International Nuclear Information System (INIS)
Wu, K.K.; Sanduja, R.; Tsai, A.L.; Ferhanoglu, B.; Loose-Mitchell, D.S.
1991-01-01
Prostaglandin H (PGH) synthase is a key enzyme in the biosynthesis of prostaglandins, thromboxane, and prostacyclin. In cultured human umbilical vein endothelial cells, interleukin 1 (IL-1) is known to induce the synthesis of this enzyme, thereby raising the level of PGH synthase protein severalfold over the basal level. Pretreatment with aspirin at low concentrations inhibited more than 60% of the enzyme mass and also the cyclooxygenase activity in IL-1-induced cells with only minimal effects on the basal level of the synthase enzyme in cells without IL-1. Sodium salicylate exhibited a similar inhibitory action whereas indomethacin had no apparent effect. Similarly low levels of aspirin inhibited the increased L-[ 35 S]methionine incorporation into PGH synthase that was induced by IL0-1 and also suppressed expression of the 2.7-kilobase PGH synthase mRNA. These results suggest that in cultured endothelial cells a potent inhibition of eicosanoid biosynthetic capacity can be effected by aspirin or salicylate at the level of PGH synthase gene expression. The aspirin effect may well be due to degradation of salicylate
DEFF Research Database (Denmark)
Vestergaard, Martin; Nøhr-Meldgaard, Katrine; Bojer, Martin Saxtorph
2017-01-01
, linezolid, daptomycin, and oxacillin were unchanged. ATP synthase activity is known to be inhibited by oligomycin A, and the presence of this compound increased polymyxin B-mediated killing of S. aureus Our results demonstrate that the ATP synthase contributes to intrinsic resistance of S. aureus towards...
Prostaglandin E(2) synthase inhibition as a therapeutic target.
Iyer, Jitesh P; Srivastava, Punit K; Dev, Rishabh; Dastidar, Sunanda G; Ray, Abhijit
2009-07-01
Most NSAIDs function by inhibiting biosynthesis of PGE(2) by inhibition of COX-1 and/or COX-2. Since COX-1 has a protective function in the gastro-intestinal tract (GIT), non-selective inhibition of both cycloxy genases leads to moderate to severe gastro-intestinal intolerance. Attempts to identify selective inhibitors of COX-2, led to the identification of celecoxib and rofecoxib. However, long-term use of these drugs has serious adverse effects of sudden myocardial infarction and thrombosis. Drug-mediated imbalance in the levels of prostaglandin I(2) (PGI(2)) and thromboxane A(2) (TXA(2)) with a bias towards TXA(2) may be the primary reason for these events. This resulted in the drugs being withdrawn from the market, leaving a need for an effective and safe anti-inflammatory drug. Recently, the focus of research has shifted to enzymes downstream of COX in the prosta glandin biosynthetic pathway such as prostaglandin E(2) synthases. Microsomal prostaglandin E(2) synthase-1 (mPGES-1) specifically isomerizes PGH(2) to PGE(2), under inflammatory conditions. In this review, we examine the biology of mPGES-1 and its role in disease. Progress in designing molecules that can selectively inhibit mPGES-1 is reviewed. mPGES-1 has the potential to be a target for anti-inflammatory therapy, devoid of adverse GIT and cardiac effects and warrants further investigation.
Directory of Open Access Journals (Sweden)
Nevzat Selim Gokay
2016-01-01
Full Text Available The objective of this study was to investigate the effects of selective inducible nitric oxide synthase and neuronal nitric oxide synthase inhibitors on cartilage regeneration. The study involved 27 Wistar rats that were divided into five groups. On Day 1, both knees of 3 rats were resected and placed in a formalin solution as a control group. The remaining 24 rats were separated into 4 groups, and their right knees were surgically damaged. Depending on the groups, the rats were injected with intra-articular normal saline solution, neuronal nitric oxide synthase inhibitor 7-nitroindazole (50 mg/kg, inducible nitric oxide synthase inhibitor amino-guanidine (30 mg/kg, or nitric oxide precursor L-arginine (200 mg/kg. After 21 days, the right and left knees of the rats were resected and placed in formalin solution. The samples were histopathologically examined by a blinded evaluator and scored on 8 parameters. Although selective neuronal nitric oxide synthase inhibition exhibited significant (P=0.044 positive effects on cartilage regeneration following cartilage damage, it was determined that inducible nitric oxide synthase inhibition had no statistically significant effect on cartilage regeneration. It was observed that the nitric oxide synthase activation triggered advanced arthrosis symptoms, such as osteophyte formation. The fact that selective neuronal nitric oxide synthase inhibitors were observed to have mitigating effects on the severity of the damage may, in the future, influence the development of new agents to be used in the treatment of cartilage disorders.
Mechanism of Action and Inhibition of dehydrosqualene Synthase
Energy Technology Data Exchange (ETDEWEB)
F Lin; C Liu; Y Liu; Y Zhang; K Wang; W Jeng; T Ko; R Cao; A Wang; E Oldfield
2011-12-31
'Head-to-head' terpene synthases catalyze the first committed steps in sterol and carotenoid biosynthesis: the condensation of two isoprenoid diphosphates to form cyclopropylcarbinyl diphosphates, followed by ring opening. Here, we report the structures of Staphylococcus aureus dehydrosqualene synthase (CrtM) complexed with its reaction intermediate, presqualene diphosphate (PSPP), the dehydrosqualene (DHS) product, as well as a series of inhibitors. The results indicate that, on initial diphosphate loss, the primary carbocation so formed bends down into the interior of the protein to react with C2,3 double bond in the prenyl acceptor to form PSPP, with the lower two-thirds of both PSPP chains occupying essentially the same positions as found in the two farnesyl chains in the substrates. The second-half reaction is then initiated by the PSPP diphosphate returning back to the Mg{sup 2+} cluster for ionization, with the resultant DHS so formed being trapped in a surface pocket. This mechanism is supported by the observation that cationic inhibitors (of interest as antiinfectives) bind with their positive charge located in the same region as the cyclopropyl carbinyl group; that S-thiolo-diphosphates only inhibit when in the allylic site; activity results on 11 mutants show that both DXXXD conserved domains are essential for PSPP ionization; and the observation that head-to-tail isoprenoid synthases as well as terpene cyclases have ionization and alkene-donor sites which spatially overlap those found in CrtM.
Formentini, Laura; Pereira, Marta P; Sánchez-Cenizo, Laura; Santacatterina, Fulvio; Lucas, José J; Navarro, Carmen; Martínez-Serrano, Alberto; Cuezva, José M
2014-04-01
A key transducer in energy conservation and signaling cell death is the mitochondrial H(+)-ATP synthase. The expression of the ATPase inhibitory factor 1 (IF1) is a strategy used by cancer cells to inhibit the activity of the H(+)-ATP synthase to generate a ROS signal that switches on cellular programs of survival. We have generated a mouse model expressing a mutant of human IF1 in brain neurons to assess the role of the H(+)-ATP synthase in cell death in vivo. The expression of hIF1 inhibits the activity of oxidative phosphorylation and mediates the shift of neurons to an enhanced aerobic glycolysis. Metabolic reprogramming induces brain preconditioning affording protection against quinolinic acid-induced excitotoxicity. Mechanistically, preconditioning involves the activation of the Akt/p70S6K and PARP repair pathways and Bcl-xL protection from cell death. Overall, our findings provide the first in vivo evidence highlighting the H(+)-ATP synthase as a target to prevent neuronal cell death.
Inhibition of fatty acid synthase prevents preadipocyte differentiation
International Nuclear Information System (INIS)
Schmid, Bernhard; Rippmann, Joerg F.; Tadayyon, Moh; Hamilton, Bradford S.
2005-01-01
Inhibition of fatty acid synthase (FAS) reduces food intake in rodents. As adipose tissue expresses FAS, we sought to investigate the effect of reduced FAS activity on adipocyte differentiation. FAS activity was suppressed either pharmacologically or by siRNA during differentiation of 3T3-L1 cells. Cerulenin (10 μM), triclosan (50 μM), and C75 (50 μM) reduced dramatically visible lipid droplet accumulation, while incorporation of [1- 14 C]acetate into lipids was reduced by 75%, 70%, and 90%, respectively. Additionally, the substances reduced FAS, CEBPα, and PPARγ mRNA by up to 85% compared to that of control differentiated cells. Transient transfection with FAS siRNA suppressed FAS mRNA and FAS activity, and this was accompanied by reduction of CEBPα and PPARγ mRNA levels, and complete prevention of lipid accumulation. CD36, a late marker of differentiation, was also reduced. Together, these results suggest that FAS generated signals may be essential to support preadipocyte differentiation
Fumonisins (FB) are mycotoxins found in corn. FB1 is the most common FB. It is the cause of farm animal diseases and is carcinogenic in rodents. The mode of action is the inhibition of ceramide synthase (CerS). Inhibition of CerS in mice causes a dose-dependent accumulation of sphinganine 1-phosphat...
Inhibition of thromboxane synthase induces lung cancer cell death via increasing the nuclear p27
Energy Technology Data Exchange (ETDEWEB)
Leung, Kin Chung; Hsin, Michael K.Y.; Chan, Joey S.Y.; Yip, Johnson H.Y.; Li, Mingyue; Leung, Billy C.S. [Department of Surgery, The Chinese University of Hong Kong, Shatin, New Territories (Hong Kong); Mok, Tony S.K. [Department of Clinical Oncology, The Chinese University of Hong Kong, Shatin, New Territories (Hong Kong); Warner, Timothy D. [The William Harvey Research Institute, Queen Mary University of London, London (United Kingdom); Underwood, Malcolm J. [Department of Surgery, The Chinese University of Hong Kong, Shatin, New Territories (Hong Kong); Chen, George G., E-mail: gchen@cuhk.edu.hk [Department of Surgery, The Chinese University of Hong Kong, Shatin, New Territories (Hong Kong)
2009-10-15
The role of thromboxane in lung carcinogenesis is not clearly known, though thromboxane B2 (TXB{sub 2}) level is increased and antagonists of thromboxane receptors or TXA2 can induce apoptosis of lung cancer cells. p27, an atypical tumor suppressor, is normally sequestered in the nucleus. The increased nuclear p27 may result in apoptosis of tumor cells. We hypothesize that the inhibition of thromboxane synthase (TXS) induces the death of lung cancer cells and that such inhibition is associated with the nuclear p27 level. Our experiment showed that the inhibition of TXS significantly induced the death or apoptosis in lung cancer cells. The activity of TXS was increased in lung cancer. The nuclear p27 was remarkably reduced in lung cancer tissues. The inhibition of TXS caused the cell death and apoptosis of lung cancer cells, likely via the elevation of the nuclear p27 since the TXS inhibition promoted the nuclear p27 level and the inhibition of p27 by its siRNA recovered the cell death induced by TXS inhibition. Collectively, lung cancer cells produce high levels of TXB{sub 2} but their nuclear p27 is markedly reduced. The inhibition of TXS results in the p27-related induction of cell death in lung cancer cells.
