WorldWideScience

Sample records for systemic murine cytomegalovirus

  1. Amphipathic DNA polymers exhibit antiviral activity against systemic Murine Cytomegalovirus infection

    Directory of Open Access Journals (Sweden)

    Juteau Jean-Marc

    2009-12-01

    Full Text Available Abstract Background Phosphorothioated oligonucleotides (PS-ONs have a sequence-independent, broad spectrum antiviral activity as amphipathic polymers (APs and exhibit potent in vitro antiviral activity against a broad spectrum of herpesviruses: HSV-1, HSV-2, HCMV, VZV, EBV, and HHV-6A/B, and in vivo activity in a murine microbiocide model of genital HSV-2 infection. The activity of these agents against animal cytomegalovirus (CMV infections in vitro and in vivo was therefore investigated. Results In vitro, a 40 mer degenerate AP (REP 9 inhibited both murine CMV (MCMV and guinea pig CMV (GPCMV with an IC50 of 0.045 μM and 0.16 μM, respectively, and a 40 mer poly C AP (REP 9C inhibited MCMV with an IC50 of 0.05 μM. Addition of REP 9 to plaque assays during the first two hours of infection inhibited 78% of plaque formation whereas addition of REP 9 after 10 hours of infection did not significantly reduce the number of plaques, indicating that REP 9 antiviral activity against MCMV occurs at early times after infection. In a murine model of CMV infection, systemic treatment for 5 days significantly reduced virus replication in the spleens and livers of infected mice compared to saline-treated control mice. REP 9 and REP 9C were administered intraperitoneally for 5 consecutive days at 10 mg/kg, starting 2 days prior to MCMV infection. Splenomegaly was observed in infected mice treated with REP 9 but not in control mice or in REP 9 treated, uninfected mice, consistent with mild CpG-like activity. When REP 9C (which lacks CpG motifs was compared to REP 9, it exhibited comparable antiviral activity as REP 9 but was not associated with splenomegaly. This suggests that the direct antiviral activity of APs is the predominant therapeutic mechanism in vivo. Moreover, REP 9C, which is acid stable, was effective when administered orally in combination with known permeation enhancers. Conclusion These studies indicate that APs exhibit potent, well tolerated

  2. The immunogenicity of human and murine cytomegaloviruses.

    Science.gov (United States)

    Reddehase, M J

    2000-08-01

    Cytomegaloviruses are strictly host-species-specific. During an aeon of co-evolution, virus and host have found an arrangement: the productive and cytopathogenic cycle of viral gene expression is held in check by the host's immune response. As a consequence, cytomegalovirus disease is restricted to the immunocompromised host. The virus has evolved strategies to avoid its elimination and eventually hides itself in a silent state, referred to as 'viral latency'. Redundant molecular mechanisms have been identified by which cytomegaloviruses interfere with antigen presentation pathways to 'evade' immune control. In the annual period covered by this review, the IE1 protein was revisited as an immunodominant antigen of human cytomegalovirus and the identification of a first antigenic early-phase peptide of murine cytomegalovirus that escapes viral immunosubversive mechanisms may initiate a period of research on the immune control of cytomegaloviruses 'beyond immune evasion'.

  3. Murine Cytomegalovirus Spreads by Dendritic Cell Recirculation

    Directory of Open Access Journals (Sweden)

    Helen E. Farrell

    2017-10-01

    Full Text Available Herpesviruses have coevolved with their hosts over hundreds of millions of years and exploit fundamental features of their biology. Cytomegaloviruses (CMVs colonize blood-borne myeloid cells, and it has been hypothesized that systemic dissemination arises from infected stem cells in bone marrow. However, poor CMV transfer by stem cell transplantation argues against this being the main reservoir. To identify alternative pathways for CMV spread, we tracked murine CMV (MCMV colonization after mucosal entry. We show that following intranasal MCMV infection, lung CD11c+ dendritic cells (DC migrated sequentially to lymph nodes (LN, blood, and then salivary glands. Replication-deficient virus followed the same route, and thus, DC infected peripherally traversed LN to enter the blood. Given that DC are thought to die locally following their arrival and integration into LN, recirculation into blood represents a new pathway. We examined host and viral factors that facilitated this LN traverse. We show that MCMV-infected DC exited LN by a distinct route to lymphocytes, entering high endothelial venules and bypassing the efferent lymph. LN exit required CD44 and the viral M33 chemokine receptor, without which infected DC accumulated in LN and systemic spread was greatly reduced. Taken together, our studies provide the first demonstration of virus-driven DC recirculation. As viruses follow host-defined pathways, high endothelial venules may normally allow DC to pass from LN back into blood.

  4. Heterologous Immunity and Persistent Murine Cytomegalovirus Infection.

    Science.gov (United States)

    Che, Jenny W; Daniels, Keith A; Selin, Liisa K; Welsh, Raymond M

    2017-01-15

    One's history of infections can affect the immune response to unrelated pathogens and influence disease outcome through the process of heterologous immunity. This can occur after acute viral infections, such as infections with lymphocytic choriomeningitis virus (LCMV) and vaccinia virus, where the pathogens are cleared, but it becomes a more complex issue in the context of persistent infections. In this study, murine cytomegalovirus (MCMV) was used as a persistent infection model to study heterologous immunity with LCMV. If mice were previously immune to LCMV and then infected with MCMV (LCMV+MCMV), they had more severe immunopathology, enhanced viral burden in multiple organs, and suppression of MCMV-specific T cell memory inflation. MCMV infection initially reduced the numbers of LCMV-specific memory T cells, but continued MCMV persistence did not further erode memory T cells specific to LCMV. When MCMV infection was given first (MCMV+LCMV), the magnitude of the acute T cell response to LCMV declined with age though this age-dependent decline was not dependent on MCMV. However, some of these MCMV persistently infected mice with acute LCMV infection (7 of 36) developed a robust immunodominant CD8 T cell response apparently cross-reactive between a newly defined putative MCMV epitope sequence, M57 727-734 , and the normally subdominant LCMV epitope L 2062-2069 , indicating a profound private specificity effect in heterologous immunity between these two viruses. These results further illustrate how a history of an acute or a persistent virus infection can substantially influence the immune responses and immune pathology associated with acute or persistent infections with an unrelated virus. This study extends our understanding of heterologous immunity in the context of persistent viral infection. The phenomenon has been studied mostly with viruses such as LCMV that are cleared, but the situation can be more complex with a persistent virus such as MCMV. We found that

  5. Immunobiology of congenital cytomegalovirus infection of the central nervous system—the murine cytomegalovirus model.

    Science.gov (United States)

    Slavuljica, Irena; Kveštak, Daria; Huszthy, Peter Csaba; Kosmac, Kate; Britt, William J; Jonjić, Stipan

    2015-03-01

    Congenital human cytomegalovirus infection is a leading infectious cause of long-term neurodevelopmental sequelae, including mental retardation and hearing defects. Strict species specificity of cytomegaloviruses has restricted the scope of studies of cytomegalovirus infection in animal models. To investigate the pathogenesis of congenital human cytomegalovirus infection, we developed a mouse cytomegalovirus model that recapitulates the major characteristics of central nervous system infection in human infants, including the route of neuroinvasion and neuropathological findings. Following intraperitoneal inoculation of newborn animals with mouse cytomegalovirus, the virus disseminates to the central nervous system during high-level viremia and replicates in the brain parenchyma, resulting in a focal but widespread, non-necrotizing encephalitis. Central nervous system infection is coupled with the recruitment of resident and peripheral immune cells as well as the expression of a large number of pro-inflammatory cytokines. Although infiltration of cellular constituents of the innate immune response characterizes the early immune response in the central nervous system, resolution of productive infection requires virus-specific CD8(+) T cells. Perinatal mouse cytomegalovirus infection results in profoundly altered postnatal development of the mouse central nervous system and long-term motor and sensory disabilities. Based on an enhanced understanding of the pathogenesis of this infection, prospects for novel intervention strategies aimed to improve the outcome of congenital human cytomegalovirus infection are proposed.

  6. Evasion of cytotoxic T lymphocytes by murine cytomegalovirus.

    Science.gov (United States)

    Kavanagh, D G; Hill, A B

    2001-02-01

    Murine cytomegalovirus causes lifelong infections with little pathology in normal host animals. Control of viral replication and prevention of pathology depend on both innate and adaptive immune mechanisms, and cytolytic T lymphocytes play a key role in this process. The virus encodes a number of genes which alter the normal assembly of class I major histocompatability complex proteins, and thus interfere with the ability of infected cells to present antigen to CD8(+)T cells. This review will examine what is known about these viral genes, and present some unanswered questions regarding the role of CTL evasion in the viral infectious cycle. Copyright 2001 Academic Press.

  7. Transplacental murine cytomegalovirus infection in the brain of SCID mice

    Directory of Open Access Journals (Sweden)

    Jaquish Dawn V

    2007-03-01

    Full Text Available Abstract Background Congenital cytomegalovirus (CMV infection is the most common congenital viral infection in humans and the major nonhereditary cause of central nervous system (CNS developmental disorders. Previous attempts to develop a murine CMV (MCMV model of natural congenital human CMV (HCMV infection have failed because MCMV does not cross the placenta in immunocompetent mice. Results In marked contrast with immunocompetent mice, C.B-17 SCID (severe combined immunodeficient mice were found to be highly susceptible to natural MCMV transplacental transmission and congenital infection. Timed-pregnant SCID mice were intraperitoneally (IP injected with MCMV at embryonic (E stages E0-E7, and vertical MCMV transmission was evaluated using nested polymerase chain reaction (nPCR, in situ hybridization (ISH and immunohistochemical (IHC assays. SCID mouse dams IP injected at E0 with 102 PFU of MCMV died or resorbed their fetuses by E18. Viable fetuses collected at E18 from SCID mice IP injected with 102–104 PFU of MCMV at E7 did not demonstrate vertical MCMV transmission. Notably, transplacental MCMV transmission was confirmed in E18 fetuses from SCID mice IP injected with 103 PFU of MCMV at stages E3-E5. The maximum rate of transplacental MCMV transmission (53% at E18 occurred when SCID mouse dams were IP injected with 103 PFU of MCMV at E4. Congenital infection was confirmed by IHC immunostaining of MCMV antigens in 26% of the MCMV nPCR positive E18 fetuses. Transplacental MCMV transmission was associated with intrauterine growth retardation and microcephaly. Additionally, E18 fetuses with MCMV nPCR positive brains had cerebral interleukin-1α (IL-1α expression significantly upregulated and cerebral IL-1 receptor II (IL-1RII transcription significantly downregulated. However, MCMV-induced changes in cerebral cytokine expression were not associated with any histological signs of MCMV infection or inflammation in the brain. Conclusion Severe T

  8. Murine cytomegalovirus (CMV) M33 and human CMV US28 receptors exhibit similar constitutive signaling activities

    DEFF Research Database (Denmark)

    Waldhoer, Maria; Kledal, Thomas N; Farrell, Helen

    2002-01-01

    Cellular infection by cytomegalovirus (CMV) is associated with very early G-protein-mediated signal transduction and reprogramming of gene expression. Here we investigated the involvement of human CMV (HCMV)-encoded US27, US28, and UL33 receptors as well as murine CMV-encoded M33 transmembrane (7TM...

  9. Murine cytomegalovirus degrades MHC class II to colonize the salivary glands.

    Science.gov (United States)

    Yunis, Joseph; Farrell, Helen E; Bruce, Kimberley; Lawler, Clara; Sidenius, Stine; Wyer, Orry; Davis-Poynter, Nicholas; Stevenson, Philip G

    2018-02-01

    Cytomegaloviruses (CMVs) persistently and systemically infect the myeloid cells of immunocompetent hosts. Persistence implies immune evasion, and CMVs evade CD8+ T cells by inhibiting MHC class I-restricted antigen presentation. Myeloid cells can also interact with CD4+ T cells via MHC class II (MHC II). Human CMV (HCMV) attacks the MHC II presentation pathway in vitro, but what role this evasion might play in host colonization is unknown. We show that Murine CMV (MCMV) down-regulates MHC II via M78, a multi-membrane spanning viral protein that captured MHC II from the cell surface and was necessary although not sufficient for its degradation in low pH endosomes. M78-deficient MCMV down-regulated MHC I but not MHC II. After intranasal inoculation, it showed a severe defect in salivary gland colonization that was associated with increased MHC II expression on infected cells, and was significantly rescued by CD4+ T cell loss. Therefore MCMV requires CD4+ T cell evasion by M78 to colonize the salivary glands, its main site of long-term shedding.

  10. Systemic lupus erythematous revealed by cytomegalovirus infection ...

    African Journals Online (AJOL)

    Cytomegalovirus (CMV) infection have been described as exacerbing systemic lupus erythematous (SLE). The role of CMV in starting off SLE remains object of debate. We report a severe presentation of SLE revealed by CMV infection with hemophogocytic syndrome. A 22 old women without a history of systemic disease ...

  11. The murine cytomegalovirus chemokine homolog, m131/129, is a determinant of viral pathogenicity.

    Science.gov (United States)

    Fleming, P; Davis-Poynter, N; Degli-Esposti, M; Densley, E; Papadimitriou, J; Shellam, G; Farrell, H

    1999-08-01

    Chemokines are important mediators of the early inflammatory response to infection and modify a wide range of host immune responses. Functional homologs of cellular chemokines have been identified in a number of herpesviruses, suggesting that the subversion of the host chemokine response contributes to the pathogenesis of these viruses. Transcriptional and reverse transcription-PCR analyses demonstrated that the murine cytomegalovirus (MCMV) chemokine homolog, m131, was spliced at the 3' end to the adjacent downstream open reading frame, m129, resulting in a predicted product of 31 kDa, which is significantly larger than most known chemokines. The in vivo impact of m131/129 was investigated by comparing the replication of MCMV mutants having m131/129 deleted (Deltam131/129) with that of wild-type (wt) MCMV. Our studies demonstrate that both wt and Deltam131/129 viruses replicated to equivalent levels during the first 2 to 3 days following in vivo infection. However, histological studies demonstrated that the early inflammatory response elicited by Deltam131/129 was reduced compared with that of wt MCMV. Furthermore, the Deltam131/129 mutants failed to establish a high-titer infection in the salivary glands. These results suggest that m131/129 possesses proinflammatory properties in vivo and is important for the dissemination of MCMV to or infection of the salivary gland. Notably, the Deltam131/129 mutants were cleared more rapidly from the spleen and liver during acute infection compared with wt MCMV. The accelerated clearance of the mutants was dependent on NK cells and cells of the CD4(+) CD8(+) phenotype. These data suggest that m131/129 may also contribute to virus mechanisms of immune system evasion during early infection, possibly through the interference of NK cells and T cells.

  12. Nodular inflammatory foci are sites of T cell priming and control of murine cytomegalovirus infection in the neonatal lung.

    Directory of Open Access Journals (Sweden)

    Felix R Stahl

    Full Text Available Neonates, including mice and humans, are highly susceptible to cytomegalovirus (CMV infection. However, many aspects of neonatal CMV infections such as viral cell tropism, spatio-temporal distribution of the pathogen as well as genesis of antiviral immunity are unknown. With the use of reporter mutants of the murine cytomegalovirus (MCMV we identified the lung as a primary target of mucosal infection in neonatal mice. Comparative analysis of neonatal and adult mice revealed a delayed control of virus replication in the neonatal lung mucosa explaining the pronounced systemic infection and disease in neonates. This phenomenon was supplemented by a delayed expansion of CD8(+ T cell clones recognizing the viral protein M45 in neonates. We detected viral infection at the single-cell level and observed myeloid cells forming "nodular inflammatory foci" (NIF in the neonatal lung. Co-localization of infected cells within NIFs was associated with their disruption and clearance of the infection. By 2-photon microscopy, we characterized how neonatal antigen-presenting cells (APC interacted with T cells and induced mature adaptive immune responses within such NIFs. We thus define NIFs of the neonatal lung as niches for prolonged MCMV replication and T cell priming but also as sites of infection control.

  13. A dominant role for the immunoproteasome in CD8+ T cell responses to murine cytomegalovirus.

    Directory of Open Access Journals (Sweden)

    Sarah Hutchinson

    2011-02-01

    Full Text Available Murine cytomegalovirus (MCMV is an important animal model of human cytomegalovirus (HCMV, a β-Herpesvirus that infects the majority of the world's population and causes disease in neonates and immunocompromised adults. CD8(+ T cells are a major part of the immune response to MCMV and HCMV. Processing of peptides for presentation to CD8(+ T cells may be critically dependent on the immunoproteasome, expression of which is affected by MCMV. However, the overall importance of the immunoproteasome in the generation of immunodominant peptides from MCMV is not known. We therefore examined the role of the immunoproteasome in stimulation of CD8(+ T cell responses to MCMV - both conventional memory responses and those undergoing long-term expansion or "inflation". We infected LMP7(-/- and C57BL/6 mice with MCMV or with newly-generated recombinant vaccinia viruses (rVVs encoding the immunodominant MCMV protein M45 in either full-length or epitope-only minigene form. We analysed CD8(+ T cell responses using intracellular cytokine stain (ICS and MHC Class I tetramer staining for a panel of MCMV-derived epitopes. We showed a critical role for immunoproteasome in MCMV affecting all epitopes studied. Interestingly we found that memory "inflating" epitopes demonstrate reduced immunoproteasome dependence compared to non-inflating epitopes. M45-specific responses induced by rVVs remain immunoproteasome-dependent. These results help to define a critical restriction point for CD8(+ T cell epitopes in natural cytomegalovirus (CMV infection and potentially in vaccine strategies against this and other viruses.

  14. The p36 Isoform of Murine Cytomegalovirus m152 Protein Suffices for Mediating Innate and Adaptive Immune Evasion

    OpenAIRE

    Fink, Annette; Renzaho, Angeliqué; Reddehase, Matthias J.; Lemmermann, Niels A. W.

    2013-01-01

    The MHC-class I (MHC-I)-like viral (MHC-Iv) m152 gene product of murine cytomegalovirus (mCMV) was the first immune evasion molecule described for a member of the β-subfamily of herpesviruses as a paradigm for analogous functions of human cytomegalovirus proteins. Notably, by interacting with classical MHC-I molecules and with MHC-I-like RAE1 family ligands of the activatory natural killer (NK) cell receptor NKG2D, it inhibits presentation of antigenic peptides to CD8 T cells and the NKG2D-d...

  15. Intratumoral Infection with Murine Cytomegalovirus Synergizes with PD-L1 Blockade to Clear Melanoma Lesions and Induce Long-term Immunity

    Science.gov (United States)

    Erkes, Dan A; Xu, Guangwu; Daskalakis, Constantine; Zurbach, Katherine A; Wilski, Nicole A; Moghbeli, Toktam; Hill, Ann B; Snyder, Christopher M

    2016-01-01

    Cytomegalovirus is an attractive cancer vaccine platform because it induces strong, functional CD8+ T-cell responses that accumulate over time and migrate into most tissues. To explore this, we used murine cytomegalovirus expressing a modified gp100 melanoma antigen. Therapeutic vaccination by the intraperitoneal and intradermal routes induced tumor infiltrating gp100-specific CD8+ T-cells, but provided minimal benefit for subcutaneous lesions. In contrast, intratumoral infection of established tumor nodules greatly inhibited tumor growth and improved overall survival in a CD8+ T-cell-dependent manner, even in mice previously infected with murine cytomegalovirus. Although murine cytomegalovirus could infect and kill B16F0s in vitro, infection was restricted to tumor-associated macrophages in vivo. Surprisingly, the presence of a tumor antigen in the virus only slightly increased the efficacy of intratumoral infection and tumor-specific CD8+ T-cells in the tumor remained dysfunctional. Importantly, combining intratumoral murine cytomegalovirus infection with anti-PD-L1 therapy was synergistic, resulting in tumor clearance from over half of the mice and subsequent protection against tumor challenge. Thus, while a murine cytomegalovirus-based vaccine was poorly effective against established subcutaneous tumors, direct infection of tumor nodules unexpectedly delayed tumor growth and synergized with immune checkpoint blockade to promote tumor clearance and long-term protection. PMID:27434584

  16. Intratumoral Infection with Murine Cytomegalovirus Synergizes with PD-L1 Blockade to Clear Melanoma Lesions and Induce Long-term Immunity.

    Science.gov (United States)

    Erkes, Dan A; Xu, Guangwu; Daskalakis, Constantine; Zurbach, Katherine A; Wilski, Nicole A; Moghbeli, Toktam; Hill, Ann B; Snyder, Christopher M

    2016-08-01

    Cytomegalovirus is an attractive cancer vaccine platform because it induces strong, functional CD8(+) T-cell responses that accumulate over time and migrate into most tissues. To explore this, we used murine cytomegalovirus expressing a modified gp100 melanoma antigen. Therapeutic vaccination by the intraperitoneal and intradermal routes induced tumor infiltrating gp100-specific CD8(+) T-cells, but provided minimal benefit for subcutaneous lesions. In contrast, intratumoral infection of established tumor nodules greatly inhibited tumor growth and improved overall survival in a CD8(+) T-cell-dependent manner, even in mice previously infected with murine cytomegalovirus. Although murine cytomegalovirus could infect and kill B16F0s in vitro, infection was restricted to tumor-associated macrophages in vivo. Surprisingly, the presence of a tumor antigen in the virus only slightly increased the efficacy of intratumoral infection and tumor-specific CD8(+) T-cells in the tumor remained dysfunctional. Importantly, combining intratumoral murine cytomegalovirus infection with anti-PD-L1 therapy was synergistic, resulting in tumor clearance from over half of the mice and subsequent protection against tumor challenge. Thus, while a murine cytomegalovirus-based vaccine was poorly effective against established subcutaneous tumors, direct infection of tumor nodules unexpectedly delayed tumor growth and synergized with immune checkpoint blockade to promote tumor clearance and long-term protection.

  17. Riboflavin and ultraviolet light for pathogen reduction of murine cytomegalovirus in blood products.

    Science.gov (United States)

    Keil, Shawn D; Saakadze, Natia; Bowen, Richard; Newman, James L; Karatela, Sulaiman; Gordy, Paul; Marschner, Susanne; Roback, John; Hillyer, Christopher D

    2015-04-01

    Two studies were performed to test the effectiveness of riboflavin and ultraviolet (UV) light treatment (Mirasol PRT, Terumo BCT) against murine cytomegalovirus (MCMV). The first study utilized immune-compromised mice to measure the reduction of cell-free MCMV. A second study used a murine model to evaluate the ability of Mirasol PRT to prevent transfusion-transmitted (TT)-MCMV infection. Human plasma was inoculated with MCMV and then treated with Mirasol PRT. The viral titer was measured using an infectious dose 50% assay in nude mice. Mice were euthanized on Day 10 posttransfusion, and their spleens were tested for the presence of MCMV DNA using polymerase chain reaction (PCR). Mirasol PRT was also evaluated to determine its effectiveness in preventing TT-MCMV in platelets (PLTs) stored in PLT additive solution. PLTs were inoculated with either cell-associated MCMV or cell-free MCMV and then treated with Mirasol PRT. Mice were transfused with treated or untreated product and were euthanized 14 days posttransfusion. Blood and spleens were assayed for MCMV DNA by real-time-PCR. Using nude mice to titer MCMV, a modest 2.1-log reduction was observed in plasma products after Mirasol PRT treatment. TT-MCMV was not observed in the mouse transfusion model when either cell-free or cell-associated MCMV was treated with Mirasol PRT; MCMV transmission was uniformly observed in mice transfused with untreated PLTs. These results suggest that using riboflavin and UV light treatment may be able to reduce the occurrence of transmission of human CMV from infectious PLTs and plasma units. © 2014 AABB.

  18. Detection of murine cytomegalovirus DNA in circulating leukocytes harvested during acute infection of mice

    International Nuclear Information System (INIS)

    Bale, J.F. Jr.; O'Neil, M.E.

    1989-01-01

    The authors used virus assay and in situ hybridization with a cloned fragment of the murine cytomegalovirus (MCMV) genome to study MCMV infection of circulating leukocytes harvested from 3-week-old BALB/c, C57BL/6, and C3H mice infected with MCMV intraperitoneally. Infectious virus or MCMV DNA was detected in leukocytes on days 1 through 21 of infection in BALB/c mice and on days 3 through 7 in C57BL/6 mice. On days 5 and 7, MCMV DNA or infectious virus was detected in the leukocytes of 17 (94%) of 18 BALB/c mice and 10 (59%) of 17 C57BL/6 mice. In both strains infection peaked on days 5 and 7, when as many as 0.01 to 0.1% of the circulating leukocytes contained MCMV DNA. In C3H mice, however, infectious virus was rarely recovered from leukocyte fractions and MCMV DNA was detected in the circulating leukocytes of only one animal. Circulating leukocytes may have an important role in the dissemination of CMV infections in susceptible hosts

  19. Crystal Structure of the Murine Cytomegalovirus MHC-I Homolog m144

    Energy Technology Data Exchange (ETDEWEB)

    Natarajan,K.; Hicks, A.; Mans, J.; Robinson, H.; Guan, R.; Mariuzza, R.; Margulies, D.

    2006-01-01

    Large DNA viruses of the herpesvirus family produce proteins that mimic host MHC-I molecules as part of their immunoevasive strategy. The m144 glycoprotein, expressed by murine cytomegalovirus, is thought to be an MHC-I homolog whose expression prolongs viral survival in vivo by preventing natural killer cell activation. To explore the structural basis of this m144 function, we have determined the three-dimensional structure of an m144/{beta}2-microglobulin ({beta}2m) complex at 1.9 {angstrom} resolution. This structure reveals the canonical features of MHC-I molecules including readily identifiable {alpha}1, {alpha}2, and {alpha}3 domains. A unique disulfide bond links the {alpha}1 helix to the {beta}-sheet floor, explaining the known thermal stability of m144. Close juxtaposition of the {alpha}1 and {alpha}2 helices and the lack of critical residues that normally contribute to anchoring the peptide N and C termini eliminates peptide binding. A region of 13 amino acid residues, corresponding to the amino-terminal portion of the {alpha}2 helix, is missing in the electron density map, suggesting an area of structural flexibility that may be involved in ligand binding.

  20. Murine cytomegalovirus stimulates natural killer cell function but kills genetically resistant mice treated with radioactive strontium

    International Nuclear Information System (INIS)

    Masuda, A.; Bennett, M.

    1981-01-01

    Treatment of C3H/St mice with 100 microCi of 89Sr weakened their genetic resistance to murine cytomegalovirus (MCMV) infection. The criteria utilized to detect increased susceptibility were: (i) survival of mice; (ii) numbers of MCMV-infected cells in the spleens and liver; and (iii) serum glutamic pyruvic transaminase levels. The natural killer (NK) cell activity of spleen cells from mice treated with 89Sr is very low. However, the NK activities of spleen cells of both normal and 89Sr-treated mice were greatly augmented 3 days after infection with MCMV. These NK cells lysed a variety of tumor cells and shared several features with conventional NK cells, but were not lysed by anti-Nk-1.2 serum (specific for NK cells) plus complement. Splenic adherent cells did not lyse tumor cells themselves but were necessary for the stimulation of NK cells by MCMV. The paradox of high NK cell function and poor survival in 89Sr-treated mice infected with MCMV was a surprise. We conclude that these augmented NK cells, of themselves, cannot account for the genetic resistance of C3H/St mice to infection with MCMV

  1. Functional analysis of the murine cytomegalovirus chemokine receptor homologue M33: ablation of constitutive signaling is associated with an attenuated phenotype in vivo

    DEFF Research Database (Denmark)

    Case, Ruth; Sharp, Emma; Benned-Jensen, Tau

    2007-01-01

    The murine cytomegalovirus (MCMV) M33 gene is conserved among all betaherpesviruses and encodes a homologue of seven-transmembrane receptors (7TMR) with the capacity for constitutive signaling. Previous studies have demonstrated that M33 is important for MCMV dissemination to or replication within...

  2. The p36 Isoform of Murine Cytomegalovirus m152 Protein Suffices for Mediating Innate and Adaptive Immune Evasion

    Science.gov (United States)

    Fink, Annette; Renzaho, Angeliqué; Reddehase, Matthias J.; Lemmermann, Niels A. W.

    2013-01-01

    The MHC-class I (MHC-I)-like viral (MHC-Iv) m152 gene product of murine cytomegalovirus (mCMV) was the first immune evasion molecule described for a member of the β-subfamily of herpesviruses as a paradigm for analogous functions of human cytomegalovirus proteins. Notably, by interacting with classical MHC-I molecules and with MHC-I-like RAE1 family ligands of the activatory natural killer (NK) cell receptor NKG2D, it inhibits presentation of antigenic peptides to CD8 T cells and the NKG2D-dependent activation of NK cells, respectively, thus simultaneously interfering with adaptive and innate immune recognition of infected cells. Although the m152 gene product exists in differentially glycosylated isoforms whose individual contributions to immune evasion are unknown, it has entered the scientific literature as m152/gp40, based on the quantitatively most prominent isoform but with no functional justification. By construction of a recombinant mCMV in which all three N-glycosylation sites are mutated (N61Q, N208Q, and N241Q), we show here that N-linked glycosylation is not essential for functional interaction of the m152 immune evasion protein with either MHC-I or RAE1. These data add an important functional detail to recent structural analysis of the m152/RAE1γ complex that has revealed N-glycosylations at positions Asn61 and Asn208 of m152 distant from the m152/RAE1γ interface. PMID:24351798

  3. The p36 isoform of murine cytomegalovirus m152 protein suffices for mediating innate and adaptive immune evasion.

    Science.gov (United States)

    Fink, Annette; Renzaho, Angeliqué; Reddehase, Matthias J; Lemmermann, Niels A W

    2013-12-16

    The MHC-class I (MHC-I)-like viral (MHC-Iv) m152 gene product of murine cytomegalovirus (mCMV) was the first immune evasion molecule described for a member of the β-subfamily of herpesviruses as a paradigm for analogous functions of human cytomegalovirus proteins. Notably, by interacting with classical MHC-I molecules and with MHC-I-like RAE1 family ligands of the activatory natural killer (NK) cell receptor NKG2D, it inhibits presentation of antigenic peptides to CD8 T cells and the NKG2D-dependent activation of NK cells, respectively, thus simultaneously interfering with adaptive and innate immune recognition of infected cells. Although the m152 gene product exists in differentially glycosylated isoforms whose individual contributions to immune evasion are unknown, it has entered the scientific literature as m152/gp40, based on the quantitatively most prominent isoform but with no functional justification. By construction of a recombinant mCMV in which all three N-glycosylation sites are mutated (N61Q, N208Q, and N241Q), we show here that N-linked glycosylation is not essential for functional interaction of the m152 immune evasion protein with either MHC-I or RAE1. These data add an important functional detail to recent structural analysis of the m152/RAE1g complex that has revealed N-glycosylations at positions Asn61 and Asn208 of m152 distant from the m152/RAE1g interface.

  4. Immune evasion proteins of murine cytomegalovirus preferentially affect cell surface display of recently generated peptide presentation complexes.

    Science.gov (United States)

    Lemmermann, Niels A W; Gergely, Kerstin; Böhm, Verena; Deegen, Petra; Däubner, Torsten; Reddehase, Matthias J

    2010-02-01

    For recognition of infected cells by CD8 T cells, antigenic peptides are presented at the cell surface, bound to major histocompatibility complex class I (MHC-I) molecules. Downmodulation of cell surface MHC-I molecules is regarded as a hallmark function of cytomegalovirus-encoded immunoevasins. The molecular mechanisms by which immunoevasins interfere with the MHC-I pathway suggest, however, that this downmodulation may be secondary to an interruption of turnover replenishment and that hindrance of the vesicular transport of recently generated peptide-MHC (pMHC) complexes to the cell surface is the actual function of immunoevasins. Here we have used the model of murine cytomegalovirus (mCMV) infection to provide experimental evidence for this hypothesis. To quantitate pMHC complexes at the cell surface after infection in the presence and absence of immunoevasins, we generated the recombinant viruses mCMV-SIINFEKL and mCMV-Deltam06m152-SIINFEKL, respectively, expressing the K(b)-presented peptide SIINFEKL with early-phase kinetics in place of an immunodominant peptide of the viral carrier protein gp36.5/m164. The data revealed approximately 10,000 K(b) molecules presenting SIINFEKL in the absence of immunoevasins, which is an occupancy of approximately 10% of all cell surface K(b) molecules, whereas immunoevasins reduced this number to almost the detection limit. To selectively evaluate their effect on preexisting pMHC complexes, cells were exogenously loaded with SIINFEKL peptide shortly after infection with mCMV-SIINFEKA, in which endogenous presentation is prevented by an L174A mutation of the C-terminal MHC-I anchor residue. The data suggest that pMHC complexes present at the cell surface in advance of immunoevasin gene expression are downmodulated due to constitutive turnover in the absence of resupply.

  5. Murine cytomegalovirus infection of neural stem cells alters neurogenesis in the developing brain.

    Directory of Open Access Journals (Sweden)

    Manohar B Mutnal

    2011-01-01

    Full Text Available Congenital cytomegalovirus (CMV brain infection causes serious neuro-developmental sequelae including: mental retardation, cerebral palsy, and sensorineural hearing loss. But, the mechanisms of injury and pathogenesis to the fetal brain are not completely understood. The present study addresses potential pathogenic mechanisms by which this virus injures the CNS using a neonatal mouse model that mirrors congenital brain infection. This investigation focused on, analysis of cell types infected with mouse cytomegalovirus (MCMV and the pattern of injury to the developing brain.We used our MCMV infection model and a multi-color flow cytometry approach to quantify the effect of viral infection on the developing brain, identifying specific target cells and the consequent effect on neurogenesis. In this study, we show that neural stem cells (NSCs and neuronal precursor cells are the principal target cells for MCMV in the developing brain. In addition, viral infection was demonstrated to cause a loss of NSCs expressing CD133 and nestin. We also showed that infection of neonates leads to subsequent abnormal brain development as indicated by loss of CD24(hi cells that incorporated BrdU. This neonatal brain infection was also associated with altered expression of Oct4, a multipotency marker; as well as down regulation of the neurotrophins BDNF and NT3, which are essential to regulate the birth and differentiation of neurons during normal brain development. Finally, we report decreased expression of doublecortin, a marker to identify young neurons, following viral brain infection.MCMV brain infection of newborn mice causes significant loss of NSCs, decreased proliferation of neuronal precursor cells, and marked loss of young neurons.

  6. The Putative Natural Killer Decoy Early Gene m04 (gp34) of Murine Cytomegalovirus Encodes an Antigenic Peptide Recognized by Protective Antiviral CD8 T Cells

    OpenAIRE

    Holtappels, Rafaela; Thomas, Doris; Podlech, Jürgen; Geginat, Gernot; Steffens, Hans-Peter; Reddehase, Matthias J.

    2000-01-01

    Several early genes of murine cytomegalovirus (MCMV) encode proteins that mediate immune evasion by interference with the major histocompatibility complex class I (MHC-I) pathway of antigen presentation to cytolytic T lymphocytes (CTL). Specifically, the m152 gene product gp37/40 causes retention of MHC-I molecules in the endoplasmic reticulum (ER)-Golgi intermediate compartment. Lack of MHC-I on the cell surface should activate natural killer (NK) cells recognizing the “missing self.” The re...

  7. Genome-Wide Exome Analysis of Cmv5-Disparate Mouse Strains that Differ in Host Resistance to Murine Cytomegalovirus Infection

    Directory of Open Access Journals (Sweden)

    Alyssa Gillespie

    2017-06-01

    Full Text Available Host resistance to murine cytomegalovirus (MCMV varies in different strains of laboratory mice due to differences in expression of determinants that control and clear viral infection. The major histocompatibility complex class I Dk molecule is one such determinant that controls MCMV through the action of natural killer (NK cells. However, the extent of NK cell–mediated Dk-dependent resistance to infection varies in different mouse strains. The molecular genetic basis of this variation remains unclear. Previous work to examine the Dk effect on MCMV resistance in MA/My × C57L offspring discovered multiple quantitative trait loci (QTL that may serve to modify NK cells or their capacity to respond during MCMV infection. One QTL in particular, Cmv5, was found to regulate the frequency of NK cells and secondary lymphoid organ structure in spleen during MCMV infection. Cmv5 alleles, however, have not been identified. We therefore sequenced and analyzed genome-wide exome (GWE variants, including those aligned to the critical genetic interval, in Cmv5-disparate mouse strains. Their GWE variant profiles were compared to assess strain-specific sequence data integrity and to analyze mouse strain relatedness across the genome. GWE content was further compared against data from the Mouse Genomes Project. This approach was developed as a platform for using GWE variants to define genomic regions of divergence and similarity in different mouse strains while also validating the overall quality of GWE sequence data. Moreover, the analysis provides a framework for the selection of novel QTL candidate sequences, including at the Cmv5 critical region.

  8. In vivo impact of cytomegalovirus evasion of CD8 T-cell immunity: facts and thoughts based on murine models.

    Science.gov (United States)

    Lemmermann, Niels A W; Böhm, Verena; Holtappels, Rafaela; Reddehase, Matthias J

    2011-05-01

    Cytomegaloviruses (CMVs) co-exist with their respective host species and have evolved to avoid their elimination by the hosts' immune effector mechanisms and to persist in a non-replicative state, known as viral latency. There is evidence to suggest that latency is nevertheless a highly dynamic condition during which episodes of viral gene desilencing, which can be viewed as incomplete reactivations, cause intermittent antigenic activity that stimulates CD8 memory-effector T cells and drives their clonal expansion. These T cells are supposed to terminate reactivation before completion of the productive viral cycle. In this view, CMVs do not "evade" their respective host's immune response but are actually held in check all the time, unless the host gets immunocompromised. Accordingly, CMV disease is typically a disease of the immunocompromised host only. Here we review current knowledge about the in vivo role of viral proteins involved in subverting the immune recognition of infected cells with focus on the CD8 T-cell response and viral interference with the MHC class-I pathway of antigenic peptide presentation. Whereas the intracellular functions of these "immune-evasion proteins" are known in molecular detail, knowledge of their in vivo role in CMV biology is only beginning to take shape. Experimental studies on the in vivo function of human CMV (hCMV) immune-evasion proteins prohibits, of course. Studying animal CMVs paradigmatically in the corresponding natural host is therefore used to identify principles from which the role of hCMV immune-evasion proteins can hopefully be inferred. Here we summarize recent insights gained primarily from the murine model. Copyright © 2010 Elsevier B.V. All rights reserved.

  9. The multiple immune-evasion genes of murine cytomegalovirus are not redundant: m4 and m152 inhibit antigen presentation in a complementary and cooperative fashion.

    Science.gov (United States)

    Kavanagh, D G; Gold, M C; Wagner, M; Koszinowski, U H; Hill, A B

    2001-10-01

    Both human cytomegaloviruses (HCMVs) and murine cytomegaloviruses (MCMVs) encode multiple genes that interfere with antigen presentation by major histocompatibility complex (MHC) class I, and thus protect infected targets from lysis by virus-specific cytotoxic T lymphocytes (CTLs). HCMV has been shown to encode four such genes and MCMV to encode two. MCMV m152 blocks the export of class I from a pre-Golgi compartment, and MCMV m6 directs class I to the lysosome for degradation. A third MCMV gene, m4, encodes a glycoprotein which is expressed at the cell surface in association with class I. Here we here show that m4 is a CTL-evasion gene which, unlike previously described immune-evasion genes, inhibited CTLs without blocking class I surface expression. m152 was necessary to block antigen presentation to both K(b)- and D(b)-restricted CTL clones, while m4 was necessary to block presentation only to K(b)-restricted clones. m152 caused complete retention of D(b), but only partial retention of K(b), in a pre-Golgi compartment. Thus, while m152 effectively inhibited D(b)-restricted CTLs, m4 was required to completely inhibit K(b)-restricted CTLs. We propose that cytomegaloviruses encode multiple immune-evasion genes in order to cope with the diversity of class I molecules in outbred host populations.

  10. The pathogenicity of cytomegalovirus.

    Science.gov (United States)

    Sweet, C

    1999-07-01

    Human cytomegalovirus is ubiquitous, yet causes little illness in immunocompetent individuals. Disease is evident in immunodeficient groups such as neonates, transplant recipients and AIDS patients either following a primary infection or reactivation of a latent infection. Little is known of the mechanisms underlying the pathogenicity of the virus. The recent determination of the nucleotide sequence of both human cytomegalovirus (strain AD169) and murine cytomegalovirus (murine cytomegalovirus strain Smith) has allowed an analysis of the biological importance of several virus genes. Studies with human cytomegalovirus have indicated that many viral genes are non-essential for replication in vitro which are thus assumed to be important in the pathogenesis of the virus. This is being examined in the murine model where the role of the gene and its product in disease can be directly examined in vivo using viral mutants in which the relevant gene has been interrupted or deleted. Current information on the role of cytomegalovirus genes in tissue tropism, immune evasion, latency, reactivation from latency and damage is described.

  11. Controlling Cytomegalovirus: Helping the Immune System Take the Lead

    Directory of Open Access Journals (Sweden)

    Patrick J. Hanley

    2014-05-01

    Full Text Available Cytomegalovirus, of the Herpesviridae family, has evolved alongside humans for thousands of years with an intricate balance of latency, immune evasion, and transmission. While upwards of 70% of humans have evidence of CMV infection, the majority of healthy people show little to no clinical symptoms of primary infection and CMV disease is rarely observed during persistent infection in immunocompetent hosts. Despite the fact that the majority of infected individuals are asymptomatic, immunologically, CMV hijacks the immune system by infecting and remaining latent in antigen-presenting cells that occasionally reactivate subclinically and present antigen to T cells, eventually causing the inflation of CMV-specific T cells until they can compromise up to 10% of the entire T cell repertoire. Because of this impact on the immune system, as well as its importance in fields such as stem cell and organ transplant, the relationship between CMV and the immune response has been studied in depth. Here we provide a review of many of these studies and insights into how CMV-specific T cells are currently being used therapeutically.

  12. Controlling Cytomegalovirus: Helping the Immune System Take the Lead

    Science.gov (United States)

    Hanley, Patrick J.; Bollard, Catherine M.

    2014-01-01

    Cytomegalovirus, of the Herpesviridae family, has evolved alongside humans for thousands of years with an intricate balance of latency, immune evasion, and transmission. While upwards of 70% of humans have evidence of CMV infection, the majority of healthy people show little to no clinical symptoms of primary infection and CMV disease is rarely observed during persistent infection in immunocompetent hosts. Despite the fact that the majority of infected individuals are asymptomatic, immunologically, CMV hijacks the immune system by infecting and remaining latent in antigen-presenting cells that occasionally reactivate subclinically and present antigen to T cells, eventually causing the inflation of CMV-specific T cells until they can compromise up to 10% of the entire T cell repertoire. Because of this impact on the immune system, as well as its importance in fields such as stem cell and organ transplant, the relationship between CMV and the immune response has been studied in depth. Here we provide a review of many of these studies and insights into how CMV-specific T cells are currently being used therapeutically. PMID:24872114

  13. Cytomegalovirus colitis after systemic chemotherapy in a patient with recurrent colon cancer: A case report

    Directory of Open Access Journals (Sweden)

    Teraishi Fuminori

    2008-08-01

    Full Text Available Abstract Introduction The occurrence of cytomegalovirus colitis is well known in immunosuppressed patients, such as neoplastic patients following chemotherapy, although its exact etiology remains unclear. Case presentation We present a case of cytomegalovirus colitis occurring in a 77-year-old man with vomiting and diarrhea 2 weeks after initial systemic chemotherapy consisting of 5-fluorouracil, leucovorin and irinotecan for a recurrent colorectal cancer. Initial colonoscopy revealed multiple punched-out ulcers in the transverse colon and the diagnosis of cytomegalovirus was based on positive cytomegalovirus antigen detected by indirect enzyme antibody method, although immunohistological examination of tissues biopsied at colonoscopy was negative. The symptoms ceased under ganciclovir and octreotide treatment, and the patient recovered gradually. Conclusion The most probable cause of the cytomegalovirus colitis in this case was impaired immunity following chemotherapy. Cytomegalovirus infection should be included in the differential diagnosis of gastrointestinal disease in colorectal cancer patients after chemotherapy and, when suspected, the clinician should pursue appropriate diagnostic interventions including colonoscopy.

  14. Cytomegalovirus in pediatric systemic lupus erythematosus: prevalence and clinical manifestations.

    Science.gov (United States)

    Rozenblyum, E V; Levy, D M; Allen, U; Harvey, E; Hebert, D; Silverman, E D

    2015-06-01

    Cytomegalovirus (CMV) is a beta-herpesvirus and antibodies to this virus are common in patients with systemic lupus erythematosus (SLE). However, few studies have examined the relationship between CMV infection and SLE. Our objectives were: 1) to determine the prevalence of CMV infection at the time of SLE diagnosis, and 2) to determine the risk factors for CMV infection. A database review of 670 patients with pediatric SLE (pSLE) seen over a 20-year period identified seven patients with a CMV infection detected at the time of diagnosis of SLE. CMV was diagnosed by serology, urine and bronchoalveolar lavage. Clinical manifestations, laboratory findings, virology studies and treatments were reviewed. CMV infection was detected in seven patients at the time of SLE diagnosis (1.04% of total cohort): six were female: mean age was 13 years. Predominant features included non-Caucasian ethnicity (p < 0.01 as compared to total SLE cohort), persistent fevers on prednisone in seven and nephrotic syndrome in four. Laboratory findings included: anemia in seven, lymphopenia in five, elevated liver enzymes in four, with anti-dsDNA and anti-RNP antibodies present in six and five, respectively. Six patients received ganciclovir and CMV hyperimmune globulin (Cytogam®) with the continuation of prednisone during CMV treatment. Six of seven fully recovered without sequelae (one without treatment) but one patient died with active CMV infection. There were 1.04% of patients with pSLE who developed CMV infection. All were of non-Caucasian ethnicity. Persistent fever despite prednisone, with concomitant anemia, may be additional clues to CMV infection in pSLE. We suggest all patients have routine testing for CMV immunity at initial presentation of pSLE. © The Author(s) 2015 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  15. Cytomegalovirus retinitis

    Science.gov (United States)

    ... sharing features on this page, please enable JavaScript. Cytomegalovirus (CMV) retinitis is a viral infection of the ... need treatment to prevent its return. Alternative Names Cytomegalovirus retinitis Images Eye CMV retinitis CMV (cytomegalovirus) References ...

  16. Cytomegalovirus evasion of natural killer cell responses.

    Science.gov (United States)

    Farrell, H E; Degli-Esposti, M A; Davis-Poynter, N J

    1999-04-01

    Natural killer (NK) cells are an important component of the innate cellular immune system. They are particularly important during the early immune responses following virus infection, prior to the induction of cytotoxic T cells (CTL). Unlike CTL, which recognize specific peptides displayed on the surface of cells by class I MHC, NK cells respond to aberrant expression of cell surface molecules, in particular class I MHC, in a non-specific manner. Thus, cells expressing low levels of surface class I MHC are susceptible to recognition by NK cells, with concomitant triggering of cytolytic and cytokine-mediated responses. Many viruses, including the cytomegaloviruses, downregulate cell surface MHC class I: this is likely to provide protection against CTL-mediated clearance of infected cells, but may also render infected cells sensitive to NK-cell attack. This review focuses upon cytomegalovirus-encoded proteins that are believed to promote evasion of NK-cell-mediated immunity. The class I MHC homologues, encoded by all cytomegaloviruses characterised to date, have been implicated as molecular 'decoys', which may mimic the ability of cellular MHC class I to inhibit NK-cell functions. Results from studies in vitro are not uniform, but in general they support the proposal that the class I homologues engage inhibitory receptors from NK cells and other cell types that normally interact with cellular class I. Consistent with this, in vivo studies of murine cytomegalovirus indicate that the class I homologue is required for efficient evasion of NK-cell-mediated clearance. Recently a second murine cytomegalovirus protein, a C-C chemokine homologue, has been implicated as promoting evasion of NK and T-cell-mediated clearance in vivo.

  17. Murine cytomegalovirus immune evasion proteins operative in the MHC class I pathway of antigen processing and presentation: state of knowledge, revisions, and questions.

    Science.gov (United States)

    Lemmermann, Niels A W; Fink, Annette; Podlech, Jürgen; Ebert, Stefan; Wilhelmi, Vanessa; Böhm, Verena; Holtappels, Rafaela; Reddehase, Matthias J

    2012-11-01

    Medical interest in cytomegalovirus (CMV) is based on lifelong neurological sequelae, such as sensorineural hearing loss and mental retardation, resulting from congenital infection of the fetus in utero, as well as on CMV disease with multiple organ manifestations and graft loss in recipients of hematopoietic cell transplantation or solid organ transplantation. CMV infection of transplantation recipients occurs consequent to reactivation of virus harbored in a latent state in the transplanted donor cells and tissues, or in the tissues of the transplantation recipient herself or himself. Hence, CMV infection is a paradigm for a viral infection that causes disease primarily in the immunocompromised host, while infection of the immunocompetent host is associated with only mild and nonspecific symptoms so that it usually goes unnoticed. Thus, CMV is kept under strict immune surveillance. These medical facts are in apparent conflict with the notion that CMVs in general, human CMV as well as animal CMVs, are masters of 'immune evasion', which during virus-host co-speciation have convergently evolved sophisticated mechanisms to avoid their recognition by innate and adaptive immunity of their respective host species, with viral genes apparently dedicated to serve just this purpose (Reddehase in Nat Rev Immunol 2:831-844, 2002). With focus on viral interference with antigen presentation to CD8 T cells in the preclinical model of murine CMV infection, we try here to shed some more light on the in vivo balance between host immune surveillance of CMV infection and viral 'immune evasion' strategies.

  18. Cytomegalovirus vector expressing RAE-1γ induces enhanced anti-tumor capacity of murine CD8+T cells.

    Science.gov (United States)

    Tršan, Tihana; Vuković, Kristina; Filipović, Petra; Brizić, Ana Lesac; Lemmermann, Niels A W; Schober, Kilian; Busch, Dirk H; Britt, William J; Messerle, Martin; Krmpotić, Astrid; Jonjić, Stipan

    2017-08-01

    Designing CD8 + T-cell vaccines, which would provide protection against tumors is still considered a great challenge in immunotherapy. Here we show the robust potential of cytomegalovirus (CMV) vector expressing the NKG2D ligand RAE-1γ as CD8 + T cell-based vaccine against malignant tumors. Immunization with the CMV vector expressing RAE-1γ, delayed tumor growth or even provided complete protection against tumor challenge in both prophylactic and therapeutic settings. Moreover, a potent tumor control in mice vaccinated with this vector can be further enhanced by blocking the immune checkpoints TIGIT and PD-1. CMV vector expressing RAE-1γ potentiated expansion of KLRG1 + CD8 + T cells with enhanced effector properties. This vaccination was even more efficient in neonatal mice, resulting in the expansion and long-term maintenance of epitope-specific CD8 + T cells conferring robust resistance against tumor challenge. Our data show that immunomodulation of CD8 + T-cell responses promoted by herpesvirus expressing a ligand for NKG2D receptor can provide a powerful platform for the prevention and treatment of CD8 + T-cell sensitive tumors. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Competition for antigen at the level of the antigen presenting cell is a major determinant of immunodominance during memory inflation in murine cytomegalovirus infection

    Science.gov (United States)

    Farrington, Lila A.; Smith, Tameka A.; Grey, Finn; Hill, Ann B.; Snyder, Christopher M.

    2013-01-01

    Cytomegalovirus’s (CMV’s) unique ability to drive the expansion of virus-specific T-cell populations over the course of a lifelong, persistent infection has generated interest in the virus as a potential vaccine strategy. When designing CMV-based vaccine vectors to direct immune responses against HIV or tumor antigens, it becomes important to understand how and why certain CMV-specific populations are chosen to inflate over time. To investigate this, we designed recombinant murine cytomegaloviruses (MCMV) encoding a SIINFEKL-eGFP fusion protein under the control of endogenous immediate early promoters. When mice were infected with these viruses, T cells specific for the SIINFEKL epitope inflated and profoundly dominated T cells specific for non-recombinant (i.e. MCMV-derived) antigens. Moreover, when the virus encoded SIINFEKL, T cells specific for non-recombinant antigens displayed a phenotype indicative of less frequent exposure to antigen. The immunodominance of SIINFEKL-specific T cells could not be altered by decreasing the number of SIINFEKL-specific cells available to respond, or by increasing the number of cells specific for endogenous MCMV antigens. In contrast, coinfection with viruses expressing and lacking SIINFEKL enabled co-inflation of T cells specific for both SIINFEKL and non-recombinant antigens. Because coinfection allows presentation of SIINFEKL and MCMV-derived antigens by different cells within the same animal, these data reveal that competition for, or availability of, antigen at the level of the antigen presenting cell determines the composition of the inflationary response to MCMV. SIINFEKL’s strong affinity for H2-Kb, and its early and abundant expression, may provide this epitope’s competitive advantage. PMID:23455500

  20. The putative natural killer decoy early gene m04 (gp34) of murine cytomegalovirus encodes an antigenic peptide recognized by protective antiviral CD8 T cells.

    Science.gov (United States)

    Holtappels, R; Thomas, D; Podlech, J; Geginat, G; Steffens, H P; Reddehase, M J

    2000-02-01

    Several early genes of murine cytomegalovirus (MCMV) encode proteins that mediate immune evasion by interference with the major histocompatibility complex class I (MHC-I) pathway of antigen presentation to cytolytic T lymphocytes (CTL). Specifically, the m152 gene product gp37/40 causes retention of MHC-I molecules in the endoplasmic reticulum (ER)-Golgi intermediate compartment. Lack of MHC-I on the cell surface should activate natural killer (NK) cells recognizing the "missing self." The retention, however, is counteracted by the m04 early gene product gp34, which binds to folded MHC-I molecules in the ER and directs the complex to the cell surface. It was thus speculated that gp34 might serve to silence NK cells and thereby complete the immune evasion of MCMV. In light of these current views, we provide here results demonstrating an in vivo role for gp34 in protective antiviral immunity. We have identified an antigenic nonapeptide derived from gp34 and presented by the MHC-I molecule D(d). Besides the immunodominant immediate-early nonapeptide consisting of IE1 amino acids 168-176 (IE1(168-176)), the early nonapeptide m04(243-251) is the second antigenic peptide described for MCMV. The primary immune response to MCMV generates significant m04-specific CD8 T-cell memory. Upon adoptive transfer into immunodeficient recipients, an m04-specific CTL line controls MCMV infection with an efficacy comparable to that of an IE1-specific CTL line. Thus, gp34 is the first noted early protein of MCMV that escapes viral immune evasion mechanisms. These data document that MCMV is held in check by a redundance of protective CD8 T cells recognizing antigenic peptides in different phases of viral gene expression.

  1. Resolving the titer of murine cytomegalovirus by plaque assay using the M2-10B4 cell line and a low viscosity overlay

    Science.gov (United States)

    2014-01-01

    Background Murine cytomegalovirus (MCMV) is increasingly used as an infectious model to investigate host-pathogen interactions in mice. Detailed methods have been published for using primary murine embryonic fibroblasts (MEFs) for preparing stocks and determining viral titers of MCMV. For determining the titer of MCMV by plaque assay, these methods rely on a high viscosity media that restricts viral spreading through the supernatant of the culture, but is also usually too viscous to pipet. Moreover, MEFs must be repeatedly generated and can vary widely from batch-to-batch in purity, proliferation rates, and the development of senescence. In contrast, the M2-10B4 bone marrow stromal cell line (ATCC # CRL-1972), which is also permissive for MCMV, has been reported to produce high-titer stocks of MCMV and has the considerable advantages of growing rapidly and consistently. However, detailed methods using these cells have not been published. Methods We modified existing protocols to use M2-10B4 cells for measuring MCMV titers by plaque assay. Results We found that MCMV plaques could be easily resolved on monolayers of M2-10B4 cells. Moreover, plaques formed normally even when cultures of M2-10B4 cells were less than 50% confluent on the day of infection, as long as we also used a reduced viscosity overlay. Conclusions Overall, our protocol enabled us to use a consistent cell line to assess viral titers, rather than repeatedly producing primary MEFs. It also allowed us to start the assay with 4-fold fewer cells than would be required to generate a confluent monolayer, reducing the lead-time prior to the start of the assay. Finally, the reduced viscosity CMC could be handled by pipet and did not need to be pre-mixed with media, thus increasing its shelf-life and ease-of-use. We describe our results here, along with detailed protocols for the use of the M2-10B4 cell lines to determine the titer and grow stocks of MCMV. PMID:24742045

  2. Iron status alters murine systemic lupus erythematosus.

    Science.gov (United States)

    Leiter, L M; Reuhl, K R; Racis, S P; Sherman, A R

    1995-03-01

    The effect of Fe status on murine systemic lupus erythematosus was investigated. Weanling female MRL/MPJ-lpr/lpr mice (systemic lupus erythematosus strain) were fed diets with the following levels (mg Fe/kg diet): 3 (severely deficient), 10 (moderately deficient), 35 (control) and 250 (supplemented). A fifth group was pair fed the control diet in the amounts consumed by the severely deficient group. C3H/Hej mice fed the same diets were used as non-lupus controls. Anemia was more severe in severely deficient mice than in all other MRL groups and C3H severely deficient mice. Incidence of skin lesions was highest in MRL severely and moderately deficient mice compared with pair-fed, control and supplemented mice. By 22 wk of age, mortality was higher in supplemented and severely deficient mice than in moderately deficient, pair-fed and control MRL mice. Anti-dsDNA activity in serum was not altered by Fe. In a second experiment, kidney function was examined in mice fed severely deficient, control, supplemented and pair-fed diets. Urine protein concentration was highest in supplemented mice at 14 wk of age. Serum urea nitrogen was significantly higher in MRL severely deficient mice than in pair-fed and control mice at 18 wk of age. Glomerular filtration rate, measured by creatinine clearance, was significantly lower in MRL severely deficient mice than in pair-fed and Fe supplemented mice at 16 wk of age and pair-fed and control mice at 18 wk of age. Renal histopathology was more severe in Fe supplemented mice than in pair-fed and control mice, and more severe in severely deficient and pair-fed mice than in control mice. Fluorescent staining of kidneys with anti-Ig G and anti-C3 fluorescein-conjugated antibodies was most intense in severely deficient mice, and the concentration of circulating immune complexes in serum was significantly higher in severely deficient mice than in all other groups. These data demonstrate that systemic lupus erythematosus in MRL

  3. Cytomegalovirus (CMV) infection

    Science.gov (United States)

    CMV mononucleosis; Cytomegalovirus; CMV; Human cytomegalovirus; HCMV ... Crumpacker CS. Cytomegalovirus (CMV). In: Bennett JE, Dolin R, Blaser MJ, eds. Mandell, Douglas, and Bennett's Principles and Practice of Infectious ...

  4. A new automatic system for Cytomegalovirus antibodies screening: preliminary evaluation

    Directory of Open Access Journals (Sweden)

    Anna De Angelis

    2008-12-01

    Full Text Available The aim of our study was to evaluate the automated enhanced-chemiluminescence VITROS EciQ (Ortho system compared to the EIA ALISEI (Radim system for the first level detection of CMV IgG and IgM antibodies. Samples derived from 95 immunocompetent patients were examined. Both systems showed similar results for CMV IgG: 63 samples were positive, 28 negative and 4 samples were weakly positive. The four weakly positive samples were subsequently confirmed with the LIAISON (DiaSorin system. Agreement was 91% concerning CMV IgM detection: 79 samples were negative, 7 positive and 9 samples releved discrepancy between the two systems.When these 9 cases were tested with LIAISON system for CMV IgM and IgG and the CMV IgG avidity test, data revealed complete agreement between VITROS EciQ and LIAISON systems.VITROS EciQ system seems to be a valuable system for the first level diagnosis of CMV infection.

  5. Disseminated cytomegalovirus infection complicating active treatment of systemic lupus erythematosus: an emerging problem.

    Science.gov (United States)

    Berman, N; Belmont, H M

    2017-04-01

    Patients with systemic lupus erythematosus (SLE) often require immunosuppression to induce remission of active disease exacerbations. Over the past two decades, treatment modalities for this condition have emerged leading to improved morbidity from disease related outcomes. However, as a result, infection risks and patterns have changed, leading to higher rates of opportunistic infections among this population. We report four cases of cytomegalovirus (CMV) in patients with SLE who received immunosuppressive therapy, including pulse steroids, antimetabolites such as mycophenolate mofetil, and alkylating agents such as cyclophosphamide. We propose that given the rise in prevalence of CMV, there is a need for appropriate screening for this opportunistic pathogen and studies to determine the risks and benefits of prophylactic or preemptive treatment for this virus.

  6. CD4+ T cell help has an epitope-dependent impact on CD8+ T cell memory inflation during murine cytomegalovirus infection.

    Science.gov (United States)

    Snyder, Christopher M; Loewendorf, Andrea; Bonnett, Elizabeth L; Croft, Michael; Benedict, Chris A; Hill, Ann B

    2009-09-15

    Murine CMV (MCMV) establishes a systemic, low-level persistent infection resulting in the accumulation of CD8(+) T cells specific for a subset of viral epitopes, a process called memory inflation. Although replicating virus is rarely detected in chronically infected C57BL/6 mice, these inflationary cells display a phenotype suggestive of repeated Ag stimulation, and they remain functional. CD4(+) T cells have been implicated in maintaining the function and/or number of CD8(+) T cells in other chronic infections. Moreover, CD4(+) T cells are essential for complete control of MCMV. Thus, we wondered whether CD4(+) T cell deficiency would result in impaired MCMV-specific CD8(+) T cell responses. Here we show that CD4(+) T cell deficiency had an epitope-specific impact on CD8(+) T cell memory inflation. Of the three codominant T cell responses during chronic infection, only accumulation of the late-appearing IE3-specific CD8(+) T cells was substantially impaired in CD4(+) T cell-deficient mice. Moreover, the increased viral activity did not drive increased CD8(+) T cell division or substantial dysfunction in any MCMV-specific population that we studied. These data show that CD4(+) T cell help is needed for inflation of a response that develops only during chronic infection but is otherwise dispensable for the steady state maintenance and function of MCMV-specific CD8(+) T cells.

  7. A possible coincidence of cytomegalovirus retinitis and intraocular lymphoma in a patient with systemic non-Hodgkin’s lymphoma

    Directory of Open Access Journals (Sweden)

    Svozílková Petra

    2013-01-01

    Full Text Available Abstract Purpose To present a possible coincidence of cytomegalovirus retinitis and intraocular lymphoma in a patient with systemic non-Hodgkin’s lymphoma. Case presentation A 47-year-old woman presented with decreased visual acuity associated with white retinal lesions in both eyes. A history of pneumonia of unknown aetiology closely preceded the deterioration of vision. Five years previously the patient was diagnosed with follicular non-Hodgkin’s lymphoma. She was treated with a chemotherapy regimen comprised of cyclophosphamide, adriamycin, vincristin, and prednisone with later addition of the anti-CD20 antibody rituximab. She experienced a relapse 19 months later with involvement of the retroperitoneal lymph nodes, and commenced treatment with rituximab and 90Y-ibritumomab tiuxetan. A second relapse occurred 22 months after radioimmunotherapy and was treated with a combination of fludarabine, cyclophosphamide, and mitoxantrone followed by rituximab. The patient experienced no further relapses until the current presentation (April, 2010. Pars plana vitrectomy with vitreous fluid analysis was performed in the right eye. PCR testing confirmed the presence of cytomegalovirus in the vitreous. Atypical lymphoid elements, highly suspicious of malignancy were also found on cytologic examination. Intravenous foscarnet was administered continually for three weeks, followed by oral valganciclovir given in a dose of 900 mg twice per day. In addition, the rituximab therapy continued at three monthly intervals. Nevertheless, cessation of foscarnet therapy was followed by a recurrence of retinitis on three separate occasions during a 3-month period instigating its reinduction to the treatment regime after each recurrence. Conclusions Cytomegalovirus retinitis is an opportunistic infection found in AIDS patients as well as in bone marrow and solid organ transplant recipients being treated with systemic immunosuppressive drugs. This case presents a less

  8. Perianal Plaques of Cytomegalovirus in a Patient with Central Nervous System Lymphoma

    Directory of Open Access Journals (Sweden)

    Scott K. Heysell

    2012-01-01

    Full Text Available Cutaneous manifestations of cytomegalovirus (CMV in patients without human immunodeficiency virus remain rare. Perianal CMV may be observed due to periodic fecal shedding but may be confused for other pathogens, and definitive diagnosis requires histopathologic examination. An instructive case is described, and the literature reviewed.

  9. Clinical relevance of cytomegalovirus infection in patients with disorders of the immune system.

    Science.gov (United States)

    Steininger, C

    2007-10-01

    Cytomegalovirus (CMV) infection is one of the most important infectious complications of solid-organ transplantation, and is also responsible for serious, life-threatening diseases in patients infected with human immunodeficiency virus (HIV). Tremendous progress has been made with respect to prevention and treatment of CMV disease in such patients. The use of anti-CMV drugs and the immune reconstitution achieved by use of anti-retroviral drugs has reduced the incidence of CMV disease dramatically. Nevertheless, problems of clinical relevance remain (e.g., drug toxicity, drug-drug interactions, antiviral resistance) and new problems have emerged. Intragenic recombination among different CMV strains has been identified as a possible source of novel CMV strains in patients with advanced HIV infection. Development of a protective CMV vaccine remains elusive, perhaps, in part, because of strain-specific variation in immunodominant epitopes. Late-onset CMV disease, which occurs several months or years after transplantation, has been recognised as a clinically relevant complication in transplant recipients. The most effective strategy for the prevention of CMV disease in transplant recipients (i.e., prophylaxis or pre-emptive therapy) remains a matter of debate. A link between CMV infection and Guillain-Barré syndrome, a neurological disease characterised by flaccid paralysis, has been substantiated, but the efficacy of antiviral therapy in such patients remains to be determined. This review summarises the current status of CMV disease in immunocompromised patients, and discusses some of the emerging issues of clinical relevance with regard to CMV infection in patients with disorders of the immune system.

  10. Cytomegalovirus-specific T-cells are associated with immune senescence, but not with systemic inflammation, in people living with HIV

    DEFF Research Database (Denmark)

    Ballegaard, Vibe; Brændstrup, Peter; Pedersen, Karin Kaereby

    2018-01-01

    In people living with HIV (PLWHIV), coinfection with cytomegalovirus (CMV) has been associated with inflammation, immunological ageing, and increased risk of severe non-AIDS related comorbidity. The effect of CMV-specific immune responses on systemic inflammation, immune activation and T-cell sen......In people living with HIV (PLWHIV), coinfection with cytomegalovirus (CMV) has been associated with inflammation, immunological ageing, and increased risk of severe non-AIDS related comorbidity. The effect of CMV-specific immune responses on systemic inflammation, immune activation and T...

  11. Murine cytomegalovirus immediate-early 1 gene expression correlates with increased GVHD after allogeneic hematopoietic cell transplantation in recipients reactivating from latent infection.

    Directory of Open Access Journals (Sweden)

    Senthilnathan Palaniyandi

    Full Text Available The success of allogeneic (allo hematopoietic cell transplantation (HCT is limited by its treatment related complications, mostly graft versus host disease (GVHD and fungal and viral infections. CMV reactivation after HCT has been associated with increased morbidity and mortality, and a causal relation between GVHD, immunosuppressive therapy and vice versa has been postulated. Using a low GVHD severity murine HCT model, we assessed the role of MCMV reactivation and GVHD development. BALB/c mice were infected with either murine CMV (MCMV or mock and monitored for 25 weeks to establish latency, followed by sublethal irradiation conditioning and infusion of bone marrow plus splenocytes from either syngeneic (syn BALB/c or allo B10.D2 donors. Engraftment of allo donor cells was confirmed by PCR for D2Mit265 gene product size. Day+100 mortality and overall GVHD severity in allo MCMV pre-infected recipients was higher than in allo mock controls. Pathologic changes of lung and liver GVHD in immediate-early gene 1 (IE1 positive recipients were significantly increased compared to mock controls, and were only slightly increased in IE1 negative. No significant gut injury was seen in any group. Aggravated lung injury in IE1 positive recipients correlated with higher BAL cell counts both for total cells and for CD4+ T cells when compared with mock controls, and also with protein expression of lung IFN-gamma and liver TNF. No evidence for CMV specific morphologic changes was seen on histopathology in any organ of IE1 positive recipients, suggesting that CMV reactivation is related to increased GVHD severity but does not require active CMV disease, strengthening the concept of a reciprocal relationship between CMV and GVHD.

  12. Cytomegalovirus (CMV) and Pregnancy

    Science.gov (United States)

    Cytomegalovirus (CMV) In every pregnancy, a woman starts out with a 3-5% chance of having a ... risk. This sheet talks about whether exposure to cytomegalovirus (CMV) can increase the risk for birth defects ...

  13. Maternal and fetal cytomegalovirus infection: diagnosis, management, and prevention

    Science.gov (United States)

    Pass, Robert F.; Arav-Boger, Ravit

    2018-01-01

    Congenital cytomegalovirus infection is a major cause of central nervous system and sensory impairments that affect cognition, motor function, hearing, language development, vestibular function, and vision. Although the importance of congenital cytomegalovirus infection is readily evident, the vast majority of maternal and fetal infections are not identified, even in developed countries. Multiple studies of prenatal cytomegalovirus infections have produced a body of knowledge that can inform the clinical approach to suspected or proven maternal and fetal infection. Reliable diagnosis of cytomegalovirus infection during pregnancy and accurate diagnosis of fetal infection are a reality. Approaches to preventing the transmission of cytomegalovirus from mother to fetus and to the treatment of fetal infection are being studied. There is evidence that public health approaches based on hygiene can dramatically reduce the rate of primary maternal cytomegalovirus infections during pregnancy. This review will consider the epidemiology of congenital cytomegalovirus infection, the diagnosis and management of primary infection during pregnancy, and approaches to preventing maternal infection. PMID:29560263

  14. The problem of congenital cytomegalovirus infection

    Directory of Open Access Journals (Sweden)

    R. A. Ivanova

    2016-01-01

    Full Text Available This paper comprises a review of up-to-date literature devoted to the problem of congenital cytomegalovirus infection, its epidemiology and pathogenesis. The paper includes one report on features and variants of clinical presentation of congenital cytomegalovirus infection and its sequelae, including late-onset complications. We pay attention to the problems related to timely diagnostics of congenital infections during pregnancy and suggest measures that can improve the quality of the survey. The basic aspects of laboratorial verification of cytomegalovirus infection in fetus and newborn are reviewed in the light of peculiarities of the features of the newborns’ immune system. In addition, significant points of etiotropic therapy are emphasized. Principal groups of antiviral drugs are delineated in this review, with proposal for their administration according to the clinical course and sequlae development. Furthermore, in this review we pay attention to the importance of preventive measures for reducing prevalence of cytomegalovirus in pregnant women. In view of its high prevalence among adult population and likelihood of recurrent clinical course in pregnant women, we specifically focus on necessity of further professional development of pediatricians and neonatogists. This necessity is determined by the prevalence of latent course of congenital cytomegalovirus infection, as its diagnostics is frequently retarded and, consequently, provokes development of severe complications. In this paper the indispensability of universal neonatal cytomegalovirus screening embedding is proven. Therefore, this review presents contemporary data about the problem of congenital cytomegalovirus infection and highlights general problems related to timely diagnostics and treatment of intrauterine infections.

  15. Detection of cytomegalovirus in blood donors by PCR using the digene SHARP signal system assay: effects of sample preparation and detection methodology.

    OpenAIRE

    Krajden, M; Shankaran, P; Bourke, C; Lau, W

    1996-01-01

    Cytomegalovirus (CMV) is an important cause of transfusion-associated morbidity and mortality; however, only 0.4 to 12% of the blood products obtained from seropositive blood donors transmit infection. The effects of three commercially available whole-blood sample preparation kits on the detection of CMV PCR products by a semiquantitative adaptation of the Digene SHARP Signal System Assay (DSSSA) in samples from volunteer blood donors was assessed. Of 101 samples from seropositive blood donor...

  16. Screening for retinitis in children with probable systemic cytomegalovirus infection at Tygerberg Hospital, Cape Town, South Africa

    Directory of Open Access Journals (Sweden)

    Johan Engelbrecht

    2017-07-01

    Full Text Available Background. The incidence of immunocompromised children with probable systemic cytomegalovirus (CMV infection is increasing. Currently, there is no protocol for screening children for CMV retinitis in South Africa. Screening for CMV retinitis may prevent permanent visual impairment. Objectives. To determine the prevalence of retinitis in children with probable systemic CMV infection. To assess the value of clinical and laboratory data in identifying risk factors for the development of CMV retinitis in children. Methods. A retrospective, cross-sectional study design was used. All children (≤12 years with probable systemic CMV infection who underwent ophthalmic screening over a 5-year period, were included. Presumed CMV retinitis was diagnosed by dilated fundoscopy. All cases were evaluated to identify possible risk factors for the development of CMV retinitis. Results. A total of 164 children were screened. Presumed CMV retinitis was diagnosed in 4.9% of participants. Causes of immunosuppression were HIV infection (n=7 and chemotherapy (n=1. HIV infection showed a definite trend towards association with the development of CMV retinitis in our study population (p=0.064. Conclusion.The prevalence of CMV retinitis was 4.9% in our sample. Other than HIV, we were not able to identify additional risk factors for CMV retinitis. Our results show that CD4 levels are possibly not a reliable indicator to predict CMV retinitis.

  17. Immunohistochemical diagnosis of systemic bovine zygomycosis by murine monoclonal antibodies

    DEFF Research Database (Denmark)

    Jensen, H.E.; Aalbaek, B.; Lind, Peter

    1996-01-01

    Murine monoclonal antibodies (Mabs) against water-soluble somatic antigens (WSSA) and the wall fraction (WF) from Rhizopus arrhizus (Rhizopus oryzae) were produced in vitro by fusion of splenocytes from immunized BALB/c mice with mouse myeloma X63-Ag 8.653 cells. Supernatants reacting only...... with homologous antigens in an enzyme-linked immunosorbent assay were subsequently screened for reactivity with homologous fungi in immunohistochemical techniques. All four Mabs raised against the WF of A. arrhizus failed to react on tissues. However, four of the Mabs raised against the WSSA of R. arrhizus (Mab......-WSSA-RA-1 through Mab-WSSA-RA-4) revealed a high homologous reactivity on tissues and the cross-reactivity of these were subsequently evaluated on tissues containing other members of the family Mucoraceae and other unrelated fungi. On tissues and on immunoblots all four Mabs reacted identically...

  18. Cytomegalovirus infection causes morbidity and mortality in patients with autoimmune diseases, particularly systemic lupus: in a Chinese population in Taiwan.

