluxes.

    Science.gov (United States)

    Jung, Sung Yong; Park, Han Wook; Kim, Bo Heum; Lee, Sang Joon

    2013-05-01

    X-ray imaging is used to visualize the biofluid flow phenomena in a nondestructive manner. A technique currently used for quantitative visualization is X-ray particle image velocimetry (PIV). Although this technique provides a high spatial resolution (less than 10 µm), significant hemodynamic parameters are difficult to obtain under actual physiological conditions because of the limited temporal resolution of the technique, which in turn is due to the relatively long exposure time (~10 ms) involved in X-ray imaging. This study combines an image intensifier with a high-speed camera to reduce exposure time, thereby improving temporal resolution. The image intensifier amplifies light flux by emitting secondary electrons in the micro-channel plate. The increased incident light flux greatly reduces the exposure time (below 200 µs). The proposed X-ray PIV system was applied to high-speed blood flows in a tube, and the velocity field information was successfully obtained. The time-resolved X-ray PIV system can be employed to investigate blood flows at beamlines with insufficient X-ray fluxes under specific physiological conditions. This method facilitates understanding of the basic hemodynamic characteristics and pathological mechanism of cardiovascular diseases.

  5. The structure of para-toluidine by X-ray and neutron diffraction

    International Nuclear Information System (INIS)

    Bertinotti, A.L.

    1965-12-01

    The crystal and molecular structure of para-toluidine has been solved by X-ray and neutron diffraction counter techniques. The molecules are arranged in the form of infinite chains in the crystal, each molecule being linked to two neighbours by hydrogen bonds. The presence of the H bonds makes clear the difference in the melting points between para-toluidine and benzene hydrocarbons of related symmetry and molecular weight. Their direction accounts for the (001) cleavage and the growth anisotropy of crystals from supersaturated vapour phase. A structure-seeking method by computer has been elaborated, using lattice energy calculations applied to molecules treated as rigid bodies and making use of a simplex method for function minimization without calculation of derivatives. The way the available information is handled allows to increase the range of convergence, as shown in the case of para-toluidine. (author) [fr

  6. Contributions to the defocusing effect on pole figure measurements by X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Palacios G, J.; Salat F, R. S.; Jimenez J, A.; Kryshtab, T., E-mail: palacios@esfm.ipn.mx [Instituto Politecnico Nacional, Escuela Superior de Fisica y Matematicas, Av. IPN s/n, 07738 Mexico D. F. (Mexico)

    2015-07-01

    A simple method, considering a parallel beam approximation has been made to reproduce the main features of the defocusing effect, observed when pole figures are measured with the Schulz reflection technique using X-ray diffraction. A Lorentzian curve was used to approximate the primary beam profile. This method applied to low index reflections of copper and silver shows qualitatively and partially quantitatively, the extent the elongation of the ellipse resulting from the intersection of the beam with the tilted sample causes the defocusing effect. Differences observed experimentally are attributed mainly to the divergence of the beam, but also partially to the particular primary beam profile. Additionally, measurements with two different vertical heights of the receiving slit, i. e. the measured arch length of the Debye-Scherrer ring, indicate that this parameter plays no role in defocusing. (Author)

  7. Study of 249BkBr3 dimorphism by absorption spectrometry and X ray diffraction

    International Nuclear Information System (INIS)

    Peterson, J.R.; Fellows, R.L.; Young, J.P.; Haire, R.G.

    1977-01-01

    The phase transformation that occurs in solid BkBr 3 was studied by absorption spectroscopy and X-ray diffraction. Both techniques were applied to each 2-12 microgram sample at ambient and elevated temperatures. Significant increases in the f-f transition intensities were observed when the crystal structure was changed from the AlCl 3 -type monoclinic to the PuBr 3 -type orthorhombic form. The high-temperature monoclinic form can be maintained at room temperature by quenching the sample from above 350 deg C. By following the absorption intensity changes, it is also possible to study the kinetics of the phase transformation in the temperature range of 200-350 deg C [fr

  8. Imperfections study of the smoky quartz from Bahia by X-ray diffraction

    International Nuclear Information System (INIS)

    D'Aguiar Neto, M.M.F.

    1974-01-01

    X-ray diffraction techniques were used to study the type of point defects in Smoky quartz from Itambe and Vitoria da Conquista in Bahia. The power method, using the Seemann Bohlin camara (back refletion), was utilized in the analysis of the policrystals, while the monocrystals were studied by means of the precession camara. The positions occupied by the defects in the crystal net were calculated. The results show that while the defects of substitutional impurities predominate in the quartz from Itambe, in the quartz from Vitoria da Conquista the substitutional defects exist in comparable proportions that the interstital ones. Isochronous annealing curves, for both type of smoky quartz indicate an increase in the net parameter to temperature values above the annealing temperatures. Was formulated the hypothesis that providing a thermal energy greater than that of annealing is used, new interstitial defects would be created as a result of a thermic diffusion mechanism. (C.D.G.) [pt

  9. The Crystal Structure of the Malaria Pigment Hemozoin as Elucidated by X-ray Powder Diffraction

    DEFF Research Database (Denmark)

    Straasø, Tine

    in the eradication of malaria. This thesis is a step towards that goal. When examining red blood cells from an infected person under a microscope dark pigment is observed. This dark pigment is actually small crystals called hemozoin. Hemozoin is a by-product formed by the parasite and a necessity for parasitic......Malaria is a widespread and severe disease caused by an infection by the parasite of the genus Plasmodium, the lifecycle of which is very complex. During its lifecycle the parasite resides in both a mosquito and a human host. If this cycle can be disrupted at any point, it will result...... survival. Successful inhibition of hemozoin crystallization will lead to parasitic death and thus break the cycle. The aim of this thesis is to elucidate the structure of hemozoin by means of X-ray diffraction techniques. Knowledge of the structure will help facilitate intelligent drug design in the future...

  10. X-ray diffraction and mechanical properties studies on Kevlar-49 fibres

    International Nuclear Information System (INIS)

    Abdo, S. M.

    1988-01-01

    The thesis deals with the effect of annealing in the temperature range 150-500 degrees celsius, and long-term ageing (1-150 days) at 150 degrees celsius, on the structure and mechanical properties of Kevlar-49 fibres. Wide-angle x-ray diffraction techniques were used to characterize quantitatively the structure in terms of crystallinity, crystallite size and orientation. The mechanical properties were characterized in terms of initial Young's modulus, tensile strength, and elongation at break. Thermogravimetric analysis was performed to determine the loss in weight after annealing. Differential Thermal Analysis (DTA) scan was performed to determine the 'peak melting point' of the untreated Kevlar-49 fibres. The surface topography, fracture behaviour and microfibrillar character of Kevlar-49 were studied in a scanning electron microscope. 52 refs., 30 figs., 6 tabs. (A.M.H.)

  11. Diffraction crystals for sagittally focusing x-rays

    Science.gov (United States)

    Ice, G.E.; Sparks, C.J. Jr.

    1982-06-07

    The invention is a new type of diffraction crystal designed for sagittally focusing photons of various energies. The invention is based on the discovery that such focusing is not obtainable with conventional crystals because of distortion resulting from anticlastic curvature. The new crystal comprises a monocrystalline base having a front face contoured for sagittally focusing photons and a back face provided with rigid, upstanding, stiffening ribs restricting anticlastic curvature. When mounted in a suitable bending device, the reflecting face of the crystal can be adjusted to focus photons having any one of a range of energies.

  12. Real-time direct and diffraction X-ray imaging of irregular silicon wafer breakage

    Directory of Open Access Journals (Sweden)

    Alexander Rack

    2016-03-01

    Full Text Available Fracture and breakage of single crystals, particularly of silicon wafers, are multi-scale problems: the crack tip starts propagating on an atomic scale with the breaking of chemical bonds, forms crack fronts through the crystal on the micrometre scale and ends macroscopically in catastrophic wafer shattering. Total wafer breakage is a severe problem for the semiconductor industry, not only during handling but also during temperature treatments, leading to million-dollar costs per annum in a device production line. Knowledge of the relevant dynamics governing perfect cleavage along the {111} or {110} faces, and of the deflection into higher indexed {hkl} faces of higher energy, is scarce due to the high velocity of the process. Imaging techniques are commonly limited to depicting only the state of a wafer before the crack and in the final state. This paper presents, for the first time, in situ high-speed crack propagation under thermal stress, imaged simultaneously in direct transmission and diffraction X-ray imaging. It shows how the propagating crack tip and the related strain field can be tracked in the phase-contrast and diffracted images, respectively. Movies with a time resolution of microseconds per frame reveal that the strain and crack tip do not propagate continuously or at a constant speed. Jumps in the crack tip position indicate pinning of the crack tip for about 1–2 ms followed by jumps faster than 2–6 m s−1, leading to a macroscopically observed average velocity of 0.028–0.055 m s−1. The presented results also give a proof of concept that the described X-ray technique is compatible with studying ultra-fast cracks up to the speed of sound.