Inhibition of thromboxane synthase induces lung cancer cell death via increasing the nuclear p27
International Nuclear Information System (INIS)
Leung, Kin Chung; Hsin, Michael K.Y.; Chan, Joey S.Y.; Yip, Johnson H.Y.; Li, Mingyue; Leung, Billy C.S.; Mok, Tony S.K.; Warner, Timothy D.; Underwood, Malcolm J.; Chen, George G.
2009-01-01
The role of thromboxane in lung carcinogenesis is not clearly known, though thromboxane B2 (TXB 2 ) level is increased and antagonists of thromboxane receptors or TXA2 can induce apoptosis of lung cancer cells. p27, an atypical tumor suppressor, is normally sequestered in the nucleus. The increased nuclear p27 may result in apoptosis of tumor cells. We hypothesize that the inhibition of thromboxane synthase (TXS) induces the death of lung cancer cells and that such inhibition is associated with the nuclear p27 level. Our experiment showed that the inhibition of TXS significantly induced the death or apoptosis in lung cancer cells. The activity of TXS was increased in lung cancer. The nuclear p27 was remarkably reduced in lung cancer tissues. The inhibition of TXS caused the cell death and apoptosis of lung cancer cells, likely via the elevation of the nuclear p27 since the TXS inhibition promoted the nuclear p27 level and the inhibition of p27 by its siRNA recovered the cell death induced by TXS inhibition. Collectively, lung cancer cells produce high levels of TXB 2 but their nuclear p27 is markedly reduced. The inhibition of TXS results in the p27-related induction of cell death in lung cancer cells.
Chronic inhibition of nitric oxide synthase augments the ACTH response to exercise.
Jankord, Ryan; McAllister, Richard M; Ganjam, Venkataseshu K; Laughlin, M Harold
2009-03-01
Exercise can activate the hypothalamo-pituitary-adrenocortical (HPA) axis, and regular exercise training can impact how the HPA axis responds to stress. The mechanism by which acute exercise induces HPA activity is unclear. Therefore, the purpose of this study was to test the hypothesis that nitric oxide modulates the neuroendocrine component of the HPA axis during exercise. Female Yucatan miniature swine were treated with N-nitro-l-arginine methyl ester (l-NAME) to test the effect of chronic nitric oxide synthase (NOS) inhibition on the ACTH response to exercise. In addition, we tested the effect of NOS inhibition on blood flow to tissues of the HPA axis and report the effects of handling and treadmill exercise on the plasma concentrations of ACTH and cortisol. Chronic NOS inhibition decreased plasma NO(x) levels by 44%, increased mean arterial blood pressure by 46%, and increased expression of neuronal NOS in carotid arteries. Vascular conductance was decreased in the frontal cortex, the hypothalamus, and the adrenal gland. Chronic NOS inhibition exaggerated the ACTH response to exercise. In contrast, chronic NOS inhibition decreased the ACTH response to restraint, suggesting that the role of NO in modulating HPA activity is stressor dependent. These results demonstrate that NOS activity modulates the response of the neuroendocrine component of the HPA axis during exercise stress.
HAEM SYNTHASE AND COBALT PORPHYRIN SYNTHASE IN VARIOUS MICRO-ORGANISMS.
PORRA, R J; ROSS, B D
1965-03-01
1. The preparation of a crude extract of Clostridium tetanomorphum containing cobalt porphyrin synthase but little haem-synthase activity is described. 2. The properties of cobalt porphyrin synthase in the clostridial extracts is compared with the properties of a haem synthase present in crude extracts of the yeast Torulopsis utilis. 3. Cobalt porphyrin synthase in extracts of C. tetanomorphum inserts Co(2+) ions into the following dicarboxylic porphyrins in descending order of rate of insertion: meso-, deutero- and proto-porphyrins. Esterification renders meso- and deutero-porphyrins inactive as substrates. Neither the tetracarboxylic (coproporphyrin III) nor the octacarboxylic (uroporphyrin III) compounds are converted into cobalt porphyrins by the extract, but the non-enzymic incorporation of Co(2+) ions into these two porphyrins is rapid. These extracts are unable to insert Mn(2+), Zn(2+), Mg(2+) or Cu(2+) ions into mesoporphyrin. 4. Crude extracts of T. utilis readily insert both Co(2+) and Fe(2+) ions into deutero-, meso, and proto-porphyrins. Unlike the extracts of C. tetanomorphum, these preparations catalyse the insertion of Co(2+) ions into deuteroporphyrin more rapidly than into mesoporphyrin. This parallels the formation of haems by the T. utilis extract. 5. Cobalt porphyrin synthase is present in the particulate fraction of the extracts of C. tetanomorphum but requires a heat-stable factor present in the soluble fraction. This soluble factor can be replaced by GSH. 6. Cobalt porphyrin synthase in the clostridial extract is inhibited by iodoacetamide and to a smaller extent by p-chloromercuribenzoate and N-ethylmaleimide. The haem synthases of T. utilis and Micrococcus denitrificans are also inhibited by various thiol reagents.
Directory of Open Access Journals (Sweden)
Dong Ju Son
2014-08-01
Full Text Available PURPOSE: Piperine, a major alkaloid of black pepper (Piper nigrum and long pepper (Piper longum, was shown to have anti-inflammatory activity through the suppression of cyclooxygenase (COX-2 gene expression and enzyme activity. It is also reported to exhibit anti-platelet activity, but the mechanism underlying this action remains unknown. In this study, we investigated a putative anti-platelet aggregation mechanism involving arachidonic acid (AA metabolism and how this compares with the mechanism by which it inhibits macrophage inflammatory responses; METHODS: Rabbit platelets and murine macrophage RAW264.7 cells were treated with piperine, and the effect of piperine on the activity of AA-metabolizing enzymes, including cytosolic phospholipase A2 (cPLA2, COX-1, COX-2, and thromboxane A2 (TXA2 synthase, as well as its effect on AA liberation from the plasma membrane components, were assessed using isotopic labeling methods and enzyme immunoassay kit; RESULTS: Piperine significantly suppressed AA liberation by attenuating cPLA2 activity in collagen-stimulated platelets. It also significantly inhibited the activity of TXA2 synthase, but not of COX-1, in platelets. These results suggest that piperine inhibits platelet aggregation by attenuating cPLA2 and TXA2 synthase activities, rather than through the inhibition of COX-1 activity. On the other hand, piperine significantly inhibited lipopolysaccharide-induced generation of prostaglandin (PGE2 and PGD2 in RAW264.7 cells by suppressing the activity of COX-2, without effect on cPLA2; CONCLUSION: Our findings indicate that piperine inhibits platelet aggregation and macrophage inflammatory response by different mechanisms.
Isolation and functional effects of monoclonal antibodies binding to thymidylate synthase.
Jastreboff, M M; Todd, M B; Malech, H L; Bertino, J R
1985-01-29
Monoclonal antibodies against electrophoretically pure thymidylate synthase from HeLa cells have been produced. Antibodies (M-TS-4 and M-TS-9) from hybridoma clones were shown by enzyme-linked immunoassay to recognize thymidylate synthase from a variety of human cell lines, but they did not bind to thymidylate synthase from mouse cell lines. The strongest binding of antibodies was observed to enzyme from HeLa cells. These two monoclonal antibodies bind simultaneously to different antigenic sites on thymidylate synthase purified from HeLa cells, as reflected by a high additivity index and results of cross-linked radioimmunoassay. Both monoclonal antibodies inhibit the activity of thymidylate synthase from human cell lines. The strongest inhibition was observed with thymidylate synthase from HeLa cells. Monoclonal antibody M-TS-9 (IgM subclass) decreased the rate of binding of [3H]FdUMP to thymidylate synthase in the presence of 5,10-methylenetetrahydrofolate while M-TS-4 (IgG1) did not change the rate of ternary complex formation. These data indicate that the antibodies recognize different epitopes on the enzyme molecule.
Thromboxane synthase suppression induces lung cancer cell apoptosis via inhibiting NF-κB
International Nuclear Information System (INIS)
Leung, Kin Chung; Li, Ming-Yue; Leung, Billy C.S.; Hsin, Michael K.Y.; Mok, Tony S.K.; Underwood, Malcolm J.; Chen, George G.
2010-01-01
Accumulating evidence shows that the inhibition of thromboxane synthase (TXS) induced apoptosis in cancer cells. TXS inhibitor 1-Benzylimidzole (1-BI) can trigger apoptosis in lung cancer cells but the mechanism is not fully defined. In this study, lung cancer cells were treated with 1-BI. In this study, the level of reactive oxygen species (ROS) was measured and NF-κB activity was determined in human lung cancer cells. The roles of ROS and NF-κB in 1-BI-mediated cell death were analyzed. The results showed that 1-BI induced ROS generation but decreased the activity of NF-κB by reducing phosphorylated IκBα (p-IκBα) and inhibiting the translocation of p65 into the nucleus. In contrast to 1-BI, antioxidant N-acetyl cysteine (NAC) stimulated cell proliferation and significantly protected the cells from 1-BI-mediated cell death by neutralizing ROS. Collectively, apoptosis induced by 1-BI is associated with the over-production of ROS and the reduction of NF-κB. Antioxidants can significantly block the inhibitory effect of 1-BI.