    Science.gov (United States)

    Tsai, W P; Chen, M H; Lee, M H; Yu, K H; Wu, M W; Liou, L B

    2012-09-01

    To investigate the clinical outcome of cytomegalovirus (CMV) infection in febrile hospitalized patients with autoimmune diseases, mostly systemic lupus erythematosus (SLE). Fifty-four febrile patients were analyzed retrospectively. Half were diagnosed as CMV infection, by positive CMV pp65 antigenemia assay. Clinical and laboratory data between two groups were compared. Correlation between laboratory data and SELENA-SLEDAI scores/mortality were analyzed in the CMV infection group. Receiver operating characteristic analysis was performed to determine the cutoff points of different parameters for predicting mortality or morbidity. The CMV infection group received a higher corticosteroid dosage (mean 26.3 mg/day) and a higher percentage of azathioprine use before admission than the non-CMV infection group. In the former, the deceased subgroup had a significantly higher number of infected leukocytes for CMV (shortened as CMV counts, P = 0.013), more cases of bacterial infection (P = 0.090), and a higher SLE disease activity index score (P = 0.072) than the alive subgroup. The CMV infection group had lower lymphocyte count and more positive bacterial infection than the non-CMV infection group did (P = 0.013 and P = 0.027, respectively). A level of 25 CMV particles/5 × 10(5) polymorphonuclear neutrophils (PMN) was the best cutoff point for predicting CMV-associated mortality, with a sensitivity of 75.0% and specificity of 72.2%. Moderate dose (30 mg/day) of prednisolone or azathioprine use predisposes patients with autoimmune diseases to CMV infection with concurrent bacterial infection. In particular, peak CMV counts at 25/5 × 10(5) PMN or low lymphocyte counts predict mortality or morbidity, respectively.

  19. Robust Production of Cytomegalovirus pp65-Specific T Cells Using a Fully Automated IFN-γ Cytokine Capture System.

    Science.gov (United States)

    Kim, Nayoun; Nam, Young-Sun; Im, Keon-Il; Lim, Jung-Yeon; Jeon, Young-Woo; Song, Yunejin; Lee, Jong Wook; Cho, Seok-Goo

    2018-01-01

    Cytomegalovirus(CMV)-related diseases are a serious cause of morbidity and mortality following hematopoietic stem cell transplantation (HSCT). CMV-specific cytotoxic T lymphocytes (CMV-CTLs) have been reported as an alternative to antiviral drugs that provide long-term CMV-specific immunity without major side effects. However, their application has been limited by the prolonged manufacturing process required. In this study, we applied the IFN-γ cytokine capture system (CCS) using the fully automated CliniMACS Prodigy device for rapid production of CMV-CTLs, which may be applicable in clinically urgent CMV-related diseases. Five validation runs were performed using apheresis samples from randomly selected CMV-seropositive healthy blood donors. Successive processes, including antigen stimulation, anti-IFN-γ labeling, magnetic enrichment and elution, were then performed automatically using the CliniMACS Prodigy, which took approximately 13 h. The original apheresis samples consisted mainly of CD45RA+ CD62L+ naïve T cells as well as 0.3% IFN-γ-secreting CD3+ T cells that showed a response to the CMV pp65 antigen (CD3+ IFN-γ+ cells). Following IFN-γ enrichment, the target fraction contained 51.3% CD3+ IFN-γ+ cells with a reduction in naïve T cells and selection of CD45RA- CD62L- and CD45RA+ CD62L- memory T cells. Furthermore, extended culture of these isolated cells revealed functional activity, including efficient proliferation, sustained antigen-specific IFN-γ secretion, and cytotoxicity against pp65-pulsed target cells. The findings reported here suggest that the IFN-γ CCS by the CliniMACS Prodigy is a simple and robust approach to produce CMV-CTLs, which may be applicable for the treatment of clinically urgent CMV-related diseases.

  20. Visualization and functional characterization of the developing murine cardiac conduction system

    Science.gov (United States)

    Rentschler, Stacey; Vaidya, Dhananjay M.; Tamaddon, Houman; Degenhardt, Karl; Sassoon, David; Morley, Gregory E.; Jalife, José; Fishman, Glenn I.

    2013-01-01

    SUMMARY The cardiac conduction system is a complex network of cells that together orchestrate the rhythmic and coordinated depolarization of the heart. The molecular mechanisms regulating the specification and patterning of cells that form this conductive network are largely unknown. Studies in avian models have suggested that components of the cardiac conduction system arise from progressive recruitment of cardiomyogenic progenitors, potentially influenced by inductive effects from the neighboring coronary vasculature. However, relatively little is known about the process of conduction system development in mammalian species, especially in the mouse, where even the histological identification of the conductive network remains problematic. We have identified a line of transgenic mice where lacZ reporter gene expression delineates the developing and mature murine cardiac conduction system, extending proximally from the sinoatrial node to the distal Purkinje fibers. Optical mapping of cardiac electrical activity using a voltage-sensitive dye confirms that cells identified by the lacZ reporter gene are indeed components of the specialized conduction system. Analysis of lacZ expression during sequential stages of cardiogenesis provides a detailed view of the maturation of the conductive network and demonstrates that patterning occurs surprisingly early in embryogenesis. Moreover, optical mapping studies of embryonic hearts demonstrate that a murine His-Purkinje system is functioning well before septation has completed. Thus, these studies describe a novel marker of the murine cardiac conduction system that identifies this specialized network of cells throughout cardiac development. Analysis of lacZ expression and optical mapping data highlight important differences between murine and avian conduction system development. Finally, this line of transgenic mice provides a novel tool for exploring the molecular circuitry controlling mammalian conduction system development

  1. Failure in generating hemopoietic stem cells is the primary cause of death from cytomegalovirus disease in the immunocompromised host

    International Nuclear Information System (INIS)

    Mutter, W.; Reddehase, M.J.; Busch, F.W.; Buehring, H.J.K.; Koszinowski, U.H.

    1988-01-01

    We have shown in a murine model system for cytomegalovirus (CMV) disease in the immunocompromised host that CMV infection interferes with the earliest detectable step in hemopoiesis, the generation of the stem cell CFU-S-I, and thereby prevents the autoreconstitution of bone marrow after sublethal irradiation. The antihemopoietic effect could not be ascribed to a direct infection of stem cells. The failure in hemopoiesis was prevented by adoptive transfer of antiviral CD8+ T lymphocytes and could be overcome by syngeneic bone marrow transplantation. CD8+ T lymphocytes and bone marrow cells both mediated survival, although only CD8+ T lymphocytes were able to limit virus multiplication in host tissues. We concluded that not the cytopathic effect of virus replication in host tissues, but the failure in hemopoiesis, is the primary cause of death in murine CMV disease

  2. Immune evasion proteins enhance cytomegalovirus latency in the lungs.

    Science.gov (United States)

    Böhm, Verena; Seckert, Christof K; Simon, Christian O; Thomas, Doris; Renzaho, Angélique; Gendig, Dorothea; Holtappels, Rafaela; Reddehase, Matthias J

    2009-10-01

    CD8 T cells control cytomegalovirus (CMV) infection in bone marrow transplantation recipients and persist in latently infected lungs as effector memory cells for continuous sensing of reactivated viral gene expression. Here we have addressed the question of whether viral immunoevasins, glycoproteins that specifically interfere with antigen presentation to CD8 T cells, have an impact on viral latency in the murine model. The data show that deletion of immunoevasin genes in murine CMV accelerates the clearance of productive infection during hematopoietic reconstitution and leads to a reduced latent viral genome load, reduced latency-associated viral transcription, and a lower incidence of recurrence in lung explants.

  3. Cytomegalovirus Congenital Cataract

    Directory of Open Access Journals (Sweden)

    Ridha Wahyutomo

    2011-06-01

    Full Text Available Cytomegalovirus congenital infection is an infection caused by the the subfamily â Herpesviridae, during pregnancy. The incidence of infections among newborn infants is 1 %. One of the effects of congenitally acquired infection is the congenital cataract. A 6-year-old child complained to have a blurred vision diagnosed with cytomegalovirus congenital cataract. The diagnosis was confirmed by a positive serology testing for Ig M and Ig G CMV. The laboratory test using Giemsa staining to find inclusion bodies and a faster PCR could not be carried out (Sains Medika, 3(1:84-88.

  4. Hearing Loss and Cytomegalovirus.

    Science.gov (United States)

    Strauss, Melvin

    1997-01-01

    Cytomegalovirus is the most common cause of congenital virally induced hearing loss. Maternal infection is most often asymptomatic as is the infection in the newborn. Hearing loss occurs in both clinically apparent infection and in the asymptomatic infection. Current methods of detection, treatment, and prevention and research efforts are…

  5. Cytomegalovirus Hepatitis During Pregnancy

    Directory of Open Access Journals (Sweden)

    Ying Chan

    1995-01-01

    Full Text Available Background: Although cytomegalovirus (CMV is an uncommon cause of viral hepatitis during pregnancy, a definitive diagnosis is important because of the potential for congenital CMV. In the case reported here, a diagnosis of hepatitis caused by CMV was made after the more common viral pathogens had been ruled out.

  6. Cytomegalovirus en pericarditis

    NARCIS (Netherlands)

    Beekhuis, Johan Willem

    1976-01-01

    Dit proefschrift beschrijft een onderzoek naar de aetiologische betekenis van enkele virussen, in het bijzonder van cytomegalovirus (CMV) voor verschillende vormen van pericarditis. CMV-infecties worden merendeels in de adolescentie en op volwassen leeftijd doorgemaakt en kunnen aanleiding geven tot

  7. Cytomegalovirus: pathophysiological mechanisms of the cytomegalovirus-induced cellular responses

    International Nuclear Information System (INIS)

    Nokta, M.A.

    1986-01-01

    Cytomegalovirus (CMV) infection of fibroblasts of human origin is associated with a cascade of morphologic cellular responses which in other systems have been associated with regulation of intracellular free (IF) [Ca ++ ]. In the present study, the relationship of specific ion fluxes (Ca ++ , Na + ) to the development of cytomegalovirus (CMV)-induced morphologic cellular responses was investigated. An influx of Ca ++ was observed by the first hour after CMV infection (PI), and total calcium sequestered by infected cells was enhanced by 5 hr Pl. A gradual rise in intracellular free (IF) [Ca ++ ] was observed that continued through 48 hour postinfection (hr Pl). The IF [Ca ++ ] response to CMV infection was shown to be multiplicity dependent, require viable virus, and occur under conditions consistent with the expression of immediate early CMV genes. Development and progression of cytomegaly was found to be independent of CMV DNA synthesis and appeared to be dependent on the IF [Ca ++ ] response. Ca ++ influx blockers (e.g. verapamil) and cyclic nucleotide modulators (e.g. papaverine) inhibited both Ca ++ responses and cytomegaly. Quabain-sensitive 86 Rb uptake and sequestering of Ca ++ increased in parallel with development of cytomegaly. There may be a relationship between Ca ++ influx, IF [Ca ++ ], activation of the Na + /H + exchanger, induction of Na + , Cl - , HCO 3 cotransport, Na + entry, Na + /K + ATPase activity and development of CMV-induced morphologic cellular responses including cytomegaly

  8. Central Nervous System Demyelination and Remyelination is Independent from Systemic Cholesterol Level in Theiler's Murine Encephalomyelitis.

    Science.gov (United States)

    Raddatz, Barbara B; Sun, Wenhui; Brogden, Graham; Sun, Yanyong; Kammeyer, Patricia; Kalkuhl, Arno; Colbatzky, Florian; Deschl, Ulrich; Naim, Hassan Y; Baumgärtner, Wolfgang; Ulrich, Reiner

    2016-01-01

    High dietary fat and/or cholesterol intake is a risk factor for multiple diseases and has been debated for multiple sclerosis. However, cholesterol biosynthesis is a key pathway during myelination and disturbances are described in demyelinating diseases. To address the possible interaction of dyslipidemia and demyelination, cholesterol biosynthesis gene expression, composition of the body's major lipid repositories and Paigen diet-induced, systemic hypercholesterolemia were examined in Theiler's murine encephalomyelitis (TME) using histology, immunohistochemistry, serum clinical chemistry, microarrays and high-performance thin layer chromatography. TME-virus (TMEV)-infected mice showed progressive loss of motor performance and demyelinating leukomyelitis. Gene expression associated with cholesterol biosynthesis was overall down-regulated in the spinal cord of TMEV-infected animals. Spinal cord levels of galactocerebroside and sphingomyelin were reduced on day 196 post TMEV infection. Paigen diet induced serum hypercholesterolemia and hepatic lipidosis. However, high dietary fat and cholesterol intake led to no significant differences in clinical course, inflammatory response, astrocytosis, and the amount of demyelination and remyelination in the spinal cord of TMEV-infected animals. The results suggest that down-regulation of cholesterol biosynthesis is a transcriptional marker for demyelination, quantitative loss of myelin-specific lipids, but not cholesterol occurs late in chronic demyelination, and serum hypercholesterolemia exhibited no significant effect on TMEV infection. © 2015 International Society of Neuropathology.

  9. Anatomy of the Murine Hepatobiliary System: A Whole-Organ-Level Analysis Using a Transparency Method.

    Science.gov (United States)

    Higashiyama, Hiroki; Sumitomo, Hiroyuki; Ozawa, Aisa; Igarashi, Hitomi; Tsunekawa, Naoki; Kurohmaru, Masamichi; Kanai, Yoshiakira

    2016-02-01

    The biliary tract is a well-branched ductal structure that exhibits great variation in morphology among vertebrates. Its function is maintained by complex constructions of blood vessels, nerves, and smooth muscles, the so-called hepatobiliary system. Although the mouse (Mus musculus) has been used as a model organism for humans, the morphology of its hepatobiliary system has not been well documented at the topographical level, mostly because of its small size and complexity. To reconcile this, we conducted whole-mount anatomical descriptions of the murine extrahepatic biliary tracts with related blood vessels, nerves, and smooth muscles using a recently developed transparentizing method, CUBIC. Several major differences from humans were found in mice: (1) among the biliary arteries, the arteria gastrica sinistra accessoria was commonly found, which rarely appears in humans; (2) the sphincter muscle in the choledochoduodenal junction is unseparated from the duodenal muscle; (3) the pancreatic duct opens to the bile duct without any sphincter muscles because of its distance from the duodenum. This state is identical to a human congenital malformation, an anomalous arrangement of pancreaticobiliary ducts. However, other parts of the murine hepatobiliary system (such as the branching patterns of the biliary tract, blood vessels, and nerves) presented the same patterns as humans and other mammals topologically. Thus, the mouse is useful as an experimental model for studying the human hepatobiliary system. © 2015 Wiley Periodicals, Inc.

  10. Cardiac conduction system anomalies and sudden cardiac death: insights from murine models

    Directory of Open Access Journals (Sweden)

    Amelia Eva Aranega

    2012-06-01

    Full Text Available The cardiac conduction system (CCS is a series of specialized tissues in the heart responsible for the initiation and co-ordination of the heartbeat. Alterations in the CCS, especially the His-Purkinje system, have been identified as an important player in the generation of lethal arrhythmias. Unstable arrhythmias secondary to channelopathies highly increase the risk of sudden cardiac death (SCD. Sudden cardiac death is a major contributor to mortality in industrialized nations, and most cases of SCD in the young are related to inherited ion channel diseases. In this review we examine how murine transgenic models have contributed to understanding that a broad variety of cardiac arrhythmias involve the cardiac specialized conduction system and may lead to sudden cardiac death.

  11. EXPRESSION OF PLURIPOTENCY MARKERS IN REPROGRAMMING WITH TRANSPOSON SYSTEM MURINE FIBROBLASTS

    Directory of Open Access Journals (Sweden)

    S. V. Malysheva

    2013-10-01

    Full Text Available The search for effective and safe methods to generate induced pluripotent stem cells is especially urgent. In the paper murine embryonic fibro blasts were reprogrammed towards actively proliferating colonies with typical induced pluripotent stem cells morphology by means of Sleeping beauty transposon-based vector system. The obtained clones were checked for the expression of various pluripotency markers: alkaline phosphatase, Oct4 and Sox2 genes, SSEA-1 expression in various clones was evaluated. Also the reactivation of endogenous pluripotency factors Nanog and Rex1 was indicated. The data obtained is analyzed and compared to the established pluripotent stem cell line. It is shown that somatic cells are reprogrammed towards pluripotency by means of Sleeping beauty transposon system. Therefore, the system is a new perspective biotechnological tool to generate pluripotent cells.

  12. Cytomegalovirus hepatitis and myopericarditis

    Science.gov (United States)

    Zubiaurre, Leire; Zapata, Eva; Bujanda, Luis; Castillo, María; Oyarzabal, Igor; Gutiérrez-Stampa, Maria A; Cosme, Angel

    2007-01-01

    Cytomegalovirus (CMV) infection in inmunocompetent hosts generally is asymptomatic or may present as a mononucleosis syndrome but rarely can lead to severe organ complications. We report a case of simultaneous hepatic and pericardic CMV infection in a 36-year old immunocompetent man. He was admitted to coronary unit with fever, chest pain radiated to shoulders, changes on electrocardiogram with diffuse ST elevation and modest laboratory elevations in the MB fraction of creatine kinase (CK-MB) of 33.77 μg/L (0.1-6.73), serum cardiac troponin T of 0.904 ng/mL (0-0.4), creatine kinase of 454 U/L (20-195) and myoglobin of 480.4 μg/L (28-72). Routine laboratory test detected an elevation of aminotransferase level: alanine aminotransferase 1445 U/L, aspartate aminotransferase 601 U/L. We ruled out other causes of hepatitis with normal results except IgM CMV. The patient was diagnosed with myopericarditis and hepatitis caused by cytomegalovirus and started symptomatic treatment with salicylic acid. In few days the laboratory findings became normal and the patient was discharged. PMID:17278238

  13. The murine cytomegalovirus immune evasion protein m4/gp34 forms biochemically distinct complexes with class I MHC at the cell surface and in a pre-Golgi compartment.

    Science.gov (United States)

    Kavanagh, D G; Koszinowski, U H; Hill, A B

    2001-10-01

    We have recently demonstrated that the murine CMV (MCMV) gene m4 is an immune evasion gene that protects MCMV-infected targets from some virus-specific CTL clones. m4 encodes m4/gp34, a 34-kDa glycoprotein that binds to major histocompatibility complex class I in the endoplasmic reticulum and forms a detergent-stable complex that is exported to the surface of the cell. To investigate how m4/gp34 promotes CTL evasion, we analyzed the assembly and export of m4/gp34-K(b) complexes. We found that 50-70% of K(b) exported over the course of MCMV infection was m4/gp34 associated. Because these complexes are present at the cell surface, it is possible that m4 mediates CTL evasion by interfering with contact between class I and receptors on the T cell. In addition, we found that K(b) retained by the MCMV immune evasion gene m152 formed a novel type of complex with Endo H-sensitive m4/gp34; these complexes are distinguished from the exported complexes by being stable in 1% digitonin and unstable in 1% Nonidet P-40. Because this association occurs in a pre-Golgi compartment, m4/gp34 might also interfere with Ag presentation by affecting some aspect of class I assembly, such as peptide loading. Although m4/gp34 requires beta(2)-microglobulin to bind class I, there was no significant binding of m4/gp34 to beta(2)-microglobulin in the absence of class I H chain, demonstrating that m4/gp34 forms Nonidet P-40-stable complexes specifically with folded conformations of class I. We conclude that m4/gp34 promotes immune evasion by a novel mechanism involving altered assembly and/or T cell recognition of class I molecules.

  14. Murine and Human Model Systems for the Study of Dendritic Cell Immunobiology.

    Science.gov (United States)

    Hargadon, Kristian M

    2016-01-01

    Dendritic cells are a population of innate immune cells that possess their own effector functions as well as numerous regulatory properties that shape the activity of other innate and adaptive cells of the immune system. Following their development from either lymphoid or myeloid progenitors, the function of dendritic cells is tightly linked to their maturation and activation status. Differentiation into specialized subsets of dendritic cells also contributes to the diverse immunologic functions of these cells. Because of the key role played by dendritic cells in the regulation of both immune tolerance and activation, significant efforts have been focused on understanding dendritic cell biology. This review highlights the model systems currently available to study dendritic cell immunobiology and emphasizes the advantages and disadvantages to each system in both murine and human settings. In particular, in vitro cell culture systems involving immortalized dendritic cell lines, ex vivo systems for differentiating and expanding dendritic cells from their precursor populations, and systems for expanding, ablating, and manipulating dendritic cells in vivo are discussed. Emphasis is placed on the contribution of these systems to our current understanding of the development, function, and immunotherapeutic applications of dendritic cells, and insights into how these models might be extended in the future to answer remaining questions in the field are discussed.

  15. Pathogenesis of Candida albicans infections in the alternative chorio-allantoic membrane chicken embryo model resembles systemic murine infections.

    Directory of Open Access Journals (Sweden)

    Ilse D Jacobsen

    Full Text Available Alternative models of microbial infections are increasingly used to screen virulence determinants of pathogens. In this study, we investigated the pathogenesis of Candida albicans and C. glabrata infections in chicken embryos infected via the chorio-allantoic membrane (CAM and analyzed the virulence of deletion mutants. The developing immune system of the host significantly influenced susceptibility: With increasing age, embryos became more resistant and mounted a more balanced immune response, characterized by lower induction of proinflammatory cytokines and increased transcription of regulatory cytokines, suggesting that immunopathology contributes to pathogenesis. While many aspects of the chicken embryo response resembled murine infections, we also observed significant differences: In contrast to systemic infections in mice, IL-10 had a beneficial effect in chicken embryos. IL-22 and IL-17A were only upregulated after the peak mortality in the chicken embryo model occurred; thus, the role of the Th17 response in this model remains unclear. Abscess formation occurs frequently in murine models, whereas the avian response was dominated by granuloma formation. Pathogenicity of the majority of 15 tested C. albicans deletion strains was comparable to the virulence in mouse models and reduced virulence was associated with significantly lower transcription of proinflammatory cytokines. However, fungal burden did not correlate with virulence and for few mutants like bcr1Δ and tec1Δ different outcomes in survival compared to murine infections were observed. C. albicans strains locked in the yeast stage disseminated significantly more often from the CAM into the embryo, supporting the hypothesis that the yeast morphology is responsible for dissemination in systemic infections. These data suggest that the pathogenesis of C. albicans infections in the chicken embryo model resembles systemic murine infections but also differs in some aspects. Despite

  16. The role of cytomegalovirus-encoded homologs of G protein-coupled receptors and chemokines in manipulation of and evasion from the immune system.

    Science.gov (United States)

    Vink, C; Smit, M J; Leurs, R; Bruggeman, C A

    2001-12-01

    Cytomegaloviruses (CMVs) have the ability to persist lifelong within the infected host. This ability implies that these viruses are highly adapted to their hosts. Most importantly, they will have to employ strategies to remain hidden from the host's immune system. Virus genes predicted to be involved in these strategies include genes encoding homologs of cellular immune effector or regulatory proteins, such as chemokine (CK) receptor-like G protein-coupled receptors (GPCRs), CKs and MHC class I molecules. These genes may have been pirated by the virus during the long co-evolution of pathogen and host. In light of the crucial roles that GPCRs, CKs and MHC class I molecules play in the normal physiology of the host, it is to be expected that the CMV homologs of these proteins may have a profound impact on this physiology and, at the same time, serve vital functions in maintenance as well as replication of the virus within the infected host. As a consequence, these viral homologs can be envisaged as attractive targets for novel anti-viral strategies. The aim of this report is to present an overview of the current state of knowledge on the (putative) functions of the CMV homologs of GPCRs and CKs.

  17. Isolation, expansion and transplantation of postnatal murine progenitor cells of the enteric nervous system.

    Directory of Open Access Journals (Sweden)

    Heike Monika Dettmann

    Full Text Available Neural stem or progenitor cells have been proposed to restore gastrointestinal function in patients suffering from congenital or acquired defects of the enteric nervous system. Various, mainly embryonic cell sources have been identified for this purpose. However, immunological and ethical issues make a postnatal cell based therapy desirable. We therefore evaluated and quantified the potential of progenitor cells of the postnatal murine enteric nervous system to give rise to neurons and glial cells in vitro. Electrophysiological analysis and BrdU uptake studies provided direct evidence that generated neurons derive from expanded cells in vitro. Transplantation of isolated and expanded postnatal progenitor cells into the distal colon of adult mice demonstrated cell survival for 12 weeks (end of study. Implanted cells migrated within the gut wall and differentiated into neurons and glial cells, both of which were shown to derive from proliferated cells by BrdU uptake. This study indicates that progenitor cells isolated from the postnatal enteric nervous system might have the potential to serve as a source for a cell based therapy for neurogastrointestinal motility disorders. However, further studies are necessary to provide evidence that the generated cells are capable to positively influence the motility of the diseased gastrointestinal tract.

  18. Human Cytomegalovirus and Autoimmune Disease

    Science.gov (United States)

    2014-01-01

    Human cytomegalovirus (HCMV) represents a prototypic pathogenic member of the β-subgroup of the herpesvirus family. A range of HCMV features like its lytic replication in multiple tissues, the lifelong persistence through periods of latency and intermitting reactivation, the extraordinary large proteome, and extensive manipulation of adaptive and innate immunity make HCMV a high profile candidate for involvement in autoimmune disorders. We surveyed the available literature for reports on HCMV association with onset or exacerbation of autoimmune disease. A causative linkage between HCMV and systemic lupus erythematosus (SLE), systemic sclerosis (SSc), diabetes mellitus type 1, and rheumatoid arthritis (RA) is suggested by the literature. However, a clear association of HCMV seroprevalence and disease could not be established, leaving the question open whether HCMV could play a coresponsible role for onset of disease. For convincing conclusions population-based prospective studies must be performed in the future. Specific immunopathogenic mechanisms by which HCMV could contribute to the course of autoimmune disease have been suggested, for example, molecular mimicry by UL94 in SSc and UL83/pp65 in SLE patients, as well as aggravation of joint inflammation by induction and expansion of CD4+/CD28− T-cells in RA patients. Further studies are needed to validate these findings and to lay the grounds for targeted therapeutic intervention. PMID:24967373

  19. Applications of the CRISPR/Cas9 system in murine cancer modeling.

    Science.gov (United States)

    Zuckermann, Marc; Kawauchi, Daisuke; Gronych, Jan

    2017-01-01

    Advanced biological technologies allowing for genetic manipulation of the genome are increasingly being used to unravel the molecular pathogenesis of human diseases. The clustered regulatory interspaced short palindromic repeat/CRISPR-associated protein (CRISPR/Cas) technology started a revolution of this field owing to its flexibility and relative ease of use. Recently, application of the CRISPR/Cas9 system has been extended to in vivo approaches, leveraging its potential for human disease modeling. Particularly in oncological research, where genetic defects in somatic cells are tightly linked to etiology and pathological phenotypes, the CRISPR/Cas technology is being used to recapitulate various types of genetic aberrations. Here we review murine cancer models that have been developed via combining the CRISPR/Cas9 technology with in vivo somatic gene transfer approaches. Exploiting these methodological advances will further accelerate detailed investigations of tumor etiology and treatment. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  20. Congenital and perinatal cytomegalovirus infection

    Directory of Open Access Journals (Sweden)

    Chun Soo Kim

    2010-01-01

    Full Text Available Cytomegalovirus (CMV is currently the most common agent of congenital infection and the leading infectious cause of brain damage and hearing loss in children. Symptomatic congenital CMV infections usually result from maternal primary infection during early pregnancy. One half of symptomatic infants have cytomegalic inclusion disease (CID, which is characterized by involvement of multiple organs, in particular, the reticuloendothelial and central nervous system (CNS. Moreover, such involvement may or may not include ocular and auditory damage. Approximately 90% of infants with congenital infection are asymptomatic at birth. Preterm infants with perinatal CMV infection can have symptomatic diseases such as pneumonia, hepatitis, and thrombocytopenia. Microcephaly and abnormal neuroradiologic imaging are associated with a poor prognosis. Hearing loss may occur in both symptomatic and asymptomatic infants with congenital infection and may progress through childhood. Congenital infection is defined by the isolation of CMV from infants within the first 3 weeks of life. Ganciclovir therapy can be considered for infants with symptomatic congenital CMV infection involving the CNS. Pregnant women of seronegative state should be counseled on the importance of good hand washing and other control measures to prevent CMV infection. Heat treatment of infected breast milk at 72?#608;for 5 seconds can eliminate CMV completely.

  1. Nonprimary Cytomegalovirus Fetal Infection.

    Science.gov (United States)

    Rodrigues, Sofia; Gonçalves, Daniela; Taipa, Ricardo; Rodrigues, Maria do Céu

    2016-04-01

    Cytomegalovirus (CMV) is the most common congenital viral infection, causing hearing, visual and psychomotor impairment. Preexisting maternal CMV immunity substantially reduces, but not eliminates, the risk of fetal infection and affectation. This article is about a case of nonprimary maternal CMV infection during pregnancy, with vertical transmission, resulting in severe fetal affectation. Preconceptional analysis indicated maternal CMV past infection. Pregnancy progressed uneventfully until the 20th week ultrasound (US), which revealed cerebral abnormalities: thin and hyperechogenic cerebral cortex with prominent lateral ventricles, bilateral periventricular hyperechogenicities, cerebellar vermis hypoplasia and absent corpus callosum. The MRI suggested these findings were compatible with congenital infection rather than primary brain malformation.The fetal karyotype was normal. The title of CMV's IgG antibodies almost tripled. Since the first semester, analysis of the polymerase chain reaction (PCR) for CMV DNA in the amniotic fluid was negative. The pregnancy was terminated at 23 weeks. Neuropathological findings at autopsy showed severe brain lesions associated with CMV infection. Thieme Publicações Ltda Rio de Janeiro, Brazil.

  2. Cytomegalovirus infection in pregnancy.

    Science.gov (United States)

    Kagan, Karl Oliver; Hamprecht, Klaus

    2017-07-01

    Due to the severe risk of long-term sequelae, prenatal cytomegalovirus infection is of particular importance amongst intrauterine viral infections. This review summarizes the current knowledge about CMV infection in pregnancy. A search of the Medline and Embase database was done for articles about CMV infection in pregnany. We performed a detailed review of the literature in view of diagnosis, epidemiology and management of CMV infection in pregnancy. The maternal course of the infection is predominantly asymptomatic; the infection often remains unrecognized until the actual fetal manifestation. Typical ultrasound signs that should arouse suspicion of intrauterine CMV infection can be distinguished into CNS signs such as ventriculomegaly or microcephaly and extracerebral infection signs such as hepatosplenomegaly or hyperechogenic bowel. Current treatment strategies focus on hygienic measures to prevent a maternal CMV infection during pregnancy, on maternal application of hyperimmunoglobulines to avoid materno-fetal transmission in case of a maternal seroconversion, and on an antiviral therapy in case the materno-fetal transmission have occurred. CMV infection in pregnancy may result in a severe developmental disorder of the newborn. This should be taken into account in the treatment of affected and non-affected pregnant women.

  3. Diagnosis of Cytomegalovirus Infections

    Science.gov (United States)

    Ross, S.A.; Novak, Z.; Pati, S.; Boppana, S.B.

    2013-01-01

    Cytomegalovirus (CMV) is recognized as the most common congenital viral infection in humans and an important cause of morbidity and mortality in immunocompromised hosts. This recognition of the clinical importance of invasive CMV disease in the setting of immunodeficiency and in children with congenital CMV infection has led to the development of new diagnostic procedures for the rapid identification of immunocompromised individuals with CMV disease, as well as fetuses and infants with congenital infection. Diagnosis of acute maternal CMV infection by the presence of IgM and low IgG avidity requires confirmation of fetal infection which is typically performed by CMV PCR of the amniotic fluid. Viral culture of the urine and saliva obtained within the first two weeks of life continue to be the gold standard for diagnosis of congenitally infected infants. PCR assays of dried blood spots from infants have not been shown to have sufficient sensitivity for the identification of most infants with congenital CMV infection. However, saliva PCR assays are currently being assessed as a useful screening method for congenital CMV infection. In the immunocompromised host, newer rapid diagnostic assays such as pp65 antigenemia and real-time CMV PCR of blood or plasma have allowed for preemptive treatment reducing morbidity and mortality. However, lack of standardized real-time PCR protocols hinders the comparison of the data across different centers and the development of uniform guidelines for the management of invasive CMV infections in immunocompromised individuals. PMID:21827433

  4. Cytomegalovirus Infection of the Rat Developing Brain In Utero Prominently Targets Immune Cells and Promotes Early Microglial Activation.

    Directory of Open Access Journals (Sweden)

    Robin Cloarec

    Full Text Available Congenital cytomegalovirus infections are a leading cause of neurodevelopmental disorders in human and represent a major health care and socio-economical burden. In contrast with this medical importance, the pathophysiological events remain poorly known. Murine models of brain cytomegalovirus infection, mostly neonatal, have brought recent insights into the possible pathogenesis, with convergent evidence for the alteration and possible involvement of brain immune cells.In order to confirm and expand those findings, particularly concerning the early developmental stages following infection of the fetal brain, we have created a model of in utero cytomegalovirus infection in the developing rat brain. Rat cytomegalovirus was injected intraventricularly at embryonic day 15 (E15 and the brains analyzed at various stages until the first postnatal day, using a combination of gene expression analysis, immunohistochemistry and multicolor flow cytometry experiments.Rat cytomegalovirus infection was increasingly seen in various brain areas including the choroid plexi and the ventricular and subventricular areas and was prominently detected in CD45low/int, CD11b+ microglial cells, in CD45high, CD11b+ cells of the myeloid lineage including macrophages, and in CD45+, CD11b- lymphocytes and non-B non-T cells. In parallel, rat cytomegalovirus infection of the developing rat brain rapidly triggered a cascade of pathophysiological events comprising: chemokines upregulation, including CCL2-4, 7 and 12; infiltration by peripheral cells including B-cells and monocytes at E17 and P1, and T-cells at P1; and microglia activation at E17 and P1.In line with previous findings in neonatal murine models and in human specimen, our study further suggests that neuroimmune alterations might play critical roles in the early stages following cytomegalovirus infection of the brain in utero. Further studies are now needed to determine which role, whether favorable or detrimental

  5. Valaciclovir to prevent Cytomegalovirus mediated adverse modulation of the immune system in ANCA-associated vasculitis (CANVAS): study protocol for a randomised controlled trial.

    Science.gov (United States)

    Chanouzas, Dimitrios; Dyall, Lovesh; Nightingale, Peter; Ferro, Charles; Moss, Paul; Morgan, Matthew David; Harper, Lorraine

    2016-07-22

    The ANCA-associated vasculitides (AAV) are systemic autoimmune inflammatory disorders characterised by necrotising inflammation affecting small to medium-sized blood vessels. Despite improvements in survival, infection and cardiovascular disease remain leading causes of morbidity and mortality. Considerable evidence suggests that CD4 + CD28null T-cell expansions, predominantly seen in Cytomegalovirus (CMV) seropositive individuals, are associated with systemic dysregulation of immune function leading to a heightened risk of infection and cardiovascular disease. In patients with AAV, CD4 + CD28null expansions are driven by CMV and are associated with an increased risk of infection and mortality. The aim of this study is to explore in detail the ways in which CMV modulates the immune system and to determine whether treatment with valaciclovir blocks subclinical CMV reactivation in CMV seropositive AAV patients and ameliorates the CMV-induced adverse effects on the immune system. CANVAS is a single-centre prospective open-label randomised controlled proof-of-concept trial of 50 adult CMV seropositive patients with stable AAV. Participants will be randomly allocated to receive valaciclovir orally (2 g QDS or reduced according to renal function) or no additional treatment for 6 months with an additional 6-month follow-up period. The primary outcome is the proportion of patients with CMV reactivation, as assessed by measurable viral load on quantitative blood and urine CMV polymerase chain reaction. The secondary outcomes are safety, change in the proportion of CD4+ CMV-specific T-cell population (defined as CD4 + CD28null cells) and change in soluble markers of inflammation from baseline to 6 months. Further tertiary and exploratory outcomes include persistence of the effect of valaciclovir on the proportion of CD4 + CD28null cells at 6 months post completion of treatment, change in the immune phenotype of CD4+ T cells and change in blood pressure and

  6. Sepsis and cytomegalovirus: foes or conspirators?

    Science.gov (United States)

    Mansfield, Sara; Grießl, Marion; Gutknecht, Michael; Cook, Charles H

    2015-06-01

    Cytomegalovirus (CMV) reactivation in non-immune-suppressed critically ill patients is an area of increasing interest. CMV has long been appreciated as a pathogen in immunocompromised hosts. CMV reactivates in approximately one-third of latently infected non-immune-suppressed hosts during critical illness; however, its role as a pathogen in these patients remains unclear. CMV reactivation has been linked to bacterial sepsis and likely results from inflammation, transient immune compromise, and viral epigenetic changes. While CMV may improve immune response to some bacterial infections, other data suggest that CMV induces exaggerated responses to severe infections that may be harmful to latently infected hosts. These results also suggest that previous infection history may explain significant differences seen between human septic responses and murine models of sepsis. While critically ill human hosts clearly have worse outcomes associated with CMV reactivation, determining causality remains an area of investigation, with randomized control trials currently being performed. Here we review the current literature and highlight areas for future investigation.

  7. Cytomegalovirus : a culprit or protector in multiple sclerosis?

    NARCIS (Netherlands)

    Vanheusden, Marjan; Stinissen, Piet; 't Hart, Bert A.; Hellings, Niels

    Multiple sclerosis (MS) is a chronic disabling autoimmune disease of the central nervous system (CNS). Cytomegalovirus (CMV), a beta herpes virus, may have a detrimental or beneficial role in MS pathology. Accumulating evidence indicates that CMV contributes to MS disease via interplay of different

  8. Survival and Transfer of Murine Norovirus within a Hydroponic System during Kale and Mustard Microgreen Harvesting.

    Science.gov (United States)

    Wang, Qing; Kniel, Kalmia E

    2016-01-15

    Hydroponically grown microgreens are gaining in popularity, but there is a lack of information pertaining to their microbiological safety. The potential risks associated with virus contamination of crops within a hydroponic system have not been studied to date. Here a human norovirus (huNoV) surrogate (murine norovirus [MNV]) was evaluated for its ability to become internalized from roots to edible tissues of microgreens. Subsequently, virus survival in recirculated water without adequate disinfection was assessed. Kale and mustard seeds were grown on hydroponic pads (for 7 days with harvest at days 8 to 12), edible tissues (10 g) were cut 1 cm above the pads, and corresponding pieces (4 cm by 4 cm) of pads containing only roots were collected separately. Samples were collected from a newly contaminated system (recirculated water inoculated with ∼3 log PFU/ml MNV on day 8) and from a previously contaminated system. (A contaminated system without adequate disinfection or further inoculation was used for production of another set of microgreens.) Viral titers and RNA copies were quantified by plaque assay and real-time reverse transcription (RT)-PCR. The behaviors of MNV in kale and mustard microgreens were similar (P > 0.05). MNV was detected in edible tissues and roots after 2 h postinoculation, and the levels were generally stable during the first 12 h. Relatively low levels (∼2.5 to ∼1.5 log PFU/sample of both edible tissues and roots) of infectious viruses were found with a decreasing trend over time from harvest days 8 to 12. However, the levels of viral RNA present were higher and consistently stable (∼4.0 to ∼5.5 log copies/sample). Recirculated water maintained relatively high levels of infectious MNV over the period of harvest, from 3.54 to 2.73 log PFU/ml. Importantly, cross-contamination occurred easily; MNV remained infectious in previously contaminated hydroponic systems for up to 12 days (2.26 to 1.00 PFU/ml), and MNV was detected in both

  9. Pluripotent stem cells are protected from cytomegalovirus infection at multiple points: implications of a new pathogenesis for congenital anomaly caused by cytomegalovirus.

    Science.gov (United States)

    Kawasaki, Hideya

    2012-09-01

    In humans, the cytomegalovirus (CMV) is the most significant cause of intrauterine infections that cause congenital anomalies. Intrauterine infection with human CMV is thought to be responsible for a variety of abnormalities, including mental retardation, microcephaly, developmental delay, seizure disorders, and cerebral palsy, depending on the timing of the fetal infection, the infectious route, and the virulence of the virus. In addition to the adaptive immune system, the embryo has potential resistance to CMV during early embryogenesis. Embryonic stem (ES) cells are more resistant to CMV than most other cell types, although the mechanism responsible for this resistance is not well understood. ES cells allow approximately 20-fold less murine CMV (MCMV) DNA to enter the nucleus than mouse embryonic fibroblasts (MEFs), and this inhibition occurs in a multistep manner. In situ hybridization showed that ES cell nuclei had significantly less MCMV DNA than MEF nuclei. This finding appears to be supported by the fact that ES cells express less heparan sulfate, β1-integrin, and vimentin and have fewer nuclear pores than differentiated cells such as MEF. This may reduce the ability of MCMV to attach to and enter the cellular membrane, translocate to the nucleus, and cross the nuclear membrane in pluripotent stem cells (ES-induced pluripotent stem cells). This finding may indicate a new pathogenesis for the congenital anomaly caused by CMV. © 2012 The Author. Congenital Anomalies © 2012 Japanese Teratology Society.

  10. Maternal and fetal cytomegalovirus infection: diagnosis, management, and prevention [version 1; referees: 3 approved

    Directory of Open Access Journals (Sweden)

    Robert F. Pass

    2018-03-01

    Full Text Available Congenital cytomegalovirus infection is a major cause of central nervous system and sensory impairments that affect cognition, motor function, hearing, language development, vestibular function, and vision. Although the importance of congenital cytomegalovirus infection is readily evident, the vast majority of maternal and fetal infections are not identified, even in developed countries. Multiple studies of prenatal cytomegalovirus infections have produced a body of knowledge that can inform the clinical approach to suspected or proven maternal and fetal infection. Reliable diagnosis of cytomegalovirus infection during pregnancy and accurate diagnosis of fetal infection are a reality. Approaches to preventing the transmission of cytomegalovirus from mother to fetus and to the treatment of fetal infection are being studied. There is evidence that public health approaches based on hygiene can dramatically reduce the rate of primary maternal cytomegalovirus infections during pregnancy. This review will consider the epidemiology of congenital cytomegalovirus infection, the diagnosis and management of primary infection during pregnancy, and approaches to preventing maternal infection.

  11. Expression of the Wilms' tumor gene WT1 in the murine urogenital system.

    Science.gov (United States)

    Pelletier, J; Schalling, M; Buckler, A J; Rogers, A; Haber, D A; Housman, D

    1991-08-01

    The Wilms' tumor gene WT1 is a recessive oncogene that encodes a putative transcription factor implicated in nephrogenesis during kidney development. In this report we analyze expression of WT1 in the murine urogenital system. WT1 is expressed in non-germ-cell components of the testis and ovaries in both young and adult mice. In situ mRNA hybridization studies demonstrate that WT1 is expressed in the granulosa and epithelial cells of ovaries, the Sertoli cells of the testis, and in the uterine wall. In addition to the 3.1-kb WT1 transcript detected by Northern blotting of RNA from kidney, uterus, and gonads, there is an approximately 2.5-kb WT1-related mRNA species in testis. The levels of WT1 mRNA in the gonads are among the highest observed, surpassing amounts detected in the embryonic kidney. During development, these levels are differentially regulated, depending on the sexual differentiation of the gonad. Expression of WT1 mRNA in the female reproductive system does not fluctuate significantly from days 4 to 40 postpartum. In contrast, WT1 mRNA levels in the tesis increase steadily after birth, reaching their highest expression levels at day 8 postpartum and decreasing slightly as the animal matures. Expression of WT1 in the gonads is detectable as early as 12.5 days postcoitum (p.c.). As an initial step toward exploring the tissue-specific expression of WT1, DNA elements upstream of WT1 were cloned and sequenced. Three putative transcription initiation sites, utilized in testis, ovaries, and uterus, were mapped by S1 nuclease protection assays. The sequences surrounding these sites have a high G + C content, and typical upstream CCAAT and TATAA boxes are not present. These studies allowed us to identify the translation initiation site for WT1 protein synthesis. We have also used an epitope-tagging protocol to demonstrate that WT1 is a nuclear protein, consistent with its role as a transcription factor. Our results demonstrate regulation of WT1 expression

  12. Cytomegalovirus glycoprotein B genotyping in ocular fluids and blood of AIDS patients with cytomegalovirus retinitis

    NARCIS (Netherlands)

    Peek, R.; Verbraak, F.; Bruinenberg, M.; van der Lelij, A.; van den Horn, G.; Kijlstra, A.

    1998-01-01

    To determine the frequency of cytomegalovirus glycoprotein B (gB) genotypes in clinical samples of ocular fluids of patients with acquired immune deficiency syndrome (AIDS) who have cytomegalovirus retinitis and to compare these with the cytomegalovirus gB genotype in paired peripheral blood

  13. Sustained CD8+ T cell memory inflation after infection with a single-cycle cytomegalovirus.

    Directory of Open Access Journals (Sweden)

    Christopher M Snyder

    2011-10-01

    Full Text Available Cytomegalovirus (CMV is a β-herpesvirus that establishes a lifelong latent or persistent infection. A hallmark of chronic CMV infection is the lifelong persistence of large numbers of virus-specific CD8+ effector/effector memory T cells, a phenomenon called "memory inflation". How the virus continuously stimulates these T cells without being eradicated remains an enigma. The prevailing view is that CMV establishes a low grade "smoldering" infection characterized by tiny bursts of productive infection which are rapidly extinguished, leaving no detectable virus but replenishing the latent pool and leaving the immune system in a highly charged state. However, since abortive reactivation with limited viral gene expression is known to occur commonly, we investigated the necessity for virus reproduction in maintaining the inflationary T cell pool. We inhibited viral replication or spread in vivo using two different mutants of murine CMV (MCMV. First, famcyclovir blocked the replication of MCMV encoding the HSV Thymidine Kinase gene, but had no impact on the CD8+ T cell memory inflation once the infection was established. Second, MCMV that lacks the essential glycoprotein L, and thus is completely unable to spread from cell to cell, also drove memory inflation if the virus was administered systemically. Our data suggest that CMV which cannot spread from the cells it initially infects can repeatedly generate viral antigens to drive memory inflation without suffering eradication of the latent genome pool.

  14. Sustained CD8+ T cell memory inflation after infection with a single-cycle cytomegalovirus.

    Science.gov (United States)

    Snyder, Christopher M; Cho, Kathy S; Bonnett, Elizabeth L; Allan, Jane E; Hill, Ann B

    2011-10-01

    Cytomegalovirus (CMV) is a β-herpesvirus that establishes a lifelong latent or persistent infection. A hallmark of chronic CMV infection is the lifelong persistence of large numbers of virus-specific CD8+ effector/effector memory T cells, a phenomenon called "memory inflation". How the virus continuously stimulates these T cells without being eradicated remains an enigma. The prevailing view is that CMV establishes a low grade "smoldering" infection characterized by tiny bursts of productive infection which are rapidly extinguished, leaving no detectable virus but replenishing the latent pool and leaving the immune system in a highly charged state. However, since abortive reactivation with limited viral gene expression is known to occur commonly, we investigated the necessity for virus reproduction in maintaining the inflationary T cell pool. We inhibited viral replication or spread in vivo using two different mutants of murine CMV (MCMV). First, famcyclovir blocked the replication of MCMV encoding the HSV Thymidine Kinase gene, but had no impact on the CD8+ T cell memory inflation once the infection was established. Second, MCMV that lacks the essential glycoprotein L, and thus is completely unable to spread from cell to cell, also drove memory inflation if the virus was administered systemically. Our data suggest that CMV which cannot spread from the cells it initially infects can repeatedly generate viral antigens to drive memory inflation without suffering eradication of the latent genome pool.

  15. History of the molecular biology of cytomegaloviruses.

    Science.gov (United States)

    Stinski, Mark F

    2014-01-01

    The history of the molecular biology of cytomegaloviruses from the purification of the virus and the viral DNA to the cloning and expression of the viral genes is reviewed. A key genetic element of cytomegalovirus (the CMV promoter) contributed to our understanding of eukaryotic cell molecular biology and to the development of lifesaving therapeutic proteins. The study of the molecular biology of cytomegaloviruses also contributed to the development of antivirals to control the viral infection.

  16. Cytomegalovirus vaccines under clinical development

    OpenAIRE

    Schleiss, Mark R

    2016-01-01

    Abstract Congenital cytomegalovirus (CMV) infection is the most common infectious cause of disability in newborn infants. CMV also causes serious disease in solid organ (SOT) and haematopoietic stem cell transplant (HSCT) recipients. In otherwise healthy children and adults, primary CMV infection rarely causes illness. However, even asymptomatic CMV infections may predispose an individual towards an increased risk of atherosclerosis, cancer and immune senescence over the life course, although...

  17. Cytomegalovirus replicon-based regulation of gene expression in vitro and in vivo.

    Directory of Open Access Journals (Sweden)

    Hermine Mohr

    Full Text Available There is increasing evidence for a connection between DNA replication and the expression of adjacent genes. Therefore, this study addressed the question of whether a herpesvirus origin of replication can be used to activate or increase the expression of adjacent genes. Cell lines carrying an episomal vector, in which reporter genes are linked to the murine cytomegalovirus (MCMV origin of lytic replication (oriLyt, were constructed. Reporter gene expression was silenced by a histone-deacetylase-dependent mechanism, but was resolved upon lytic infection with MCMV. Replication of the episome was observed subsequent to infection, leading to the induction of gene expression by more than 1000-fold. oriLyt-based regulation thus provided a unique opportunity for virus-induced conditional gene expression without the need for an additional induction mechanism. This principle was exploited to show effective late trans-complementation of the toxic viral protein M50 and the glycoprotein gO of MCMV. Moreover, the application of this principle for intracellular immunization against herpesvirus infection was demonstrated. The results of the present study show that viral infection specifically activated the expression of a dominant-negative transgene, which inhibited viral growth. This conditional system was operative in explant cultures of transgenic mice, but not in vivo. Several applications are discussed.

  18. A microculture system for the measurement of antigen-induced murine lymphocyte proliferation: advantages of 5% horse serum and 5 X 10(-5) M mercaptoethanol.

    Science.gov (United States)

    Brummer, E; Vris, T W; Lawrence, H S

    1977-01-01

    Short term microculture systems which measure murine lymphocyte proliferative responses to mitogens are well established. We demonstrate here that these microculture methods are not suitable for antigen-induced responses because of the high levels of murine lymphocyte proliferation in control cultures associated with the use of fetal calf serum or human serum. We also show that this problem can be eliminated with the use of a combination of 5% horse serum and 5 X 10(-5) M mercaptoethanol. We describe an antigen-induced murine lymphocyte proliferation microculture system in which good stimulation indices are achieved and the lymphocyte proliferation in control cultures remain at a low level throughout the 7 day culture period.

  19. 21 CFR 866.3175 - Cytomegalovirus serological reagents.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Cytomegalovirus serological reagents. 866.3175... Cytomegalovirus serological reagents. (a) Identification. Cytomegalovirus serological reagents are devices that consist of antigens and antisera used in serological tests to identify antibodies to cytomegalovirus in...

  20. The Seroprevalence of Cytomegalovirus Antibodies among ...

    African Journals Online (AJOL)

    Background: Human cytomegalovirus, otherwise called human herpes virus type 5, is a significant cause of morbidity and mortality in pregnancy, and among immunocompromised patients like recipients of organ transplants. Cytomegalovirus is transmissible via blood transfusion, among other parenteral routes. This study ...

  1. Multi-walled carbon nanotubes: biodegradation by gastric agents in vitro and effect on murine intestinal system

    Science.gov (United States)

    Masyutin, A.; Erokhina, M.; Sychevskaya, K.; Gusev, A.; Vasyukova, I.; Smirnova, E.; Onishchenko, G.

    2015-11-01

    One of the main questions limiting application of fibrous carbon nanomaterials (CNM) in medicine and food industry concerns presumptive degradation of CNM in living organisms. In this study, we have investigated biodegradation of multi-walled carbon nanotubes (MWCNTs) by gastric agents in vitro and influence of ingested MWCNTs on murine intestine. Using scanning, conventional transmission and analytical electron microscopy, we demonstrated that industrial MWCNTs treated in vitro by 0.1 M hydrochloric acid (pH=1) and gastric juice (pH=2-3) isolated from murine stomach, are subjected to incomplete degradation. After 30 days of oral administration to experimental mice, we did find MWCNTs in the cells of small intestine, and it may indicate that agglomerates of MWCNTs do not penetrate into colon epithelia and do not accumulate in enterocytes. However, we observed local areas of necrotic damages of intestinal villi. It seems likely, therefore, that MWCNTs end up leaving gastrointestinal tract by excretion with the feces. Our results suggest that MWCNTs do not undergo complete degradation in gastrointestinal tract of mice, and passing through non-degraded particles may negatively affect intestinal system.

  2. Cytomegaloviruses use multiple mechanisms to elude the host immune response.

    Science.gov (United States)

    Wiertz, E; Hill, A; Tortorella, D; Ploegh, H

    1997-06-01

    The study of the effects of cytomegaloviruses on the MHC class I-restricted antigen presentation pathway has yielded an embarrassment of riches. The human cytomegalovirus (HCMV) encodes at least five to six different glycoproteins, each interfering in a different way with elimination of the virus by the host immune system. Most likely, it is the concerted action of these glycoproteins that allows HCMV to escape from elimination by the host immune system during acute and perhaps also persistent infection. Prime targets of these CMV glycoproteins are MHC class I glycoproteins: the very molecules that signal the presence of a virally infected cell to the immune system. Recently, several novel links in the multi-step process of immune evasion by HCMV have been discovered.

  3. Clinical and morphological characteristics of malformations in infants with congenital cytomegalovirus infection and congenital toxoplasmosis

    Directory of Open Access Journals (Sweden)

    L. Yu. Barycheva

    2015-01-01

    Full Text Available The results of following up infants with intrauterine infections and malformations were retrospectively analyzed. Infants with malformations were diagnosed as having congenital cytomegalovirus infection and congenital toxoplasmosis in 127 and 69 cases, respectively. The aim of the study was to characterize malformations in infants with congenital cytomegalovirus and congenital Toxoplasma infections. The infants with malformations in congenital cytomegalovirus infection were found to have higher mortality rates (61,4% than those with congenital toxoplasmosis (34,8%. Postmortem analysis indicated that there was a predominance of embryopathies in infants with congenital cytomegalovirus infection and that of fetopathies in those with congenital toxoplasmosis. The dead infants with congenital cytomegalovirus infection had more commonly developed visceral defects, including heart diseases, pneumopathies, gastrointestinal and genitourinary abnormalities; fetopathies of the central nervous system and eye were prevalent in congenital toxoplasmosis. The surviving children with congenital toxoplasmosis were more frequently observed to have disabling CNS and ocular sequels as obstructive hydrocephalus, infantile cerebral palsy, complete or partial blindness, and cerebrasthenic disorders than those with congenital cytomegalovirus infection. 

  4. Diverse immune evasion strategies by human cytomegalovirus.

    Science.gov (United States)

    Noriega, Vanessa; Redmann, Veronika; Gardner, Thomas; Tortorella, Domenico

    2012-12-01

    Members of the Herpesviridae family have the capacity to undergo both lytic and latent infection to establish a lifelong relationship with their host. Following primary infection, human cytomegalovirus (HCMV) can persist as a subclinical, recurrent infection for the lifetime of an individual. This quiescent portion of its life cycle is termed latency and is associated with periodic bouts of reactivation during times of immunosuppression, inflammation, or stress. In order to exist indefinitely and establish infection, HCMV encodes a multitude of immune modulatory mechanisms devoted to escaping the host antiviral response. HCMV has become a paradigm for studies of viral immune evasion of antigen presentation by both major histocompatibility complex (MHC) class I and II molecules. By restricting the presentation of viral antigens during both productive and latent infection, HCMV limits elimination by the human immune system. This review will focus on understanding how the virus manipulates the pathways of antigen presentation in order to modulate the host response to infection.

  5. Development of murine monoclonal antibodies for the immunohistochemical diagnosis of systemic bovine aspergillosis

    DEFF Research Database (Denmark)

    Jensen, H.E.; Aalbaek, B.; Lind, Peter

    1996-01-01

    Murine monoclonal antibodies (MAbs) against water-soluble somatic antigens (WSSA) and the wall fraction (WF) from Aspergillus fumigatus were produced by fusion of splenocytes from immunized BALB/c mice with mouse myeloma X63-Ag 8.653 cells. The supernatants of in vitro cultured hybridomas were...... techniques using formalin-fixed, paraffin-embedded tissues from experimentally infected mice. Because of a high immunohistochemical reactivity with homologous fungi, 4 MAbs raised against A. fumigatus WSSA and WF were selected for a further evaluation of cross-reactivity (diagnostic specificity......) in immunohistochemical and immunoblotting assays. In immunohistochemical assays, all MAbs raised against WSSA cross-reacted heavily with a number of other fungal species. All 4 MAbs (MAb-WF-AF-1-4) raised against the WF reacted strongly with hyphae of Aspergillus spp.; hyphae of Scedosporium apiospermum were also...

  6. Congenital Human Cytomegalovirus Infection and the Enigma of Maternal Immunity.

    Science.gov (United States)

    Britt, William J

    2017-08-01

    Human cytomegalovirus (HCMV) is the most common viral infection acquired by the developing human fetus and can result in damage to the developing central nervous system. Although vaccine development to modify this congenital infection is ongoing, the unique epidemiology of maternal HCMV infections appears discordant with strategies for vaccine development. Several characteristics of congenital HCMV infections suggest that the efficacy of vaccines designed to induce responses similar to those that follow natural infection will be limited. Copyright © 2017 American Society for Microbiology.

  7. Congenital Cytomegalovirus Infection: Clinical Outcome

    Science.gov (United States)

    Boppana, Suresh B.; Ross, Shannon A.; Fowler, Karen B.

    2013-01-01

    Congenital cytomegalovirus (CMV) infection is a leading cause of hearing loss and neurologic disabilities in children worldwide. Infants with symptomatic congenital CMV infection at birth are at significantly increased risk for developing adverse long-term outcomes. The vast majority of infants with congenital CMV infection have no clinical findings at birth (asymptomatic infants), and about 10%–15% of these children develop long-term sequelae. Currently, predictors of adverse outcome in asymptomatic congenital CMV infection are not known, and it is important that future studies address this issue. PMID:24257422

  8. Properties of virion transactivator proteins encoded by primate cytomegaloviruses

    Directory of Open Access Journals (Sweden)

    Barry Peter A

    2009-05-01

    Full Text Available Abstract Background Human cytomegalovirus (HCMV is a betaherpesvirus that causes severe disease in situations where the immune system is immature or compromised. HCMV immediate early (IE gene expression is stimulated by the virion phosphoprotein pp71, encoded by open reading frame (ORF UL82, and this transactivation activity is important for the efficient initiation of viral replication. It is currently recognized that pp71 acts to overcome cellular intrinsic defences that otherwise block viral IE gene expression, and that interactions of pp71 with the cell proteins Daxx and ATRX are important for this function. A further property of pp71 is the ability to enable prolonged gene expression from quiescent herpes simplex virus type 1 (HSV-1 genomes. Non-human primate cytomegaloviruses encode homologs of pp71, but there is currently no published information that addresses their effects on gene expression and modes of action. Results The UL82 homolog encoded by simian cytomegalovirus (SCMV, strain Colburn, was identified and cloned. This ORF, named S82, was cloned into an HSV-1 vector, as were those from baboon, rhesus monkey and chimpanzee cytomegaloviruses. The use of an HSV-1 vector enabled expression of the UL82 homologs in a range of cell types, and permitted investigation of their abilities to direct prolonged gene expression from quiescent genomes. The results show that all UL82 homologs activate gene expression, and that neither host cell type nor promoter target sequence has major effects on these activities. Surprisingly, the UL82 proteins specified by non-human primate cytomegaloviruses, unlike pp71, did not direct long term expression from quiescent HSV-1 genomes. In addition, significant differences were observed in the intranuclear localization of the UL82 homologs, and in their effects on Daxx. Strikingly, S82 mediated the release of Daxx from nuclear domain 10 substructures much more rapidly than pp71 or the other proteins tested. All

  9. Generation of murine tumor cell lines deficient in MHC molecule surface expression using the CRISPR/Cas9 system.

    Science.gov (United States)

    Das, Krishna; Eisel, David; Lenkl, Clarissa; Goyal, Ashish; Diederichs, Sven; Dickes, Elke; Osen, Wolfram; Eichmüller, Stefan B

    2017-01-01

    In this study, the CRISPR/Cas9 technology was used to establish murine tumor cell lines, devoid of MHC I or MHC II surface expression, respectively. The melanoma cell line B16F10 and the murine breast cancer cell line EO-771, the latter stably expressing the tumor antigen NY-BR-1 (EO-NY), were transfected with an expression plasmid encoding a β2m-specific single guide (sg)RNA and Cas9. The resulting MHC I negative cells were sorted by flow cytometry to obtain single cell clones, and loss of susceptibility of peptide pulsed MHC I negative clones to peptide-specific CTL recognition was determined by IFNγ ELISpot assay. The β2m knockout (KO) clones did not give rise to tumors in syngeneic mice (C57BL/6N), unless NK cells were depleted, suggesting that outgrowth of the β2m KO cell lines was controlled by NK cells. Using sgRNAs targeting the β-chain encoding locus of the IAb molecule we also generated several B16F10 MHC II KO clones. Peptide loaded B16F10 MHC II KO cells were insusceptible to recognition by OT-II cells and tumor growth was unaltered compared to parental B16F10 cells. Thus, in our hands the CRISPR/Cas9 system has proven to be an efficient straight forward strategy for the generation of MHC knockout cell lines. Such cell lines could serve as parental cells for co-transfection of compatible HLA alleles together with human tumor antigens of interest, thereby facilitating the generation of HLA matched transplantable tumor models, e.g. in HLAtg mouse strains of the newer generation, lacking cell surface expression of endogenous H2 molecules. In addition, our tumor cell lines established might offer a useful tool to investigate tumor reactive T cell responses that function independently from MHC molecule surface expression by the tumor.

  10. Generation of murine tumor cell lines deficient in MHC molecule surface expression using the CRISPR/Cas9 system.

    Directory of Open Access Journals (Sweden)

    Krishna Das

    Full Text Available In this study, the CRISPR/Cas9 technology was used to establish murine tumor cell lines, devoid of MHC I or MHC II surface expression, respectively. The melanoma cell line B16F10 and the murine breast cancer cell line EO-771, the latter stably expressing the tumor antigen NY-BR-1 (EO-NY, were transfected with an expression plasmid encoding a β2m-specific single guide (sgRNA and Cas9. The resulting MHC I negative cells were sorted by flow cytometry to obtain single cell clones, and loss of susceptibility of peptide pulsed MHC I negative clones to peptide-specific CTL recognition was determined by IFNγ ELISpot assay. The β2m knockout (KO clones did not give rise to tumors in syngeneic mice (C57BL/6N, unless NK cells were depleted, suggesting that outgrowth of the β2m KO cell lines was controlled by NK cells. Using sgRNAs targeting the β-chain encoding locus of the IAb molecule we also generated several B16F10 MHC II KO clones. Peptide loaded B16F10 MHC II KO cells were insusceptible to recognition by OT-II cells and tumor growth was unaltered compared to parental B16F10 cells. Thus, in our hands the CRISPR/Cas9 system has proven to be an efficient straight forward strategy for the generation of MHC knockout cell lines. Such cell lines could serve as parental cells for co-transfection of compatible HLA alleles together with human tumor antigens of interest, thereby facilitating the generation of HLA matched transplantable tumor models, e.g. in HLAtg mouse strains of the newer generation, lacking cell surface expression of endogenous H2 molecules. In addition, our tumor cell lines established might offer a useful tool to investigate tumor reactive T cell responses that function independently from MHC molecule surface expression by the tumor.

  11. Cytomegalovirus Infection and Pre-Eclampsia

    Directory of Open Access Journals (Sweden)

    Rădulescu Carmen

    2016-06-01

    Full Text Available Introduction: Pre-eclampsia is a pregnancy-specific disease characterized by hypertension after 20 weeks of gestation and proteinuria. It is a major cause of maternal and perinatal morbidity and mortality. The pathogenesis of pre-eclampsia is not completely understood. In our study we investigated if there is a potential link between cytomegalovirus infection and pre-eclampsia and if cytomegalovirus infection is the triggering factor of pre-eclampsia.

  12. Prevalence of cytomegalovirus antibodies in blood donars at the ...

    African Journals Online (AJOL)

    Background: Cytomegalovirus (CMV) infection in susceptible patients is associated with serious morbidity and a high mortality. Transmission of cytomegalovirus infection through blood transfusion is markedly reduced by transfusion of CMV seronegative blood products, or by transfusion of leucodepleted blood products.

  13. Congenital cytomegalovirus infection: Clinical presentation, epidemiology, diagnosis and prevention.

    Science.gov (United States)

    van Zuylen, Wendy J; Hamilton, Stuart T; Naing, Zin; Hall, Beverly; Shand, Antonia; Rawlinson, William D

    2014-12-01

    Cytomegalovirus is the most common congenital infection causing serious disease in infants. It is the leading infectious cause of sensorineural hearing loss and neurodevelopmental disability in developed countries. Despite the clinical importance of congenital cytomegalovirus, surveys show there is limited awareness and knowledge in the medical and general community about congenital cytomegalovirus infection. This article reviews the clinical features, global epidemiology, transmission and risk factors for cytomegalovirus infections. It also highlights several major advances made in recent years in the diagnosis and prevention of cytomegalovirus infection during pregnancy. Although research is ongoing, no therapy is currently proven to prevent or treat maternal, fetal or neonatal cytomegalovirus infection. Education of women regarding hygiene measures can help prevent cytomegalovirus infection and are currently the best strategy to prevent congenital cytomegalovirus disease.

  14. Outcome of Preterm Infants With Postnatal Cytomegalovirus Infection

    NARCIS (Netherlands)

    Gunkel, Julia; De Vries, Linda S.; Jongmans, Marian; Koopman-Esseboom, Corine; van Haastert, Ingrid C; Eijsermans, Maria C J; van Stam, Carolien; van Zanten, Bert G A; Wolfs, Tom F W; Nijman, Joppe

    OBJECTIVES: To assess whether preterm infants with postnatal cytomegalovirus infection develop neurologic sequelae in early childhood. METHODS: Infants <32 weeks' gestation were prospectively screened for cytomegalovirus (CMV) at term-equivalent age. Neurodevelopment was compared between

  15. Congenital cytomegalovirus infection: Clinical presentation, epidemiology, diagnosis and prevention

    Science.gov (United States)

    van Zuylen, Wendy J; Hamilton, Stuart T; Naing, Zin; Hall, Beverly; Shand, Antonia

    2014-01-01

    Cytomegalovirus is the most common congenital infection causing serious disease in infants. It is the leading infectious cause of sensorineural hearing loss and neurodevelopmental disability in developed countries. Despite the clinical importance of congenital cytomegalovirus, surveys show there is limited awareness and knowledge in the medical and general community about congenital cytomegalovirus infection. This article reviews the clinical features, global epidemiology, transmission and risk factors for cytomegalovirus infections. It also highlights several major advances made in recent years in the diagnosis and prevention of cytomegalovirus infection during pregnancy. Although research is ongoing, no therapy is currently proven to prevent or treat maternal, fetal or neonatal cytomegalovirus infection. Education of women regarding hygiene measures can help prevent cytomegalovirus infection and are currently the best strategy to prevent congenital cytomegalovirus disease. PMID:27512442

  16. The role of interleukin-6 in pulmonary and systemic manifestations in a murine model of chronic obstructive pulmonary disease.

    Science.gov (United States)

    Pauwels, Nele S; Bracke, Ken R; Maes, Tania; Pilette, Charles; Joos, Guy F; Brusselle, Guy G

    2010-10-01

    Chronic obstructive pulmonary disease (COPD) is characterized by pulmonary and extrapulmonary manifestations including systemic inflammation and weight loss. Increased levels of interleukin-6 (IL-6) have been demonstrated in sputum and serum of COPD patients. Therefore, the authors investigated the in vivo role of IL-6 in a murine model of COPD. Wild-type (WT) and IL-6 knockout (KO) mice were exposed subacutely (4 weeks) and chronically (24 weeks) to air or cigarette smoke (CS). Subacute and chronic CS exposure significantly increased pulmonary IL-6 mRNA expression in lung tissue and IL-6 protein levels in bronchoalveolar lavage fluid of WT mice. However, CS-induced accumulation of inflammatory cells at both time points and lymphoid aggregate formation upon chronic CS exposure were independent of IL-6. Chonic CS exposure was associated with a significant failure to gain weight in both WT mice and IL-6 KO mice. Remarkably, air-exposed IL-6 KO mice have lower body weight, serum leptin levels, and adipose tissue mass compared to air-exposed WT mice. In conclusion, IL-6 is of minor importance in CS-induced pulmonary and systemic manifestations in mice, but this study confirms the role for IL-6 as regulator of body weight and body composition.

  17. Amla Enhances Mitochondrial Spare Respiratory Capacity by Increasing Mitochondrial Biogenesis and Antioxidant Systems in a Murine Skeletal Muscle Cell Line

    Directory of Open Access Journals (Sweden)

    Hirotaka Yamamoto

    2016-01-01

    Full Text Available Amla is one of the most important plants in Indian traditional medicine and has been shown to improve various age-related disorders while decreasing oxidative stress. Mitochondrial dysfunction is a proposed cause of aging through elevated oxidative stress. In this study, we investigated the effects of Amla on mitochondrial function in C2C12 myotubes, a murine skeletal muscle cell model with abundant mitochondria. Based on cell flux analysis, treatment with an extract of Amla fruit enhanced mitochondrial spare respiratory capacity, which enables cells to overcome various stresses. To further explore the mechanisms underlying these effects on mitochondrial function, we analyzed mitochondrial biogenesis and antioxidant systems, both proposed regulators of mitochondrial spare respiratory capacity. We found that Amla treatment stimulated both systems accompanied by AMPK and Nrf2 activation. Furthermore, we found that Amla treatment exhibited cytoprotective effects and lowered reactive oxygen species (ROS levels in cells subjected to t-BHP-induced oxidative stress. These effects were accompanied by increased oxygen consumption, suggesting that Amla protected cells against oxidative stress by using enhanced spare respiratory capacity to produce more energy. Thus we identified protective effects of Amla, involving activation of mitochondrial function, which potentially explain its various effects on age-related disorders.

  18. Cytomegalovirus

    Science.gov (United States)

    ... headache fatigue weakness muscle aches loss of appetite. Newborns infected with CMV while in the womb can be very sick ... mental disability. However, only a small percentage of newborns infected with CMV during pregnancy experience problems from the virus. Most ...

  19. Elusive Role of the CD94/NKG2C NK Cell Receptor in the Response to Cytomegalovirus: Novel Experimental Observations in a Reporter Cell System

    Directory of Open Access Journals (Sweden)

    Aldi Pupuleku

    2017-10-01

    Full Text Available Human cytomegalovirus (HCMV infection promotes the differentiation and persistent expansion of a mature NK cell subset, which displays high surface levels of the activating CD94/NKG2C NK cell receptor, together with additional distinctive phenotypic and functional features. The mechanisms underlying the development of adaptive NK cells remain uncertain but some observations support the involvement of a cognate interaction of CD94/NKG2C with ligand(s displayed by HCMV-infected cells. To approach this issue, the heterodimer and its adaptor (DAP12 were expressed in the human Jurkat leukemia T cell line; signaling was detected by transfection of a reporter plasmid encoding for Luciferase (Luc under NFAT/AP1-dependent control. Engagement of the receptor by solid-phase bound CD94- or NKG2C-specific monoclonal antibodies (mAbs triggered Luc expression. Moreover, reporter activation was detectable upon interaction with HLA-E+ 721.221 (.221-AEH cells, as well as with 721.221 cells incubated with synthetic peptides, which stabilized surface expression of endogenous HLA-E; the response was specifically antagonized by soluble NKG2C- and HLA-E-specific mAbs. By contrast, activation of Jurkat-NKG2C+ was undetectable upon interaction with Human Fetal Foreskin Fibroblasts (HFFF infected with HCMV laboratory strains (i.e., AD169, Towne, regardless of their differential ability to preserve surface HLA-E expression. On the other hand, infection with two clinical isolates or with the endotheliotropic TB40/E strain triggered Jurkat-NKG2C+ activation; yet, this response was not inhibited by blocking mAbs and was independent of CD94/NKG2C expression. The results are discussed in the framework of previous observations supporting the hypothetical existence of specific ligand(s for CD94/NKG2C in HCMV-infected cells.

  20. Inhibition of Human Cytomegalovirus pUL89 Terminase Subunit Blocks Virus Replication and Genome Cleavage.

    Science.gov (United States)

    Wang, Yan; Mao, Lili; Kankanala, Jayakanth; Wang, Zhengqiang; Geraghty, Robert J

    2017-02-01

    The human cytomegalovirus terminase complex cleaves concatemeric genomic DNA into unit lengths during genome packaging and particle assembly. This process is an attractive drug target because cleavage of concatemeric DNA is not required in mammalian cell DNA replication, indicating that drugs targeting the terminase complex could be safe and selective. One component of the human cytomegalovirus terminase complex, pUL89, provides the endonucleolytic activity for genome cleavage, and the domain responsible is reported to have an RNase H-like fold. We hypothesize that the pUL89 endonuclease activity is inhibited by known RNase H inhibitors. Using a novel enzyme-linked immunosorbent assay (ELISA) format as a screening assay, we found that a hydroxypyridonecarboxylic acid compound, previously reported to be an inhibitor of human immunodeficiency virus RNase H, inhibited pUL89 endonuclease activity at low-micromolar concentrations. Further characterization revealed that this pUL89 endonuclease inhibitor blocked human cytomegalovirus replication at a relatively late time point, similarly to other reported terminase complex inhibitors. Importantly, this inhibitor also prevented the cleavage of viral genomic DNA in infected cells. Taken together, these results substantiate our pharmacophore hypothesis and validate our ligand-based approach toward identifying novel inhibitors of pUL89 endonuclease. Human cytomegalovirus infection in individuals lacking a fully functioning immune system, such as newborns and transplant patients, can have severe and debilitating consequences. The U.S. Food and Drug Administration-approved anti-human cytomegalovirus drugs mainly target the viral polymerase, and resistance to these drugs has appeared. Therefore, anti-human cytomegalovirus drugs from novel targets are needed for use instead of, or in combination with, current polymerase inhibitors. pUL89 is a viral ATPase and endonuclease and is an attractive target for anti-human cytomegalovirus

  1. Type I Interferon Receptor Deficiency in Dendritic Cells Facilitates Systemic Murine Norovirus Persistence Despite Enhanced Adaptive Immunity.