  13. Observation of parametric X-ray radiation in an anomalous diffraction region

    Energy Technology Data Exchange (ETDEWEB)

    Alexeyev, V.I., E-mail: vial@x4u.lebedev.ru [P.N. Lebedev Physical Institute RAS, 53 Leninskiy prospect, Moscow (Russian Federation); Belgorod National Research University, 85 Pobedy st., Belgorod (Russian Federation); Eliseyev, A.N., E-mail: elisseev@pluton.lpi.troitsk.ru [P.N. Lebedev Physical Institute RAS, 53 Leninskiy prospect, Moscow (Russian Federation); Belgorod National Research University, 85 Pobedy st., Belgorod (Russian Federation); Irribarra, E., E-mail: esteban.irribarra@epn.edu.ec [Escuela Politécnica Nacional, Ladrón de Guevara E11-253, Quito (Ecuador); Kishin, I.A., E-mail: ivan.kishin@mail.ru [P.N. Lebedev Physical Institute RAS, 53 Leninskiy prospect, Moscow (Russian Federation); Belgorod National Research University, 85 Pobedy st., Belgorod (Russian Federation); Kubankin, A.S., E-mail: kubankin@bsu.edu.ru [P.N. Lebedev Physical Institute RAS, 53 Leninskiy prospect, Moscow (Russian Federation); Belgorod National Research University, 85 Pobedy st., Belgorod (Russian Federation); Nazhmudinov, R.M., E-mail: fizeg@bk.ru [P.N. Lebedev Physical Institute RAS, 53 Leninskiy prospect, Moscow (Russian Federation); Belgorod National Research University, 85 Pobedy st., Belgorod (Russian Federation)

    2016-08-19

    A new possibility to expand the energy region of diffraction processes based on the interaction of relativistic charged particles with crystalline structures is presented. Diffracted photons related to parametric X-ray radiation produced by relativistic electrons are detected below the low energy threshold for the X-ray diffraction mechanism in crystalline structures for the first time. The measurements were performed during the interaction of 7 MeV electrons with a textured polycrystalline tungsten foil and a highly oriented pyrolytic graphite crystal. The experiment results are in good agreement with a developed model based on the PXR kinematical theory. The developed experimental approach can be applied to separate the contributions of real and virtual photons to the total diffracted radiation generated during the interaction of relativistic charged particles with crystalline targets. - Highlights: • Parametric X-ray radiation below the low energy threshold for diffraction of free X-rays. • Experimental separation of the contributions from different radiation mechanisms. • PXR from relativistic electrons in mosaic crystals and textured polycrystlas.

  14. Femtosecond X-ray diffraction from two-dimensional protein crystals

    Directory of Open Access Journals (Sweden)

    Matthias Frank

    2014-03-01

    Full Text Available X-ray diffraction patterns from two-dimensional (2-D protein crystals obtained using femtosecond X-ray pulses from an X-ray free-electron laser (XFEL are presented. To date, it has not been possible to acquire transmission X-ray diffraction patterns from individual 2-D protein crystals due to radiation damage. However, the intense and ultrafast pulses generated by an XFEL permit a new method of collecting diffraction data before the sample is destroyed. Utilizing a diffract-before-destroy approach at the Linac Coherent Light Source, Bragg diffraction was acquired to better than 8.5 Å resolution for two different 2-D protein crystal samples each less than 10 nm thick and maintained at room temperature. These proof-of-principle results show promise for structural analysis of both soluble and membrane proteins arranged as 2-D crystals without requiring cryogenic conditions or the formation of three-dimensional crystals.

  15. Coded diffraction system in X-ray crystallography using a boolean phase coded aperture approximation

    Science.gov (United States)

    Pinilla, Samuel; Poveda, Juan; Arguello, Henry

    2018-03-01

    Phase retrieval is a problem present in many applications such as optics, astronomical imaging, computational biology and X-ray crystallography. Recent work has shown that the phase can be better recovered when the acquisition architecture includes a coded aperture, which modulates the signal before diffraction, such that the underlying signal is recovered from coded diffraction patterns. Moreover, this type of modulation effect, before the diffraction operation, can be obtained using a phase coded aperture, just after the sample under study. However, a practical implementation of a phase coded aperture in an X-ray application is not feasible, because it is computationally modeled as a matrix with complex entries which requires changing the phase of the diffracted beams. In fact, changing the phase implies finding a material that allows to deviate the direction of an X-ray beam, which can considerably increase the implementation costs. Hence, this paper describes a low cost coded X-ray diffraction system based on block-unblock coded apertures that enables phase reconstruction. The proposed system approximates the phase coded aperture with a block-unblock coded aperture by using the detour-phase method. Moreover, the SAXS/WAXS X-ray crystallography software was used to simulate the diffraction patterns of a real crystal structure called Rhombic Dodecahedron. Additionally, several simulations were carried out to analyze the performance of block-unblock approximations in recovering the phase, using the simulated diffraction patterns. Furthermore, the quality of the reconstructions was measured in terms of the Peak Signal to Noise Ratio (PSNR). Results show that the performance of the block-unblock phase coded apertures approximation decreases at most 12.5% compared with the phase coded apertures. Moreover, the quality of the reconstructions using the boolean approximations is up to 2.5 dB of PSNR less with respect to the phase coded aperture reconstructions.

  16. Assessment of the out-plane and in-plane ordering of high quality ZnO nanorods by X-ray multiple diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Martínez-Tomás, M.C., E-mail: Carmen.Martinez-tomas@uv.es [Departamento de Física Aplicada y Electromagnetismo, Universitat de Valencia, Dr. Moliner 50, 46100 Burjassot (Spain); Montenegro, D.N.; Agouram, S. [Departamento de Física Aplicada y Electromagnetismo, Universitat de Valencia, Dr. Moliner 50, 46100 Burjassot (Spain); Sallet, V. [Groupe d' Etude de la Matière Condensée (GEMAC), CNRS-Université de Versailles St-Quentin, 45 avenue des Etats-Unis, 78035 Versailles Cedex (France); Muñoz-Sanjosé, V. [Departamento de Física Aplicada y Electromagnetismo, Universitat de Valencia, Dr. Moliner 50, 46100 Burjassot (Spain)

    2013-08-31

    ZnO nanorods grown on buffered and non buffered sapphire substrates have been investigated by X-ray multiple diffraction using Renninger scans of the ZnO(0001) and ZnO(0003) forbidden reflections. In this technique the diffracted X-ray beam is simultaneously diffracted by several sets of planes, providing information on the broadening in different directions, as well as from nanorods, and from the layer on which they grow. The intensities and angular widths of peaks obtained by azimuthal and omega scans have been analyzed, making a direct comparison with conventional measurements of the full width at half-maximum of symmetric and asymmetric reflections. The analysis leads to establish that the peaks of the Renninger scan are highly sensitive to structural characteristics, providing information related with both the out-plane and in-plane ordering of nanostructured samples with a single scan. - Highlights: ► Structural characteristics of ZnO nanorods have been analyzed by X-ray multiple diffraction. ► X-ray multiple diffraction can provide mosaic structure characteristics from a single scan. ► Peaks of Renninger scan result to be very sensitive to structural characteristics. ► X-ray multiple diffraction can be an alternative analysis method to X-ray diffraction.

  17. New opportunities for 3D materials science of polycrystalline materials at the micrometre lengthscale by combined use of X-ray diffraction and X-ray imaging

    DEFF Research Database (Denmark)

    Ludwig, W.; King, A.; Reischig, P.

    2009-01-01

    Non-destructive, three-dimensional (3D) characterization of the grain structure in mono-phase polycrystalline materials is an open challenge in material science. Recent advances in synchrotron based X-ray imaging and diffraction techniques offer interesting possibilities for mapping 3D grain shapes...... and crystallographic orientations for certain categories of polycrystalline materials. Direct visualisation of the three-dimensional grain boundary network or of two-phase (duplex) grain structures by means of absorption and/or phase contrast techniques may be possible, but is restricted to specific material systems......, crystallographic orientation and local attenuation coefficient distribution. The technique applies to the larger range of plastically undeformed, polycrystalline mono-phase materials, provided some conditions on grain size and texture are fulfilled. The straightforward combination with high...

  18. Characterisation of microfocused beam for synchrotron powder diffraction using a new X-ray camera

    International Nuclear Information System (INIS)

    Thomas, C; Potter, J; Tang, C C; Lennie, A R

    2012-01-01

    The powder diffraction beamline I11, Diamond Light Source, is being continually upgraded as requirements of the user community evolve. Intensities of X-rays from the I11 in-vacuum electron undulator in the 3 GeV synchrotron fall off at higher energies. By focusing higher energy X-rays, we can overcome flux limitations, and open up new diffraction experiments. Here, we describe characterisation of microfocusing using compound refractive lenses (CRL). For a relatively modest outlay, we have developed an experimental setup and a novel X-ray camera with good sensitivity and a resolution specification suitable for characterising these focusing optics. We show that vertical oscillations in the focused beam compromise resolution of the source imaged by the CRL. Nevertheless, we have measured CRL focusing properties, and demonstrate the use of energy scanning to determine lens alignment. Real benefits of the intensity gain are illustrated.