Topoisomerase 1 Inhibition Promotes Cyclic GMP-AMP Synthase-Dependent Antiviral Responses
Directory of Open Access Journals (Sweden)
Geneviève Pèépin
2017-10-01
Full Text Available Inflammatory responses, while essential for pathogen clearance, can also be deleterious to the host. Chemical inhibition of topoisomerase 1 (Top1 by low-dose camptothecin (CPT can suppress transcriptional induction of antiviral and inflammatory genes and protect animals from excessive and damaging inflammatory responses. We describe the unexpected finding that minor DNA damage from topoisomerase 1 inhibition with low-dose CPT can trigger a strong antiviral immune response through cyclic GMP-AMP synthase (cGAS detection of cytoplasmic DNA. This argues against CPT having only anti-inflammatory activity. Furthermore, expression of the simian virus 40 (SV40 large T antigen was paramount to the proinflammatory antiviral activity of CPT, as it potentiated cytoplasmic DNA leakage and subsequent cGAS recruitment in human and mouse cell lines. This work suggests that the capacity of Top1 inhibitors to blunt inflammatory responses can be counteracted by viral oncogenes and that this should be taken into account for their therapeutic development.
Mariotto, S; Cuzzolin, L; Adami, A; Del Soldato, P; Suzuki, H; Benoni, G
1995-01-01
A well-known nitric oxide (NO)-releasing compound, sodium nitroprusside (SNP), decreases in a dose-dependent manner NO synthase (NOS) activity induced in rat neutrophils by treatment with lipopolysaccharide (LPS). This inhibitory action of SNP seems not to be due to its direct effect on the enzyme activity. The strong nitrosonium ion (NO+) character of SNP could be responsible for its inhibition of NOS induction in neutrophils.
International Nuclear Information System (INIS)
Nishida, Yoshihiro; Knudson, Warren; Knudson, Cheryl B.; Ishiguro, Naoki
2005-01-01
Osteosarcoma is a common malignant bone tumor associated with childhood and adolescence. The results of numerous studies have suggested that hyaluronan plays an important role in regulating the aggressive behavior of various types of cancer cells. However, no studies have addressed hyaluronan with respect to osteosarcomas. In this investigation, the mRNA expression copy number of three mammalian hyaluronan synthases (HAS) was determined using competitive RT-PCR in the osteoblastic osteosarcoma cell line, MG-63. MG-63 are highly malignant osteosarcoma cells with an abundant hyaluronan-rich matrix. The results demonstrated that HAS-2 is the predominant HAS in MG-63. Accumulation of intracellular hyaluronan increased in association with the proliferative phase of these cells. The selective inhibition of HAS-2 mRNA in MG-63 cells by antisense phosphorothioate oligonucleotides resulted in reduced hyaluronan accumulation by these cells. As expected, the reduction in hyaluronan disrupted the assembly of cell-associated matrices. However, of most interest, coincident with the reduction in hyaluronan, there was a substantial decrease in cell proliferation, a decrease in cell motility and a decrease in cell invasiveness. These data suggest that hyaluronan synthesized by HAS-2 in MG-63 plays a crucial role in osteosarcoma cell proliferation, motility, and invasion
Thupari, J N; Pinn, M L; Kuhajda, F P
2001-07-13
Inhibition of fatty acid synthase (FAS) induces apoptosis in human breast cancer cells in vitro and in vivo without toxicity to proliferating normal cells. We have previously shown that FAS inhibition causes a rapid increase in malonyl-CoA levels identifying malonyl-CoA as a potential trigger of apoptosis. In this study we further investigated the role of malonyl-CoA during FAS inhibition. We have found that: [i] inhibition of FAS with cerulenin causes carnitine palmitoyltransferase-1 (CPT-1) inhibition and fatty acid oxidation inhibition in MCF-7 human breast cancer cells likely mediated by elevation of malonyl-CoA; [ii] cerulenin cytotoxicity is due to the nonphysiological state of increased malonyl-CoA, decreased fatty acid oxidation, and decreased fatty acid synthesis; and [iii] the cytotoxic effect of cerulenin can be mimicked by simultaneous inhibition of CPT-1, with etomoxir, and fatty acid synthesis with TOFA, an acetyl-CoA carboxylase (ACC) inhibitor. This study identifies CPT-1 and ACC as two new potential targets for cancer chemotherapy. Copyright 2001 Academic Press.
Institute of Scientific and Technical Information of China (English)
Shengqiang Chen; Xuegang Luo; Quan Yang; Weiwen Sun; Kaiyi Cao; Xi Chen; Yueling Huang; Lijun Dai; Yonghong Yi
2011-01-01
In the present study, Fmr1 knockout mice (KO mice) were used as the model for fragile X syndrome. The results of step-through and step-down tests demonstrated that Fmr1 KO mice had shorter latencies and more error counts, indicating a learning and memory disorder. After treatment with 30, 60, 90, 120, or 200 mg/kg lithium chloride, the learning and memory abilities of the Fmr1 KO mice were significantly ameliorated, in particular, the 200 mg/kg lithium chloride treatment had the most significant effect. Western blot analysis showed that lithium chloride significantly enhanced the expression of phosphorylated glycogen synthase kinase 3 beta, an inactive form of glycogen synthase kinase 3 beta, in the cerebral cortex and hippocampus of the Fmr1 KO mice. These results indicated that lithium chloride improved learning and memory in the Fmr1 KO mice, possibly by inhibiting glycogen synthase kinase 3 beta activity.
Inhibition of inducible Nitric Oxide Synthase by a mustard gas analog in murine macrophages
Directory of Open Access Journals (Sweden)
Smith Milton
2006-11-01
Full Text Available Abstract Background 2-Chloroethyl ethyl sulphide (CEES is a sulphur vesicating agent and an analogue of the chemical warfare agent 2,2'-dichlorodiethyl sulphide, or sulphur mustard gas (HD. Both CEES and HD are alkylating agents that influence cellular thiols and are highly toxic. In a previous publication, we reported that lipopolysaccharide (LPS enhances the cytotoxicity of CEES in murine RAW264.7 macrophages. In the present investigation, we studied the influence of CEES on nitric oxide (NO production in LPS stimulated RAW264.7 cells since NO signalling affects inflammation, cell death, and wound healing. Murine macrophages stimulated with LPS produce NO almost exclusively via inducible nitric oxide synthase (iNOS activity. We suggest that the influence of CEES or HD on the cellular production of NO could play an important role in the pathophysiological responses of tissues to these toxicants. In particular, it is known that macrophage generated NO synthesised by iNOS plays a critical role in wound healing. Results We initially confirmed that in LPS stimulated RAW264.7 macrophages NO is exclusively generated by the iNOS form of nitric oxide synthase. CEES treatment inhibited the synthesis of NO (after 24 hours in viable LPS-stimulated RAW264.7 macrophages as measured by either nitrite secretion into the culture medium or the intracellular conversion of 4,5-diaminofluorescein diacetate (DAF-2DA or dichlorofluorescin diacetate (DCFH-DA. Western blots showed that CEES transiently decreased the expression of iNOS protein; however, treatment of active iNOS with CEES in vitro did not inhibit its enzymatic activity Conclusion CEES inhibits NO production in LPS stimulated macrophages by decreasing iNOS protein expression. Decreased iNOS expression is likely the result of CEES induced alteration in the nuclear factor kappa B (NF-κB signalling pathway. Since NO can act as an antioxidant, the CEES induced down-regulation of iNOS in LPS
Grieco, Steven F.; Cheng, Yuyan; Eldar-Finkelman, Hagit; Jope, Richard S.; Beurel, Eléonore
2016-01-01
An antidepressant dose of the rapidly-acting ketamine inhibits glycogen synthase kinase-3 (GSK3) in mouse hippocampus, and this inhibition is required for the antidepressant effect of ketamine in learned helplessness depression-like behavior. Here we report that treatment with an antidepressant dose of ketamine (10 mg/kg) increased expression of insulin-like growth factor 2 (IGF2) in mouse hippocampus, an effect that required ketamine-induced inhibition of GSK3. Ketamine also inhibited hippocampal GSK3 and increased expression of hippocampal IGF2 in mice when administered after the induction of learned helplessness. Treatment with the specific GSK3 inhibitor L803-mts was sufficient to up-regulate hippocampal IGF2 expression. Administration of IGF2 siRNA reduced ketamine's antidepressant effect in the learned helplessness paradigm. Mice subjected to the learned helplessness paradigm were separated into two groups, those that were resilient (non-depressed) and those that were susceptible (depressed). Non-depressed resilient mice displayed higher expression of IGF2 than susceptible mice. These results indicate that IGF2 contributes to ketamine's antidepressant effect and that IGF2 may confer resilience to depression-like behavior. PMID:27542584
Mariotto, S; Cuzzolin, L; Adami, A; Del Soldato, P; Suzuki, H; Benoni, G
1995-01-01
A well-known nitric oxide (NO)-releasing compound, sodium nitroprusside (SNP), decreases in a dose-dependent manner NO synthase (NOS) activity induced in rat neutrophils by treatment with lipopolysaccharide (LPS). This inhibitory action of SNP seems not to be due to its direct effect on the enzyme activity. The strong nitrosonium ion (NO+) character of SNP could be responsible for its inhibition of NOS induction in neutrophils. PMID:7542530
McEachern, Kerry Anne; Fung, John; Komarnitsky, Svetlana; Siegel, Craig S; Chuang, Wei-Lien; Hutto, Elizabeth; Shayman, James A; Grabowski, Gregory A; Aerts, Johannes M F G; Cheng, Seng H; Copeland, Diane P; Marshall, John
2007-07-01
An approach to treating Gaucher disease is substrate inhibition therapy which seeks to abate the aberrant lysosomal accumulation of glucosylceramide. We have identified a novel inhibitor of glucosylceramide synthase (Genz-112638) and assessed its activity in a murine model of Gaucher disease (D409V/null). Biochemical characterization of Genz-112638 showed good potency (IC(50) approximately 24nM) and specificity against the target enzyme. Mice that received drug prior to significant accumulation of substrate (10 weeks of age) showed reduced levels of glucosylceramide and number of Gaucher cells in the spleen, lung and liver when compared to age-matched control animals. Treatment of older mice that already displayed significant amounts of tissue glucosylceramide (7 months old) resulted in arrest of further accumulation of the substrate and appearance of additional Gaucher cells in affected organs. These data indicate that substrate inhibition therapy with Genz-112638 represents a viable alternate approach to enzyme therapy to treat the visceral pathology in Gaucher disease.