    Science.gov (United States)

    Nice, Timothy J; Osborne, Lisa C; Tomov, Vesselin T; Artis, David; Wherry, E John; Virgin, Herbert W

    2016-06-01

    In order for a virus to persist, there must be a balance between viral replication and immune clearance. It is commonly believed that adaptive immunity drives clearance of viral infections and, thus, dysfunction or viral evasion of adaptive immunity is required for a virus to persist. Type I interferons (IFNs) play pleiotropic roles in the antiviral response, including through innate control of viral replication. Murine norovirus (MNoV) replicates in dendritic cells (DCs) and type I IFN signaling in DCs is important for early control of MNoV replication. We show here that the non-persistent MNoV strain CW3 persists systemically when CD11c positive DCs are unable to respond to type I IFN. Persistence in this setting is associated with increased early viral titers, maintenance of DC numbers, increased expression of DC activation markers and an increase in CD8 T cell and antibody responses. Furthermore, CD8 T cell function is maintained during the persistent phase of infection and adaptive immune cells from persistently infected mice are functional when transferred to Rag1-/- recipients. Finally, increased early replication and persistence are also observed in mixed bone marrow chimeras where only half of the CD11c positive DCs are unable to respond to type I IFN. These findings demonstrate that increased early viral replication due to a cell-intrinsic innate immune deficiency is sufficient for persistence and a functional adaptive immune response is not sufficient for viral clearance.

  2. Type I Interferon Receptor Deficiency in Dendritic Cells Facilitates Systemic Murine Norovirus Persistence Despite Enhanced Adaptive Immunity.

    Directory of Open Access Journals (Sweden)

    Timothy J Nice

    2016-06-01

    Full Text Available In order for a virus to persist, there must be a balance between viral replication and immune clearance. It is commonly believed that adaptive immunity drives clearance of viral infections and, thus, dysfunction or viral evasion of adaptive immunity is required for a virus to persist. Type I interferons (IFNs play pleiotropic roles in the antiviral response, including through innate control of viral replication. Murine norovirus (MNoV replicates in dendritic cells (DCs and type I IFN signaling in DCs is important for early control of MNoV replication. We show here that the non-persistent MNoV strain CW3 persists systemically when CD11c positive DCs are unable to respond to type I IFN. Persistence in this setting is associated with increased early viral titers, maintenance of DC numbers, increased expression of DC activation markers and an increase in CD8 T cell and antibody responses. Furthermore, CD8 T cell function is maintained during the persistent phase of infection and adaptive immune cells from persistently infected mice are functional when transferred to Rag1-/- recipients. Finally, increased early replication and persistence are also observed in mixed bone marrow chimeras where only half of the CD11c positive DCs are unable to respond to type I IFN. These findings demonstrate that increased early viral replication due to a cell-intrinsic innate immune deficiency is sufficient for persistence and a functional adaptive immune response is not sufficient for viral clearance.

  3. Preemptive CD8 T-Cell Immunotherapy of Acute Cytomegalovirus Infection Prevents Lethal Disease, Limits the Burden of Latent Viral Genomes, and Reduces the Risk of Virus Recurrence

    OpenAIRE

    Steffens, Hans-Peter; Kurz, Sabine; Holtappels, Rafaela; Reddehase, Matthias J.

    1998-01-01

    In the immunocompetent host, primary cytomegalovirus (CMV) infection is resolved by the immune response without causing overt disease. The viral genome, however, is not cleared but is maintained in a latent state that entails a risk of virus recurrence and consequent organ disease. By using murine CMV as a model, we have shown previously that multiple organs harbor latent CMV and that reactivation occurs with an incidence that is determined by the viral DNA load in the respective organ (M. J....

  4. Poly-N-acetylglucosamine production in Staphylococcus aureus is essential for virulence in murine models of systemic infection.

    Science.gov (United States)

    Kropec, Andrea; Maira-Litran, Tomas; Jefferson, Kimberly K; Grout, Martha; Cramton, Sarah E; Götz, Friedrich; Goldmann, Donald A; Pier, Gerald B

    2005-10-01

    The contribution of the Staphylococcus aureus surface polysaccharide poly-N-acetylglucosamine (PNAG) to virulence was evaluated in three mouse models of systemic infection: bacteremia, renal abscess formation, and lethality following high-dose intraperitoneal (i.p.) infection. Deletion of the intercellular adhesin (ica) locus that encodes the biosynthetic enzymes for PNAG production in S. aureus strains Mn8, Newman, and NCTC 10833 resulted in mutant strains with significantly reduced abilities to maintain bacterial levels in blood following intravenous or i.p. injection, to spread systemically to the kidneys following i.p. injection, or to induce a moribund/lethal state following i.p. infection. In the bacteremia model, neither growth phase nor growth medium used to prepare the S. aureus inoculum affected the conclusion that PNAG production was needed for full virulence. As the SarA regulatory protein has been shown to affect ica transcription, PNAG synthesis, and biofilm formation, we also evaluated S. aureus strains Mn8 and 10833 deleted for the sarA gene in the renal infection model. A decrease in PNAG production was seen in sarA mutants using immunoblots of cell surface extracts but was insufficient to reduce the virulence of sarA-deleted strains in this model. S. aureus strains deleted for the ica genes were much more susceptible to antibody-independent opsonic killing involving human peripheral blood leukocytes and rabbit complement. Thus, PNAG confers on S. aureus resistance to killing mediated by these innate host immune mediators. Overall, PNAG production by S. aureus appears to be a critical virulence factor as assessed in murine models of systemic infection.

  5. Cytomegalovirus immune evasion of myeloid lineage cells.

    Science.gov (United States)

    Brinkmann, Melanie M; Dağ, Franziska; Hengel, Hartmut; Messerle, Martin; Kalinke, Ulrich; Čičin-Šain, Luka

    2015-06-01

    Cytomegalovirus (CMV) evades the immune system in many different ways, allowing the virus to grow and its progeny to spread in the face of an adverse environment. Mounting evidence about the antiviral role of myeloid immune cells has prompted the research of CMV immune evasion mechanisms targeting these cells. Several cells of the myeloid lineage, such as monocytes, dendritic cells and macrophages, play a role in viral control, but are also permissive for CMV and are naturally infected by it. Therefore, CMV evasion of myeloid cells involves mechanisms that qualitatively differ from the evasion of non-CMV-permissive immune cells of the lymphoid lineage. The evasion of myeloid cells includes effects in cis, where the virus modulates the immune signaling pathways within the infected myeloid cell, and those in trans, where the virus affects somatic cells targeted by cytokines released from myeloid cells. This review presents an overview of CMV strategies to modulate and evade the antiviral activity of myeloid cells in cis and in trans.

  6. Human cytomegalovirus immunity and immune evasion.

    Science.gov (United States)

    Jackson, Sarah E; Mason, Gavin M; Wills, Mark R

    2011-05-01

    Human cytomegalovirus (HCMV) infection induces both innate immune responses including Natural Killer cells as well as adaptive humoral and cell mediated (CD4+ helper, CD8+ cytotoxic and γδ T cell) responses which lead to the resolution of acute primary infection. Despite such a robust primary immune response, HCMV is still able to establish latency. Long term memory T cell responses are maintained at high frequency and are thought to prevent clinical disease following periodic reactivation of the virus. As such, a balance is established between the immune response and viral reactivation. Loss of this balance in the immunocompromised host can lead to unchecked viral replication following reactivation of latent virus, with consequent disease and mortality. HCMV encodes multiple immune evasion mechanisms that target both the innate and acquired immune system. This article describes the current understanding of Natural killer cell, antibody and T cell mediated immune responses and the mechanisms that the virus utilizes to subvert these responses. Copyright © 2010 Elsevier B.V. All rights reserved.

  7. Optimization of a murine and human tissue model to recapitulate dermal and pulmonary features of systemic sclerosis.

    Directory of Open Access Journals (Sweden)

    Tomoya Watanabe

    Full Text Available The murine bleomycin (BLM-induced fibrosis model is the most widely used in systemic sclerosis (SSc studies. It has been reported that systemic delivery of BLM via continuous diffusion from subcutaneously implanted osmotic minipumps can cause fibrosis of the skin, lungs, and other internal organs. However, the mouse strain, dosage of BLM, administration period, and additional important features differ from one report to the next. In this study, by employing the pump model in C57BL/6J mice, we show a dose-dependent increase in lung fibrosis by day 28 and a transient increase in dermal thickness. Dermal thickness and the level of collagen in skin treated with high-dose BLM was significantly higher than in skin treated with low dose BLM or vehicle. A reduction in the thickness of the adipose layer was noted in both high and low dose groups at earlier time points suggesting that the loss of the fat layer precedes the onset of fibrosis. High-dose BLM also induced dermal fibrosis and increased expression of fibrosis-associated genes ex vivo in human skin, thus confirming and extending the in vivo findings, and demonstrating that a human organ culture model can be used to assess the effect of BLM on skin. In summary, our findings suggest that the BLM pump model is an attractive model to analyze the underlying mechanisms of fibrosis and test the efficacy of potential therapies. However, the choice of mouse strain, duration of BLM administration and dose must be carefully considered when using this model.

  8. Differential susceptibility of RAE-1 isoforms to mouse cytomegalovirus.

    Science.gov (United States)

    Arapovic, Jurica; Lenac, Tihana; Antulov, Ronald; Polic, Bojan; Ruzsics, Zsolt; Carayannopoulos, Leonidas N; Koszinowski, Ulrich H; Krmpotic, Astrid; Jonjic, Stipan

    2009-08-01

    The NKG2D receptor is one of the most potent activating natural killer cell receptors involved in antiviral responses. The mouse NKG2D ligands MULT-1, RAE-1, and H60 are regulated by murine cytomegalovirus (MCMV) proteins m145, m152, and m155, respectively. In addition, the m138 protein interferes with the expression of both MULT-1 and H60. We show here that one of five RAE-1 isoforms, RAE-1delta, is resistant to downregulation by MCMV and that this escape has functional importance in vivo. Although m152 retained newly synthesized RAE-1delta and RAE-1gamma in the endoplasmic reticulum, no viral regulator was able to affect the mature RAE-1delta form which remains expressed on the surfaces of infected cells. This differential susceptibility to downregulation by MCMV is not a consequence of faster maturation of RAE-1delta compared to RAE-1gamma but rather an intrinsic property of the mature surface-resident protein. This difference can be attributed to the absence of a PLWY motif from RAE-1delta. Altogether, these findings provide evidence for a novel mechanism of host escape from viral immunoevasion of NKG2D-dependent control.

  9. An in vivo transfection system for inducible gene expression and gene silencing in murine hepatocytes.

    Science.gov (United States)

    Hubner, Eric K; Lechler, Christian; Kohnke-Ertel, Birgit; Zmoos, Anne-Flore; Sage, Julien; Schmid, Roland M; Ehmer, Ursula

    2017-01-01

    Hydrodynamic tail vein injection (HTVI) of transposon-based integration vectors is an established system for stably transfecting mouse hepatocytes in vivo that has been successfully employed to study key questions in liver biology and cancer. Refining the vectors for transposon-mediated hepatocyte transfection will further expand the range of applications of this technique in liver research. In the present study, we report an advanced transposon-based system for manipulating gene expression in hepatocytes in vivo. Transposon-based vector constructs were generated to enable the constitutive expression of inducible Cre recombinase (CreER) together with tetracycline-inducible transgene or miR-small hairpin RNA (shRNA) expression (Tet-ON system). Transposon and transposase expression vectors were co-injected into R26R-mTmG reporter mice by HTVI. Cre-mediated gene recombination was induced by tamoxifen, followed by the administration of doxycycline to drive tetracycline-inducible gene or shRNA expression. Expression was visualized by immunofluorescence staining in livers of injected mice. After HTVI, Cre recombination by tamoxifen led to the expression of membrane-bound green fluorescent protein in transfected hepatocytes. Activation of inducible gene or shRNA expression was detected by immunostaining in up to one-third of transfected hepatocytes, with an efficiency dependent on the promoter driving the Tet-ON system. Our vector system combines Cre-lox mediated gene mutation with inducible gene expression or gene knockdown, respectively. It provides the opportunity for rapid and specific modification of hepatocyte gene expression and can be a useful tool for genetic screening approaches and analysis of target genes specifically in genetically engineered mouse models. Copyright © 2016 John Wiley & Sons, Ltd.

  10. Population dynamics of the murine lymphokine activated killer system: precursor frequency and kinetics of maturation and renewal.

    Science.gov (United States)

    Owen-Schaub, L B; Hemstreet, G P; Hemingway, L L; Abraham, S R; DeBault, L E

    1987-11-01

    The proliferation kinetics and population renewal of recombinant interleukin-2 (rIL-2)-induced murine lymphokine activated killers (LAK) arising from splenic precursors was studied. Extensive proliferation has been shown to accompany the de novo generation of LAK cytotoxicity. In this report, a thymidine 'hot pulse' suicide technique was employed to examine the sensitivity of LAK progenitors during various time periods following culture initiation. Hot pulse during the first 24 hr of culture resulted in a 30-35% reduction in lytic activity when assayed on day 5. Pulse periods between days 1 and 4 resulted in almost complete inhibition (90-95%) of lytic function when assayed on day 5. Proliferation of LAK progenitors was documented by limiting dilution analysis comparison of splenic precursors and functionally mature LAK cultures. These studies showed a 75- to 80-fold enrichment of LAK progenitors after 3 days culture in rIL-2. By flow cytometric cell cycle analysis, we demonstrated that the number of cells in the S/G2/M phase increased with the length of rIL-2 culture and represented approximately 40% of the cells by day 4. Finally, we used the rate of decay of lytic activity following irradiation as a factor to define the mean life span of a cytotoxic effector in the absence of cellular input. An exponential decrease to approximately 50% of controls was observed within 8-9 hr after irradiation. Taken together, these results suggest that the LAK system is highly dynamic and requires continuous cellular proliferation for its maintenance.

  11. Immune evasion by cytomegalovirus--survival strategies of a highly adapted opportunist.

    Science.gov (United States)

    Hengel, H; Brune, W; Koszinowski, U H

    1998-05-01

    Slowly replicating, species-specific and complex DNA viruses, such as cytomegaloviruses (CMVs), which code for > 200 antigenic proteins, should be easy prey to the host's immune system. Yet, CMVs are amazingly adapted opportunists that cope with multiple immune responses. Frequently, CMVs exploit immune mechanisms generated by the host. These strategies secure the persistence of CMVs and provide opportunities to spread to naive individuals.

  12. Cytomegalovirus protease targeted prodrug development.

    Science.gov (United States)

    Sabit, Hairat; Dahan, Arik; Sun, Jing; Provoda, Chester J; Lee, Kyung-Dall; Hilfinger, John H; Amidon, Gordon L

    2013-04-01

    Human cytomegalovirus (HCMV) is a prevalent virus that infects up to 90% of the population. The goal of this research is to determine if small molecular prodrug substrates can be developed for a specific HCMV encoded protease and thus achieve site-specific activation. HCMV encodes a 256 amino acid serine protease that is responsible for capsid assembly, an essential process for herpes virus production. The esterase activity of the more stable HCMV A143T/A144T protease mutant was evaluated with model p-nitrophenol (ONp) esters, Boc-Xaa-ONp (Ala, Leu, Ile, Val, Gln, Phe at the Xaa position). We demonstrate that the A143T/A144T mutant has esterase activity toward specific small ester compounds, e.g., Boc-L-Ala-ONp. Mono amino acid and dipeptide prodrugs of ganciclovir (GCV) were also synthesized and evaluated for hydrolysis by the A143T/A144T protease mutant in solution. Hydrolysis of these prodrugs was also evaluated in Caco-2 cell homogenates, human liver microsomes (HLMs), and rat and human plasma. For the selectivity potential of the prodrugs, the hydrolysis ratio was evaluated as a percentage of prodrug hydrolyzed by the HCMV protease over the percentages of prodrug hydrolyses by Caco-2 cell homogenates, HLMs, and human/rat plasma. A dipeptide prodrug of ganciclovir, Ac-l-Gln-l-Ala-GCV, emerged as a potential selective prodrug candidate. The results of this research demonstrate that targeting prodrugs for activation by a specific protease encoded by the infectious HCMV pathogen may be achievable.

  13. Rapid, computer vision-enabled murine screening system identifies neuropharmacological potential of two new mechanisms

    Directory of Open Access Journals (Sweden)

    Steven L Roberds

    2011-09-01

    Full Text Available The lack of predictive in vitro models for behavioral phenotypes impedes rapid advancement in neuropharmacology and psychopharmacology. In vivo behavioral assays are more predictive of activity in human disorders, but such assays are often highly resource-intensive. Here we describe the successful application of a computer vision-enabled system to identify potential neuropharmacological activity of two new mechanisms. The analytical system was trained using multiple drugs that are used clinically to treat depression, schizophrenia, anxiety, and other psychiatric or behavioral disorders. During blinded testing the PDE10 inhibitor TP-10 produced a signature of activity suggesting potential antipsychotic activity. This finding is consistent with TP-10’s activity in multiple rodent models that is similar to that of clinically used antipsychotic drugs. The CK1ε inhibitor PF-670462 produced a signature consistent with anxiolytic activity and, at the highest dose tested, behavioral effects similar to that of opiate analgesics. Neither TP-10 nor PF-670462 was included in the training set. Thus, computer vision-based behavioral analysis can facilitate drug discovery by identifying neuropharmacological effects of compounds acting through new mechanisms.

  14. CD36 is involved in oleic acid detection by the murine olfactory system.

    Directory of Open Access Journals (Sweden)

    Sonja eOberland

    2015-09-01

    Full Text Available Olfactory signals influence food intake in a variety of species. To maximize the chances of finding a source of calories, an animal’s preference for fatty foods and triglycerides already becomes apparent during olfactory food search behavior. However, the molecular identity of both receptors and ligands mediating olfactory-dependent fatty acid recognition are, so far, undescribed. We here describe that a subset of olfactory sensory neurons expresses the fatty acid receptor CD36 and demonstrate a receptor-like localization of CD36 in olfactory cilia by STED microscopy. CD36-positive olfactory neurons share olfaction-specific transduction elements and project to numerous glomeruli in the ventral olfactory bulb. In accordance with the described roles of CD36 as fatty acid receptor or co-receptor in other sensory systems, the number of olfactory neurons responding to oleic acid, a major milk component, in Ca2+ imaging experiments is drastically reduced in young CD36 knock-out mice. Strikingly, we also observe marked age-dependent changes in CD36 localization, which is prominently present in the ciliary compartment only during the suckling period. Our results support the involvement of CD36 in fatty acid detection by the mammalian olfactory system.

  15. Dose-response study of thimerosal-induced murine systemic autoimmunity

    International Nuclear Information System (INIS)

    Havarinasab, S.; Lambertsson, L.; Qvarnstroem, J.; Hultman, P.

    2004-01-01

    The organic compound ethylmercurithiosalicylate (thimerosal), which is primarily present in the tissues as ethylmercury, has caused illness and several deaths due to erroneous handling when used as a disinfectant or as a preservative in medical preparations. Lately, possible health effects of thimerosal in childhood vaccines have been much discussed. Thimerosal is a well-known sensitizing agent, although usually of no clinical relevance. In rare cases, thimerosal has caused systemic immune reactions including acrodynia. We have studied if thimerosal might induce the systemic autoimmune condition observed in genetically susceptible mice after exposure to inorganic mercury. A.SW mice were exposed to 1.25-40 mg thimerosal/l drinking water for 70 days. Antinucleolar antibodies, targeting the 34-kDa protein fibrillarin, developed in a dose-related pattern and first appeared after 10 days in the two highest dose groups. The lowest observed adverse effect level (LOAEL) for antifibrillarin antibodies was 2.5 mg thimerosal/l, corresponding to an absorbed dose of 147 μg Hg/kg bw and a concentration of 21 and 1.9 μg Hg/g in the kidney and lymph nodes, respectively. The same LOAEL was found for tissue immune-complex deposits. The total serum concentration of IgE, IgG1, and IgG2a showed a significant dose-related increase in thimerosal-treated mice, with a LOAEL of 5 mg thimerosal/l for IgG1 and IgE, and 20 mg thimerosal/l for IgG2a. The polyclonal B-cell activation showed a significant dose-response relationship with a LOAEL of 10 mg thimerosal/l. Therefore, thimerosal induces in genetically susceptible mice a systemic autoimmune syndrome very similar to that seen after treatment with inorganic mercury, although a higher absorbed dose of Hg is needed using thimerosal. The autoimmune syndrome induced by thimerosal is different from the weaker and more restricted autoimmune reaction observed after treatment with an equipotent dose of methylmercury

  16. Localization of radiolabeled anti-DNA monoclonal antibodies in murine systemic lupus erythematosus (SLE)

    International Nuclear Information System (INIS)

    Wahl, R.; Hahn, B.; Ebling, F.

    1984-01-01

    The diagnosis of SLE can be extremely difficult. This multi-system disease is characterized by the deposition of DNA-anti-DNA antibody (Ab) complexes in many tissues, producing glomerulonephritis and systemic vasculitis. This study evaluates an IGG monoclonal (Mo) Ab directe3d against DNA (MrSSl) for potential radioimmunodiagnosis of SLE. Six 15 wk. old F-1 female hybrids of NZB+NZW mice (an animal SLE model that develops vasculitis and nephritis) were injected with 50 μCl of I-131 MrSSl and 15 μCl of I-125 isotype-matched control mouse myeloma (LPC-1) (non-reactive with DNA). Imaging and tissue distribution were studied. Two animals were also imaged using I-131 LPC Ab. Images at 2 and 9 days showed no clear differences in scan patterns using MrSSl or LPC-1 Ab. Tissue distribution studies at six days, however, showed a significantly higher accumulation of MrSSl in the kidneys vs. control Ab (2.7% vs. 1.8% of injected dose) (p < .04). Similarly, higher levels of MrSS were also seen in the spleen, liver and lungs (p < .03). Blood levels tended to be higher with the specific antibody as well. These differences were not apparent at 3 days post injection. The increased concentration of MrSSl present at 9 days in several organs may be secondary to MrSSl binding to DNA containing immune complexes present in diseased tissues. Blocked clearance by immune complexes or DNA, or differences in electrical charges of the antibodies could be contributing to the higher MrSSl levels seen. Images did not suggest deiodination as responsible. Further studies are necessary to determine if the amount of MrSSl retained by diseased animals is indicative of SLE disease activity

  17. Localization of radiolabeled anti-DNA monoclonal antibodies in murine systemic lupus erythematosus (SLE)

    Energy Technology Data Exchange (ETDEWEB)

    Wahl, R.; Hahn, B.; Ebling, F.

    1984-01-01

    The diagnosis of SLE can be extremely difficult. This multi-system disease is characterized by the deposition of DNA-anti-DNA antibody (Ab) complexes in many tissues, producing glomerulonephritis and systemic vasculitis. This study evaluates an IGG monoclonal (Mo) Ab directe3d against DNA (MrSSl) for potential radioimmunodiagnosis of SLE. Six 15 wk. old F-1 female hybrids of NZB+NZW mice (an animal SLE model that develops vasculitis and nephritis) were injected with 50 ..mu..Cl of I-131 MrSSl and 15 ..mu..Cl of I-125 isotype-matched control mouse myeloma (LPC-1) (non-reactive with DNA). Imaging and tissue distribution were studied. Two animals were also imaged using I-131 LPC Ab. Images at 2 and 9 days showed no clear differences in scan patterns using MrSSl or LPC-1 Ab. Tissue distribution studies at six days, however, showed a significantly higher accumulation of MrSSl in the kidneys vs. control Ab (2.7% vs. 1.8% of injected dose) (p < .04). Similarly, higher levels of MrSS were also seen in the spleen, liver and lungs (p < .03). Blood levels tended to be higher with the specific antibody as well. These differences were not apparent at 3 days post injection. The increased concentration of MrSSl present at 9 days in several organs may be secondary to MrSSl binding to DNA containing immune complexes present in diseased tissues. Blocked clearance by immune complexes or DNA, or differences in electrical charges of the antibodies could be contributing to the higher MrSSl levels seen. Images did not suggest deiodination as responsible. Further studies are necessary to determine if the amount of MrSSl retained by diseased animals is indicative of SLE disease activity.

  18. Systemic EP4 Inhibition Increases Adhesion Formation in a Murine Model of Flexor Tendon Repair.

    Directory of Open Access Journals (Sweden)

    Michael B Geary

    Full Text Available Flexor tendon injuries are a common clinical problem, and repairs are frequently complicated by post-operative adhesions forming between the tendon and surrounding soft tissue. Prostaglandin E2 and the EP4 receptor have been implicated in this process following tendon injury; thus, we hypothesized that inhibiting EP4 after tendon injury would attenuate adhesion formation. A model of flexor tendon laceration and repair was utilized in C57BL/6J female mice to evaluate the effects of EP4 inhibition on adhesion formation and matrix deposition during flexor tendon repair. Systemic EP4 antagonist or vehicle control was given by intraperitoneal injection during the late proliferative phase of healing, and outcomes were analyzed for range of motion, biomechanics, histology, and genetic changes. Repairs treated with an EP4 antagonist demonstrated significant decreases in range of motion with increased resistance to gliding within the first three weeks after injury, suggesting greater adhesion formation. Histologic analysis of the repair site revealed a more robust granulation zone in the EP4 antagonist treated repairs, with early polarization for type III collagen by picrosirius red staining, findings consistent with functional outcomes. RT-PCR analysis demonstrated accelerated peaks in F4/80 and type III collagen (Col3a1 expression in the antagonist group, along with decreases in type I collagen (Col1a1. Mmp9 expression was significantly increased after discontinuing the antagonist, consistent with its role in mediating adhesion formation. Mmp2, which contributes to repair site remodeling, increases steadily between 10 and 28 days post-repair in the EP4 antagonist group, consistent with the increased matrix and granulation zones requiring remodeling in these repairs. These findings suggest that systemic EP4 antagonism leads to increased adhesion formation and matrix deposition during flexor tendon healing. Counter to our hypothesis that EP4 antagonism

  19. seroprevalence of cytomegalovirus infection amongst pregnant

    African Journals Online (AJOL)

    boaz

    infections leading to neurological disabilities in children that result to severe sequelae such as sensor neural hearing loss, neuro-developmental delay and blindness. .... rashes and feeding difficulties [4]. Cytomegalovirus is spread through close ... using complement fixation test (CFT), a seroprevalence of 86.6% among ...

  20. Prevalence and associated characteristics of cytomegalovirus (CMV ...

    African Journals Online (AJOL)

    Background: The screening for cytomegalovirus (CMV) specific antibodies is not routine in our setting, thus the transfusion of blood portends high risk for susceptible individuals. Objective: To determine the prevalence of IgG and IgM specific antibodies and associated characteristics in blood donors seen at a referral ...

  1. Seroepidemiology study of cytomegalovirus and rubella among ...

    African Journals Online (AJOL)

    Background: Maternal cytomegalovirus (CMV) and rubella infections have adverse neonatal outcomes. Both CMV and rubella are more widespread in developing countries and in communities with lower socioeconomic status. The aim of this study was to investigate sero-prevalence of CMV and rubella infection and ...

  2. Seroprevalence of cytomegalovirus Antibodies among pregnant ...

    African Journals Online (AJOL)

    Background: Cytomegalovirus is a common virus that infects most people at some time during their lives. It becomes dormant for a while and may reactivate later. In pregnant women, intrauterine infection may be associated with congenital abnormalities, intrauterine growth retardation and intrauterine death of the fetus as ...

  3. Overlapping transcription structure of human cytomegalovirus ...

    Indian Academy of Sciences (India)

    2013-01-21

    Jan 21, 2013 ... Transcription of human cytomegalovirus UL/b′ region has been studied extensively for some genes. In this study, transcripts of the UL140 and UL141, two of the UL/b′ genes, were identified in late RNAs of three HCMV isolates using Northern blot hybridization, cDNA library screening and RACE-PCR.

  4. Overlapping transcription structure of human cytomegalovirus ...

    Indian Academy of Sciences (India)

    2013-01-21

    Jan 21, 2013 ... [Ma Y, Li M, Zheng B, Wang N, Gao S, Wang L, Qi Y, Sun Z and Ruan Q 2013 Overlapping transcription structure of human cytomegalovirus .... Genome structure of the UL139–UL141 gene region of H strain (GenBank GQ981646). The blank arrows ..... The genetic organization of the virus may provide a.

  5. Seroprevalence of cytomegalovirus among some voluntary blood ...

    African Journals Online (AJOL)

    Background: Cytomegalovirus (CMV) is one of the most significant pathogens infecting immuno-suppressed individuals. CMV is transmissible through transfusion of blood components. Aim: The goal of this study was to determine the seroprevalence of antibodies to CMV among blood donors seen at the 37 Military Hospital ...

  6. Overlapping transcription structure of human cytomegalovirus ...

    Indian Academy of Sciences (India)

    Transcription of human cytomegalovirus UL/b′ region has been studied extensively for some genes. In this study, transcripts of the UL140 and UL141, two of the UL/b′ genes, were identified in late RNAs of three HCMV isolates using Northern blot hybridization, cDNA library screening and RACE-PCR. At least three ...

  7. Seroprevalence of cytomegalovirus among pregnant women ...

    African Journals Online (AJOL)

    Background: Primary Cytomegalovirus (CMV) infection during pregnancy is a frequent and serious threat to the fetus. There is no vaccine as such alternative measures are needed to prevent congenital CMV infection. Objective: This study determined CMV Immunoglobulin G (IgG) antibody among pregnant women in order ...

  8. Subclinical Congenital Cytomegalovirus Infection and Hearing Impairment

    Science.gov (United States)

    Dahle, Arthur J.; And Others

    1974-01-01

    When the hearing sensitivity of children with subclinical congenital cytomegalovirus infection was evaluated and compared with that of a group of matched control subjects, nine of the 18 infected subjects were found to have some hearing loss, ranging from slight high-frequency impairments to a severe-to-profound unilateral loss. (MYS)

  9. ORIGINAL ARTICLES Cytomegalovirus antibodies among healthy ...

    African Journals Online (AJOL)

    2009-07-01

    Jul 1, 2009 ... Human cytomegalovirus (CMV) is a ubiquitous agent that commonly infects individuals from diverse geographical and socio-economic backgrounds. Although most CMV infections are asymptomatic, certain patient groups are at risk of developing serious illness and long-term sequelae from. CMV infection.

  10. A novel polyclonal antibody against human cytomegalovirus ...

    African Journals Online (AJOL)

    Future research should be directed to epitope screening of synthetic HMCV peptides, which could help to understand HCMV infection and virus-neutralising antibodies more fully and to prepare HCMV vaccines and antiviral drugs. Key words: Human cytomegalovirus, AD169 strain, Towne strains, polyclonal antibody.

  11. Myocyte TLR4 enhances enteric and systemic inflammation driving late murine endotoxic ileus

    Science.gov (United States)

    Buchholz, Bettina M.; Shapiro, Richard A.; Vodovotz, Yoram; Billiar, Timothy R.; Sodhi, Chhinder P.; Hackam, David J.

    2015-01-01

    Myocytes are nonhemopoietic in origin and functionally essential in generating gastrointestinal motility. In endotoxemia, a rapid-onset nonhemopoietic mechanism potently triggers early ileus in a Toll-like receptor 4 (TLR4)/myeloid differentiation primary response gene 88 (MyD88)-dependent manner. Moreover, synergistically with hemopoietic cells, nonhemopoietic cells escalate late ileus via an IL-6 receptor-dependent inflammation-driven pathway. We therefore specifically investigated the role of myocytes in TLR4-triggered inflammation and ileus. TLR4+/+, TLR4−/−, bmTLR4+/+/TLR4−/− chimera, SM22-Cre−/−TLR4flox/flox, and selective myocyte TLR4-deficient (SM22-Cre+/−TLR4flox/flox) mice were injected intraperitoneally with purified lipopolysaccharide. SM22-driven Cre recombinase activity was selectively detected in cardiac, gastrointestinal, skeletal, and vascular myocytes, of small-sized vessels in a two-color fluorescent Cre reporter mouse. In contrast to nonhemopoietic TLR4 deficiency, deletion of myocyte TLR4 signaling prevented neither endotoxin-induced suppression of spontaneous jejunal contractility in vitro nor early ileus in vivo at 6 h. Circulating plasma colony-stimulating factor 3 was greatly elevated during endotoxemia, independent of myocyte TLR4 signaling or time. TLR4 activation of myocytes contributed significantly to an early enteric IL-6 mRNA induction and systemic IL-6 release, as well as to a late increase in circulating chemokine (C-X-C motif) ligand 1 (CXCL1) and IL-17. Consequently, inhibition of myocyte TLR4 signaling allowed functional recovery of motility by preventing inflammation-driven late ileus at 24 h. Direct TLR4 activation of myocytes is not responsible for nonhemopoietic-mediated early ileus. However, myocytes are proinflammatory cells that potently drive enteric and systemic inflammation, subsequently fueling late mediator-triggered ileus. Specifically, the myocyte TLR4-dependent inflammatory signature of elevated

  12. Cytomegalovirus (CMV) Infection: A Guide for Patients and Families After Stem Cell Transplant

    Science.gov (United States)

    NIH Clinical Center Patient Education Materials Cytomegalovirus (CMV) Infection: A Guide for Patients and Families after Stem Cell Transplant What is cytomegalovirus (CMV)? Cytomegalovirus (CMV), a common virus, is ...

  13. Dietary factors regulate cytokines in murine models of systemic lupus erythematosus.

    Science.gov (United States)

    Hsieh, Chia-Chien; Lin, Bi-Fong

    2011-11-01

    Cytokines play the active roles in the pathogenesis of systemic lupus erythematosus (SLE) and contribute significantly to the immune imbalance in this disease. Conservative therapeutic approaches, such as dietary modifications have been shown to have some beneficial impact on the disease activity of the SLE. Over the past years, accumulating evidences have supported a major role for specific dietary factors, including calorie restriction, n-3/n-6 fatty acids, vitamin A, vitamin D, vitamin E, phytoestrogens or herbal medicine in the regulation of cytokines involved in SLE development. Although there are many reviews that discuss the issue of nutrition and immunity, there are relatively few articles that focus on the regulation of cytokines by dietary factors. This concise review will summarize those animal studies that investigated not only the outcome of autoantibody production and proteinuria, but also cytokines production. However, the field of dietary factors in the immunomodulation of SLE is still in its infancy. More clinical studies are needed to confirm the preliminary results and advance the knowledge in this field. Lifestyle modification and adjustments in diet are important and encouraged to be suggested as an adjuvant therapy for SLE. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. Role of corticosterone in the murine enteric nervous system during fasting.

    Science.gov (United States)

    Lowette, Katrien; Tack, Jan; Vanden Berghe, Pieter

    2014-11-01

    Food intake depends on a tightly controlled interplay of appetite hormones and the enteric (ENS) and central nervous system. Corticosterone (CORT) levels, which are mainly studied with regard to stress, are also increased during fasting. However, the role of CORT in the ENS remains elusive. Therefore, we investigated whether CORT modulates activity of enteric neurons and whether its intracellular regulator, 11β-hydroxysteroid dehydrogenase (HSD) type 1, is present in the myenteric plexus, using immunohistochemistry and RT-qPCR. Effects of CORT on neuronal activity and expression of neuronal markers in the myenteric plexus were assessed via Ca(2+) imaging and RT-qPCR, respectively, whereas modulations in mixing behavior were measured by video imaging. 11β-HSD-1 was present in enteric neurons along the gastrointestinal tract, and its expression increased after fasting (control: 0.58 ± 0.09 vs. fasted: 1.5 ± 0.23; P fasting induced significant elevations in synaptobrevin (P gastrointestinal motility. Copyright © 2014 the American Physiological Society.

  15. Systemic Correction of Murine Glycogen Storage Disease Type IV by an AAV-Mediated Gene Therapy.

    Science.gov (United States)

    Yi, Haiqing; Zhang, Quan; Brooks, Elizabeth D; Yang, Chunyu; Thurberg, Beth L; Kishnani, Priya S; Sun, Baodong

    2017-03-01

    Deficiency of glycogen branching enzyme (GBE) causes glycogen storage disease type IV (GSD IV), which is characterized by the accumulation of a less branched, poorly soluble form of glycogen called polyglucosan (PG) in multiple tissues. This study evaluates the efficacy of gene therapy with an adeno-associated viral (AAV) vector in a mouse model of adult form of GSD IV (Gbe1 ys/ys ). An AAV serotype 9 (AAV9) vector containing a human GBE expression cassette (AAV-GBE) was intravenously injected into 14-day-old Gbe1 ys/ys mice at a dose of 5 × 10 11 vector genomes per mouse. Mice were euthanized at 3 and 9 months of age. In the AAV-treated mice at 3 months of age, GBE enzyme activity was highly elevated in heart, which is consistent with the high copy number of the viral vector genome detected. GBE activity also increased significantly in skeletal muscles and the brain, but not in the liver. The glycogen content was reduced to wild-type levels in muscles and significantly reduced in the liver and brain. At 9 months of age, though GBE activity was only significantly elevated in the heart, glycogen levels were significantly reduced in the liver, brain, and skeletal muscles of the AAV-treated mice. In addition, the AAV treatment resulted in an overall decrease in plasma activities of alanine transaminase, aspartate transaminase, and creatine kinase, and a significant increase in fasting plasma glucose concentration at 9 months of age. This suggests an alleviation of damage and improvement of function in the liver and muscles by the AAV treatment. This study demonstrated a long-term benefit of a systemic injection of an AAV-GBE vector in Gbe1 ys/ys mice.

  16. A Novel Murine Candidiasis Model with Severe Colonization in the Stomach Induced by N-acetylglucosamine-treatment and Its Scoring System Based on Local Characteristic Stomach Symptoms.

    Science.gov (United States)

    Ishijima, Sanae A; Abe, Shigeru

    2015-01-01

    We developed a novel murine candidiasis model of the gastrointestinal tract using N-acetylglucosamine ( GlcNAc ) as a tool to aggravate symptoms. Forty-eight hours after intragastrically inoculating Candida albicans cells to immunosuppressed and GlcNAc-treated mice, vigorously accumulating patchy whitish plaques were observed on their inner stomach surface. Candida cells colonizing the plaques consisted of both yeast and mycelia, and were directly stained with Calcofluor White M2R. Aggravation of the candidiasis symptoms was dependent on GlcNAc concentration in drinking water, wherein administration of 50 mM GlcNAc not only severely worsened stomach symptoms, but also significantly increased Candida cell number in the stomach and small intestine. The aggravation effect of GlcNAc was enhanced by addition of sedative chemical chlorpromazine chloride after inoculation. In order to semi-quantitatively assess colonization by Candida in the stomach, we devised a new symptom scoring system that represents the extent of the patchy whitish plaques on the mucosal epithelium of the stomach. Histochemical analysis of Candida-infected tissues revealed not only a large amount of thick Candida mycelia invading mucosal epithelial stomach tissues but also infiltrating inflammatory cells. These results suggest that this murine gastrointestinal candidiasis model could serve as a useful tool for evaluating the protective activity of antifungal agents, probiotics, or functional foods against gastrointestinal candidiasis. Furthermore, from another point of view, this novel murine model could also be used to analyze the pathological mechanisms behind the translocation of C. albicans across intestinal barriers, which results in systemic Candida dissemination and infection.

  17. Cytomegalovirus myelitis in perinatally acquired HIV.

    OpenAIRE

    Güngör, T; Funk, M; Linde, R; Jacobi, G; Horn, M; Kreuz, W

    1993-01-01

    A 7 year old child perinatally infected with HIV who died from progressive muscular paralysis and central nervous respiratory failure is described. Cytomegalovirus (CMV) prophylaxis with a special intravenous CMV hyper-immunoglobulin had been successfully conducted for more than four years. Macroscopic and microscopic immunohistochemical examination of the spinal cord revealed a diffuse CMV infiltration of the entire myelon. CMV infected cells were identified as astrocytes, oligodendrocytes, ...

  18. Species peculiarities in damage to regulatory systems of murine rodents' liver cells in conditions of slight radioactive contamination

    International Nuclear Information System (INIS)

    Kudyasheva, A.G.; Shishkina, L.N.; Zagorskaya, N.G.

    1995-01-01

    Results are given from comparative analysis of the antioxidation activity (AOA) of lipids, composition of phospholipids, and activity of Krebs'-cycle and glycolysis enzymes in the liver of three species of murine rodents caught in the slightly contaminated zone of the accident at the Chernobyl nuclear power plant. Disruptions were found in individual links of the regulation of processes of peroxidation of lipids (POL), as well as depression and discoordination of dehydrogenation process. The sharpest shifts in biochemical and biophysical indices were noted in the more radiosensitive root vole

  19. Mondini dysplasia and congenital cytomegalovirus infection.

    Science.gov (United States)

    Bauman, N M; Kirby-Keyser, L J; Dolan, K D; Wexler, D; Gantz, B J; McCabe, B F; Bale, J F

    1994-01-01

    We report a case of bilateral temporal bone anomalies in a child with symptomatic congenital cytomegalovirus infection and severe, bilateral sensorineural hearing loss identified at 3 months of age. High-resolution temporal bone computed tomography (HRCT) revealed bilateral findings of a short, malformed cochlea lacking an interscalar septum, a short and wide internal auditory canal, and an enlarged vestibular aqueduct, features diagnostic of bilateral Mondini dysplasia. To determine the importance of this observation, we completed HRCT in five additional children between 7 months and 9 years of age who had evidence of symptomatic congenital cytomegalovirus infection. One child with profound sensorineural hearing loss had severe bilateral temporal bone dysplasia with a small cochlea lacking an interscalar septum, an abnormal vestibule, and a large cochlear aqueduct. Of the remaining four children, hearing thresholds ranged from normal to profoundly decreased, but their HRCT scans were normal to visual inspection. When inner ear dimensions of these temporal bones were compared with norms established by Pappas and coworkers, however, seven of the eight ears had short cochleas and narrow lateral semicircular canals, and three ears had short or narrow vestibules. These results indicate that congenital cytomegalovirus infection may cause anomalies or growth disturbances of the temporal bone.

  20. Sero-prevalence of human cytomegalovirus infection and ...

    African Journals Online (AJOL)

    Sero-prevalence of human cytomegalovirus infection and predisposing factors among HIV infected patients attending comprehensive care clinic at Kenyatta National Hospital, Kenya. ... Background: Human Cytomegalovirus (hCMV) is one of the opportunistic infections in HIV patients. ... Design: A cross sectional study.

  1. Report from the second cytomegalovirus and immunosenescence workshop

    NARCIS (Netherlands)

    Wills, Mark; Akbar, Arne; Beswick, Mark; Bosch, Jos A.; Caruso, Calogero; Colonna-Romano, Giuseppina; Dutta, Ambarish; Franceschi, Claudio; Fulop, Tamas; Gkrania-Klotsas, Effrossyni; Goronzy, Joerg; Griffiths, Stephen J.; Henson, Sian M.; Herndler-Brandstetter, Dietmar; Hill, Ann; Kern, Florian; Klenerman, Paul; Macallan, Derek; Macaulay, Richard; Maier, Andrea B.; Mason, Gavin; Melzer, David; Morgan, Matthew; Moss, Paul; Nikolich-Zugich, Janko; Pachnio, Annette; Riddell, Natalie; Roberts, Ryan; Sansoni, Paolo; Sauce, Delphine; Sinclair, John; Solana, Rafael; Strindhall, Jan; Trzonkowski, Piotr; van Lier, Rene; Vescovini, Rosanna; Wang, George; Westendorp, Rudi; Pawelec, Graham

    2011-01-01

    The Second International Workshop on CMV & Immunosenescence was held in Cambridge, UK, 2-4th December, 2010. The presentations covered four separate sessions: cytomegalovirus and T cell phenotypes; T cell memory frequency, inflation and immunosenescence; cytomegalovirus in aging, mortality and

  2. Congenital Cytomegalovirus Infection in the Absence of Maternal Cytomegalovirus-IgM Antibodies

    NARCIS (Netherlands)

    Gunkel, Julia; van der Knoop, Bloeme J; Nijman, Joppe; De Vries, Linda S.; Manten, Gwendolyn T.R.; Nikkels, Peter G.J.; Murk, Jean Luc; de Vries, Johanna I P; Wolfs, Tom F.W.

    2017-01-01

    Background: Congenital cytomegalovirus (cCMV) infections are the most prevalent intrauterine infections worldwide and are the result of maternal primary or non-primary infections. Early maternal primary infections are thought to carry the highest risk of fetal developmental abnormalities as seen by

  3. Detection of Cytomegalovirus DNA in Serum Correlates with Clinical Cytomegalovirus Retinitis in AIDS

    DEFF Research Database (Denmark)

    Hansen, K.K.; Ricksten, A.; Hofmann, B.

    1994-01-01

    The high sensitivity of nested polymerase chain reaction (PCR) offers the possibility of rapid detection of cytomegalovirus (CMV) DNA in serum. Five consecutive serum samples were examined from 52 human immunodeficiency virus (HIV)-seropositive patients (19 of whom had clinically presumed diagnosis...

  4. Cytomegalovirus-induced immunopathology and its clinical consequences

    Science.gov (United States)

    2011-01-01

    Human cytomegalovirus (CMV) is a ubiquitous DNA virus that causes severe disease in patients with immature or impaired immune systems. During active infection, CMV modulates host immunity, and CMV-infected patients often develop signs of immune dysfunction, such as immunosuppression and autoimmune phenomena. Furthermore, active viral infection has been observed in several autoimmune diseases, and case reports have linked primary CMV infection and the onset of autoimmune disorders. In addition, CMV infection promotes allograft rejection and graft-versus-host disease in solid organ and bone marrow transplant recipients, respectively, further implicating CMV in the genesis and maintenance of immunopathological phenomena. The mechanisms by which CMV could induce inhibition of host defense, inflammation, and autoimmunity are discussed, as is the treatment of virus-induced immunopathology with antivirals. PMID:21473750

  5. Drug Reaction with Eosinophilia and Systemic Symptoms Associated with Reactivation of Epstein-Barr Virus and/or Cytomegalovirus Leading to Hemophagocytic Syndrome in One of Two Patients.

    Science.gov (United States)

    Liang, Jianhua; Qu, Hui; Wang, Xiaowen; Wang, Aiping; Liu, Lingling; Tu, Ping; Li, Ruoyu; Wang, Mingyue

    2018-02-01

    Drug reaction with eosinophilia and systemic symptoms (DRESS) is a hypersensitivity reaction characterized by maculopapular rash, exfoliative dermatitis, lymphadenopathy, fever, eosinophilia, and involvement of internal organs. Evidence for reactivation of herpes family viruses has been observed in some DRESS patients, and activated CD8+ T lymphocytes are largely directed against Epstein-Barr virus. Here, we report two cases complicated with this infection. Both patients received antibiotics and non-steroidal anti-inflammatory drugs. These patients manifested clinically with high fever, facial edema, diffuse pruritic erythroderma and maculopapules over the entire body, purpuric rashes in both lower limbs and lymphadenopathy of cervical and inguinal nodes. Laboratory tests revealed abnormal liver function, blood eosinophils, and ferritin levels. The patients recovered completely; however, the female patient developed hemophagocytic syndrome on the 15th day of illness. She developed new itchy rash, and laboratory tests rapidly worsened with fibrinogen levels dramatically reduced to 0.61 g/L. Bone marrow aspiration revealed an increased number of macrophages with hemophagocytosis and a reversed CD4/CD8 ratio of 0.45. These cases suggest that human herpes virus and coagulation function evaluations are necessary in DRESS patients.

  6. Accuracy of the serological ELISA test compared with the polymerase chain reaction for the diagnosis of cytomegalovirus infection in pregnancy

    Directory of Open Access Journals (Sweden)

    Silvana Varella Parmigiani

    Full Text Available CONTEXT: The most frequently used methods for detecting antibodies are the indirect immunofluorescence test and the enzymatic immunoassay (ELISA. The polymerase chain reaction is a molecular biology technique in which the production of large amounts of specific DNA fragments is induced from very low concentrations of complex substrates aloowing the detection of very low amounts of viral particles. OBJECTIVE: To assess the accuracy of serological/ELISA tests in comparison with the polymerase chain reaction in maternal blood to diagnose cytomegalovirus infection. DESIGN: A descriptive study was performed. SETTING: High-risk outpatient clinic of Campinas University (Unicamp. PARTICIPANTS: We selected 243 pregnant women. All of them had been indicated for blood sampling because of suspicions of cytomegalovirus infection and also because of other infections. MAIN MEASUREMENTS: The group was tested for cytomegalovirus. Serological tests were run and compared to the polymerase chain reaction, which was considered to be the gold standard. Status analyses were done using Fisher's exact test, via the SAS software. RESULTS: The previous cytomegalovirus infection rate was 94.6%. The main reasons for inclusion in the study were fetal nervous system malformation (25.5%, maternal toxoplasmosis (25.5% and Rh isoimmunization (14.8%. Only two women were included because of positive serological immunoglobulin M test for cytomegalovirus. The sensitivity and specificity of the serological tests were 94% and 6% for immunoglobulin G. CONCLUSION: Serological tests had lower sensitivity in comparison with the polymerase chain reaction test when diagnosing cytomegalovirus infection. The consequences of positive polymerase chain reaction and negative immunoglobulin M in women remain unknown.

  7. Development of a New Approach to Aid in Visual Identification of Murine iPS Colonies Using a Fuzzy Logic Decision Support System

    Science.gov (United States)

    Bassaneze, Vinicius; Sacramento, Chester Bittencourt; Freire, Rodolfo; Alencar, Patrícia Fernandes De; Ortega, Neli Regina Siqueira; Krieger, Jose Eduardo

    2013-01-01

    The a priori identification of induced pluripotent stem cells remains a challenge. Being able to quickly identify the most embryonic stem cell-similar induced pluripotent stem cells when validating results could help to reduce costs and save time. In this context, tools based on non-classic logic can be useful in creating aid-systems based on visual criteria. True colonies when viewed at 100x magnification have been found to have the following 3 characteristics: a high degree of border delineation, a more uniform texture, and the absence of a cracked texture. These visual criteria were used for fuzzy logic modeling. We investigated the possibility of predicting the presence of alkaline phosphatase activity, typical of true induced pluripotent stem cell colonies, after 25 individuals, with varying degrees of experience in working with murine iPS cells, categorized the images of 136 colonies based on visual criteria. Intriguingly, the performance evaluation by area under the ROC curve (16 individuals with satisfactory performance), Spearman correlation (all statistically significant), and Cohen's Kappa agreement analysis (all statistically significant) demonstrates that the discriminatory capacity of different evaluators are similar, even those who have never cultivated cells. Thus, we report on a new system to facilitate visual identification of murine- induced pluripotent stem cell colonies that can be useful for staff training and opens the possibility of exploring visual characteristics of induced pluripotent stem cell colonies with their functional peculiarities. The fuzzy model has been integrated as a web-based tool named “2see-iPS” which is freely accessed at http://genetica.incor.usp.br/2seeips/. PMID:23950970

  8. Strongyloides Hyperinfection Syndrome Combined with Cytomegalovirus Infection

    Directory of Open Access Journals (Sweden)

    Fatehi Elnour Elzein

    2016-01-01

    Full Text Available The mortality in Strongyloides hyperinfection syndrome (SHS is alarmingly high. This is particularly common in bone marrow, renal, and other solid organ transplant (SOT patients, where figures may reach up to 50–85%. Immunosuppressives, principally corticosteroids, are the primary triggering factor. In general, the clinical features of Strongyloides stercoralis hyperinfection are nonspecific; therefore, a high index of suspicion is required for early diagnosis and starting appropriate therapy. Although recurrent Gram-negative sepsis and meningitis have been previously reported, the combination of both cytomegalovirus (CMV and strongyloidiasis had rarely been associated. We here describe a patient who survived SHS with recurrent Escherichia coli (E. coli urosepsis and CMV infection.

  9. Biliary scintigraphy in neonatal cytomegalovirus cholestasis

    International Nuclear Information System (INIS)

    Tadzher, I.S.; Grujovska, S.; Todorovski, G.; Josifovska, T.; Arsovska, S.

    1996-01-01

    Diagnostic value of hepatobiliary scintigraphy using mebrofenin-Te-99m was assessed in three newborns with cytomegalovirus (CMV) hepatitis and one baby with hepatitis B jaundice. All cases were affected by persistent jaundice with predominately conjugated bilirubin, alcoholic stools, anemia. One of this newborns (case number 1) was suspected of having biliary atresia due to the absence of intestinal excretion of the tracer. After three weeks intestinal passage was seen in scintiscan late after 24 h. Hepatobiliary scintigraphy represents a non-invasive diagnostic procedure which enables the detection of permeability of the biliary tract. (Author)

  10. The Cytomegalovirus UL146 Gene Product vCXCL1 Targets Both CXCR1 and CXCR2 as an Agonist

    DEFF Research Database (Denmark)

    Luttichau, H.R.

    2010-01-01

    Large DNA viruses, such as herpesvirus and poxvirus, encode proteins that target and exploit the chemokine system of their host. UL146 and UL147 in the cytomegalovirus (CMV) genome encode the two CXC chemokines vCXCL1 and vCXCL2. In this study, vCXCL1 was probed against a panel of the 18 classified...

  11. Cytomegalovirus (CMV) research in immune senescence comes of age: overview of the 6th International Workshop on CMV and Immunosenescence

    NARCIS (Netherlands)

    Nikolich-Žugich, Janko; van Lier, René A. W.

    2017-01-01

    Cytomegalovirus (CMV) is one of the most complex and most ubiquitous latent persistent viruses, with a considerable ability to evade and manipulate the immune system. Following an early-life infection, most immunocompetent humans spend several decades living with CMV, and, because the virus in these

  12. Human Cytomegalovirus Induces JC Virus DNA Replication in Human Fibroblasts

    Science.gov (United States)

    Heilbronn, Regine; Albrecht, Ingrid; Stephan, Sonja; Burkle, Alexander; Zur Hausen, Harald

    1993-12-01

    JC virus, a human papovavirus, is the causative agent of the demyelinating brain disease progressive multifocal leucoencephalopathy (PML). PML is a rare but fatal disease which develops as a complication of severe immunosuppression. Latent JC virus is harbored by many asymptomatic carriers and is transiently reactivated from the latent state upon immunosuppression. JC virus has a very restricted host range, with human glial cells being the only tissue in which it can replicate at reasonable efficiency. Evidence that latent human cytomegalovirus is harbored in the kidney similar to latent JC virus led to the speculation that during episodes of impaired immunocompetence, cytomegalovirus might serve as helper virus for JC virus replication in otherwise nonpermissive cells. We show here that cytomegalovirus infection indeed leads to considerable JC virus DNA replication in cultured human fibroblasts that are nonpermissive for the replication of JC virus alone. Cytomegalovirus-mediated JC virus replication is dependent on the JC virus origin of replication and T antigen. Ganciclovir-induced inhibition of cytomegalovirus replication is associated with a concomitant inhibition of JC virus replication. These results suggest that reactivation of cytomegalovirus during episodes of immunosuppression might lead to activation of latent JC virus, which would enhance the probability of subsequent PML development. Ganciclovir-induced repression of both cytomegalovirus and JC virus replication may form the rational basis for the development of an approach toward treatment or prevention of PML.

  13. Cytomegalovirus ileocolitis in a rheumatoid arthritis patient: case report and literature review

    Directory of Open Access Journals (Sweden)

    M. S. Dag

    2015-06-01

    Full Text Available Rheumatoid arthritis (RA is an autoimmune, systemic, chronic, inflammatory disease generally treated with various immunosuppressive drugs. Cytomegalovirus (CMV is an opportunistic, viral infection that is commonly seen in immunosuppressed patients. A sixty-four-year old female diagnosed with RA and treated with immunosuppressive agents was admitted to our rheumatology outpatient service with complaints of diarrhea and abdominal pain, which had lasted longer than four weeks. The patient’s colonoscopy revealed inflamed and ulcerated areas in the colon and in the terminal ileum. A biopsy showed intra-nuclear inclusion particles consistent with CMV. We started an oral valganciclovir therapy in this serum-CMV-polymerase chain reactionpositive patient. The concomitant use of immunosuppressive agents and anti-viral drugs eased the patient’s complaints, and the endoscopic picture improved. Consequently, cytomegalovirus ileocolitis in immunosuppressed patients admitted with severe diarrhea must be considered in the differential diagnosis.

  14. Report from the second cytomegalovirus and immunosenescence workshop

    Directory of Open Access Journals (Sweden)

    Wills Mark

    2011-10-01

    Full Text Available Abstract The Second International Workshop on CMV & Immunosenescence was held in Cambridge, UK, 2-4th December, 2010. The presentations covered four separate sessions: cytomegalovirus and T cell phenotypes; T cell memory frequency, inflation and immunosenescence; cytomegalovirus in aging, mortality and disease states; and the immunobiology of cytomegalovirus-specific T cells and effects of the virus on vaccination. This commentary summarizes the major findings of these presentations and references subsequently published work from the presenter laboratory where appropriate and draws together major themes that were subsequently discussed along with new areas of interest that were highlighted by this discussion.

  15. Systems genetics of liver fibrosis: identification of fibrogenic and expression quantitative trait loci in the BXD murine reference population.

    Directory of Open Access Journals (Sweden)

    Rabea A Hall

    Full Text Available The progression of liver fibrosis in response to chronic injury varies considerably among individual patients. The underlying genetics is highly complex due to large numbers of potential genes, environmental factors and cell types involved. Here, we provide the first toxicogenomic analysis of liver fibrosis induced by carbon tetrachloride in the murine 'genetic reference panel' of recombinant inbred BXD lines. Our aim was to define the core of risk genes and gene interaction networks that control fibrosis progression. Liver fibrosis phenotypes and gene expression profiles were determined in 35 BXD lines. Quantitative trait locus (QTL analysis identified seven genomic loci influencing fibrosis phenotypes (pQTLs with genome-wide significance on chromosomes 4, 5, 7, 12, and 17. Stepwise refinement was based on expression QTL mapping with stringent selection criteria, reducing the number of 1,351 candidate genes located in the pQTLs to a final list of 11 cis-regulated genes. Our findings demonstrate that the BXD reference population represents a powerful experimental resource for shortlisting the genes within a regulatory network that determine the liver's vulnerability to chronic injury.

  16. DNAs from Brucella strains activate efficiently murine immune system with production of cytokines, reactive oxygen and nitrogen species.

    Science.gov (United States)

    Tavakoli, Zahra; Ardestani, Sussan K; Lashkarbolouki, Taghi; Kariminia, Amina; Zahraei Salehi, Taghi; Tavassoli, Nasser

    2009-09-01

    Brucellosis is an infectious disease with high impact on innate immune responses which is induced partly by its DNA. In the present study the potential differences of wild type and patients isolates versus attenuated vaccine strains in terms of cytokines, ROS and NO induction on murine splenocytes and peritoneal macrophages were investigated. This panel varied in base composition and included DNA from B. abortus, B. melitensis, B.abortus strain S19 and melitensis strain Rev1, as attenuated live vaccine. Also we included Escherichia coli DNA, calf thymus DNA (a mammalian DNA), as controls. These DNA were evaluated for their ability to stimulate IL-12, TNF-alpha, IL-10, IFN-gamma and ROS production from spleenocytes as well as NO production from peritoneal macrophages. Spleen cells were cultured in 24 well at a concentration of 106 cells/ ml with subsequent addition of 10 microg/ml of Brucella or Ecoli DNAs. These cultures were incubated at 37 degrees C with 5% CO2 for 5 days. Supernatants were harvested and cytokines, ROS and NOx were evaluated. It was observed that TNF-alpha was induced in days 1,3,5 by all Brucella strains DNAs and E. coli DNA, IL-10 only was induced in day 1, IFN- gamma was induced only in day 5 and IL-12 not induced. ROS and NOx were produced by all strains; however, we observed higher production of NOx which were stimulated by DNA of B. melitensis.

  17. Ammonium glycyrrhizinate-loaded niosomes as a potential nanotherapeutic system for anti-inflammatory activity in murine models

    Directory of Open Access Journals (Sweden)

    Marianecci C

    2014-01-01

    Full Text Available Carlotta Marianecci,1 Federica Rinaldi,1 Luisa Di Marzio,2 Marica Mastriota,3 Stefano Pieretti,3 Christian Celia,2,4 Donatella Paolino,5 Michelangelo Iannone,6,7 Massimo Fresta,5 Maria Carafa11Department of Drug Chemistry and Technologies, University Sapienza of Rome, Rome, 2Department of Pharmacy, University G d'Annunzio of Chieti of Pescara, Chieti, 3Department of Therapeutic Research and Medicine Evaluation, Istituto Superiore di Sanità, Rome, Italy; 4Department of Nanomedicine, The Methodist Hospital Research Institute, Houston, TX, USA; 5Department of Health Sciences, University Magna Graecia of Catanzaro, University Campus S Venuta, Building of BioSciences, Germaneto, 6ARPA Calabria, Environmental Epidemiology Center, 7CNR, Neuroscience Institute, Pharmacology Section, Complesso "Nini Barbieri", Roccelletta di Borgia, ItalyBackground: Liquorice extracts demonstrate therapeutic efficacy in treating dermatitis, eczema, and psoriasis when compared with corticosteroids. In this work, nonionic surfactant vesicles (niosomes, NSVs containing polysorbate 20 (Tween 20, cholesterol, and cholesteryl hemisuccinate at different molar concentrations were used to prepare monoammonium glycyrrhizinate (AG-loaded NSVs. The anti-inflammatory properties of AG-loaded NSVs were investigated in murine models.Methods: The physicochemical properties of the NSVs were characterized using dynamic light scattering. The fluidity of the lipid bilayer was evaluated by measuring the fluorescence intensity of diphenylhexatriene. The drug entrapment efficiency of AG was assessed using high-performance liquid chromatography. The physicochemical stability of the NSVs was evaluated as a function of time using dynamic light scattering combined with Turbiscan Lab® Expert analysis. Serum stability was determined by incubating the NSVs with 10% v/v fetal bovine serum. The cytotoxic effects of the NSVs were investigated in human dermal fibroblasts using the Trypan blue dye

  18. Spontaneous transformation of murine oviductal epithelial cells: A model system to investigate the onset of fallopian-derived tumors

    Directory of Open Access Journals (Sweden)

    MIchael P. Endsley

    2015-07-01

    Full Text Available High-grade serous carcinoma (HGSC is the most lethal ovarian cancer histotype. The fallopian tube secretory epithelial cells (FTSECs are a proposed progenitor cell type. Genetically altered FTSECs form tumors in mice; however, a spontaneous HGSC model has not been described. Apart from a subpopulation of genetically predisposed women, most women develop ovarian cancer spontaneously, which is associated with aging and lifetime ovulations. A murine oviductal cell line (MOELOW was developed and continuously passaged in culture to mimic cellular aging (MOEHIGH. The MOEHIGH cellular model exhibited a loss of acetylated tubulin consistent with an outgrowth of secretory epithelial cells in culture. MOEHIGH cells proliferated significantly faster than MOELOW, and the MOEHIGH cells produced more 2D foci and 3D soft agar colonies as compared to MOELOW. MOEHIGH were xenografted into athymic female nude mice both in the subcutaneous and the intraperiteonal compartments. Only the subcutaneous grafts formed tumors that were negative for cytokeratin, but positive for oviductal markers such as oviductal glycoprotein 1 and Pax8. These tumors were considered to be poorly differentiated carcinoma. The differential molecular profiles between MOEHIGH and MOELOW were determined using RNA-Seq and confirmed by protein expression to uncover pathways important in transformation, like the p53 pathway, the FOXM1 pathway, WNT signaling, and splicing. MOEHIGH had enhanced protein expression of c-myc, Cyclin E, p53 and FOXM1 with reduced expression of p21. MOEHIGH were also less sensitive to cisplatin and DMBA, which induce lesions typically repaired by base-excision repair. A model of spontaneous tumorogenesis was generated starting with normal oviductal cells. Their transition to cancer involved alterations in pathways associated with high-grade serous cancer in humans.

  19. Survivin expression in odontogenic keratocysts and correlation with cytomegalovirus infection.

    Science.gov (United States)

    Andric, M; Dozic, B; Popovic, B; Stefanovic, D; Basta-Jovanovic, G; Djogo, N; Andjus, P; Milasin, J

    2010-03-01

    The aim of this study was to investigate the expression of survivin, an inhibitor of apoptosis, in odontogenic keratocysts and to compare it to the findings in non-neoplastic jaw cysts - periapical cysts, as well as to establish a possible relationship between survivin expression and human cytomegalovirus presence within these cysts. Samples of 10 odontogenic keratocysts (five positive and five negative for the presence of cytomegalovirus, as determined by polymerase chain reaction) and 10 periapical cysts (five positive and five negative for the cytomegalovirus presence) were analysed. The expression of survivin was assessed by immunohistochemical methods, using monoclonal antibody that selectively recognizes the cytoplasmic form of survivin. All 10 odontogenic keratocysts showed immunostaining for survivin, while all 10 periapical cysts were negative for its presence. There was no correlation between cytomegalovirus presence and expression of survivin within odontogenic keratocysts. Survivin may contribute to the aggressive behavior of odontogenic keratocysts, and thus support the emerging opinion of their neoplastic nature.

  20. Cytomegalovirus as a cause of anterior uveitis in immunocompetent patients

    NARCIS (Netherlands)

    van Boxtel, Lonneke A. A.; van der Lelij, Allegonda; van der Meer, Johannes; Los, Leonoor I.

    Purpose: To describe 7 cases of unilateral, chronic and/or recurrent anterior uveitis caused by cytomegalovirus (CMV) in immunocompetent patients; to identify specific ophthalmologic characteristics; and to evaluate the clinical effect of valganciclovir treatment. Design: Retrospective observational

  1. Progressive Hearing Impairment in Children with Congenital Cytomegalovirus Infection.

    Science.gov (United States)

    Dahle, Arthur J.; And Others

    1979-01-01

    Audiological assessment of 86 children (mean age 38 months at last evaluation time) with congenital cytomegalovirus infection revealed progressive hearing loss in four of 12 Ss with sensorineural hearing impairments. Case descriptions documented the progression of the hearing loss. (Author)

  2. Murine model of rotavirus infection.

    Science.gov (United States)

    Feng, N; Franco, M A; Greenberg, H B

    1997-01-01

    The murine model of homologous rotavirus infection has been used to study the determinants of protection. The local IgA immune response appears to be the critical factor in generating protective immunity after natural infection. A series of knockout mice were used to evaluate the contribution of T cells and B cells to immunity and resolution from primary infection. Both arms of immune system played a role in the resolution of primary infection but antibody was much more important for prevention of reinfection.

  3. Symptomatic Congenital Cytomegalovirus Infection Is Underdiagnosed in British Columbia.

    Science.gov (United States)

    Sorichetti, Brendan; Goshen, Oran; Pauwels, Julie; Kozak, Frederick K; Tilley, Peter; Krajden, Mel; Gantt, Soren

    2016-02-01

    Records were reviewed from all infants tested for congenital cytomegalovirus infection in British Columbia, Canada from 2006 to June 2014. Fourteen of 701 infants, or approximately 4.2 per 100,000 live births, had a positive test, indicating that >90% of expected symptomatic congenital cytomegalovirus infection cases were not diagnosed using clinician-initiated testing. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. CD8 T cells control cytomegalovirus latency by epitope-specific sensing of transcriptional reactivation.

    Science.gov (United States)

    Simon, Christian O; Holtappels, Rafaela; Tervo, Hanna-Mari; Böhm, Verena; Däubner, Torsten; Oehrlein-Karpi, Silke A; Kühnapfel, Birgit; Renzaho, Angélique; Strand, Dennis; Podlech, Jürgen; Reddehase, Matthias J; Grzimek, Natascha K A

    2006-11-01

    During murine cytomegalovirus (mCMV) latency in the lungs, most of the viral genomes are transcriptionally silent at the major immediate-early locus, but rare and stochastic episodes of desilencing lead to the expression of IE1 transcripts. This low-frequency but perpetual expression is accompanied by an activation of lung-resident effector-memory CD8 T cells specific for the antigenic peptide 168-YPHFMPTNL-176, which is derived from the IE1 protein. These molecular and immunological findings were combined in the "silencing/desilencing and immune sensing hypothesis" of cytomegalovirus latency and reactivation. This hypothesis proposes that IE1 gene expression proceeds to cell surface presentation of the IE1 peptide by the major histocompatibility complex (MHC) class I molecule L(d) and that its recognition by CD8 T cells terminates virus reactivation. Here we provide experimental evidence in support of this hypothesis. We generated mutant virus mCMV-IE1-L176A, in which the antigenic IE1 peptide is functionally deleted by a point mutation of the C-terminal MHC class I anchor residue Leu into Ala. Two revertant viruses, mCMV-IE1-A176L and the wobble nucleotide-marked mCMV-IE1-A176L*, in which Leu is restored by back-mutation of Ala codon GCA into Leu codons CTA and CTT, respectively, were constructed. Pulmonary latency of the mutant virus was found to be associated with an increased prevalence of IE1 transcription and with events of IE3 transactivator splicing. In conclusion, IE1-specific CD8 T cells recognize and terminate virus reactivation in vivo at the first opportunity in the reactivated gene expression program. The perpetual gene expression and antigen presentation might represent the driving molecular force in CMV-associated immunosenescence.

  5. Gastric cancer associated with refractory cytomegalovirus gastritis.

    Science.gov (United States)

    Ueno, Masayuki; Shimodate, Yuichi; Yamamoto, Shumpei; Yamamoto, Hiroshi; Mizuno, Motowo

    2017-12-01

    Cytomegalovirus (CMV) sometimes causes gastritis, especially in immunocompromised patients, but whether CMV gastritis promotes the development of gastric cancer is unknown. Here, we report a case of gastric cancer that developed in the presence of CMV gastritis, which had been present for at least 4 years and was refractory to treatment. An 80-year-old woman had noted epigastric discomfort and appetite loss. Esophagogastroduodenoscopy revealed a shallow geographical ulcer extending from the upper body to the pylorus. Histological findings of the biopsy and serology were suggestive of CMV gastritis. Serum anti-Helicobacter pylori antibody test was positive, suggesting co-infection with CMV and H. pylori. Her gastritis was unimproved with repeated antiviral therapy and eradication of H. pylori. Thirty months later, wide-spread gastric cancer had developed. We suggest the possibility that the addition of chronic inflammation of CMV infection to H. pylori-induced gastritis facilitated the development of gastric cancer.

  6. Screening, prevention, and treatment of congenital cytomegalovirus.

    Science.gov (United States)

    Johnson, Julie; Anderson, Brenna

    2014-12-01

    Congenital cytomegalovirus (CMV) is a leading cause of permanent disability in children. The main source of maternal infection is from contact with young children. Primary maternal infection is diagnosed with demonstration of seroconversion or a positive CMV IgM in combination with a low-avidity CMV IgG. Fetal infection may be diagnosed with amniotic fluid polymerase chain reaction and culture. CMV-specific hyperimmune globulin has shown promise as a possible means to prevent congenital infection; large randomized trials are ongoing. To date, the only effective means of prevention is through reducing exposure to the virus. Rates of maternal infection may be reduced through education regarding sources of infection and improved hygiene. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. [Respiratory infections associated with a cytomegalovirus].

    Science.gov (United States)

    Calicó, I; Moraga Llop, F A; Español, T; Bertrán Sangués, J M; Fernández Pérez, F

    1985-11-15

    We report 27 children with respiratory tract disease in whom cytomegalovirus was isolated. These group excludes transplant patients and those on hemodialysis and mononucleosis. At the time of virus studies 7 had pneumonia, 3 chronic bronchopneumopathy, 2 bronchopneumonia, 8 pertussoid syndrome, 6 bronchitis or bronchiolitis and 1 laryngitis with glottic oedema. Virus studies consisted in cell cultures of biological products (pharyngeal exudates and urine). They were positive in 18 pharyngeal exudates, 24 urines, 2 bronchial brushings and 1 bronchoaspiration. In only 5 patients a complete serologic study was performed, with 3 seroconversions and one case of persistent high titers. Three patients had severe immune disease (2 hipogammaglobulinemias) and 1 dysgammaglobulinemia. These findings are discussed.

  8. HUMAN CYTOMEGALOVIRUS LATENCY: Approaching the Gordian Knot

    Science.gov (United States)

    Goodrum, Felicia

    2017-01-01

    Herpesviruses have evolved exquisite virus-host interactions that co-opt or evade a number of host pathways to persist. Persistence of human cytomegalovirus (CMV or HCMV), the prototypical β-herpesvirus, is particularly complex in the host organism. Depending on host physiology and the cell types infected, CMV persistence is comprised of latent, chronic, and productive states that may occur concurrently. Viral latency is a central strategy by which herpesviruses ensure their life-long persistence. While much remains to be defined about the virus-host interactions important to CMV latency, it is clear that checkpoints comprised of viral and cellular factors exist to either maintain a latent state or initiate productive replication in response to host cues. CMV offers a rich platform for defining the virus-host interactions and understanding the host biology important to viral latency. This review describes current understanding of the virus-host interactions that contribute to viral latency and reactivation. PMID:27501258

  9. Celulitis por citomegalovirus Cytomegalovirus cellulitis

    Directory of Open Access Journals (Sweden)

    A. Ruiz Lascano

    2002-12-01

    Full Text Available Las lesiones cutáneas por citomegalovirus (CMV son infrecuentes y a menudo una manifestación tardía de una enfermedad sistémica, que generalmente anuncia un curso fatal. Comunicamos un caso de celulitis por CMV: una mujer de 70 años con trasplante renal efectuado 1 mes antes de la consulta, terapia inmunosupresora con ciclosporina A y metilprednisona. La paciente ingresó por fiebre, dolor e impotencia funcional en pierna derecha. Comprobamos la existencia de una placa de 8 por 4 cm eritematoedematosa. La tratamos con antibióticos sin mejoría, por lo que realizamos un estudio histopatológico de piel que mostró cambios citopáticos compatibles con infección por CMV. Los cultivos bacteriológicos y micológicos fueron negativos. La inmunohistoquímica específica para CMV y el estudio de reacción en cadena de la polimerasa (PCR de la biopsia de piel fueron positivas, al igual que la antigenemia. El tratamiento con ganciclovir produjo la mejoría del cuadro clínico. En la literatura revisada no hemos encontrado la celulitis como manifestación de enfermedad cutánea por CMV.Cutaneous lesions in CMV infection are rare, often a late manifestation of systemic infection, and usually herald a fatal course. A 70 year-old woman received a kidney transplantation one month before consulting and immunosuppressive therapy that included cyclosporine A and methylprednisone. She complained of fever, local pain in her right leg, and an erythematous and swelling plaque. She was treated with intravenous antibiotics without improvement. A skin biopsy was performed and the tissue obtained was sent for bacterial and fungal cultures as well as for histological examination. Cultures were negative. The biopsy showed CMV cytopathic changes. Immunoperoxidase staining was positive for CMV and polymerase chain reaction (PCR testing revealed CMV DNA. She was treated with ganciclovir with resolution of the lesion. CMV cellulitis is a rare cutaneous manifestation

  10. Integrative systems analysis of diet-induced obesity identified a critical transition in the transcriptomes of the murine liver and epididymal white adipose tissue.