  19. Soft x-ray resonant magnetic powder diffraction on PrNiO{sub 3}

    Energy Technology Data Exchange (ETDEWEB)

    Staub, U [Swiss Light Source, Paul Scherrer Institut, CH-5232 Villigen PSI (Switzerland); GarcIa-Fernandez, M [Swiss Light Source, Paul Scherrer Institut, CH-5232 Villigen PSI (Switzerland); Mulders, A M [Department of Applied Physics, Curtin University of Technology, GPO Box U1987, Perth WA 6845 (Australia); Bodenthin, Y [Swiss Light Source, Paul Scherrer Institut, CH-5232 Villigen PSI (Switzerland); MartInez-Lope, M J [Instituto de Ciencia de Materiales de Madrid, CSIC, Cantoblanco, E-28049 Madrid (Spain); Alonso, J A [Instituto de Ciencia de Materiales de Madrid, CSIC, Cantoblanco, E-28049 Madrid (Spain)

    2007-03-07

    We report on the first soft x-ray resonant powder diffraction experiments performed at the Ni L{sub 2,3} edges of PrNiO{sub 3}. The temperature, polarization and energy dependence of the (1/2 0 1/2) reflection indicates a magnetic origin for the signal. This experiment demonstrates that x-ray resonant magnetic powder diffraction can be relatively easily performed in the soft x-ray regime due to the very large enhancement factors at the absorption edges. Such experiments allow us to extract important information on the electronic states of the d shell. Similar results can be anticipated from orbital reflections measured in a powder. (fast track communication)

  20. In situ laser heating and radial synchrotron X-ray diffraction ina diamond anvil cell

    Energy Technology Data Exchange (ETDEWEB)

    Kunz, Martin; Caldwell, Wendel A.; Miyagi, Lowell; Wenk,Hans-Rudolf

    2007-06-29

    We report a first combination of diamond anvil cell radialx-ray diffraction with in situ laser heating. The laser-heating setup ofALS beamline 12.2.2 was modified to allow one-sided heating of a samplein a diamond anvil cell with an 80 W yttrium lithium fluoride laser whileprobing the sample with radial x-ray diffraction. The diamond anvil cellis placed with its compressional axis vertical, and perpendicular to thebeam. The laser beam is focused onto the sample from the top while thesample is probed with hard x-rays through an x-ray transparentboron-epoxy gasket. The temperature response of preferred orientation of(Fe,Mg)O is probed as a test experiment. Recrystallization was observedabove 1500 K, accompanied by a decrease in stress.

  1. Cryogenic x-ray diffraction microscopy utilizing high-pressure cryopreservation

    Science.gov (United States)

    Lima, Enju; Chushkin, Yuriy; van der Linden, Peter; Kim, Chae Un; Zontone, Federico; Carpentier, Philippe; Gruner, Sol M.; Pernot, Petra

    2014-10-01

    We present cryo x-ray diffraction microscopy of high-pressure-cryofixed bacteria and report high-convergence imaging with multiple image reconstructions. Hydrated D. radiodurans cells were cryofixed at 200 MPa pressure into ˜10-μm-thick water layers and their unstained, hydrated cellular environments were imaged by phasing diffraction patterns, reaching sub-30-nm resolutions with hard x-rays. Comparisons were made with conventional ambient-pressure-cryofixed samples, with respect to both coherent small-angle x-ray scattering and the image reconstruction. The results show a correlation between the level of background ice signal and phasing convergence, suggesting that phasing difficulties with frozen-hydrated specimens may be caused by high-background ice scattering.

  2. Hydrothermal formation of tobermorite studied by in situ X-ray diffraction under autoclave condition.

    Science.gov (United States)

    Kikuma, Jun; Tsunashima, Masamichi; Ishikawa, Tetsuji; Matsuno, Shin-ya; Ogawa, Akihiro; Matsui, Kunio; Sato, Masugu

    2009-09-01

    Hydrothermal formation of tobermorite from a pre-cured cake has been investigated by transmission X-ray diffraction (XRD) using high-energy X-rays from a synchrotron radiation source in combination with a newly designed autoclave cell. The autoclave cell has a large and thin beryllium window for wide-angle X-ray diffraction; nevertheless, it withstands a steam pressure of more than 1.2 MPa, which enables in situ XRD measurements in a temperature range of 373 to 463 K under a saturated steam pressure. Formation and/or decomposition of several components has been successfully observed during 7.5 h of reaction time. From the intensity changes of the intermediate materials, namely non-crystalline C-S-H and hydroxylellestadite, two pathways for tobermorite formation have been confirmed. Thus, the newly developed autoclave cell can be used for the analyses of reaction mechanisms under specific atmospheres and temperatures.

  3. Crystallization kinetics of amorphous griseofulvin by pattern fitting procedure using X-ray diffraction data.

    Science.gov (United States)

    Yamamura, Shigeo; Takahira, Rieko; Momose, Yasunori

    2007-05-01

    A pattern fitting procedure using X-ray powder diffraction patterns was applied to study the crystallization kinetics of amorphous griseofulvin. From the optimized parameters obtained by pattern fitting, a change in the quantity and quality of griseofulvin crystals with crystallization was also investigated. Amorphous griseofulvin was prepared by cooling the melts followed by pulverization. X-ray diffraction patterns of amorphous griseofulvin were repeatedly measured every 20 h. The observed pattern was separated into crystalline diffraction intensity and amorphous scattering intensity by the nonlinear least-squares procedure. The fitting between the observed and simulated diffraction patterns was satisfactorily independent of the degree of crystallinity. Since a good linear relationship was found in a plot of amorphous scattering intensity against crystalline diffraction intensity, the degree of crystallinity can be determined according to Hermans' method. The diffraction peak width increased with higher diffraction angles with crystallization. The crystallization was biphasic: fast and slow crystallization with the growth of low disordered crystals and disordered crystals, respectively. The pattern fitting procedure is a powerful tool to analyze the X-ray diffraction patterns of semicrystalline materials. This procedure can simultaneously analyze the degree of crystallinity and crystal disorder in semicrystalline samples during crystallization.

  4. X-ray diffraction broadening effects in metallic alloys

    International Nuclear Information System (INIS)

    Kimmel, G.; Dayan, D.

    1996-01-01

    Although an extensive work had been done in the last decade in the field of line broadening analysis of XRPD there is still little agreement whether this method can be accepted as a characterization tool. The purpose of the present work is to demonstrate that a valuable information can be retrieved from line broadening effects in XRPD. In this work it was focused on the line broadening effects accompanied with typical processes in metallic systems. The following systems were studied:, pure iron, steels, and alloying effects in uranium alloys. The broadening analysis was linked to different variables like hardness, Izod notch toughness, amount of cold work, surface treatment, concentration of additional elements in solid solutions. The Williamson-Hall method was adopted providing fast and global view of resolved 'strain'-'size' effects, considering the entire diffraction spectrum. The size effect was occasionally approved by direct observations of STM or SEM for example. The results of the broadening analysis were well correlated with other measured parameters like toughness and hardness. It was found that alloying in metallic system is sometimes expressed by pure strain effect but cold work results in a mix of strain and size broadening. The complete view of our results lead us to believe that broadening effect can be quantified. Hence, it is recommended to establish a quantitative XRD line broadening analysis method as a novel tool for characterization of metallic materials. (author)

  5. X-ray diffraction investigation of cyclohexane derivatives at 293 K

    International Nuclear Information System (INIS)

    Drozdowski, Henryk; Nowakowski, Krzysztof; BLaszczak, ZdzisLaw

    2011-01-01

    This paper reports results of the X-ray diffraction structural studies of liquid cyclohexylamine C 6 H 11 -NH 2 and cyclohexanol C 6 H 11 -OH performed at 293 K. The method of X-ray scattering and Fourier analysis enabled the determination of the mean structural parameters of the liquids studied. The wide-angle X-ray scattering (WAXS) method provided new information on mutual arrangement and orientation of the molecules of the above mentioned compounds in the liquid phase. The measurements of scattered radiation intensity were performed in a wide range of wave vector (from S min =0.925 A -1 to S max =14.311 A -1 ), with the use of X-ray radiation MoK α (λ=0.71069 A). Angular distributions of X-ray scattered intensity were measured, and differential radial distribution functions of electron density (DRDFs) were calculated. The mean distances between the neighbouring molecules and the mean radii of coordination spheres were found. A simple model of short-range arrangement of the molecules was proposed, which seems to be valid for other polar monosubstituted cyclohexane derivatives in the liquid phase. - Highlights: → X-ray method enabled the determination of the structure of cyclohexane derivatives. → Determination of the mean parameters of the liquid structure has been discussed. → A simple model of short-range arrangement and orientation of the molecules was proposed. → Results are valid for a wide group of molecular liquids.