Directory of Open Access Journals (Sweden)
Helena H. Chowdhury
2014-10-01
Full Text Available Glucose is an important source of energy for mammalian cells and enters the cytosol via glucose transporters. It has been thought for a long time that glucose entering the cytosol is swiftly phosphorylated in most cell types; hence the levels of free glucose are very low, beyond the detection level. However, the introduction of new fluorescence resonance energy transfer-based glucose nanosensors has made it possible to measure intracellular glucose more accurately. Here, we used the fluorescent indicator protein (FLIPglu-600µ to monitor cytosolic glucose dynamics in mouse 3T3-L1 cells in which glucose utilization for glycogen synthesis was inhibited. The results show that cells exhibit a low resting cytosolic glucose concentration. However, in cells with inhibited glycogen synthase activation, insulin induced a robust increase in cytosolic free glucose. The insulin-induced increase in cytosolic glucose in these cells is due to an imbalance between the glucose transported into the cytosol and the use of glucose in the cytosol. In untreated cells with sensitive glycogen synthase activation, insulin stimulation did not result in a change in the cytosolic glucose level. This is the first report of dynamic measurements of cytosolic glucose levels in cells devoid of the glycogen synthesis pathway.
Flepisi, T B; Lochner, Amanda; Huisamen, Barbara
2013-10-01
Glycogen synthase kinase-3 (GSK-3) is a serine-threonine protein kinase, discovered as a regulator of glycogen synthase. GSK-3 may regulate the expression of SERCA-2a potentially affecting myocardial contractility. It is known to phosphorylate and inhibit IRS-1, thus disrupting insulin signalling. This study aimed to determine whether myocardial GSK-3 protein and its substrate proteins are dysregulated in obesity and insulin resistance, and whether chronic GSK-3 inhibition can prevent or reverse this. Weight matched male Wistar rats were rendered obese by hyperphagia using a special diet (DIO) for 16 weeks and compared to chow fed controls. Half of each group was treated with the GSK-3 inhibitor CHIR118637 (30 mg/kg/day) from week 12 to16 of the diet period. Biometric and biochemical parameters were measured and protein expression determined by Western blotting and specific antibodies. Ca(2+)ATPase activity was determined spectrophotometrically. Cardiomyocytes were prepared by collagenase perfusion and insulin stimulated 2-deoxy-glucose uptake determined. DIO rats were significantly heavier than controls, associated with increased intra-peritoneal fat and insulin resistance. GSK-3 inhibition did not affect weight but improved insulin resistance, also on cellular level. It had no effect on GSK-3 expression but elevated its phospho/total ratio and elevated IRS-2 expression. Obesity lowered SERCA-2a expression and activity while GSK-3 inhibition alleviated this. The phospho/total ratio of phospholamban underscored inhibition of SERCA-2a in obesity. In addition, signs of myocardial hypertrophy were observed in treated control rats. GSK-3 inhibition could not reverse all the detrimental effects of obesity but may be harmful in normal rat hearts. It regulates IRS-2, SERCA-2a and phospholamban expression but not IRS-1.
Propolis attenuates oxidative injury in brain and lung of nitric oxide synthase inhibited rats
Directory of Open Access Journals (Sweden)
Zeliha Selamoglu-Talas
2015-10-01
Full Text Available Background: The blocking of nitric oxide synthase (NOS activity may reason vasoconstriction with formation of reactive oxygen species. Propolis has biological and pharmacological properties, such as antioxidant. The aim of this study was to examine the antioxidant effects of propolis which natural product on biochemical parameters in brain and lung tissues of acute nitric oxide synthase inhibited rats by Nω-nitro-L-arginine methyl ester (L-NAME.Methods: Rats have been received L-NAME (40 mg/kg, intraperitoneally, NOS inhibitor for 15 days to produce hypertension and propolis (200mg/kg, by gavage the lastest 5 of 15 days.Results: There were the increase (P<0.001 in the malondialdehyde levels in the L-NAME treatment groups when compared to control rats, but the decrease (P<0.001 in the catalase activities in both brain and lung tissues. There were statistically changes (P<0.001 in these parameters of L-NAME+propolis treated rats as compared with L-NAME-treated group.Conclusion: The application of L-NAME to the Wistar rats resulted in well developed oxidative stress. Also, propolis may influence endothelial NO production. Identification of such compounds and characterisation of their cellular actions may increase our knowledge of the regulation of endothelial NO production and could provide valuable clues for the prevention or treatment of hypertensive diseases and oxidative stress.
Nitrite reductase activity and inhibition of H₂S biogenesis by human cystathionine ß-synthase.
Directory of Open Access Journals (Sweden)
Carmen Gherasim
Full Text Available Nitrite was recognized as a potent vasodilator >130 years and has more recently emerged as an endogenous signaling molecule and modulator of gene expression. Understanding the molecular mechanisms that regulate nitrite metabolism is essential for its use as a potential diagnostic marker as well as therapeutic agent for cardiovascular diseases. In this study, we have identified human cystathionine ß-synthase (CBS as a new player in nitrite reduction with implications for the nitrite-dependent control of H₂S production. This novel activity of CBS exploits the catalytic property of its unusual heme cofactor to reduce nitrite and generate NO. Evidence for the possible physiological relevance of this reaction is provided by the formation of ferrous-nitrosyl (Fe(II-NO CBS in the presence of NADPH, the human diflavin methionine synthase reductase (MSR and nitrite. Formation of Fe(II-NO CBS via its nitrite reductase activity inhibits CBS, providing an avenue for regulating biogenesis of H₂S and cysteine, the limiting reagent for synthesis of glutathione, a major antioxidant. Our results also suggest a possible role for CBS in intracellular NO biogenesis particularly under hypoxic conditions. The participation of a regulatory heme cofactor in CBS in nitrite reduction is unexpected and expands the repertoire of proteins that can liberate NO from the intracellular nitrite pool. Our results reveal a potential molecular mechanism for cross-talk between nitrite, NO and H₂S biology.
Directory of Open Access Journals (Sweden)
Zhenyu Ma
Full Text Available Glucocorticoids are the only therapy that has been demonstrated to alter the progress of Duchenne muscular dystrophy (DMD, the most common muscular dystrophy in children. However, glucocorticoids disturb skeletal muscle metabolism and hamper myogenesis and muscle regeneration. The mechanisms involved in the glucocorticoid-mediated suppression of myogenic differentiation are not fully understood. Glycogen synthase kinase-3β (GSK-3β is considered to play a central role as a negative regulator in myogenic differentiation. Here, we showed that glucocorticoid treatment during the first 48 h in differentiation medium decreased the level of phosphorylated Ser9-GSK-3β, an inactive form of GSK-3β, suggesting that glucocorticoids affect GSK-3β activity. We then investigated whether GSK-3β inhibition could regulate glucocorticoid-mediated suppression of myogenic differentiation in vitro. Two methods were employed to inhibit GSK-3β: pharmacological inhibition with LiCl and GSK-3β gene knockdown. We found that both methods resulted in enhanced myotube formation and increased levels of muscle regulatory factors and muscle-specific protein expression. Importantly, GSK-3β inhibition attenuated glucocorticoid-induced suppression of myogenic differentiation. Collectively, these data suggest the involvement of GSK-3β in the glucocorticoid-mediated impairment of myogenic differentiation. Therefore, the inhibition of GSK-3β may be a strategy for preventing glucocorticoid-induced muscle degeneration.
Osteopontin protects against hyperoxia-induced lung injury by inhibiting nitric oxide synthases.
Zhang, Xiang-Feng; Liu, Shuang; Zhou, Yu-Jie; Zhu, Guang-Fa; Foda, Hussein D
2010-04-05
Exposure of adult mice to more than 95% O(2) produces a lethal injury by 72 hours. Nitric oxide synthase (NOS) is thought to contribute to the pathophysiology of murine hyperoxia-induced acute lung injury (ALI). Osteopontin (OPN) is a phosphorylated glycoprotein produced principally by macrophages. OPN inhibits inducible nitric oxide synthase (iNOS), which generates large amounts of nitric oxide production. However, the relationship between nitric oxide and endogenous OPN in lung tissue during hyperoxia-induced ALI has not yet been elucidated, thus we examined the role that OPN plays in the hyperoxia-induced lung injury and its relationships with NOS. One hundred and forty-four osteopontin knock-out (KO) mice and their matched wild type background control (WT) were exposed in sealed cages > 95% oxygen or room air for 24- 72 hours, and the severity of lung injury was assessed; expression of OPN, endothelial nitric oxide synthase (eNOS) and iNOS mRNA in lung tissues at 24, 48 and 72 hours of hyperoxia were studied by reverse transcription-polymerase chain reaction (RT-PCR); immunohistochemistry (IHC) was performed for the detection of iNOS, eNOS, and OPN protein in lung tissues. OPN KO mice developed more severe acute lung injury at 72 hours of hyperoxia. The wet/dry weight ratio increased to 6.85 +/- 0.66 in the KO mice at 72 hours of hyperoxia as compared to 5.31 +/- 0.92 in the WT group (P < 0.05). iNOS mRNA (48 hours: 1.04 +/- 0.08 vs. 0.63 +/- 0.09, P < 0.01; 72 hours: 0.89 +/- 0.08 vs. 0.72 +/- 0.09, P < 0.05) and eNOS mRNA (48 hours: 0.62 +/- 0.08 vs. 0.43 +/- 0.09, P < 0.05; 72 hours: 0.67 +/- 0.08 vs. 0.45 +/- 0.09, P < 0.05) expression was more significantly increased in OPN KO mice than their matched WT mice when exposed to hyperoxia. IHC study showed higher expression of iNOS (20.54 +/- 3.18 vs. 12.52 +/- 2.46, P < 0.05) and eNOS (19.83 +/- 5.64 vs. 9.45 +/- 3.82, P < 0.05) in lung tissues of OPN KO mice at 72 hours of hyperoxia. OPN can protect against
DEFF Research Database (Denmark)
Hempel, Casper; Kohnke, Hannes; Maretty, Lasse
2014-01-01
Nitric oxide (NO) accumulates in Plasmodium falciparum-infected erythrocytes. It may be produced by a parasite NO synthase (NOS) or by nitrate reduction. The parasite's benefit of NO accumulation is not understood. We investigated if inhibiting the P. falciparum NOS with specific and unspecific NOS...... increased the fraction of phosphatidyl serine exposing cells significantly. The infection did not change the level of expression of neither total CD47 nor its oxidized form. Unrelated to NOS inhibition, incubation with caveolin-1 scaffolding domain peptide lead to a decrease in oxidized CD47. In conclusion...