    Science.gov (United States)

    Kim, J; Kwon, E-Y; Park, S; Kim, J-R; Choi, S-W; Choi, M-S; Kim, S-J

    2016-02-01

    It is well known that high-fat diet (HFD) can cause immune system-related pathological alterations after a significant body weight gain. The mechanisms of the delayed pathological alterations during the development of diet-induced obesity (DIO) are not fully understood. To elucidate the mechanisms underlying DIO development, we analyzed time-course microarray data obtained from a previous study. First, differentially expressed genes (DEGs) were identified at each time point by comparing the hepatic transcriptome of mice fed HFD with that of mice fed normal diet. Next, we clustered the union of DEGs and identified annotations related to each cluster. Finally, we constructed an 'integrated obesity-associated gene regulatory network (GRN) in murine liver'. We analyzed the epididymal white adipose tissue (eWAT) transcriptome usig the same procedure. Based on time-course microarray data, we found that the genes associated with immune responses were upregulated with an oscillating expression pattern between weeks 2 and 8, relatively downregulated between weeks 12 and 16, and eventually upregulated after week 20 in the liver of the mice fed HFD. The genes associated with immune responses were also upregulated at late stage, in the eWAT of the mice fed HFD. These results suggested that a critical transition occurred in the immune system-related transcriptomes of the liver and eWAT around week 16 of the DIO development, and this may be associated with the delayed pathological alterations. The GRN analysis suggested that Maff may be a key transcription factor for the immune system-related critical transition thatoccurred at week 16. We found that transcription factors associated with immune responses were centrally located in the integrated obesity-associated GRN in the liver. In this study, systems analysis identified regulatory network modules underlying the delayed immune system-related pathological changes during the development of DIO and could suggest possible

  11. Severe cytomegalovirus infection in apparently immunocompetent patients: a systematic review

    Directory of Open Access Journals (Sweden)

    Varbobitis Ioannis C

    2008-03-01

    Full Text Available Abstract Background The morbidity and mortality associated with cytomegalovirus (CMV infection in immunocompromised patients (especially in HIV-infected patients and transplant recipients, as well as with congenital CMV infection are well known. In contrast, relatively little attention has been paid to the morbidity and mortality that CMV infection may cause in immunocompetent patients. Methods We reviewed the evidence associated with severe manifestations of CMV infection in apparently immunocompetent patients and the potential role of antiviral treatment for these infections. We searched in PubMed, Scopus, and the Cochrane Library for the period of 1950–2007 to identify relevant articles. Results We retrieved 89 articles reporting on severe CMV infection in 290 immunocompetent adults. Among these reports, the gastrointestinal tract (colitis and the central nervous system (meningitis, encephalitis, transverse myelitis were the most frequent sites of severe CMV infection. Manifestations from other organ-systems included haematological disorders (haemolytic anaemia, thrombocytopenia, thrombosis of the venous or arterial vascular system, ocular involvement (uveitis, and lung disease (pneumonitis. The clinical practice reported in the literature has been to prescribe antiviral treatment for the most severe manifestations of monophasic meningoencephalitis (seizures and coma, ocular involvement, and lung involvement due to CMV. Conclusion Severe life-threatening complications of CMV infection in immunocompetent patients may not be as rare as previously thought.

  12. Therapeutic Potential of Interferon-γ and Its Antagonists in Autoinflammation: Lessons from Murine Models of Systemic Juvenile Idiopathic Arthritis and Macrophage Activation Syndrome

    Directory of Open Access Journals (Sweden)

    Anneleen Avau

    2015-11-01

    Full Text Available Interferon-γ (IFN-γ affects immune responses in a complex fashion. Its immunostimulatory actions, such as macrophage activation and induction of T helper 1-type responsiveness, are widely acknowledged, however, as documented by a large body of literature, IFN-γ has also the potential to temper inflammatory processes via other pathways. In autoimmune and autoinflammatory disorders, IFN-γ can either play a disease-enforcing role or act as protective agent, depending on the nature of the disease. In animal models of any particular autoimmune disease, certain changes in the induction procedure can reverse the net outcome of introduction or ablation of IFN-γ. Here, we review the role of endogenous IFN-γ in inflammatory disorders and related murine models, with a focus on systemic juvenile idiopathic arthritis (sJIA and macrophage activation syndrome (MAS. In particular, we discuss our recent findings in a mouse model of sJIA, in which endogenous IFN-γ acts as a regulatory agent, and compare with results from mouse models of MAS. Also, we elaborate on the complexity in the activity of IFN-γ and the resulting difficulty of predicting its value or that of its antagonists as treatment option.

  13. Impurity of stem cell graft by murine embryonic fibroblasts – implications for cell-based therapy of the central nervous system

    Directory of Open Access Journals (Sweden)

    Marek eMolcanyi

    2014-09-01

    Full Text Available Stem cells have been demonstrated to possess a therapeutic potential in experimental models of various central nervous system disorders, including stroke. The types of implanted cells appear to play a crucial role. Previously, groups of the stem cell network NRW implemented a feeder-based cell line within the scope of their projects, examining the implantation of stem cells after ischemic stroke and traumatic brain injury. Retrospective evaluation indicated the presence of spindle-shaped cells in several grafts implanted in injured animals, which indicated potential contamination by co-cultured feeder cells (murine embryonic fibroblasts – MEFs. Because feeder-based cell lines have been previously exposed to a justified criticism with regard to contamination by animal glycans, we aimed to evaluate the effects of stem cell/MEF co-transplantation. MEFs accounted for 5.33% ± 2.81 of all cells in the primary FACS-evaluated co-culture. Depending on the culture conditions and subsequent purification procedure, the MEF-fraction ranged from 0.9 to 9.9% of the cell suspensions in vitro. MEF survival and related formation of extracellular substances in vivo were observed after implantation into the uninjured rat brain. Impurity of the stem cell graft by MEFs interferes with translational strategies, which represents a threat to the potential recipient and may affect the graft microenvironment. The implications of these findings are critically discussed.

  14. A monoclonal antibody to ameliorate central nervous system infection and improve survival in a murine model of human Enterovirus-A71 encephalomyelitis.

    Science.gov (United States)

    Tan, Soon Hao; Ong, Kien Chai; Perera, David; Wong, Kum Thong

    2016-08-01

    Enterovirus A71 (EV-A71) encephalomyelitis is an often fatal disease for which there is no specific treatment available. Passive immunization with a specific monoclonal antibody to EV-A71 was used on a murine model of EV-A71 encephalomyelitis to evaluate its therapeutic effectiveness before and after established central nervous system (CNS) infection. Mice were intraperitoneally-infected with a mouse-adapted EV-A71 strain and treated with a dose of monoclonal antibody (MAb) daily for 3 days on day 1, 2 and 3 post-infection or for 3 days on 3, 4 and 5 post-infection. Treatment effectiveness was evaluated by signs of infection and survival rate. Histopathology and qPCR analyses were performed on mice sacrificed a day after completing treatment. In mock-treated mice, CNS infection was established from day 3 post-infection. All mice treated before established CNS infection, survived and recovered completely without CNS infection. All mice treated after established CNS infection survived with mild paralysis, and viral load and antigens/RNA at day 6 post-infection were significantly reduced. Passive immunization with our MAb could prevent CNS infection in mice if given early before the establishment of CNS infection. It could also ameliorate established CNS infection if optimal and repeated doses were given. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Polyethylene and methyl methacrylate particle-stimulated inflammatory tissue and macrophages up-regulate bone resorption in a murine neonatal calvaria in vitro organ system.

    Science.gov (United States)

    Ren, Weiping; Wu, Bin; Mayton, Lois; Wooley, Paul H

    2002-09-01

    There is considerable evidence that orthopaedic wear debris plays a crucial role in the pathology of aseptic loosening of joint prostheses. This study examined the effect of inflammatory membranes stimulated with methyl methacrylate and polyethylene on bone resorption, using the murine air pouch model. The capacity of RAW 264.7 mouse macrophages exposed to polymer particles to produce factors affecting bone metabolism was also studied. Neonatal calvaria bones were co-cultured with either pouch membranes or conditioned media from activated macrophages. Bone resorption was measured by the release of calcium from cultured bones, and the activity of tartrate-resistant acid phosphatase in both bone sections and culture medium was also assayed. Results showed that inflammatory pouch membrane activated by methyl methacrylate and polyethylene enhanced osteoclastic bone resorption. Conditioned media from particles stimulated mouse macrophages also stimulated bone resorption, although this effect was weaker than resorption induced by inflammatory pouch membranes. The addition of the particles directly into the medium of cultured calvaria bones had little effect on bone resorption. Our observations indicate that both inflammatory tissue and macrophages provoked by particles can stimulate bone resorption in cultured mouse neonatal calvaria bones. This simple in vitro bone resorption system allows us to investigate the fundamental cellular and molecular mechanism of wear debris induced bone resorption and to screen potential therapeutic approaches for aseptic loosening.

  16. Waddlia chondrophila induces systemic infection, organ pathology and elicits Th1-associated humoral immunity in a murine model of genital infection

    Directory of Open Access Journals (Sweden)

    Sam eVasilevsky

    2015-11-01

    Full Text Available Waddlia chondrophila is a known bovine abortigenic Chlamydia-related bacterium that has been associated with adverse pregnancy outcomes in human. However, there is a lack of knowledge regarding how W. chondrophila infection spreads, its ability to elicit an immune response and induce pathology. A murine model of genital infection was developed to investigate the pathogenicity and immune response associated with a W. chondrophila infection. Genital inoculation of the bacterial agent resulted in a dose-dependent infection that spread to lumbar lymph nodes and successively to spleen and liver. Bacterial-induced pathology peaked on day 14, characterized by leukocyte infiltration (uterine horn, liver and spleen, necrosis (liver and extramedullary hematopoiesis (spleen. Immunohistochemistry demonstrated the presence of a large number of W. chondrophila in the spleen on day 14. Robust IgG titers were detected by day 14 and remained high until day 52. IgG isotypes consisted of high IgG2a, moderate IgG3 and no detectable IgG1, indicating a Th1-associated immune response. This study provides the first evidence that W. chondrophila genital infection is capable of inducing a systemic infection that spreads to major organs, induces uterus, spleen and liver pathology and elicits a Th1-skewed humoral response. This new animal model will help our understanding of the mechanisms related to intracellular bacteria-induced miscarriages, the most frequent complication of pregnancy that affects one in four women.

  17. Waddlia chondrophila induces systemic infection, organ pathology, and elicits Th1-associated humoral immunity in a murine model of genital infection.

    Science.gov (United States)

    Vasilevsky, Sam; Gyger, Joel; Piersigilli, Alessandra; Pilloux, Ludovic; Greub, Gilbert; Stojanov, Milos; Baud, David

    2015-01-01

    Waddlia chondrophila is a known bovine abortigenic Chlamydia-related bacterium that has been associated with adverse pregnancy outcomes in human. However, there is a lack of knowledge regarding how W. chondrophila infection spreads, its ability to elicit an immune response and induce pathology. A murine model of genital infection was developed to investigate the pathogenicity and immune response associated with a W. chondrophila infection. Genital inoculation of the bacterial agent resulted in a dose-dependent infection that spread to lumbar lymph nodes and successively to spleen and liver. Bacterial-induced pathology peaked on day 14, characterized by leukocyte infiltration (uterine horn, liver, and spleen), necrosis (liver) and extramedullary hematopoiesis (spleen). Immunohistochemistry demonstrated the presence of a large number of W. chondrophila in the spleen on day 14. Robust IgG titers were detected by day 14 and remained high until day 52. IgG isotypes consisted of high IgG2a, moderate IgG3 and no detectable IgG1, indicating a Th1-associated immune response. This study provides the first evidence that W. chondrophila genital infection is capable of inducing a systemic infection that spreads to major organs, induces uterus, spleen, and liver pathology and elicits a Th1-skewed humoral response. This new animal model will help our understanding of the mechanisms related to intracellular bacteria-induced miscarriages, the most frequent complication of pregnancy that affects one in four women.

  18. 76 FR 69743 - The Development and Evaluation of Human Cytomegalovirus Vaccines; Public Workshop

    Science.gov (United States)

    2011-11-09

    ...] The Development and Evaluation of Human Cytomegalovirus Vaccines; Public Workshop AGENCY: Food and... Cytomegalovirus Vaccines.'' The purpose of the public workshop is to identify and discuss key issues related to the development and evaluation of human cytomegalovirus (HCMV) vaccines. The public workshop will...

  19. Controlled systemic release of interleukin-12 after gene electrotransfer to muscle for cancer gene therapy alone or in combination with ionizing radiation in murine sarcomas.

    Science.gov (United States)

    Tevz, Gregor; Kranjc, Simona; Cemazar, Maja; Kamensek, Urska; Coer, Andrej; Krzan, Mojca; Vidic, Suzana; Pavlin, Darja; Sersa, Gregor

    2009-12-01

    The present study aimed to evaluate the antitumor effectiveness of systemic interleukin (IL)-12 gene therapy in murine sarcoma models, and to evaluate its interaction with the irradiation of tumors and metastases. To avoid toxic side-effects of IL-12 gene therapy, the objective was to achieve the controlled release of IL-12 after intramuscular gene electrotransfer. Gene electrotransfer of the plasmid pORF-mIL12 was performed into the tibialis cranialis in A/J and C57BL/6 mice. Systemic release of the IL-12 was monitored in the serum of mice after carrying out two sets of intramuscular IL-12 gene electrotransfer of two different doses of plasmid DNA. The antitumor effectiveness of IL-12 gene electrotransfer alone or in combination with local tumor or lung irradiation with X-rays, was evaluated on subcutaneous SA-1 and LPB tumors, as well as on lung metastases. A synergistic antitumor effect of intramuscular gene electrotransfer combined with local tumor irradiation was observed as a result of the systemic distribution of IL-12. The gene electrotransfer resulted in up to 28% of complete responses of tumors. In combination with local tumor irradiation, the curability was increased by up to 100%. The same effect was observed for lung metastases, where a potentiating factor of 1.3-fold was determined. The amount of circulating IL-12 was controlled by the number of repeats of gene electrotransfer and by the amount of the injected plasmid. The present study demonstrates the feasibility of treatment by IL-12 gene electrotransfer combined with local tumor or lung metastases irradiation on sarcoma tumors for translation into the clinical setting. Copyright (c) 2009 John Wiley & Sons, Ltd.

  20. Preemptive CD8 T-cell immunotherapy of acute cytomegalovirus infection prevents lethal disease, limits the burden of latent viral genomes, and reduces the risk of virus recurrence.

    Science.gov (United States)

    Steffens, H P; Kurz, S; Holtappels, R; Reddehase, M J

    1998-03-01

    In the immunocompetent host, primary cytomegalovirus (CMV) infection is resolved by the immune response without causing overt disease. The viral genome, however, is not cleared but is maintained in a latent state that entails a risk of virus recurrence and consequent organ disease. By using murine CMV as a model, we have shown previously that multiple organs harbor latent CMV and that reactivation occurs with an incidence that is determined by the viral DNA load in the respective organ (M. J. Reddehase, M. Balthesen, M. Rapp, S. Jonjic, I. Pavic, and U. H. Koszinowski. J. Exp. Med. 179:185-193, 1994). This predicts that a therapeutic intervention capable of limiting the load of latent viral genome should also reduce the risk of virus recurrence. Here we demonstrate the benefits and the limits of a preemptive CD8 T-cell immunotherapy of CMV infection in the immunocompromised bone marrow transplantation recipient. Antiviral CD8 T cells prevented CMV disease and accelerated the resolution of productive infection. The therapy also resulted in a lower load of latent CMV DNA in organs and consequently reduced the incidence of recurrence. The data thus provide a further supporting argument for clinical trials of preemptive cytoimmunotherapy of human CMV disease with CD8 T cells. However, CD8 T cells failed to clear the viral DNA. The therapy-susceptible portion of the DNA load differed between organs and was highest in the lungs. The existence of an invariant, therapy-resistant load suggests a role for immune system evasion mechanisms in the establishment of CMV latency.

  1. Classical and non-classical MHC I molecule manipulation by human cytomegalovirus: so many targets—but how many arrows in the quiver?

    Science.gov (United States)

    Halenius, Anne; Gerke, Carolin; Hengel, Hartmut

    2015-01-01

    Major mechanisms for the recognition of pathogens by immune cells have evolved to employ classical and non-classical major histocompatibility complex class I (MHC I) molecules. Classical MHC I molecules present antigenic peptide ligands on infected cells to CD8+ T cells, whereas a key function for non-classical MHC I molecules is to mediate inhibitory or activating stimuli in natural killer (NK) cells. The structural diversity of MHC I puts immense pressure on persisting viruses, including cytomegaloviruses. The very large coding capacity of the human cytomegalovirus allows it to express a whole arsenal of immunoevasive factors assigned to individual MHC class I targets. This review summarizes achievements from more than two decades of intense research on how human cytomegalovirus manipulates MHC I molecules and escapes elimination by the immune system. PMID:25418469

  2. Biology and pathogenesis of cytomegalovirus in periodontal disease.

    Science.gov (United States)

    Contreras, Adolfo; Botero, Javier Enrique; Slots, Jørgen

    2014-02-01

    Human periodontitis is associated with a wide range of bacteria and viruses and with complex innate and adaptive immune responses. Porphyromonas gingivalis, Tannerella forsythia, Aggregatibacter actinomycetemcomitans, Treponema denticola, cytomegalovirus and other herpesviruses are major suspected pathogens of periodontitis, and a combined herpesvirus-bacterial periodontal infection can potentially explain major clinical features of the disease. Cytomegalovirus infects periodontal macrophages and T-cells and elicits a release of interleukin-1β and tumor necrosis factor-α. These proinflammatory cytokines play an important role in the host defense against the virus, but they also have the potential to induce alveolar bone resorption and loss of periodontal ligament. Gingival fibroblasts infected with cytomegalovirus also exhibit diminished collagen production and release of an increased level of matrix metalloproteinases. This article reviews innate and adaptive immunity to cytomegalovirus and suggests that immune responses towards cytomegalovirus can play roles in controlling, as well as in exacerbating, destructive periodontal disease. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  3. Novel oral amphotericin B formulation (iCo-010) remains highly effective against murine systemic candidiasis following exposure to tropical temperature.

    Science.gov (United States)

    Wasan, Kishor M; Sivak, Olena; Bartlett, Karen; Wasan, Ellen K; Gershkovich, Pavel

    2015-01-01

    To evaluate the antifungal activity of amphotericin B (AmB) in a mouse model of systemic candidiasis following administration of a novel oral AmB formulation (iCo-010) that has been pre-exposed to tropical temperatures. Amphotericin B (AmB) was prepared as a 5 mg/mL dispersion in a mixture of Peceol, Gelucire 44/14 and VitE-TPGS 2,3 (iCo-010). The formulation was protected from light and incubated in a sealed container at 43 °C for 60 days. Mice infected with Candida albicans were treated with either iCo-010 formulation pre-incubated at 43 °C for 60 days or freshly prepared iCo-010 formulation at doses of 5, 10 and 20 mg/kg once daily for five consecutive days. Single intravenous 5 mg/kg dose of AmBisome® was used as a positive control group. Seven days following the last dose, the kidney, liver, spleen, lung, heart and brain were removed and the number of colony forming units (CFUs) was determined as a measure of tissue fungal load. In addition, the concentration of AmB within each tissue was determined using high performance liquid chromatography (HPLC). There were no significant differences in the reduction of CFUs and the concentration of AmB recovered in all organs at all iCo-010 doses tested between the freshly prepared iCo-010 formulation compared to the formulation that was incubated at 43 °C for 60 days. A novel oral AmB formulation, iCo-010, incubated at 43 °C for 60 days to simulate the exposure of the formulation to tropical temperatures remained highly effective against murine systemic candidiasis.

  4. Cytomegalovirus infection: a driving force in human T cell immunosenescence.

    Science.gov (United States)

    Koch, Sven; Larbi, Anis; Ozcelik, Dennis; Solana, Rafael; Gouttefangeas, Cécile; Attig, Sebastian; Wikby, Anders; Strindhall, Jan; Franceschi, Claudio; Pawelec, Graham

    2007-10-01

    The human immune system evolved to defend the organism against pathogens, but is clearly less well able to do so in the elderly, resulting in greater morbidity and mortality due to infectious disease in old people, and higher healthcare costs. Many age-associated immune alterations have been reported over the years, of which probably the changes in T cell immunity, often manifested dramatically as large clonal expansions of cells of limited antigen specificity together with a marked shrinkage of the T cell antigen receptor repertoire, are the most notable. It has recently emerged that the common herpesvirus, cytomegalovirus (CMV), which establishes persistent, life-long infection, usually asymptomatically, may well be the driving force behind clonal expansions and altered phenotypes and functions of CD8 cells seen in most old people. In those few who are not CMV-infected, another even more common herpesvirus, the Epstein-Barr virus, appears to have the same effect. These virus-driven changes are less marked in "successfully aged" centenarians, but most marked in people whom longitudinal studies have shown to be at higher risk of death, that is, those possessing an "immune risk profile" (IRP) characterized by an inverted CD4:8 ratio (caused by the accumulation primarily of CD8(+) CD28(-) cells). These findings support the hypothesis that persistent herpesviruses, especially CMV, act as chronic antigenic stressors and play a major causative role in immunosenescence and associated mortality.

  5. Congenital nephrotic syndrome, an uncommon presentation of cytomegalovirus infection.

    Science.gov (United States)

    Rahman, H; Begum, A; Jahan, S; Muinuddin, G; Hossain, M M

    2008-07-01

    Cytomegalovirus (CMV) infection is a very rare infection in children as well as in infancy. In CMV infection extra renal manifestations in central nervous system (CNS), eyes and hematological are prominent and common than renal manifestation. We are describing two case reports one at the age of 5 months and another at one month with features of both extra renal and renal manifestations of nephritic syndrome. Our first case presented with predominant features of CNS manifestations like convulsion and spastic monoplegia, sensory type of deafness and absence of light reflexes along with nephritic features. Deafness and absence of light reflex were confirmed by audiometric and ophthalmological examination and brain atrophy was confirmed by CT scan. Our second case had features of hypothyroidism along with nephritic features. Hypothyroid status was confirmed by elevated serum TSH level and reduced T4 level. In both cases nephritic features were confirmed at bed site urine examination by heat coagulation test and other relevant investigations. CMV infection was confirmed in both cases by detecting anti CMV IgM by ELISA method. Both patients were clinically improved with intravenous gangcyclovir therapy. In these two cases reports, clinical, serological and therapeutic observation established the causal relationship between the CMV infection and nephrotic syndrome.

  6. Congenital Cytomegalovirus Infection: New Prospects for Prevention and Therapy

    Science.gov (United States)

    Swanson, Elizabeth C.; Schleiss, Mark R.

    2013-01-01

    SYNOPSIS Cytomegalovirus (CMV) is the most common congenital viral infection in the developed world, with an overall birth prevalence of approximately 0.6%. Approximately 10% of congenitally infected infants have signs and symptoms of disease at birth, and these symptomatic infants have a high risk for demonstration of subsequent neurologic sequelae, including sensorineural hearing loss (SNHL), mental retardation, microcephaly, development delay, seizure disorders, and cerebral palsy. Antiviral therapy of children with symptomatic central nervous system (CNS) congenital CMV infection is effective at reducing the risk of long-term disabilities and should be offered to families with affected newborns. An effective pre-conceptual vaccine against CMV could, by preventing congenital infection, protect against long-term neurological sequelae and other disabilities. A variety of active and passive immunization strategies are in clinical trials and are likely to be licensed in the next few years. Until a vaccine is licensed, preventive strategies aimed at reducing transmission should be emphasized and public awareness increased, particularly among women of child-bearing age. PMID:23481104

  7. Cytomegalovirus immune evasion by perturbation of endosomal trafficking.

    Science.gov (United States)

    Lučin, Pero; Mahmutefendić, Hana; Blagojević Zagorac, Gordana; Ilić Tomaš, Maja

    2015-03-01

    Cytomegaloviruses (CMVs), members of the herpesvirus family, have evolved a variety of mechanisms to evade the immune response to survive in infected hosts and to establish latent infection. They effectively hide infected cells from the effector mechanisms of adaptive immunity by eliminating cellular proteins (major histocompatibility Class I and Class II molecules) from the cell surface that display viral antigens to CD8 and CD4 T lymphocytes. CMVs also successfully escape recognition and elimination of infected cells by natural killer (NK) cells, effector cells of innate immunity, either by mimicking NK cell inhibitory ligands or by downregulating NK cell-activating ligands. To accomplish these immunoevasion functions, CMVs encode several proteins that function in the biosynthetic pathway by inhibiting the assembly and trafficking of cellular proteins that participate in immune recognition and thereby, block their appearance at the cell surface. However, elimination of these proteins from the cell surface can also be achieved by perturbation of their endosomal route and subsequent relocation from the cell surface into intracellular compartments. Namely, the physiological route of every cellular protein, including immune recognition molecules, is characterized by specific features that determine its residence time at the cell surface. In this review, we summarize the current understanding of endocytic trafficking of immune recognition molecules and perturbations of the endosomal system during infection with CMVs and other members of the herpesvirus family that contribute to their immune evasion mechanisms.

  8. Human Cytomegalovirus IE2 Protein Disturbs Brain Development by the Dysregulation of Neural Stem Cell Maintenance and the Polarization of Migrating Neurons.

    Science.gov (United States)

    Han, Dasol; Byun, Sung-Hyun; Kim, Juwan; Kwon, Mookwang; Pleasure, Samuel J; Ahn, Jin-Hyun; Yoon, Keejung

    2017-09-01

    Despite the high incidence of severe defects in the central nervous system caused by human cytomegalovirus (HCMV) congenital infection, the mechanism of HCMV neuropathogenesis and the roles of individual viral genes have not yet been fully determined. In this study, we show that the immediate-early 2 (IE2) protein may play a key role in HCMV-caused neurodevelopmental disorders. IE2-transduced neural progenitor cells gave rise to neurospheres with a lower frequency and produced smaller neurospheres than control cells in vitro , indicating reduction of self-renewal and expansion of neural progenitors by IE2. At 2 days after in utero electroporation into the ventricle of the developing brain, a dramatically lower percentage of IE2-expressing cells was detected in the ventricular zone (VZ) and cortical plate (CP) compared to control cells, suggesting that IE2 concurrently dysregulates neural stem cell maintenance in the VZ and neuronal migration to the CP. In addition, most IE2 + cells in the lower intermediate zone either showed multipolar morphology with short neurites or possessed nonradially oriented processes, whereas control cells had long, radially oriented monopolar or bipolar neurites. IE2 + callosal axons also failed to cross the midline to form the corpus callosum. Furthermore, we provide molecular evidence that the cell cycle arrest and DNA binding activities of IE2 appear to be responsible for the increased neural stem cell exit from the VZ and cortical migrational defects, respectively. Collectively, our results demonstrate that IE2 disrupts the orderly process of brain development in a stepwise manner to further our understanding of neurodevelopmental HCMV pathogenesis. IMPORTANCE HCMV brain pathogenesis has been studied in limited experimental settings, such as in vitro HCMV infection of neural progenitor cells or in vivo murine CMV infection of the mouse brain. Here, we show that IE2 is a pivotal factor that contributes to HCMV-induced abnormalities in

  9. Natural killer cells attenuate cytomegalovirus-induced hearing loss in mice.

    Directory of Open Access Journals (Sweden)

    Ali A Almishaal

    2017-08-01

    Full Text Available Congenital cytomegalovirus (CMV infection is the most common non-hereditary cause of sensorineural hearing loss (SNHL yet the mechanisms of hearing loss remain obscure. Natural Killer (NK cells play a critical role in regulating murine CMV infection via NK cell recognition of the Ly49H cell surface receptor of the viral-encoded m157 ligand expressed at the infected cell surface. This Ly49H NK receptor/m157 ligand interaction has been found to mediate host resistance to CMV in the spleen, and lung, but is much less effective in the liver, so it is not known if this interaction is important in the context of SNHL. Using a murine model for CMV-induced labyrinthitis, we have demonstrated that the Ly49H/m157 interaction mediates host resistance in the temporal bone. BALB/c mice, which lack functional Ly49H, inoculated with mCMV at post-natal day 3 developed profound hearing loss and significant outer hair cell loss by 28 days of life. In contrast, C57BL/6 mice, competent for the Ly49H/m157 interaction, had minimal hearing loss and attenuated outer hair cell loss with the same mCMV dose. Administration of Ly49H blocking antibody or inoculation with a mCMV viral strain deleted for the m157 gene rendered the previously resistant C57BL/6 mouse strain susceptible to hearing loss to a similar extent as the BALB/c mouse strain indicating a direct role of the Ly49H/m157 interaction in mCMV-dependent hearing loss. Additionally, NK cell recruitment to sites of infection was evident in the temporal bone of inoculated susceptible mouse strains. These results demonstrate participation of NK cells in protection from CMV-induced labyrinthitis and SNHL in mice.

  10. Systemic delivery of chTNT-3/CpG immunoconjugates for immunotherapy in murine solid tumor models

    Science.gov (United States)

    Jang, Julie K.; Khawli, Leslie A.; Canter, David C.; Hu, Peisheng; Zhu, Tian H.; Wu, Brian W.; Angell, Trevor E.; Li, Zhongjun; Epstein, Alan L.

    2016-01-01

    CpG oligodeoxynucleotides (CpG) potently activate the immune system by mimicking microbial DNA. Conjugation of CpG to chTNT-3, an antibody targeting the necrotic centers of tumors, enabled CpG to accumulate in tumors after systemic delivery, where it can activate the immune system in the presence of tumor antigens. CpG chemically conjugated to chTNT-3 (chTNT-3/CpG) were compared to free CpG in their ability to stimulate the immune system in vitro and reduce tumor burden in vivo. In subcutaneous Colon 26 adenocarcinoma and B16-F10 melanoma models in BALB/c and C57BL/6 mice, respectively, chTNT-3/CpG, free CpG, or several different control constructs were administered systemically. Intraperitoneal injections of chTNT-3/CpG delayed tumor growth and improved survival, and were comparable to intratumorally administered CpG. Compared to saline-treated mice, chTNT-3/CpG-treated mice had smaller average tumor volumes by as much as 72% in Colon 26-bearing mice and 79% in B16-bearing mice. Systemically delivered free CpG and CpG conjugated to an isotype control antibody did not reduce tumor burden or improve survival. In this study, chTNT-3/CpG retained immunostimulatory activity of the CpG moiety and enabled delivery to tumors. Because systemically administered CpG rapidly clear the body and do not accumulate into tumors, chTNT-3/CpG provide a solution to the limitations observed in preclinical and clinical trials. PMID:26960932

  11. Infection by cytomegalovirus in patients with neonatal cholestasis Infecção por cytomegalovirus em pacientes com colestase neonatal

    Directory of Open Access Journals (Sweden)

    Nara Léia Gelle de OLIVEIRA

    2002-04-01

    Full Text Available Background - Neonatal cholestasis syndrome with an intra or extrahepatic origin has been associated to viral infections. The participation of the cytomegalovirus in the etiopathogenesis of neonatal hepatitis has been already known for some time, but only recently there have been indications that this virus may be one of the possible etiological factors for extrahepatic biliary atresia. Aims - To assess the prevalence of infection by cytomegalovirus in patients with intrahepatic cholestasis and extrahepatic cholestasis. To compare the clinical characteristics of the intrahepatic cholestasis and extrahepatic cholestasis groups with the cytomegalovirus serological results. Patients and Methods - This study consisted of 76 patients with neonatal cholestasis who were admitted between January 1980 and January 1999 when they underwent a cytomegalovirus serologic study using the ELISA method. A case note was kept on each patient with the following data: age of patient at admission, serologic result for cytomegalovirus, history of maternal infection, prematurity, fetal distress, birth weight, ponderal gain, choluria and fecal acholia. The final anatomic diagnosis of cholestasis was based on the results of an abdominal ultrasonography, a liver biopsy and its evolution. The patients were then divided into two groups: group I - intrahepatic cholestasis and group II - extrahepatic cholestasis. Each of these groups were then divided into two subgroups: subgroup A - positive serology (IgM for cytomegalovirus and subgroup B - negative serology (IgM for cytomegalovirus. Results - The frequency of positive serology (IgM for cytomegalovirus was 29.4% in children with intrahepatic cholestasis and 28.5% in children with extrahepatic cholestasis. In comparison with group IIB, group IIA presented a higher rate of maternal infection history. The patients in group IIA demonstrated a delayed access to the service in comparison with group IA. The groups did not

  12. Cytomegalovirus Immunoglobulin After Thoracic Transplantation: An Overview.

    Science.gov (United States)

    Grossi, Paolo; Mohacsi, Paul; Szabolcs, Zoltán; Potena, Luciano

    2016-03-01

    Cytomegalovirus (CMV) is a highly complex pathogen which, despite modern prophylactic regimens, continues to affect a high proportion of thoracic organ transplant recipients. The symptomatic manifestations of CMV infection are compounded by adverse indirect effects induced by the multiple immunomodulatory actions of CMV. These include a higher risk of acute rejection, cardiac allograft vasculopathy after heart transplantation, and potentially bronchiolitis obliterans syndrome in lung transplant recipients, with a greater propensity for opportunistic secondary infections. Prophylaxis for CMV using antiviral agents (typically oral valganciclovir or intravenous ganciclovir) is now almost universal, at least in high-risk transplants (D+/R-). Even with extended prophylactic regimens, however, challenges remain. The CMV events can still occur despite antiviral prophylaxis, including late-onset infection or recurrent disease, and patients with ganciclovir-resistant CMV infection or who are intolerant to antiviral therapy require alternative strategies. The CMV immunoglobulin (CMVIG) and antiviral agents have complementary modes of action. High-titer CMVIG preparations provide passive CMV-specific immunity but also exert complex immunomodulatory properties which augment the antiviral effect of antiviral agents and offer the potential to suppress the indirect effects of CMV infection. This supplement discusses the available data concerning the immunological and clinical effects of CMVIG after heart or lung transplantation.

  13. Cytomegalovirus Infections among African-Americans

    Directory of Open Access Journals (Sweden)

    Best Al M

    2008-08-01

    Full Text Available Abstract Background Since African-Americans have twice the prevalence of cytomegalovirus (CMV infections as age-matched Caucasians we sought to determine the ages and possible sources of infection of African-American children. Methods Subjects were 157 African-American healthy children and adolescents and their 113 household adults in Richmond VA. Families completed a questionnaire, provided saliva for antibody testing, and adolescents were interviewed regarding sexual activity. Results Regardless of age CMV seropositivity was not associated with gender, breast feeding, health insurance, sexual activity, or household income, education, or size. In the final regression model, prior CMV infection in adults was over two-fold higher than in children (chi-square = 18.8, p Conclusion We observed that African-American children had CMV seroprevalence rates by age 20 years at less than one-half of that of their adult mothers and caregivers. Sibling-to-sibling transmission was a likely source of CMV infections for the children. The next generation of African-American women may be highly susceptible to a primary CMV infection during pregnancy and may benefit from a CMV vaccine.

  14. Women's attitudes toward practicing cytomegalovirus prevention behaviors

    Directory of Open Access Journals (Sweden)

    Rosemary Thackeray

    2016-12-01

    Full Text Available Congenital cytomegalovirus (CMV infection causes severe disabilities and developmental delays. Women's awareness of CMV is low. Only about half of healthcare providers report counseling women about behaviors to reduce CMV risk and public health education is limited. Routine CMV counseling is not recommend. Providers may lack time to counsel women; other conditions may take priority for counseling; there may be a perception that women are reluctant to follow advice. This cross-sectional descriptive study examined women's attitudes toward CMV prevention behaviors. Data were collected from an online panel of 840 U.S. women 18–40 years of age, who had a child <5 years of age, and were pregnant or planning a pregnancy in the next 12 months. Questions assessed CMV awareness, frequency of past behaviors that transmit CMV, and attitudes toward eight CMV prevention behaviors. Only 15.5% of women were somewhat or very familiar with CMV. Very few women (6.1% reported hearing from their provider about CMV. Women held positive attitudes toward the CMV prevention behaviors and perceived them as feasible. Least positive attitudes were toward not kissing a child on the lips and not sharing foods. Predictors of positive attitudes were CMV awareness, past behavior, talking to a healthcare provider, and perceived risk reduction. Healthcare providers and public health practitioners should collaborate to increase CMV awareness. Encouraging behaviors to reduce saliva sharing may result in greater gains in reducing CMV infection.

  15. No. 240-Cytomegalovirus Infection in Pregnancy.

    Science.gov (United States)

    Yinon, Yoav; Farine, Dan; Yudin, Mark H

    2018-02-01

    To review the principles of prenatal diagnosis of congenital cytomegalovirus (CMV) infection and to describe the outcomes of the affected pregnancies. Effective management of fetal infection following primary and secondary maternal CMV infection during pregnancy. Neonatal signs include intrauterine growth restriction (IUGR), microcephaly, hepatosplenomegaly, petechiae, jaundice, chorioretinitis, thrombocytopenia and anemia, and long-term sequelae consist of sensorineural hearing loss, mental retardation, delay of psychomotor development, and visual impairment. These guidelines provide a framework for diagnosis and management of suspected CMV infections. Medline was searched for articles published in English from 1966 to 2009, using appropriate controlled vocabulary (congenital CMV infection) and key words (intrauterine growth restriction, microcephaly). Results were restricted to systematic reviews, randomized controlled trials/controlled clinical trials, and observational studies. Searches were updated on a regular basis and incorporated into the guideline. Grey (unpublished) literature was identified through searching the websites of health technology assessment and health technology assessment-related agencies, clinical practice guideline collections, clinical trial registries, and national and international medical specialty societies. The quality of evidence reported in this document has been assessed using the evaluation of evidence criteria in the Report of the Canadian Task Force on Preventive Health Care (Table 1). Copyright © 2018. Published by Elsevier Inc.

  16. Neonatal gastrointestinal involvement and congenital cytomegalovirus

    Directory of Open Access Journals (Sweden)

    Alessandro Porta

    2016-11-01

    Full Text Available Cytomegalovirus (CMV is the most common cause of congenital viral infection, affecting 0.2 to 2.3% of all live births in developed countries. Very low birth weight and extremely low birth weight newborns are at higher risk of symptomatic CMV infection, most commonly secondary and acquired through breast milk. Gastrointestinal involvement is rare in acquired CMV infections, but it could be an important manifestation of postnatal infection in preterm infants admitted to neonatal intensive care units. Early onset of CMV gastrointestinal signs/symptoms is very rare. In a review of the literature it is described in 5 newborns in the first 24 hours of life, and 6 considering the onset in the first week of life. This review describes also a case report of congenital CMV in an immunocompetent newborn with onset of gastrointestinal signs immediately after birth: a possible association between viral infection and enteric manifestations was considered in the differential diagnosis. A review of the literature of the different case reports found has done, with description and comparison of the different patients and clinical presentations.

  17. Human Cytomegalovirus Manipulation of Latently Infected Cells

    Science.gov (United States)

    Sinclair, John H.; Reeves, Matthew B.

    2013-01-01

    Primary infection with human cytomegalovirus (HCMV) results in the establishment of a lifelong infection of the host which is aided by the ability of HCMV to undergo a latent infection. One site of HCMV latency in vivo is in haematopoietic progenitor cells, resident in the bone marrow, with genome carriage and reactivation being restricted to the cells of the myeloid lineage. Until recently, HCMV latency has been considered to be relatively quiescent with the virus being maintained essentially as a “silent partner” until conditions are met that trigger reactivation. However, advances in techniques to study global changes in gene expression have begun to show that HCMV latency is a highly active process which involves expression of specific latency-associated viral gene products which orchestrate major changes in the latently infected cell. These changes are argued to help maintain latent infection and to modulate the cellular environment to the benefit of latent virus. In this review, we will discuss these new findings and how they impact not only on our understanding of the biology of HCMV latency but also how they could provide tantalising glimpses into mechanisms that could become targets for the clearance of latent HCMV. PMID:24284875

  18. Cytomegalovirus Vaccines: Current Status and Future Prospects

    Science.gov (United States)

    Anderholm, KM; Bierle, CJ; Schleiss, MR

    2017-01-01

    Congenital human cytomegalovirus (HCMV) infection can result in in severe and permanent neurological injury in newborns, and vaccine development is accordingly a major public health priority. HCMV can also cause disease in solid organ (SOT) and hematopoietic stem cell transplant (HSCT) recipients, and a vaccine would be valuable in prevention of viremia and end-organ disease in these populations. Currently there is no licensed HCMV vaccine, but progress toward this goal has been made in recent clinical trials. A recombinant HCMV glycoprotein B (gB) vaccine has been shown to have some efficacy in prevention of infection in young women and adolescents, and provided benefit to HCMV-seronegative SOT recipients. Similarly, DNA vaccines based on gB and the immunodominant T-cell target, pp65 (ppUL83), have been shown to reduce viremia in HSCT patients. This review provides an overview of HCMV vaccine candidates in various stages of development, as well as an update on the current status of ongoing clinical trials. Protective correlates of vaccine-induced immunity may be different for pregnant woman and transplant patients. As more knowledge emerges about correlates of protection, the ultimate licensure of HCMV vaccines may reflect the uniqueness of the target populations being immunized. PMID:27882457

  19. Cytomegalovirus pneumonia in immunocompromised patients : HRCT findings

    International Nuclear Information System (INIS)

    Kim, Hyung Soo; Lee, Jin Seong

    1999-01-01

    The purpose of this study was to describe the HRCT findings of cytomegalovirus (CMV) pneumonia in immunocompromised patients. Eleven immunocompromised patients with proven CMV pneumonia underwent HRCT scanning. Three had undergone a transplant, three had a malignant tumor, two had undergone steroid therapy, one had pancytopenia and two had AIDS. In all patients, CMV was diagnosed by bronchoalveolar lavage culture. HRCT scans were retrospectively reviewed by two radiologists for disease distribution and patterns. HRCT findings included ground-glass opacity(n=11), consolidation (n=7), reticular opacity (n=10), multiple small nodules or mass (n=6), and bronchiectasis or bronchial wall thickening (n=5). Ground-glass opacity was usually distributed bilaterally and diffusely. Consolidation was most marked in the lower lobes, and reticular opacity and nodules or mass showed a variable, nonsegmental distribution. The HRCT findings of CMV pneumonia in immunocompromised patients were variable and nonspecific. The most common patterns included diffuse ground-glass opacity and consolidation, combined with variable reticulation

  20. The immunological burden of human cytomegalovirus infection.

    Science.gov (United States)

    Khan, Naeem

    2007-01-01

    Cytomegalovirus (CMV) is a persistent DNA virus that has evolved with humans to establish a finely balanced host-virus relationship. This balance is maintained by host immune surveillance since deficiencies in these processes can result in life-threatening disease, as observed in immunologically immature neonates and pharmacologically immunosuppressed transplant recipients. Both T cells and natural killer cells are intimately involved in maintaining asymptomatic infection by specific and non-specific recognition of infected cells. Under pressure from such host immune responses, CMV appears to have evolved elaborate strategies to subvert these responses in order to persist in the host. CMV target antigens are well characterized, with many CD8 T cell and CD4 T cell epitopes reported. This information is now being exploited to treat immunocompromised patients in order to boost virus-specific immunity. This review also discusses our current understanding of how virus carriage may skew lymphocyte populations in immunocompetent subjects and the association of CMV-seropositivity with immunosenescence.

  1. Human Cytomegalovirus Manipulation of Latently Infected Cells

    Directory of Open Access Journals (Sweden)

    John H. Sinclair

    2013-11-01

    Full Text Available Primary infection with human cytomegalovirus (HCMV results in the establishment of a lifelong infection of the host which is aided by the ability of HCMV to undergo a latent infection. One site of HCMV latency in vivo is in haematopoietic progenitor cells, resident in the bone marrow, with genome carriage and reactivation being restricted to the cells of the myeloid lineage. Until recently, HCMV latency has been considered to be relatively quiescent with the virus being maintained essentially as a “silent partner” until conditions are met that trigger reactivation. However, advances in techniques to study global changes in gene expression have begun to show that HCMV latency is a highly active process which involves expression of specific latency-associated viral gene products which orchestrate major changes in the latently infected cell. These changes are argued to help maintain latent infection and to modulate the cellular environment to the benefit of latent virus. In this review, we will discuss these new findings and how they impact not only on our understanding of the biology of HCMV latency but also how they could provide tantalising glimpses into mechanisms that could become targets for the clearance of latent HCMV.

  2. Highly efficient siRNA delivery system into human and murine cells using single-wall carbon nanotubes

    Science.gov (United States)

    Ladeira, M. S.; Andrade, V. A.; Gomes, E. R. M.; Aguiar, C. J.; Moraes, E. R.; Soares, J. S.; Silva, E. E.; Lacerda, R. G.; Ladeira, L. O.; Jorio, A.; Lima, P.; Leite, M. Fatima; Resende, R. R.; Guatimosim, S.

    2010-09-01

    Development of RNA interference (RNAi) technology utilizing short interfering RNA sequences (siRNA) has focused on creating methods for delivering siRNAs to cells and for enhancing siRNA stability in vitro and in vivo. Here, we describe a novel approach for siRNA cellular delivery using siRNA coiling into carboxyl-functionalized single-wall carbon nanotubes (SWCNTs). The CNT-siRNA delivery system successfully demonstrates nonspecific toxicity and transfection efficiency greater than 95%. This approach offers the potential for siRNA delivery into different types of cells, including hard-to-transfect cells, such as neuronal cells and cardiomyocytes. We also tested the CNT-siRNA system in a non-metastatic human hepatocellular carcinoma cell line (SKHep1). In all types of cells used in this work the CNT-siRNA delivery system showed high efficiency and apparent no side effects for various in vitro applications.

  3. Highly efficient siRNA delivery system into human and murine cells using single-wall carbon nanotubes

    Energy Technology Data Exchange (ETDEWEB)

    Ladeira, M S; Andrade, V A; Gomes, E R M; Aguiar, C J; Moraes, E R; Fatima Leite, M; Guatimosim, S [Department of Physiology and Biophysics, Federal University of Minas Gerais, Belo Horizonte, MG, 31270-901 (Brazil); Soares, J S; Silva, E E; Lacerda, R G; Ladeira, L O; Jorio, A; Resende, R R [Department of Physics, Federal University of Minas Gerais, Belo Horizonte, MG, 31270-901 (Brazil); Lima, P, E-mail: rrresende@hotmail.com, E-mail: guatimosim@icb.ufmg.br [Department of Biosystems Engineering, Federal University of Sao Joao Del Rei, Sao Joao Del Rei, MG, 36307-352 (Brazil)

    2010-09-24

    Development of RNA interference (RNAi) technology utilizing short interfering RNA sequences (siRNA) has focused on creating methods for delivering siRNAs to cells and for enhancing siRNA stability in vitro and in vivo. Here, we describe a novel approach for siRNA cellular delivery using siRNA coiling into carboxyl-functionalized single-wall carbon nanotubes (SWCNTs). The CNT-siRNA delivery system successfully demonstrates nonspecific toxicity and transfection efficiency greater than 95%. This approach offers the potential for siRNA delivery into different types of cells, including hard-to-transfect cells, such as neuronal cells and cardiomyocytes. We also tested the CNT-siRNA system in a non-metastatic human hepatocellular carcinoma cell line (SKHep1). In all types of cells used in this work the CNT-siRNA delivery system showed high efficiency and apparent no side effects for various in vitro applications.

  4. Transient Cerebral Arteriopathy in a Child Associated With Cytomegalovirus Infection

    Directory of Open Access Journals (Sweden)

    Wei-Tsun Kao MD

    2015-08-01

    Full Text Available Vascular wall injuries account for up to 80% of childhood strokes, excluding emboli of cardiac origin. Transient cerebral arteriopathy is a recently described entity that is increasingly recognized as an important cause. The cerebral arterial wall is thought to be affected by an inflammatory process related to certain infections. The authors report a 2.5-year-old girl with sudden left hemiplegia and aphasia. The neuroimaging showed occlusion of the right middle cerebral artery and ischemic damages. Laboratory revealed positive cytomegalovirus immunoglobulin M and G in cerebrospinal fluid and in early and late sera. Treatment with ganciclovir, anticytomegalovirus immunoglobulin, and prednisolone, followed by oral aspirin, resulted in clinical improvement. The follow-up neuroimaging showed stabilization of the arterial lesions without residual stenosis. To our knowledge, this is the first report of a cytomegalovirus-associated transient cerebral arteriopathy in an immunocompetent child. Our report demonstrates the propensity for cytomegalovirus to be involved in pediatric cerebral vascular disease.

  5. A Central Nervous System-Dependent Intron-Embedded Gene Encodes a Novel Murine Fyn Binding Protein.

    Science.gov (United States)

    Ben Khalaf, Noureddine; Taha, Safa; Bakhiet, Moiz; Fathallah, M Dahmani

    2016-01-01

    The interplay between the nervous and immune systems is gradually being unraveled. We previously reported in the mouse the novel soluble immune system factor ISRAA, whose activation in the spleen is central nervous system-dependent. We also showed that ISRAA plays a role in modulating anti-infection immunity. Herein, we report the genomic description of the israa locus, along with some insights into the structure-function relationship of the protein. Our findings revealed that israa is nested within intron 6 of the mouse zmiz1 gene. Protein sequence analysis revealed a typical SH2 binding motif (Y102TEV), with Fyn being the most likely binding partner. Docking simulation showed a favorable conformation for the ISRAA-Fyn complex, with a specific binding mode for the binding of the YTEV motif to the SH2 domain. Experimental studies showed that in vitro, recombinant ISRAA is phosphorylated by Fyn at tyrosine 102. Cell transfection and pull-down experiments revealed Fyn as a binding partner of ISRAA in the EL4 mouse T-cell line. Indeed, we demonstrated that ISRAA downregulates T-cell activation and the phosphorylation of an activation tyrosine (Y416) of Src-family kinases in mouse splenocytes. Our observations highlight ISRAA as a novel Fyn binding protein that is likely to be involved in a signaling pathway driven by the nervous system.

  6. Effects of Space Flight-Associated Stimuli on Development of Murine and Medaka Sensory-Motor Systems

    Science.gov (United States)

    Wolgemuth, Debra J.

    1999-01-01

    The major goal of these studies was to continue investigations into the influence of altered gravitational fields on the development and function of the vertebrate brain and nervous system. Of major focus during the 18-month finding period of this award was the maintenance of the animals used in the experimental mouse and medaka model paradigms. The experiments focused on characterization of stress-sensitive periods in neural development and immediate or delayed effects on gene expression, physiology and behavior. The hypothesis under investigation was that the environment of space will have biologically significant effects on the development and function of the vertebrate nervous system. We have postulated that these effects will be more significant on certain neural compartments, such as the vestibular-motor system, and that these effects will have greater impact at particular stages of embryonic and post-natal development of the animal. Development of the central nervous system is well known for its vulnerability and sensitivity to environmental stimuli, although the effects of gravitational influences are poorly understood. The long-term goals of this research effort, initiated previously and continued in limited capacity during this interim period, were to provide important new information on the effects of altered environments during these critical periods.

  7. Shedding light on the elusive role of endothelial cells in cytomegalovirus dissemination.

    Directory of Open Access Journals (Sweden)

    Torsten Sacher

    2011-11-01

    Full Text Available Cytomegalovirus (CMV is frequently transmitted by solid organ transplantation and is associated with graft failure. By forming the boundary between circulation and organ parenchyma, endothelial cells (EC are suited for bidirectional virus spread from and to the transplant. We applied Cre/loxP-mediated green-fluorescence-tagging of EC-derived murine CMV (MCMV to quantify the role of infected EC in transplantation-associated CMV dissemination in the mouse model. Both EC- and non-EC-derived virus originating from infected Tie2-cre(+ heart and kidney transplants were readily transmitted to MCMV-naïve recipients by primary viremia. In contrast, when a Tie2-cre(+ transplant was infected by primary viremia in an infected recipient, the recombined EC-derived virus poorly spread to recipient tissues. Similarly, in reverse direction, EC-derived virus from infected Tie2-cre(+ recipient tissues poorly spread to the transplant. These data contradict any privileged role of EC in CMV dissemination and challenge an indiscriminate applicability of the primary and secondary viremia concept of virus dissemination.

  8. Inhibition of natural killer cells by a cytomegalovirus MHC class I homologue in vivo.

    Science.gov (United States)

    Farrell, H E; Vally, H; Lynch, D M; Fleming, P; Shellam, G R; Scalzo, A A; Davis-Poynter, N J

    1997-04-03

    Herpesviruses, such as murine and human cytomegalovirus (MCMV and HCMV), can establish a persistent infection within the host and have diverse mechanisms as protection from host immune defences. Several herpesvirus genes that are homologous to host immune modulators have been identified, and are implicated in viral evasion of the host immune response. The discovery of a viral major histocompatibility complex (MHC) class I homologue, encoded by HCMV, led to speculation that it might function as an immune modulator and disrupt presentation of peptides by MHC class I to cytotoxic T cells. However, there is no evidence concerning the biological significance of this gene during viral infection. Recent analysis of the MCMV genome has also demonstrated the presence of a MHC class I homologue. Here we show that a recombinant MCMV, in which the gene encoding the class I homologue has been disrupted, has severely restricted replication during the acute stage of infection compared with wild-type MCMV. We demonstrate by in vivo depletion studies that natural killer (NK) cells are responsible for the attenuated phenotype of the mutant. Thus the viral MHC class I homologue contributes to immune evasion through interference with NK cell-mediated clearance.

  9. Suppressive versus augmenting effect of the same pretreatment regimen in two murine tumor systems with distinct effector mechanisms

    International Nuclear Information System (INIS)

    Fujiwara, Hiromi; Hamaoka, Toshiyuki; Kitagawa, Masayasu

    1978-01-01

    The effect of presensitization with x-irradiated tumor cells on the development of host's immune resistance against the tumor-associated transplantation antigens (TATA) was investigated in two syngeneic tumor systems with distinct effector mechanisms. When X5563 plasmacytoma, to which immune resistance was mediated exclusively by killer T lymphocytes, was intravenously inoculated into syngeneic C3H/He mice with lower number after 7000 R x-irradiation, the mice failed to exhibit any protective immunity against the subsequent challenge with viable tumor cells. Moreover, these mice lost their capability to develop any immune resistance even after an appropriate immunization procedure. The immunodepression induced by such a pretreatment regimen was specific for X5563 tumor. While no suppressor cell activity was detected in the above pretreated mice, serum factor(s) from these mice was virtually responsible for this suppression. When the serum factor mediating this tumor-specific suppression was fractionated on the Sephadex G-200 column, the suppressive activity was found in albumin-corresponding fraction, free of any immunoglobulin component. In contrast, in MM102 mammary tumor system, in which immune resistance is solely mediated by tumor-specific antibody, the pretreatment with x-irradiated MM102 cells augmented the induction of anti-tumor immunity. These results indicate that while tumor antigens given in the form of x-irradiated tumor cells suppress the induction of killer T cell-mediated immunity in one system, the same presensitization regimen of tumor antigens augments the antibody-mediated immunity in another system, thus giving a divergent effect on the distinct effector mechanisms of syngeneic tumor immunity. (author)

  10. Cardiac gene expression and systemic cytokine profile are complementary in a murine model of post-ischemic heart failure

    Directory of Open Access Journals (Sweden)

    S. Lachtermacher

    2010-04-01

    Full Text Available After myocardial infarction (MI, activation of the immune system and inflammatory mechanisms, among others, can lead to ventricular remodeling and heart failure (HF. The interaction between these systemic alterations and corresponding changes in the heart has not been extensively examined in the setting of chronic ischemia. The main purpose of this study was to investigate alterations in cardiac gene and systemic cytokine profile in mice with post-ischemic HF. Plasma was tested for IgM and IgG anti-heart reactive repertoire and inflammatory cytokines. Heart samples were assayed for gene expression by analyzing hybridization to AECOM 32k mouse microarrays. Ischemic HF significantly increased the levels of total serum IgM (by 5.2-fold and total IgG (by 3.6-fold associated with a relatively high content of anti-heart specificity. A comparable increase was observed in the levels of circulating pro-inflammatory cytokines such as IL-1β (3.8X and TNF-α (6.0X. IFN-γ was also increased by 3.1-fold in the MI group. However, IL-4 and IL-10 were not significantly different between the MI and sham-operated groups. Chemokines such as MCP-1 and IL-8 were 1.4- and 13-fold increased, respectively, in the plasma of infarcted mice. We identified 2079 well annotated unigenes that were significantly regulated by post-ischemic HF. Complement activation and immune response were among the most up-regulated processes. Interestingly, 21 of the 101 quantified unigenes involved in the inflammatory response were significantly up-regulated and none were down-regulated. These data indicate that post-ischemic heart remodeling is accompanied by immune-mediated mechanisms that act both systemically and locally.

  11. Murine model for congenital CMV infection and hearing impairment

    Directory of Open Access Journals (Sweden)

    Tao Liu

    2011-02-01

    Full Text Available Abstract Background Congenital cytomegalovirus (CMV infection is the leading cause of sensorineural hearing loss (SNHL, and SNHL is the most frequent sequela of congenital CMV infection. But the pathogenic mechanism remains unknown, and there is no ideal CMV intrauterine infection animal model to study the mechanisms by which SNHL develops. Methods We established the congenital murine cytomegalovirus (MCMV infection model by directly injecting the virus into the placenta on day 12.5 of gestation. Then, we observed the development and the MCMV congenital infection rate of the fetuses on the day they were born. Furthermore, we detected the auditory functions, the conditions of the MCMV infection, and the histological change of the inner ears of 28-day-old and 70-day-old offspring. Results Both the fetal loss rate and the teratism rate of offspring whose placentas were inoculated with MCMV increased, and their body length, head circumference, and weight decreased. The hearing level of offspring both decreased at both 28- and 70-days post birth; the 70-day-old mice developed lower hearing levels than did the 28-day old mice. No significant inflammatory changes in the cochleae of the mice were observed. MCMV DNA signals were mainly detected in the spiral ganglion neurons and the endolymph area, but not in the perilymph area. The number of neurons decreased, and their ultrastructures changed. Moreover, with age, the number of neurons dramatically decreased, and the ultrastructural lesions of neurons became much more severe. Conclusions The results suggest that the direct injection of MCMV into the placenta may efficiently cause fetal infection and disturb the intrauterine development of the fetus, and placental inoculation itself has no obvious adverse effects on offspring. The reduction in the number of spiral ganglion neurons and the ultrastructural lesions of the neurons may be the major cause of congenital CMV infection-induced progressive SNHL.

  12. Hydrogel Based 3-Dimensional (3D System for Toxicity and High-Throughput (HTP Analysis for Cultured Murine Ovarian Follicles.

    Directory of Open Access Journals (Sweden)

    Hong Zhou

    Full Text Available Various toxicants, drugs and their metabolites carry potential ovarian toxicity. Ovarian follicles, the functional unit of the ovary, are susceptible to this type of damage at all stages of their development. However, despite of the large scale of potential negative impacts, assays that study ovarian toxicity are limited. Exposure of cultured ovarian follicles to toxicants of interest served as an important tool for evaluation of toxic effects for decades. Mouse follicles cultured on the bottom of a culture dish continue to serve an important approach for mechanistic studies. In this paper, we demonstrated the usefulness of a hydrogel based 3-dimensional (3D mouse ovarian follicle culture as a tool to study ovarian toxicity in a different setup. The 3D in vitro culture, based on fibrin alginate interpenetrating network (FA-IPN, preserves the architecture of the ovarian follicle and physiological structure-function relationship. We applied the novel 3D high-throughput (HTP in vitro ovarian follicle culture system to study the ovotoxic effects of an anti-cancer drug, Doxorobucin (DXR. The fibrin component in the system is degraded by plasmin and appears as a clear circle around the encapsulated follicle. The degradation area of the follicle is strongly correlated with follicle survival and growth. To analyze fibrin degradation in a high throughput manner, we created a custom MATLAB® code that converts brightfield micrographs of follicles encapsulated in FA-IPN to binary images, followed by image analysis. We did not observe any significant difference between manually processed images to the automated MATLAB® method, thereby confirming that the automated program is suitable to measure fibrin degradation to evaluate follicle health. The cultured follicles were treated with DXR at concentrations ranging from 0.005 nM to 200 nM, corresponding to the therapeutic plasma levels of DXR in patients. Follicles treated with DXR demonstrated decreased

  13. Hydrogel Based 3-Dimensional (3D) System for Toxicity and High-Throughput (HTP) Analysis for Cultured Murine Ovarian Follicles.

    Science.gov (United States)

    Zhou, Hong; Malik, Malika Amattullah; Arab, Aarthi; Hill, Matthew Thomas; Shikanov, Ariella

    2015-01-01

    Various toxicants, drugs and their metabolites carry potential ovarian toxicity. Ovarian follicles, the functional unit of the ovary, are susceptible to this type of damage at all stages of their development. However, despite of the large scale of potential negative impacts, assays that study ovarian toxicity are limited. Exposure of cultured ovarian follicles to toxicants of interest served as an important tool for evaluation of toxic effects for decades. Mouse follicles cultured on the bottom of a culture dish continue to serve an important approach for mechanistic studies. In this paper, we demonstrated the usefulness of a hydrogel based 3-dimensional (3D) mouse ovarian follicle culture as a tool to study ovarian toxicity in a different setup. The 3D in vitro culture, based on fibrin alginate interpenetrating network (FA-IPN), preserves the architecture of the ovarian follicle and physiological structure-function relationship. We applied the novel 3D high-throughput (HTP) in vitro ovarian follicle culture system to study the ovotoxic effects of an anti-cancer drug, Doxorobucin (DXR). The fibrin component in the system is degraded by plasmin and appears as a clear circle around the encapsulated follicle. The degradation area of the follicle is strongly correlated with follicle survival and growth. To analyze fibrin degradation in a high throughput manner, we created a custom MATLAB® code that converts brightfield micrographs of follicles encapsulated in FA-IPN to binary images, followed by image analysis. We did not observe any significant difference between manually processed images to the automated MATLAB® method, thereby confirming that the automated program is suitable to measure fibrin degradation to evaluate follicle health. The cultured follicles were treated with DXR at concentrations ranging from 0.005 nM to 200 nM, corresponding to the therapeutic plasma levels of DXR in patients. Follicles treated with DXR demonstrated decreased survival rate in

  14. CC and CX3C chemokines differentially interact with the N terminus of the human cytomegalovirus-encoded US28 receptor

    DEFF Research Database (Denmark)

    Casarosa, Paola; Waldhoer, Maria; LiWang, Patricia J

    2005-01-01

    Human cytomegalovirus (HCMV) is the causative agent of life-threatening systemic diseases in immunocompromised patients as well as a risk factor for vascular pathologies, like atherosclerosis, in immunocompetent individuals. HCMV encodes a G-protein-coupled receptor (GPCR), referred to as US28...

  15. Influence of the route of sensitization on local and systemic immune responses in a murine model of type I allergy

    Science.gov (United States)

    REPA, A; WILD, C; HUFNAGL, K; WINKLER, B; BOHLE, B; POLLAK, A; WIEDERMANN, U

    2004-01-01

    The pathophysiological and immunological characteristics of allergic immune responses are controlled by a variety of factors. We have studied the extent to which the route of sensitization influences allergen-specific IgE synthesis and local airway inflammation using a mouse model of allergic sensitization to the major birch pollen allergen Bet v 1. Sensitization of BALB/c mice with recombinant (r)Bet v 1 was performed using intraperitoneal (IP), subcutaneous (SC) or aerosol (AS) sensitization protocols. Mice were analysed for allergen-specific serum antibodies by ELISA and IgE-dependent basophil degranulation. Proliferative responses and cytokine production of splenocytes were measured upon Bet v 1 stimulation in vitro. Bronchoalveolar lavages were performed after airway challenge with aerosolized birch pollen extract for assessment of eosinophilic airway inflammation and local cytokine production in vivo. Highest allergen specific IgE levels and IgE-dependent basophil degranulation were achieved using the SC route. High IL-5 production by spleen and lung cells was associated with pronounced eosinophilia in bronchoalveolar lavages. After IP sensitization, despite giving the highest IgG levels, only low IgE levels, basophil degranulation and IL-5 production were seen. On the other hand, AS sensitization, resulting in the lowest systemic IgE and IL-5 levels, led to a comparably strong airway inflammation as the SC route. Our finding that the route of sensitization can result in a dissociation of local and systemic immune responses may contribute to a better understanding of the pathogenesis of allergic diseases and help to develop new treatment strategies. PMID:15196238

  16. Immunoliposomes containing Soluble Leishmania Antigens (SLA) as a novel antigen delivery system in murine model of leishmaniasis.

    Science.gov (United States)

    Eskandari, Faeze; Talesh, Ghazal Alipour; Parooie, Maryam; Jaafari, Mahmoud Reza; Khamesipour, Ali; Saberi, Zahra; Abbasi, Azam; Badiee, Ali

    2014-11-01

    Development of new generation of vaccines against leishmaniasis requires adjuvants to elicit the type and intensity of immune response needed for protection. The coupling of target-specific antibodies to the liposomal surface to create immunoliposomes has appeared as a promising way in achieving a liposome active targeting. In this study, immunoliposomes were prepared by grafting non-immune mouse IgG onto the liposomal surface. The influence of active targeted immunoliposomes on the type and intensity of generated immune response against Leishmania was then investigated and compared with that of liposomes and control groups which received either SLA or HEPES buffer alone. All formulations contained SLA and were used to immunize the mice in the left hind footpad three times in 3-week intervals. Evaluation of lesion development and parasite burden in the foot and spleen after challenge with Leishmania major, evaluation of Th1 cytokine (IFN-γ), and titration of IgG isotypes were carried out to assess the type of generated immune response and the extent of protection. The results indicated that liposomes might be effective adjuvant systems to induce protection against L. major challenge in BALB/c mice, but stronger cell mediated immune responses were induced when immunoliposomes were utilized. Thus, immune modulation using immunoliposomes might be a practical approach to improve the immunization against L. major. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. The "silent" global burden of congenital cytomegalovirus.

    Science.gov (United States)

    Manicklal, Sheetal; Emery, Vincent C; Lazzarotto, Tiziana; Boppana, Suresh B; Gupta, Ravindra K

    2013-01-01

    Human cytomegalovirus (CMV) is a leading cause of congenital infections worldwide. In the developed world, following the virtual elimination of circulating rubella, it is the commonest nongenetic cause of childhood hearing loss and an important cause of neurodevelopmental delay. The seroprevalence of CMV in adults and the incidence of congenital CMV infection are highest in developing countries (1 to 5% of births) and are most likely driven by nonprimary maternal infections. However, reliable estimates of prevalence and outcome from developing countries are not available. This is largely due to the dogma that maternal preexisting seroimmunity virtually eliminates the risk for sequelae. However, recent data demonstrating similar rates of sequelae, especially hearing loss, following primary and nonprimary maternal infection have underscored the importance of congenital CMV infection in resource-poor settings. Although a significant proportion of congenital CMV infections are attributable to maternal primary infection in well-resourced settings, the absence of specific interventions for seronegative mothers and uncertainty about fetal prognosis have discouraged routine maternal antibody screening. Despite these challenges, encouraging results from prototype vaccines have been reported, and the first randomized phase III trials of prenatal interventions and prolonged postnatal antiviral therapy are under way. Successful implementation of strategies to prevent or reduce the burden of congenital CMV infection will require heightened global awareness among clinicians and the general population. In this review, we highlight the global epidemiology of congenital CMV and the implications of growing knowledge in areas of prevention, diagnosis, prognosis, and management for both low (50 to 70%)- and high (>70%)-seroprevalence settings.

  18. Congenital Cytomegalovirus among Children with Cerebral Palsy.

    Science.gov (United States)

    Smithers-Sheedy, Hayley; Raynes-Greenow, Camille; Badawi, Nadia; Fernandez, Marian A; Kesson, Alison; McIntyre, Sarah; Leung, Kin-Chuen; Jones, Cheryl A

    2017-02-01

    To determine the proportion of children with cerebral palsy (CP) and cytomegalovirus (CMV) DNA detected retrospectively in their newborn screening cards (NBSC), to compare the proportion of children with CMV DNA in their NBSC across spastic subtypes of CP, and to compare the sex and other characteristics of children with CP and CMV detected on their NSBC with those in whom CMV DNA was not detected. Retrospective observational study. Data were extracted from patient records on children with CP (birth years 1996-2014) from 2 Australian state CP registers and state-wide paediatric rehabilitation services with consent. NBSCs were retrospectively analyzed for CMV DNA by nested polymerase chain reaction (PCR) using primers against gB. Positive samples were validated using real time PCR for CMV UL83. Of 401 children recruited, 323 (80.5%) had an available NBSC. Of these, 31 (9.6%; 95% CI, 6.8-13.3) tested positive for CMV DNA by nested PCR for CMV gB, of whom 28 (8.7%; 95% CI, 6.1-12.2) also had CMV DNA detected by real-time PCR for CMV UL83. Detection of CMV DNA was significantly associated with epilepsy, but not with clinical or epidemiologic characteristics, including sex and pattern of spasticity. CMV viremia in the newborn period, indicating congenital CMV infection, is highly prevalent among children with CP. Further research is needed to investigate the mechanisms and contribution of congenital CMV to the causal pathways to CP. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Attitudes toward newborn screening for cytomegalovirus infection.

    Science.gov (United States)

    Din, Erica S; Brown, Cedric J; Grosse, Scott D; Wang, Chengbin; Bialek, Stephanie R; Ross, Danielle S; Cannon, Michael J

    2011-12-01

    Newborns are not routinely screened for cytomegalovirus (CMV), the leading infectious cause of developmental disability. Congenital CMV satisfies a number of criteria for inclusion in newborn screening, and screening potentially offers benefits. Screening could also introduce harms such as anxiety and unnecessary costs for the families of the substantial proportion of CMV-infected children who never develop CMV-related disabilities. Our objective was to assess attitudes toward newborn screening for CMV. We analyzed responses to 5 statements about CMV and newborn screening from 3922 participants in the 2009 HealthStyles survey, a national mail survey designed to include a group similar to the US population with respect to gender, age, race/ethnicity, income, and household size. Two-step cluster analysis was performed to identify clusters of parental attitudes. The majority of respondents strongly or somewhat agreed that they would want to have their newborn tested for CMV even if it was not performed routinely (84%), they had to pay $20 (87%), or CMV-related problems never developed (84%). Nearly half (47%) of them "would worry that the CMV test would lead to unneeded doctor visits and expenses," and 32% "think CMV problems are too rare to worry about." Three clusters of parent respondents were identified on the basis of their attitudes toward CMV screening: "strongly in favor" (31%), "moderately in favor" (49%), and "weakly opposed" (20%). Among most parents, costs, worry, and anxiety associated with newborn screening for CMV would be acceptable. Although attitudes were generally favorable, a minority of the parents were weakly opposed to newborn screening for CMV.

  20. Prenatal Diagnosis of Congenital Cytomegalovirus Infection

    Science.gov (United States)

    Lazzarotto, T.; Guerra, B.; Spezzacatena, P.; Varani, S.; Gabrielli, L.; Pradelli, P.; Rumpianesi, F.; Banzi, C.; Bovicelli, L.; Landini, M. P.

    1998-01-01

    We report here the results of a study on the prenatal diagnosis of congenital cytomegalovirus (CMV) infection. The study was carried out by both PCR and virus isolation from amniotic fluid (AF) for 82 pregnant women at risk of transmitting CMV for the detection of (i) seroconversion to CMV immunoglobulin G (IgG) positivity during the first trimester of pregnancy, (ii) symptomatic CMV infection in the mother during the first trimester of pregnancy or intrauterine growth retardation detected by ultrasound or abnormal ultrasonographic findings suggestive of fetal infections, and (iii) seropositivity for CMV-specific IgM. For 50 women, fetal blood (FB) was also obtained and tests for antigenemia and PCR were performed. The results indicate that AF is better than FB for the prenatal diagnosis of CMV infection. PCR with AF has a sensitivity (SNS) of 100%, a specificity (SPE) of 83.3%, a positive predictive value (PPV) of 40%, and a negative predictive value (NPV) of 100%; rapid virus isolation with the same material has an SNS of 50%, an SPE of 100%, a PPV of 100%, and an NPV of 94.7%. Fewer than 10% of the women positive for IgM by enzyme immunoassay (EIA) had a congenitally infected fetus or newborn infant. When EIA IgM positivity was confirmed by Western blotting (WB) and the WB profile was considered, the percent transmission detected among women with an “at-risk” profile was higher than that observed among IgM-positive women and was the same as that among women who seroconverted during the first trimester of pregnancy (transmission rates of 29 and 25%, respectively). PMID:9817869

  1. Trib1 Is Overexpressed in Systemic Lupus Erythematosus, While It Regulates Immunoglobulin Production in Murine B Cells

    Directory of Open Access Journals (Sweden)

    Léa Simoni

    2018-03-01

    Full Text Available Systemic lupus erythematosus (SLE is a severe and heterogeneous autoimmune disease with a complex genetic etiology, characterized by the production of various pathogenic autoantibodies, which participate in end-organ damages. The majority of human SLE occurs in adults as a polygenic disease, and clinical flares interspersed with silent phases of various lengths characterize the usual evolution of the disease in time. Trying to understand the mechanism of the different phenotypic traits of the disease, and considering the central role of B cells in SLE, we previously performed a detailed wide analysis of gene expression variation in B cells from quiescent SLE patients. This analysis pointed out an overexpression of TRIB1. TRIB1 is a pseudokinase that has been implicated in the development of leukemia and also metabolic disorders. It is hypothesized that Trib1 plays an adapter or scaffold function in signaling pathways, notably in MAPK pathways. Therefore, we planned to understand the functional significance of TRIB1 overexpression in B cells in SLE. We produced a new knock-in model with B-cell-specific overexpression of Trib1. We showed that overexpression of Trib1 specifically in B cells does not impact B cell development nor induce any development of SLE symptoms in the mice. By contrast, Trib1 has a negative regulatory function on the production of immunoglobulins, notably IgG1, but also on the production of autoantibodies in an induced model. We observed a decrease of Erk activation in BCR-stimulated Trib1 overexpressing B cells. Finally, we searched for Trib1 partners in B cells by proteomic analysis in order to explore the regulatory function of Trib1 in B cells. Interestingly, we find an interaction between Trib1 and CD72, a negative regulator of B cells whose deficiency in mice leads to the development of autoimmunity. In conclusion, the overexpression of Trib1 could be one of the molecular pathways implicated in the negative regulation

  2. Batf3 transcription factor-dependent DC subsets in murine CMV infection: differential impact on T-cell priming and memory inflation.