  6. Ab initio structure determination via powder X-ray diffraction

    Indian Academy of Sciences (India)

    Although the method of structure completion when once the starting model is provided is facile through the Rietveld refinement technique, the structure solution ab initio os still not push-button technology. In this article a survey of the recent development in this area is provided with an illustration of the structure determination ...

  7. X-ray diffraction microscopy based on refractive optics

    DEFF Research Database (Denmark)

    Poulsen, Henning Friis; Jakobsen, A. C.; Simons, Hugh

    2017-01-01

    A formalism is presented for dark‐field X‐ray microscopy using refractive optics. The new technique can produce three‐dimensional maps of lattice orientation and axial strain within millimetre‐sized sampling volumes and is particularly suited to in situ studies of materials at hard X‐ray energies...

  8. About some practical aspects of X-ray diffraction : From powder to thin film

    Energy Technology Data Exchange (ETDEWEB)

    Valvoda, V. [Charles Univ. Prague (Czech Republic). Faculty of Mathematics and Physics

    1996-09-01

    Structure of thin films can be amorphous, polycrystalline or epitaxial, and the films can be prepared as a single layer films, multilayers or as graded films. A complete structure analysis of thin films by means of X-ray diffraction (XRD) usually needs more than one diffraction geometry to be used. Their principles, advantages and disadvantages will be shortly described, especially with respect to their different sampling depth and different response to orientation of diffracting crystallographic planes. Main differences in structure of thin films with respect to powder samples are given by a singular direction of their growth, by their adhesion to a substrate and often also by a simultaneous bombardment by atomic species during the growth. It means that a thermodynamically unstable atomic structures can be found too. These special features of growth of thin polycrystalline films are reflected in often found strong preferred orientation of grains and in residual stresses conserved in the films. The methods of structure analysis of thin films by XRD will be compared with other techniques which can supply structure images on different scales.

  9. Quantitative analysis of phases by x-ray diffraction and thermogravimetry in Cuban phosphorite ores

    International Nuclear Information System (INIS)

    Casanova Gomez, Abdel; Martinez Montalvo, Asor; Cilano Campos, Guillermo; Arostegui Aguirre, Miladys; Ferreiro Fernandez, Adalyz; Alonso Perez, Jose A.

    2016-01-01

    Phases analysis is performed by instrumental techniques X - ray diffraction and Thermal Analysis in two groups of samples of Cuban minerals carriers'phosphorus, candidates to reference materials. To this end, the variant of structural refinement of the diffraction pattern in the form of adjustment profile is applied, using the Full prof program of Juan Rodriguez-Carvajal. This analysis is the first step to develop the standard specification of these resources and classify them as phosphate rock and / or phospharite from their mass content. The statistical evaluation of the uncertainty of the quantitative analysis (standard deviation) was carried out in ten replicate samples of phosphate rock and eight of phosphate from the field Trinidad de Guedes. The qualitative phase analysis reflected the following phase composition: carbonate fluoroapatite (CFA), Calcite, Quartz and Halloysite (present only in the clayey granular phosphorite ore; FGA). By the method of setting pattern powder diffraction profile, the quantitative phase composition is reported in the sample FGA: 87 (2) % of CFA, 4 (1) % of Calcite, 1% Quartz, and 8 (3) % Halloysite. For granular limestone ore (FGC), the following contents were obtained: 87 (3) % Calcite, 8 (3) % of CFA and 5 (1) % Quartz: The obtained values are corroborated by Thermogravimetric Analysis (TG) through the calculation of the mass content of the thermally active phases (Calcite and CFA) in the range (27-10000 0 C), confirming the validity of the results of XRD. (Author)

  10. Dewetting of Au Films Studied by Coherent X-ray Diffraction (CXD)

    Science.gov (United States)

    Williams, G. J.; Pfeifer, M. A.; Robinson, I. K.

    2002-03-01

    Long-term heating of Au thin films evaporated on quartz or silica substrates causes dewetting. Eventually, single crystals of Au are formed with a size and spacing determined by the initial deposit thickness. When a finite perfect crystal is illuminated by a coherent X-ray beam, the diffracted intensity near a Bragg peak is the square modulus of the Fourier Transform of the diffracting crystal. The advantage of the coherent technique in this situation lies in its ability to recover the shape of the resulting crystal, allowing measurement not only of the size and spatial distribution of the dewetted film, but also of the contact angle and the strain within the 3D crystal. The quantity measured in such a CXD experiment is the intensity; the phase of the diffracted beam may be recovered using an iterative algorithm, thereby allowing the reconstruction of crystal shape. We present here the successful inversion of a CXD pattern in three dimensions from a micron-sized Au single crystal prepared in this way.

  11. Possibilities and Challenges of Scanning Hard X-ray Spectro-microscopy Techniques in Material Sciences

    Directory of Open Access Journals (Sweden)

    Andrea Somogyi

    2015-06-01

    Full Text Available Scanning hard X-ray spectro-microscopic imaging opens unprecedented possibilities in the study of inhomogeneous samples at different length-scales. It gives insight into the spatial variation of the major and minor components, impurities and dopants of the sample, and their chemical and electronic states at micro- and nano-meter scales. Measuring, modelling and understanding novel properties of laterally confined structures are now attainable. The large penetration depth of hard X-rays (several keV to several 10 keV beam energy makes the study of layered and buried structures possible also in in situ and in operando conditions. The combination of different X-ray analytical techniques complementary to scanning spectro-microscopy, such as X-ray diffraction, X-ray excited optical luminescence, secondary ion mass spectrometry (SIMS and nano-SIMS, provides access to optical characteristics and strain and stress distributions. Complex sample environments (temperature, pressure, controlled atmosphere/vacuum, chemical environment are also possible and were demonstrated, and allow as well the combination with other analysis techniques (Raman spectroscopy, infrared imaging, mechanical tensile devices, etc. on precisely the very same area of the sample. The use of the coherence properties of X-rays from synchrotron sources is triggering emerging experimental imaging approaches with nanometer lateral resolution. New fast analytical possibilities pave the way towards statistically significant studies at multi- length-scales and three dimensional tomographic investigations. This paper gives an overview of these techniques and their recent achievements in the field of material sciences.

  12. High alumina refractory castables monitored by X-ray diffraction and dilatometry techniques; Sinterizacao de concretos refratarios de alta alumina monitorada pelas tecnicas de dilatometria e difracao de raios-X

    Energy Technology Data Exchange (ETDEWEB)

    Menegazzo, A.P.M.; Pandolfelli, V.C.; Rodrigues, J.A. [Sao Carlos Univ., SP (Brazil). Dept. de Engenharia de Materiais

    1997-12-31

    The utilization of free calcium hydraulic binder in refractory castables of Al{sub 2} O{sub 3} - Si O{sub 2} system affords a better thermochemical performance. Silica fume improves castable flowability and workability, promotes mullite formation, and the presence of free calcium hydraulic blinder it can act as a sintering additive promoting strength development at low firing temperatures. The main objective of this study was to evaluate the sintering steps and strength development of high alumina castables prepared with or without cement/silica fume. The dialometric and X-ray diffraction analysis were applied to evaluate the influence of phases formation on the mechanical characteristics. (author) 3 refs., 6 figs., 1 tab.

  13. Mössbauer effect studies and X-ray diffraction analysis of cobalt ...

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science; Volume 26; Issue 5. Mössbauer effect studies and X-ray diffraction analysis of cobalt ferrite prepared in powder form by thermal decomposition method. M D Joseph Sebastian B Rudraswamy M C Radhakrishna Ramani. Magnetic Materials Volume 26 Issue 5 August 2003 pp ...

  14. High-pressure X-ray diffraction of L-ALANINE crystal

    DEFF Research Database (Denmark)

    Olsen, J.S.; Gerward, Leif; Souza, A.G.

    2006-01-01

    L-ALANINE has been studied by X-ray diffraction at ambient temperature and pressure up to 10.3 GPa. The material is found to transform to a tetragonal structure between 2 and 3 GPa. and to a monoclinic structure between 8 and 10 GPa. The experimental bulk modulus is 25(5) GPa for the orthorhombic...

  15. Small angles X-ray diffraction and Mössbauer characterization of ...

    Indian Academy of Sciences (India)

    The effect of thermal annealing on the structure and magnetic properties of crystalline Tb/Fe multilayers has been studied using conversion electron Mössbauer spectrometry and small-angle X-ray diffraction. The growth of Tb–Fe amorphous alloy from the interface is observed with increasing annealing temperature.