Directory of Open Access Journals (Sweden)
Louw Abraham I
2010-04-01
Full Text Available Abstract Background Plasmodium falciparum, the causative agent of severe human malaria, has evolved to become resistant to previously successful antimalarial chemotherapies, most notably chloroquine and the antifolates. The prevalence of resistant strains has necessitated the discovery and development of new chemical entities with novel modes-of-action. Although much effort has been invested in the creation of analogues based on existing drugs and the screening of chemical and natural compound libraries, a crucial shortcoming in current Plasmodial drug discovery efforts remains the lack of an extensive set of novel, validated drug targets. A requirement of these targets (or the pathways in which they function is that they prove essential for parasite survival. The polyamine biosynthetic pathway, responsible for the metabolism of highly abundant amines crucial for parasite growth, proliferation and differentiation, is currently under investigation as an antimalarial target. Chemotherapeutic strategies targeting this pathway have been successfully utilized for the treatment of Trypanosomes causing West African sleeping sickness. In order to further evaluate polyamine depletion as possible antimalarial intervention, the consequences of inhibiting P. falciparum spermidine synthase (PfSpdSyn were examined on a morphological, transcriptomic, proteomic and metabolic level. Results Morphological analysis of P. falciparum 3D7 following application of the PfSpdSyn inhibitor cyclohexylamine confirmed that parasite development was completely arrested at the early trophozoite stage. This is in contrast to untreated parasites which progressed to late trophozoites at comparable time points. Global gene expression analyses confirmed a transcriptional arrest in the parasite. Several of the differentially expressed genes mapped to the polyamine biosynthetic and associated metabolic pathways. Differential expression of corresponding parasite proteins involved in
DEFF Research Database (Denmark)
Ollerstam, A.; Skøtt, O.; Ek, J.
2001-01-01
Nitric oxide (NO) produced by neuronal NO-synthase (nNOS) in macula densa cells may be involved in the control of renin release. 7-Nitro indazole (7-NI) inhibits nNOS, and we investigated the effect of short- (4 days) and long-term (4 weeks) 7-NI treatment on blood pressure (BP), plasma renin...... LS rats (107 +/- 15 vs. 56 +/- 1 mGU mL(-1)). Stimulation of PRC in LS rats was further enhanced by 7-NI after 4 days of treatment, but not affected in rats treated for 4 weeks. This suggests that inhibition of nNOS stimulates renin release but that this stimulatory effect in the long run might...
Topoisomerase 1 Inhibition Promotes Cyclic GMP-AMP Synthase-Dependent Antiviral Responses.
Pépin, Geneviève; Nejad, Charlotte; Ferrand, Jonathan; Thomas, Belinda J; Stunden, H James; Sanij, Elaine; Foo, Chwan-Hong; Stewart, Cameron R; Cain, Jason E; Bardin, Philip G; Williams, Bryan R G; Gantier, Michael P
2017-10-03
Inflammatory responses, while essential for pathogen clearance, can also be deleterious to the host. Chemical inhibition of topoisomerase 1 (Top1) by low-dose camptothecin (CPT) can suppress transcriptional induction of antiviral and inflammatory genes and protect animals from excessive and damaging inflammatory responses. We describe the unexpected finding that minor DNA damage from topoisomerase 1 inhibition with low-dose CPT can trigger a strong antiviral immune response through cyclic GMP-AMP synthase (cGAS) detection of cytoplasmic DNA. This argues against CPT having only anti-inflammatory activity. Furthermore, expression of the simian virus 40 (SV40) large T antigen was paramount to the proinflammatory antiviral activity of CPT, as it potentiated cytoplasmic DNA leakage and subsequent cGAS recruitment in human and mouse cell lines. This work suggests that the capacity of Top1 inhibitors to blunt inflammatory responses can be counteracted by viral oncogenes and that this should be taken into account for their therapeutic development. IMPORTANCE Recent studies suggest that low-dose DNA-damaging compounds traditionally used in cancer therapy can have opposite effects on antiviral responses, either suppressing (with the example of CPT) or potentiating (with the example of doxorubicin) them. Our work demonstrates that the minor DNA damage promoted by low-dose CPT can also trigger strong antiviral responses, dependent on the presence of viral oncogenes. Taken together, these results call for caution in the therapeutic use of low-dose chemotherapy agents to modulate antiviral responses in humans. Copyright © 2017 Pépin et al.
Yutani, Masahiro; Hashimoto, Yukie; Ogita, Akira; Kubo, Isao; Tanaka, Toshio; Fujita, Ken-ichi
2011-11-01
trans-Anethole (anethole), a major component of anise oil, has a broad antimicrobial spectrum with antimicrobial activity relatively weaker than those of well-known antibiotics, and significantly enhances the antifungal activity of polygodial and dodecanol against the baker's yeast Saccharomyces cerevisiae and human pathogenic yeast Candida albicans. However, the antifungal mechanism of anethole is unresolved. Anethole demonstrated antifungal activity against the filamentous fungus, Mucor mucedo IFO 7684, accompanied by hyphal morphological changes such as swollen hyphae at the tips. Its minimum growth inhibitory concentration was 0.625 mM. A hyperosmotic condition (1.2 M sorbitol) restricted the induction of morphological changes, while hypoosmotic treatment (distilled water) induced bursting of hyphal tips and leakage of cytoplasmic constituents. Furthermore, anethole dose-dependently inhibited chitin synthase (CHS) activity in permeabilized hyphae in an uncompetitive manner. These results suggest that the morphological changes of M. mucedo could be explained by the fragility of cell walls caused by CHS inhibition. Copyright © 2011 John Wiley & Sons, Ltd.
Pahan, Kalipada; Jana, Malabendu; Liu, Xiaojuan; Taylor, Bradley S.; Wood, Charles; Fischer, Susan M.
2007-01-01
Gemfibrozil, a lipid-lowering drug, inhibited cytokine-induced production of NO and the expression of inducible nitric-oxide synthase (iNOS) in human U373MG astroglial cells and primary astrocytes. Similar to gemfibrozil, clofibrate, another fibrate drug, also inhibited the expression of iNOS. Inhibition of human iNOS promoter-driven luciferase activity by gemfibrozil in cytokine-stimulated U373MG astroglial cells suggests that this compound inhibits the transcription of iNOS. Since gemfibrozil is known to activate peroxisome proliferator-activated receptor-α (PPAR-α), we investigated the role of PPAR-α in gemfibrozil-mediated inhibition of iNOS. Gemfibrozil induced peroxisome proliferator-responsive element (PPRE)-dependent luciferase activity, which was inhibited by the expression of ΔhPPAR-α, the dominant-negative mutant of human PPAR-α. However, ΔhPPAR-α was unable to abrogate gemfibrozil-mediated inhibition of iNOS suggesting that gemfibrozil inhibits iNOS independent of PPAR-α. The human iNOS promoter contains consensus sequences for the binding of transcription factors, including interferon-γ (IFN-γ) regulatory factor-1 (IRF-1) binding to interferon-stimulated responsive element (ISRE), signal transducer and activator of transcription (STAT) binding to γ-activation site (GAS), nuclear factor-κB (NF-κB), activator protein-1 (AP-1), and CCAAT/enhancer-binding protein β (C/EBPβ); therefore, we investigated the effect of gemfibrozil on the activation of these transcription factors. The combination of interleukin (IL)-1β and IFN-γ induced the activation of NF-κB, AP-1, C/EBPβ, and GAS but not that of ISRE, suggesting that IRF-1 may not be involved in cytokine-induced expression of iNOS in human astrocytes. Interestingly, gemfibrozil strongly inhibited the activation of NF-κB, AP-1, and C/EBPβ but not that of GAS in cytokine-stimulated astroglial cells. These results suggest that gemfibrozil inhibits the induction of iNOS probably by
Lee, Ming Hong; Kim, Jae Yeon; Yoon, Jeong Hoon; Lim, Hyo Jin; Kim, Tae Hee; Jin, Changbae; Kwak, Wie-Jong; Han, Chang-Kyun; Ryu, Jae-Ha
2006-09-01
Activated microglia by neuronal injury or inflammatory stimulation overproduce nitric oxide (NO) by inducible nitric oxide synthase (iNOS) and reactive oxygen species (ROS) such as superoxide anion, resulting in neurodegenerative diseases. The toxic peroxynitrite (ONOO-), the reaction product of NO and superoxide anion further contributes to oxidative neurotoxicity. A butanol fraction obtained from 50% ethanol extracts of Opuntia ficus indica var. saboten (Cactaceae) stem (SK OFB901) and its hydrolysis product (SK OFB901H) inhibited the production of NO in LPS-activated microglia in a dose dependent manner (IC50 15.9, 4.2 microg/mL, respectively). They also suppressed the expression of protein and mRNA of iNOS in LPS-activated microglial cells at higher than 30 microg/mL as observed by western blot analysis and RT-PCR experiment. They also inhibited the degradation of I-kappaB-alpha in activated microglia. Moreover, they showed strong activity of peroxynitrite scavenging in a cell free bioassay system. These results imply that Opuntia ficus indica may have neuroprotective activity through the inhibition of NO production by activated microglial cells and peroxynitrite scavenging activity. Copyright (c) 2006 John Wiley & Sons, Ltd.