    Science.gov (United States)

    Torti, Nicole; Walton, Senta M; Murphy, Kenneth M; Oxenius, Annette

    2011-09-01

    Priming of CD8(+) T cells specific for viruses that interfere with the MHC class I presentation pathway is a challenge for the immune system and is believed to rely on cross-presentation. Cytomegalovirus (CMV) infection induces vigorous CD8(+) T-cell responses despite its potent immune evasion strategies. Furthermore, CD8(+) T cells specific for a subset of viral epitopes accumulate and are maintained at high levels exhibiting an activated phenotype - referred to as "inflationary T cells". Taking advantage Batf3(-/-) mice in which the development of cross-presenting CD8α(+) and CD103(+) DCs is severely compromised, we analyzed their role in the induction and inflation of murine (M)CMV-specific CD8(+) T-cell responses. We found that priming of MCMV-specific CD8(+) T cells was severely impaired in the absence of cross-presenting DCs. However, inflation of two immuno-dominant MCMV-specific CD8(+) T-cell populations was largely normal in the absence of cross-presenting DCs, indicating that inflation during latency was mainly dependent on direct antigen presentation. These results highlight differential antigen presentation requirements during acute and latent MCMV infection. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Transcriptome analysis of porcine thymus following porcine cytomegalovirus infection.

    Directory of Open Access Journals (Sweden)

    Xiao Liu

    Full Text Available Porcine cytomegalovirus (PCMV is a major immunosuppressive virus that mainly affects the immune function of T lymphocytes and macrophages. Despite being widely distributed around the world, no significantly different PCMV serotypes have been found. Moreover, the molecular immunosuppressive mechanisms of PCMV, along with the host antiviral mechanisms, are still not well characterized. To understand the potential impact of PCMV on the function of immune organs, we examined the transcriptome of PCMV-infected thymuses by microarray analysis. We identified 5,582 genes that were differentially expressed as a result of PCMV infection. Of these, 2,161 were upregulated and 3,421 were downregulated compared with the uninfected group. We confirmed the expression of 13 differentially expressed immune-related genes using quantitative real-time RT-PCR, and further confirmed the expression of six of those cytokines by western blot. Gene ontology, gene interaction networks, and KEGG pathway analysis of our results indicated that PCMV regulates multiple functional pathways, including the immune system, cellular and metabolic processes, networks of cytokine-cytokine receptor interactions, the TGF-β signaling pathway, the lymphocyte receptor signaling pathway, and the TNF-α signaling pathway. Our study is the first comprehensive attempt to explore the host transcriptional response to PCMV infection in the porcine immune system. It provides new insights into the immunosuppressive molecular mechanisms and pathogenesis of PCMV. This previously unrecognized endogenous antiviral mechanism has implications for the development of host-directed strategies for the prevention and treatment of immunosuppressive viral diseases.

  4. Treatment of cytomegalovirus retinitis with intravitreal ganciclovir: a ...

    African Journals Online (AJOL)

    A 60-year-old male on chemotherapy for multiple myeloma developed cytomegalovirus (CMV) retinitis in one eye. He was commenced on intravenous ganciclovir. This regime had to be modified, however, in view of the fact that he had bone marrow neoplasia (multiple myeloma) and was on chemotherapy.

  5. Effects of Acute Cytomegalovirus Infection on Rat Islet Allograft Survival

    NARCIS (Netherlands)

    Smelt, M. J.; Faas, M. M.; Melgert, B. N.; de Vos, P.; de Haan, Bart; de Haan, Aalzen

    2011-01-01

    Transplantation of pancreatic islets is a promising therapy for the treatment of type 1 diabetes mellitus. However, long-term islet graft survival rates are still unsatisfactory low. In this study we investigated the role of cytomegalovirus (CMV) in islet allograft failure. STZ-diabetic rats

  6. Incidence and risk of primary cytomegalovirus infection among ...

    African Journals Online (AJOL)

    Background: Primary cytomegalovirus infection in pregnancy remains a leading cause of congenital hearing loss and mental retardation worldwide. Most women acquired CMV infection horizontally from their infected children or younger children who were cross- infected at school or day care facilities. Over 90% of infected ...

  7. Congenital cytomegalovirus infection: review of the epidemiology and outcome.

    NARCIS (Netherlands)

    Gaytant, M.A.; Steegers, E.A.P.; Semmekrot, B.A.; Merkus, J.M.W.M.; Galama, J.M.D.

    2002-01-01

    Cytomegalovirus (CMV) is one of the most common viral causes of congenital infection. A future decision to lower its incidence by vaccination will depend on epidemiological conditions within a country and on the safety of the vaccine to be used, because a life vaccine may cause latency and

  8. Neonatal screening parameters in infants with congenital Cytomegalovirus infection.

    NARCIS (Netherlands)

    Rovito, Roberta; Korndewal, Marjolein J; Schielen, Peter C J I; Kroes, Aloys C M; Vossen, Ann C T M

    2017-01-01

    Congenital Cytomegalovirus infection (cCMV) is the most common cause of congenital infections worldwide that can cause long-term impairment (LTI). The metabolic alterations due to cCMV are largely unknown. This study aims to assess the metabolites included in the neonatal screening in relation to

  9. Sero-Prevalence of Cytomegalovirus Infection among New -Born ...

    African Journals Online (AJOL)

    Aim: The aim of this study was to determine the seroprevalence of cytomegalovirus (CMV) infection in newborn babies in our environment and hence the suitability of cord blood for stem cell transplantation. Methodology: Cord blood sera of 212 babies in the labour room of the University of Benin Teaching Hospital (UBTH) ...

  10. Molecular diagnostic of cytomegalovirus, Epstein Barr virus and ...

    African Journals Online (AJOL)

    Introduction: in most developing countries, Cytomegalovirus (CMV), Epstein Barr virus (EBV) and Herpes virus 6 (HHV-6) are not diagnosed in blood donors. The aim of this study is to determine the prevalence of these viruses in blood donors from the city of Ouagadougou, Burkina Faso. Methods: the study included 198 ...

  11. Cytomegalovirus infection in NICU admitted neonates in Boushehr

    Directory of Open Access Journals (Sweden)

    Maryam Sanjideh

    2016-01-01

    Full Text Available Background: Cytomegalovirus is the most prevalent cause of congenital infections and the most important cause of congenital deafness. Which it's spread is about 0.64% of all birth which differ based on geolocation, race and socioeconomically situations. This proposal accomplished in the end of July until middle of February 2014 with the goal of studying Cytomegalovirus infection distribution among newborns who are hospitalized in Bushehr Shohadaye Khalij Fars hospital NICU. Material & Method: 80 urine samples were collected between July until February 2014 in NICU of Bushehr Khalij Fars hospitalized neonates. Samples were tested by PCR method on urine samples to find if they are infected by cytomegalovirus. Results: Mean age of neonates was 30.59±9.30 days. Only one newborn under 30 days had Cytomegalovirus and 11 cases older than 30 days had positive reaction. The relation between age and CMV seropositivity was statistically valid (p<0.05.this means only 1.2% of newborns are CMV and 55% are older than 1 month. Conclusion: The pattern of CMV seropositivity shows that most infections may be acquired from environment. According to low prevalence of congenital CMV infection, there is no need to introduce preventive methods and following present guidelines is enough.

  12. Initial characterization of four cytomegalovirus strains isolated from chimpanzees

    International Nuclear Information System (INIS)

    Swinkels, B.W.; Geelen, J.L.M.C.; Wertheim-van Dillen, P.; Noordaa, J. van der; Es, A.A. van

    1984-01-01

    Cytomegalovirus was isolated from chimpanzees. The chimpanzee CMV showed a strong antigenic relationship with human CMV. The genome of the chimpanzee CMV was found to have a molecular weight of 147 +- 11.3 x 10 6 and showed partial homology to human CMV DNA. (Author)

  13. Autism in a Child with Congenital Cytomegalovirus Infection.

    Science.gov (United States)

    Markowitz, Phillip I.

    1983-01-01

    A case study is described in which early infantile autism was diagnosed in a child with congenital cytomegalovirus (CMU) infection. It is suggested that congenital infection should be considered as an etiological agent in autism. The case's synergistic effect of CMU-induced brain damage, deafness, and maternal deprivation in noted. (CL)

  14. Is antenatal screening for rubella and cytomegalovirus justified?

    African Journals Online (AJOL)

    Abstract Altogether 2 250 asymptomatic pregnant women attending an antenatal clinic were investigated for serological evidence of past exposure to rubella and cytomegalovirus (CMV) as well as for active primary infection or reinfectionJreactivation. Only. 7 (0,3%) active rubella infections were diagnosed, none of them ...

  15. Infantile Spasms and Cytomegalovirus Infection: Antiviral and Antiepileptic Treatment

    Science.gov (United States)

    Dunin-Wasowicz, Dorota; Kasprzyk-Obara, Jolanta; Jurkiewicz, Elzbieta; Kapusta, Monika; Milewska-Bobula, Bogumila

    2007-01-01

    From 1 January 1995 to 31 December 2004, 22 patients (13 males, nine females; age range 2-12mo) with infantile spasms and cytomegalovirus (CMV) infection were treated with intravenous ganciclovir (GCV) and antiepileptic drugs. GCV was given for 3 to 12 weeks with a 1-month interval (one, two, or three courses). Epileptic spasms occurred before…

  16. Low humoral responses to human cytomegalovirus is associated ...

    African Journals Online (AJOL)

    Human cytomegalovirus (HCMV) is one of the opportunistic infections associated with significant morbidity and mortality among HIV/AIDS patients especially before introduction of antiretroviral therapy (ART). Little is known regarding the humoral immune response against HCMV in relation to CD4 counts among HIV ...

  17. Cytomegalovirus antibodies among healthy blood donors at Lagos ...

    African Journals Online (AJOL)

    Objectives. Cytomegalovirus (CMV) is found worldwide in all geographical locations and socio-economic groups and is the virus most frequently transmitted to a developing child before birth. This study aimed to determine the prevalence and risk factors for CMV antibodies among healthy blood donors at Lagos University ...

  18. Prevalence and detection of cytomegalovirus by polymerase chain ...

    African Journals Online (AJOL)

    A total of 327 women were screened, amongst them, 7 (2.14%) were cytomegalovirus (CMV) DNA positive by polymerase chain reaction (PCR). Antibodies against toxoplasma were also detected in 106 (32.41%) women, while 54 (16.51%) were anti CMV positive. Eleven (3.36%) and thirteen (3.97%) women were anti HSV ...

  19. Brief Report: Autistic Disorder in Three Children with Cytomegalovirus Infection

    Science.gov (United States)

    Sweeten, Thayne L.; Posey, David J.; McDougle, Christopher J.

    2004-01-01

    Previous research has identified a relationship between autistic disorder (autism) and specific congenital infections. Three cases of congenital or perinatal cytomegalovirus (CMV) infection occurring in association with autism are described. Hypothetical mechanisms relating congenital infection, such as CMV, to the development of autism are…

  20. Cytomegalovirus infections among low birth weight infants in a ...

    African Journals Online (AJOL)

    Human Cytomegalovirus (HCMV) is one of the leading causes of congenital infections, which can lead to severe foetal anomalies or even foetal loss. In order to determine the incidence of congenital HCMV infection in low birth weight neonates and the most prevalent genotype, cord blood samples were collected from a ...

  1. Childhood environments and cytomegalovirus serostatus and reactivation in adults

    NARCIS (Netherlands)

    Janicki-Deverts, D.; Cohen, S.; Doyle, W.J.; Marsland, A.L.; Bosch, J.

    2014-01-01

    Childhood adversity, defined in terms of material hardship or physical or emotional maltreatment has been associated with risk for infection with cytomegalovirus (CMV) among children and adolescents, and with CMV reactivation in children and adults. The present study examined whether different

  2. Antibody responses to human cytomegalovirus-specific polypeptides studied by immunoblotting in relation to viral load during cytomegalovirus infection

    NARCIS (Netherlands)

    van Zanten, J; van der Giessen, M.; van Son, W. J.; The, T. Hauw

    The humoral immune response to individual proteins of human cytomegalovirus (CMV) was studied by immunoblotting. CMV polypeptides present in an extract of CMV-infected fibroblasts in a late stage of infection were recognized by sera of healthy seropositive individuals and transplant recipients who

  3. Immune senescence: relative contributions of age and cytomegalovirus infection.

    Directory of Open Access Journals (Sweden)

    Andrea Mekker

    Full Text Available Immune senescence, defined as the age-associated dysregulation and dysfunction of the immune system, is characterised by impaired protective immunity and decreased efficacy of vaccines. Recent clinical, epidemiological and immunological studies suggest that Cytomegalovirus (CMV infection may be associated with accelerated immune senescence, possibly by restricting the naïve T cell repertoire. However, direct evidence whether and how CMV-infection is implicated in immune senescence is still lacking. In this study, we have investigated whether latent mouse CMV (MCMV infection with or without thymectomy (Tx alters antiviral immunity of young and aged mice. After infection with lymphocytic choriomeningitis virus (LCMV or Vaccinia virus, specific antiviral T cell responses were significantly reduced in old, old MCMV-infected and/or Tx mice compared to young mice. Importantly, control of LCMV replication was more profoundly impaired in aged MCMV-infected mice compared to age-matched MCMV-naïve or young mice. In addition, latent MCMV infection was associated with slightly reduced vaccination efficacy in old Tx mice. In contrast to the prevailing hypothesis of a CMV-mediated restriction of the naïve T cell repertoire, we found similar naïve T cell numbers in MCMV-infected and non-infected mice, whereas ageing and Tx clearly reduced the naïve T cell pool. Instead, MCMV-infection expanded the total CD8(+ T cell pool by a massive accumulation of effector memory T cells. Based on these results, we propose a new model of increased competition between CMV-specific memory T cells and any 'de novo' immune response in aged individuals. In summary, our results directly demonstrate in a mouse model that latent CMV-infection impairs immunity in old age and propagates immune senescence.

  4. Crystal Structure of the Human Cytomegalovirus Glycoprotein B.

    Directory of Open Access Journals (Sweden)

    Heidi G Burke

    2015-10-01

    Full Text Available Human cytomegalovirus (HCMV, a dsDNA, enveloped virus, is a ubiquitous pathogen that establishes lifelong latent infections and caused disease in persons with compromised immune systems, e.g., organ transplant recipients or AIDS patients. HCMV is also a leading cause of congenital viral infections in newborns. Entry of HCMV into cells requires the conserved glycoprotein B (gB, thought to function as a fusogen and reported to bind signaling receptors. gB also elicits a strong immune response in humans and induces the production of neutralizing antibodies although most anti-gB Abs are non-neutralizing. Here, we report the crystal structure of the HCMV gB ectodomain determined to 3.6-Å resolution, which is the first atomic-level structure of any betaherpesvirus glycoprotein. The structure of HCMV gB resembles the postfusion structures of HSV-1 and EBV homologs, establishing it as a new member of the class III viral fusogens. Despite structural similarities, each gB has a unique domain arrangement, demonstrating structural plasticity of gB that may accommodate virus-specific functional requirements. The structure illustrates how extensive glycosylation of the gB ectodomain influences antibody recognition. Antigenic sites that elicit neutralizing antibodies are more heavily glycosylated than those that elicit non-neutralizing antibodies, which suggest that HCMV gB uses glycans to shield neutralizing epitopes while exposing non-neutralizing epitopes. This glycosylation pattern may have evolved to direct the immune response towards generation of non-neutralizing antibodies thus helping HCMV to avoid clearance. HCMV gB structure provides a starting point for elucidation of its antigenic and immunogenic properties and aid in the design of recombinant vaccines and monoclonal antibody therapies.

  5. Signal peptide-dependent inhibition of MHC class I heavy chain translation by rhesus cytomegalovirus.

    Directory of Open Access Journals (Sweden)

    Colin J Powers

    2008-10-01

    Full Text Available The US2-11 region of human and rhesus cytomegalovirus encodes a conserved family of glycoproteins that inhibit MHC-I assembly with viral peptides, thus preventing cytotoxic T cell recognition. Since HCMV lacking US2-11 is no longer able to block assembly and transport of MHC-I, we examined whether this is also observed for RhCMV lacking the corresponding region. Unexpectedly, recombinant RhCMV lacking US2-11 was still able to inhibit MHC-I expression in infected fibroblasts, suggesting the presence of an additional MHC-I evasion mechanism. Progressive deletion analysis of RhCMV-specific genomic regions revealed that MHC-I expression is fully restored upon additional deletion of rh178. The protein encoded by this RhCMV-specific open reading frame is anchored in the endoplasmic reticulum membrane. In the presence of rh178, RhCMV prevented MHC-I heavy chain (HC expression, but did not inhibit mRNA transcription or association of HC mRNA with translating ribosomes. Proteasome inhibitors stabilized a HC degradation intermediate in the absence of rh178, but not in its presence, suggesting that rh178 prevents completion of HC translation. This interference was signal sequence-dependent since replacing the signal peptide with that of CD4 or murine HC rendered human HCs resistant to rh178. We have identified an inhibitor of antigen presentation encoded by rhesus cytomegalovirus unique in both its lack of homology to any other known protein and in its mechanism of action. By preventing signal sequence-dependent HC translocation, rh178 acts prior to US2, US3 and US11 which attack MHC-I proteins after protein synthesis is completed. Rh178 is the first viral protein known to interfere at this step of the MHC-I pathway, thus taking advantage of the conserved nature of HC leader peptides, and represents a new mechanism of translational interference.

  6. Peptide inhibition of human cytomegalovirus infection

    Directory of Open Access Journals (Sweden)

    Morris Cindy A

    2011-02-01

    Full Text Available Abstract Background Human cytomegalovirus (HCMV is the most prevalent congenital viral infection in the United States and Europe causing significant morbidity and mortality to both mother and child. HCMV is also an opportunistic pathogen in immunocompromised individuals, including human immunodeficiency virus (HIV- infected patients with AIDS, and solid organ and allogeneic stem cell transplantation recipients. Current treatments for HCMV-associated diseases are insufficient due to the emergence of drug-induced resistance and cytotoxicity, necessitating novel approaches to limit HCMV infection. The aim of this study was to develop therapeutic peptides targeting glycoprotein B (gB, a major glycoprotein of HCMV that is highly conserved across the Herpesviridae family, that specifically inhibit fusion of the viral envelope with the host cell membrane preventing HCMV entry and infection. Results Using the Wimley-White Interfacial Hydrophobicity Scale (WWIHS, several regions within gB were identified that display a high potential to interact with lipid bilayers of cell membranes and hydrophobic surfaces within proteins. The ability of synthetic peptides analogous to WWIHS-positive sequences of HCMV gB to inhibit viral infectivity was evaluated. Human foreskin fibroblasts (HFF were infected with the Towne-GFP strain of HCMV (0.5 MOI, preincubated with peptides at a range of concentrations (78 nm to 100 μM, and GFP-positive cells were visualized 48 hours post-infection by fluorescence microscopy and analyzed quantitatively by flow cytometry. Peptides that inhibited HCMV infection demonstrated different inhibitory concentration curves indicating that each peptide possesses distinct biophysical properties. Peptide 174-200 showed 80% inhibition of viral infection at a concentration of 100 μM, and 51% and 62% inhibition at concentrations of 5 μM and 2.5 μM, respectively. Peptide 233-263 inhibited infection by 97% and 92% at concentrations of 100

  7. The role of cytomegalovirus infection in the pathogenesis of periodontal diseases.

    Science.gov (United States)

    Beader, Natasa; Ivić-Kardum, Marija

    2011-03-01

    The main characteristic ofperiodontal disease is chronic inflammation that leads to progressive destruction of the connective tissues and bone with subsequent tooth mobility and finally tooth loss. Traditionally, the pathogenesis of periodontitis was based on the infection caused by bacteria that colonize tooth surface and gingival sulcus. Accumulated evidence show that host response factors such as inflammatory reaction and activation of the innate immune system are critical to the pathogenesis of periodontal disease. Periodontal disease has been widely recognized as a chronic disease but the nature of chronicity remains unclear. The question is whether periodontal disease is a continuous process or consists of episodes of exacerbations and remissions. Maybe cytomegalovirus infection of the periodontium, depending on the latent or active phase of infection, can partly explain the episodic progressive nature of periodontal disease. Cytomegalovirus infection impairs periodontal defense and permits overgrowth of periodontopathogenic bacteria. Owing to advances in new technologies, experimental evidence show the influence and interrelatedness of genomic, epigenetic, proteomic and metabolic factors in the pathogenesis of periodontal disease. Data on the pathogenesis of periodontal disease are reviewed.

  8. Cytomegalovirus latency and reactivation: Recent insights into an age old problem

    Science.gov (United States)

    Dupont, L.; Reeves, M.B.

    2017-01-01

    Summary Human cytomegalovirus (HCMV) infection remains a major cause of morbidity in patient populations. In certain clinical settings it is the reactivation of the pre-existing latent infection in the host that poses the health risk. The prevailing view of HCMV latency was that the virus was essentially quiescent in myeloid progenitor cells and that terminal differentiation resulted in the initiation of the lytic lifecycle and reactivation of infectious virus. However, our understanding of HCMV latency and reactivation at the molecular level has been greatly enhanced through recent advancements in systems biology approaches to perform global analyses of both experimental and natural latency. These approaches, in concert with more classical reductionist experimentation, are furnishing researchers with new concepts in cytomegalovirus latency and suggest that latent infection is far more active than first thought. In this review we will focus on new studies that suggest that distinct sites of cellular latency could exist in the human host which, when coupled with recent observations that report different transcriptional programmes within cells of the myeloid lineage, argues for multiple latent phenotypes that could impact differently on the biology of this virus in vivo. Finally, we will also consider how the biology of the host cell where the latent infection persists further contributes to the concept of a spectrum of latent phenotypes in multiple cell types which can be exploited by the virus. PMID:26572645

  9. Genotype distribution, viral load and clinical characteristics of infants with postnatal or congenital cytomegalovirus infection.

    Directory of Open Access Journals (Sweden)

    Joppe Nijman

    Full Text Available Congenital cytomegalovirus infection is a leading cause of long-term sequelae. Cytomegalovirus is also frequently transmitted to preterm infants postnatally, but these infections are mostly asymptomatic. A correlation between cytomegalovirus genotypes and clinical manifestations has been reported previously in infants with congenital infection, but not in preterm infants with postnatal infection.The main objective of this study was to investigate cytomegalovirus genotype distribution in postnatal and congenital cytomegalovirus infection and its association with disease severity.Infants admitted to the neonatal intensive care unit of the University Medical Center Utrecht, The Netherlands between 2003-2010 and diagnosed with postnatal or congenital cytomegalovirus infection were included. Classification of cytomegalovirus isolates in genotypes was performed upon amplification and sequencing of the cytomegalovirus UL55 (gB and UL144 genes. Clinical data, cerebral abnormalities, neurodevelopmental outcome and viral load were studied in relation to genotype distribution.Genotyping results were obtained from 58 preterm infants with postnatal cytomegalovirus infection and 13 infants with congenital cytomegalovirus infection. Postnatal disease was mild in all preterm infants and all had favourable outcome. Infants with congenital infection were significantly more severely affected than infants with postnatal infection. Seventy-seven percent of these infants were symptomatic at birth, 2/13 died and 3/13 developed long-term sequelae (median follow-up 6 (range 2-8 years. The distribution of cytomegalovirus genotypes was comparable for postnatal and congenital infection. UL55 genotype 1 and UL144 genotype 3 were predominant genotypes in both groups.Distribution of UL55 and UL144 genotypes was similar in asymptomatic postnatal and severe congenital CMV infection suggesting that other factors rather than cytomegalovirus UL55 and UL144 genotype are responsible

  10. Genotype distribution, viral load and clinical characteristics of infants with postnatal or congenital cytomegalovirus infection.

    Science.gov (United States)

    Nijman, Joppe; Mandemaker, Femke S; Verboon-Maciolek, Malgorzata A; Aitken, Susan C; van Loon, Anton M; de Vries, Linda S; Schuurman, Rob

    2014-01-01

    Congenital cytomegalovirus infection is a leading cause of long-term sequelae. Cytomegalovirus is also frequently transmitted to preterm infants postnatally, but these infections are mostly asymptomatic. A correlation between cytomegalovirus genotypes and clinical manifestations has been reported previously in infants with congenital infection, but not in preterm infants with postnatal infection. The main objective of this study was to investigate cytomegalovirus genotype distribution in postnatal and congenital cytomegalovirus infection and its association with disease severity. Infants admitted to the neonatal intensive care unit of the University Medical Center Utrecht, The Netherlands between 2003-2010 and diagnosed with postnatal or congenital cytomegalovirus infection were included. Classification of cytomegalovirus isolates in genotypes was performed upon amplification and sequencing of the cytomegalovirus UL55 (gB) and UL144 genes. Clinical data, cerebral abnormalities, neurodevelopmental outcome and viral load were studied in relation to genotype distribution. Genotyping results were obtained from 58 preterm infants with postnatal cytomegalovirus infection and 13 infants with congenital cytomegalovirus infection. Postnatal disease was mild in all preterm infants and all had favourable outcome. Infants with congenital infection were significantly more severely affected than infants with postnatal infection. Seventy-seven percent of these infants were symptomatic at birth, 2/13 died and 3/13 developed long-term sequelae (median follow-up 6 (range 2-8) years). The distribution of cytomegalovirus genotypes was comparable for postnatal and congenital infection. UL55 genotype 1 and UL144 genotype 3 were predominant genotypes in both groups. Distribution of UL55 and UL144 genotypes was similar in asymptomatic postnatal and severe congenital CMV infection suggesting that other factors rather than cytomegalovirus UL55 and UL144 genotype are responsible for the

  11. Colonic stenosis post-necrotizing enterocolitis in term newborn with acquired cytomegalovirus infection.

    Science.gov (United States)

    Marseglia, L; Manti, S; D'Angelo, G; Lima, M; Impellizzeri, P; Romeo, C; Gitto, E

    2015-01-01

    Necrotizing enterocolitis is a gastrointestinal emergency typical of premature infants. Intestinal strictures infrequently complicate medical or surgical treatment of necrotizing enterocolitis. Postnatal cytomegalovirus infection with gastrointestinal linvolvement has occasionally been described in subjects with necrotizing enterocolitis. We report the case of a full term infant presenting necrotizing enterocolitis, acquired cytomegalovirus infection and post necrotizing enterocolitis colonic stricture.List of abbreviations: necrotizing enterocolitis = NEC,cytomegalovirus = CMV. Celsius.

  12. Murine CMV-induced hearing loss is associated with inner ear inflammation and loss of spiral ganglia neurons.

    Directory of Open Access Journals (Sweden)

    Russell D Bradford

    2015-04-01

    Full Text Available Congenital human cytomegalovirus (HCMV occurs in 0.5-1% of live births and approximately 10% of infected infants develop hearing loss. The mechanism(s of hearing loss remain unknown. We developed a murine model of CMV induced hearing loss in which murine cytomegalovirus (MCMV infection of newborn mice leads to hematogenous spread of virus to the inner ear, induction of inflammatory responses, and hearing loss. Characteristics of the hearing loss described in infants with congenital HCMV infection were observed including, delayed onset, progressive hearing loss, and unilateral hearing loss in this model and, these characteristics were viral inoculum dependent. Viral antigens were present in the inner ear as were CD(3+ mononuclear cells in the spiral ganglion and stria vascularis. Spiral ganglion neuron density was decreased after infection, thus providing a mechanism for hearing loss. The lack of significant inner ear histopathology and persistence of inflammation in cochlea of mice with hearing loss raised the possibility that inflammation was a major component of the mechanism(s of hearing loss in MCMV infected mice.

  13. Color doppler and power doppler ultrasonography in renal transplant recipients with cytomegalovirus infection

    International Nuclear Information System (INIS)

    Wan Guangsheng; Chen Xionghui; Li Meidi; Shao Zheying; Peng Shubai

    2003-01-01

    Objective: To investigate the features of color Doppler and Doppler ultrasonography of transplanted kidneys in patients with cytomegalovirus infections. Methods: Color Doppler and Power Doppler ultrasonography was used to examine transplanted kidneys in 36 recipients with cytomegalovirus infection. The blood flow area ratios (BFAR), the volumes, the resistive indexes (RI), the peak flow velocities in parenchymal arteries (Vmax) were measured and compared with no complication (normal) cases. Results: BFAR was lower in patients with cytomegalovirus infection than that in no complication (normal) cases (P 0.05). Conclusions: The blood flows of transplanted kidneys were reduced in patients with cytomegalovirus infection. To monitor BFAR of transplanted kidneys was contributed to evaluate management effect

  14. Human Cytomegalovirus-Encoded Receptor US28 Is Expressed in Renal Allografts and Facilitates Viral Spreading In Vitro

    NARCIS (Netherlands)

    Lollinga, Wouter T.; de Wit, Raymond H.; Rahbar, Afsar; Vasse, Gwenda F.; Davoudi, Belghis; Diepstra, Arjan; Riezebos-Brilman, Annelies; Harmsen, Martin C.; Hillebrands, Jan-Luuk; Soderberg-Naucler, Cecilia; van Son, Willem J.; Smit, Martine J.; Sanders, Jan-Stephan; van den Born, Jacob

    BACKGROUND: Renal transplantation is the preferred treatment for patients with end-stage renal disease. Human cytomegalovirus (HCMV) activation is associated with decreased renal graft function and survival. Human cytomegalovirus encodes several immune modulatory proteins, including the G

  15. Serum neopterin/creatinine values correlate with severity of symptoms caused by cytomegalovirus infection in renal transplant recipients

    NARCIS (Netherlands)

    Raasveld, M. H.; Bloemena, E.; Wertheim-van Dillen, P.; Surachno, J.; Wilmink, J. M.; ten Berge, I. J.

    1993-01-01

    Serum neopterin/creatinine ratios were longitudinally measured in 86 renal transplant recipients from the day before transplantation until 4 months after transplantation, and the relationship to the clinical symptoms of cytomegalovirus (CMV) infection was studied. Infection with cytomegalovirus

  16. Cytomegalovirus retinitis treated with valganciclovir in Wegener’s granulomatosis

    Directory of Open Access Journals (Sweden)

    Kabata Y

    2012-03-01

    Full Text Available Yoshiaki Kabata1, Genichiro Takahashi1, Hiroshi Tsuneoka21Department of Ophthalmology, Jikei University School of Medicine, Katsushika Medical Center, Katsushika, Tokyo, Japan; 2Department of Ophthalmology, Jikei University School of Medicine, Minato, Tokyo, JapanAbstract: A case of cytomegalovirus (CMV retinitis in a patient with Wegener’s granulomatosis treated with oral valganciclovir as maintenance therapy is reported. A 68-year-old male patient with anti-proteinase-3 ANCA-positive Wegener’s granulomatosis who was receiving immunosuppressive therapy with methylprednisolone, cyclophosphamide, and azathioprine developed CMV retinitis. The patient received intravenous ganciclovir as induction therapy and oral valganciclovir as maintenance therapy. The patient responded to treatment and showed no recurrence for 8 months. There were no serious adverse effects associated with oral valganciclovir. Oral valganciclovir is convenient and effective for the management of CMV retinitis in the patient with Wegener’s granulomatosis.Keywords: cytomegalovirus retinitis, Wegener’s granulomatosis, valganciclovir, ganciclovir, maintenance therapy

  17. Cytomegalovirus infection can mimic genetic nephrotic syndrome: a case report.

    Science.gov (United States)

    Hogan, Julien; Fila, Marc; Baudouin, Véronique; Peuchmaur, Michel; Deschênes, Georges; Niel, Olivier

    2015-09-22

    Nephrotic syndrome is a relatively rare but serious condition in children. Infantile nephrotic syndrome often has a genetic origin; the treatment is then symptomatic, with a poor prognosis, and a rapid evolution to chronic kidney disease. However, non-genetic infantile nephrotic syndrome has been identified. Here we report for the first time in a child a nephrotic syndrome as the sole clinical expression of a cytomegalovirus infection. The patient was 5 months old when he presented with a nephrotic syndrome. An exhaustive genetic testing was conducted and came back negative. A viral work-up only showed a positive cytomegalovirus PCR. Antiviral treatment lead to a complete remission of the nephrotic syndrome, with no requirement for steroid therapy. Renal function remained normal throughout follow-up. Nephrotic syndrome should always be carefully investigated in children. This observation reinforces the connection between viral infections and pediatric nephrotic syndrome, sparking more controversy about an infectious origin to childhood nephrotic disease.

  18. A case of cytomegalovirus colitis in an immunocompetent host

    Directory of Open Access Journals (Sweden)

    P P Binny

    2016-01-01

    Full Text Available Cytomegalovirus (CMV is a common pathogen worldwide. Clinically significant CMV infection is mostly seen in the context of immunosuppression, whether congenital, acquired, or iatrogenic. In the recent past, however, in both adults and children, an increasing number of moderate-to-severe cases of colitis have been described among immunocompetent patients. We describe a rare case of severe CMV colitis in an immunocompetent patient which resolved spontaneously.

  19. Knowledge and Awareness of Congenital Cytomegalovirus Among Women

    Science.gov (United States)

    Jeon, Jiyeon; Victor, Marcia; Adler, Stuart P.; Arwady, Abigail; Demmler, Gail; Fowler, Karen; Goldfarb, Johanna; Keyserling, Harry; Massoudi, Mehran; Richards, Kristin; Staras, Stephanie A. S.; Cannon, Michael J.

    2006-01-01

    Background. Congenital cytomegalovirus (CMV) infection is a leading cause of disabilities in children, yet the general public appears to have little awareness of CMV. Methods. Women were surveyed about newborn infections at 7 different geographic locations. Results. Of the 643 women surveyed, 142 (22%) had heard of congenital CMV. Awareness increased with increasing levels of education (P congenital CMV, and even fewer were aware of prevention strategies. PMID:17485810

  20. A young patient with multisystem complications after cytomegalovirus infection

    OpenAIRE

    Swaroopa Pulivarthi; Murali Krishna Gurram

    2014-01-01

    We are describing a case of an 18-year-old male patient with cytomegalovirus (CMV) associated guillain-barre syndrome (GBS) who presented with an acute onset of generalized weakness and numbness in the extremities, dysphagia, and facial diplegia, followed by respiratory failure, which led to mechanical ventilation. He had positive immunoglobulin G and immunoglobulin M antibodies against CMV, and CMV polymerase chain reaction was positive with

  1. Symptomatic Congenital Cytomegalovirus Infection in Children of Seropositive Women

    OpenAIRE

    Ines Mack; Marie-Anne Burckhardt; Marie-Anne Burckhardt; Ulrich Heininger; Friederike Prüfer; Sven Schulzke; Sven Wellmann

    2017-01-01

    Cytomegalovirus (CMV) is the most frequent congenital virus infection worldwide. The risk of congenital CMV (cCMV) transmission is highest in seronegative women who acquire primary CMV infection during pregnancy. A growing body of evidence indicates that secondary CMV infections in pregnant women with preconceptual immunity (either through reactivation of latent virus or re-infection with a new strain of CMV) contribute to a much greater proportion of symptomatic cCMV than was previously thou...

  2. Multiorgan involvement due to cytomegalovirus infection in AIDS

    Directory of Open Access Journals (Sweden)

    Shounak Majumder

    Full Text Available Cytomegalovirus (CMV infection is a relatively late complication of AIDS. Like other viruses contributing to co-morbidity of HIV infection, cytomegalovirus has the propensity to cause multiorgan involvement. We report the case of a 34-year-old seropositive man who presented with bilateral lower limb weakness and symptomatic pallor. He was already on antiretroviral drugs for a month prior to presentation. Detailed clinical examination and laboratory investigations revealed cytomegalovirus polyradiculoneuropathy associated with bone marrow dysplasia. Dysplasia of haematopoeitic cell lines occurs in 30% to 70% of HIV infected patients, and is often indistinguishable from myelodysplastic syndrome. However, in our case, the bone marrow picture reverted back to normal with treatment of the CMV infection, pointing to a possible role of CMV as the causative agent of bone marrow dysplasia. Moreover, CMV has been incriminated as a pathogen producing the immune reconstitution inflammatory syndrome. The onset of the disease in our case one month after initiation of HAART strongly raises the possibility of this being a case of CMV related IRIS. This is the first reported case where IRIS has presented with CMV polyradiculoneuropathy and bone marrow dysplasia. We would like to highlight that in today's era of HIV care, clinicians should be aware of the possibility of multiorgan involvement by CMV, for appropriate management of this disease in the background of AIDS.

  3. Reprint of: Recent advances in cytomegalovirus: an update on pharmacologic and cellular therapies.

    Science.gov (United States)

    Boeckh, Michael; Murphy, William J; Peggs, Karl S

    2015-02-01

    The 2015 Tandem American Society for Blood and Marrow Transplantation/Center for International Blood and Marrow Transplant Meetings provide an opportunity to review the current status and future perspectives on therapy for cytomegalovirus (CMV) infection in the setting of hematopoietic stem cell transplantation (HSCT). After many years during which we have seen few tangible advances in terms of new antiviral drugs, we are now experiencing an exciting period of late-stage drug development, characterized by a series of phase III trials incorporating a variety of novel agents. These trials have the potential to shift our current standard therapeutic strategies, which generally involve pre-emptive therapy based on sensitive molecular surveillance, towards the prophylactic approaches we see more generally with other herpes viruses such as herpes simplex and varicella zoster. This comes at a time when the promise of extensive preclinical research has been translated into encouraging clinical responses with several cellular immunotherapy strategies, which have also been moved towards definitive late-stage clinical trials. How these approaches will be integrated with the new wave of antiviral drugs remains open to conjecture. Although most of the focus of these cellular immunotherapy studies has been on adaptive immunity, and in particular T cells, an increasing awareness of the possible role of other cellular subsets in controlling CMV infection has developed. In particular, the role of natural killer (NK) cells is being revisited, along with that of γδ T cells. Depletion of NK cells in mice results in higher titers of murine CMV in tissues and increased mortality, whereas NK cell deficiency in humans has been linked to severe CMV disease. We will review recent progress in these areas. Copyright © 2015. Published by Elsevier Inc.

  4. Recent advances in cytomegalovirus: an update on pharmacologic and cellular therapies.

    Science.gov (United States)

    Boeckh, Michael; Murphy, William J; Peggs, Karl S

    2015-01-01

    The 2015 Tandem American Society for Blood and Marrow Transplantation/Center for International Blood and Marrow Transplant Meetings provide an opportunity to review the current status and future perspectives on therapy for cytomegalovirus (CMV) infection in the setting of hematopoietic stem cell transplantation (HSCT). After many years during which we have seen few tangible advances in terms of new antiviral drugs, we are now experiencing an exciting period of late-stage drug development, characterized by a series of phase III trials incorporating a variety of novel agents. These trials have the potential to shift our current standard therapeutic strategies, which generally involve pre-emptive therapy based on sensitive molecular surveillance, towards the prophylactic approaches we see more generally with other herpes viruses such as herpes simplex and varicella zoster. This comes at a time when the promise of extensive preclinical research has been translated into encouraging clinical responses with several cellular immunotherapy strategies, which have also been moved towards definitive late-stage clinical trials. How these approaches will be integrated with the new wave of antiviral drugs remains open to conjecture. Although most of the focus of these cellular immunotherapy studies has been on adaptive immunity, and in particular T cells, an increasing awareness of the possible role of other cellular subsets in controlling CMV infection has developed. In particular, the role of natural killer (NK) cells is being revisited, along with that of γδ T cells. Depletion of NK cells in mice results in higher titers of murine CMV in tissues and increased mortality, whereas NK cell deficiency in humans has been linked to severe CMV disease. We will review recent progress in these areas. Copyright © 2015 American Society for Blood and Marrow Transplantation. Published by Elsevier Inc. All rights reserved.

  5. Intestinal cytomegalovirus disease in immunocompromised patients may be ruled out by search for cytomegalovirus DNA in stool samples.

    OpenAIRE

    Michel, D; Marre, E; Hampl, W; Roczkos, J; Müller, S; Hertenstein, B; Kern, P; Heymer, B; Salzberger, B; Arasteh, K

    1995-01-01

    Cytomegalovirus (CMV) PCR from stool specimens was adopted as a diagnostic tool for patients with suspected CMV colitis. After being established, the method was evaluated in 17 AIDS patients and 19 other immunocompromised patients by comparison of PCR results with clinical, histological, and microbiological or virological data. CMV PCR was positive in 4 symptomatic patients with proven CMV colitis and negative in 15 of 16 patients without characteristic histopathology. Neither CMV immunoglobu...

  6. Mesenteric vein thrombosis associated with primary cytomegalovirus infection : a case report

    NARCIS (Netherlands)

    Lijfering, Willem M.; Sprenger, Herman G.; van Son, Willem J.; van der Meer, Jan

    In the past few years several studies have supported an interplay between cytomegalovirus infections and a prothrombotic state. We describe a case of primary cytomegalovirus infection in an immunocompetent adult that was complicated with mesenteric vein thrombosis. Transient protein C deficiency,

  7. Symptomatic primary cytomegalovirus infection in a HIV-positive pregnant woman.

    LENUS (Irish Health Repository)

    Bergin, Sarah

    2014-12-01

    We describe a case of symptomatic primary Cytomegalovirus infection in a HIV-positive pregnant woman on antiretroviral treatment with a CD4 count >200 × 10(6)\\/l requiring intravenous ganciclovir. No adverse consequences from ganciclovir or evidence of congenital Cytomegalovirus infection were found.

  8. EBI3 regulates the NK cell response to mouse cytomegalovirus infection

    DEFF Research Database (Denmark)

    Jensen, Helle; Chen, Shih-Yu; Folkersen, Lasse Westergaard

    2017-01-01

    Natural killer (NK) cells are key mediators in the control of cytomegalovirus infection. Here, we show that Epstein-Barr virus-induced 3 (EBI3) is expressed by human NK cells after NKG2D or IL-12 plus IL-18 stimulation and by mouse NK cells during mouse cytomegalovirus (MCMV) infection...

  9. Bilateral cytomegalovirus retinitis in a child with acute lymphoblastic leukemia while on maintenance chemotherapy

    Directory of Open Access Journals (Sweden)

    Vaidehi S. Dedania

    2016-08-01

    Full Text Available We report a case of bilateral cytomegalovirus retinitis in a 12 year-old with neutropenic fever after maintenance chemotherapy for acute lymphoblastic leukemia. Ophthalmologic examination for photophobia prompted a diagnosis of cytomegalovirus retinitis. With early diagnosis and prompt treatment, this patient had a favorable visual outcome.

  10. Human cytomegalovirus infection and the immune response to exercise.

    Science.gov (United States)

    Simpson, Richard J; Bigley, Austin B; Spielmann, Guillaume; LaVoy, Emily C P; Kunz, Hawley; Bollard, Catherine M

    2016-01-01

    Human cytomegalovirus (HCMV) is a ubiquitous -herpes virus that has co-evolved with its host since the very beginning of human life. The vast majority of adults worldwide carry the virus in a latent state, which is known to have striking effects on the composition and function of both T-cells and NK-cells. While there is evidence to suggest that prior exposure to HCMV can have beneficial effects in the immune competent host, poor control of the virus may contribute to T-cell exhaustion and the early onset of immunosenescence. The interaction between HCMV and exercise has garnered a lot of recent research attention. This stemmed from observations that people with HCMV redeploy greater numbers of CD8+ T-cells in response to a single exercise bout, while NK-cell mobilization is, conversely, impaired. Moreover, athletes with latent HCMV infection may be better protected against symptoms of upper respiratory illness (URI), and it has been suggested that the host's ability to control HCMV (i.e. keeping CMV in a latent state) may connect apparent bidirectional effects of exercise volume on host immunity and infection risk. This work has set a new paradigm that immune responses to both acute and chronic exercise might be governed by the infection history of the host. In this review, we summarize current knowledge on the effects of HCMV infection on T-cells and NK-cells and synthesize the literature on HCMV and the immune response to both single exercise bouts and prolonged periods of exercise training. We also discuss potential clinical and practical applications of this work including the use of HCMV reactivation as a biomarker of immune depression in athletes, its relevance in immunosenescence and the associated immune risk profile, and the potential for exercise to augment vaccine responses and the man ufacture of immune cells for adoptive transfer immunotherapy. Although research in this area is still in its infancy, we conclude that host infection history and the

  11. Update on treatment of cytomegalovirus infection in pregnancy and of the newborn with congenital cytomegalovirus.

    Science.gov (United States)

    Rawlinson, William D; Hamilton, Stuart T; van Zuylen, Wendy J

    2016-12-01

    The purpose of this review is to assess the recent studies of therapy of pregnant women and neonates, aimed at preventing the consequences of congenital cytomegalovirus (CMV) infection. A recent randomized controlled trial of treatment of CMV during pregnancy with hyperimmune globulin did not show significant efficacy in prevention of foetal infection and morbidity, although there was a trend towards improvement with treatment. Trials of antiviral therapy of the mother during pregnancy have involved small numbers only, confounded by ethical and practical difficulties, and further studies are needed to demonstrate whether or not antivirals are useful and well tolerated in this setting.Antiviral treatment of neonatal CMV acquired congenitally has been studied in well controlled trials and the antiviral valganciclovir has shown efficacy in reducing the more severe outcomes. Trials are ongoing of the use of antivirals in less severe disease, although results are likely to take several years. Congenital CMV infection is the most frequent cause of congenital malformation in developed countries, with a symptomatic prevalence of 0.64% of all live births. Infection may result in neurodevelopmental delay, foetal or neonatal death, and most frequently, sensorineural hearing loss. Successful control of viral infections during pregnancy and in the newborn period is essential in reducing early and late morbidity and mortality. Control of congenital CMV infection may be via primary prevention methods such as reducing contact with the pathogen, improved hygiene - both for the pregnant mother and for the neonate, or secondary prevention via reduction of vertical transmission from mother to foetus and reduction in consequences of infection by treatment of infected pregnant women and infected neonates.

  12. Review of cytomegalovirus shedding in bodily fluids and relevance to congenital cytomegalovirus infection

    Science.gov (United States)

    Cannon, Michael J.; Hyde, Terri B.; Schmid, D. Scott

    2015-01-01

    SUMMARY Congenital cytomegalovirus (CMV) infections are a leading cause of sensorineural hearing loss (SNHL) and neurological impairment. Congenital transmission of CMV can occur with maternal primary infection, reactivation, or reinfection during pregnancy. We reviewed studies of CMV shedding in bodily fluids (defined as CMV detected by culture or CMV DNA detected by polymerase chain reaction). Following diagnosis at birth, children with congenital CMV infection exhibited the highest prevalences of CMV shedding (median = 80%, number of sample population prevalences [N] = 6) and duration of shedding, with a steep decline by age five. Healthy children attending day care shed more frequently (median = 23%, N = 24) than healthy children not attending day care (median = 12%, N = 11). Peak shedding prevalences in children occurred at 1–2 years of age, confirming that young children are the key transmission risk for pregnant women. CMV shedding among children was more prevalent in urine specimens than in oral secretions (median prevalence difference = 11.5%, N = 12). Adults with risk factors such as STD clinic attendance had higher shedding prevalences (median = 22%, N = 20) than adults without risk factors (median = 7%, N = 44). In adults with risk factors, CMV was shed more frequently in urine; in adults without risk factors genital shedding was most common. The prevalence of CMV shedding in nine sample populations of pregnant women increased with advancing gestation. In seven sample populations of children with congenital CMV infection, higher viral load at birth was consistently associated with an elevated risk of SNHL. Higher CMV viral load at birth also consistently correlated with the presence of symptoms of congenital CMV at birth. Published 2011. This article is a US Government work and is in the public domain in the USA. PMID:21674676

  13. Circulating levels of chromatin fragments are inversely correlated with anti-dsDNA antibody levels in human and murine systemic lupus erythematosus

    DEFF Research Database (Denmark)

    Jørgensen, Mariann H; Rekvig, Ole Petter; Jacobsen, Rasmus S

    2011-01-01

    Anti-dsDNA antibodies represent a central pathogenic factor in Lupus nephritis. Together with nucleosomes they deposit as immune complexes in the mesangial matrix and along basement membranes within the glomeruli. The origin of the nucleosomes and when they appear e.g. in circulation is not known...... an inverse correlation between anti-dsDNA antibodies and the DNA concentration in the circulation in both murine and human serum samples. High titer of anti-DNA antibodies in human sera correlated with reduced levels of circulating chromatin, and in lupus prone mice with deposition within glomeruli....... The inverse correlation between DNA concentration and anti-dsDNA antibodies may reflect antibody-dependent deposition of immune complexes during the development of lupus nephritis in autoimmune lupus prone mice. The measurement of circulating DNA in SLE sera by using qPCR may indicate and detect...

  14. Irradiation Design for an Experimental Murine Model

    International Nuclear Information System (INIS)

    Ballesteros-Zebadua, P.; Moreno-Jimenez, S.; Suarez-Campos, J. E.; Celis, M. A.; Larraga-Gutierrez, J. M.; Garcia-Garduno, O. A.; Rubio-Osornio, M. C.; Custodio-Ramirez, V.; Paz, C.

    2010-01-01

    In radiotherapy and stereotactic radiosurgery, small animal experimental models are frequently used, since there are still a lot of unsolved questions about the biological and biochemical effects of ionizing radiation. This work presents a method for small-animal brain radiotherapy compatible with a dedicated 6MV Linac. This rodent model is focused on the research of the inflammatory effects produced by ionizing radiation in the brain. In this work comparisons between Pencil Beam and Monte Carlo techniques, were used in order to evaluate accuracy of the calculated dose using a commercial planning system. Challenges in this murine model are discussed.

  15. Toxic epidermal necrolysis associated with severe cytomegalovirus infection in a patient on regular hemodialysis.

    Directory of Open Access Journals (Sweden)

    Dina Khalaf

    2011-01-01

    Full Text Available Primary illness with cytomegalovirus leads to latent infection with possible reactivations especially in the immunocompromised patients. Toxic epidermal necrolysis is an immune mediated cytotoxic reaction. A fifty years old female diabetic hypertensive patient with end stage renal disease was admitted with fever of unknown origin, constitutional symptoms, vague upper gastrointestinal symptoms and skin rash. Upper gastrointestinal endoscopic biopsy confirmed her diagnosis with cytomegalovirus esophagitis and duodenitis. Cytomegalovirus immunoglobulin M and immunoglobulin G levels were negative but polymerase chain reaction showed fulminant viremia. Biopsy of the skin rash was consistent with toxic epidermal necrolysis. Despite treatment with Ganciclovir, intravenous immunoglobulins, and granulocyte colony stimulating factor the patient’s condition rapidly deteriorated and she died due to multiorgan failure, disseminated intravascular coagulopathy and overwhelming sepsis. Probably there is a true association linking toxic epidermal necrolysis to fulminant reactivation of cytomegalovirus. The aim of this anecdote is reporting a newly recognized presentation of cytomegalovirus.

  16. [Open clinical trial with oral acyclovir for the prophylaxis of disease by Cytomegalovirus in low risk liver transplant recipients].

    Science.gov (United States)

    Moreno, J; Montero, J L; Gavilán, F; Costán, G; Herrero, C; Cárdenas, M; Sánchez-Guijo, P; Torre-Cisneros, J

    1999-10-01

    Checking the first 70 low risk liver transplantation performed in our hospital, who did not receive prophylaxis for Cytomegalovirus, we found that the incidence of Cytomegalovirus-infection and Cytomegalovirus-disease were 47% and 16% respectively. For this reason we started a prospective, open clinical study, to address the safety of acyclovir prophylaxis in low-risk liver transplant patients. Seventy patients did not receive acyclovir. Fifty patients received oral acyclovir during 3 months (800-3,200 mg/day). The occurrence of Cytomegalovirus infection was not modified (40%) but Cytomegalovirus disease decreased dramatically (4%, p Varicela-zoster symptomatic disease in this group of patients.

  17. Aged-associated cytomegalovirus and Epstein-Barr virus reactivation and cytomegalovirus relationship with the frailty syndrome in older women.

    Directory of Open Access Journals (Sweden)

    Ronaldo Luis Thomasini

    Full Text Available Immunosenescence is an age-related reduction of immune system activity that can be associated with frailty. This study aimed to compare cytomegalovirus (CMV and Epstein-Barr virus (EBV reactivations (based on viremias between young and elderly women who had a chronic CMV and/or EBV infection (i.e., an IgG+ serostatus without an acute infection (i.e., an IgM- serostatus, and among the elderly group categorized according to frailty status. DNA was extracted from plasma using standard protocols and serostatus was determined by enzyme-linked immunosorbent assay. Quantitative real-time polymerase chain reaction analyses for CMV and EBV were carried out and viral loads were determined. Among elderly women (n = 71, 59% were positive for CMV, in contrast to only 8% of young women (n = 73. Elderly women classified as frail, pre-frail, and non-frail presented 82%, 56%, and 48% positivity for CMV, respectively. Frequency and viral load were significantly higher in the elderly group vs. the young group (p < 0.0001 and p = 0.01, respectively and in elderly with frailty vs. those without frailty (p = 0.007 and p = 0.03, respectively. The frequency of CMV reactivation presented odds ratios of 11.77 for aging and 6.13 for frailty, and relative risks of 5.39 for aging and 1.93 for frailty. EBV was detected in 30% of the elderly women and 15% of the young women (p = 0.04; however, the viral load did not significantly differ between the two age groups. The frequency of EBV reactivation presented odds ratios of 2.36 for aging and 2.90 for frailty, and relative risks of 1.96 for aging and 2.12 for frailty. However, no difference in EBV viral load among the frailty status subgroups was found. In conclusion, the frequency of CMV reactivation was associated with aging and ongoing frailty, whereas the frequency of EBV reactivation was associated only with aging.

  18. Septic Shock due to Cytomegalovirus Infection in Acute Respiratory Distress Syndrome after Falciparum Malaria.

    Science.gov (United States)

    Harbarth; Meyer; Grau; Loutan; Ricou

    1997-09-01

    Incidence of falciparum malaria in developed countries has increased in recent years due to tourism to tropical countries and immigration from Asia and Africa. In Switzerland, about 250 cases of malaria were reported in 1994 to the Federal Office of Health, including three cases with fatal outcome.1 The most commonly described complications of plasmodia infection are cerebral malaria, acute renal failure, and severe anemia with disseminated intravascular coagulation. However, pulmonary involvement occurs in 3 to 10% of cases and represents the most serious complication of this infection, with a lethality of 70%.2,3 Furthermore, a pronounced general immunosuppression has been reported in malaria patients, which may predispose them to opportunistic infections.4 We report a case of Plasmodium falciparum infection complicated by severe acute respiratory distress syndrome (ARDS) with development of systemic cytomegalovirus (CMV) infection leading to death. This evolution implies a severe immune deficiency associated with malaria, as previously suggested in the literature.

  19. The DNA Damage Response Induced by Infection with Human Cytomegalovirus and Other Viruses

    Science.gov (United States)

    E, Xiaofei; Kowalik, Timothy F.

    2014-01-01

    Viruses use different strategies to overcome the host defense system. Recent studies have shown that viruses can induce DNA damage response (DDR). Many of these viruses use DDR signaling to benefit their replication, while other viruses block or inactivate DDR signaling. This review focuses on the effects of DDR and DNA repair on human cytomegalovirus (HCMV) replication. Here, we review the DDR induced by HCMV infection and its similarities and differences to DDR induced by other viruses. As DDR signaling pathways are critical for the replication of many viruses, blocking these pathways may represent novel therapeutic opportunities for the treatment of certain infectious diseases. Lastly, future perspectives in the field are discussed. PMID:24859341

  20. RATIONALE FOR A SPECIFIC THERAPY OF CYTOMEGALOVIRUS INFECTION IN CHILDREN WITH BRONCHIAL ASTHMA

    Directory of Open Access Journals (Sweden)

    E. N. Suprun

    2013-01-01

    Full Text Available Abstract. We propose a protocol of treatment in cases of bronchial asthma with cytomegalovirus (CMV persistence. This basic therapy is administered depending on the disease severity, according to the National Programme 2009. The treatment includes administration of human immunoglobulin, with dosage according on CMV antibodies titers. The study has revealed that such regimen of antibody administration based on the content of anti-CMV antibodies in bronchial asthma treatment stops active CMV replication in bronchial mucous membrane, alleviates clinical course of the disease, diminishes changes of immune system typical to children suffering from bronchial asthma and CMV reactivation, thus allowing to reduce the volume of basic therapy, along with maintaining control of asthma control.

  1. Cutaneous cytomegalovirus infection in a child with hyper IgE and specific defects in antibody response to protein vaccines

    Directory of Open Access Journals (Sweden)

    Shahrzad Fallah

    Full Text Available Cytomegalovirus (CMV infection is a common opportunistic systemic infection in immunocompromised patients, but skin involvement is rare. Herein, we report a 10 year-old girl from consanguineous parents who was referred to our center because of disseminated maculopapular rash. She had history of upper and lower respiratory tract infections. In immunological studies, increased serum IgE level and decreased responses to tetanus and diphtheria were detected. Polymerase chain reaction (PCR examination of bronchoalveolar lavage and serum sample revealed the presence of CMV. Early diagnosis of cutaneous CMV and appropriate treatment are the key actions in management of patients with underlying immunodeficiencies to avoid further complications.

  2. Interstitial neumonia and cytomegalovirus: and immunopathological process Neumonía intersticial y citomegalovirus: un proceso inmunopatológico

    Directory of Open Access Journals (Sweden)

    Ana Isabel Toro

    1995-03-01

    Full Text Available

    Cytomegalovirus (CMV infection is a frequent cause of morbidity and mortality in immunocompromised individuals. including renal and bone marrow transplant recipients and patients with the acquired immunodeficiency syndrome (AIDS. CMV infection often affects the lung producing a fatal interstitial pneumonitis (IP. The pathogenesis of CMV IP is not well understood, but clinical observations in humans and laboratory studies with murine models, offer possibilities for explaining CMV-induced IP as an immunopathological disease.

    La infección activa por Citomegalovirus (CMV es causa frecuente de morbi-mortalidad en individuos inmunocomprometidos, particularmente entre receptores de trasplante renal y médula ósea y en personas afectadas por el virus de la inmunodeficiencia adquirida (HIV, en las cuales, a menudo, se presenta neumonía intersticial (NI fatal (1,2. La patogénesis de la NI causada por CMV no es clara aún, pero las observaciones clínicas en el hombre y los estudios con modelos murinos permiten pensar en ella como una alteración inmunopatológica. El análisis de tales conceptos es el objetivo de esta revisión.

  3. Developing a Vaccine against Congenital Cytomegalovirus (CMV) Infection: What Have We Learned from Animal Models? Where Should We Go Next?

    Science.gov (United States)

    Schleiss, Mark R.

    2014-01-01

    Summary Congenital human cytomegalovirus (HCMV) infection can lead to long-term neurodevelopmental sequelae, including mental retardation and sensorineural hearing loss. Unfortunately, CMVs are highly adapted to their specific species, precluding the evaluation of HCMV vaccines in animal models prior to clinical trials. Several species-specific CMVs have been characterized and developed in models of pathogenesis and vaccine-mediated protection against disease. These include the murine CMV (MCMV), the porcine CMV (PCMV), the rhesus macaque CMV (RhCMV), the rat CMV (RCMV), and the guinea pig CMV (GPCMV). Because of the propensity of the GPCMV to cross the placenta, infecting the fetus in utero, it has emerged as a model of particular interest in studying vaccine-mediated protection of the fetus. In this paper, a review of these various models, with particular emphasis on the value of the model in the testing and evaluation of vaccines against congenital CMV, is provided. Recent exciting developments and advances in these various models are summarized, and recommendations offered for high-priority areas for future study. PMID:24523827

  4. Mucosal priming of the murine immune system against enterohemorrhagic Escherichia coli O157:H7 using Lactococcus lactis expressing the type III secretion system protein EspB.

    Science.gov (United States)

    Ahmed, B; Loos, M; Vanrompay, D; Cox, E

    2013-03-15

    Enterohemorrhagic Escherichia coli (EHEC), particularly E. coli serotype O157:H7, has been responsible for multiple human outbreaks of hemorrhagic colitis and hemolytic uremic syndrome worldwide. Humans become infected by direct or indirect contact with faeces of asymptomatic EHEC shedding ruminants. Currently there is no human or animal vaccine available against EHEC infection. EHEC use a type III secretion system (T3SS) to colonize the intestine and therefore eliciting mucosal immunity against T3SS proteins could be a potential vaccination strategy. To develop such a mucosal vaccine, EspB - a significant member of the T3SS - was intracellularly expressed in Lactococcus lactis (LL-EspB) and this strain was used to immunize BALB/c mice orally. Ten days post-immunization, no specific antibody response was detected in serum or faeces of immunized mice. However, statistically significant (PT3SS protein, EspB. Nevertheless, an optimized EspB expression in L. lactis may be required to improve the mucosal immune response. Copyright © 2012 Elsevier B.V. All rights reserved.

  5. Screening for seemingly healthy newborns with congenital cytomegalovirus infection by quantitative real-time polymerase chain reaction using newborn urine: an observational study

    OpenAIRE

    Yamaguchi, Akira; Oh-ishi, Tsutomu; Arai, Takashi; Sakata, Hideaki; Adachi, Nodoka; Asanuma, Satoshi; Oguma, Eiji; Kimoto, Hirofumi; Matsumoto, Jiro; Fujita, Hidetoshi; Uesato, Tadashi; Fujita, Jutaro; Shirato, Ken; Ohno, Hideki; Kizaki, Takako

    2017-01-01

    Objective Approximately 8?10% of newborns with asymptomatic congenital cytomegalovirus (cCMV) infection develop sensorineural hearing loss (SNHL). However, the relationship between CMV load, SNHL and central nervous system (CNS) damage in cCMV infection remains unclear. This study aimed to examine the relationship between urinary CMV load, SNHL and CNS damage in newborns with cCMV infection. Study design The study included 23?368 newborns from two maternity hospitals in Saitama Prefecture, Ja...

  6. A Role for Myosin Va in Human Cytomegalovirus Nuclear Egress.

    Science.gov (United States)

    Wilkie, Adrian R; Sharma, Mayuri; Pesola, Jean M; Ericsson, Maria; Fernandez, Rosio; Coen, Donald M

    2018-03-15

    Herpesviruses replicate and package their genomes into capsids in replication compartments within the nuclear interior. Capsids then move to the inner nuclear membrane for envelopment and release into the cytoplasm in a process called nuclear egress. We previously found that nuclear F-actin is induced upon infection with the betaherpesvirus human cytomegalovirus (HCMV) and is important for nuclear egress and capsid localization away from replication compartment-like inclusions toward the nuclear rim. Despite these and related findings, it has not been shown that any specific motor protein is involved in herpesvirus nuclear egress. In this study, we have investigated whether the host motor protein, myosin Va, could be fulfilling this role. Using immunofluorescence microscopy and coimmunoprecipitation, we observed associations between a nuclear population of myosin Va and the viral major capsid protein, with both concentrating at the periphery of replication compartments. Immunoelectron microscopy showed that nearly 40% of assembled nuclear capsids associate with myosin Va. We also found that myosin Va and major capsid protein colocalize with nuclear F-actin. Importantly, antagonism of myosin Va with RNA interference or a dominant negative mutant revealed that myosin Va is important for the efficient production of infectious virus, capsid accumulation in the cytoplasm, and capsid localization away from replication compartment-like inclusions toward the nuclear rim. Our results lead us to suggest a working model whereby human cytomegalovirus capsids associate with myosin Va for movement from replication compartments to the nuclear periphery during nuclear egress. IMPORTANCE Little is known regarding how newly assembled and packaged herpesvirus capsids move from the nuclear interior to the periphery during nuclear egress. While it has been proposed that an actomyosin-based mechanism facilitates intranuclear movement of alphaherpesvirus capsids, a functional role for

  7. CYTOMEGALOVIRUS: A REVIEW OF PATHOGENESIS, EPIDEMIOLOGY AND DIAGNOSIS OF INFECTION

    Directory of Open Access Journals (Sweden)

    Sócrates Bezerra de Matos

    2011-05-01

    Full Text Available The cytomegalovirus (CMV is a human β-herpesvirus ubiquitous and has high worldwide prevalence. The transmission occurs through contact with biological fluids, such as: saliva, semen, vaginal secretions, urine and breast milk, as well as transplacental, blood transfusion or organ transplantation. The most CMV infected individuals remains asymptomatic, however, some patients, especially the immunosuppressed, can develop severe infection with serious clinical signs, like the transplant recipients, HIV positive, leukemic or newborn. This review aims, among other things, discuss the pathogenesis and highlight important sites of immunology and diagnosis of CMV infection.

  8. Cytomegalovirus: a review of pathogenesis, epidemiology and diagnosis of infection

    Directory of Open Access Journals (Sweden)

    Sócrates Bezerra de Matos

    2011-01-01

    Full Text Available The cytomegalovirus (CMV is a human β-herpesvirus ubiquitous and has high worldwide prevalence. The transmission occurs through contact with biological fluids, such as: saliva, semen, vaginal secretions, urine and breast milk, as well as trans placental, blood transfusion or organ transplantation. The most CMV infected individuals remains asymptomatic, however, some patients, especially the immunosuppressed, can develop severe infection with serious clinical signs, like the transplant recipients, HIV positive, leukemic or newborn. This review aims, among other things, discuss the pathogenesis and highlight important sites of immunology and diagnosis of CMV infection.

  9. Bronchial atresia in a neonate with congenital cytomegalovirus infection

    Directory of Open Access Journals (Sweden)

    Abdullah A Yousef

    2013-01-01

    Full Text Available Bronchial atresia (BA is characterized by a mucus-filled bronchocele in a blind-ending segmental or lobar bronchus with hyperinflation of the obstructed segment of the lung. We describe a neonate who presented on his 9 th day of life with respiratory distress. Chest computed tomography showed a soft tissue density involving the right middle lobe (RML. RML lobectomy confirmed the diagnosis of BA. Cytomegalovirus was detected by polymerase chain reaction in blood, urine, and tracheal aspirates which may provide further insight into the pathogenesis of BA.

  10. Detection and differentiation of cytomegalovirus antibodies by radioimmunoassay

    International Nuclear Information System (INIS)

    Jankowski, M.A.; Gut, W.; Nawrocka, E.; Kantoch, M.

    1980-01-01

    A sensitive radioimmunological method was adapted for the assay of anticytomegalovirus IgG and IgM antibodies. Binding of immunoglobulins G with cytomegalovirus (CMV) antigens was greatly reduced when an antigen prepared by sonication of the infected cells in glycine buffer was used in place of the antigen obtained by freezing and thawing of the cells. The application of labelled serum against the Fc fragment of IgG made it possible to identify selectively the antibodies bound with the virus antigen by antigenic determinants. (Auth.)

  11. Use of in vivo imaging to monitor the progression of experimental mouse cytomegalovirus infection in neonates.

    Science.gov (United States)

    Ostermann, Eleonore; Macquin, Cécile; Bahram, Seiamak; Georgel, Philippe

    2013-07-06

    Human Cytomegalovirus (HCMV or HHV-5) is a life-threatening pathogen in immune-compromised individuals. Upon congenital or neonatal infection, the virus can infect and replicate in the developing brain, which may induce severe neurological damage, including deafness and mental retardation. Despite the potential severity of the symptoms, the therapeutic options are limited by the unavailability of a vaccine and the absence of a specific antiviral therapy. Furthermore, a precise description of the molecular events occurring during infection of the central nervous system (CNS) is still lacking since observations mostly derive from the autopsy of infected children. Several animal models, such as rhesus macaque CMV, have been developed and provided important insights into CMV pathogenesis in the CNS. However, despite its evolutionary proximity with humans, this model was limited by the intracranial inoculation procedure used to infect the animals and consistently induce CNS infection. Furthermore, ethical considerations have promoted the development of alternative models, among which neonatal infection of newborn mice with mouse cytomegalovirus (MCMV) has recently led to significant advances. For instance, it was reported that intraperitoneal injection of MCMV to Balb/c neonates leads to infection of neurons and glial cells in specific areas of the brain. These findings suggested that experimental inoculation of mice might recapitulate the deficits induced by HCMV infection in children. Nevertheless, a dynamic analysis of MCMV infection of neonates is difficult to perform because classical methodology requires the sacrifice of a significant number of animals at different time points to analyze the viral burden and/or immune-related parameters. To circumvent this bottleneck and to enable future investigations of rare mutant animals, we applied in vivo imaging technology to perform a time-course analysis of the viral dissemination in the brain upon peripheral injection of

  12. The Naïve Murine Cornea as a Model System to Identify Novel Endogenous Regulators of Lymphangiogenesis: TRAIL and rtPA.

    Science.gov (United States)

    Regenfuß, Birgit; Dreisow, Marie-Luise; Hos, Deniz; Masli, Sharmila; Bock, Felix; Cursiefen, Claus

    2015-06-01

    In the murine cornea, which is an established model for analyzing pathologic lymphatic vessel growth, phenotypic heterogeneity of the endogenous lymphatic vessels in the limbus of the cornea was previously described. In this study, the cornea of BALB/c, C57BL/6, and FVB mice with different limbal lymphangiogenic phenotypes was analyzed to identify novel candidates potentially influencing lymphatic vessel growth. Pathway specific expression analysis of the cornea was performed to identify novel candidate genes. Corneal protein expression of the respective candidates was analyzed by fluorescent immunohistochemistry. The effect of the candidates on proliferation of human dermal lymphatic endothelial cells (HDLECs) was analyzed by BrdU proliferation ELISA. Thirteen genes were differentially regulated in corneas of mouse strains with more endogenous limbal lymphatic vessels (high-lymphangiogenic) (C57BL/6) compared to mouse strains with less endogenous limbal lymphatic vessels (low-lymphangiogenic) (BALB/c, FVB). Two candidates, Tumor necrosis factor (ligand) superfamily member 10 (Tnfsf10/Trail) and Plasminogen activator, tissue (Plat/tPA) were expressed in the cornea of BALB/c and C57BL/6 mice on the protein level. In vitro, Trail and recombinant tPA inhibited the proliferation of human dermal lymphatic endothelial cells. Molecular analysis of the naive cornea in mouse strains with different limbal lymphatic phenotypes is a valuable model to identify novel endogenous regulators of lymphangiogenesis.

  13. Saccharomyces cerevisiae strain UFMG 905 protects against bacterial translocation, preserves gut barrier integrity and stimulates the immune system in a murine intestinal obstruction model.

    Science.gov (United States)

    Generoso, Simone V; Viana, Mirelle; Santos, Rosana; Martins, Flaviano S; Machado, José A N; Arantes, Rosa M E; Nicoli, Jacques R; Correia, Maria I T D; Cardoso, Valbert N

    2010-06-01

    Probiotic is a preparation containing microorganisms that confers beneficial effect to the host. This work assessed whether oral treatment with viable or heat-killed yeast Saccharomyces cerevisiae strain UFMG 905 prevents bacterial translocation (BT), intestinal barrier integrity, and stimulates the immunity, in a murine intestinal obstruction (IO) model. Four groups of mice were used: mice undergoing only laparotomy (CTL), undergoing intestinal obstruction (IO) and undergoing intestinal obstruction after previous treatment with viable or heat-killed yeast. BT, determined as uptake of (99m)Tc-E. coli in blood, mesenteric lymph nodes, liver, spleen and lungs, was significantly higher in IO group than in CTL group. Treatments with both yeasts reduced BT in blood and all organs investigated. The treatment with both yeasts also reduced intestinal permeability as determined by blood uptake of (99m)Tc-DTPA. Immunological data demonstrated that both treatments were able to significantly increase IL-10 levels, but only viable yeast had the same effect on sIgA levels. Intestinal lesions were more severe in IO group when compared to CTL and yeasts groups. Concluding, both viable and heat-killed cells of yeast prevent BT, probably by immunomodulation and by maintaining gut barrier integrity. Only the stimulation of IgA production seems to depend on the yeast viability.

  14. Prevention of maternal cytomegalovirus infection: current status and future prospects

    Directory of Open Access Journals (Sweden)

    Jessica L Nyholm

    2010-02-01

    Full Text Available Jessica L Nyholm1, Mark R Schleiss21Department of Obstetrics, Gynecology, and Women’s Health, and 2Department of Pediatrics, University of Minnesota School of Medicine, Minneapolis, MN, USAAbstract: Human cytomegalovirus (CMV infection is the most common cause of perinatal viral infection in the developed world, resulting in approximately 40,000 congenitally infected infants in the United States each year. Congenital CMV infection can produce varying degrees of neurodevelopmental disabilities. The significant impact of congenital CMV has led the Institute of Medicine to rank development of a CMV vaccine as a top priority. Vaccine development has been ongoing; however no licensed CMV vaccine is currently available. Treatment of pregnant women with CMV hyperimmune globulin has shown promising results, but has not been studied in randomized controlled trials. Education on methods to prevent CMV transmission, particularly among young women of child-bearing age, should continue until a CMV vaccine becomes available. The epidemiology, clinical manifestations, prevention strategies, and treatment of CMV infections are reviewed.Keywords: cytomegalovirus, CMV vaccines, congenital CMV, CMV infection, immunoglobulin

  15. Intelligence and Academic Achievement With Asymptomatic Congenital Cytomegalovirus Infection.

    Science.gov (United States)

    Lopez, Adriana S; Lanzieri, Tatiana M; Claussen, Angelika H; Vinson, Sherry S; Turcich, Marie R; Iovino, Isabella R; Voigt, Robert G; Caviness, A Chantal; Miller, Jerry A; Williamson, W Daniel; Hales, Craig M; Bialek, Stephanie R; Demmler-Harrison, Gail

    2017-11-01

    To examine intelligence, language, and academic achievement through 18 years of age among children with congenital cytomegalovirus infection identified through hospital-based newborn screening who were asymptomatic at birth compared with uninfected infants. We used growth curve modeling to analyze trends in IQ (full-scale, verbal, and nonverbal intelligence), receptive and expressive vocabulary, and academic achievement in math and reading. Separate models were fit for each outcome, modeling the change in overall scores with increasing age for patients with normal hearing ( n = 78) or with sensorineural hearing loss (SNHL) diagnosed by 2 years of age ( n = 11) and controls ( n = 40). Patients with SNHL had full-scale intelligence and receptive vocabulary scores that were 7.0 and 13.1 points lower, respectively, compared with controls, but no significant differences were noted in these scores among patients with normal hearing and controls. No significant differences were noted in scores for verbal and nonverbal intelligence, expressive vocabulary, and academic achievement in math and reading among patients with normal hearing or with SNHL and controls. Infants with asymptomatic congenital cytomegalovirus infection identified through newborn screening with normal hearing by age 2 years do not appear to have differences in IQ, vocabulary or academic achievement scores during childhood, or adolescence compared with uninfected children. Copyright © 2017 by the American Academy of Pediatrics.