  16. Characterization, crystallization and preliminary X-ray diffraction studies of tomato nuclease I

    Czech Academy of Sciences Publication Activity Database

    Koval, Tomáš; Dohnálek, Jan; Lipovová, P.; Podzimek, T.; Matoušek, Jaroslav

    2009-01-01

    Roč. 16, 1a (2009), b33 ISSN 1211-5894. [Discussions in Structural Molecular Biology /7./. 12.03.2009-14.03.2009, Nové Hrady] Institutional research plan: CEZ:AV0Z40500505 Keywords : X-ray diffraction * tomato nuclease Subject RIV: CD - Macromolecular Chemistry

  17. Origin of nondetectable x-ray diffraction peaks in nanocomposite CuTiZr alloys

    DEFF Research Database (Denmark)

    Jiang, Jianzhong; Kato, H.; Ohsuna, T.

    2003-01-01

    Microscopic structures of Cu60Ti10+xZr30-x (x=0 and 10) alloys have been investigated by transmission electron microscopy, x-ray diffraction (XRD) and differential scanning calorimeter (DSC). In the Cu60Ti10Zr30 samples annealed at 708 K for times ranging from 0 to 130 min, where the enthalpy...

  18. Quantitative phase analysis of uranium carbide from x-ray diffraction data using the Rietveld method

    International Nuclear Information System (INIS)

    Singh Mudher, K.D.; Krishnan, K.

    2003-01-01

    Quantitative phase analysis of a uranium carbide sample was carried out from the x-ray diffraction data by Rietveld profile fitting method. The method does not require the addition of any reference material. The percentage of UC, UC 2 and UO 2 phases in the sample were determined. (author)

  19. High-pressure phases of uranium monophosphide studied by synchrotron x-ray diffraction

    DEFF Research Database (Denmark)

    Olsen, J. Staun; Gerward, Leif; Benedict, U.

    1988-01-01

    X-ray diffraction studies have been performed on UP powder for pressures up to 51 GPa using synchrotron radiation and a diamond-anvil cell. At ambient pressure UP has the rocksalt structure. The bulk modulus has been determined to B0=102(4) GPa and its pressure derivative to B0’=4.0(8). The cubic...

  20. Electrochemical cell for in situ x-ray diffraction under ultrapure conditions

    DEFF Research Database (Denmark)

    Koop, T.; Schindler, W.; Kazimirov, A.

    1998-01-01

    of the crystal using a Luggin capillary and a standard reference electrode. We demonstrate the performance of our cell by in situ synchrotron x-ray diffraction measurements on ultrathin Co layers electrodeposited on Cu(001) in an aqueous H(2)SO(4)/CoSO(4) solution. (C) 1998 American Institute of Physics....

  1. A greedy method for reconstructing polycrystals from three-dimensional X-ray diffraction data

    DEFF Research Database (Denmark)

    Kulshreshth, Arun Kumar; Alpers, Andreas; Herman, Gabor T.

    2009-01-01

    An iterative search method is proposed for obtaining orientation maps inside polycrystals from three-dimensional X-ray diffraction (3DXRD) data. In each step, detector pixel intensities are calculated by a forward model based on the current estimate of the orientation map. The pixel at which the ...

  2. X-ray and neutron diffraction line broadening measurements in a martensitic steel for fusion technology

    International Nuclear Information System (INIS)

    Coppola, R.; Lukas, P.; Vrana, M.; Montanari, R.; Rustichelli, F.

    1995-01-01

    X-ray and neutron diffraction line broadening measurements have been carried out on a modified martensitic steel DIN 1.4914 for fusion technology (MANET) after quenching followed by tempering treatments at 700C. The results of the two experiments are discussed with reference to Cr redistribution phenomena in the matrix

  3. Standing-wave effects in grazing-incidence x-ray diffraction from polycrystalline multilayers

    Czech Academy of Sciences Publication Activity Database

    Krčmář, J.; Holý, V.; Horák, L.; Metzger, T. H.; Sobota, Jaroslav

    2008-01-01

    Roč. 103, č. 3 (2008), 033504:1-7 ISSN 0021-8979 Institutional research plan: CEZ:AV0Z20650511 Keywords : acoustic wave interference * carbon * crystallites * interface structure * nickel * optical multilayers * superlattices * X-ray diffraction Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.201, year: 2008

  4. Applications of X-ray diffraction method III: determination of crystallite size and strain

    International Nuclear Information System (INIS)

    Majid, C.A.; Hussain, M.A.

    1995-01-01

    The broadening of X-ray diffraction powder pattern peaks of metals and/or alloys etc. is normally caused by small crystalline size and/or by distortions within the crystallites as a consequence of dislocation configurations. Thus measure the broadening of diffraction peaks provides a tool to determine the crystallite size and strain in the sample. It is well known that rates of reaction between solid particles and a gas phase depend on the particle size. The knowledge about crystallite size and strain is useful for the investigation of important phenomena in materials. X-ray profile analysis is useful for the investigation of processes like crystal growth, solid solution formation, stacking faults and radiation damage etc. X-ray diffraction is most widely used for the determination of crystallite size and strain. This important application of X-ray diffraction is reviewed in this paper. Results on aluminium bulk samples and thin films treated under conditions are reported. Application of the method to UO/sub 2/ powder is discussed. (author)

  5. A logical explanation of structurally unfit X-ray diffraction peaks in ...

    Indian Academy of Sciences (India)

    2018-02-05

    Feb 5, 2018 ... Abstract. In the present paper we suggest the cause and solution of some unidentified X-ray diffraction (XRD) peaks in ferroelectric ... to some structurally unfit minor peaks of all three trail samples show good agreement to the values estimated from the .... This shows that the value of 2θ limits the (a + b) val-.

  6. A simple model for dynamic small-angle X-ray diffraction in colloidal crystals

    NARCIS (Netherlands)

    de Beer, A.G.F.; Petukhov, A.V.

    2007-01-01

    A simple model is presented that allows calculation of the small-angle X-ray diffraction patterns of perfect colloidal crystals. The model is based on the Wentzel–Kramers–Brillouin approximation and permits a straightforward evaluation of multibeam interactions. Results are illustrated by several

  7. Simultaneous X-ray diffraction from multiple single crystals of macromolecules

    DEFF Research Database (Denmark)

    Paithankar, Karthik S.; Sørensen, Henning Osholm; Wright, Jonathan P.

    2011-01-01

    The potential in macromolecular crystallography for using multiple crystals to collect X-ray diffraction data simultaneously from assemblies of up to seven crystals is explored. The basic features of the algorithms used to extract data and their practical implementation are described. The procedure...

  8. High-pressure X-ray diffraction study of bulk- and nanocrystalline GaN

    DEFF Research Database (Denmark)

    Jorgensen, J.E.; Jakobsen, J.M.; Jiang, Jianzhong

    2003-01-01

    Bulk- and nanocrystalline GaN have been studied by high-pressure energy-dispersive X-ray diffraction. Pressure-induced structural phase transitions from the wurtzite to the NaCl phase were observed in both materials. The transition pressure was found to be 40 GPa for the bulk-crystalline GaN, whi...

  9. An x-ray diffraction study of interface roughness and diffusion in Ag/Pd superlattices

    NARCIS (Netherlands)

    Temst, K.; van Bael, M.J.; van Haesendonck, Ch.; Bruynseraede, Y.; de Groot, D.G.; Koeman, N.J.; Griessen, R.P.

    1999-01-01

    The influence of thermal annealing on the surface and interface roughness of epitaxial Ag/Pd superlattices has been quantitatively characterized by high-angle X-ray diffraction and atomic force microscopy. Although Ag and Pd form a continuous series of solid solutions, it is shown that thermal

  10. Electron Paramagnetic Resonance and X-ray Diffraction of Boron- and Phosphorus-Doped Nanodiamonds

    Science.gov (United States)

    Binh, Nguyen Thi Thanh; Dolmatov, V. Yu.; Lapchuk, N. M.; Shymanski, V. I.

    2017-11-01

    Powders of boron- and phosphorus-doped detonation nanodiamonds and sintered pellets of non-doped nanodiamond powders were studied using electron paramagnetic resonance and x-ray diffraction. Doping of detonation nanodiamond crystals with boron and phosphorus was demonstrated to be possible. These methods could be used to diagnose diamond nanocrystals doped during shock-wave synthesis.

  11. HIV protease inhibition seen by X-ray diffraction and molecular dynamics

    Czech Academy of Sciences Publication Activity Database

    Hašek, Jindřich; Dohnálek, Jan; Skálová, Tereza; Dušková, Jarmila; Petroková, Hana; Vondráčková, Eva; Kolenko, P.; Zimmermann, K.

    2005-01-01

    Roč. 14, č. 1 (2005), s. 276 ISSN 0961-8368. [Symposium of the Protein Society /19./. 30.7.2005-3.8.2005, Boston] R&D Projects: GA AV ČR(CZ) KJB4050312 Keywords : HIV protease * X-ray diffraction * molecular dynamics Subject RIV: CF - Physical ; Theoretical Chemistry

  12. Determination of the X-ray diffraction pattern and the lattice parameters of the nickel ferricyanide

    International Nuclear Information System (INIS)

    Fernandez Miranda, J.; Herrera Palma, V.