Larran, Alvaro S; Palmieri, Valeria E; Perotti, Valeria E; Lieber, Lucas; Tuesca, Daniel; Permingeat, Hugo R
2017-12-01
Herbicide-resistant weeds are a serious problem worldwide. Recently, two populations of Amaranthus palmeri with suspected cross-resistance to acetolactate synthase (ALS)-inhibiting herbicides (R1 and R2) were found by farmers in two locations in Argentina (Vicuña Mackenna and Totoras, respectively). We conducted studies to confirm and elucidate the mechanism of resistance. We performed in vivo dose-response assays, and confirmed that both populations had strong resistance to chlorimuron-ethyl, diclosulam and imazethapyr when compared with a susceptible population (S). In vitro ALS activity inhibition tests only indicated considerable resistance to imazethapyr and chlorimuron-ethyl, indicating that other non-target mechanisms could be involved in diclosulam resistance. Subsequently, molecular analysis of als nucleotide sequences revealed three single base-pair mutations producing substitutions in amino acids previously associated with resistance to ALS inhibitors, A122, W574, and S653. This is the first report of als resistance alleles in A. palmeri in Argentina. The data support the involvement of a target-site mechanism of resistance to ALS-inhibiting herbicides. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Boutsalis, P; Powles, S B
1995-07-01
A biotype of Sonchus oleraceus L. (Compositae) has developed resistance to herbicides inhibiting acetolactate synthase (ALS) following field selection with chlorsulfuron for 8 consecutive years. The aim of this study was to determine the inheritance and mechanism of resistance in this biotype. Determination of ALS activity and inhibition kinetics revealed that Km and Vmax did not vary greatly between the resistant and susceptible biotypes. ALS extracted from the resistant biotype was resistant to five ALS-inhibiting herbicides in an in vitro assay. ALS activity from the resistant biotype was 14 19, 2, 3 and 3 times more resistant to inhibition by chlorsulfuron, sulfometuron, imazethapyr, imazapyr and flumetsulam, respectively, than the susceptible biotype. Hybrids between the resistant and a susceptible biotype were produced, and inheritance was followed through the F1, F2 and F3 generations. F1 hybrids displayed a uniform intermediate level of resistance between resistant and susceptible parents. Three distinct phenotypes, resistant, intermediate and susceptible, were identified in the F2 generation following chlorsulfuron application. A segregation ratio of 1∶2∶1 was observed, indicative of the action of a single, nuclear, incompletely dominant gene. F3 families, derived from intermediate F2 individuals, segregated in a similar manner. Resistance to herbicides inhibiting ALS in this biotype of S. oleraceus is due to the effect of a single gene coding for a resistant form of the target enzyme, ALS.
Class II recombinant phosphoribosyl diphosphate synthase from spinach
DEFF Research Database (Denmark)
Krath, B N; Hove-Jensen, B
2001-01-01
to other PRPP synthases the activity of spinach PRPP synthase isozyme 3 is independent of P(i), and the enzyme is inhibited by ribonucleoside diphosphates in a purely competitive manner, which indicates a lack of allosteric inhibition by these compounds. In addition spinach PRPP synthase isozyme 3 shows...... an unusual low specificity toward diphosphoryl donors by accepting dATP, GTP, CTP, and UTP in addition to ATP. The kinetic mechanism of the enzyme is an ordered steady state Bi Bi mechanism with K(ATP) and K(Rib-5-P) values of 170 and 110 micrometer, respectively, and a V(max) value of 13.1 micromol (min x...... mg of protein)(-1). The enzyme has an absolute requirement for magnesium ions, and maximal activity is obtained at 40 degrees C at pH 7.6....
Energy Technology Data Exchange (ETDEWEB)
Zhu, Wenzhen; Yang, Bingwu; Fu, Huiling; Ma, Long; Liu, Tingting; Chai, Rongfei; Zheng, Zhaodi [Shandong Provincial Key Laboratory of Animal Resistant Biology, School of Life Sciences, Shandong Normal University, Jinan 250014 (China); Zhang, Qunye, E-mail: wz.zhangqy@sdu.edu.cn [Key Laboratory of Cardiovascular Remodeling and Function Research Chinese Ministry of Education and Ministry of Public Health, Qilu Hospital, Shandong University, Jinan, Shandong (China); Li, Guorong, E-mail: grli@sdnu.edu.cn [Shandong Provincial Key Laboratory of Animal Resistant Biology, School of Life Sciences, Shandong Normal University, Jinan 250014 (China)
2015-03-13
As the core structure of flavonoids, flavone has been proved to possess anticancer effects. Flavone's growth inhibitory functions are related to NO. NO is synthesized by nitric oxide synthase (NOS), and generally increased in a variety of cancer cells. NO regulates multiple cellular responses by S-nitrosylation. In this study, we explored flavone-induced regulations on nitric oxide (NO)-related cellular processes in breast cancer cells. Our results showed that, flavone suppresses breast cancer cell proliferation and induces apoptosis. Flavone restrains NO synthesis by does-dependent inhibiting NOS enzymatic activity. The decrease of NO generation was detected by fluorescence microscopy and flow cytometry. Flavone-induced inhibitory effect on NOS activity is dependent on intact cell structure. For the NO-induced protein modification, flavone treatment significantly down-regulated protein S-nitrosylation, which was detected by “Biotin-switch” method. The present study provides a novel, NO-related mechanism for the anticancer function of flavone. - Highlights: • Flavone inhibits proliferation and induces apoptosis in MCF-7 cells. • Flavone decreases nitric oxide production by inhibiting NOS enzymatic activity in breast cancer cells. • Flavone down-regulates protein S-nitrosylation.
International Nuclear Information System (INIS)
Zhu, Wenzhen; Yang, Bingwu; Fu, Huiling; Ma, Long; Liu, Tingting; Chai, Rongfei; Zheng, Zhaodi; Zhang, Qunye; Li, Guorong
2015-01-01
As the core structure of flavonoids, flavone has been proved to possess anticancer effects. Flavone's growth inhibitory functions are related to NO. NO is synthesized by nitric oxide synthase (NOS), and generally increased in a variety of cancer cells. NO regulates multiple cellular responses by S-nitrosylation. In this study, we explored flavone-induced regulations on nitric oxide (NO)-related cellular processes in breast cancer cells. Our results showed that, flavone suppresses breast cancer cell proliferation and induces apoptosis. Flavone restrains NO synthesis by does-dependent inhibiting NOS enzymatic activity. The decrease of NO generation was detected by fluorescence microscopy and flow cytometry. Flavone-induced inhibitory effect on NOS activity is dependent on intact cell structure. For the NO-induced protein modification, flavone treatment significantly down-regulated protein S-nitrosylation, which was detected by “Biotin-switch” method. The present study provides a novel, NO-related mechanism for the anticancer function of flavone. - Highlights: • Flavone inhibits proliferation and induces apoptosis in MCF-7 cells. • Flavone decreases nitric oxide production by inhibiting NOS enzymatic activity in breast cancer cells. • Flavone down-regulates protein S-nitrosylation
Fatty acid synthase inhibition triggers apoptosis during S phase in human cancer cells.
Zhou, Weibo; Simpson, P Jeanette; McFadden, Jill M; Townsend, Craig A; Medghalchi, Susan M; Vadlamudi, Aravinda; Pinn, Michael L; Ronnett, Gabriele V; Kuhajda, Francis P
2003-11-01
C75, an inhibitor of fatty acid synthase (FAS), induces apoptosis in cultured human cancer cells. Its proposed mechanism of action linked high levels of malonyl-CoA after FAS inhibition to potential downstream effects including inhibition of carnitine palmitoyltransferase-1 (CPT-1) with resultant inhibition of fatty acid oxidation. Recent data has shown that C75 directly stimulates CPT-1 increasing fatty acid oxidation in MCF-7 human breast cancer cells despite inhibitory concentrations of malonyl-CoA. In light of these findings, we have studied fatty acid metabolism in MCF7 human breast cancer cells to elucidate the mechanism of action of C75. We now report that: (a) in the setting of increased fatty acid oxidation, C75 inhibits fatty acid synthesis; (b) C273, a reduced form of C75, is unable to inhibit fatty acid synthesis and is nontoxic to MCF7 cells; (c) C75 and 5-(tetradecyloxy)-2-furoic acid (TOFA), an inhibitor of acetyl-CoA carboxylase, both cause a significant reduction of fatty acid incorporation into phosphatidylcholine, the major membrane phospholipid, within 2 h; (d) pulse chase studies with [(14)C]acetate labeling of membrane lipids show that both C75 and TOFA accelerate the decay of (14)C-labeled lipid from membranes within 2 h; (e) C75 also promotes a 2-3-fold increase in oxidation of membrane lipids within 2 h; and (f) because interference with phospholipid synthesis during S phase is known to trigger apoptosis in cycling cells, we performed double-labeled terminal deoxynucleotidyltransferase-mediated nick end labeling and BrdUrd analysis with both TOFA and C75. C75 triggered apoptosis during S phase, whereas TOFA did not. Moreover, application of TOFA 2 h before C75 blocked the C75 induced apoptosis, whereas etomoxir did not. Taken together these data indicate that FAS inhibition and its downstream inhibition of phospholipid production is a necessary part of the mechanism of action of C75. CPT-1 stimulation does not likely play a role in the
Directory of Open Access Journals (Sweden)
Liang Ma
2013-08-01
Full Text Available Alternative strategies beyond current chemotherapy and radiation therapy regimens are needed in the treatment of advanced stage and recurrent endometrial cancers. There is considerable promise for biologic agents targeting the extracellular signal-regulated kinase (ERK pathway for treatment of these cancers. Many downstream substrates of the ERK signaling pathway, such as glycogen synthase kinase 3β (GSK3β, and their roles in endometrial carcinogenesis have not yet been investigated. In this study, we tested the importance of GSK3β inhibition in endometrial cancer cell lines and in vivo models. Inhibition of GSK3β by either lithium chloride (LiCl or specific GSK3β inhibitor VIII showed cytostatic and cytotoxic effects on multiple endometrial cancer cell lines, with little effect on the immortalized normal endometrial cell line. Flow cytometry and immunofluorescence revealed a G2/M cell cycle arrest in both type I (AN3CA, KLE, and RL952 and type II (ARK1 endometrial cancer cell lines. In addition, LiCl pre-treatment sensitized AN3CA cells to the chemotherapy agent paclitaxel. Administration of LiCl to AN3CA tumor-bearing mice resulted in partial or complete regression of some tumors. Thus, GSK3β activity is associated with endometrial cancer tumorigenesis and its pharmacologic inhibition reduces cell proliferation and tumor growth.