  16. Central nervous system Toll-like receptor expression in response to Theiler's murine encephalomyelitis virus-induced demyelination disease in resistant and susceptible mouse strains

    Directory of Open Access Journals (Sweden)

    Turrin Nicolas P

    2008-12-01

    Full Text Available Abstract Background In immunopathological diseases, such as multiple sclerosis (MS, genetic and environmental factors that contribute to the initiation and progression of the disease are often discussed. The Theiler murine encephalomyelitis virus-induced demyelination disease (TMEV-IDD model used to study MS reflects this: genetically susceptible mice infected intra-cerebrally with TMEV develop a chronic demyelination disease. TMEV-IDD can be induced in resistant mouse strains by inducing innate immunity with lipopolysaccharide (LPS. Interestingly, Toll-like receptor 4 (TLR4 is the cognate receptor for LPS and its activation can induces up-regulation of other TLRs, such as TLR7 (the receptor for TMEV and 9, known to be involved in autoimmunity. Up-regulation of TLRs could be involved in precipitating an autoimmune susceptible state. Consequently, we looked at TLR expression in the susceptible (SJL/J and resistant (C57BL/6 strains of mice infected with TMEV. The resistant mice were induced to develop TMEV-IDD by two LPS injections following TMEV infection. Results Both strains were found to up-regulate multiple TLRs (TLR2, 7 and 9 following the TMEV infection. Expression of these TLRs and of viral mRNA was significantly greater in infected SJL/J mice. The susceptible SJL/J mice showed up-regulation of TLR3, 6 and 8, which was not seen in C57BL/6 mice. Conclusion Expression of TLRs by susceptible mice and the up-regulation of the TLRs in resistant mice could participate in priming the mice toward an autoimmune state and develop TMEV-IDD. This could have implications on therapies that target TLRs to prevent the emergence of conditions such as MS in patients at risk for the disease.

  17. Longitudinal Kinetics of Cytomegalovirus-Specific T-Cell Immunity and Viral Replication in Infants With Congenital Cytomegalovirus Infection.

    Science.gov (United States)

    Chen, Sharon F; Holmes, Tyson H; Slifer, Teri; Ramachandran, Vasavi; Mackey, Sally; Hebson, Cathleen; Arvin, Ann M; Lewis, David B; Dekker, Cornelia L

    2016-03-01

    Congenital cytomegalovirus (CMV) is reported to affect up to 1% of all live births in the United States. T-cell immunity may be important for controlling CMV replication in congenital CMV-infected infants. We describe the natural history of CMV-specific T-cell evolution and CMV replication in infants with congenital CMV infection. Cytomegalovirus viral load, CMV urine culture, and CMV-specific CD4 and CD8 T-cell responses were assessed in a prospective longitudinal cohort of 51 infants with congenital CMV infection who were observed from birth to 3 years of age. We found a kinetic pattern of decreasing urinary CMV replication and increasing CMV-specific CD4 and CD8 T-cell responses during the first 3 years of life. We also found higher CMV-specific CD8 T-cell responses were associated with subsequent reduction of urine CMV viral load. For infants with congenital CMV infection, our data suggest an age-related maturation of both CMV-specific CD4 and CD8 T-cell immunity that is associated with an age-related decline in urinary CMV replication. © The Author 2014. Published by Oxford University Press on behalf of the Pediatric Infectious Diseases Society. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  18. Antigen test for early diagnosis of active cytomegalo-virus infection in heart-transplant recipients

    NARCIS (Netherlands)

    van der Bij, W; van Dijk, R. B.; van Son, W. J.; Torensma, R; Prenger, K. B.; Prop, J.; Tegzess, A. M.; The, T. H.

    An assay was developed for the detection of cytomegalovirus (CMV) antigens in blood leukocytes and evaluated for its diagnostic significance in six heart transplant recipients. Slides of cytocentrifuged blood leukocytes were prepared at regular intervals during the posttransplantation period and

  19. The spectrum of cranial ultrasound and magnetic resonance imaging abnormalities in congenital cytomegalovirus infection

    NARCIS (Netherlands)

    de Vries, L. S.; Gunardi, H.; Barth, P. G.; Bok, L. A.; Verboon-Maciolek, M. A.; Groenendaal, F.

    2004-01-01

    Congenital cytomegalovirus (CMV) infection can lead to severe neurological sequelae and (progressive) sensorineural deafness. Neonatal imaging data is mainly based on cranial ultrasound (US) and computed tomography (CT). The additional value of magnetic resonance imaging (MRI) was assessed in

  20. Congenital cytomegalovirus infection in the Netherlands: birth prevalence and risk factors

    NARCIS (Netherlands)

    Vries, J.C. de; Korver, A.M.H.; Verkerk, P.H.; Rusman, L.; Claas, E.C.J.; Gerard, L.J.; Kroes, A.C.M.; Vossen, A.C.T.M.

    2011-01-01

    Congenital cytomegalovirus (CMV) infection is the most common congenital viral infection worldwide. The sequela encountered most frequently is hearing impairment, affecting approximately one out of five infants congenitally infected. Data on the birth prevalence and risk factors of congenital CMV

  1. Lymphotropic Herpesvirus infection and malignant lymphoma, immunological aspects of cytomegalovirus and Epstein- Barr virus infections

    NARCIS (Netherlands)

    Napel, Christianus Hubertus Henricus ten

    1979-01-01

    In de voorgaande hoofdstukken van dit proefschrift werd de oorspronkelijke chronologische volgorde van het onderzoek aangehouden. Maar in dit deel wordt hiervan afgeweken en zullen de resultaten worden samengevat en besproken volgens onderstaande indeling: 1. Cytomegalovirus( CMV)-specifieke

  2. Adenovirus, herpes simplex virus and cytomegalovirus infection in a lung transplant recipient

    Directory of Open Access Journals (Sweden)

    Sandhya Nagarakanti

    2018-01-01

    Full Text Available Allograft infections post lung transplantation have a significant impact on morbidity and mortality. We report a rare case of triple viral infection with adenovirus, Herpes Simplex virus (HSV and Cytomegalovirus (CMV in a lung transplant recipient.

  3. Therapy for cytomegalovirus polyradiculomyelitis in patients with AIDS: treatment with ganciclovir

    NARCIS (Netherlands)

    de Gans, J.; Portegies, P.; Tiessens, G.; Troost, D.; Danner, S. A.; Lange, J. M.

    1990-01-01

    Six AIDS patients with progressive cytomegalovirus (CMV) polyradiculomyelitis were treated with ganciclovir in an open study. The diagnosis was based on the presence of a distinct clinical syndrome with progressive flaccid paraparesis, preserved proprioception and urinary retention with specific

  4. Clinical Trials Using Adenovirus/Cytomegalovirus/Epstein-Barr Virus-specific Allogeneic Cytotoxic T Lymphocytes

    Science.gov (United States)

    NCI supports clinical trials that test new and more effective ways to treat cancer. Find clinical trials studying adenovirus/cytomegalovirus/epstein-barr virus-specific allogeneic cytotoxic t lymphocytes.

  5. Blastogenic response of human lymphocytes to early antigen(s) of human cytomegalovirus.

    OpenAIRE

    Waner, J L; Kong, N; Biano, S

    1983-01-01

    The lymphocytes of asymptomatic, seropositive donors demonstrated blastogenic responses to early antigens of human cytomegalovirus whether or not antibodies to early antigens were detectable. The lymphocytes of six of nine patients with active cytomegalovirus infections gave stimulation indexes of greater than or equal to 2.00 with antigens of productively infected cells, whereas only two patients demonstrated comparable stimulation indexes with early antigens. Four patients with stimulation ...

  6. Cytomegalovirus Antibody in Cerebrospinal Fluid of Schizophrenic Patients Detected by Enzyme Immunoassay

    Science.gov (United States)

    Fuller Torrey, E.; Yolken, Robert H.; Winfrey, C. Jack

    1982-05-01

    By means of enzyme immunoassay techniques to detect the presence of antibody to cytomegalovirus, the cerebrospinal fluid of 178 patients with schizophrenia, 17 patients with bipolar disorders, and 11 other psychiatric patients was compared with that of 79 neurological patients and 41 normal control subjects. The cerebrospinal fluid of 20 of the schizophrenic patients and 3 of the patients with bipolar disorders showed significant increases in immunoglobulin M antibody to cytomegalovirus; no difference was found in patients on or off psychotropic medications.

  7. Mutual Interference between Cytomegalovirus and Reconstitution of Protective Immunity after Hematopoietic Cell Transplantation

    Science.gov (United States)

    Reddehase, Matthias J.

    2016-01-01

    Hematopoietic cell transplantation (HCT) is a therapy option for aggressive forms of hematopoietic malignancies that are resistant to standard antitumoral therapies. Hematoablative treatment preceding HCT, however, opens a “window of opportunity” for latent Cytomegalovirus (CMV) by releasing it from immune control with the consequence of reactivation of productive viral gene expression and recurrence of infectious virus. A “window of opportunity” for the virus represents a “window of risk” for the patient. In the interim between HCT and reconstitution of antiviral immunity, primarily mediated by CD8+ T cells, initially low amounts of reactivated virus can expand exponentially, disseminate to essentially all organs, and cause multiple organ CMV disease, with interstitial pneumonia (CMV-IP) representing the most severe clinical manifestation. Here, I will review predictions originally made in the mouse model of experimental HCT and murine CMV infection, some of which have already paved the way to translational preclinical research and promising clinical trials of a preemptive cytoimmunotherapy of human CMV disease. Specifically, the mouse model has been pivotal in providing “proof of concept” for preventing CMV disease after HCT by adoptive transfer of preselected, virus epitope-specific effector and memory CD8+ T cells bridging the critical interim. However, CMV is not a “passive antigen” but is a pathogen that actively interferes with the reconstitution of protective immunity by infecting bone marrow (BM) stromal cells that otherwise form niches for hematopoiesis by providing the structural microenvironment and by producing hematopoietically active cytokines, the hemopoietins. Depending on the precise conditions of HCT, reduced homing of transplanted hematopoietic stem- and progenitor cells to infected BM stroma and impaired colony growth and lineage differentiation can lead to “graft failure.” In consequence, uncontrolled virus spread

  8. Real-time transcriptional profiling of cellular and viral gene expression during lytic cytomegalovirus infection.

    Directory of Open Access Journals (Sweden)

    Lisa Marcinowski

    2012-09-01

    Full Text Available During viral infections cellular gene expression is subject to rapid alterations induced by both viral and antiviral mechanisms. In this study, we applied metabolic labeling of newly transcribed RNA with 4-thiouridine (4sU-tagging to dissect the real-time kinetics of cellular and viral transcriptional activity during lytic murine cytomegalovirus (MCMV infection. Microarray profiling on newly transcribed RNA obtained at different times during the first six hours of MCMV infection revealed discrete functional clusters of cellular genes regulated with distinct kinetics at surprising temporal resolution. Immediately upon virus entry, a cluster of NF-κB- and interferon-regulated genes was induced. Rapid viral counter-regulation of this coincided with a very transient DNA-damage response, followed by a delayed ER-stress response. Rapid counter-regulation of all three clusters indicated the involvement of novel viral regulators targeting these pathways. In addition, down-regulation of two clusters involved in cell-differentiation (rapid repression and cell-cycle (delayed repression was observed. Promoter analysis revealed all five clusters to be associated with distinct transcription factors, of which NF-κB and c-Myc were validated to precisely match the respective transcriptional changes observed in newly transcribed RNA. 4sU-tagging also allowed us to study the real-time kinetics of viral gene expression in the absence of any interfering virion-associated-RNA. Both qRT-PCR and next-generation sequencing demonstrated a sharp peak of viral gene expression during the first two hours of infection including transcription of immediate-early, early and even well characterized late genes. Interestingly, this was subject to rapid gene silencing by 5-6 hours post infection. Despite the rapid increase in viral DNA load during viral DNA replication, transcriptional activity of some viral genes remained remarkably constant until late-stage infection, or was

  9. Topical Apigenin Alleviates Cutaneous Inflammation in Murine Models

    Directory of Open Access Journals (Sweden)

    Mao-Qiang Man

    2012-01-01

    Full Text Available Herbal medicines have been used in preventing and treating skin disorders for centuries. It has been demonstrated that systemic administration of chrysanthemum extract exhibits anti-inflammatory properties. However, whether topical applications of apigenin, a constituent of chrysanthemum extract, influence cutaneous inflammation is still unclear. In the present study, we first tested whether topical applications of apigenin alleviate cutaneous inflammation in murine models of acute dermatitis. The murine models of acute allergic contact dermatitis and acute irritant contact dermatitis were established by topical application of oxazolone and phorbol 12-myristate 13-acetate (TPA, respectively. Inflammation was assessed in both dermatitis models by measuring ear thickness. Additionally, the effect of apigenin on stratum corneum function in a murine subacute allergic contact dermatitis model was assessed with an MPA5 physiology monitor. Our results demonstrate that topical applications of apigenin exhibit therapeutic effects in both acute irritant contact dermatitis and allergic contact dermatitis models. Moreover, in comparison with the vehicle treatment, topical apigenin treatment significantly reduced transepidermal water loss, lowered skin surface pH, and increased stratum corneum hydration in a subacute murine allergic contact dermatitis model. Together, these results suggest that topical application of apigenin could provide an alternative regimen for the treatment of dermatitis.

  10. Antiviral Activities of Nucleosides and Nucleotides Against Wild-Type and Drug-Resistant Strains of Murine Cytomegalovirus

    Czech Academy of Sciences Publication Activity Database

    Smee, D. F.; Barnett, B. B.; Sidwell, R. W.; Reist, E. J.; Holý, Antonín

    1995-01-01

    Roč. 26, č. 1 (1995), s. 1-9 ISSN 0166-3542 Grant - others:National Institute of Allergy and Infectious Diseases(US) 1R01 AI33326; Utah State University Faculty Research Grant(US) 1U01 AI33375 Impact factor: 1.849, year: 1995

  11. Congenital cytomegalovirus infection in pregnancy and the neonate: consensus recommendations for prevention, diagnosis, and therapy.

    Science.gov (United States)

    Rawlinson, William D; Boppana, Suresh B; Fowler, Karen B; Kimberlin, David W; Lazzarotto, Tiziana; Alain, Sophie; Daly, Kate; Doutré, Sara; Gibson, Laura; Giles, Michelle L; Greenlee, Janelle; Hamilton, Stuart T; Harrison, Gail J; Hui, Lisa; Jones, Cheryl A; Palasanthiran, Pamela; Schleiss, Mark R; Shand, Antonia W; van Zuylen, Wendy J

    2017-06-01

    Congenital cytomegalovirus is the most frequent, yet under-recognised, infectious cause of newborn malformation in developed countries. Despite its clinical and public health importance, questions remain regarding the best diagnostic methods for identifying maternal and neonatal infection, and regarding optimal prevention and therapeutic strategies for infected mothers and neonates. The absence of guidelines impairs global efforts to decrease the effect of congenital cytomegalovirus. Data in the literature suggest that congenital cytomegalovirus infection remains a research priority, but data are yet to be translated into clinical practice. An informal International Congenital Cytomegalovirus Recommendations Group was convened in 2015 to address these questions and to provide recommendations for prevention, diagnosis, and treatment. On the basis of consensus discussions and a review of the literature, we do not support universal screening of mothers and the routine use of cytomegalovirus immunoglobulin for prophylaxis or treatment of infected mothers. However, treatment guidelines for infected neonates were recommended. Consideration must be given to universal neonatal screening for cytomegalovirus to facilitate early detection and intervention for sensorineural hearing loss and developmental delay, where appropriate. The group agreed that education and prevention strategies for mothers were beneficial, and that recommendations will need continual updating as further data become available. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Immune thrombocytopenic purpura secondary to cytomegalovirus infection: A case report.

    Directory of Open Access Journals (Sweden)

    Bessy S Flores Chang

    2015-11-01

    Full Text Available Immune Thrombocytopenic Purpura (ITP is defined as an acquired thrombocytopenia with antibodies detected against platelet surface antigens, and it is the most common form of thrombocytopenia in otherwise asymptomatic adults. ITP secondary to an underlying condition is a diagnosis of exclusion that is essential to establish for treatment efficacy. Secondary thrombocytopenia caused by Cytomegalovirus (CMV is common, however case reports associated with diagnosis in immunocompetent adults are rare, and to the best of our knowledge only 20 publications have been associated with this diagnosis. Our report is based on a clinical presentation of a 37 year old female complaining of petechiae, heavy menses, shortness of breath and a platelet count of 1 X 109 /L. Treatment with IVIG and steroids failed to improve platelet count. Subsequently, an infectious laboratory workup was performed, detecting CMV infection, and treatment with antiviral agents was initiated, causing platelet count to increase as viral load decreased.

  13. Human Cytomegalovirus: detection of congenital and perinatal infection in Argentina

    Science.gov (United States)

    Distéfano, Angélica Lidia; Alonso, Alicia; Martin, Fabián; Pardon, Fabián

    2004-01-01

    Background Human cytomegalovirus (CMV) is one of the most commonly found agents of congenital infections. Primary maternal infection is associated with risk of symptomatic congenital diseases, and high morbidity is frequently associated with very low birth weight. Neonates with asymptomatic infection develop various sequelae during infancy. This is the first Argentine study performed in neonates with congenital and postnatal HCMV infection. The purpose of this study was to evaluate the performance of the polymerase chain reaction (PCR) technique with different pairs of primers, to detect cytomegalovirus isolated in tissue cultures and directly in urine and dried blood spot (DBS) specimens. Results were compared with IgM detection. Methods The study was performed between 1999 and 2001 on routine samples in the Laboratory. A total of 61 urine and 56 serum samples were selected from 61 newborns/infants, 33 patients whose samples were analyzed during the first two to three weeks of life were considered congenital infections; the remaining 28 patients whose samples were taken later than the third week were grouped as perinatal infections, although only in 4 the perinatal transmission of infection was determined unequivocally Cytomegalovirus diagnosis was made by isolating the virus from urine samples in human foreskin fibroblast cells. Three different primer pairs directed to IE, LA and gB genes were used for the HCMV PCR assay in viral isolates. Subsequently, PCR and nested PCR (nPCR) assays with gB primers were performed directly in urine and in 11 samples of dried blood spot (DBS) on Guthrie Card, these results were then compared with serology. Results The main clinical manifestations of the 33 patients with congenital infection were purpura, jaundice, hepatomegaly and anaemia. Three patients presented low birth weight as single symptom, 10, intracranial calcifications, and 2, kidney failure. In the 28 patients grouped as with perinatal infection, anaemia

  14. Evaluation and management of cytomegalovirus-associated congenital hearing loss.

    Science.gov (United States)

    Dobbie, Allison M

    2017-10-01

    The current article reviews the current literature related to congenital cytomegalovirus (CMV)-related hearing loss. The discussion will focus on the epidemiology, pathogenesis, and clinical presentation of human CMV infection as it pertains to hearing loss. Current methods of CMV diagnosis with a focus on the evolving trend toward broader neonatal screening protocols will also be explored. Discussion of medical, surgical, and audiologic management of the condition will also be addressed. Much of the current research on this topic is focused on improving detection of CMV through screening programs. Some advances in understanding cochlear pathogenesis have also been made. Congenital CMV infection remains an important cause of hearing loss in infants and children. Early detection of CMV infection can broaden treatment options and allow for improved hearing and language outcome for patients with CMV-associated sensorineural hearing loss.

  15. Magnetic resonance imaging of the brain in congenital cytomegalovirus infection

    Energy Technology Data Exchange (ETDEWEB)

    Boesch, C.; Issakainen, J.; Kewitz, G.; Kikinis, R.; Martin, E.; Boltshauser, E.

    1989-01-01

    The children (age 2 months to 8 years) with a congenital cytomegalovirus (CMV) infection were studied by magnetic resonance imaging (MRI) using a 2.35 Tesla magnet. CMV infection was confirmed by serological investigations and virus culture in the neonatal period. Nine children had severe mental retardation and cerebral palsy, 1 patient suffered from microcephaly, ataxia and deafness. The cranial MRI examination showed the following abnormalities (N): Dilated lateral ventricles (10) and subarachnoid space (8), oligo/pacgyria (8), delayed/pathological myelination (7), paraventricular cysts (6), intra-cerebral calcification (1). This lack of sensitivity for calcification is explainable by the basic principles of MRI. The paraventricular cystic lesions were adjacent ot the occipital horns of the lateral ventricles and separated only by a thin membrane. This finding might represent a 'new sign' for congenital CMV infection in MRI examinations, being characteristic but nevertheless nonspecific, like calcification in CT.

  16. Congenital Cytomegalovirus: a "Now" Problem-No Really, Now.

    Science.gov (United States)

    Bernstein, David I

    2017-01-01

    Despite the clear need, progress toward a vaccine for congenital cytomegalovirus (CMV) has been slow. However, recent events have provided new interest, and several vaccine candidates are either in clinical trials or the trials are close to starting. In this issue of Clinical and Vaccine Immunology, Schleiss and colleagues show that a nonreplicating lymphocytic choriomeningitis virus (rLCMV)-vectored vaccine expressing CMV glycoprotein B (gB) and/or pp65 induces B and T cells and improves pup survival in a guinea pig model of congenital CMV infection (Clin Vaccine Immunol 24:e00300-16, 2017, https://doi.org/10.1128/CVI.00300-16). The combination vaccine appeared to be the most effective. Copyright © 2017 American Society for Microbiology.

  17. Growth in Agarose of Human Cells Infected with Cytomegalovirus

    Science.gov (United States)

    Lang, David J.; Montagnier, Luc; Latarjet, Raymond

    1974-01-01

    After infection by human cytomegalovirus (CMV), human diploid fibroblasts could grow in agarose medium for several generations. Clones of infected cells grew for weeks, although in every case they ultimately underwent lysis owing to the cytopathic effect of the virus. Virus was inoculated at high dilution and after UV irradiation in an effort to derive cells infected with noninfectious defective particles still capable of inducing cell stimulation. Dilute or irradiated virus occasionally yielded large colonies of replicating cells, although permanent transformation was not observed. One clone derived from UV-CMV-infected cells was passaged four times before undergoing lysis. During these passages the cells exhibited alterations in morphology and orientation. Images PMID:4367907

  18. Magnetic resonance imaging of the brain in congenital cytomegalovirus infection

    International Nuclear Information System (INIS)

    Boesch, C.; Issakainen, J.; Kewitz, G.; Kikinis, R.; Martin, E.; Boltshauser, E.

    1989-01-01

    The children (age 2 months to 8 years) with a congenital cytomegalovirus (CMV) infection were studied by magnetic resonance imaging (MRI) using a 2.35 Tesla magnet. CMV infection was confirmed by serological investigations and virus culture in the neonatal period. Nine children had severe mental retardation and cerebral palsy, 1 patient suffered from microcephaly, ataxia and deafness. The cranial MRI examination showed the following abnormalities (N): Dilated lateral ventricles (10) and subarachnoid space (8), oligo/pacgyria (8), delayed/pathological myelination (7), paraventricular cysts (6), intra-cerebral calcification (1). This lack of sensitivity for calcification is explainable by the basic principles of MRI. The paraventricular cystic lesions were adjacent ot the occipital horns of the lateral ventricles and separated only by a thin membrane. This finding might represent a 'new sign' for congenital CMV infection in MRI examinations, being characteristic but nevertheless nonspecific, like calcification in CT. (orig.)

  19. Knowledge and Awareness of Congenital Cytomegalovirus Among Women

    Directory of Open Access Journals (Sweden)

    Jiyeon Jeon

    2006-01-01

    Full Text Available Background. Congenital cytomegalovirus (CMV infection is a leading cause of disabilities in children, yet the general public appears to have little awareness of CMV. Methods. Women were surveyed about newborn infections at 7 different geographic locations. Results. Of the 643 women surveyed, 142 (22% had heard of congenital CMV. Awareness increased with increasing levels of education (P<.0001. Women who had worked as a healthcare professional had a higher prevalence of awareness of CMV than had other women (56% versus 16%, P <.0001. Women who were aware of CMV were most likely to have heard about it from a healthcare provider (54%, but most could not correctly identify modes of CMV transmission or prevention. Among common causes of birth defects and childhood illnesses, women's awareness of CMV ranked last. Conclusion. Despite its large public health burden, few women had heard of congenital CMV, and even fewer were aware of prevention strategies.

  20. Human Cytomegalovirus: Coordinating Cellular Stress, Signaling, and Metabolic Pathways.

    Science.gov (United States)

    Shenk, Thomas; Alwine, James C

    2014-11-01

    Viruses face a multitude of challenges when they infect a host cell. Cells have evolved innate defenses to protect against pathogens, and an infecting virus may induce a stress response that antagonizes viral replication. Further, the metabolic, oxidative, and cell cycle state may not be conducive to the viral infection. But viruses are fabulous manipulators, inducing host cells to use their own characteristic mechanisms and pathways to provide what the virus needs. This article centers on the manipulation of host cell metabolism by human cytomegalovirus (HCMV). We review the features of the metabolic program instituted by the virus, discuss the mechanisms underlying these dramatic metabolic changes, and consider how the altered program creates a synthetic milieu that favors efficient HCMV replication and spread.

  1. Role of Human Cytomegalovirus Tegument Proteins in Virion Assembly

    Science.gov (United States)

    Smith, Rebecca Marie; Kosuri, Srivenkat; Kerry, Julie Anne

    2014-01-01

    Like other herpesviruses, human cytomegalovirus (HCMV) contains a unique proteinaceous layer between the virion envelope and capsid, termed the tegument. Upon infection, the contents of the tegument layer are delivered to the host cell, along with the capsid and the viral genome, where they facilitate the initial stages of virus replication. The tegument proteins also play important roles in virion assembly and this dual nature makes them attractive potential targets for antiviral therapies. While our knowledge regarding tegument protein function during the initiation of infection has been the subject of intense study, their roles in assembly are much less well understood. In this review, we will focus on recent studies that highlight the functions of HCMV tegument proteins during assembly, and pose key questions for further investigation. PMID:24509811

  2. Synchronous cytomegalovirus infection in a newly diagnosed ulcerative colitis patient

    Directory of Open Access Journals (Sweden)

    Jin Yu Chieng

    2017-12-01

    Full Text Available A 61-year-old Punjabi female patient presented with six months history of mild abdominal discomfort with bloody diarrhea. She did not have underlying chronic medical illness; she neither took steroid nor immunosuppressant. She was found anemic, thrombocytosis, and elevated C-reactive protein. Colonoscopy showed moderate left sided colitis, with histopathology evidence of ulcerative colitis (UC with cytomegalovirus (CMV infection. Her serum anti-CMV IgM antibody was detected. She was treated with intravenous ganciclovir, together with 5-ASA and tapering dose of steroid. Anemia was corrected. Subsequent clinic reviews and follow up endoscopies showed dramatically improvement. CMV colitis should be considered for the patients presenting with moderate to severe UC. Early prescription of antiviral would be beneficial in the treatment of flare of UC.

  3. Hearing Loss in Children With Asymptomatic Congenital Cytomegalovirus Infection

    Science.gov (United States)

    Chung, Winnie; Flores, Marily; Blum, Peggy; Caviness, A. Chantal; Bialek, Stephanie R.; Grosse, Scott D.; Miller, Jerry A.; Demmler-Harrison, Gail

    2017-01-01

    OBJECTIVES: To assess the prevalence, characteristics, and risk of sensorineural hearing loss (SNHL) in children with congenital cytomegalovirus infection identified through hospital-based newborn screening who were asymptomatic at birth compared with uninfected children. METHODS: We included 92 case-patients and 51 controls assessed by using auditory brainstem response and behavioral audiometry. We used Kaplan–Meier survival analysis to estimate the prevalence of SNHL, defined as ≥25 dB hearing level at any frequency and Cox proportional hazards regression analyses to compare SNHL risk between groups. RESULTS: At age 18 years, SNHL prevalence was 25% (95% confidence interval [CI]: 17%–36%) among case-patients and 8% (95% CI: 3%–22%) in controls (hazard ratio [HR]: 4.0; 95% CI: 1.2–14.5; P = .02). Among children without SNHL by age 5 years, the risk of delayed-onset SNHL was not significantly greater for case-patients than for controls (HR: 1.6; 95% CI: 0.4–6.1; P = .5). Among case-patients, the risk of delayed-onset SNHL was significantly greater among those with unilateral congenital/early-onset hearing loss than those without (HR: 6.9; 95% CI: 2.5–19.1; P congenital cytomegalovirus infection continued to occur throughout adolescence. However, the risk of developing SNHL after age 5 years among case-patients was not different than in uninfected children. Overall, 2% of case-patients developed SNHL that was severe enough for them to be candidates for cochlear implantation. PMID:28209771

  4. Prevalence and clinical management of cytomegalovirus retinitis in AIDS patients in shanghai, china

    Directory of Open Access Journals (Sweden)

    Shi Ying

    2011-11-01

    Full Text Available Abstract Background Cytomegalovirus retinitis is a common AIDS-associated illness, leading to blindness in up to 30% of patients. This study was to investigate the prevalence and clinical management of the cytomegalovirus retinitis associated with AIDS in a large municipality of China. Methods Clinical and laboratory data from 23 cytomegalovirus retinitis patients (35 eyes out of 303 hospitalized AIDS individuals in a single medical center were analyzed retrospectively. Two of 23 patients were diagnosed cytomegalovirus retinitis just before hospitalization without anti-CMV therapy. Ganciclovir combined with the high active anti-retroviral therapy was installed for treatment of cytomegalovirus retinitis after diagnosis was confirmed. The data were analyzed by specialists and statistics was also applied. Results The prevalence of cytomegalovirus retinitis in hospitalized AIDS patients was 7.6% in this study. The level of CD4+ T lymphocytes was correlated well with the occurrence of cytomegalovirus retinitis, showing 16.8% (19/113 (95% confidence interval: 10.4,25.0, 5.4% (3/56 (95% confidence interval: 1.1,14.9, and 1.4% (1/69 (95% confidence interval: 0.0,7.8 occurrence in the patients with CD4+ T lymphocyte counts 4+ T lymphocyte counts was 31.7 ± 38.6 cells/μl in 23 AIDS patients with cytomegalovirus retinitis. Median CD4+ T lymphocyte count is 20 cells/μl with inter-quartile range as (5, 36. Seven patients died (11 eyes and 16 patients (24 eyes survived. The proportion of blindness and low vision in eyes infected with cytomegalovirus retinitis respectively was 20.8% (5/24 and 29.2% (7/24 when they were diagnosed in survivors. The ganciclovir therapy was effective in 16 patients (24 eyes. Clinical recovery of cytomegalovirus retinitis was 41.7% (10/24 and clinical improvement 58.3% (14/24. After anti-CMV treatment, the proportion of blindness or low vision was 16.7% (4/24. Conclusions The AIDS patients with CD4+ T lymphocyte 4+ T lymphocyte

  5. Cytomegalovirus Immunoglobulin for Prophylaxis and Treatment of Cytomegalovirus Infection in the (Val)Ganciclovir Era: A Single-Center Experience.

    Science.gov (United States)

    Lopez Garcia-Gallo, Cristina; García Fadul, Christian; Laporta, Rosalia; Portero, Francisca; Millan, Isabel; Ussetti, Piedad

    2015-11-05

    Evidence concerning the effectiveness of anti-cytomegalovirus immunoglobulin (CMVIg) following lung transplantation in the era of new antiviral agents is limited and controversial. At-risk patients (donor seropositive/recipient seronegative [D+/R-] and R+) received valganciclovir for 3 months (R+) or 6 months (D+/R). CMVIg (2 mg/kg) was given to D+/R- patients on days 1, 4, 8, 15, and 30 post-transplant, then monthly for a further year. Patients with valganciclovir-induced leukopenia were switched to CMVIg (2 mg/kg) prophylaxis. Tissue-invasive disease was treated with intravenous ganciclovir with CMVIg (2 mg/kg) every other day for 1 week and then weekly until discharge. Of 159 patients analyzed, 26 (17%) were D+/R-. Cytomegalovirus (CMV) viremia was more frequent in D+/R- recipients than in R+ patients (61% vs. 35%; P38°C), leukopenia, and detection of CMV in blood. Ten patients developed tissue-invasive disease after completion of prophylaxis (5 pneumonitis and 5 gastrointestinal disease); all were successfully treated with combined intravenous ganciclovir and CMVIg. None of the 18 donor seropositive/recipient seronegative patients who were switched from valganciclovir to CMVIg for persistent leukopenia developed CMV viremia during treatment. No cases of CMV infection or disease were attributable to ganciclovir-resistant strains. During follow-up, 44 patients died (4/26 R+/D- [15%], 40/133 R+ [30%), none directly due to CMV infection. Combined prophylaxis with valganciclovir and CMVIg delayed CMV viremia and tissue-invasive disease in D+/R- lung transplant recipients, and prevented CMV-related mortality and development of ganciclovir resistance. CMVIg monotherapy prophylaxis was effective in R+ patients with ganciclovir-related toxicity.

  6. Cyclin A degradation by primate cytomegalovirus protein pUL21a counters its innate restriction of virus replication.

    Directory of Open Access Journals (Sweden)

    Nicolas Caffarelli

    Full Text Available Cyclin A is critical for cellular DNA synthesis and S phase progression of the cell cycle. Human cytomegalovirus (HCMV can reduce cyclin A levels and block cellular DNA synthesis, and cyclin A overexpression can repress HCMV replication. This interaction has only been previously observed in HCMV as murine CMV does not downregulate cyclin A, and the responsible viral factor has not been identified. We previously reported that the HCMV protein pUL21a disrupted the anaphase-promoting complex (APC, but a point mutant abrogating this activity did not phenocopy a UL21a-deficient virus, suggesting that pUL21a has an additional function. Here we identified a conserved arginine-x-leucine (RxL cyclin-binding domain within pUL21a, which allowed pUL21a to interact with cyclin A and target it for proteasome degradation. Homologous pUL21a proteins from both chimpanzee and rhesus CMVs also contained the RxL domain and similarly degraded cyclin A, indicating that this function is conserved in primate CMVs. The RxL point mutation disabled the virus' ability to block cellular DNA synthesis and resulted in a growth defect similar to pUL21a-deficient virus. Importantly, knockdown of cyclin A rescued growth of UL21a-deficient virus. Together, these data show that during evolution, the pUL21a family proteins of primate CMVs have acquired a cyclin-binding domain that targets cyclin A for degradation, thus neutralizing its restriction on virus replication. Finally, the combined proteasome-dependent degradation of pUL21a and its cellular targets suggests that pUL21a may act as a novel suicide protein, targeting its protein cargos for destruction.

  7. Single-dose protection against Plasmodium berghei by a simian adenovirus vector using a human cytomegalovirus promoter containing intron A.

    Science.gov (United States)

    Sridhar, S; Reyes-Sandoval, A; Draper, S J; Moore, A C; Gilbert, S C; Gao, G P; Wilson, J M; Hill, A V S

    2008-04-01

    Human adenovirus serotype 5 (AdH5) vector vaccines elicit strong immune responses to the encoded antigen and have been used in various disease models. We designed AdH5 vectors expressing antigen under the control of a human cytomegalovirus (HCMV) immediate-early promoter containing its intron A sequence. The transcriptional levels of antigen and immune responses to antigen for vectors with the HCMV promoter with the intron A sequence (LP) were greater than those for AdH5 vectors using the HCMV promoter sequence without intron A (SP). We compared an E1E3-deleted AdH5 adenoviral vector, which affords more space for insertion of foreign sequences, and showed it to be as immunogenic as an E1-deleted AdH5 vector. Neutralizing antibodies to AdH5 limit the efficacy of vaccines based on the AdH5 serotype, and simian adenoviral vectors offer an attractive option to overcome this problem. We constructed E1E3-deleted human and simian adenoviral vectors encoding the pre-erythrocytic-stage malarial antigen Plasmodium berghei circumsporozoite protein. We compared the immunogenicity and efficacy of AdC6, a recombinant simian adenovirus serotype 6 vector, in a murine malaria model to those of AdH5 and the poxviral vectors MVA and FP9. AdC6 induced sterile protection from a single dose in 90% of mice, in contrast to AdH5 (25%) and poxviral vectors MVA and FP9 (0%). Adenoviral vectors maintained potent CD8(+) T-cell responses for a longer period after immunization than did poxviral vectors and mainly induced an effector memory phenotype of cells. Significantly, AdC6 was able to maintain protection in the presence of preexisting immunity to AdH5.

  8. The human cytomegalovirus gene products essential for late viral gene expression assemble into prereplication complexes before viral DNA replication.

    Science.gov (United States)

    Isomura, Hiroki; Stinski, Mark F; Murata, Takayuki; Yamashita, Yoriko; Kanda, Teru; Toyokuni, Shinya; Tsurumi, Tatsuya

    2011-07-01

    The regulation of human cytomegalovirus (HCMV) late gene expression by viral proteins is poorly understood, and these viral proteins could be targets for novel antivirals. HCMV open reading frames (ORFs) UL79, -87, and -95 encode proteins with homology to late gene transcription factors of murine gammaherpesvirus 68 ORFs 18, 24, and 34, respectively. To determine whether these HCMV proteins are also essential for late gene transcription of a betaherpesvirus, we mutated HCMV ORFs UL79, -87, and -95. Cells were infected with the recombinant viruses at high and low multiplicities of infection (MOIs). While viral DNA was detected with the recombinant viruses, infectious virus was not detected unless the wild-type viral proteins were expressed in trans. At a high MOI, mutation of ORF UL79, -87, or -95 had no effect on the level of major immediate-early (MIE) gene expression or viral DNA replication, but late viral gene expression from the UL44, -75, and -99 ORFs was not detected. At a low MOI, preexpression of UL79 or -87, but not UL95, in human fibroblast cells negatively affected the level of MIE viral gene expression and viral DNA replication. The products of ORFs UL79, -87, and -95 were expressed as early viral proteins and recruited to prereplication complexes (pre-RCs), along with UL44, before the initiation of viral DNA replication. All three HCMV ORFs are indispensable for late viral gene expression and viral growth. The roles of UL79, -87, and -95 in pre-RCs for late viral gene expression are discussed.

  9. The effects of age and cytomegalovirus on markers of inflammation and lymphocyte populations in captive baboons.

    Directory of Open Access Journals (Sweden)

    Erin L Willis

    Full Text Available The human immune system undergoes age-related changes that can lead to increased disease susceptibility. Using the baboon as a model for human immune system aging, we examined age-related changes in relative and absolute numbers of T cell subpopulations, cytomegalovirus (CMV titer and markers of inflammation. In addition, the effect of gender, social status and peer group on lymphocyte subpopulations was determined. Relative and absolute numbers of total lymphocytes (CD3+, T helper cells (CD4+, and cytotoxic T cells (CD8+ increased with age. The proportion of naïve T cells (CD45RA+ decreased, while the total number of cells negative for the co-stimulatory receptor, CD28 (CD28- increased in an age-dependent manner. Furthermore, CMV titers were negatively correlated with the number of naive CD4+ cells. IL-6 and cortisol concentration were also negatively associated with T cell subpopulations. Additionally, socially dominant baboons exhibited decreases in naïve CD4+ and CD8+ cells (by 65% and 52%, respectively compared to subordinate animals. These results suggest that factors such as CMV exposure and inflammation may contribute to the age-related decline in immune health and indicate that factors like social status should be considered when studying immunosenescence in animal models.

  10. The tiers and dimensions of evasion of the type I interferon response by human cytomegalovirus.

    Science.gov (United States)

    Amsler, Lisi; Verweij, Marieke; DeFilippis, Victor R

    2013-12-13

    Human cytomegalovirus (HCMV) is a member of the β-herpesvirus family that invariably occupies hosts for life despite a consistent multi-pronged antiviral immune response that targets the infection. This persistence is enabled by the large viral genome that encodes factors conferring a wide assortment of sophisticated, often redundant phenotypes that disable or otherwise manipulate impactful immune effector processes. The type I interferon system represents a first line of host defense against infecting viruses. The physiological reactions induced by secreted interferon act to effectively block replication of a broad spectrum of virus types, including HCMV. As such, the virus must exhibit counteractive mechanisms to these responses that involve their inhibition, tolerance, or re-purposing. The goal of this review is to describe the impact of the type I interferon system on HCMV replication and to showcase the number and diversity of strategies employed by the virus that allow infection of hosts in the presence of interferon-dependent activity. © 2013.

  11. Letermovir and inhibitors of the terminase complex: a promising new class of investigational antiviral drugs against human cytomegalovirus

    Directory of Open Access Journals (Sweden)

    Melendez DP

    2015-08-01

    Full Text Available Dante P Melendez,1,2 Raymund R Razonable1,2 1Division of Infectious Diseases, 2William J von Liebig Center for Transplantation and Clinical Regeneration, Mayo Clinic, Rochester, MN, USA Abstract: Infection with cytomegalovirus is prevalent in immunosuppressed patients. In solid organ transplant and hematopoietic stem cell transplant recipients, cytomegalovirus infection is associated with high morbidity and preventable mortality. Prevention and treatment of cytomegalovirus with currently approved antiviral drugs is often associated with side effects that sometimes preclude their use. Moreover, cytomegalovirus has developed mutations that confer resistance to standard antiviral drugs. During the last decade, there have been calls to develop novel antiviral drugs that could provide better options for prevention and treatment of cytomegalovirus. Letermovir (AIC246 is a highly specific antiviral drug that is currently undergoing clinical development for the management of cytomegalovirus infection. It acts by inhibiting the viral terminase complex. Letermovir is highly potent in vitro and in vivo against cytomegalovirus. Because of a distinct mechanism of action, it does not exhibit cross-resistance with other antiviral drugs. It is predicted to be active against strains that are resistant to ganciclovir, foscarnet, and cidofovir. To date, early-phase clinical trials suggest a very low incidence of adverse effects. Herein, we present a comprehensive review on letermovir, from its postulated novel mechanism of action to the results of most recent clinical studies. Keywords: cytomegalovirus, letermovir, AIC246, terminase, antivirals, transplantation 

  12. In silico pattern-based analysis of the human cytomegalovirus genome.

    Science.gov (United States)

    Rigoutsos, Isidore; Novotny, Jiri; Huynh, Tien; Chin-Bow, Stephen T; Parida, Laxmi; Platt, Daniel; Coleman, David; Shenk, Thomas

    2003-04-01

    More than 200 open reading frames (ORFs) from the human cytomegalovirus genome have been reported as potentially coding for proteins. We have used two pattern-based in silico approaches to analyze this set of putative viral genes. With the help of an objective annotation method that is based on the Bio-Dictionary, a comprehensive collection of amino acid patterns that describes the currently known natural sequence space of proteins, we have reannotated all of the previously reported putative genes of the human cytomegalovirus. Also, with the help of MUSCA, a pattern-based multiple sequence alignment algorithm, we have reexamined the original human cytomegalovirus gene family definitions. Our analysis of the genome shows that many of the coded proteins comprise amino acid combinations that are unique to either the human cytomegalovirus or the larger group of herpesviruses. We have confirmed that a surprisingly large portion of the analyzed ORFs encode membrane proteins, and we have discovered a significant number of previously uncharacterized proteins that are predicted to be G-protein-coupled receptor homologues. The analysis also indicates that many of the encoded proteins undergo posttranslational modifications such as hydroxylation, phosphorylation, and glycosylation. ORFs encoding proteins with similar functional behavior appear in neighboring regions of the human cytomegalovirus genome. All of the results of the present study can be found and interactively explored online (http://cbcsrv.watson.ibm.com/virus/).

  13. Clinical and morphological variants of hepatitis onset with congenital cytomegalovirus and hepatitis C infection

    Directory of Open Access Journals (Sweden)

    R. A. Ushakova

    2013-01-01

    Full Text Available We present comparative analysis of clinical – morphological data from infants with congenital cytomegalovirus and hepatitis C infection. 97 patients with hepatitis underwent a standard set of clinical and laboratory tests. ELISA and PCR were used to verify infectious agents. Informed consent to perform a liver biopsy was obtained from the parents of 28 children. immunohistochemical test of the liver samples managed to identify markers of cytomegalovirus (protein pp65 and p52 and hepatitis C (helicase NS3. The hepatitis C virus was detected in 41 patients: 3a genotype – 68.3%, 1b –31.7% respectively. Congenital hepatitis C onset presents itself as mild and atypical and causes chronic hepatitis with the 1st degree fibrosis. Cytomegalovirus replication markers were found in 56 children. The most common manifestations of hepatitis associated with cytomegalovirus infection are prolonged jaundice, cholestasis, gepatolienalny syndrome, early onset of the disease with increased transaminase levels and dominance in AST. Structural changes of the liver are characterized by the presence of inflammatory infiltration, cholestasis with duktulopenia, lobular structure damage. Congenital cytomegalovirus-related hepatitis is likely to result in liver cirrhosis and is associated with poor prognosis.

  14. Cytomegalovirus infection in renal transplantation: clinical aspects, management and the perspectives

    Science.gov (United States)

    Requião-Moura, Lúcio Roberto; de Matos, Ana Cristina Carvalho; Pacheco-Silva, Alvaro

    2015-01-01

    Cytomegalovirus infection is one of most frequent infectious complications after renal transplantation, and can be classified as primo-infection, when the transmission occurs through the graft, or reactivation, when the recipient is cytomegalovirus seropositive. After transplantation, cytomegalovirus can appear as an infection, when the patient presents with evidence of viral replication without symptoms or disease, which has two clinical spectra: typical viral syndrome or invasive disease, which is a less common form. Their effects can be classified as direct, while the disease is developed, or indirect, with an increase of acute rejection and chronic allograft dysfunction risks. Diagnosis must be made based on viremia by one of the standardized methods: antigenemia or PCR, which is more sensitive. The risk factors related to infection after transplantation are the serologic matching (positive donor and negative recipient) and anti-lymphocyte antibody drugs. One of the strategies to reduce risk of disease should be chosen for patients at high risk: preemptive treatment or universal prophylaxis. Recent clinical research has described ganciclovir resistance as an emergent problem in management of cytomegalovirus infection. Two types of mutation that cause resistance were described: UL97 (most frequent) and UL54. Today, sophisticated methods of immunologic monitoring to detect specific T-cell clones against cytomegalovirus are used in clinical practice to improve the management of high-risk patients after renal transplantation. PMID:25993081

  15. Seroprevalence of cytomegalovirus antibodies amongst normal pregnant women in Nigeria

    Directory of Open Access Journals (Sweden)

    Akinbami AA

    2011-12-01

    Full Text Available Akinsegun Abduljaleel Akinbami1, Kabiru Afolarin Rabiu2, Adeniyi Abiodun Adewunmi2, Kikelomo Ololade Wright3, Adedoyin Owolabi Dosunmu1, Titilope Adenike Adeyemo4, Adewumi Adediran4, Oluseye Vincent Osunkalu41Department of Haematology and Blood Transfusion, 2Department of Obstetrics and Gynaecology, 3Department of Community Medicine and Primary Health Care, College of Medicine, Lagos State University, Ikeja, 4Department of Haematology and Blood Transfusion, College of Medicine, Faculty of Clinical Sciences, University of Lagos, Idiaraba, NigeriaObjective: Cytomegalovirus (CMV, a ubiquitous virus belonging to the herpes family, is known to be transmitted frequently to developing fetuses in pregnancy. In an immunocompromised state like pregnancy, primary infection through blood transfusion or reactivation of a latent CMV infection can cause severe illness. The study was carried out to determine the seroprevalence of the immunoglobulin G (IgG antibody to cytomegalovirus amongst pregnant women in correlation with previous exposure to blood transfusion.Methods: A cross sectional study was carried out amongst 179 HIV negative pregnant women attending the antenatal clinic of Lagos State University Teaching Hospital (LASUTH, Ikeja, Nigeria. Five mL of blood was collected and stored in a plain bottle, centrifuged on the same day and the serum stored at -20°C. All samples were screened for anti-CMV IgG antibodies using the enzyme linked immunosorbent assay (ELISA. Consenting participants were instructed to fill a semi-structured questionnaire to obtain demographic and other related information. Statistical analysis of the results was done using Pearson's chi squared test for analytical assessment.Results: A total of 97.2% of the pregnant women recruited for this study were anti-CMV IgG positive. Out of the 179 recruited for the study 174 responded to the question on previous history of blood transfusion, 14.9% of the respondents (26 of 174 had a previous

  16. Human Cytomegalovirus is Present in Alveolar Soft Part Sarcoma.

    Science.gov (United States)

    Price, Richard L; Harkins, Lualhati; Chiocca, Ennio A; Zhang, Paul J; Kurt, Habibe; Iwenofu, Obiajulu H

    2017-10-01

    Alveolar soft part sarcoma (ASPS) is an exquisitely rare sarcoma of unknown histogenesis, with a predilection for adolescents and young adults, characterized by slow progressive clinical course and high frequency of metastases. They are traditionally chemoresistant with very limited treatment options in the metastatic setting. Human cytomegalovirus (HCMV) is a DNA β-herpes virus and it is characterized by persistent lifelong and latent infection. There is growing evidence to indicate the presence of HCMV proteins and nucleic acids in glioblastoma, medulloblastoma, rhabdomyosarcoma, and a variety of solid organ malignancies of the breast, prostate, lung, and colon at very high prevalence. Immunotherapy-based clinical trials targeting specific cytomegalovirus proteins are currently in progress in the treatment of glioblastoma. Herein, we evaluated for the presence of HCMV proteins (IE1 and pp65), genes (US28 and UL96), and RNA in a cohort of ASPS. Six confirmed cases of ASPS were retrieved and full thickness sections of formalin-fixed paraffin-embedded material were stained for anti-HMCV-IE1 and anti-HCMV-pp65. Any nuclear and/or cytoplasmic staining was considered positive. DNA was purified from 50 µm of formalin-fixed paraffin-embedded material. One hundred nanogram of DNA was amplified using polymerase chain reaction for primers specific to HCMV-US28 (forward: AGCGTGCCGTGTACGTTAC and reverse: ATAAAGACAAGCACGACC) and HCMV-UL96 (forward: ACAGCTCTTAAAGGACGTGATGCG and reverse: ACCGTGTCCTTCAGCTCGGTTAAA) using Promega Taq polymerase. HCMV in situ hybridization was performed. All 6 cases of ASPS were positive for both HCMV-IE1 and HCMV-pp65. Usable DNA was available in 4 of the 6 cases. HCMV-US28 gene was found in 75% (3/4) of cases and HCMV-UL96 gene was detected in 50% (2/4) of cases. Importantly, all cases tested positive for at least 1 gene. HCMV-encoded RNA was identified in 80% (4/5) of cases. The presence of HCMV DNA, RNA along with HCMV protein indicates that

  17. Cytomegalovirus-associated splenic infarcts in a female patient with Factor V Leiden mutation: a case report

    Directory of Open Access Journals (Sweden)

    Atzmony Lihi

    2008-12-01

    Full Text Available Abstract Introduction Cytomegalovirus-associated thrombosis has rarely been reported in the medical literature, and if so, mainly in immunocompromized patients. Case presentation We report the case of a 36-year-old Caucasian woman with acute cytomegalovirus infection presenting with spontaneous splenic infarcts. Trans-esophageal echocardiography did not show any vegetations or mural thrombi. The patient was also found to be heterozygous for the Factor V Leiden mutation. Anticoagulation treatment was considered but ruled out since cytomegalovirus was the obvious trigger for thrombosis in this patient. To the best of our knowledge, this is only the third report to date of cytomegalovirus-associated splenic infarcts. Conclusion This case report serves as additional evidence for the role of cytomegalovirus in thrombosis.

  18. Efficacy of topical and systemic antibiotic treatment of meticillin-resistant Staphylococcus aureus in a murine superficial skin wound infection model

    DEFF Research Database (Denmark)

    Vingsbo Lundberg, Carina; Frimodt-Møller, Niels

    2013-01-01

    in an experimental skin wound infection model in mice. Mice were treated either topically with retapamulin (1%), fusidic acid (2%) or mupirocin (2%) or systemically with linezolid (50-100 mg/kg/day) or vancomycin (50-200 mg/kg/day) twice daily for 3 days or 6 days and the total bacterial loads in the skin lesions...

  19. Generation of cytotoxic T lymphocytes specific for human cytomegalovirus using dendritic cells in vitro.

    Science.gov (United States)

    Cho, H I; Han, H; Kim, C C; Kim, T G

    2001-01-01

    For the adoptive immunotherapy in immunodeficient bone marrow transplant recipients to prevent and treat human cytomegalovirus (HCMV)-associated diseases, HCMV-pulsed dendritic cells (DCs) were used as antigen-presenting cells for the induction of cytotoxic T lymphocytes (CTLs) specific to HCMV antigens in vitro. The antiviral CTL responses induced by HCMV-pulsed DCs were as highly efficient as those induced by HCMV-infected dermal fibroblasts, and endogenous viral gene expression was not required to induce virus-specific T-cell lines. The strong cytotoxic activity against HCMV-pp65, known as HCMV major antigen, was identified using autologous B lymphoblastoid cell line expressing pp65 antigen. The cytotoxic activity toward HCMV-infected target cells was found to be mediated primarily by CD8+ T cells, although both CD8+ cells and CD4+ cells were able to lyse autologous virus-infected target cells. The CTLs contained a mixture of effector cells that recognized virus peptides in the context of major histocompatibility complex. This system may be useful for defining the cellular immune response to HCMV and for the treatment of HCMV infection in immunocompromised patients.

  20. Reactivation of herpes simplex virus type 1 is associated with cytomegalovirus and age.

    Science.gov (United States)

    Stowe, Raymond P; Peek, M Kristen; Cutchin, Malcolm P; Goodwin, James S

    2012-11-01

    Recent studies have shown that cytomegalovirus (CMV) may be an emerging marker of immunosenescence. CMV can affect the immune system by directly infecting leukocytes and hematopoietic cells or by eliciting an expansion of oligoclonal CD8+ T cells/contraction of the naïve T cell compartment that may reduce the host's ability to fight other pathogens. To investigate further CMV-associated changes in immunity, a study was conducted with 1,454 adults (ages 25-91) to determine the association between CMV and reactivation of another latent herpesvirus, Herpes simplex virus type 1 (HSV-1), as indexed by antibody titers. Elevated antibody titers to latent HSV-1 were significantly associated with both CMV seropositivity and high CMV antibody levels. Evaluation by specific age groups (old) revealed that this association was detectable early in life (age). Increases in HSV-1 antibodies by age occurred in CMV seropositive individuals but not CMV seronegative subjects. Within CMV seropositive subjects, increases in HSV-1 antibodies by age were only found in individuals with low CMV antibody levels as those with high CMV antibodies already exhibited elevated HSV-1 antibodies. These associations remained significant after accounting for body mass index, gender, and socioeconomic status. These results suggest that CMV can influence the immune response to another pathogen and support the concept that CMV may accelerate immunosenescence. Copyright © 2012 Wiley Periodicals, Inc.

  1. Cytomegalovirus Infection Impairs Immunosuppressive and Antimicrobial Effector Functions of Human Multipotent Mesenchymal Stromal Cells

    Directory of Open Access Journals (Sweden)

    Roland Meisel

    2014-01-01

    Full Text Available Human mesenchymal stromal cells (MSC possess immunosuppressive and antimicrobial effects that are partly mediated by the tryptophan-catabolizing enzyme indoleamine-2,3-dioxygenase (IDO. Therefore MSC represent a promising novel cellular immunosuppressant which has the potential to control steroid-refractory acute graft versus host disease (GvHD. In addition, MSC are capable of reducing the risk of infection in patients after haematopoietic stem cell transplantation (HST. Recent data indicate that signals from the microenvironment including those from microbes may modulate MSC effector functions. As Cytomegalovirus (CMV represents a prominent pathogen in immunocompromised hosts, especially in patients following HST, we investigated the impact of CMV infection on MSC-mediated effects on the immune system. We demonstrate that CMV-infected MSC lose their cytokine-induced immunosuppressive capacity and are no longer able to restrict microbial growth. IDO expression is substantially impaired following CMV infection of MSC and this interaction critically depends on intact virus and the number of MSC as well as the viral load. Since overt CMV infection may undermine the clinical efficacy of MSC in the treatment of GvHD in transplant patients, we recommend that patients scheduled for MSC therapy should undergo thorough evaluation for an active CMV infection and receive CMV-directed antiviral therapy prior to the administration of MSC.

  2. The Potential Harm of Cytomegalovirus Infection in Immunocompetent Critically Ill Children

    Directory of Open Access Journals (Sweden)

    Raidan Alyazidi

    2018-04-01

    Full Text Available Cytomegalovirus (CMV is a ubiquitous infection that causes disease in congenitally infected children and immunocompromised patients. Although nearly all CMV infections remain latent and asymptomatic in immunologically normal individuals, numerous studies have found that systemic viral reactivation is common in immunocompetent critically ill adults, as measured by detection of CMV in the blood (viremia. Furthermore, CMV viremia is strongly correlated with adverse outcomes in the adult intensive care unit (ICU, including prolonged stay, duration of mechanical ventilation, and death. Increasing evidence, including from a randomized clinical trial of antiviral treatment, suggests that these effects of CMV may be causal. Therefore, interventions targeting CMV might improve outcomes in adult ICU patients. CMV may have an even greater impact on critically ill children, particularly in low and middle income countries (LMIC, where CMV is regularly acquired in early childhood, and where inpatient morbidity and mortality are inordinately high. However, to date, there are few data regarding the clinical relevance of CMV infection or viremia in immunocompetent critically ill children. We propose that CMV infection should be studied as a potential modifiable cause of disease in critically ill children, and that these studies be conducted in LMIC. Below, we briefly review the role of CMV in immunologically normal critically ill adults and children, outline age-dependent differences in CMV infection that may influence ICU outcomes, and describe an agenda for future research.

  3. Epiretinal membrane in a 12-year-old immunocompetent girl with cytomegalovirus infection.

    Science.gov (United States)

    Costagliola, Ciro; Romano, Mario R; Parmeggiani, Francesco; Dell'omo, Roberto; Cultrera, Rosario

    2009-01-01

    To report the case of a 12-year-old immunocompetent girl presenting bilateral epiretinal membrane formation in conjunction with systemic human cytomegalovirus (HCMV) infection. The patient had a sudden onset of blurred vision and floaters in both eyes. Her medical history was unremarkable, except for allergic asthma that she had had for several years and that she was treating with inhaler corticosteroids prescribed by her pediatrician. The patient underwent a complete ophthalmic examination and serologic blood test. The ocular examination revealed an epiretinal membrane confirmed by optical coherence tomography, which showed a band of high optical reflectivity compatible with a proliferation of abnormal tissue on the surface of the retina. The patient had serologic evidence of exposure to HCMV, which was verified by a strongly positive HCMV IgM antibody test result (320 IU), with detectable IgG antibodies against HCMV, which significantly rose further in consecutive blood samples, due to IgG antibody seroconversion. Our patient had allergic asthma that she was treating with inhaled corticosteroids. The immunosuppressive properties of corticosteroids could induce endogenous reactivation of latent HCMV.

  4. Functional analysis of the human cytomegalovirus immune evasion protein, pUS322kDa

    International Nuclear Information System (INIS)

    Zhao Yiqiang; Biegalke, Bonita J.

    2003-01-01

    Human cytomegalovirus (HCMV) is an important opportunistic pathogen that infrequently causes disease in individuals with mature immune systems. The HCMV US3 gene encodes a 22-kDa protein that interferes with immune recognition of virally infected cells. The 22-kDa US3 protein binds to major histocompatibility complex (MHC) class I complexes, retaining them in the endoplasmic reticulum (ER), thereby decreasing the presentation of viral antigen to cytotoxic T cells. Our studies demonstrate that correct folding of the ER lumenal domain of the US3 protein is essential, but insufficient for interactions with MHC class I complexes. We demonstrate a requirement for the transmembrane domain of the 22-kDa US3 protein, confirming the results of others, and also show that the cytosolic carboxyl-terminal tail influences the function of the protein. Anchoring of the ER-lumenal immunoglobulin-like fold of the US3 protein to the membrane of the endoplasmic reticulum is critical for the binding and retention of MHC class I complexes

  5. Isolation and characterization of the murine alpha-L-iduronidase cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Clarke, L.A.; Zhang, H. Nasir, J. [Univ. of British Columbia, Vancouver (Canada)] [and others

    1994-09-01

    Mucopolysaccharidosis I (MPS I) are a group of disorders caused by deficiency of the lysosomal enzyme alpha-L-iduronidase. The characterization of the human gene and the identification of mutations underlying MPS I in humans has led to the delineation of the molecular basis of this disorder. Model systems are now needed for the evaluation and development of therapeutics for this disorder. Both canine and feline models for MPS type I have been described but only the canine gene has been isolated and characterized. We report here the cloning and expression of the murine alpha-L-iduronidase cDNA. The murine cDNA was obtained by screening a mouse liver cDNA library with a probe from the human cDNA. The full length murine cDNA is 3120 base pairs in length and thus is considerably larger than both the human and canine transcripts. The increase in size is due to a 1.2 kb 3{prime} untranslated region in the murine cDNA that contains a CA dinucleotide repeat. Within the coding region the murine cDNA shows sequences. At the protein level the murine protein shows 77% similarity with the human protein and 75% similarity with the canine protein. There are significant differences in both the start and stop sites with the murine protein 9 amino acids shorter at both the N terminal signal peptide region and the C terminus. Expression of the murine cDNA in COS-1 cells resulted in a 20 fold increase in intracellular alpha-L-iduronidase activity as well as the detection of considerable enzyme activity in the culture medium. Comparison of the reported missense mutations underlying MPS I in humans (A75T, H82P, R89Q, L218P, P533R, Q310X, T366P) has shown conservation of these amino acid residues in the murine protein. The isolation of the murine iduronidase cDNA will now allow for the development of a murine model for MPS I.

  6. Serologic survey of cytomegalovirus and rubella virus in Tabriz, Iran

    Directory of Open Access Journals (Sweden)

    Samad Farhadi

    2015-12-01

    Full Text Available Objective: To determine the prevalence of rubella and cytomegalovirus (CMV among women in Tabriz City, Iran in 2013. Methods: This study was carried out in numerous laboratories in city of Tabriz. In 2013, 26618 women aged 18–35 years were enrolled in this study. Serum samples were analyzed with chemiluminescence apparatus and SPSS software was used to conduct the statistical analysis. Results: A total of 26618 individuals were examined (10598 cases for anti-CMV and 16020 cases for anti-rubella. About 98.9% and 1.1% samples were reported positive and negative for CMV immunoglobulin G (IgG, respectively. The positivity for anti-CMV immunoglobulin M (IgM antibody was found in 0.75% samples, while 99.25% were negative for the anti-CMV IgM antibody. Anti-IgG against rubella seropositivity was found in 95.8% and rubella IgM seropositivity in 0.93%. Anti-IgG against rubella seronegativity was found in 4.2% and rubella IgM seronegativity in 99.07%. Conclusions: According to the results, primary and secondary infections are usually symptomless or inconspicuous, but they can cause serious fetal damage. Routine antenatal care should therefore include serological testing to check the immune status of the woman and to diagnose any fresh virus infections that may arise.

  7. [Giant gastric ulcer by cytomegalovirus in infection VIH/SIDA].

    Science.gov (United States)

    Pérez-Pereyra, Julia; Morales, Domingo; Díaz, Ramiro; Yoza, Max; Frisancho, Oscar

    2008-01-01

    Cytomegalovirus infection is an important cause of morbidity in immunosupressed patients with Human Immunodeficiency Virus (HIV). In this paper we present a 43 years old man with renal failure under hemodialysis, several blood transfusions because of anemia and three months of disease characterized by epigastric pain, specially at nights, ameliorated with antacid drugs. Other symptoms were early satisfy, vomits and weigh loss (18Kg). At clinical exam, the patient was pallid, presented adenopathies at cervical and inguinal regions and had a pain at epigastric region in profound touch palpation. The most important exams were HB: 10mg/dl, CMV: 83.5, leukocytes 7000, lymphocytes: 1715, erythrocyte sedimentation rate 49mm/h, the venon test (-), and Giardia lamblia trophozoites in stools. The studies demonstrated the patient was seropositive for HIV and the tests for IgG CMV and IgG Herpes virus resulted seropositives too. At endoscopy the esophagus mucosa was covered by a white plaque which suggests candida infection. In the stomach, over the body gastric, we found a big and deep ulcerated lesion (45 x 41mm), with defined rims and white fund. Biopsy from the edges of the gastric ulcer had the characteristic CMV intranuclear and intracytoplasmic inclusions; we confirmed the diagnosis by immunohystochemistry. The patient receives ganciclovir an then HAART and is getting well.

  8. Early motor development of children with a congenital cytomegalovirus infection.

    Science.gov (United States)

    De Kegel, Alexandra; Maes, Leen; Dhooge, Ingeborg; van Hoecke, Helen; De Leenheer, Els; Van Waelvelde, Hilde

    2016-01-01

    Congenital cytomegalovirus (cCMV) infection is the most important etiology of non-hereditary childhood hearing loss and an important cause of neurodevelopmental delay. The current study aimed to investigate the early motor development of symptomatic and asymptomatic cCMV infected children with and without sensorineural hearing loss (SNHL). Sixty-four children with a cCMV infection, without cerebral palsy, were compared to a control group of 107 normal hearing children. They were assessed around the ages of 6, 12, and 24 months with the Peabody Developmental Motor Scales-2 (PDMS-2), Alberta Infant Motor Scales (AIMS), and Ghent Developmental Balance Test (GDBT). The cCMV infected children were subdivided into a symptomatic (n=26) and asymptomatic cCMV group (n=38) but also into a cCMV group with SNHL (n=19) and without SNHL (n=45). Symptomatic cCMV infected children and cCMV infected children with SNHL performed significantly weaker for all gross motor outcome measures. A congenital CMV infection is a risk factor for a delay in the early motor development. Follow-up will be necessary to gain insight into the exact cause of this motor delay and to define the predictive value of early motor assessment of cCMV infected children. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Cytomegalovirus Hyper Immunoglobulin for CMV Prophylaxis in Thoracic Transplantation.

    Science.gov (United States)

    Rea, Federico; Potena, Luciano; Yonan, Nizar; Wagner, Florian; Calabrese, Fiorella

    2016-03-01

    Cytomegalovirus (CMV) infection negatively influences both short- and long-term outcomes after cardiothoracic transplantation. In heart transplantation, registry analyses have shown that CMV immunoglobulin (CMVIG) with or without virostatic prophylaxis is associated with a significant reduction in mortality and graft loss versus no prophylaxis, particularly in high-risk donor (D)+/recipient (R)- transplants. Randomized comparative trials are lacking but retrospective data suggest that addition of CMVIG to antiviral prophylaxis may reduce rates of CMV-related events after heart transplantation, including the incidence of acute rejection or chronic allograft vasculopathy. However, available data consistently indicate that when CMVIG is used, it should be administered with concomitant antiviral therapy, and that evidence concerning preemptive management with CMVIG is limited, but promising. In lung transplantation, CMVIG should again only be used with concomitant antiviral therapy. Retrospective studies have shown convincing evidence that addition of CMVIG to antiviral prophylaxis lowers CMV endpoints and mortality. The current balance of evidence suggests that CMVIG prophylaxis reduces the risk of bronchiolitis obliterans syndrome, but a controlled trial is awaited. Overall, the relatively limited current data set suggests that prophylaxis with CMVIG in combination with antiviral therapy appears effective in D+/R- heart transplant patients, whereas in lung transplantation, addition of CMVIG in recipients of a CMV-positive graft may offer an advantage in terms of CMV infection and disease.

  10. Cytomegalovirus infectivity in whole blood following leukocyte reduction by filtration.

    Science.gov (United States)

    Lipson, S M; Shepp, D H; Match, M E; Axelrod, F B; Whitbread, J A

    2001-07-01

    Cytomegalovirus (CMV) may be transmitted by transfusion of whole blood and cellular components processed according to standard processing procedures. A need exists to develop new procedures to remove CMV and other leukocyte-borne viruses from donor blood. Ten patients (AIDS/bone marrow transplants) who were CMV antigenemic (virus subsequently confirmed by isolation), donated 50 mL of venous blood within 24 to 72 hours of the initial antigen detection. Twenty-five-milliliter aliquots of each specimen were passed through Purecell Neo Neonatal Leukocyte Reduction Filters (Pall, East Hills, NY). The remaining 25-mL nonfiltered aliquots, as well as the blood filtrates, were subjected to infectivity endpoint determinations. The Purecell Neo filter effected a 3 to 4 log10 leukocyte reduction. CMV input titers ranged from less than 10 to 7.3 x 10(1) median tissue culture infectious dose (TCID50) per milliliter. CMV was not isolated from any postfiltration effluent (i.e., leukocytes, erythrocytes, or plasma). CMV DNA was not detected by nested polymerase chain reaction in 8 of 10 postfiltrate blood specimens. The Purecell Neo filter was efficacious in eliminating or significantly reducing viral (CMV) load in venous blood.

  11. Seroprevalence of cytomegalovirus infection in France in 2010.

    Science.gov (United States)

    Antona, D; Lepoutre, A; Fonteneau, L; Baudon, C; Halftermeyer-Zhou, F; LE Strat, Y; Lévy-Bruhl, D

    2017-05-01

    Cytomegalovirus (CMV) infection remains the leading cause of congenital virus infection in developed countries. Measuring the national prevalence of this infection, especially among women of childbearing age, is of great value to estimate the risk of congenital CMV infection, as well as to identify risk groups that should be targeted for behavioural interventions and/or vaccination once a CMV vaccine finally becomes available. In order to fulfil these objectives, a seroprevalence survey was conducted in 2010, using a nationally representative, population-based sample of 2536 people aged between 15 and 49 years, living in metropolitan France and attending private microbiological laboratories for blood testing. All blood samples were analysed in the same laboratory and screened for CMV-specific IgG using an enzyme-linked immunoassay technique (Elisa PKS Medac Enzyme immunoassay). The overall point estimate of CMV infection seroprevalence for individuals aged 15-49 years was 41.9%. The estimates were higher in women than in men (respectively 45.6% and 39.3%), and people born in a non-Western country were more likely to be CMV seropositive than those born in France or in another Western country (93.7% vs. 37.7%). Our results showed that a substantial percentage of women of childbearing age in France are CMV seronegative and therefore at risk of primary CMV infection during pregnancy. Educational measures and future vaccine are key issues to prevent infection in pregnant women and congenital CMV disease.

  12. Computed tomography for diagnosis of intestinal cytomegalovirus infection in AIDS

    International Nuclear Information System (INIS)

    Engelbrecht, V.; Schonlau, R.; Moedder, U.

    1994-01-01

    To check the value of computed tomography (CT) in the diagnosis of cytomegalovirus (CMV) infection of the intestine, CT findings in ten patients with coloscopically proven CMV infection were reviewed. All patients were chronically ill men with AIDS. In nine of the ten cases CT scans of the small intestine and/or colon disclosed abnormalities. The predominant alteration (9/9) was a symmetric wall thickening in the bowel segments involved (10-30 mm). The location and extent showed good agreement with the inflammatory areas seen on coloscopy. The cecum and terminal ileum were the regions most frequently affected. In seven of the nine patients with CT abnormalities CT revealed pericolonic inflammation, particularly around the cecum. Lymph nodes were increased but not enlarged. Comparison of the findings in intestinal CMV infection with those in other AIDS-related diseases suggests that CT may be to limit the differential diagnosis. Abdominal CT serves as suitable primary imaging modality for the initial evaluation of patients with AIDS and abdominal symptoms of unknow etiology. (orig.)

  13. Cytomegalovirus Hyper Immunoglobulin for CMV Prophylaxis in Thoracic Transplantation

    Science.gov (United States)

    Rea, Federico; Potena, Luciano; Yonan, Nizar; Wagner, Florian; Calabrese, Fiorella

    2016-01-01

    Cytomegalovirus (CMV) infection negatively influences both short- and long-term outcomes after cardiothoracic transplantation. In heart transplantation, registry analyses have shown that CMV immunoglobulin (CMVIG) with or without virostatic prophylaxis is associated with a significant reduction in mortality and graft loss versus no prophylaxis, particularly in high-risk donor (D)+/recipient (R)− transplants. Randomized comparative trials are lacking but retrospective data suggest that addition of CMVIG to antiviral prophylaxis may reduce rates of CMV-related events after heart transplantation, including the incidence of acute rejection or chronic allograft vasculopathy. However, available data consistently indicate that when CMVIG is used, it should be administered with concomitant antiviral therapy, and that evidence concerning preemptive management with CMVIG is limited, but promising. In lung transplantation, CMVIG should again only be used with concomitant antiviral therapy. Retrospective studies have shown convincing evidence that addition of CMVIG to antiviral prophylaxis lowers CMV endpoints and mortality. The current balance of evidence suggests that CMVIG prophylaxis reduces the risk of bronchiolitis obliterans syndrome, but a controlled trial is awaited. Overall, the relatively limited current data set suggests that prophylaxis with CMVIG in combination with antiviral therapy appears effective in D+/R− heart transplant patients, whereas in lung transplantation, addition of CMVIG in recipients of a CMV-positive graft may offer an advantage in terms of CMV infection and disease. PMID:26900991

  14. Congenital cytomegalovirus infection in Central Germany: an underestimated risk.

    Science.gov (United States)

    Rütten, Hannah; Rissmann, Anke; Brett, Birgit; Costa, Serban-Dan; Doßow, Birgit; Färber, Jacqueline; Fest, Stefan; Fritzsch, Christiane; Lux, Anke; Päge, Ilona; Spillner, Claudia; Redlich, Anke

    2017-08-01

    This is the first study to determine the cytomegalovirus (CMV) seronegativity rate for women of childbearing age in Saxony-Anhalt and to determine the prevalence of clinically relevant congenital CMV (cCMV) infection in Central Germany, because there are no valid data available. The retrospective study was undertaken between January 2005 and December 2015. For the first time in Germany, the following seven data sources were used to analyze the prevalence of clinically relevant cCMV infection and the rate of CMV seronegative women of childbearing age: CMV Screening in maternity unit, University Women's Hospital, Social Paediatrics Centre (SPC), Malformation Monitoring Centre (MMC), Newborn Hearing Screening (NHS), Neonatal Intensive Care Unit (NICU), and In-house Doctor Department. Key parameters were anti-CMV IgG and IgM, CMV PCR of urine, and clinically relevant symptoms caused by CMV. Between 46 and 52% of women of childbearing age were CMV seronegative. The prevalence of clinically relevant cCMV infection was between 0.008 and 0.04%. The CMV seronegativity rate of women of childbearing age was confirmed to be in the middle range of estimated data from other sources in Germany. Data from the NICU, SPC, NHS, and MMC show the prevalence of clinically relevant cCMV infection. The risk of all cCMV infections is underestimated. Thus, the true prevalence of clinically relevant and subclinical cCMV infections is >0.04%.