    1981-01-01

    The X-ray diffraction pattern of the nickel ferricyanide was found by Debye-Scherrer method. The measurements were made in cameras of 57,3 mm and 114 mm diameter. The crystal structure of the compound has been determined. The lattice parameter was measured by the least square method. (author)

  13. A logical explanation of structurally unfit X-ray diffraction peaks in ...

    Indian Academy of Sciences (India)

    2018-02-05

    Feb 5, 2018 ... Abstract. In the present paper we suggest the cause and solution of some unidentified X-ray diffraction (XRD) peaks in ferroelectric nanoparticles. Indeed, a relationship between the structurally unfit XRD peaks and domains in the ferroelectric nanoparticles is suggested. BaTiO3, PbTiO3 and ...

  14. Caracterization of the crystalline phases by X-Ray diffraction in electrode coatings

    International Nuclear Information System (INIS)

    Neves, M.C.G.P.; Souza Caillaux, Z. de

    1981-01-01

    Some electrodes and their respective coatings were studied in order to verify their compatibility with their utilization in the welding of base metals appropriate for the equipment of sugar and alcohol plants. The carried out studies include the characterization, by X-ray diffraction, of crystaline phases, existent in electrodes coatings. (Author) [pt

  15. Tensile behavior of orthorhombic alpha ''-titanium alloy studied by in situ X-ray diffraction

    DEFF Research Database (Denmark)

    Wang, X.D.; Lou, H.B.; Ståhl, Kenny

    2010-01-01

    The tensile behavior of a Ti-11%Zr-14%Nb-10%Sn alloy with pure orthorhombic alpha '' phase was studied by in situ X-ray diffraction using synchrotron radiation. It is found that no phase transformation happens during the whole tensile process. The "double-yielding" platforms of this alloy...

  16. Study of caprine bones after moist and dry heat processes by X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Barbosa, Caroline M., E-mail: carolmattosb@yahoo.com.br [Instituto de Arqueologia Brasileira (IAB), Belford Roxo, RJ (Brazil); Azeredo, Soraia R.; Lopes, Ricardo T., E-mail: soraia@lin.ufrj.br [Coordenacao dos Programas de Pos-Graduacao em Engenharia (COPPE/LIN/UFRJ), Rio de Janeiro, RJ (Brazil). Laboratorio de Instrumentacao Nuclear; Souza, Sheila M.F.M de, E-mail: sferraz@ensp.fiocruz.br [Fundacao Oswaldo Cruz (ENSP/FIOCRUZ), Rio de Janeiro, RJ (Brazil). Escola Nacional de Saude Publica Sergio Arouca

    2013-07-01

    Bone tissue is a biological material composed of hydroxyapatite (HAp) and collagen matrix. The bone X-ray diffraction (XRD) pattern presents characteristics of the hydroxyapatite crystallography planes. This paper presents the characterization by X-ray diffraction of caprine bone powder pattern and the comparison of this pattern with moist or dry heat cooked bone patterns. The parameters chosen to characterize the X-ray diffraction peaks were: angular position (2θ), full width at half maximumt (FWHM), and relative intensity (I{sub rel}). The X-ray diffraction patterns were obtained with a Shimadzu XRD-6000 diffractometer. The caprine bone XRD pattern revealed a significant correlation of several crystallographic parameters (lattice data) with hydroxyapatite. The profiles of the three bone types analyzed presented differences. The study showed as small angular displacement (decrease of the 2θ angle) of some peaks was observed after moist and dry heat cooking processes. The characterization of bone tissue aimed to contribute to future analysis in the field of archeology. (author)

  17. X-ray diffraction studies of sucrose and sucrose irradiated with γ-radiation

    International Nuclear Information System (INIS)

    Prasad, Mahendra

    1981-01-01

    In order to understand and solve numerous problems related to sugar quality and its storage life, X-ray diffraction studies of sucrose and sucrose irradiated with γ-radiation have been made. It is observed that the interplanar spacing 'd' in irradiated sucrose is reduced indicating the partial damage of sucrose lattice. (author)

  18. Study of caprine bones after moist and dry heat processes by X-ray diffraction

    International Nuclear Information System (INIS)

    Barbosa, Caroline M.; Azeredo, Soraia R.; Lopes, Ricardo T.; Souza, Sheila M.F.M de

    2013-01-01

    Bone tissue is a biological material composed of hydroxyapatite (HAp) and collagen matrix. The bone X-ray diffraction (XRD) pattern presents characteristics of the hydroxyapatite crystallography planes. This paper presents the characterization by X-ray diffraction of caprine bone powder pattern and the comparison of this pattern with moist or dry heat cooked bone patterns. The parameters chosen to characterize the X-ray diffraction peaks were: angular position (2θ), full width at half maximumt (FWHM), and relative intensity (I rel ). The X-ray diffraction patterns were obtained with a Shimadzu XRD-6000 diffractometer. The caprine bone XRD pattern revealed a significant correlation of several crystallographic parameters (lattice data) with hydroxyapatite. The profiles of the three bone types analyzed presented differences. The study showed as small angular displacement (decrease of the 2θ angle) of some peaks was observed after moist and dry heat cooking processes. The characterization of bone tissue aimed to contribute to future analysis in the field of archeology. (author)

  19. Small angles X-ray diffraction and Mössbauer characterization of ...

    Indian Academy of Sciences (India)

    Abstract. The effect of thermal annealing on the structure and magnetic properties of crystalline Tb/Fe multilayers has been studied using conversion electron Mössbauer spectrometry and small-angle X-ray diffraction. The growth of Tb–Fe amorphous alloy from the interface is observed with increasing annealing ...

  20. Toward atomic resolution diffractive imaging of isolated molecules with x-ray free-electron lasers

    DEFF Research Database (Denmark)

    Stern, Stephan; Holmegaard, Lotte; Filsinger, Frank

    2014-01-01

    We give a detailed account of the theoretical analysis and the experimental results of an x-ray-diffraction experiment on quantum-state selected and strongly laser-aligned gas-phase ensembles of the prototypical large asymmetric rotor molecule 2,5-diiodobenzonitrile, performed at the Linac Cohere...

  1. High spatial resolution X-ray and gamma ray imaging system using diffraction crystals

    Science.gov (United States)

    Smither, Robert K [Hinsdale, IL

    2011-05-17

    A method and a device for high spatial resolution imaging of a plurality of sources of x-ray and gamma-ray radiation are provided. The device comprises a plurality of arrays, with each array comprising a plurality of elements comprising a first collimator, a diffracting crystal, a second collimator, and a detector.

  2. Characterization of calcium crystals in Abelia using x-ray diffraction and electron microscopes

    Science.gov (United States)

    Localization, chemical composition, and morphology of calcium crystals in leaves and stems of Abelia mosanensis and A. ×grandiflora were analyzed with a variable pressure scanning electron microscope (VP-SEM) equipped with an X-ray diffraction system, low temperature SEM (LT-SEM) and a transmission ...

  3. Temperature-dependent vibrational spectroscopic and X-ray diffraction investigation of nanosized nickel chromite

    Czech Academy of Sciences Publication Activity Database

    Matulková, Irena; Holec, Petr; Němec, I.; Kitazawa, H.; Furubayashi, T.; Vejpravová, Jana

    2015-01-01

    Roč. 1090, Jun SI (2015), s. 70-75 ISSN 0022-2860 R&D Projects: GA ČR GAP108/10/1250 Institutional support: RVO:68378271 ; RVO:61388980 Keywords : vibrational spectroscopy * nickel chromite * X-ray diffraction * size effect Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.780, year: 2015

  4. A X-ray diffraction analysis on graphene layers of Assam coal

    Indian Academy of Sciences (India)

    The so-called turbostatic structure of carbons in coal with randomly oriented stacking of the lamellae (graphene) produces intense peaks, which are the dominant features in its X-ray diffraction profiles. The diffractogram may be conveniently divided into two regions of reciprocal space, the medium S region (1 < S < 3 Å) and ...

  5. Advances in thin film diffraction instrumentation by X-ray optics

    International Nuclear Information System (INIS)

    Haase, A.