Energy Technology Data Exchange (ETDEWEB)
Aripirala, Srinivas [Johns Hopkins University, 725 North Wolfe Street WBSB 605, Baltimore, MD 21210 (United States); Gonzalez-Pacanowska, Dolores [López-Neyra Institute of Parasitology and Biomedicine, 18001 Granada (Spain); Oldfield, Eric [University of Illinois at Urbana-Champaign, Urbana, IL 61801 (United States); Kaiser, Marcel [University of Basel, Petersplatz 1, CH-4003 Basel (Switzerland); Amzel, L. Mario, E-mail: mamzel@jhmi.edu [Johns Hopkins University School of Medicine, 725 N. Wolfe Street WBSB 604, Baltimore, MD 21205 (United States); Gabelli, Sandra B., E-mail: mamzel@jhmi.edu [Johns Hopkins University School of Medicine, 725 N. Wolfe Street WBSB 604, Baltimore, MD 21205 (United States); Johns Hopkins University School of Medicine, Baltimore, MD 21205 (United States); Johns Hopkins University, 725 North Wolfe Street WBSB 605, Baltimore, MD 21210 (United States)
2014-03-01
Structural insights into L. major farnesyl diphosphate synthase, a key enzyme in the mevalonate pathway, are described. Farnesyl diphosphate synthase (FPPS) is an essential enzyme involved in the biosynthesis of sterols (cholesterol in humans and ergosterol in yeasts, fungi and trypanosomatid parasites) as well as in protein prenylation. It is inhibited by bisphosphonates, a class of drugs used in humans to treat diverse bone-related diseases. The development of bisphosphonates as antiparasitic compounds targeting ergosterol biosynthesis has become an important route for therapeutic intervention. Here, the X-ray crystallographic structures of complexes of FPPS from Leishmania major (the causative agent of cutaneous leishmaniasis) with three bisphosphonates determined at resolutions of 1.8, 1.9 and 2.3 Å are reported. Two of the inhibitors, 1-(2-hydroxy-2,2-diphosphonoethyl)-3-phenylpyridinium (300B) and 3-butyl-1-(2,2-diphosphonoethyl)pyridinium (476A), co-crystallize with the homoallylic substrate isopentenyl diphosphate (IPP) and three Ca{sup 2+} ions. A third inhibitor, 3-fluoro-1-(2-hydroxy-2,2-diphosphonoethyl)pyridinium (46I), was found to bind two Mg{sup 2+} ions but not IPP. Calorimetric studies showed that binding of the inhibitors is entropically driven. Comparison of the structures of L. major FPPS (LmFPPS) and human FPPS provides new information for the design of bisphosphonates that will be more specific for inhibition of LmFPPS. The asymmetric structure of the LmFPPS–46I homodimer indicates that binding of the allylic substrate to both monomers of the dimer results in an asymmetric dimer with one open and one closed homoallylic site. It is proposed that IPP first binds to the open site, which then closes, opening the site on the other monomer, which closes after binding the second IPP, leading to the symmetric fully occupied FPPS dimer observed in other structures.
Effects of hypercapnia and NO synthase inhibition in sustained hypoxic pulmonary vasoconstriction
2012-01-01
Background Acute respiratory disorders may lead to sustained alveolar hypoxia with hypercapnia resulting in impaired pulmonary gas exchange. Hypoxic pulmonary vasoconstriction (HPV) optimizes gas exchange during local acute (0-30 min), as well as sustained (> 30 min) hypoxia by matching blood perfusion to alveolar ventilation. Hypercapnia with acidosis improves pulmonary gas exchange in repetitive conditions of acute hypoxia by potentiating HPV and preventing pulmonary endothelial dysfunction. This study investigated, if the beneficial effects of hypercapnia with acidosis are preserved during sustained hypoxia as it occurs, e.g in permissive hypercapnic ventilation in intensive care units. Furthermore, the effects of NO synthase inhibitors under such conditions were examined. Method We employed isolated perfused and ventilated rabbit lungs to determine the influence of hypercapnia with or without acidosis (pH corrected with sodium bicarbonate), and inhibitors of endothelial as well as inducible NO synthase on acute or sustained HPV (180 min) and endothelial permeability. Results In hypercapnic acidosis, HPV was intensified in sustained hypoxia, in contrast to hypercapnia without acidosis when HPV was amplified during both phases. L-NG-Nitroarginine (L-NNA), a non-selective NO synthase inhibitor, enhanced acute as well as sustained HPV under all conditions, however, the amplification of sustained HPV induced by hypercapnia with or without acidosis compared to normocapnia disappeared. In contrast 1400 W, a selective inhibitor of inducible NO synthase (iNOS), decreased HPV in normocapnia and hypercapnia without acidosis at late time points of sustained HPV and selectively reversed the amplification of sustained HPV during hypercapnia without acidosis. Hypoxic hypercapnia without acidosis increased capillary filtration coefficient (Kfc). This increase disappeared after administration of 1400 W. Conclusion Hypercapnia with and without acidosis increased HPV during
Effects of hypercapnia and NO synthase inhibition in sustained hypoxic pulmonary vasoconstriction
Directory of Open Access Journals (Sweden)
Ketabchi Farzaneh
2012-01-01
Full Text Available Abstract Background Acute respiratory disorders may lead to sustained alveolar hypoxia with hypercapnia resulting in impaired pulmonary gas exchange. Hypoxic pulmonary vasoconstriction (HPV optimizes gas exchange during local acute (0-30 min, as well as sustained (> 30 min hypoxia by matching blood perfusion to alveolar ventilation. Hypercapnia with acidosis improves pulmonary gas exchange in repetitive conditions of acute hypoxia by potentiating HPV and preventing pulmonary endothelial dysfunction. This study investigated, if the beneficial effects of hypercapnia with acidosis are preserved during sustained hypoxia as it occurs, e.g in permissive hypercapnic ventilation in intensive care units. Furthermore, the effects of NO synthase inhibitors under such conditions were examined. Method We employed isolated perfused and ventilated rabbit lungs to determine the influence of hypercapnia with or without acidosis (pH corrected with sodium bicarbonate, and inhibitors of endothelial as well as inducible NO synthase on acute or sustained HPV (180 min and endothelial permeability. Results In hypercapnic acidosis, HPV was intensified in sustained hypoxia, in contrast to hypercapnia without acidosis when HPV was amplified during both phases. L-NG-Nitroarginine (L-NNA, a non-selective NO synthase inhibitor, enhanced acute as well as sustained HPV under all conditions, however, the amplification of sustained HPV induced by hypercapnia with or without acidosis compared to normocapnia disappeared. In contrast 1400 W, a selective inhibitor of inducible NO synthase (iNOS, decreased HPV in normocapnia and hypercapnia without acidosis at late time points of sustained HPV and selectively reversed the amplification of sustained HPV during hypercapnia without acidosis. Hypoxic hypercapnia without acidosis increased capillary filtration coefficient (Kfc. This increase disappeared after administration of 1400 W. Conclusion Hypercapnia with and without acidosis
International Nuclear Information System (INIS)
Miziorko, H.M.; Behnke, C.E.
1985-01-01
3-Chloropropionyl coenzyme A (3-chloropropionyl-CoA) irreversibly inhibits avian liver 3-hydroxy-3-methylglutaryl-CoA synthase (HMG-CoA synthase). Enzyme inactivation follows pseudo-first-order kinetics and is retarded in the presence of substrates, suggesting that covalent labeling occurs at the active site. A typical rate saturation effect is observed when inactivation kinetics are measured as a function of 3-chloropropionyl-CoA concentration. These data indicate a Ki = 15 microM for the inhibitor and a limiting kinact = 0.31 min-1. [1- 14 C]-3-Chloropropionyl-CoA binds covalently to the enzyme with a stoichiometry (0.7 per site) similar to that measured for acetylation of the enzyme by acetyl-CoA. While the acetylated enzyme formed upon incubation of HMG-CoA synthase with acetyl-CoA is labile to performic acid oxidation, the adduct formed upon 3-chloropropionyl-CoA inactivation is stable to such treatment. Therefore, such an adduct cannot solely involve a thio ester linkage. Exhaustive Pronase digestion of [ 14 C]-3-chloropropionyl-CoA-labeled enzyme produces a radioactive compound which cochromatographs with authentic carboxyethylcysteine using reverse-phase/ion-pairing high-pressure liquid chromatography and both silica and cellulose thin-layer chromatography systems. This suggests that enzyme inactivation is due to alkylation of an active-site cysteine residue
Directory of Open Access Journals (Sweden)
Maolong Hu
Full Text Available Acetohydroxyacid synthase (AHAS, also called acetolactate synthase, is a key enzyme involved in the first step of the biosynthesis of the branched-chain amino acids valine, isoleucine and leucine. Acetohydroxyacid synthase-inhibiting herbicides (AHAS herbicides are five chemical families of herbicides that inhibit AHAS enzymes, including imidazolinones (IMI, sulfonylureas (SU, pyrimidinylthiobenzoates, triazolinones and triazolopyrimidines. Five AHAS genes have been identified in rapeseed, but little information is available regarding the role of miRNAs in response to AHAS herbicides. In this study, an AHAS herbicides tolerant genotype and a sensitive genotype were used for miRNA comparative analysis. A total of 20 small RNA libraries were obtained of these two genotypes at three time points (0h, 24 h and 48 h after spraying SU and IMI herbicides with two replicates. We identified 940 conserved miRNAs and 1515 novel candidate miRNAs in Brassica napus using high-throughput sequencing methods combined with computing analysis. A total of 3284 genes were predicted to be targets of these miRNAs, and their functions were shown using GO, KOG and KEGG annotations. The differentiation expression results of miRNAs showed almost twice as many differentiated miRNAs were found in tolerant genotype M342 (309 miRNAs after SU herbicide application than in sensitive genotype N131 (164 miRNAs. In additiond 177 and 296 miRNAs defined as differentiated in sensitive genotype and tolerant genotype in response to SU herbicides. The miR398 family was observed to be associated with AHAS herbicide tolerance because their expression increased in the tolerant genotype but decreased in the sensitive genotype. Moreover, 50 novel miRNAs from 39 precursors were predicted. There were 8 conserved miRNAs, 4 novel miRNAs and 3 target genes were validated by quantitative real-time PCR experiment. This study not only provides novel insights into the miRNA content of AHAS herbicides
Taguchi, Yoshimitsu; Kondo, Tadakazu; Watanabe, Mitsumasa; Miyaji, Michihiko; Umehara, Hisanori; Kozutsumi, Yasunori; Okazaki, Toshiro
2004-11-15
Interleukin 2 (IL-2) rescued human natural killer (NK) KHYG-1 cells from apoptosis along with a reduction of ceramide. Conversely, an increase of ceramide inhibited IL-2-rescued survival. IL-2 deprivation-induced activation of acid sphingomyelinase (SMase) and inhibition of glucosylceramide synthase (GCS) and sphingomyelin synthase (SMS) were normalized by IL-2 supplementation. A phosphatidyl inositol-3 (PI-3) kinase inhibitor, LY294002, inhibited IL-2-rescued survival, but a mitogen-activated protein kinase inhibitor, PD98059, and an inhibitor of Janus tyrosine kinase/signal transducer and activator of transcription pathway, AG490, did not. LY294002 inhibited IL-2-induced reduction of ceramide through activation of acid SMase and inhibition of GCS and SMS, suggesting the positive involvement of PI-3 kinase in ceramide reduction through enzymatic regulation. Indeed, a constitutively active PI-3 kinase enhanced growth rate and ceramide reduction through inhibition of acid SMase and activation of GCS and SMS. Further, LY294002 inhibited IL-2-induced changes of transcriptional level as well as mRNA and protein levels in acid SMase and GCS but did not affect the stability of the mRNAs. These results suggest that PI-3 kinase-dependent reduction of ceramide through regulation of acid SMase, GCS, and SMS plays a role in IL-2-rescued survival of NK cells.