  15. Sclerosing cholangitis by cytomegalovirus in highly active antiretroviral therapy era

    Directory of Open Access Journals (Sweden)

    Carmen Hidalgo-Tenorio

    2013-10-01

    Full Text Available Sclerosing colangitis (SC due to cytomegalovirus (CMV is very rare. It has been described mainly in immunocompromised patients. Currently, in HIV infected patients it is exceptional. The most of cases belong to pre-highly active antiretroviral therapy (pre-HAART and those cases were in stage AIDS with less than 100 CD4/μl. The most frequently involved pathogen in pre-HAART period was Cryptosporidium parvum (30-57% and CMV (10-30%; in late HAART period this information are unaware. CMV has been implicated as a possible etiological agent in primary SC partly because of the ability to cause liver damage and its relationship with smooth muscle antibodies. The most effective treatment for SC was the combination of antiretroviral therapy and endoscopic retrograde cholangiopancreatography with sphincterotomy and stent placement. Following, we present the first case of late HAART period which describes a SC extrahepatic without papillary stenosis with CMV as the only cause and clinical presentation of HIV infection in a woman with 177 CD4/μl.

  16. BST2/Tetherin enhances entry of human cytomegalovirus.

    Directory of Open Access Journals (Sweden)

    Kasinath Viswanathan

    2011-11-01

    Full Text Available Interferon-induced BST2/Tetherin prevents budding of vpu-deficient HIV-1 by tethering mature viral particles to the plasma membrane. BST2 also inhibits release of other enveloped viruses including Ebola virus and Kaposi's sarcoma associated herpesvirus (KSHV, indicating that BST2 is a broadly acting antiviral host protein. Unexpectedly however, recovery of human cytomegalovirus (HCMV from supernatants of BST2-expressing human fibroblasts was increased rather than decreased. Furthermore, BST2 seemed to enhance viral entry into cells since more virion proteins were released into BST2-expressing cells and subsequent viral gene expression was elevated. A significant increase in viral entry was also observed upon induction of endogenous BST2 during differentiation of the pro-monocytic cell line THP-1. Moreover, treatment of primary human monocytes with siRNA to BST2 reduced HCMV infection, suggesting that BST2 facilitates entry of HCMV into cells expressing high levels of BST2 either constitutively or in response to exogenous stimuli. Since BST2 is present in HCMV particles we propose that HCMV entry is enhanced via a reverse-tethering mechanism with BST2 in the viral envelope interacting with BST2 in the target cell membrane. Our data suggest that HCMV not only counteracts the well-established function of BST2 as inhibitor of viral egress but also employs this anti-viral protein to gain entry into BST2-expressing hematopoietic cells, a process that might play a role in hematogenous dissemination of HCMV.

  17. Cytomegalovirus in the Neonate: Immune Correlates of Infection and Protection

    Directory of Open Access Journals (Sweden)

    Mark R. Schleiss

    2013-01-01

    Full Text Available Fetal and neonatal infections caused by human cytomegalovirus (CMV are important causes of morbidity and occasional mortality. Development of a vaccine against congenital CMV infection is a major public health priority. Vaccine design is currently focused on strategies that aim to elicit neutralizing antibody and T-cell responses, toward the goal of preventing primary or recurrent infection in women of child-bearing age. However, there has been relatively little attention given to understanding the mechanisms of immune protection against acquisition of CMV infection in the fetus and newborn and how this information might be exploited for vaccine design. There has similarly been an insufficient study of what deficits in the immune response to CMV, both for mother and fetus, may increase susceptibility to congenital infection and disease. Protection of the fetus against vertical transmission can likely be achieved by protection of the placenta, which has its own unique immunological milieu, further complicating the analysis of the correlates of protective immunity. In this review, the current state of knowledge about immune effectors of protection against CMV in the maternal, placental, and fetal compartments is reviewed. A better understanding of immune responses that prevent and/or predispose to infection will help in the development of novel vaccine strategies.

  18. A young patient with multisystem complications after cytomegalovirus infection

    Directory of Open Access Journals (Sweden)

    Swaroopa Pulivarthi

    2014-01-01

    Full Text Available We are describing a case of an 18-year-old male patient with cytomegalovirus (CMV associated guillain-barre syndrome (GBS who presented with an acute onset of generalized weakness and numbness in the extremities, dysphagia, and facial diplegia, followed by respiratory failure, which led to mechanical ventilation. He had positive immunoglobulin G and immunoglobulin M antibodies against CMV, and CMV polymerase chain reaction was positive with <2000 copies of deoxyribonucleic acid. Human immunodeficiency virus test was negative. He received a course of ganciclovir, intravenous immunoglobulin, and plasmapheresis. After improving from acute episode, patient was transferred to a rehabilitation facility for physical and occupational therapy. At the rehabilitation facility, he exhibited signs of acute abdomen with pain in the left upper quadrant secondary to peritonitis from dislodged gastrostomy tube and underwent exploratory laparotomy. During the hospital course he was found to have splenic infarct and colitis on the computed tomography of abdomen. This case showed an immunocompetent young patient with multisystem complications including guillain-barre syndrome (GBS, splenic infarct, hepatitis, and colitis due to CMV.

  19. Vertically transmitted cytomegalovirus infection in newborn preterm infants.

    Science.gov (United States)

    Balcells, Carla; Botet, Francesc; Gayete, Sònia; Marcos, M Ángeles; Dorronsoro, Izaskun; de Alba, Concepción; Figueras-Aloy, Josep

    2016-07-01

    To determine the epidemiology of congenital and acquired cytomegalovirus (CMV) infections in preterm infants and to analyze the efficacy of breast milk freezing in decreasing the vertical transmission rate of CMV. During 2013 and 2014, preterm newborns who weighed ≤1500 g and were admitted to 22 Spanish neonatal units were included and screened for CMV infection according to the Spanish Neonatology Society recommendations. Each hospital treated the breast milk according to its own protocols. Among the 1236 preterm neonates included, 10 had a congenital infection (0.8%) and 49 had an acquired infection (4.0%) (82% demonstrated positive PCR-CMV in breast milk). The neonates who received only frozen milk presented less frequently with acquired infection (1.2%) than those fed fresh milk (5.5%) (RR=0.22; 95% CI 0.05-0.90; P=0.017). The newborns who received bank milk followed by frozen or fresh breast milk more frequently had an acquired infection (2.1% or 2.2%, respectively) than those fed only frozen breast milk. The incidence of congenital CMV infection in our sample is low, as described in the literature. To reduce acquired CMV infection, freezing breast milk might be an advisable procedure for preterm neonates born from seropositive mothers, either from the beginning of lactation or after a period of bank milk administration.

  20. Progress toward Development of a Vaccine against Congenital Cytomegalovirus Infection

    Science.gov (United States)

    Permar, Sallie R.; Plotkin, Stanley A.

    2017-01-01

    ABSTRACT A vaccine against congenital human cytomegalovirus (CMV) infection is a major public health priority. Congenital CMV causes substantial long-term morbidity, particularly sensorineural hearing loss (SNHL), in newborns, and the public health impact of this infection on maternal and child health is underrecognized. Although progress toward development of a vaccine has been limited by an incomplete understanding of the correlates of protective immunity for the fetus, knowledge about some of the key components of the maternal immune response necessary for preventing transplacental transmission is accumulating. Moreover, although there have been concerns raised about observations indicating that maternal seropositivity does not fully prevent recurrent maternal CMV infections during pregnancy, it is becoming increasing clear that preconception immunity does confer some measure of protection against both CMV transmission and CMV disease (if transmission occurs) in the newborn infant. Although the immunity to CMV conferred by both infection and vaccination is imperfect, there are encouraging data emerging from clinical trials demonstrating the immunogenicity and potential efficacy of candidate CMV vaccines. In the face of the knowledge that between 20,000 and 30,000 infants are born with congenital CMV in the United States every year, there is an urgent and compelling need to accelerate the pace of vaccine trials. In this minireview, we summarize the status of CMV vaccines in clinical trials and provide a perspective on what would be required for a CMV immunization program to become incorporated into clinical practice. PMID:29046308

  1. Cytomegalovirus in the Neonate: Immune Correlates of Infection and Protection

    Science.gov (United States)

    Schleiss, Mark R.

    2013-01-01

    Fetal and neonatal infections caused by human cytomegalovirus (CMV) are important causes of morbidity and occasional mortality. Development of a vaccine against congenital CMV infection is a major public health priority. Vaccine design is currently focused on strategies that aim to elicit neutralizing antibody and T-cell responses, toward the goal of preventing primary or recurrent infection in women of child-bearing age. However, there has been relatively little attention given to understanding the mechanisms of immune protection against acquisition of CMV infection in the fetus and newborn and how this information might be exploited for vaccine design. There has similarly been an insufficient study of what deficits in the immune response to CMV, both for mother and fetus, may increase susceptibility to congenital infection and disease. Protection of the fetus against vertical transmission can likely be achieved by protection of the placenta, which has its own unique immunological milieu, further complicating the analysis of the correlates of protective immunity. In this review, the current state of knowledge about immune effectors of protection against CMV in the maternal, placental, and fetal compartments is reviewed. A better understanding of immune responses that prevent and/or predispose to infection will help in the development of novel vaccine strategies. PMID:24023565

  2. Possible association between congenital cytomegalovirus infection and autistic disorder.

    Science.gov (United States)

    Yamashita, Yushiro; Fujimoto, Chizu; Nakajima, Eisuke; Isagai, Takeo; Matsuishi, Toyojiro

    2003-08-01

    We encountered seven children with symptomatic congenital cytomegalovirus (CMV) infection from 1988 to 1995, of whom two (28.6%) developed typical autistic disorder. Case 1: A boy born at 38 weeks' gestation with a birth weight of 3164 g showed generalized petechiae, hepatosplenomegaly, and positive serum CMV-specific IgM antibodies. He was profoundly deaf, mentally retarded, and exhibited a lack of eye contact, stereotyped repetitive play, and hyperactivity. Case 2: A boy delivered at 39 weeks gestation with a birthweight of 2912 g showed non-progressive dilatation of the lateral ventricles observed postnatally. CMV-specific IgM antibodies were positive and CMV-DNA in the urine was confirmed by PCR. The boy was mentally retarded but not deaf. He showed no interest in people and delayed speech development. Subependymal cysts were detected by cranial ultrasound after birth in both patients. This is the first report describing subependymal cysts and the later development of AD. Cranial magnetic resonance imaging revealed an abnormal intensity area in the periventricular white matter suggestive of disturbed myelination; however, no migration disorders were found in our patients. These findings suggest that the timing of injury to the developing brain by CMV may be in the third trimester in some patients with autistic disorder.

  3. Cytomegalovirus Antivirals and Development of Improved Animal Models

    Science.gov (United States)

    McGregor, Alistair; Choi, K. Yeon

    2015-01-01

    Introduction Cytomegalovirus (CMV) is a ubiquitous pathogen that establishes a life long asymptomatic infection in healthy individuals. Infection of immunesuppressed individuals causes serious illness. Transplant and AIDS patients are highly susceptible to CMV leading to life threatening end organ disease. Another vulnerable population is the developing fetus in utero, where congenital infection can result in surviving newborns with long term developmental problems. There is no vaccine licensed for CMV and current antivirals suffer from complications associated with prolonged treatment. These include drug toxicity and emergence of resistant strains. There is an obvious need for new antivirals. Candidate intervention strategies are tested in controlled pre-clinical animal models but species specificity of HCMV precludes the direct study of the virus in an animal model. Areas covered This review explores the current status of CMV antivirals and development of new drugs. This includes the use of animal models and the development of new improved models such as humanized animal CMV and bioluminescent imaging of virus in animals in real time. Expert Opinion Various new CMV antivirals are in development, some with greater spectrum of activity against other viruses. Although the greatest need is in the setting of transplant patients there remains an unmet need for a safe antiviral strategy against congenital CMV. This is especially important since an effective CMV vaccine remains an elusive goal. In this capacity greater emphasis should be placed on suitable pre-clinical animal models and greater collaboration between industry and academia. PMID:21883024

  4. Cytomegalovirus in inflammatory bowel disease: A systematic review

    Science.gov (United States)

    Römkens, Tessa EH; Bulte, Geert J; Nissen, Loes HC; Drenth, Joost PH

    2016-01-01

    AIM: To identify definitions of cytomegalovirus (CMV) infection and intestinal disease, in inflammatory bowel disease (IBD), to determine the prevalence associated with these definitions. METHODS: We conducted a systematic review and interrogated PubMed, EMBASE and Cochrane for literature on prevalence and diagnostics of CMV infection and intestinal disease in IBD patients. As medical headings we used “cytomegalovirus” OR “CMV” OR “cytomegalo virus” AND “inflammatory bowel disease” OR “IBD” OR “ulcerative colitis” OR “colitis ulcerosa” OR “Crohn’s disease”. Both MeSH-terms and free searches were performed. We included all types of English-language (clinical) trials concerning diagnostics and prevalence of CMV in IBD. RESULTS: The search strategy identified 924 citations, and 52 articles were eligible for inclusion. We identified 21 different definitions for CMV infection, 8 definitions for CMV intestinal disease and 3 definitions for CMV reactivation. Prevalence numbers depend on used definition, studied population and region. The highest prevalence for CMV infection was found when using positive serum PCR as a definition, whereas for CMV intestinal disease this applies to the use of tissue PCR > 10 copies/mg tissue. Most patients with CMV infection and intestinal disease had steroid refractory disease and came from East Asia. CONCLUSION: We detected multiple different definitions used for CMV infection and intestinal disease in IBD patients, which has an effect on prevalence numbers and eventually on outcome in different trials. PMID:26811669

  5. Human cytomegalovirus replicates in gamma-irradiated fibroblasts

    International Nuclear Information System (INIS)

    Shanley, J.D.

    1986-01-01

    Because of the unique interdependence of human cytomegalovirus (HCMV) and the physiological state of the host cell, we evaluated the ability of human foreskin fibroblasts (HFF), exposed to gamma radiation, to support HCMV growth. Irradiation of HFF with 2,500 rADS prevented cellular proliferation and suppressed cellular DNA, but not RNA or protein synthesis. Treatment of HFF cells with 2,500 rADS 6 or 48 hours prior to infection did not alter the time course or virus yield during HCMV replication. Virus plaquing efficiency in irradiated cells was comparable to that of nonirradiated cells. As judged by thymidine incorporation and BUdR inhibition of virus replication, HCMV infection induced both thymidine kinase activity and host cell DNA synthesis in irradiated cells. In addition, virus could be recovered from HFF exposed to radiation 0-2 days after infection with HCMV. These studies indicate that the damage to cells by gamma irradiation does not alter the capacity of host cells to support HCMV replication

  6. Cytomegalovirus and ulcerative colitis: Place of antiviral therapy

    Science.gov (United States)

    Pillet, Sylvie; Pozzetto, Bruno; Roblin, Xavier

    2016-01-01

    The link between cytomegalovirus (CMV) infection and inflammatory bowel diseases remains an important subject of debate. CMV infection is frequent in ulcerative colitis (UC) and has been shown to be potentially harmful. CMV reactivation needs to be diagnosed using methods that include in situ detection of viral markers by immunohistochemistry or by nucleic acid amplification techniques. Determination of the density of infection using quantitative tools (numbers of infected cells or copies of the genome) is particularly important. Although CMV reactivation can be considered as an innocent bystander in active flare-ups of refractory UC, an increasing number of studies suggest a deleterious role of CMV in this situation. The presence of colonic CMV infection is possibly linked to a decreased response to steroids and other immunosuppressive agents. Some treatments, notably steroids and cyclosporine A, have been shown to favor CMV reactivation, which seems not to be the case for therapies using anti-tumor necrosis factor drugs. According to these findings, in flare-ups of refractory UC, it is now recommended to look for the presence of CMV reactivation by using quantitative tools in colonic biopsies and to treat them with ganciclovir in cases of high viral load or severe disease. PMID:26877608

  7. Prophylaxis of cytomegalovirus infection with ganciclovir in allogeneic marrow transplantation

    International Nuclear Information System (INIS)

    Yau, J.C.; Dimopoulos, M.A.; Huan, S.D.; Tarrand, J.J.; Spencer, V.; Spitzer, G.; Meneghetti, C.M.; Wallerstein, R.O.; Andersson, B.S.; LeMaistre, C.F.

    1991-01-01

    Cytomegalovirus (CMV) infection is one of the most common causes of morbidity and mortality after allogeneic marrow transplantation. We studied 14 consecutive CMV-seropositive patients adding ganciclovir (2.5 mg/kg i.v. every 8 hours for 7 days prior to transplant and 6 mg/kg three times a week after neutrophils became >0.5x10 9 /l and the patients were platelet transfusion-independent until d 70) to our previous prophylaxis regimen which consisted of intravenous immunoglobulin and acyclovir. The result was compared with 30 consecutive patients whom we studied with our previous regimen. The addition of ganciclovir did not cause any extra toxicities. The incidence of interstitial pneumonitis and cumulative probability of CMV excretion in the first 100 d post-transplantation was significantly reduced (p = 0.038 and p = 0.035 respectively). The result shows that addition of ganciclovir significantly decreased the incidence of CMV infection in the early post-transplantation period. (au)

  8. Rhabdomyolysis associated with cytomegalovirus infection in kidney transplant recipients.

    Science.gov (United States)

    Jung, H-Y; Kim, K-H; Park, S-C; Lee, J-H; Choi, J-Y; Cho, J-H; Park, S-H; Kim, Y-L; Kim, H-K; Huh, S; Kim, C-D

    2014-12-01

    Rhabdomyolysis is a pathological syndrome caused by skeletal muscle cell damage that affects the integrity of the cellular membrane and leads to the release of toxic intracellular constituents into the bloodstream. Although cytomegalovirus (CMV) has rarely been reported as a cause of rhabdomyolysis, CMV infection could be considered as a possible cause because of its clinical significance in kidney transplant recipients (KTRs). We report 2 cases of rhabdomyolysis associated with CMV infection in KTRs. A 64-year-old woman (Case 1) and a 65-year-old man (Case 2), who had each received a kidney from a living unrelated donor, were admitted with complaints of weakness in both legs and myalgia. Laboratory findings revealed highly increased creatine phosphokinase and myoglobinuria. In both cases, no recent alterations of medications had occurred, and other causes of rhabdomyolysis--such as trauma, alcohol, drugs, and electrolyte abnormalities - were excluded. CMV pp65 antigen was positive, and patients were diagnosed with rhabdomyolysis associated with CMV infection. Both patients recovered without complications after ganciclovir treatment. In conclusion, CMV infection should be considered as a possible cause of rhabdomyolysis in KTRs. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. Resistance to antivirals in human cytomegalovirus: mechanisms and clinical significance.

    Science.gov (United States)

    Pérez, J L

    1997-09-01

    Long term therapies needed for managing human cytomegalovirus (HCMV) infections in immunosupressed patients provided the background for the emergence of the resistance to antivirals active against HCMV. In addition, laboratory selected mutants have also been readily achieved. Both clinical and laboratory resistant strains share the same determinants of resistance. Ganciclovir resistance may be due to a few mutations in the HCMV UL97 gene and/or viral DNA pol gene, the former being responsible for about 70% of clinical resistant isolates. Among them, V464, V594, S595 and F595 are the most frequent mutations. Because of their less extensive clinical use, much less is known about resistance to foscarnet and cidofovir (formerly, HPMPC) but in both cases, it has been associated to mutations in the DNA pol. Ganciclovir resistant strains showing DNA pol mutations are cross-resistant to cidofovir and their corresponding IC50 are normally higher than those from strains harboring only mutations at the UL97 gene. To date, foscarnet resistance seems to be independent of both ganciclovir and cidofovir resistance.

  10. Neutralization of Human Cytomegalovirus Entry into Fibroblasts and Epithelial Cells.

    Science.gov (United States)

    Wussow, Felix; Chiuppesi, Flavia; Contreras, Heidi; Diamond, Don J

    2017-10-31

    Human cytomegalovirus (HCMV) is a leading cause of permanent birth defects, highlighting the need to develop an HCMV vaccine candidate. However, HCMV vaccine development is complicated by the varying capacity of neutralizing antibodies (NAb) to interfere in vitro with the HCMV entry routes mediating infection of fibroblast (FB) and epithelial cells (EC). While HCMV infection of FB and EC requires glycoprotein complexes composed of gB and gH/gL/gO, EC infection depends additionally on the envelope pentamer complex (PC) composed of gH, gL, UL128, UL130 and UL131A. Unlike NAb to gB or gH epitopes that can interfere with both FB and EC infection, NAb targeting predominantly conformational epitopes of the UL128/130/131A subunits are unable to prevent FB entry, though they are highly potent in blocking EC infection. Despite the selective requirement of the PC for EC entry, the PC is exceptionally immunogenic as vaccine antigen to stimulate both EC- and FB-specific NAb responses due to its capacity to elicit NAb that target epitopes of the UL128/130/131A subunits and gH. These findings suggest that the PC could be sufficient in a subunit vaccine formulation to induce robust FB- and EC-specific NAb responses. In this short review, we discuss NAb responses induced through natural infection and vaccination that interfere in vitro with HCMV infection of FB and EC.

  11. Congenital Cytomegalovirus Infection: Molecular Mechanisms Mediating Viral Pathogenesis

    Science.gov (United States)

    Schleiss, Mark R.

    2013-01-01

    Human cytomegalovirus (CMV) is responsible for approximately 40,000 congenital infections in the United States each year. Congenital CMV disease frequently produces serious neurodevelopmental disability, as well as vision impairment and sensorineural hearing loss. Development of a CMV vaccine is therefore considered to be a major public health priority. The mechanisms by which CMV injures the fetus are complex and likely include a combination of direct fetal injury induced by pathologic virally-encoded gene products, an inability of the maternal immune response to control infection, and the direct impact of infection on placental function. CMV encodes gene products that function, both at the RNA and the protein level, to interfere with many cellular processes. These include gene products that modify the cell cycle; interfere with apoptosis; induce an inflammatory response; mediate vascular injury; induce site-specific breakage of chromosomes; promote oncogenesis; dysregulate cellular proliferation; and facilitate evasion of host immune responses. This minireview summarizes current concepts regarding these aspects of the molecular virology of CMV and the potential pathogenic impact of viral gene expression on the developing fetus. Areas for potential development of novel therapeutic intervention are suggested for improving the outcome of this disabling congenital infection. PMID:21827434

  12. PP65 antigenemia in the diagnosis of cytomegalovirus infection in AIDS patients

    Directory of Open Access Journals (Sweden)

    RC Capela

    2012-01-01

    Full Text Available Cytomegalovirus causes significant morbidity and mortality in AIDS patients and those having undergone bone marrow or another transplant. PP65 antigenemia is based on detecting viral antigen in peripheral blood leukocytes through immunochemistry and by monitoring the infection in immunocompromised individuals. The present study aimed to set up this diagnostic technique in AIDS patients with active cytomegalovirus infection and verify its occurrence in the Botucatu region of São Paulo state, Brazil. Fifty patients, 35 men and 15 women aged from 24 to 69 years, were recruited from those attended at the Department of Tropical Diseases of Botucatu Medical School, UNESP, and divided into three groups according to CD4+ T lymphocyte counts and antiretroviral treatment. The control group comprised bone marrow transplant patients. Fourteen AIDS patients with low CD4+ cell counts tested positive for PP65 antigenemia, which could predict cytomegalovirus infection and indicate prophylactic treatment.

  13. [Wernicke-Korsakoff syndrome secondary to cytomegalovirus encephalitis: A case report].

    Science.gov (United States)

    Uribe, Luis Guillermo; Pérez, María Alejandra; Lara, Camilo Andrés; Rueda, Natalia; Hernández, Javier Augusto

    2017-12-01

    Cytomegalovirus (CMV) is one of the opportunistic microorganisms with the highest prevalence in immunocompromised patients. Reactivation has decreased after the introduction of highly active antiretroviral therapy (HAART). Encephalitis has been reported in the coinfection as one of the most frequent presentations.We present the case of a young adult patient with HIV infection and rapid neurological deterioration due to classic clinical symptoms and signs of the Wernicke-Korsakoff syndrome, with no risk factors for thiamine deficiency, with images by nuclear magnetic resonance typical of the syndrome, and identification of cytomegalovirus in cerebrospinal fluid. The specific treatment for CMV managed to control the symptoms with neurological sequelae in progression towards improvement.This is one of the few cases reported in the literature of Wernicke syndrome secondary to cytomegalovirus encephalitis.

  14. Apoptosis modulation in the immune system reveals a role of neutrophils in tissue damage in a murine model of chlamydial genital infection.

    Science.gov (United States)

    Zortel, Tom; Schmitt-Graeff, Annette; Kirschnek, Susanne; Häcker, Georg

    2018-03-07

    Chlamydial infection frequently causes damage to the female genital tract. The precise mechanisms of chlamydial clearance and tissue damage are unknown but studies suggest immunopathology with a particular role of neutrophils. The goal of this study was to understand the contribution of the immune system, in particular neutrophils. Using Chlamydia muridarum, we infected mice with a prolonged immune response due to expression of Bcl-2 in haematopoietic cells (Bcl-2-mice), and mice where mature neutrophils are lacking due to the deletion of Mcl-1 in myeloid cells (LysM-cre-mcl-1-flox-mice; Mcl-1-mice). We monitored bacterial clearance, cellular infiltrate and long-term tissue damage. Both mutant strains showed slightly delayed clearance of the acute infection. Bcl-2-mice had a strongly increased inflammatory infiltrate concerning almost all cell lineages. The infection of Bcl-2-mice caused increased tissue damage. The loss of neutrophils in Mcl-1-mice was associated with substantial quantitative and qualitative alterations of the inflammatory infiltrate. Mcl-1-mice had higher chlamydial burden and reduced tissue damage, including lower incidence of hydrosalpinx and less uterine dilation. Inhibition of apoptosis in the haematopoietic system increases inflammation and tissue damage. Neutrophils have broad functions, including a role in chlamydial clearance and in tissue destruction.

  15. Cytomegalovirus infection in inflammatory bowel disease is not associated with worsening of intestinal inflammatory activity.

    Directory of Open Access Journals (Sweden)

    Alexandre Medeiros do Carmo

    Full Text Available Cytomegalovirus is highly prevalent virus and usually occurs in immunocompromised patients. The pathophysiology and treatment of inflammatory bowel disease often induce a state of immunosuppression. Because this, there are still doubts and controversies about the relationship between inflammatory bowel disease and cytomegalovirus.Evaluate the frequency of cytomegalovirus in patients with inflammatory bowel disease and identify correlations.Patients with inflammatory bowel disease underwent an interview, review of records and collection of blood and fecal samples. The search for cytomegalovirus was performed by IgG and IgM blood serology, by real-time PCR in the blood and by qualitative PCR in feces. Results were correlated with red blood cell levels, C-reactive protein levels, erythrocyte sedimentation rates and fecal calprotectin levels for each patient.Among the 400 eligible patients, 249 had Crohn's disease, and 151 had ulcerative colitis. In the group of Crohn's disease, 67 of the patients had moderate or severe disease, but 126 patients presented with active disease, based on the evaluation of the fecal calprotectin. In patients with ulcerative colitis, only 21 patients had moderate disease, but 76 patients presented with active disease, based on the evaluation of the fecal calprotectin. A large majority of patients had positive CMV IgG. Overall, 10 patients had positive CMV IgM, and 9 patients had a positive qualitative detection of CMV DNA by PCR in the feces. All 400 patients returned negative results after the quantitative detection of CMV DNA in blood by real-time PCR. Analyzing the 19 patients with active infections, we only found that such an association occurred with the use of combined therapy (anti-TNF-alpha + azathioprine.The findings show that latent cytomegalovirus infections are frequent and active cytomegalovirus infection is rare. We did not find any association between an active infection of CMV and inflammatory bowel

  16. A Point Mutation in the Rhesus Rotavirus VP4 Protein Generated through a Rotavirus Reverse Genetics System Attenuates Biliary Atresia in the Murine Model.

    Science.gov (United States)

    Mohanty, Sujit K; Donnelly, Bryan; Dupree, Phylicia; Lobeck, Inna; Mowery, Sarah; Meller, Jaroslaw; McNeal, Monica; Tiao, Greg

    2017-08-01

    Rotavirus infection is one of the most common causes of diarrheal illness in humans. In neonatal mice, rhesus rotavirus (RRV) can induce biliary atresia (BA), a disease resulting in inflammatory obstruction of the extrahepatic biliary tract and intrahepatic bile ducts. We previously showed that the amino acid arginine (R) within the sequence SRL (amino acids 445 to 447) in the RRV VP4 protein is required for viral binding and entry into biliary epithelial cells. To determine if this single amino acid (R) influences the pathogenicity of the virus, we generated a recombinant virus with a single amino acid mutation at this site through a reverse genetics system. We demonstrated that the RRV mutant (RRV VP4-R446G ) produced less symptomatology and replicated to lower titers both in vivo and in vitro than those seen with wild-type RRV, with reduced binding in cholangiocytes. Our results demonstrate that a single amino acid change in the RRV VP4 gene influences cholangiocyte tropism and reduces pathogenicity in mice. IMPORTANCE Rotavirus is the leading cause of diarrhea in humans. Rhesus rotavirus (RRV) can also lead to biliary atresia (a neonatal human disease) in mice. We developed a reverse genetics system to create a mutant of RRV (RRV VP4-R446G ) with a single amino acid change in the VP4 protein compared to that of wild-type RRV. In vitro , the mutant virus had reduced binding and infectivity in cholangiocytes. In vivo , it produced fewer symptoms and lower mortality in neonatal mice, resulting in an attenuated form of biliary atresia. Copyright © 2017 American Society for Microbiology.

  17. Absence of cross-presenting cells in the salivary gland and viral immune evasion confine cytomegalovirus immune control to effector CD4 T cells.

    Directory of Open Access Journals (Sweden)

    Senta M Walton

    2011-08-01

    Full Text Available Horizontal transmission of cytomegaloviruses (CMV occurs via prolonged excretion from mucosal surfaces. We used murine CMV (MCMV infection to investigate the mechanisms of immune control in secretory organs. CD4 T cells were crucial to cease MCMV replication in the salivary gland (SG via direct secretion of IFNγ that initiated antiviral signaling on non-hematopoietic cells. In contrast, CD4 T cell helper functions for CD8 T cells or B cells were dispensable. Despite SG-resident MCMV-specific CD8 T cells being able to produce IFNγ, the absence of MHC class I molecules on infected acinar glandular epithelial cells due to viral immune evasion, and the paucity of cross-presenting antigen presenting cells (APCs prevented their local activation. Thus, local activation of MCMV-specific T cells is confined to the CD4 subset due to exclusive presentation of MCMV-derived antigens by MHC class II molecules on bystander APCs, resulting in IFNγ secretion interfering with viral replication in cells of non-hematopoietic origin.

  18. Absence of cross-presenting cells in the salivary gland and viral immune evasion confine cytomegalovirus immune control to effector CD4 T cells.

    Science.gov (United States)

    Walton, Senta M; Mandaric, Sanja; Torti, Nicole; Zimmermann, Albert; Hengel, Hartmut; Oxenius, Annette

    2011-08-01

    Horizontal transmission of cytomegaloviruses (CMV) occurs via prolonged excretion from mucosal surfaces. We used murine CMV (MCMV) infection to investigate the mechanisms of immune control in secretory organs. CD4 T cells were crucial to cease MCMV replication in the salivary gland (SG) via direct secretion of IFNγ that initiated antiviral signaling on non-hematopoietic cells. In contrast, CD4 T cell helper functions for CD8 T cells or B cells were dispensable. Despite SG-resident MCMV-specific CD8 T cells being able to produce IFNγ, the absence of MHC class I molecules on infected acinar glandular epithelial cells due to viral immune evasion, and the paucity of cross-presenting antigen presenting cells (APCs) prevented their local activation. Thus, local activation of MCMV-specific T cells is confined to the CD4 subset due to exclusive presentation of MCMV-derived antigens by MHC class II molecules on bystander APCs, resulting in IFNγ secretion interfering with viral replication in cells of non-hematopoietic origin.

  19. Herpes simplex and cytomegalovirus coinfected oral ulcers in HIV-positive patients.

    Science.gov (United States)

    Regezi, J A; Eversole, L R; Barker, B F; Rick, G M; Silverman, S

    1996-01-01

    Four HIV-positive patients with herpes simplex virus and cytomegalovirus coinfected oral ulcers are presented. All patients had persistent oral pain associated with nonhealing mucosal ulcers. Lesions occurred on the palate, retromolar pad, tongue, and lip, and the clinical appearance of the ulcers was nonspecific. Histologic and immunohistochemical stains showed herpes simples virus alterations in keratinocyte nuclei and cytomegalovirus alterations in mesenchymal/endothelial cell nuclei and cytoplasm. Lesions in one patient responded to ganciclovir therapy. One patient improved with acyclovir, and another healed normally after excisional biopsy. Each virus alone has been described as causing oral ulcerations; their appearance together in the same lesion would suggest a synergistic relationship.

  20. Tuberculoid leprosy and cytomegalovirus retinitis as immune restoration disease in a patient with AIDS.

    Science.gov (United States)

    Kumar, Shishir; Ghosh, Manab Kumar; Sarkar, Somenath; Mallik, Sudeshna; Biswas, Pradyot Narayan; Saha, Bibhuti

    2012-02-01

    Here we report a unique case of tuberculoid leprosy and cytomegalovirus retinitis in a 27-year-old female patient with AIDS, suggestive of highly active antiretroviral therapy (HAART)-induced immune restoration disease. After initiation of HAART, the patient presented with decreased visual acuity, hypoesthetic patch with local nerve thickening, and an increase in her CD4+ T cell count. On further investigations cytomegalovirus retinitis and tuberculoid leprosy were confirmed. To our knowledge no case with such a co-existence has previously been reported. Copyright © 2011 International Society for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  1. Cytomegalovirus Replicates in Differentiated but not in Undifferentiated Human Embryonal Carcinoma Cells

    Science.gov (United States)

    Gonczol, Eva; Andrews, Peter W.; Plotkin, Stanley A.

    1984-04-01

    To study the mode of action of human cytomegalovirus, an important teratogenic agent in human populations, the susceptibility of a pluripotent human embryonal carcinoma cell line to the virus was investigated. Viral antigens were not expressed nor was infectious virus produced by human embryonal carcinoma cells after infection, although the virus was able to penetrate these cells. In contrast, retinoic acid-induced differentiated derivatives of embryonal carcinoma cells were permissive for antigen expression and infectious virus production. Replication of human cytomegalovirus in human teratocarcinoma cells may therefore depend on cellular functions associated with differentiation.

  2. Presence of cytomegalovirus in the perilymphatic fluid of patients with profound sensorineural hearing loss caused by congenital cytomegalovirus infection.

    Science.gov (United States)

    Ogawa, Hiroshi; Matsui, Takamichi; Baba, Yoko; Yamada, Naoko; Suzuki, Yukie; Suzutani, Tatsuo

    2016-01-01

    Not all patients diagnosed with congenital infection using umbilical cord assay were found to be positive for CMV-DNA by perilymphatic fluid assay. In addition, a CMV-DNA-positive result was observed in one patient who had not been diagnosed with congenital infection. Sampling of perilymphatic fluid from a large population of patients with congenital SNHL caused by congenital CMV infection or of unknown etiology is required to determine the prevalence of CMV-related profound HL. Sensorineural hearing loss (SNHL) is one of the most frequent manifestations in patients with congenital cytomegalovirus (CMV) infection. Using dried umbilical cord, a PCR-based assay was recently developed for the retrospective detection of congenital CMV infection. This study analyzed the presence of CMV in the perilymphatic fluid and evaluated differences in the effect of cochlear implantation between CMV-positive and -negative groups. Perilymphatic fluid was collected from each patient at the time of cochlear implantation and analyzed for the presence of CMV using a PCR method. The perilymphatic fluid in two of the five patients suffering from congenital CMV infection and in one of the 17 patients without congenital CMV infection was found to be positive for CMV.

  3. Maternal Cytomegalovirus-Specific Immune Responses and Symptomatic Postnatal Cytomegalovirus Transmission in Very Low-Birth-Weight Preterm Infants

    Science.gov (United States)

    Ehlinger, Elizabeth P.; Webster, Emily M.; Kang, Helen H.; Cangialose, Aislyn; Simmons, Adam C.; Barbas, Kimberly H.; Burchett, Sandra K.; Gregory, Mary L.; Puopolo, Karen P.

    2011-01-01

    Introduction. Transmission of cytomegalovirus (CMV) via breast milk can lead to severe acute illness in very low-birth-weight (VLBW) preterm infants. Although the majority of CMV-seropositive women shed CMV in milk, symptomatic postnatal infection of VLBW infants occurs infrequently, suggesting that virologic or immunologic factors in milk may be associated with the risk and severity of postnatal CMV infection. Methods. We investigated the magnitude of CMV-specific cellular and humoral immune responses in milk of 30 seropositive mothers of VLWB preterm infants and assessed their relationship to milk CMV load and symptomatic CMV transmission. Results. Milk immunoglobulin G (IgG) avidity was inversely correlated to milk CMV load (r = −0.47; P = .009). However, milk CMV load and CMV-specific cellular and humoral immune responses were similar in mothers of VLBW infants with and those without symptomatic postnatal CMV infection. Conclusions. Similar immunologic parameters in milk of CMV-seropositive mothers of VLBW infants with and without symptomatic postnatal CMV infection indicate that screening milk by these parameters may not predict disease risk. However, the inverse correlation between milk CMV IgG avidity and CMV load may suggest that enhancement of maternal CMV-specific IgG responses could aid in reduction of CMV shedding into breast milk. PMID:21984738

  4. ­Glial and stem cell expression of murine Fibroblast Growth Factor Receptor 1 in the embryonic and perinatal nervous system

    Directory of Open Access Journals (Sweden)

    Jantzen C. Collette

    2017-06-01

    Full Text Available Background Fibroblast growth factors (FGFs and their receptors (FGFRs are involved in the development and function of multiple organs and organ systems, including the central nervous system (CNS. FGF signaling via FGFR1, one of the three FGFRs expressed in the CNS, stimulates proliferation of stem cells during prenatal and postnatal neurogenesis and participates in regulating cell-type ratios in many developing regions of the brain. Anomalies in FGFR1 signaling have been implicated in certain neuropsychiatric disorders. Fgfr1 expression has been shown, via in situ hybridization, to vary spatially and temporally throughout embryonic and postnatal development of the brain. However, in situ hybridization lacks sufficient resolution to identify which cell-types directly participate in FGF signaling. Furthermore, because antibodies raised against FGFR1 commonly cross-react with other members of the FGFR family, immunocytochemistry is not alone sufficient to accurately document Fgfr1 expression. Here, we elucidate the identity of Fgfr1 expressing cells in both the embryonic and perinatal mouse brain. Methods To do this, we utilized a tgFGFR1-EGFPGP338Gsat BAC line (tgFgfr1-EGFP+ obtained from the GENSAT project. The tgFgfr1-EGFP+ line expresses EGFP under the control of a Fgfr1 promoter, thereby causing cells endogenously expressing Fgfr1 to also present a positive GFP signal. Through simple immunostaining using GFP antibodies and cell-type specific antibodies, we were able to accurately determine the cell-type of Fgfr1 expressing cells. Results This technique revealed Fgfr1 expression in proliferative zones containing BLBP+ radial glial stem cells, such as the cortical and hippocampal ventricular zones, and cerebellar anlage of E14.5 mice, in addition to DCX+ neuroblasts. Furthermore, our data reveal Fgfr1 expression in proliferative zones containing BLBP+ cells of the anterior midline, hippocampus, cortex, hypothalamus, and cerebellum of P0.5 mice

  5. Diet-induced obesity has neuroprotective effects in murine gastric enteric nervous system: involvement of leptin and glial cell line-derived neurotrophic factor.

    Science.gov (United States)

    Baudry, Charlotte; Reichardt, François; Marchix, Justine; Bado, André; Schemann, Michael; des Varannes, Stanislas Bruley; Neunlist, Michel; Moriez, Raphaël

    2012-02-01

    Nutritional factors can induce profound neuroplastic changes in the enteric nervous system (ENS), responsible for changes in gastrointestinal (GI) motility. However, long-term effects of a nutritional imbalance leading to obesity, such as Western diet (WD), upon ENS phenotype and control of GI motility remain unknown. Therefore, we investigated the effects of WD-induced obesity (DIO) on ENS phenotype and function as well as factors involved in functional plasticity. Mice were fed with normal diet (ND) or WD for 12 weeks. GI motility was assessed in vivo and ex vivo. Myenteric neurons and glia were analysed with immunohistochemical methods using antibodies against Hu, neuronal nitric oxide synthase (nNOS), Sox-10 and with calcium imaging techniques. Leptin and glial cell line-derived neurotrophic factor (GDNF) were studied using immunohistochemical, biochemical or PCR methods in mice and primary culture of ENS. DIO prevented the age-associated decrease in antral nitrergic neurons observed in ND mice. Nerve stimulation evoked a stronger neuronal Ca(2+) response in WD compared to ND mice. DIO induced an NO-dependent increase in gastric emptying and neuromuscular transmission in the antrum without any change in small intestinal transit. During WD but not ND, a time-dependent increase in leptin and GDNF occurred in the antrum. Finally, we showed that leptin increased GDNF production in the ENS and induced neuroprotective effects mediated in part by GDNF. These results demonstrate that DIO induces neuroplastic changes in the antrum leading to an NO-dependent acceleration of gastric emptying. In addition, DIO induced neuroplasticity in the ENS is likely to involve leptin and GDNF.

  6. Sustained secretion of human alpha-1-antitrypsin from murine muscle transduced with adeno-associated virus vectors

    Science.gov (United States)

    Song, Sihong; Morgan, Michael; Ellis, Tamir; Poirier, Amy; Chesnut, Kye; Wang, Jianming; Brantly, Mark; Muzyczka, Nicholas; Byrne, Barry J.; Atkinson, Mark; Flotte, Terence R.

    1998-01-01

    Recombinant adeno-associated virus (AAV) vectors have been used to transduce murine skeletal muscle as a platform for secretion of therapeutic proteins. The utility of this approach for treating alpha-1-antitrypsin (AAT) deficiency was tested in murine myocytes in vitro and in vivo. AAV vectors expressing the human AAT gene from either the cytomegalovirus (CMV) promoter (AAV-C-AT) or the human elongation factor 1-α promoter (AAV-E-AT) were examined. In vitro in C2C12 murine myoblasts, the expression levels in transient transfections were similar between the two vectors. One month after transduction, however, the human elongation factor 1 promoter mediated 10-fold higher stable human AAT expression than the CMV promoter. In vivo transduction was performed by injecting doses of up to 1.4 × 1013 particles into skeletal muscles of several mouse strains (C57BL/6, BALB/c, and SCID). In vivo, the CMV vector mediated higher levels of expression, with sustained serum levels over 800 μg/ml in SCID and over 400 μg/ml in C57BL/6 mice. These serum concentrations are 100,000-fold higher than those previously observed with AAV vectors in muscle and are at levels which would be therapeutic if achieved in humans. High level expression was delayed for several weeks but was sustained for over 15 wk. Immune responses were dependent upon the mouse strain and the vector dosage. These data suggest that recombinant AAV vector transduction of skeletal muscle could provide a means for replacing AAT or other essential serum proteins but that immune responses may be elicited under certain conditions. PMID:9826709

  7. Th17 cells and IL-17 promote the skin and lung inflammation and fibrosis process in a bleomycin-induced murine model of systemic sclerosis.

    Science.gov (United States)

    Lei, Ling; Zhao, Cheng; Qin, Fang; He, Zhi-Yi; Wang, Xu; Zhong, Xiao-Ning

    2016-01-01

    Systemic sclerosis (SSc) is characterised by fibrosis of the skin and internal organs, such as the lungs. Enhanced Th17 responses are associated with skin fibrosis in patients with SSc, however, whether they are associated with lung fibrosis has not been clarified. This study aimed to investigate the potential association of Th17 responses with the skin and pulmonary fibrosis as well as the potential mechanisms in a mouse bleomycin (BLM) model of SSc. BALB/c mice were injected subcutaneously with phosphate buffered saline (PBS) (control) or BLM for 28 days and the skin and pulmonary inflammation and fibrosis were characterized by histology. The percentages of circulating, skin and pulmonary infiltrating Th17 cells and the contents of collagen in mice were analysed. The levels of RORγt, IL-17A, IL-6 and TGF-β1 mRNA transcripts in the skin and lungs were determined by quantitative RTPCR and the levels of serum IL-17A, IL-6 and TGF-β1 were determined by ELISA. Furthermore, the effect of rIL-17A on the proliferation of pulmonary fibroblasts and their cytokine expression was analysed. The potential association of Th17 responses with the severity of skin and lung fibrosis was analysed. In comparison with the control mice, significantly increased skin and pulmonary inflammation and fibrosis and higher levels of hydroxyproline were detected in the BLM mice. Significantly higher frequency of circulating, skin and lung infiltrating Th17 cells and higher levels of serum, skin and lung IL-17A, TGF-β1, IL-6 and RORγt were detected in the BLM mice. The concentrations of serum IL-17A were correlated positively with the percentages of Th17 cells and the contents of skin hydroxyproline in the BLM mice. The levels of IL-17A expression were positively correlated with the skin and lung inflammatory scores as well as the skin fibrosis in the BLM mice. In addition, IL-17A significantly enhanced pulmonary fibroblast proliferation and their type I collagen, TGF-β and IL-6 expression

  8. Production of antibodies which recognize opiate receptors on murine leukocytes

    Energy Technology Data Exchange (ETDEWEB)

    Carr, D.J.J.; Bost, K.L.; Blalock, J.E.

    1988-01-01

    An antibody has been developed which recognizes opiate receptors on cells of the immune system. This antibody blocks specific binding of the radiolabeled opiate receptor ligand, /sup 3/H-dihydromorphine, to receptors on murine splenocytes. Additionally, the anti-receptor antibody competes with ..beta..-endorphin, meta-enkephalin, and naloxone for the same binding site on the leukocytes. Moreover, the anti-receptor antibody possesses agonist activity similar to ..beta..-endorphin in suppressing cAMP production by lymphocytes. These results suggest the development of an antibody which recognizes classical opiate receptors on cells of the immune system.

  9. Growth and development of infants with asymptomatic congenital cytomegalovirus infection.

    Science.gov (United States)

    Shan, Ruobing; Wang, Xiaoliang; Fu, Ping

    2009-10-31

    To observe changes in audiology, intellectual development, behavior development, and physical growth during systematic follow-up of infants with asymptomatic congenital human cytomegalovirus (HCMV) infection. Fifty-two infants diagnosed with asymptomatic congenital HCMV infection from July 2003 to July 2007 served as the infection group, and 21 healthy infants served as the control group. All infants were confirmed to have HCMV infection by Fluorescent Quantative polymerase chain reaction (FQ-PCR). In both the infection and control groups, the neonates and infants at 3 months, 6 months, and 1 year of age underwent examinations. 1) 20 items of National Black Nurses Association (NBNA) scores of neonates 12-14 days after birth in 2 groups were 38.3 +/- 1.95 and 38.5 +/- 2.29, without significant differences. 2) Auditory test: 50 ears of 25 cases in the infection group showed abnormal auditory thresholds in V waves with an abnormal rate of 14%, while no abnormalities were found in 21 cases in the control group. 3) Mental and psychomotor development index scores in the control group (107.49 +/- 11.31 and 107.19 +/- 10.98) were compared with those in 41 asymptomatically infected infants at 1 year of age (107.21 +/- 9.96 and 108.31 +/- 11.25), and no statistically significant difference was noted. 1) An elevated threshold in the V wave was present in asymptomatically infected infants, but could not be detected through otoacoustic emission (OAE) screening. 2) Either in the neonatal or infant periods, asymptomatic congenital HCMV infection did not have a significant influence on nervous behavior or on physical and intellectual development.

  10. Seropositivity of cytomegalovirus in patients with recurrent pregnancy loss

    Directory of Open Access Journals (Sweden)

    Roya Sherkat

    2014-01-01

    Full Text Available Background: Some evidence has shown a relationship between human cytomegalovirus (CMV infection and pregnancy loss. However, whether recurrent or latent CMV infection or altered immune response to CMV is related to recurrent pregnancy loss (RPL is unclear. We evaluated CMV infection and avidity of antibodies to CMV in women with RPL. Materials and Methods: This case-control study was conducted on 43 women with RPL referred to a clinical immunology out-patient clinic in Isfahan (Iran, and 43 age-matched multiparous women without history of abortion as control subjects. Patients and controls were evaluated for anti-CMV IgG and IgM antibodies and IgG avidity index (AI using the enzyme linked immunosorbent assay method. Student′s t-test and Chi-square test were used to analyze the data. Results: One case (2.3% of positive anti-CMV IgM was detected in each group. Anti-CMV IgG positivity was more frequent in patients than in controls (90.6% vs. 69.8%, P = 0.014, but there was no difference between the two groups in anti-CMV IgG AI (79.4 ± 11.4 vs. 80.1 ± 10.2, P = 0.781. IgG titer was significantly higher in seropositive cases with RPL than seropositive controls (5.18 ± 1.99 vs. 2.00 ± 0.81, P < 0.001. Conclusion: We found that previous exposure to CMV was significantly higher in patients with RPL than the control group. However, no association was found between IgG AI and RPL. Further investigations are needed to find whether latent CMV infection starts an indirect process of autoimmune etiology in RPL or women with RPL have recurrent or reactivation of CMV infection.

  11. Congenital Cytomegalovirus Infection: Prognostic Value of Maternal DNAemia at Amniocentesis.

    Science.gov (United States)

    Simonazzi, Giuliana; Cervi, Francesca; Zavatta, Alice; Pellizzoni, Laura; Guerra, Brunella; Mastroroberto, Marianna; Morselli-Labate, Antonio Maria; Gabrielli, Liliana; Rizzo, Nicola; Lazzarotto, Tiziana

    2017-01-15

    Human Cytomegalovirus (HCMV) is the most common cause of childhood hearing loss and can lead to neurodevelopmental delay. To date, few studies have examined the correlation between maternal viremia and congenital HCMV infection. The aim of our study was to ascertain if HCMV DNA in the peripheral blood of pregnant women with primary HCMV infection at the time of amniocentesis may have a prognostic value in terms of congenital infection and neonatal symptomatic disease. We performed a prospective observational study of pregnant women referred to our maternal-fetal medicine division with suspected HCMV infection. Primary infection was diagnosed based on seroconversion for HCMV and/or HCMV immunoglobulin M-positive and low or moderate HCMV immunoglobulin G avidity. At the time of amniocentesis, maternal blood samples were collected and analyzed by means of real-time polymerase chain reaction to determine the presence of viral DNAemia. Fetuses and newborns were evaluated for the presence of congenital infection and symptomatic disease. A total of 239 pregnant women were enrolled; 32 blood samples (13.4%) were positive, and 207 (86.6%) were negative for HCMV DNA. The overall rate of transmission was 23.4%. Fifteen infected patients (26.8%) were symptomatic. Vertical transmission occurred in 14 women (43.8%) with positive and 42 (20.3%) with negative results for HCMV DNAemia (P = .006; odds ratio, 3.06; 95% confidence interval, 1.41-6.64). Symptomatic infection occurred in 6 (42.9%) infected fetuses or newborns from women with and in 9 (21.4%) from women without viral DNAemia (P = .16). Maternal viremia at amniocentesis is associated with a 3-fold greater chance of congenital infection, but it is not correlated with symptomatic disease. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  12. Compartmentalized dynamics of cytomegalovirus replication in treated congenital infection.

    Science.gov (United States)

    Luck, S E; Emery, V C; Atkinson, C; Sharland, M; Griffiths, P D

    2016-09-01

    Cytomegalovirus (CMV) is the most prevalent congenital infection in developed countries. A significant number of infected infants develop long-term neurodevelopmental and hearing impairment irrespective of whether disease is detectable at birth. Studies of viral load and replication dynamics have informed the treatment of CMV in adult populations but no similar data exist in neonates. To study CMV virus kinetics in different body fluids of babies treated for congenital infection. CMV virus load was sequentially analyzed in blood, urine and saliva in 17 babies treated for symptomatic congenital CMV infection. Virus was detectable in the urine and saliva of all babies at baseline but in only 15/17 in blood. At the end of 6 weeks of antiviral treatment CMV remained detectable in 9/14 blood samples, 9/12 urine samples and 4/7 salivary swabs. Median half-life (T1/2) of virus decline in blood was 2.4 days (IQR 1.9-3.3) and basic reproductive number (Ro) was 2.3. Although T1/2 values were similar in urine and saliva to those observed in blood, virus dynamics differed both during and after treatment. T1/2 and Ro in blood in this group of neonates were similar to values derived from studies of immunocompromised adults. The persistent viremia observed in treated neonates cannot therefore be adequately explained by the virus dynamics early in treatment. The different dynamics exhibited in blood and urine suggests that studying changes in distinct body compartments may assist in further understanding long-term manifestations of disease. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

  13. The “Silent” Global Burden of Congenital Cytomegalovirus

    Science.gov (United States)

    Emery, Vincent C.; Lazzarotto, Tiziana; Gupta, Ravindra K.

    2013-01-01

    Human cytomegalovirus (CMV) is a leading cause of congenital infections worldwide. In the developed world, following the virtual elimination of circulating rubella, it is the commonest nongenetic cause of childhood hearing loss and an important cause of neurodevelopmental delay. The seroprevalence of CMV in adults and the incidence of congenital CMV infection are highest in developing countries (1 to 5% of births) and are most likely driven by nonprimary maternal infections. However, reliable estimates of prevalence and outcome from developing countries are not available. This is largely due to the dogma that maternal preexisting seroimmunity virtually eliminates the risk for sequelae. However, recent data demonstrating similar rates of sequelae, especially hearing loss, following primary and nonprimary maternal infection have underscored the importance of congenital CMV infection in resource-poor settings. Although a significant proportion of congenital CMV infections are attributable to maternal primary infection in well-resourced settings, the absence of specific interventions for seronegative mothers and uncertainty about fetal prognosis have discouraged routine maternal antibody screening. Despite these challenges, encouraging results from prototype vaccines have been reported, and the first randomized phase III trials of prenatal interventions and prolonged postnatal antiviral therapy are under way. Successful implementation of strategies to prevent or reduce the burden of congenital CMV infection will require heightened global awareness among clinicians and the general population. In this review, we highlight the global epidemiology of congenital CMV and the implications of growing knowledge in areas of prevention, diagnosis, prognosis, and management for both low (50 to 70%)- and high (>70%)-seroprevalence settings. PMID:23297260

  14. Anti-cytomegalovirus activity of the anthraquinone atanyl blue PRL.

    Science.gov (United States)

    Alam, Zohaib; Al-Mahdi, Zainab; Zhu, Yali; McKee, Zachary; Parris, Deborah S; Parikh, Hardik I; Kellogg, Glen E; Kuchta, Alison; McVoy, Michael A

    2015-02-01

    Human cytomegalovirus (CMV) causes significant disease in immunocompromised patients and serious birth defects if acquired in utero. Available CMV antivirals target the viral DNA polymerase, have significant toxicities, and suffer from resistance. New drugs targeting different pathways would be beneficial. The anthraquinone emodin is proposed to inhibit herpes simplex virus by blocking the viral nuclease. Emodin and related anthraquinones are also reported to inhibit CMV. In the present study, emodin reduced CMV infectious yield with an EC50 of 4.9μM but was cytotoxic at concentrations only twofold higher. Related anthraquinones acid blue 40 and alizarin violet R inhibited CMV at only high concentrations (238-265μM) that were also cytotoxic. However, atanyl blue PRL inhibited infectious yield of CMV with an EC50 of 6.3μM, significantly below its 50% cytotoxic concentration of 216μM. Atanyl blue PRL reduced CMV infectivity and inhibited spread. When added up to 1h after infection, it dramatically reduced CMV immediate early protein expression and blocked viral DNA synthesis. However, it had no antiviral activity when added 24h after infection. Interestingly, atanyl blue PRL inhibited nuclease activities of purified CMV UL98 protein with IC50 of 4.5 and 9.3μM. These results indicate that atanyl blue PRL targets very early post-entry events in CMV replication and suggest it may act through inhibition of UL98, making it a novel CMV inhibitor. This compound may provide valuable insights into molecular events that occur at the earliest times post-infection and serve as a lead structure for antiviral development. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Human cytomegalovirus (HCMV) induces human endogenous retrovirus (HERV) transcription.

    Science.gov (United States)

    Assinger, Alice; Yaiw, Koon-Chu; Göttesdorfer, Ingmar; Leib-Mösch, Christine; Söderberg-Nauclér, Cecilia

    2013-11-12

    Emerging evidence suggests that human cytomegalovirus (HCMV) is highly prevalent in tumours of different origin. This virus is implied to have oncogenic and oncomodulatory functions, through its ability to control host gene expression. Human endogenous retroviruses (HERV) are also frequently active in tumours of different origin, and are supposed to contribute as cofactors to cancer development. Due to the high prevalence of HCMV in several different tumours, and its ability to control host cell gene expression, we sought to define whether HCMV may affect HERV transcription. Infection of 3 established cancer cell lines, 2 primary glioblastoma cells, endothelial cells from 3 donors and monocytes from 4 donors with HCMV (strains VR 1814 or TB40/F) induced reverse transcriptase (RT) activity in all cells tested, but the response varied between donors. Both, gammaretrovirus-related class I elements HERV-T, HERV-W, HERV-F and ERV-9, and betaretrovirus-related class II elements HML-2 - 4 and HML-7 - 8, as well as spuma-virus related class III elements of the HERV-L group were up-regulated in response to HCMV infection in GliNS1 cells. Up-regulation of HERV activity was more pronounced in cells harbouring active HCMV infection, but was also induced by UV-inactivated virus. The effect was only slightly affected by ganciclovir treatment and was not controlled by the IE72 or IE86 HCMV genes. Within this brief report we show that HCMV infection induces HERV transcriptional activity in different cell types.

  16. Cytomegalovirus infection in living-donor and cadaveric lung transplantations.

    Science.gov (United States)

    Ohata, Keiji; Chen-Yoshikawa, Toyofumi F; Takahashi, Koji; Aoyama, Akihiro; Motoyama, Hideki; Hijiya, Kyoko; Hamaji, Masatsugu; Menju, Toshi; Sato, Toshihiko; Sonobe, Makoto; Takakura, Shunji; Date, Hiroshi

    2017-11-01

    Cytomegalovirus (CMV) infection remains a major cause of morbidity after lung transplantation. Some studies have reported prognostic factors for the postoperative development of CMV infection in cadaveric lung transplantation (CLT), but no research has been performed in living-donor lobar lung transplantation (LDLLT). Therefore, we analysed the possible risk factors of post-transplant CMV infection and the differences between LDLLT and CLT. The development of CMV disease and viraemia in 110 patients undergoing lung transplantation at Kyoto University Hospital in 2008-2015 were retrospectively assessed. The prognostic factors in the development of CMV infection and the differences between LDLLT and CLT were analysed. Among 110 patients, 58 LDLLTs and 52 CLTs were performed. The 3-year freedom rates from CMV disease and viraemia were 92.0% and 58.5%, respectively. There was no difference in the development of CMV infection between LDLLT and CLT (disease: 94.6% vs 91.0%, P = 0.58 and viraemia: 59.3% vs 57.2%, P = 0.76). In preoperative anti-CMV immunoglobulin status, R-D+ recipients (recipient: negative, donor: positive) and R-D- recipients (recipient: negative, donor: negative) tended to have higher and lower cumulative incidences, respectively, of CMV infection (disease: P = 0.34 and viraemia: P = 0.24) than that with R+ recipients (recipient: seropositive). Significantly lower cumulative incidence of CMV viraemia was observed in patients receiving 12-month prophylactic medication (70.6% vs 36.8%, P CLT. We found that there was no difference in the development of CMV infection between LDLLT and CLT. Twelve-month prophylaxis protocol provides beneficial effect without increased toxicity also in LDLLT. © The Author 2017. Published by Oxford University Press on behalf of the European Association for Cardio-Thoracic Surgery. All rights reserved.

  17. Relationship between cytomegalovirus infection and procoagulant changes in human immunodeficiency virus-infected patients

    NARCIS (Netherlands)

    Mulder, R.; Tichelaar, Y. I. G. V.; Sprenger, H. G.; Mulder, A. B.; Lijfering, W. M.

    P>Cytomegalovirus is associated with hypercoagulability, and is reported to increase the risk of venous thrombosis in human immunodeficiency virus (HIV)-infected patients. Progression to AIDS, however, is also associated with hypercoagulability and venous thrombosis, and may result in more

  18. Neck stiffness in Guillaine-Barre syndrome subsequent to cytomegalovirus infection

    Directory of Open Access Journals (Sweden)

    İbrahim Etem Pişkin

    2011-03-01

    Full Text Available Guillain-Barre syndrome is an acute inflammatory demyelinating polyradiculoneuropathy that can be seen at any age. The classic symptoms such as flaccid paralysis and areflexia are not always predominant in children. In this study, we presented a 3-year-old girl with Guillain-Barre syndrome associated with cytomegalovirus infection who referred with showed atypical symptoms including neck stiffness.

  19. Immunoglobulin A-specific serodiagnosis of acute human cytomegalovirus infection by using recombinant viral antigens

    NARCIS (Netherlands)

    Vornhagen, R; Hinderer, W; Sonneborn, HH; Bein, G; Matter, L; The, TH; Jahn, G; Plachter, B

    The immunoglobulin A-specific reactivities of recombinant viral proteins from nine different reading frames of human cytomegalovirus were evaluated in enzyme-linked immunosorbent assay experiments. Antigen fragments of reading frames pUL32, pUL44, and pUL57 were identified as preferable antigens for

  20. Management of cytomegalovirus infection and disease after solid-organ transplantation

    NARCIS (Netherlands)

    van der Bij, W; Speich, R

    2001-01-01

    Cytomegalovirus (CMV) continues to be a cause of substantial morbidity and death after solid-organ transplantation. There are 3 major consequences of CMV infection: CMV disease, including a wide range of clinical illnesses; superinfection with opportunistic pathogens; and injury to the transplanted

  1. Congenital Cytomegalovirus Infection in Children with Autism Spectrum Disorder: Systematic Review and Meta-Analysis

    Science.gov (United States)

    Maeyama, Kaori; Tomioka, Kazumi; Nagase, Hiroaki; Yoshioka, Mieko; Takagi, Yasuko; Kato, Takeshi; Mizobuchi, Masami; Kitayama, Shinji; Takada, Satoshi; Nagai, Masashi; Sakakibara, Nana; Nishiyama, Masahiro; Taniguchi-Ikeda, Mariko; Morioka, Ichiro; Iijima, Kazumoto; Nishimura, Noriyuki

    2018-01-01

    Association of congenital cytomegalovirus (CMV) infection with autism spectral disorder (ASD) has been suggested since 1980s. Despite the observed association, its role as a risk factor for ASD remains to be defined. In the present review, we systematically evaluated the available evidence associating congenital CMV infection with ASD using…

  2. Cytomegalovirus induced hemophagocytic lymphocytic histiocytosis in two pediatric patients with acute lymphoblastic leukemia

    Directory of Open Access Journals (Sweden)

    Benjamin Waddell

    2017-01-01

    Full Text Available Hemophagocytic lymphohistiocytosis (HLH is a rare inflammatory condition with tissue destruction due to abnormal immune activation. We present a series of 2 cases of cytomegalovirus-induced HLH in children during maintenance chemotherapy for acute lymphoblastic leukemia. These cases emphasize the importance of considering secondary HLH in this high-risk subset of pediatric patients.

  3. Central pontine myelinolysis secondary to cytomegalovirus hepatitis in a 10-month-old child

    Energy Technology Data Exchange (ETDEWEB)

    Tarhan, Cagla N.; Firat, Ali; Agildere, Muhtesem A. [Fevzi Cakmak Cad. 10. Sok. No:45, 06490 Bahcelievler, Ankara (Turkey); Otken, Arzu; Demirceken, Fulya [Sami Ulus Children' s Hospital, Department of Paediatrics, Ankara (Turkey)

    2003-01-01

    We present a 10-month-old child with central pontine myelinolysis (CPM) secondary to chronic active hepatitis due to cytomegalovirus (CMV) infection. A total of 35 paediatric cases of pontine and/or extrapontine myelinolysis are reported and, to our knowledge, CPM secondary to CMV hepatitis in an infant has not been previously reported. The MRI findings are highlighted. (orig.)

  4. Human cytomegalovirus-encoded miR-US4-1 promotes cell ...

    Indian Academy of Sciences (India)

    2016-04-05

    Apr 5, 2016 ... Human cytomegalovirus (HCMV) can cause congenital diseases and opportunistic infections in immunocompromised individuals. .... The recombinant products were then transformed into E. coli to produce a target pool ..... is not affected by genomic DNA contamination (Chen et al. 2005; Schmittgen et al.

  5. Clinical and immunologic aspects of cytomegalovirus infection in solid organ transplant recipients

    NARCIS (Netherlands)

    Rowshani, Ajda T.; Bemelman, Frederike J.; van Leeuwen, Ester M. M.; van Lier, René A. W.; ten Berge, Ineke J. M.

    2005-01-01

    Primary cytomegalovirus (CMV) infection is a major cause of morbidity and mortality in recipients after solid organ transplantation (SOT). Widespread and prolonged use of antiviral drugs has changed the natural course of CMV disease by delaying its onset and causing drug resistance. CMV induces a

  6. Factors associated with the development of cytomegalovirus infection following solid organ transplantation

    DEFF Research Database (Denmark)

    da Cunha-Bang, Caspar; Sørensen, Søren S; Iversen, Martin

    2011-01-01

    Infection with cytomegalovirus (CMV) remains a potentially serious complication in transplant patients. In this study we explored the risk factors for CMV infection in the 12 months following a solid organ transplantation (n = 242) in patients monitored for CMV infection from 2004 to 2007....

  7. Tumor necrosis factor α promotes replication and pathogenicity of rat cytomegalovirus

    NARCIS (Netherlands)

    Horzinek, M.C.; Haagmans, B.L.; Stals, F.S.; Meide, P.H. van der; Bruggeman, C.A.; Schijns, Virgil E.C.J.

    1994-01-01

    We investigated the role of tumor necrosis factor alpha (TNF-α) in the pathogenesis of rat cytomegalovirus (RCMV) infection. TNF-α levels found in the sera of radiation-immunosuppressed rats in the course of infection (> 350 pg/ml) correlated with the development of RCMV disease. Administration of

  8. Congenital Cytomegalovirus Infection: Child Development, Quality of Life and Impact on Daily Life.

    NARCIS (Netherlands)

    Korndewal, Marjolein J; Oudesluys-Murphy, Anne Marie; Kroes, Aloys C M; Vossen, Ann C T M; de Melker, Hester E

    2017-01-01

    Congenital cytomegalovirus (cCMV) infection is the most common congenital infection worldwide and can lead to long-term impairments such as developmental delay. It is currently unknown how this affects the daily life of children and their parents. Children For this study, children with cCMV were

  9. Congenital cytomegalovirus infection after recurrent infection: case reports and review of the literature.

    NARCIS (Netherlands)

    Gaytant, M.A.; Rours, G.I.J.G.; Steegers, E.A.P.; Galama, J.M.D.; Semmekrot, B.A.

    2003-01-01

    Cytomegalovirus (CMV) is one of the most common causes of congenital infections in developed countries with reported incidences varying between 0.15% and 2.0%. The effects of congenital CMV infection may vary from a congenital syndrome to an asymptomatic course. Infants that are asymptomatic at

  10. Cytomegalovirus induced hemophagocytic lymphocytic histiocytosis in two pediatric patients with acute lymphoblastic leukemia.

    Science.gov (United States)

    Waddell, Benjamin; Belcher, Chris; Willey, Emily

    2017-01-01

    Hemophagocytic lymphohistiocytosis (HLH) is a rare inflammatory condition with tissue destruction due to abnormal immune activation. We present a series of 2 cases of cytomegalovirus-induced HLH in children during maintenance chemotherapy for acute lymphoblastic leukemia. These cases emphasize the importance of considering secondary HLH in this high-risk subset of pediatric patients.

  11. Child Care Provider Awareness and Prevention of Cytomegalovirus and Other Infectious Diseases

    Science.gov (United States)

    Thackeray, Rosemary; Magnusson, Brianna M.

    2016-01-01

    Background: Child care facilities are prime locations for the transmission of infectious and communicable diseases. Children and child care providers are at high risk for cytomegalovirus (CMV) infection which causes severe birth defects and developmental delays. Objective: The goals of study were: (1) to determine the level of cytomegalovirus…

  12. Cytomegalovirus-associated colitis mimicking necrotizing enterocolitis – A near miss diagnosis of neonatal colonic stricture

    Directory of Open Access Journals (Sweden)

    Fanny Yeung

    2014-10-01

    Full Text Available Although cytomegalovirus (CMV is a common congenital infection in neonates, most patients are asymptomatic. Gastrointestinal manifestation is unusual. In this report, we described a newborn with perinatal CMV infection presented with symptoms mimicking necrotizing enterocolitis. We hope to alert clinicians about this possible diagnosis when managing newborn gastrointestinal diseases.

  13. Congenital cytomegalovirus infection : disease burden and screening tools : towards newborn screening

    NARCIS (Netherlands)

    Vries, Jutte Jacoba Catharina de

    2012-01-01

    Cytomegalovirus (CMV) infection is the most common congenital viral infection worldwide. The symptom of congenital CMV infection encountered most frequently is sensorineural hearing loss, which will affect approximately one out of five congenitally infected newborns. Because of the late-onset nature

  14. DECIBEL study: Congenital cytomegalovirus infection in young children with permanent bilateral hearing impairment in the Netherlands

    NARCIS (Netherlands)

    Korver, A. M. H.; de Vries, J. J. C.; Konings, S.; de Jong, J. W.; Dekker, F. W.; Vossen, A. C. T. M.; Frijns, J. H. M.; Oudesluys-Murphy, A. M.; Wever, C. C.; Beers, M.; Soede, W.; Kant, S. G.; van den Akker-van Marle, M. E.; Rieffe, C.; Ens-Dokkum, M. H.; van Straaten, H. L. M.; Meuwese-Jongejeugd, J.; Elvers, B.; Loeber, G.; Maré, M. J.; Van Zanten, G. A.; Goedegebure, A.; Coster, F.; de Leeuw, M.; Dijkhuizen, J.; Scharloo, M.; Hoeben, D.; Rijpma, G.; Graef, W.; Linschoten, D.; Kuijper, J.; Hof, N. J.; Pans, D.; Jorritsma, F.; van Beurden, M.; ter Huurne, C. T.; Brienesse, P.; Koldewijn, G. J.; Letourneur, K. G.; Seekles, L.; Thijssen, A.; Lievense, A.; van Egdom-van der Wind, M.; Theunissen, S. C. P. M.; Mooij, S.

    2009-01-01

    A significant number of asymptomatic newborns infected with congenital cytomegalovirus (CMV) will present with permanent childhood hearing impairment (PCHI) during early childhood. To investigate the role of congenital CMV infection in causing PCHI in the Netherlands, and assess the efficacy of two

  15. Differential effects of Cytomegalovirus carriage on the immune phenotype of middle-aged males and females

    NARCIS (Netherlands)

    van der Heiden, Marieke; van Zelm, Menno C.; Bartol, Sophinus J. W.; de Rond, Lia G. H.; Berbers, Guy A. M.; Boots, Annemieke M. H.; Buisman, Anne-Marie

    2016-01-01

    The elderly population is more susceptible to infections as a result of an altered immune response, commonly referred to as immunosenescence. Cytomegalovirus (CMV)-infection associated changes in blood lymphocytes are known to impact this process, but the interaction with gender remains unclear.

  16. Investigation of the Role of the Cytomegalovirus as a Respiratory Pathogen in HIV-Infected Patients

    Directory of Open Access Journals (Sweden)

    Rafael E de la Hoz

    1996-01-01

    Full Text Available OBJECTIVE: To investigate the occurrence of cytomegalovirus (CMV pneumonitis in the setting of human immunodeficiency virus (HIV infection and whether the presence of CMV as copathogen is associated with increased clinical severity or short term mortality in patients with Pneumocystis carinii pneumonia.

  17. Associations between anti-cytomegalovirus IgG responses and health effect biomarkers

    Science.gov (United States)

    Human cytomegalovirus (HCMV) is a member of the herpes simplex virus family that infects approximately 50% of US adults. HCMV is transmitted from person to person through bodily fluids, congenitally or from donors to transplant recipients. It causes a lifelong latent infection th...

  18. An Italian Prospective Experience on the Association between Congenital Cytomegalovirus Infection and Autistic Spectrum Disorder

    Science.gov (United States)

    Garofoli, Francesca; Lombardi, Giuseppina; Orcesi, Simona; Pisoni, Camilla; Mazzucchelli, Iolanda; Angelini, Micol; Balottin, Umberto; Stronati, Mauro

    2017-01-01

    The aim of this retrospective study, with prospective data collection, was to correlate congenital cytomegalovirus (CMV) infection with autism spectrum disorder (ASD) and to define its prevalence. Seventy proven congenitally-infected infants, born between 2007 and 2012, were referred to our centre for CMV diagnosis and follow-up, which consisted…

  19. Partial functional complementation between human and mouse cytomegalovirus chemokine receptor homologues

    DEFF Research Database (Denmark)

    Farrell, Helen E; Abraham, Alexander M; Cardin, Rhonda D

    2011-01-01

    The human cytomegalovirus (CMV) proteins US28 and UL33 are homologous to chemokine receptors (CKRs). Knockout of the mouse CMV M33 protein (UL33 homologue) results in substantial attenuation of salivary gland infection/replication and reduced efficiency of reactivation from tissue explants. M33...

  20. Congenital Cytomegalovirus Infection: A Significant Cause of Deafness and Mental Deficiency.

    Science.gov (United States)

    Eichhorn, Sarah K.

    1982-01-01

    Research on cytomegalovirus (CMV), a herpes virus causing neurological damage (hearing problems and/or mental retardation) in 10 percent of infants born with the condition, is reviewed. Incidence of hearing and retardation in CMV cases is reported and current treatment described. (CL)

  1. The time course of development and impact from viral resistance against ganciclovir in cytomegalovirus infection

    DEFF Research Database (Denmark)

    Cunha-Bang, C da; Kirkby, N; Sønderholm, M

    2013-01-01

    (Val)ganciclovir is used to treat cytomegalovirus (CMV) infection following solid organ (SOT) or hematopoietic stem cell (HSCT) transplantation. Treatment failures occur, but the contribution from 39 known ganciclovir-related mutations (GRMs) in the CMV-UL97 gene remains controversial. We propose...

  2. Targeting the latent cytomegalovirus reservoir with an antiviral fusion toxin protein

    DEFF Research Database (Denmark)

    Krishna, B A; Spiess, K; Poole, E L

    2017-01-01

    Reactivation of human cytomegalovirus (HCMV) in transplant recipients can cause life-threatening disease. Consequently, for transplant recipients, killing latently infected cells could have far-reaching clinical benefits. In vivo, myeloid cells and their progenitors are an important site of HCMV...