    1996-01-01

    The structural characterisation of thin films requires a parallel X-ray beam of high intensity. Parallel beam geometry is commonly used in high resolution and single crystal experiments, but also in the field of X-ray diffraction for polycrystalline material (e.g. in phase, texture and stress analysis). For grazing incidence diffraction (GID), the use of small slits on the primary side and of long soller slits with a flat monochromator on the secondary side is standard. New optical elements have been introduced with polychromatic or monochromatic radiation. By means of different applications the results are compared with those of classical beam optics. X-ray fiber optics utilize total external reflection of X-rays on smooth surfaces. Effects of monochromatization are presented. In many fields of application, fiber optics may replace conventional collimators. The use of primary and secondary channel cut crystals can also produce a high parallel monochromatic X-ray beam. A parabolically bent graded multilayer produces a monochromatic parallel beam of high intensity. Compared with classical Bragg-Brentano (focussing) geometry, excellent results have been obtained, especially for samples with an irregular shape. In combination with a channel cut monochromator there is a substantial gain in intensity leading to an increase of the dynamic intensity range of rocking curves

  6. Advances in thin film diffraction instrumentation by X-ray optics

    Energy Technology Data Exchange (ETDEWEB)

    Haase, A. [Rich. Seifert and Co., Analytical X-ray Systems, Ahrensburg (Germany)

    1996-09-01

    The structural characterisation of thin films requires a parallel X-ray beam of high intensity. Parallel beam geometry is commonly used in high resolution and single crystal experiments, but also in the field of X-ray diffraction for polycrystalline material (e.g. in phase, texture and stress analysis). For grazing incidence diffraction (GID), the use of small slits on the primary side and of long soller slits with a flat monochromator on the secondary side is standard. New optical elements have been introduced with polychromatic or monochromatic radiation. By means of different applications the results are compared with those of classical beam optics. X-ray fiber optics utilize total external reflection of X-rays on smooth surfaces. Effects of monochromatization are presented. In many fields of application, fiber optics may replace conventional collimators. The use of primary and secondary channel cut crystals can also produce a high parallel monochromatic X-ray beam. A parabolically bent graded multilayer produces a monochromatic parallel beam of high intensity. Compared with classical Bragg-Brentano (focussing) geometry, excellent results have been obtained, especially for samples with an irregular shape. In combination with a channel cut monochromator there is a substantial gain in intensity leading to an increase of the dynamic intensity range of rocking curves.

  7. Structural Characterization of Perpendicularly Aligned Submicrometer-Thick Synthetic Glycolipid Polycrystalline Films Using Conventional X-ray Diffraction

    Directory of Open Access Journals (Sweden)

    Shigesaburo Ogawa

    2017-12-01

    Full Text Available The structural analysis of the synthetic glycolipid crystalline phase has been performed during the past few decades; however, it has not been sufficiently understood in terms of both static and dynamic aspects. We have recently shown that grazing incidence X-ray diffraction (GIXD affords better information than conventional powder X-ray diffraction (PXRD for the crystal structure analysis of octyl β-d-galactoside (MOβGal using sub-micrometer-thick crystalline films and a two-dimensional detector, together with a synchrotron radiation source. However, access to this technique is not universal because of the limited machine time at the required synchrotron radiation sources. Herein, we employed XRD analysis on MOβGal hemihydrate crystalline films using commercial X-ray sources instead of synchrotron radiation sources to extend the availability of the methodology. We investigated some technical aspects of the methodology, such as incident angle and radiation time, using MOβGal polycrystalline films with different thicknesses in order to obtain sufficient reciprocal data for identifying the lattice constants with conventional X-ray sources. Complementary uses of GIXD with a two-dimensional detector, with much higher incident angles than the total reflection angle using a NANO-Viewer system and out-of-plane and in-plane measurements using SmartLab, enabled us to determine the complete lattice parameters for the MOβGal hemihydrate crystalline film.

  8. Graphical method for analyzing wide-angle x-ray diffraction

    Science.gov (United States)

    Chen, XiaoHui; Xue, Tao; Liu, DongBing; Yang, QingGuo; Luo, BinQiang; Li, Mu; Li, XiaoYa; Li, Jun

    2018-01-01

    Wide-angle X-ray diffraction on large-scale laser facility is a well-established experimental method, which is used to study the shock response of single crystal materials by recording X-rays diffracted from numerous lattice planes. We present a three-dimensional graphical method for extracting physical understanding from the raw diffraction data in shocked experiments. This method advances beyond the previous iterative process by turning abstract diffraction theories in shock physics into mathematic issues, providing three-dimensional visualization and quick extraction of data characteristics. The capability and versatility of the method are exhibited by identifying lattice planes for single crystal samples with different orientations and quantitatively measuring the lattice compression and rotation under dynamic loading.

  9. X-ray diffraction measurements for solid methane at high pressures

    CERN Document Server

    Umemoto, S; Akahama, Y; Kawamura, H

    2002-01-01

    X-ray powder diffraction and Raman scattering experiments for solid methane were carried out at pressures up to 37 GPa and room temperature. The diffraction pattern of phase B at 16.9 GPa is assigned to a cubic lattice with lattice constant of 7.914 A (B. At the transition from phase B to the HP phase, the pressure-volume curve shows an anomaly without the structural change.

  10. REAL STRUCTURE AND RESIDUAL STRESSES IN ADVANCED WELDS DETERMINED BY X-RAY AND NEUTRON DIFFRACTION

    Directory of Open Access Journals (Sweden)

    Karel Trojan

    2017-07-01

    Full Text Available The paper outlines the capability of X-ray diffraction (XRD for evaluation of real structure changes and residual stresses (RS on cross-section of advanced thick welds due to the welding of ferromagnetic plates. The results of neutron diffraction describe a three-dimensional state of RS and also verify previous assumptions of RS redistribution as a result of the surface preparation for determination 2D maps measured by XRD.

  11. Exploring the behavior of molybdenum diboride (MoB2): A high pressure x-ray diffraction study

    International Nuclear Information System (INIS)

    Liu, Pingping; Peng, Fang; Yin, Shuai; Liu, Fangming; Wang, Qiming; Zhu, Xuhui; Wang, Pei; He, Duanwei; Liu, Jing

    2014-01-01

    Investigation of the equation of state of molybdenum diboride (MoB 2 ) has been performed to 24.1 GPa using synchrotron radiation angle-dispersive x-ray diffraction techniques (ADXRD) in a diamond anvil cell (DAC) at room temperature. Rietveld refinement of the X-ray powder diffraction data reveals that the rhombohedral structure MoB 2 is stable up to 24.1 GPa. The ADXRD data yield a bulk modulus K 0  = 314(11) GPa with a pressure derivative K 0 ′  = 6.4(1.5). The experimental data are discussed and compared to the results of first-principles calculations. In addition, the compressibility of the unit cell axes (a and c axes) of MoB 2 demonstrates an anisotropic property with pressure increasing

  12. Ultrafast coherent diffractive imaging of nanoparticles using X-ray free-electron laser radiation

    International Nuclear Information System (INIS)

    Kassemeyer, Stephan

    2014-01-01

    Coherent diffractive imaging with X-ray free-electron lasers (X-FEL) promises high-resolution structure determination of single microscopic particles without the need for crystallization. The diffraction signal of small samples can be very weak, a difficulty that can not be countered by merely increasing the number of photons because the sample would be damaged by a high absorbed radiation dose. Traditional X-ray crystallography avoids this problem by bringing many sample particles into a periodic arrangement, which amplifies the individual signals while distributing the absorbed dose. Depending on the sample, however, crystallization can be very difficult or even impossible. This thesis presents algorithms for a new imaging approach using X-FEL radiation that works with single, non-crystalline sample particles. X-FELs can deliver X-rays with a peak brilliance many orders of magnitude higher than conventional X-ray sources, compensating for their weak interaction cross sections. At the same time, FELs can produce ultra-short pulses down to a few femtoseconds. In this way it is possible to perform ultra-fast imaging, essentially ''freezing'' the atomic positions in time and terminating the imaging process before the sample is destroyed by the absorbed radiation. This thesis primarily focuses on the three-dimensional reconstruction of single (and not necessarily crystalline) particles using coherent diffractive imaging at X-FELs: in order to extract three-dimensional information from scattering data, two-dimensional diffraction patterns from many different viewing angles must be combined. Therefore, the diffraction signal of many identical sample copies in random orientations is measured. The main result of this work is a globally optimal algorithm that can recover the sample orientations solely based on the diffraction signal, enabling three-dimensional imaging for arbitrary samples. The problem of finding three-dimensional orientations is

  13. Preliminary study of determination of UO2 grain size using X-ray diffraction method

    International Nuclear Information System (INIS)

    Mulyana, T.; Sambodo, G. D.; Juanda, D.; Fatchatul, B.

    1998-01-01

    The determination of UO 2 grain size has accomplished using x-ray diffraction method. The UO 2 powder is obtained from sol-gel process. A copper target as radiation source in the x-ray diffractometer was used in this experiment with CμKα characteristic wavelength 1.54433 Angstrom. The result indicate that the UO 2 mean grain size on presintered (temperature 800 o C) has the value 456.8500 Angstrom and the UO 2 mean grain size on sintered (temperature 1700 o C) has value 651.4934 Angstrom

  14. Reflection-mode x-ray powder diffraction cell for in situ studies of electrochemical reactions

    International Nuclear Information System (INIS)

    Roberts, G.A.; Stewart, K.D.

    2004-01-01

    The design and operation of an electrochemical cell for reflection-mode powder x-ray diffraction experiments are discussed. The cell is designed for the study of electrodes that are used in rechargeable lithium batteries. It is designed for assembly in a glove box so that air-sensitive materials, such as lithium foil electrodes and carbonate-based electrolytes with lithium salts, can be used. The cell uses a beryllium window for x-ray transmission and electrical contact. A simple mechanism for compressing the electrodes is included in the design. Sample results for the cell are shown with a Cu Kα source and a position-sensitive detector

  15. X-ray diffraction in laser-irradiated epsomite crystals grown in presence of borax

    International Nuclear Information System (INIS)

    Zaitseva, E.V.; Portnov, V.N.; Faddeev, M.A.; Chuprunov, E.V.

    1997-01-01

    Relative changes in the intensities ΔI/I of the (220) and (440) X-ray diffraction reflection during laser irradiation of epsomite (MgSO 2 ·7H 2 O) crystals grown from an aqueous solution in the presence of borax (Na 2 B 4 O 7 ·10H 2 O) were measured using the CoK α , CuK α , MoK α radiations. The intensities measured depend on the real crystal structure dependent on the borax content in the solution. The dependence of ΔI/I is studied as a function of borax in the solution and X-ray-radiation wavelength

  16. A sample holder for in-house X-ray powder diffraction studies of protein powders

    DEFF Research Database (Denmark)

    Frankær, Christian Grundahl; Harris, Pernille; Ståhl, Kenny

    2011-01-01

    A sample holder for handling samples of protein for in-house X-ray powder diffraction (XRPD) analysis has been made and tested on lysozyme. The use of an integrated pinhole reduced the background, and good signal-to-noise ratios were obtained from only 7 l of sample, corresponding to approximately...... 2-3 mg of dry protein. The sample holder is further adaptable to X-ray absorption spectroscopy (XAS) measurements. Both XRPD and XAS at the Zn K-edge were tested with hexameric Zn insulin....

  17. A laboratory based system for Laue micro x-ray diffraction

    Science.gov (United States)

    Lynch, P. A.; Stevenson, A. W.; Liang, D.; Parry, D.; Wilkins, S.; Tamura, N.

    2007-02-01

    A laboratory diffraction system capable of illuminating individual grains in a polycrystalline matrix is described. Using a microfocus x-ray source equipped with a tungsten anode and prefigured monocapillary optic, a micro-x-ray diffraction system with a 10 μm beam was developed. The beam profile generated by the ellipsoidal capillary was determined using the "knife edge" approach. Measurement of the capillary performance, indicated a beam divergence of 14 mrad and a useable energy bandpass from 5.5 to 19 keV. Utilizing the polychromatic nature of the incident x-ray beam and application of the Laue indexing software package X-Ray Micro-Diffraction Analysis Software, the orientation and deviatoric strain of single grains in a polycrystalline material can be studied. To highlight the system potential the grain orientation and strain distribution of individual grains in a polycrystalline magnesium alloy (Mg 0.2 wt % Nd) was mapped before and after tensile loading. A basal (0002) orientation was identified in the as-rolled annealed alloy; after tensile loading some grains were observed to undergo an orientation change of 30° with respect to (0002). The applied uniaxial load was measured as an increase in the deviatoric tensile strain parallel to the load axis.

  18. Analytical characterization of a new mobile X-ray fluorescence and X-ray diffraction instrument combined with a pigment identification case study

    International Nuclear Information System (INIS)

    Van de Voorde, Lien; Vekemans, Bart; Verhaeven, Eddy; Tack, Pieter; De Wolf, Robin; Garrevoet, Jan; Vandenabeele, Peter; Vincze, Laszlo

    2015-01-01

    A new, commercially available, mobile system combining X-ray diffraction and X-ray fluorescence has been evaluated which enables both elemental analysis and phase identification simultaneously. The instrument makes use of a copper or molybdenum based miniature X-ray tube and a silicon-Pin diode energy-dispersive detector to count the photons originating from the samples. The X-ray tube and detector are both mounted on an X-ray diffraction protractor in a Bragg–Brentano θ:θ geometry. The mobile instrument is one of the lightest and most compact instruments of its kind (3.5 kg) and it is thus very useful for in situ purposes such as the direct (non-destructive) analysis of cultural heritage objects which need to be analyzed on site without any displacement. The supplied software allows both the operation of the instrument for data collection and in-depth data analysis using the International Centre for Diffraction Data database. This paper focuses on the characterization of the instrument, combined with a case study on pigment identification and an illustrative example for the analysis of lead alloyed printing letters. The results show that this commercially available light-weight instrument is able to identify the main crystalline phases non-destructively, present in a variety of samples, with a high degree of flexibility regarding sample size and position. - Highlights: • New X-ray fluorescence and X-ray diffraction instrument for non-destructive analysis • Commercially available, mobile system • One of the lightest and most compact of its kind • Characterization, data acquisition and analysis are performed. • Results of measurements on pigment model samples and cultural heritage materials

  19. Analytical characterization of a new mobile X-ray fluorescence and X-ray diffraction instrument combined with a pigment identification case study

    Energy Technology Data Exchange (ETDEWEB)

    Van de Voorde, Lien, E-mail: lien.vandevoorde@ugent.be [Ghent University, Department of Analytical Chemistry, X-ray Microspectroscopy and Imaging Research Group, Krijgslaan 281 S12, B-9000 Gent (Belgium); Vekemans, Bart [Ghent University, Department of Analytical Chemistry, X-ray Microspectroscopy and Imaging Research Group, Krijgslaan 281 S12, B-9000 Gent (Belgium); Verhaeven, Eddy [Antwerp University, Faculty of Design Sciences, Mutsaardstraat 31, B-2000 Antwerpen (Belgium); Tack, Pieter; De Wolf, Robin; Garrevoet, Jan [Ghent University, Department of Analytical Chemistry, X-ray Microspectroscopy and Imaging Research Group, Krijgslaan 281 S12, B-9000 Gent (Belgium); Vandenabeele, Peter [Ghent University, Department of Archaeology, Archaeometry Research Group, Sint-Pietersnieuwstraat 35, B-9000 Gent (Belgium); Vincze, Laszlo [Ghent University, Department of Analytical Chemistry, X-ray Microspectroscopy and Imaging Research Group, Krijgslaan 281 S12, B-9000 Gent (Belgium)

    2015-08-01

    A new, commercially available, mobile system combining X-ray diffraction and X-ray fluorescence has been evaluated which enables both elemental analysis and phase identification simultaneously. The instrument makes use of a copper or molybdenum based miniature X-ray tube and a silicon-Pin diode energy-dispersive detector to count the photons originating from the samples. The X-ray tube and detector are both mounted on an X-ray diffraction protractor in a Bragg–Brentano θ:θ geometry. The mobile instrument is one of the lightest and most compact instruments of its kind (3.5 kg) and it is thus very useful for in situ purposes such as the direct (non-destructive) analysis of cultural heritage objects which need to be analyzed on site without any displacement. The supplied software allows both the operation of the instrument for data collection and in-depth data analysis using the International Centre for Diffraction Data database. This paper focuses on the characterization of the instrument, combined with a case study on pigment identification and an illustrative example for the analysis of lead alloyed printing letters. The results show that this commercially available light-weight instrument is able to identify the main crystalline phases non-destructively, present in a variety of samples, with a high degree of flexibility regarding sample size and position. - Highlights: • New X-ray fluorescence and X-ray diffraction instrument for non-destructive analysis • Commercially available, mobile system • One of the lightest and most compact of its kind • Characterization, data acquisition and analysis are performed. • Results of measurements on pigment model samples and cultural heritage materials.

  20. Crystallographic orientation study of silicon steels using X-ray diffraction, electrons diffraction and the Etch Pit method

    International Nuclear Information System (INIS)

    Santos, Hamilta de Oliveira

    1999-01-01

    The aim of the present study is the microstructural and crystallographic orientation of Fe-3%Si steel. The silicon steel shows good electrical properties and it is used in the nuclear and electrical power fields. The studied steel was supplied by Cia. Acos Especiais Itabira S/A - ACESITA. The material was received in the hot compressed condition, in one or two passes. The hot compressing temperatures used were 900, 1000 and 1100 deg C with soaking times ranging from 32 to 470 s. The material preferential crystallographic orientation was evaluated in every grain of the samples. The characterization techniques used were: scanning electron microscopy (SEM) using the etch pit method; X ray diffraction using the Laue back-reflection method; orientation imaging microscopy (OIM). Microstructural characterization in terms of grain size measurement and mean number of grains in the sample were also undertaken. The Laue method was found an easy technique to access crystallographic orientation of this work polycrystalline samples 2.5 mm average grain size. This was due to the inability to focus the X-rays on a single grain of the material. The scanning electron microscopy showed microcavities left by the etch pit method, which allowed the observation of the crystallographic orientation of each grain from the samples. No conclusive grain crystallographic orientation was possible to obtain by the OIM technique due to the non-existing rolling direction. A more extensive work with the OIM technique must be undertaken on the Fe-3%Si with oriented grains and non oriented grains. (author)