  3. Hypertrophic osteoarthropathy in a young child with cytomegalovirus pneumonia and the bare lymphocyte syndrome

    International Nuclear Information System (INIS)

    Taets van Amerongen, A.H.M.; Golding, R.P.; Veerman, A.J.P.

    1986-01-01

    A case of hypertrophic osteoarthropathy is reported in a 3-year-old Turkish girl. She had combined immunodeficiency, later shown to be the Bare Lymphocyte syndrome, and chronic pneumonia. Lung biopsy showed cytomegalovirus. The child developed painful elbow and knee joints and hypertrophic osteoarthropathy was demonstrated radiologically. (orig.)

  4. CD27-CD70 costimulation controls T cell immunity during acute and persistent cytomegalovirus infection

    NARCIS (Netherlands)

    Welten, Suzanne P. M.; Redeker, Anke; Franken, Kees L.; Benedict, Chris A.; Yagita, Hideo; Wensveen, Felix M.; Borst, Jannie; Melief, Cornelis J. M.; van Lier, René A. W.; van Gisbergen, Klaas P. J. M.; Arens, Ramon

    2013-01-01

    Cytomegaloviruses (CMVs) establish lifelong infections that are controlled in part by CD4(+) and CD8(+) T cells. To promote persistence, CMVs utilize multiple strategies to evade host immunity, including modulation of costimulatory molecules on infected antigen-presenting cells. In humans,

  5. Identification and characterization of the murine cell surface receptor for the urokinase-type plasminogen activator

    DEFF Research Database (Denmark)

    Solberg, H; Løber, D; Eriksen, J

    1992-01-01

    Cell-binding experiments have indicated that murine cells on their surface have specific binding sites for mouse urokinase-type plasminogen activator (u-PA). In contrast to the human system, chemical cross-linking studies with an iodinated ligand did not yield any covalent adducts in the murine...... system, but in ligand-blotting analysis, two mouse u-PA-binding proteins could be visualized. To confirm that these proteins are the murine counterpart of the human u-PA receptor (u-PAR), a peptide was derived from the murine cDNA clone assigned to represent the murine u-PAR due to cross......-blotting analysis. Binding of mouse u-PA to its receptor showed species specificity in ligand-blotting analysis, since mouse u-PA did not bind to human u-PAR and human u-PA did not bind to mouse u-PAR. The apparent M(r) of mouse u-PAR varied between different mouse cell lines and ranged over M(r) 45...

  6. Critical Role of CD8 T Cells in Mediating Sex-Based Differences in a Murine Model of Lupus

    Science.gov (United States)

    2009-08-21

    disease and is also seen in some murine lupus models (2, 3). Lupus nephritis results from IC deposition in the kidneys resulting in glomerular damage... treatment of disease, as well as diagnosis of milder cases of SLE. A recent study on lupus mortality reported that diseases of the circulatory system...disease may also be attributable to treatment with immunosuppressive drugs in addition to the hypo-responsive T cells seen in lupus . Murine Models of

  7. Congenital cytomegalovirus: association between dried blood spot viral load and hearing loss.

    Science.gov (United States)

    Walter, S; Atkinson, C; Sharland, M; Rice, P; Raglan, E; Emery, V C; Griffiths, P D

    2008-07-01

    To investigate the relation between cytomegalovirus (CMV) viral load on dried blood spots (DBS) from newborn biochemical screening ("Guthrie") cards, and sensorineural hearing loss (SNHL) in congenital CMV. Cross-sectional study with retrospective case-note review. Seven paediatric audiology departments in the United Kingdom. 84 children, median age 7 years: 43 with known congenital CMV, 41 with unexplained SNHL. Half a DBS was tested for CMV DNA viral load by quantitative real-time polymerase chain reaction (PCR). Pure tone average hearing thresholds (0.5-4 kHz). DBS CMV DNA viral load significantly correlated with hearing thresholds for the worse and better hearing ears (Spearman's rank correlations: r = 0.445, p = 0.008 and r = 0.481, p = 0.004 respectively). Multivariable logistic regression showed that the effect of DBS viral load on the risk of SNHL remained important, when age and central nervous system involvement had been taken into account (odds ratio (OR) 2.76, 95% confidence interval (CI) 1.14 to 6.63, p = 0.024). The mean log DBS viral load was significantly higher in children with SNHL than in those with normal hearing (2.69 versus 1.64, 95% CI -1.84 to -0.27, p = 0.01). 8/35 (23%) children with unexplained SNHL tested positive for CMV DNA on DBS. One false positive result was obtained. The risk of SNHL increased with DBS viral load. Further studies should investigate whether DBS CMV testing has a role in identifying asymptomatic congenitally infected neonates at risk of SNHL, and whether antiviral treatment can reduce this risk.

  8. T Cell Immunosenescence after Early Life Adversity: Association with Cytomegalovirus Infection

    Directory of Open Access Journals (Sweden)

    Martha M. C. Elwenspoek

    2017-10-01

    Full Text Available Early life adversity (ELA increases the risk for multiple age-related diseases, such as diabetes type 2 and cardiovascular disease. As prevalence is high, ELA poses a major and global public health problem. Immunosenescence, or aging of the immune system, has been proposed to underlie the association between ELA and long-term health consequences. However, it is unclear what drives ELA-associated immunosenescence and which cells are primarily affected. We investigated different biomarkers of immunosenescence in a healthy subset of the EpiPath cohort. Participants were either parent-reared (Ctrl, n = 59 or had experienced separation from their parents in early childhood and were subsequently adopted (ELA, n = 18. No difference was observed in telomere length or in methylation levels of age-related CpGs in whole blood, containing a heterogeneous mixture of immune cells. However, when specifically investigating T cells, we found a higher expression of senescence markers (CD57 in ELA. In addition, senescent T cells (CD57+ in ELA had an increased cytolytic potential compared to senescent cells in controls. With a mediation analysis we demonstrated that cytomegalovirus (CMV infection, which is an important driving force of immunosenescence, largely accounted for elevated CD57 expression observed in ELA. Leukocyte telomere length may obscure cell-specific immunosenescence; here, we demonstrated that the use of cell surface markers of senescence can be more informative. Our data suggest that ELA may increase the risk of CMV infection in early childhood, thereby mediating the effect of ELA on T cell-specific immunosenescence. Thus, future studies should include CMV as a confounder or selectively investigate CMV seronegative cohorts.

  9. Newborn screening for congenital cytomegalovirus using real-time polymerase chain reaction in umbilical cord blood.

    Science.gov (United States)

    Barkai, Galia; Barzilai, Asher; Mendelson, Ella; Tepperberg-Oikawa, Michal; Roth, Daphne Ari-Even; Kuint, Jacob

    2013-06-01

    Congenital cytomegalovirus (C-CMV) infection affects 0.4-2% of newborn infants in Israel, most of whom are asymptomatic. Of these, 10-20% will subsequently develop hearing impairment and may have benetitted from early detection by neonatal screeing. To retrospectively anaIyze the results of a screening program for C-CMV performed at the Sheba Medical Center, Tel, Hashomer, during a 1 year period, using real-time polymerase chain reaction (rt-PCR) from umbilical cord blood. CMV DNA was detected by rt-PCR performed on infants' cord blood. C-CMV was confirmed by urine culture (Shell-vial). All confirmed cases were further investigated for C-CMV manifestations by head ultrasound, complete blood count, liver enzyme measurement, ophthalmology examination and hearing investigation. During the period 1 June 2009 to 31 May 2010, 11,022 infants were born at the Sheba Medical Center, of whom 8105 (74%) were screened. Twenty-three (0.28%) were positive for CMV and 22 of them (96%) were confirmed by urine culture. Two additional infants, who had not been screened, were detected after clinical suspicion. All 24 infants were further Investigated, and 3 (12.5%) had central nervous system involvement (including hearing impairment) and were offered intravenous ganciclovir for 6 weeks. Eighteen infants (82%) would not otherwise have been diagnosed. The relatively low incidence of C-CMV detected in our screening program probably reflects the low sensitivity of cord blood screening. Nevertheless, this screening program reliably detected a non-negligible number of infants who could benefit from early detection. Other screening methods using saliva should be investigated further.

  10. DIAGNOSIS OF CONGENITAL CYTOMEGALOVIRUS INFECTION IN HIGH RISK NEONATES

    Directory of Open Access Journals (Sweden)

    Ehab abdelmoniem Albanna

    2013-07-01

    Full Text Available Objectives: This study aimed to compare polymerase chain reaction (PCR and IgM detection using enzyme linked immune-sorbent assay (ELISA in diagnosis of congenital cytomegalovirus (CMV infection.   Methods: This study was conducted from May 2009 to December 2010. Urine and blood samples were collected from 94 neonates with suspected congenital CMV infection. Serum and part of urine samples were stored at -20°C freezer, until the serologic and PCR tests were achieved. A 94 fresh urine samples were processed for cell culture. Nineteen (20.2% out of 94 urine samples were proven positive for CMV infection by viral culture. For comparing PCR and IgM ELISA we used tissue culture technique as a reference, the 19 positive samples on culture (CMV group and 20 negative samples (control group were included in the comparison. Some characteristics of CMV and control groups were compared including sex, age, birth weight, gestational age < 37 and small for gestational age. Clinical and laboratory abnormalities were also compared in both groups.   Results: This study showed that the sensitivity and specificity of PCR in relation to viral culture were 100% and 100% respectively, there was excellent agreement between both tests (Kappa coefficient was 1 and P=0.000. On the other hand, the sensitivity of IgM CMV ELISA in relation to viral culture was 63.2% and the specificity was 85%. There was good agreement between both tests (Kappa coefficient was 0.48 and P=0.002. By comparing CMV and control groups, there were high statistically significant differences between both groups as regard the birth weight, gestational age < 37 and small for gestational age items (P= 0.00, 0.03 and 0.01 respectively. There were statistically insignificant differences as regarding the clinical and laboratory abnormalities detected for neonates of both groups. In this study jaundice (63% and hepato-splenomegaly (42% were the most common clinical signs in both groups.   Conclusion

  11. The immunological underpinnings of vaccinations to prevent cytomegalovirus disease.

    Science.gov (United States)

    McCormick, A Louise; Mocarski, Edward S

    2015-03-01

    A universal cytomegalovirus (CMV) vaccination promises to reduce the burden of the developmental damage that afflicts up to 0.5% of live births worldwide. An effective vaccination that prevents transplacental transmission would reduce CMV congenital disease and CMV-associated still births and leave populations less susceptible to opportunistic CMV disease. Thus, a vaccination against this virus has long been recognized for the potential of enormous health-care savings because congenital damage is life-long and existing anti-viral options are limited. Vaccine researchers, industry leaders, and regulatory representatives have discussed the challenges posed by clinical efficacy trials that would lead to a universal CMV vaccine, reviewing the links between infection and disease, and identifying settings where disrupting viral transmission might provide a surrogate endpoint for disease prevention. Reducing the complexity of such trials would facilitate vaccine development. Children and adolescents are the targets for universal vaccination, with the expectation of protecting the offspring of immunized women. Given that a majority of females worldwide experience CMV infection during childhood, a universal vaccine must boost natural immunity and reduce transmission due to reactivation and re-infection as well as primary infection during pregnancy. Although current vaccine strategies recognize the value of humoral and cellular immunity, the precise mechanisms that act at the placental interface remain elusive. Immunity resulting from natural infection appears to limit rather than prevent reactivation of latent viruses and susceptibility to re-infection, leaving a challenge for universal vaccination to improve upon natural immunity levels. Despite these hurdles, early phase clinical trials have achieved primary end points in CMV seronegative subjects. Efficacy studies must be expanded to mixed populations of CMV-naive and naturally infected subjects to understand the overall

  12. Hearing outcome of infants with congenital cytomegalovirus and hearing impairment.

    Science.gov (United States)

    Bilavsky, Efraim; Shahar-Nissan, Keren; Pardo, Joseph; Attias, Joseph; Amir, Jacob

    2016-05-01

    Congenital cytomegalovirus (cCMV) is the most common non-genetic cause of childhood sensorineural hearing loss. Antiviral treatment has been shown to prevent hearing deterioration in these infants. However, studies focused on infants with hearing impairment at birth and on the specific degree of impairment and further improvement or deterioration are lacking. To investigate the relationship between hearing status at birth and any change in hearing status at the end of a prolonged follow-up period, after receiving 12 months of antiviral treatment in children born with hearing impairment due to congenital cCMV. Clinical, laboratory, radiological and audiological data of all infants with cCMV infection followed in our centre between 2005 and 2013 were reviewed. Treatment with antiviral medication for hearing impairment found during the neonatal period was12 months of gan/valganciclovir. Hearing studies were performed only on infants who had been followed up for more than 1 year after treatment. Hearing impairment at birth was found in 54 (36.2%) of the 149 infants diagnosed with symptomatic cCMV, and found in 77 affected ears; unilateral in 31 (57.4%) and bilateral in 23 (42.6%). After 1 year of antiviral treatment and a long-term follow-up of the 77 affected ears at baseline, 50 (64.9%) had improved, 22 (28.6%) remained unchanged and 5 (6.5%) had deteriorated. Most improved ears (38/50=76%) returned to normal hearing. Improvement was most likely to occur in infants born with mild or moderate hearing loss and less in those with severe impairment. We found that infants born with cCMV and hearing impairment, receiving 12 months of antiviral treatment, showed significant improvement in hearing status. The probability of hearing improvement seems inversely related to the severity of the impairment at birth. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  13. Washing our hands of the congenital cytomegalovirus disease epidemic

    Directory of Open Access Journals (Sweden)

    Cannon Michael J

    2005-06-01

    Full Text Available Abstract Background Each year in the United States, an estimated 40,000 children are born with congenital cytomegalovirus (CMV infection, causing an estimated 400 deaths and leaving approximately 8000 children with permanent disabilities such as hearing or vision loss, or mental retardation. More children are affected by serious CMV-related disabilities than by several better-known childhood maladies, including Down syndrome, fetal alcohol syndrome, and spina bifida. Discussion Congenital CMV is a prime target for prevention not only because of its substantial disease burden but also because the biology and epidemiology of CMV suggest that there are ways to reduce viral transmission. Because exposure to the saliva or urine of young children is a major cause of CMV infection among pregnant women, it is likely that good personal hygiene, especially hand-washing, can reduce the risk of CMV acquisition. Experts agree that such measures are likely to be efficacious (i.e., they will work if consistently followed and the American College of Obstetricians and Gynecologists recommends that physicians counsel pregnant women about preventing CMV acquisition through careful attention to hygiene. However, because of concerns about effectiveness (i.e., Will women consistently follow hygienic practices as the result of interventions?, the medical and public health communities appear reluctant to embrace primary CMV prevention via improved hygienic practices, and educational interventions are rare. Current data on the effectiveness of such measures in preventing CMV infection are promising, but limited. There is strong evidence, however, that educational interventions can prevent other infectious diseases with similar transmission modes, suggesting that effective interventions can also be found for CMV. Until a CMV vaccine becomes available, effective educational interventions are needed to inform women about congenital CMV prevention. Summary Perhaps no single

  14. Cytomegalovirus induces abnormal chondrogenesis and osteogenesis during embryonic mandibular development

    Directory of Open Access Journals (Sweden)

    Bringas Pablo

    2008-03-01

    Full Text Available Abstract Background Human clinical studies and mouse models clearly demonstrate that cytomegalovirus (CMV disrupts normal organ and tissue development. Although CMV is one of the most common causes of major birth defects in humans, little is presently known about the mechanism(s underlying CMV-induced congenital malformations. Our prior studies have demonstrated that CMV infection of first branchial arch derivatives (salivary glands and teeth induced severely abnormal phenotypes and that CMV has a particular tropism for neural crest-derived mesenchyme (NCM. Since early embryos are barely susceptible to CMV infection, and the extant evidence suggests that the differentiation program needs to be well underway for embryonic tissues to be susceptible to viral infection and viral-induced pathology, the aim of this study was to determine if first branchial arch NCM cells are susceptible to mCMV infection prior to differentiation of NCM derivatives. Results E11 mouse mandibular processes (MANs were infected with mouse CMV (mCMV for up to 16 days in vitro. mCMV infection of undifferentiated embryonic mouse MANs induced micrognathia consequent to decreased Meckel's cartilage chondrogenesis and mandibular osteogenesis. Specifically, mCMV infection resulted in aberrant stromal cellularity, a smaller, misshapen Meckel's cartilage, and mandibular bone and condylar dysmorphogenesis. Analysis of viral distribution indicates that mCMV primarily infects NCM cells and derivatives. Initial localization studies indicate that mCMV infection changed the cell-specific expression of FN, NF-κB2, RelA, RelB, and Shh and Smad7 proteins. Conclusion Our results indicate that mCMV dysregulation of key signaling pathways in primarily NCM cells and their derivatives severely disrupts mandibular morphogenesis and skeletogenesis. The pathogenesis appears to be centered around the canonical and noncanonical NF-κB pathways, and there is unusual juxtaposition of abnormal stromal

  15. Cytomegalovirus pp65 limits dissemination but is dispensable for persistence

    Energy Technology Data Exchange (ETDEWEB)

    Malouli, Daniel; Hansen, Scott G.; Nakayasu, Ernesto S.; Marshall, Emily E.; Hughes, Colette M.; Ventura, Abigail B.; Gilbride, Roxanne M.; Lewis, Matthew S.; Xu, Guangwu; Kreklywich, Craig; Whizin, Nathan; Fischer, Miranda; Legasse, Alfred W.; Viswanathan, Kasinath; Siess, Don; Camp, David G.; Axthelm, Michael K.; Kahl, Christoph; DeFilippis, Victor R.; Smith, Richard D.; Streblow, Daniel N.; Picker, Louis J.; Früh, Klaus

    2014-04-01

    The tegument phosphoprotein pp65 (UL83) is the most abundant virion protein in human cytomegalovirus (HCMV). Since pp65 is immunodominant in persistently infected individuals, subunit vaccines against HCMV often include pp65 as T cell stimulatory component. Although HCMV pp65 is non-essential for viral growth in vitro it is thought to have an important role in primary and persistent infection since pp65 displays multiple immunomodulatory functions. To determine whether pp65 is required for infection and to evaluate its role in natural and vaccination-induced immunity we generated a rhesus CMV lacking both homologues, pp65a (Rh111) and pp65b (Rh112). Lack of pp65 resulted in a slight growth defect in vitro and an increase of defective particle formation. However, most pp65-deleted virions in the supernatant were phenotypically normal and proteomics analysis revealed that the ratios of the remaining viral proteins were largely unchanged. RhCMV Δpp65ab was able to persistently infect CMV-negative rhesus macaques (RM) and to super-infect RM previously infected with CMV. To determine whether T cells against pp65 are essential for protection against CMV, we challenged Δpp65ab-infected animals with RhCMV ΔUS2-11, a viral recombinant that lacks inhibitors of MHC-I antigen presentation and is thus unable to overcome CMV-specific T cell immunity. Despite a complete lack of pp65-specific T cells, Δpp65ab protected against ΔUS2-11 challenge suggesting that pp65-specific T cells are not essential for T cell immunity against CMV. Using the same approach we further demonstrate that pp65b-specific T cells, induced by heterologous prime/boost vaccination, are not sufficient to protect against ΔUS2-11 challenge. Our data provides a new approach to test the efficacy of subunit vaccine candidates and suggest that pp65 vaccines are insufficient to induce a T cell response that recapitulates the protective effect of natural infection.

  16. Symptomatic Congenital Cytomegalovirus Infection in Children of Seropositive Women

    Directory of Open Access Journals (Sweden)

    Ines Mack

    2017-06-01

    Full Text Available Cytomegalovirus (CMV is the most frequent congenital virus infection worldwide. The risk of congenital CMV (cCMV transmission is highest in seronegative women who acquire primary CMV infection during pregnancy. A growing body of evidence indicates that secondary CMV infections in pregnant women with preconceptual immunity (either through reactivation of latent virus or re-infection with a new strain of CMV contribute to a much greater proportion of symptomatic cCMV than was previously thought. Here, we describe a case of symptomatic cCMV infection in the newborn of a woman with proven immunity prior to pregnancy. Diagnosis was confirmed by CMV PCR from amniotic fluid and fetal MR imaging. The newborn presented with typical cCMV symptoms including jaundice, hepatosplenomegaly, cholestasis, petechiae, small head circumference, and sensorineural hearing loss, the most common neurologic sequela. CMV was detected in infant blood and urine by PCR, and intravenous ganciclovir was initiated and continued orally for 6 weeks totally. Apart from persisting right-sided deafness, the child exhibited normal neurological development up through the last follow-up at 4.5 years. To date, the most effective strategy to prevent vertical CMV transmission is hygiene counseling for women of childbearing age, which, in our case, and in concordance with recent literature, applies to seronegative, as well as seropositive, women. Once an expecting mother shows seroconversion or signs of an active CMV infection, there are no established procedures to reduce the risk of transmission, or therapeutic options for the fetus with signs of infection. After birth, symptomatic infants can be treated with ganciclovir to inhibit viral replication and improve hearing ability and neurodevelopmental outcome. A comprehensive review of the literature, including our case study, reveals the most current and significant diagnostic and treatment options available. In conclusion, the triad

  17. Letermovir Prophylaxis for Cytomegalovirus in Hematopoietic-Cell Transplantation.

    Science.gov (United States)

    Marty, Francisco M; Ljungman, Per; Chemaly, Roy F; Maertens, Johan; Dadwal, Sanjeet S; Duarte, Rafael F; Haider, Shariq; Ullmann, Andrew J; Katayama, Yuta; Brown, Janice; Mullane, Kathleen M; Boeckh, Michael; Blumberg, Emily A; Einsele, Hermann; Snydman, David R; Kanda, Yoshinobu; DiNubile, Mark J; Teal, Valerie L; Wan, Hong; Murata, Yoshihiko; Kartsonis, Nicholas A; Leavitt, Randi Y; Badshah, Cyrus

    2017-12-21

    Cytomegalovirus (CMV) infection remains a common complication after allogeneic hematopoietic-cell transplantation. Letermovir is an antiviral drug that inhibits the CMV-terminase complex. In this phase 3, double-blind trial, we randomly assigned CMV-seropositive transplant recipients, 18 years of age or older, in a 2:1 ratio to receive letermovir or placebo, administered orally or intravenously, through week 14 after transplantation; randomization was stratified according to trial site and CMV disease risk. Letermovir was administered at a dose of 480 mg per day (or 240 mg per day in patients taking cyclosporine). Patients in whom clinically significant CMV infection (CMV disease or CMV viremia leading to preemptive treatment) developed discontinued the trial regimen and received anti-CMV treatment. The primary end point was the proportion of patients, among patients without detectable CMV DNA at randomization, who had clinically significant CMV infection through week 24 after transplantation. Patients who discontinued the trial or had missing end-point data at week 24 were imputed as having a primary end-point event. Patients were followed through week 48 after transplantation. From June 2014 to March 2016, a total of 565 patients underwent randomization and received letermovir or placebo beginning a median of 9 days after transplantation. Among 495 patients with undetectable CMV DNA at randomization, fewer patients in the letermovir group than in the placebo group had clinically significant CMV infection or were imputed as having a primary end-point event by week 24 after transplantation (122 of 325 patients [37.5%] vs. 103 of 170 [60.6%], P<0.001). The frequency and severity of adverse events were similar in the two groups overall. Vomiting was reported in 18.5% of the patients who received letermovir and in 13.5% of those who received placebo; edema in 14.5% and 9.4%, respectively; and atrial fibrillation or flutter in 4.6% and 1.0%, respectively. The rates of

  18. Mannose-binding lectin and Ficolin-2 gene polymorphisms predispose to cytomegalovirus (re)infection after orthotopic liver transplantation

    NARCIS (Netherlands)

    de Rooij, Bert-Jan F.; van der Beek, Martha T.; van Hoek, Bart; Vossen, Ann C. T. M.; ten Hove, W. Rogier; Roos, Anja; Schaapherder, Alexander F.; Porte, Robert J.; van der Reijden, Johan J.; Coenraad, Minneke J.; Hommes, Daniel W.; Verspaget, Hein W.

    2011-01-01

    Background & Aims: The lectin pathway of complement activation is a crucial effector cascade of the innate immune response to pathogens. Cytomegalovirus (CMV) infection occurs frequently in immunocompromised patients after orthotopic liver transplantation (OLT). Single-nucleotide polymorphisms

  19. Observational study to assess pregnant women’s knowledge and behaviour to prevent toxoplasmosis, listeriosis and cytomegalovirus.

    NARCIS (Netherlands)

    Pereboom, M.T.R.; Manniën, J.; Spelten, E.R.; Schellevis, F.G.; Hutton, E.K.

    2013-01-01

    Background: Toxoplasmosis, listeriosis and cytomegalovirus (CMV) can negatively affect pregnancy outcomes, but can be prevented by simple precautions of pregnant women. Literature suggests that pregnant women are not always adequately informed by their care provider about preventable infectious

  20. Giardia Alters Commensal Microbial Diversity throughout the Murine Gut.

    Science.gov (United States)

    Barash, N R; Maloney, J G; Singer, S M; Dawson, S C

    2017-06-01

    Giardia lamblia is the most frequently identified protozoan cause of intestinal infection. Over 200 million people are estimated to have acute or chronic giardiasis, with infection rates approaching 90% in areas where Giardia is endemic. Despite its significance in global health, the mechanisms of pathogenesis associated with giardiasis remain unclear, as the parasite neither produces a known toxin nor induces a robust inflammatory response. Giardia colonization and proliferation in the small intestine of the host may, however, disrupt the ecological homeostasis of gastrointestinal commensal microbes and contribute to diarrheal disease associated with giardiasis. To evaluate the impact of Giardia infection on the host microbiota, we used culture-independent methods to quantify shifts in the diversity of commensal microbes throughout the gastrointestinal tract in mice infected with Giardia We discovered that Giardia 's colonization of the small intestine causes a systemic dysbiosis of aerobic and anaerobic commensal bacteria. Specifically, Giardia colonization is typified by both expansions in aerobic Proteobacteria and decreases in anaerobic Firmicutes and Melainabacteria in the murine foregut and hindgut. Based on these shifts, we created a quantitative index of murine Giardia -induced microbial dysbiosis. This index increased at all gut regions during the duration of infection, including both the proximal small intestine and the colon. Giardiasis could be an ecological disease, and the observed dysbiosis may be mediated directly via the parasite's unique anaerobic fermentative metabolism or indirectly via parasite induction of gut inflammation. This systemic alteration of murine gut commensal diversity may be the cause or the consequence of inflammatory and metabolic changes throughout the gut. Shifts in the commensal microbiota may explain observed variations in giardiasis between hosts with respect to host pathology, degree of parasite colonization, infection

  1. Peripheral Blood Leukocytes and Serum Nested Polymerase Chain Reaction Are Complementary Methods for Monitoring Active Cytomegalovirus Infection in Transplant Patients

    Directory of Open Access Journals (Sweden)

    PD Andrade

    2013-01-01

    Full Text Available BACKGROUND: Human cytomegalovirus is an important cause of morbidity and mortality in immunocompromised patients. Qualitative polymerase chain reaction (PCR has proven to be a sensitive and effective technique in defining active cytomegalovirus infection, in addition to having low cost and being a useful test for situations in which there is no need for quantification. Real-time PCR has the advantage of quantification; however, the high cost of this methodology makes it impractical for routine use.

  2. Clinical Outcome of Cytomegalovirus Infection on Low Birth Weight Infants

    Directory of Open Access Journals (Sweden)

    Ali Usman

    2014-09-01

    Full Text Available Abstract Cytomegalovirus (CMV is a DNA virus and a marker of the herpes virus groups. This virus was found only in human and the infection occurs for a long time. The transmission of CMV infection to fetus/neonates is via congenital infections or perinatal infections. Clinical manifestation of symptomatic CMV infection of the fetus has two presentations, early and second early manifestations. Diagnosis of neonatal CMV infection may be done by serologic test based on detection of IgM of CMV infection. The objective of this study is to asses clinical outcome of CMV infection of low birth weight infants delivery with long term sequelae. An observational study was conducted since March 2010 until December 2011 in Advent and Hermina Pasteur Hospital, all subjects were low birth weight infants (LBWI. The inclusion criterias are all LBWI who were delivered in those hospital or were a referred neonates. The exclusion criterias are major congenital defect, which is not related to congenital CMV infection and neonates’ death before one week of life. Every neonate was examine both their physical and peripher blood count, glucose, Ca. Liver function test done for neonates with acute hepatitis and titre IgG and IgM CMV serial, head ultrasound serial and head CT scan/MRI used for babies with intracranial bleeding and hydrocephaly.  During the period of this study there were 50 cases of LBWI, consisted of 41 preterm babies, and 30 small for gestational age babies. Clinical manifestation of acute hepatitis were found in 20% subjects, all of them with the  elevation of liver function test. Microcephaly which occured in the first untill three weeks of life were 8%. Ventricular dilatation were 10% in the first week of life and increased up to 48% after three weeks. Cases with intracranial haemorrhage were found in 6% and 10% with cerebral calcification on head while sensorineural hearing loss were 8%. All of LBWI have 100% serorespon immune IgG. IgM CMV

  3. Validation of the use of an artificial mitochondrial reporter DNA vector containing a Cytomegalovirus promoter for mitochondrial transgene expression.

    Science.gov (United States)

    Yamada, Yuma; Ishikawa, Takuya; Harashima, Hideyoshi

    2017-08-01

    Mitochondria have their own gene expression system that is independent of the nuclear system, and control cellular functions in cooperation with the nucleus. While a number of useful technologies for achieving nuclear transgene expression have been reported, only a few have focused on mitochondria. In this study, we validated the utility of an artificial mitochondrial DNA vector with a virus promoter on mitochondrial transgene expression. We designed and constructed pCMV-mtLuc (CGG) that contains a CMV promotor derived from Cytomegalovirus and an artificial mitochondrial genome with a NanoLuc (Nluc) luciferase gene that records adjustments to the mitochondrial codon system. Nluc luciferase activity measurements showed that the pCMV-mtLuc (CGG) efficiently produced the Nluc luciferase protein in human HeLa cells. Moreover, we optimized the mitochondrial transfection of pCMV-mtLuc (CGG) using a MITO-Porter system, a liposome-based carrier for mitochondrial delivery via membrane fusion. As a result, we found that transfection of pCMV-mtLuc (CGG) by MITO-Porter modified with the KALA peptide (cationic amphipathic cell-penetrating peptide) showed a high mitochondrial transgene expression. The developed mitochondrial transgene expression system represents a potentially useful tool for the fields of nanoscience and nanotechnology for controlling the intracellular microenvironment via the regulation of mitochondrial function and promises to open additional innovative research fields of study. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Cloning of rat thymic stromal lymphopoietin receptor (TSLPR) and characterization of genomic structure of murine Tslpr gene

    DEFF Research Database (Denmark)

    Blagoev, Blagoy; Nielsen, Mogens M; Angrist, Misha

    2002-01-01

    IL-2 receptor common gamma chain (Il2rg). Use of an alternative splice acceptor site leads to two alternatively spliced transcript variants of murine TSLPR, both of which are functional receptors. Finally, using linkage analysis, we mapped the murine Tslpr gene to mouse chromosome 5 between the Ecm2...... expressed in rats suggesting that TSLPR may have roles in signaling outside the hematopoietic system. A zooblot analysis revealed that TSLPR is expressed in all vertebrate species examined. The absence of TSLPR in Saccharomyces cerevisiae, Drosophila melanogaster and Caenorhabditis elegans genomes...... is similar to the expression of several other cytokine receptors that have been characterized thus far. We have also characterized the genomic structure of the murine Tslpr gene which shows that in addition to primary sequence homology, it shares a common genomic organization of coding exons with the murine...

  5. Structure of the murine Thy-1 gene

    NARCIS (Netherlands)

    V. Giguere; K-I. Isobe; F.G. Grosveld (Frank)

    1985-01-01

    textabstractWe have cloned the murine Thy-1.1 (AKR) and Thy-1.2 (Balb/c) genes. The complete exon/intron structure and the nucleotide sequence of the Thy-1.2 gene was determined. The gene contains four exons and three intervening sequences. The complete transcriptional unit gives rise to a tissue

  6. Reemergence of Murine Typhus in the US

    Centers for Disease Control (CDC) Podcasts

    2015-04-21

    Dr. Lucas Blanton discusses the Reemergence of Murine Typhus in Galveston Texas in 2013.  Created: 4/21/2015 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 4/27/2015.

  7. Aerobic bacteria, Chlamydia trachomatis, Pneumocystis carinii and Cytomegalovirus as agents of severe peneumonia in small infants Bactérias aeróbias, Chlamydia trachomatis, Pneumocystis carinii e Cytomegalovirus: agentes causadores de pneumonia grave em pequenos lactentes

    Directory of Open Access Journals (Sweden)

    Bernardo Ejzenberg

    1996-02-01

    Full Text Available The authors studied 58 infants hospitalized for pneumonia in a semi-intensive care unit. Age ranged from 1 complete to 6 incomplete months. The infants were sent from another hospital in 20 cases and from home in a further 38. Pulmonary involvement, which was alveolar in 46 cases and interstitial in 12, was bilateral in 31 children. The investigation was carried out prospectively on the etiological agents associated with respiratory infection to look for evidence of aerobic bacteria (blood cultures, Chlamydia trachomatis and Cytomegalovirus (serology, and Pneumocystis carinii (direct microscopy of tracheal aspirated material. The following infectious agents were diagnosed in 21 children (36.2%: Aerobic bacteria (8, Chlamydia trachomatis (5, Pneumocystis carinii (3, Cytomegalovirus (3, Cytomegalovirus and Chlamydia trachomatis (1, Aerobic bacteria and Cytomegalovirus (1. Seven cases of infection by Chlamydia trachomatis and/or Cytomegalovirus were diagnosed out of the 12 cases with pulmonary interstitial involvement.Os autores estudaram prospectivamente 58 lactentes internados por pneumonia em unidade semi-intensiva. A idade foi limitada entre 1 mês completo e 6 meses incompletos. A procedência das crianças foi de outro hospital em 20 casos e domiciliar em 38. O acometimento pulmonar era alveolar em 46 casos, intersticial em 12 e bilateral em 31 crianças. Foram pesquisados agentes etiológicos associados à infecção respiratória dos lactentes jovens: Bactérias aeróbias (Hemoculturas, Chlamydia trachomatis e Cytomegalovirus (sorologia, e Pneumocystis carinii (microscopia direta do aspirado traqueal. Foram diagnosticadas infecções em 21 crianças (36,2%: Bactérias aeróbias (8, Chlamydia trachomatis (5, Cytomegalovirus (3, Pneumocystis carinii (3, Cytomegalovirus e Chlamydia trachomatis (1, Bactéria aeróbia e Cytomegalovirus (1. Foram diagnosticadas 7 infecções por Chlamydia trachomatis e/ou Cytomegalovirus entre as 12 crianças com

  8. [Evaluation of Fusarium spp. pathogenicity in plant and murine models].

    Science.gov (United States)

    Forero-Reyes, Consuelo M; Alvarado-Fernández, Angela M; Ceballos-Rojas, Ana M; González-Carmona, Lady C; Linares-Linares, Melva Y; Castañeda-Salazar, Rubiela; Pulido-Villamarín, Adriana; Góngora-Medina, Manuel E; Cortés-Vecino, Jesús A; Rodríguez-Bocanegra, María X

    The genus Fusarium is widely recognized for its phytopathogenic capacity. However, it has been reported as an opportunistic pathogen in immunocompetent and immunocompromised patients. Thus, it can be considered a microorganism of interest in pathogenicity studies on different hosts. Therefore, this work evaluated the pathogenicity of Fusarium spp. isolates from different origins in plants and animals (murine hosts). Twelve isolates of Fusarium spp. from plants, animal superficial mycoses, and human superficial and systemic mycoses were inoculated in tomato, passion fruit and carnation plants, and in immunocompetent and immunosuppressed BALB/c mice. Pathogenicity tests in plants did not show all the symptoms associated with vascular wilt in the three plant models; however, colonization and necrosis of the vascular bundles, regardless of the species and origin of the isolates, showed the infective potential of Fusarium spp. in different plant species. Moreover, the pathogenicity tests in the murine model revealed behavioral changes. It was noteworthy that only five isolates (different origin and species) caused mortality. Additionally, it was observed that all isolates infected and colonized different organs, regardless of the species and origin of the isolates or host immune status. In contrast, the superficial inoculation test showed no evidence of epidermal injury or colonization. The observed results in plant and murine models suggest the pathogenic potential of Fusarium spp. isolates in different types of hosts. However, further studies on pathogenicity are needed to confirm the multihost capacity of this genus. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  9. Biological markers as predictors of radiosensitivity in syngeneic murine tumors

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Sei Kyung; Shin, Hyun Soo [Bundang CHA General Hospital, Seongnam (Korea, Republic of); Seong, Jin Sil; Kim, Sung Hee [Yonsei Cancer Center, Yonsei University College of Medicine, Seoul (Korea, Republic of)

    2006-06-15

    We investigated whether a relationship exists between tumor control dose 50 (TCD{sub 50}) or tumor growth delay (TGD) and radiation induced apoptosis (RIA) in syngeneic murine tumors. Also we investigated the biological markers that can predict radiosensitivity in murine tumor system through analysis of relationship between TCD{sub 50}, TGD, RIA and constitutive expression levels of the genetic products regulating RIA. Syngeneic murine tumors such as ovarian adenocarcinoma, mammary carcinoma, squamous cell carcinoma, fibrosarcoma, hepatocarcinoma were used in this study. C3H/HeJ mice were bred and maintained in our specific pathogen free mouse colony and were 8 {approx} 12 weeks old when used for the experiments. The tumors, growing in the right hind legs of mice, were analyzed for TCD{sub 50}, TGD, and RIA at 8 mm in diameter. The tumors were also analyzed for the constitutive expression levels of p53, p21{sup WAF1/CIP1}, BAX, Bcl-2, Bcl-x{sub L}, Bcl-x{sub S}, and p34. Correlation analysis was performed whether the level of RIA were correlated with TCD{sub 50} or TGD, and the constitutive expression levels of genetic products regulating RIA were correlated with TCD{sub 50}, TGD, RIA. The level of RIA showed a significant positive correlation (R = 0.922, {rho} = 0.026) with TGD, and showed a trend to correlation (R = -0.848), marginally significant correlation with TCD{sub 50} ({rho} = 0.070). It indicates that tumors that respond to radiation with high percentage of apoptosis were more radiosensitive. The constitutive expression levels of p21{sup WAF1/CIP1} and p34 showed a significant correlation either with TCD{sub 50} (R = 0.893, {rho} = 0.041 and R = 0.904, {rho} = 0.035) or with TGD (R = -0.922, {rho} 0.026 and R = -0.890, {rho} = 0.043). The tumors with high constitutive expression levels of p21{sup WAF1/CIP1} or p34 were less radiosensitive than those with low expression. Radiosensitivity may be predicted with the level of RIA in murine tumors. The

  10. Biological markers as predictors of radiosensitivity in syngeneic murine tumors

    International Nuclear Information System (INIS)

    Chang, Sei Kyung; Shin, Hyun Soo; Seong, Jin Sil; Kim, Sung Hee

    2006-01-01

    We investigated whether a relationship exists between tumor control dose 50 (TCD 50 ) or tumor growth delay (TGD) and radiation induced apoptosis (RIA) in syngeneic murine tumors. Also we investigated the biological markers that can predict radiosensitivity in murine tumor system through analysis of relationship between TCD 50 , TGD, RIA and constitutive expression levels of the genetic products regulating RIA. Syngeneic murine tumors such as ovarian adenocarcinoma, mammary carcinoma, squamous cell carcinoma, fibrosarcoma, hepatocarcinoma were used in this study. C3H/HeJ mice were bred and maintained in our specific pathogen free mouse colony and were 8 ∼ 12 weeks old when used for the experiments. The tumors, growing in the right hind legs of mice, were analyzed for TCD 50 , TGD, and RIA at 8 mm in diameter. The tumors were also analyzed for the constitutive expression levels of p53, p21 WAF1/CIP1 , BAX, Bcl-2, Bcl-x L , Bcl-x S , and p34. Correlation analysis was performed whether the level of RIA were correlated with TCD 50 or TGD, and the constitutive expression levels of genetic products regulating RIA were correlated with TCD 50 , TGD, RIA. The level of RIA showed a significant positive correlation (R = 0.922, ρ = 0.026) with TGD, and showed a trend to correlation (R = -0.848), marginally significant correlation with TCD 50 (ρ = 0.070). It indicates that tumors that respond to radiation with high percentage of apoptosis were more radiosensitive. The constitutive expression levels of p21 WAF1/CIP1 and p34 showed a significant correlation either with TCD 50 (R = 0.893, ρ = 0.041 and R = 0.904, ρ = 0.035) or with TGD (R = -0.922, ρ 0.026 and R = -0.890, ρ = 0.043). The tumors with high constitutive expression levels of p21 WAF1/CIP1 or p34 were less radiosensitive than those with low expression. Radiosensitivity may be predicted with the level of RIA in murine tumors. The constitutive expression levels of p21 WAF1/CIP1 or p34 can be used as biological

  11. Cytomegalovirus retinitis presenting as vasculitis in a patient with Wegener’s granulomatosis

    Directory of Open Access Journals (Sweden)

    Paris G Tranos

    2008-08-01

    Full Text Available Paris G Tranos1, Ilias Georgalas2, Panagiota Founti1, Ioannis Ladas21Papageorgiou University Hospital, Thessaloniki, Greece; 2Department of Ophthalmology, “G.Genimatas” Hospital, Athens, GreecePurpose: To present an unusual case of cytomegalovirus (CMV retinitis in a patient with Wegener’s granulomatosis.Results: A 54-year-old lady with Wegener’s granulomatosis presented with decreased vision in her left eye. Wegener’s retinal vasculitis was diagnosed initially and the patient received treatment with oral steroids. Three days later the patient developed typical CMV retinitis.Conclusion: The likelihood of CMV retinitis in patients with Wegener’s granulomatosis should not be overlooked. Increased awareness in such cases is very important since CMV retinitis may present with less typical manifestations, which makes the correct diagnosis more challenging.Keywords: cytomegalovirus retinitis, Wegener’s granulomatosis, ganciclovir

  12. Review of cytomegalovirus coinfection in HIV-infected individuals in Africa

    DEFF Research Database (Denmark)

    Grønborg, Helene Ladefoged; Jespersen, Sanne; Hønge, Bo Langhoff

    2016-01-01

    on HIV and CMV coinfection in Africa. Methods: Systematic review of published studies on HIV and CMV coinfection in Africa using the PubMed database. Results: High CMV seroprevalence was found throughout Africa, exceeding 90% in most populations. Retinitis, pneumonia, and colitis were the most commonly...... was found to be associated with increased transmission and progression of HIV infection. Moreover, detectable CMV DNA was an independent predictor of HIV transmission and mortality among HIV‐infected individuals. Conclusions: Cytomegalovirus is highly prevalent in Africa and a common cause of disease...... manifestations in HIV‐infected individuals among all age groups. Cytomegalovirus coinfection in HIV‐infected individuals in Africa is associated with increased transmission and mortality of HIV, but it is a neglected area of research....

  13. Cytomegalovirus implicated in a case of progressive outer retinal necrosis (PORN).

    Science.gov (United States)

    Sfeir, Maroun

    2015-08-01

    Progressive outer retinal necrosis, also known as PORN, has been described as a variant of necrotizing herpetic retinopathy, occurring particularly in patients with acquired immune deficiency syndrome (AIDS). Although the etiologic organism has been reported to be Varicella-zoster virus, cytomegalovirus (CMV) can be an etiologic agent. Our case illustrates the occurrence of two opportunistic infections: PORN associated with CMV and Mycobacterium avium intracellulare duodenitis in a patient with uncontrolled HIV infection. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Use of In vivo Imaging to Monitor the Progression of Experimental Mouse Cytomegalovirus Infection in Neonates

    OpenAIRE

    Ostermann, Eleonore; Macquin, Cécile; Bahram, Seiamak; Georgel, Philippe

    2013-01-01

    Human Cytomegalovirus (HCMV or HHV-5) is a life-threatening pathogen in immune-compromised individuals. Upon congenital or neonatal infection, the virus can infect and replicate in the developing brain, which may induce severe neurological damage, including deafness and mental retardation. Despite the potential severity of the symptoms, the therapeutic options are limited by the unavailability of a vaccine and the absence of a specific antiviral therapy. Furthermore, a precise description of ...

  15. Transient Antiphospholipid Syndrome Associated with Primary Cytomegalovirus Infection: A Case Report and Literature Review

    Directory of Open Access Journals (Sweden)

    Tsuyoshi Nakayama

    2014-01-01

    Full Text Available Viral infection is known to induce transient autoimmunity in humans. Acute cytomegalovirus (CMV infection is implicated in occasional thrombosis formation. We here, for the first time, report a 19-year-old female who had an acute CMV infection, leading to a deep venous thrombosis and a pulmonary embolism along with transient appearance of lupus anticoagulant. The pathological role of antiphospholipid antibodies in CMV-mediated thrombosis is discussed.

  16. Cytomegalovirus Infection Drives Adaptive Epigenetic Diversification of NK Cells with Altered Signaling and Effector Function

    OpenAIRE

    Schlums, Heinrich; Cichocki, Frank; Tesi, Bianca; Theorell, Jakob; Beziat, Vivien; Holmes, Tim D.; Han, Hongya; Chiang, Samuel C.C.; Foley, Bree; Mattsson, Kristin; Larsson, Stella; Schaffer, Marie; Malmberg, Karl-Johan; Ljunggren, Hans-Gustaf; Miller, Jeffrey S.

    2015-01-01

    The mechanisms underlying human natural killer (NK) cell phenotypic and functional heterogeneity are unknown. Here, we describe the emergence of diverse subsets of human NK cells selectively lacking expression of signaling proteins after human cytomegalovirus (HCMV) infection. The absence of B and myeloid cell-related signaling protein expression in these NK cell subsets correlated with promoter DNA hyperme-thylation. Genome-wide DNA methylation patterns were strikingly similar between HCMV-a...

  17. Complete Genome Sequence of Rat Cytomegalovirus Strain ALL-03 (Malaysian Strain)

    Science.gov (United States)

    Abdullah, Ashwaq Ahmed; Camalxaman, Siti Nazrina; Quah, Yi Wan; Abba, Yusuf; Hani, Homayoun; Loh, Hwei San; Kamal, Farina Mustaffa; Zeenathul, Nazariah Allaudin; Aini, Ideris; Omar, A. R.; Noordin, Mohamed Mustapha; Mohd Azmi, Mohd Lila

    2015-01-01

    The complete genome sequence of the ALL-03 strain of rat cytomegalovirus (RCMV) has been determined. The RCMV genome has a length of 197,958 bp and is arranged as a single unique sequence flanked by 504-bp terminal direct repeats. This strain is closely related to the English strain of RCMV in terms of genetic arrangement but differs slightly in size. PMID:26044413

  18. Infantile Cytomegalovirus-Associated Severe Warm Autoimmune Hemolytic Anemia: A Case Report

    OpenAIRE

    Khalifeh, Hassan K.; Mourad, Youmna M.; Chamoun, Cynthia T.

    2017-01-01

    Autoimmune hemolytic anemia is a rare hematologic entity in children. Etiologies are mainly viruses or bacteria. We describe here a case of severe warm autoimmune hemolytic anemia (IgG- and C3d-positive direct antiglobulin test) in an immunocompetent 6-month-old infant with acute Cytomegalovirus infection that responded well to corticotherapy and intraveneous immunoglobulins without using blood component transfusion. This case demonstrates the importance of recognizing CMV in infantile Autoim...

  19. Diagnosis of cytomegalovirus infections by qualitative and quantitative PCR in HIV infected patients

    OpenAIRE

    CUNHA, Aldo de Albuquerque; MARIN, Lauro Juliano; AQUINO, Victor Hugo; FIGUEIREDO, Luiz Tadeu Moraes

    2002-01-01

    A high incidence of cytomegalovirus (CMV) infections is observed in Brazil. These viruses are causatives of significant morbidity and mortality among patients with advanced human immunodeficiency virus (HIV) infection. This work, shows the application of a PCR on determination of CMV load in the buffy coat and plasma. We analyzed the samples of 247 HIV infected patients in order to diagnose CMV infection and disease. We developed a semi-quantitative PCR that amplifies part of the glycoprotein...

  20. Neuropathogenesis of Congenital Cytomegalovirus Infection: Disease Mechanisms and Prospects for Intervention

    OpenAIRE

    Cheeran, Maxim C.-J.; Lokensgard, James R.; Schleiss, Mark R.

    2009-01-01

    Congenital cytomegalovirus (CMV) infection is the leading infectious cause of mental retardation and hearing loss in the developed world. In recent years, there has been an improved understanding of the epidemiology, pathogenesis, and long-term disabilities associated with CMV infection. In this review, current concepts regarding the pathogenesis of neurological injury caused by CMV infections acquired by the developing fetus are summarized. The pathogenesis of CMV-induced disabilities is con...

  1. Congenital cytomegalovirus infection: disease burden and screening tools : towards newborn screening

    OpenAIRE

    Vries, Jutte Jacoba Catharina de

    2012-01-01

    Cytomegalovirus (CMV) infection is the most common congenital viral infection worldwide. The symptom of congenital CMV infection encountered most frequently is sensorineural hearing loss, which will affect approximately one out of five congenitally infected newborns. Because of the late-onset nature of the hearing loss, up to half of the children with congenital CMV-related hearing loss may not be detected in the newborn hearing screening. This thesis addresses several aspects of congenital CM...

  2. Immunobiology of herpes simplex virus and cytomegalovirus infections of the fetus and newborn

    OpenAIRE

    Muller, William J.; Jones, Cheryl A.; Koelle, David M.

    2010-01-01

    Immunologic “immaturity” is often blamed for the increased susceptibility of newborn humans to infection, but the precise mechanisms and details of immunologic development remain somewhat obscure. Herpes simplex virus (HSV) and cytomegalovirus (CMV) are two of the more common severe infectious agents of the fetal and newborn periods. HSV infection in the newborn most commonly occurs after exposure to the virus during delivery, and can lead to a spectrum of clinical disease ranging from isolat...

  3. [Clinical aspects of children presenting specific IgM antibodies to cytomegalovirus by immunofluorescent test].

    Science.gov (United States)

    Yamamoto, A Y; Gonçalves, A L; Figueiredo, L T; Carlucci, R H

    1994-01-01

    Clinical data observed in 25 children presenting IgM specific antibodies to cytomegalovirus (CMV) by immunofluorescent test are reported. The children were grouped by the presented clinical picture in: neonatal hepatitis, mononucleosis syndrome,pneumonitis, neurologic disease, ocular abnormalities, and thrombocytopenic purpure. Clinical aspects of CMV infection were analyzed and compared with data reported in the literature. CMV infections can involve multiple organs and this viral disease must to be considered on differential diagnosis of many infectious diseases.

  4. Enhanced reactivation of ultraviolet-irradiated human cytomegalovirus in normal host cells

    International Nuclear Information System (INIS)

    Dion, M.; Hamelin, C.

    1987-01-01

    Enhanced survival of UV-irradiated human cytomegalovirus (HCMV) is demonstrated in normal human cells exposed to UV light prior to infection. The UV fluence that gave rise to maximum UV reactivation falls in the range of 15 J/m 2 . A large number of temperature-sensitive HCMV mutants were found under the peak of reactivation. These results confirm the existence of inducible SOS functions in human cells. 18 refs.; 2 figs.; 1 table

  5. Isolation and partial chemical characterization of a 64,000-dalton glycoprotein of human cytomegalovirus

    International Nuclear Information System (INIS)

    Clark, B.R.; Zaia, J.A.; Balce-Directo, L.; Ting, Y.P.

    1984-01-01

    A guanidinium chloride extract of [ 3 H]glucosamine- and [ 35 S]methionine-labeled virions plus dense bodies of human cytomegalovirus (Towne) was separated by reverse-phase high-pressure liquid chromatography. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of the eluate revealed the major peak to be a glycoprotein with a relative mass of 64,000. This glycoprotein (HCMVgp64) was characterized by amino acid analysis and a high-pressure liquid chromatographic map of its tryptic peptides

  6. Modulation of the Host Environment by Human Cytomegalovirus with Viral Interleukin 10 in Peripheral Blood

    Science.gov (United States)

    Young, Vivian P.; Mariano, Margarette C.; Tu, Carolyn C.; Allaire, Kathryn M.; Avdic, Selmir; Slobedman, Barry

    2017-01-01

    Abstract Background. Human cytomegalovirus (HCMV) is a herpesvirus with both lytic and latent life cycles. Human cytomegalovirus encodes 2 viral cytokines that are orthologs of human cellular interleukin 10 (cIL-10). Both cytomegalovirus interleukin 10 (cmvIL-10) and Latency-associated cytomegalovirus interleukin 10 (LAcmvIL-10) (collectively vIL-10) are expressed during lytic infection and cause immunosuppressive effects that impede virus clearance. LAcmvIL-10 is also expressed during latent infection of myeloid progenitor cells and monocytes and facilitates persistence. Here, we investigated whether vIL-10 could be detected during natural infection. Methods. Plasma from healthy blood donors was tested by enzyme-linked immunosorbent assay for anti-HCMV immunoglobulin G and immunoglobulin M and for cIL-10 and vIL-10 levels using a novel vIL-10 assay that detects cmvIL-10 and LAcmvIL-10, with no cross-reactivity to cIL-10. Results. vIL-10 was evident in HCMV+ donors (n = 19 of 26), at levels ranging 31–547 pg/mL. By comparison, cIL-10 was detected at lower levels ranging 3–69 pg/mL. There was a strong correlation between vIL-10 and cIL-10 levels (P = .01). Antibodies against vIL-10 were also detected and neutralized vIL-10 activity. Conclusions. vIL-10 was detected in peripheral blood of healthy blood donors. These findings suggest that vIL-10 may play a key role in sensing or modifying the host environment during latency and, therefore, may be a potential target for intervention strategies. PMID:28453840

  7. Seroepidemiology of Rubella, Cytomegalovirus, Herpes simplex & Varicella zoster virus in college women of Bushehr.

    Directory of Open Access Journals (Sweden)

    Afshin Barazesh

    2014-01-01

    Full Text Available Abstract Background: Acute viral infections such as cytomegalovirus, Rubella, Herpes simplex and varicella zoster virus in pregnant women can cause congenital infection with increased risk of developing congenital anomalies and morbidity. We aimed to identify young women susceptible to these viral infections in Bushehr. Materials and Methods: In 2009, 180 female were randomly selected from high schools and college students who were been assisted in marriage consulting clinics. In this cross sectional study, IgG antibodies against varicella zoster virus (VZV, Herpes simplex virus I,II (HSV I,II , Rubella & cytomegalovirus (CMV were determined by indirect enzyme immunoassay (ELISA technique. Results: Mean age of the participants was 18.72 years old. %99.4 and %95 of sera were positive for cytomegalovirus & Rubella respectively and also Antibodies against VZV & HSV were detected in %74.5 & %69.4 of samples. There were no significant correlation between antibody seropositivity and education level, living places (rural or urban and occupation. (P<0/05. Conclusion: Although, The findings of this study indicated that high prevalence rate of VZV &HSV 1,2 in child bearing age women, but 1/3 -1/4 of them, are still susceptible to these infections, so routine screening of these viruses is suggested in antenatal care.

  8. Cytomegalovirus shapes long-term immune reconstitution after allogeneic stem cell transplantation

    Science.gov (United States)

    Itzykson, Raphael; Robin, Marie; Moins-Teisserenc, Helene; Delord, Marc; Busson, Marc; Xhaard, Aliénor; de Fontebrune, Flore Sicre; de Latour, Régis Peffault; Toubert, Antoine; Socié, Gérard

    2015-01-01

    Immune reconstitution after allogeneic stem cell transplantation is a dynamic and complex process depending on the recipient and donor characteristics, on the modalities of transplantation, and on the occurrence of graft-versus-host disease. Multivariate methods widely used for gene expression profiling can simultaneously analyze the patterns of a great number of biological variables on a heterogeneous set of patients. Here we use these methods on flow cytometry assessment of up to 25 lymphocyte populations to analyze the global pattern of long-term immune reconstitution after transplantation. Immune patterns were most distinct from healthy controls at six months, and had not yet fully recovered as long as two years after transplant. The two principal determinants of variability were linked to the balance of B and CD8+ T cells and of natural killer and B cells, respectively. Recipient’s cytomegalovirus serostatus, cytomegalovirus replication, and chronic graft-versus-host disease were the main factors shaping the immune pattern one year after transplant. We identified a complex signature of under- and over-representation of immune populations dictated by recipient’s cytomegalovirus seropositivity. Finally, we identified dimensions of variance in immune patterns as significant predictors of long-term non-relapse mortality, independently of chronic graft-versus-host disease. PMID:25261095

  9. A macrophage inflammatory protein homolog encoded by guinea pig cytomegalovirus signals via CC chemokine receptor 1

    International Nuclear Information System (INIS)

    Penfold, Mark; Miao Zhenhua; Wang Yu; Haggerty, Shannon; Schleiss, Mark R.

    2003-01-01

    Cytomegaloviruses encode homologs of cellular immune effector proteins, including chemokines (CKs) and CK receptor-like G protein-coupled receptors (GPCRs). Sequence of the guinea pig cytomegalovirus (GPCMV) genome identified an open reading frame (ORF) which predicted a 101 amino acid (aa) protein with homology to the macrophage inflammatory protein (MIP) subfamily of CC (β) CKs, designated GPCMV-MIP. To assess functionality of this CK, recombinant GPCMV-MIP was expressed in HEK293 cells and assayed for its ability to bind to and functionally interact with a variety of GPCRs. Specific signaling was observed with the hCCR1 receptor, which could be blocked with hMIP -1α in competition experiments. Migration assays revealed that GPCMV-MIP was able to induce chemotaxis in hCCR1-L1.2 cells. Antisera raised against a GST-MIP fusion protein immunoprecipitated species of ∼12 and 10 kDa from GPCMV-inoculated tissue culture lysates, and convalescent antiserum from GPCMV-infected animals was immunoreactive with GST-MIP by ELISA assay. These results represent the first substantive in vitro characterization of a functional CC CK encoded by a cytomegalovirus

  10. Saturated very long chain fatty acids are required for the production of infectious human cytomegalovirus progeny.

    Directory of Open Access Journals (Sweden)

    Emre Koyuncu

    Full Text Available Human cytomegalovirus hijacks host cell metabolism, increasing the flux of carbon from glucose to malonyl-CoA, the committed precursor to fatty acid synthesis and elongation. Inhibition of acetyl-CoA carboxylase blocks the production of progeny virus. To probe further the role of fatty acid metabolism during infection, we performed an siRNA screen to identify host cell metabolic enzymes needed for the production of infectious cytomegalovirus progeny. The screen predicted that multiple long chain acyl-CoA synthetases and fatty acid elongases are needed during infection, and the levels of RNAs encoding several of these enzymes were upregulated by the virus. Roles for acyl-CoA synthetases and elongases during infection were confirmed by using small molecule antagonists. Consistent with a role for these enzymes, mass spectrometry-based fatty acid analysis with ¹³C-labeling revealed that malonyl-CoA is consumed by elongases to produce very long chain fatty acids, generating an approximately 8-fold increase in C26-C34 fatty acid tails in infected cells. The virion envelope was yet further enriched in C26-C34 saturated fatty acids, and elongase inhibitors caused the production of virions with lower levels of these fatty acids and markedly reduced infectivity. These results reveal a dependence of cytomegalovirus on very long chain fatty acid metabolism.

  11. Recovery from a possible cytomegalovirus meningoencephalitis-induced apparent brain stem death in an immunocompetent man: a case report.

    Science.gov (United States)

    Rahardjo, Theresia Monica; Maskoen, Tinni Trihartini; Redjeki, Ike Sri

    2016-08-26

    Recovery from cytomegalovirus meningoencephalitis with brain stem death in an immunocompetent patient is almost impossible. We present a remarkable recovery from a possible cytomegalovirus infection in an immunocompetent man who had severe neurological syndromes, suggesting brain stem death complicated by pneumonia and pleural effusion. A 19-year-old Asian man presented at our hospital's emergency department with reduced consciousness and seizures following high fever, headache, confusion, and vomitus within a week before arrival. He was intubated and sent to our intensive care unit. He had nuchal rigidity and tetraparesis with accentuated tendon reflexes. Electroencephalography findings suggested an acute structural lesion at his right temporal area or an epileptic state. A cerebral spinal fluid examination suggested viral infection. A computed tomography scan was normal at the early stage of disease. Immunoglobulin M, immunoglobulin G anti-herpes simplex virus, and immunoglobulin M anti-cytomegalovirus were negative. However, immunoglobulin G anti-cytomegalovirus was positive, which supported a diagnosis of cytomegalovirus meningoencephalitis. His clinical condition deteriorated, spontaneous respiration disappeared, cranial reflexes became negative, and brain stem death was suspected. Therapy included antivirals, corticosteroids, antibiotics, anticonvulsant, antipyretics, antifungal agents, and a vasopressor to maintain hemodynamic stability. After 1 month, he showed a vague response to painful stimuli at his supraorbital nerve and respiration started to appear the following week. After pneumonia and pleural effusion were resolved, he was weaned from the ventilator and moved from the intensive care unit on day 90. This case highlights several important issues that should be considered. First, the diagnosis of brain stem death must be confirmed with caution even if there are negative results of brain stem death test for a long period. Second, cytomegalovirus

  12. Forced recombination of psi-modified murine leukaemia virus-based vectors with murine leukaemia-like and VL30 murine endogenous retroviruses

    DEFF Research Database (Denmark)

    Mikkelsen, J G; Lund, Anders Henrik; Duch, M

    1999-01-01

    -impaired Akv-MLV-derived vectors, we here examine putative genetic interactions between vector RNAs and copackaged endogenous retroviral RNAs of the murine leukaemia virus (MLV) and VL30 retroelement families. We show (i) that MLV recombination is not blocked by nonhomology within the 5' untranslated region....... We note that recombination-based rescue of primer binding site knock-out retroviral vectors may constitute a sensitive assay to register putative genetic interactions involving endogenous retroviral RNAs present in cells of various species.......Co-encapsidation of retroviral RNAs into virus particles allows for the generation of recombinant proviruses through events of template switching during reverse transcription. By use of a forced recombination system based on recombinational rescue of replication- defective primer binding site...

  13. Scanning electron microscopy of the neuropathology of murine cerebral malaria

    Directory of Open Access Journals (Sweden)

    Brenneis Christian

    2006-11-01

    Full Text Available Abstract Background The mechanisms leading to death and functional impairments due to cerebral malaria (CM are yet not fully understood. Most of the knowledge about the pathomechanisms of CM originates from studies in animal models. Though extensive histopathological studies of the murine brain during CM are existing, alterations have not been visualized by scanning electron microscopy (SEM so far. The present study investigates the neuropathological features of murine CM by applying SEM. Methods C57BL/6J mice were infected with Plasmodium berghei ANKA blood stages. When typical symptoms of CM developed perfused brains were processed for SEM or light microscopy, respectively. Results Ultrastructural hallmarks were disruption of vessel walls, parenchymal haemorrhage, leukocyte sequestration to the endothelium, and diapedesis of macrophages and lymphocytes into the Virchow-Robin space. Villous appearance of observed lymphocytes were indicative of activated state. Cerebral oedema was evidenced by enlargement of perivascular spaces. Conclusion The results of the present study corroborate the current understanding of CM pathophysiology, further support the prominent role of the local immune system in the neuropathology of CM and might expose new perspectives for further interventional studies.

  14. Myeloid Dendritic Cells Repress Human Cytomegalovirus Gene Expression and Spread by Releasing Interferon-Unrelated Soluble Antiviral Factors.

    Science.gov (United States)

    Kasmapour, Bahram; Kubsch, Tobias; Rand, Ulfert; Eiz-Vesper, Britta; Messerle, Martin; Vondran, Florian W R; Wiegmann, Bettina; Haverich, Axel; Cicin-Sain, Luka

    2018-01-01

    Cytomegalovirus (CMV) is a betaherpesvirus that latently infects most adult humans worldwide and is a major cause of morbidity and mortality in immunocompromised hosts. Latent human CMV (HCMV) is believed to reside in precursors of myeloid-lineage leukocytes and monocytes, which give rise to macrophages and dendritic cells (DC). We report here that human monocyte-derived DC (mo-DC) suppress HCMV infection in coculture with infected fibroblast target cells in a manner dependent on the effector-to-target ratio. Intriguingly, optimal activation of mo-DC was achieved under coculture conditions and not by direct infection with HCMV, implying that mo-DC may recognize unique molecular patterns on, or within, infected fibroblasts. We show that HCMV is controlled by secreted factors that act by priming defenses in target cells rather than by direct viral neutralization, but we excluded a role for interferons (IFNs) in this control. The expression of lytic viral genes in infected cells and the progression of infection were significantly slowed, but this effect was reversible, indicating that the control of infection depended on the transient induction of antiviral effector molecules in target cells. Using immediate early or late-phase reporter HCMVs, we show that soluble factors secreted in the cocultures suppress HCMV replication at both stages of the infection and that their antiviral effects are robust and comparable in numerous batches of mo-DC as well as in primary fibroblasts and stromal cells. IMPORTANCE Human cytomegalovirus is a widespread opportunistic pathogen that can cause severe disease and complications in vulnerable individuals. This includes newborn children, HIV AIDS patients, and transplant recipients. Although the majority of healthy humans carry this virus throughout their lives without symptoms, it is not exactly clear which tissues in the body are the main reservoirs of latent virus infection or how the delicate balance between the virus and the immune

  15. The structure of cytomegalovirus immune modulator UL141 highlights structural Ig-fold versatility for receptor binding

    International Nuclear Information System (INIS)

    Nemčovičová, Ivana; Zajonc, Dirk M.

    2014-01-01

    The crystal structure of Human cytomegalovirus immune modulator UL141 was solved at 3.25 Å resolution. Here, a detailed analysis of its intimate dimerization interface and the biophysical properties of its receptor (TRAIL-R2 and CD155) binding interactions are presented. Natural killer (NK) cells are critical components of the innate immune system as they rapidly detect and destroy infected cells. To avoid immune recognition and to allow long-term persistence in the host, Human cytomegalovirus (HCMV) has evolved a number of genes to evade or inhibit immune effector pathways. In particular, UL141 can inhibit cell-surface expression of both the NK cell-activating ligand CD155 as well as the TRAIL death receptors (TRAIL-R1 and TRAIL-R2). The crystal structure of unliganded HCMV UL141 refined to 3.25 Å resolution allowed analysis of its head-to-tail dimerization interface. A ‘dimerization-deficient’ mutant of UL141 (ddUL141) was further designed, which retained the ability to bind to TRAIL-R2 or CD155 while losing the ability to cross-link two receptor monomers. Structural comparison of unliganded UL141 with UL141 bound to TRAIL-R2 further identified a mobile loop that makes intimate contacts with TRAIL-R2 upon receptor engagement. Superposition of the Ig-like domain of UL141 on the CD155 ligand T-cell immunoreceptor with Ig and ITIM domains (TIGIT) revealed that UL141 can potentially engage CD155 similar to TIGIT by using the C′C′′ and GF loops. Further mutations in the TIGIT binding site of CD155 (Q63R and F128R) abrogated UL141 binding, suggesting that the Ig-like domain of UL141 is a viral mimic of TIGIT, as it targets the same binding site on CD155 using similar ‘lock-and-key’ interactions. Sequence alignment of the UL141 gene and its orthologues also showed conservation in this highly hydrophobic (L/A)X 6 G ‘lock’ motif for CD155 binding as well as conservation of the TRAIL-R2 binding patches, suggesting that these host–receptor interactions

  16. The structure of cytomegalovirus immune modulator UL141 highlights structural Ig-fold versatility for receptor binding

    Energy Technology Data Exchange (ETDEWEB)

    Nemčovičová, Ivana [La Jolla Institute for Allergy and Immunology, 9420 Athena Circle, La Jolla, CA 92037 (United States); Slovak Academy of Sciences, Dúbravská cesta 9, SK 84505 Bratislava (Slovakia); Zajonc, Dirk M., E-mail: dzajonc@liai.org [La Jolla Institute for Allergy and Immunology, 9420 Athena Circle, La Jolla, CA 92037 (United States)

    2014-03-01

    The crystal structure of Human cytomegalovirus immune modulator UL141 was solved at 3.25 Å resolution. Here, a detailed analysis of its intimate dimerization interface and the biophysical properties of its receptor (TRAIL-R2 and CD155) binding interactions are presented. Natural killer (NK) cells are critical components of the innate immune system as they rapidly detect and destroy infected cells. To avoid immune recognition and to allow long-term persistence in the host, Human cytomegalovirus (HCMV) has evolved a number of genes to evade or inhibit immune effector pathways. In particular, UL141 can inhibit cell-surface expression of both the NK cell-activating ligand CD155 as well as the TRAIL death receptors (TRAIL-R1 and TRAIL-R2). The crystal structure of unliganded HCMV UL141 refined to 3.25 Å resolution allowed analysis of its head-to-tail dimerization interface. A ‘dimerization-deficient’ mutant of UL141 (ddUL141) was further designed, which retained the ability to bind to TRAIL-R2 or CD155 while losing the ability to cross-link two receptor monomers. Structural comparison of unliganded UL141 with UL141 bound to TRAIL-R2 further identified a mobile loop that makes intimate contacts with TRAIL-R2 upon receptor engagement. Superposition of the Ig-like domain of UL141 on the CD155 ligand T-cell immunoreceptor with Ig and ITIM domains (TIGIT) revealed that UL141 can potentially engage CD155 similar to TIGIT by using the C′C′′ and GF loops. Further mutations in the TIGIT binding site of CD155 (Q63R and F128R) abrogated UL141 binding, suggesting that the Ig-like domain of UL141 is a viral mimic of TIGIT, as it targets the same binding site on CD155 using similar ‘lock-and-key’ interactions. Sequence alignment of the UL141 gene and its orthologues also showed conservation in this highly hydrophobic (L/A)X{sub 6}G ‘lock’ motif for CD155 binding as well as conservation of the TRAIL-R2 binding patches, suggesting that these host

  17. Signaling pathways regulating murine pancreatic development

    DEFF Research Database (Denmark)

    Serup, Palle

    2012-01-01

    The recent decades have seen a huge expansion in our knowledge about pancreatic development. Numerous lineage-restricted transcription factor genes have been identified and much has been learned about their function. Similarly, numerous signaling pathways important for pancreas development have...... been identified and the specific roles have been investigated by genetic and cell biological methods. The present review presents an overview of the principal signaling pathways involved in regulating murine pancreatic growth, morphogenesis, and cell differentiation....

  18. Probable neuroimmunological link between Toxoplasma and cytomegalovirus infections and personality changes in the human host

    Directory of Open Access Journals (Sweden)

    Roubalová Kateřina

    2005-07-01

    Full Text Available Abstract Background Recently, a negative association between Toxoplasma-infection and novelty seeking was reported. The authors suggested that changes of personality trait were caused by manipulation activity of the parasite, aimed at increasing the probability of transmission of the parasite from an intermediate to a definitive host. They also suggested that low novelty seeking indicated an increased level of the neurotransmitter dopamine in the brain of infected subjects, a phenomenon already observed in experimentally infected rodents. However, the changes in personality can also be just a byproduct of any neurotropic infection. Moreover, the association between a personality trait and the toxoplasmosis can even be caused by an independent correlation of both the probability of Toxoplasma-infection and the personality trait with the third factor, namely with the size of living place of a subject. To test these two alternative hypotheses, we studied the influence of another neurotropic pathogen, the cytomegalovirus, on the personality of infected subjects, and reanalyzed the original data after the effect of the potential confounder, the size of living place, was controlled. Methods In the case-control study, 533 conscripts were tested for toxoplasmosis and presence of anti-cytomegalovirus antibodies and their novelty seeking was examined with Cloninger's TCI questionnaire. Possible association between the two infections and TCI dimensions was analyzed. Results The decrease of novelty seeking is associated also with cytomegalovirus infection. After the size of living place was controlled, the effect of toxoplasmosis on novelty seeking increased. Significant difference in novelty seeking was observed only in the largest city, Prague. Conclusion Toxoplasma and cytomegalovirus probably induce a decrease of novelty seeking. As the cytomegalovirus spreads in population by direct contact (not by predation as with Toxoplasma, the observed changes are

  19. Identification of common mechanisms by which human and mouse cytomegalovirus seven-transmembrane receptor homologues contribute to in vivo phenotypes in a mouse model

    DEFF Research Database (Denmark)

    Farrell, Helen E; Abraham, Alexander M; Cardin, Rhonda D

    2013-01-01

    The mouse cytomegalovirus chemokine receptor homologue (CKR) M33 is required for salivary gland tropism and efficient reactivation from latency, phenotypes partially rescued by the human cytomegalovirus CKR US28. Herein, we demonstrate that complementation of salivary gland tropism is mediated...

  20. The Effect of Human Immunodeficiency Virus and Cytomegalovirus Infection on Infant Responses to Vaccines: A Review

    Directory of Open Access Journals (Sweden)

    Olivia Falconer

    2018-03-01

    Full Text Available The success of prevention of mother to child transmission programs over the last two decades has led to an increasing number of infants who are exposed to human immunodeficiency virus (HIV, but who are not themselves infected (HIV-exposed, uninfected infants. Although the morbidity and mortality among HIV-exposed, uninfected infants is considerably lower than that among HIV-infected infants, they may remain at increased risk of infections in the first 2 years of life compared with their HIV-unexposed peers, especially in the absence of breastfeeding. There is some evidence of immunological differences in HIV-exposed, uninfected infants, which could play a role in susceptibility to infection. Cytomegalovirus (CMV may contribute to the increased immune activation observed in HIV-exposed, uninfected infants. Infants born to HIV-infected women are at increased risk of congenital CMV infection, as well as early acquisition of postnatal CMV infection. In infants with HIV infection, CMV co-infection in early life is associated with higher morbidity and mortality. This review considers how HIV infection, HIV exposure, and CMV infection affect infant responses to vaccination, and explores possible immunological and other explanations for these findings. HIV-infected infants have lower vaccine-induced antibody concentrations following tetanus, diphtheria, pertussis, hepatitis B, and pneumococcal vaccination, although the clinical relevance of this difference is not known. Despite lower concentrations of maternal-specific antibody at birth, HIV-exposed, uninfected infants respond to vaccination at least as well as their HIV-unexposed uninfected peers. CMV infection leads to an increase in activation and differentiation of the whole T-cell population, but there is limited data on the effects of CMV infection on infant vaccine responses. In light of growing evidence of poor clinical outcomes associated with CMV infection in HIV-exposed, uninfected infants