Beurel, Eléonore; Grieco, Steven F; Amadei, Celeste; Downey, Kimberlee; Jope, Richard S
2016-01-01
Objectives Sub-anesthetic doses of ketamine have been found to provide rapid antidepressant actions, indicating that the cellular signaling systems targeted by ketamine are potential sites for therapeutic intervention. Ketamine acts as an antagonist of N-methyl-D-aspartate (NMDA) receptors, and animal studies indicate that subsequent augmentation of signaling by α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptors is critical for the antidepressant outcome. Methods In this study, we tested if the inhibitory effect of ketamine on glycogen synthase kinase-3 (GSK3) affected hippocampal cell-surface AMPA receptors using immunoblotting of membrane and synaptosomal extracts from wild-type and GSK3 knockin mice. Results Treatment with an antidepressant dose of ketamine increased the hippocampal membrane level of the AMPA glutamate receptor (GluA)1 subunit, but did not alter the localization of GluA2, GluA3, or GluA4. This effect of ketamine was abrogated in GSK3 knockin mice expressing mutant GSK3 that cannot be inhibited by ketamine, demonstrating that ketamine-induced inhibition of GSK3 is necessary for up-regulation of cell surface AMPA GluA1 subunits. AMPA receptor trafficking is regulated by post-synaptic density-95 (PSD-95), a substrate for GSK3. Ketamine treatment decreased the hippocampal membrane level of phosphorylated PSD-95 on Thr-19, the target of GSK3 that promotes AMPA receptor internalization. Conclusions These results demonstrate that ketamine-induced inhibition of GSK3 causes reduced phosphorylation of PSD-95, diminishing the internalization of AMPA GluA1 subunits to allow for augmented signaling through AMPA receptors following ketamine treatment. PMID:27687706
Wang, Qiang; Du, Xia; Zhou, Bingjie; Li, Jing; Lu, Wenlong; Chen, Qiuyun; Gao, Jing
2017-12-01
Targeting cellular metabolism is becoming a hallmark to overcome drug resistance in breast cancer treatment. Activation of fatty acid synthase (FASN) has been shown to promote breast cancer cell growth. However, there is no concrete report underlying the mechanism associated with mitochondrial dysfunction in relation to fatty acid synthase inhibition-induced apoptosis in breast cancer cells. The current study is aimed at exploring the effect of the novel manganese (Mn) complex, labeled as PdpaMn, on lipid metabolism and mitochondrial function in breast cancer cells. Herein, we observed that PdpaMn displayed strong cytotoxicity on breast cancer cell lines and selectively targeted the tumor without affecting the normal organs or cells in vivo. We also observed that PdpaMn could bind to TE domain of FASN and decrease the activity and the level of expression of FASN, which is an indication that FASN could serve as a target of PdpaMn. In addition, we demonstrated that PdpaMn increased intrinsic apoptosis in breast cancer cells relayed by a suppressed the level of expression of FASN, followed by the release of mitochondrial cytochrome c and the activation of caspases-9. Instigated by the above observations, we hypothesized that PdpaMn-induced apoptosis events are dependent on mitochondrial dysfunction. Indeed, we found that mitochondrial membrane potential (MMP) collapse, mitochondrial oxygen consumption reduction and adenosine triphosphate (ATP) release were deeply repressed. Furthermore, our results showed that PdpaMn significantly increased the reactive oxygen species (ROS) production, and the protection conferred by the free radical scavenger N-acetyl-cysteine (NAC) indicates that PdpaMn-induced apoptosis through an oxidative stress-associated mechanism. More so, the above results have demonstrated that mitochondrial dysfunction participated in FASN inhibition-induce apoptosis in breast cancer cells by PdpaMn. Therefore, PdpaMn may be considered as a good candidate
Inami, Yoshihiro; Omura, Mitsuru; Kubota, Kenta; Konishi, Yoshiyuki
2018-07-01
Recent studies have uncovered various molecules that play key roles in neuronal morphogenesis. Nevertheless, the mechanisms underlying the neuron-type-dependent regulation of morphogenesis remain unknown. We have previously reported that inhibition of glycogen synthase kinase-3 (GSK3) markedly reduced axonal length of cerebellar granule neurons (CGNs) in a neuron-type-dependent manner. In the present study, we investigated the mechanisms by which the growth of CGN axons was severely suppressed upon GSK3 inhibition. Using time-lapse imaging of cultured CGNs at early morphogenesis, we found that extension of the leading process was severely inhibited by the pharmacological inhibition of GSK3. The rate of somal migration was also reduced with a GSK3 inhibitor in dissociated culture as well as in microexplant culture. In addition, CGNs ectopically expressed with a catalytically inactive mutant of GSK3 exhibited a migration defect in vivo. In axonal leading processes of CGNs, detyrosination and acetylation of α-tubulin, which are known to correlate with microtubule stability, were decreased by GSK3 inhibition. A photoconversion analysis found that inhibition of GSK3 increases the turnover of microtubules. Furthermore, in the presence of paclitaxel, a microtubule-stabilizing reagent, inhibition of GSK3 recovered the axonal leading process extension that was reduced by paclitaxel. Our results suggest that GSK3 supports the extension of axonal processes by stabilizing microtubules, contrary to its function in other neuron-types, lending mechanical insight into neuron-type-dependent morphological regulation. Copyright © 2018 Elsevier B.V. All rights reserved.
ATP Synthase, a Target for Dementia and Aging?
Larrick, James W; Larrick, Jasmine W; Mendelsohn, Andrew R
2018-02-01
Advancing age is the biggest risk factor for development for the major life-threatening diseases in industrialized nations accounting for >90% of deaths. Alzheimer's dementia (AD) is among the most devastating. Currently approved therapies fail to slow progression of the disease, providing only modest improvements in memory. Recently reported work describes mechanistic studies of J147, a promising therapeutic molecule previously shown to rescue the severe cognitive deficits exhibited by aged, transgenic AD mice. Apparently, J147 targets the mitochondrial alpha-F1-ATP synthase (ATP5A). Modest inhibition of the ATP synthase modulates intracellular calcium to activate AMP-activated protein kinase to inhibit mammalian target of rapamycin, a known mechanism of lifespan extension from worms to mammals.
Blokland, A; de Vente, J; Prickaerts, J; Honig, W; Markerink-van Ittersum, M; Steinbusch, H
1999-01-01
Recent studies have provided evidence that nitric oxide (NO) has a role in certain forms of memory formation. Spatial learning is one of the cognitive abilities that has been found to be impaired after systemic administration of an NO-synthase inhibitor. As the hippocampus has a pivotal role in spatial orientation, the present study examined the role of hippocampal NO in spatial learning and reversal learning in a Morris task in adult rats. It was found that N omega-nitro-L-arginine infusions into the dorsal hippocampus affected the manner in which the rats were searching the submerged platform during training, but did not affect the efficiency to find the spatial location of the escape platform. Hippocampal NO-synthase inhibition did not affect the learning of a new platform position in the same water tank (i.e. reversal learning). Moreover, no treatment effects were observed in the probe trials (i.e. after acquisition and after reversal learning), indicating that the rats treated with N omega-nitro-L-arginine had learned the spatial location of the platform. These findings were obtained under conditions where the NO synthesis in the dorsal hippocampus was completely inhibited. On the basis of the present data it was concluded that hippocampal NO is not critically involved in place learning in rats.
Effects of hypercapnia and NO synthase inhibition in sustained hypoxic pulmonary vasoconstriction.
Ketabchi, Farzaneh; Ghofrani, Hossein A; Schermuly, Ralph T; Seeger, Werner; Grimminger, Friedrich; Egemnazarov, Bakytbek; Shid-Moosavi, S Mostafa; Dehghani, Gholam A; Weissmann, Norbert; Sommer, Natascha
2012-01-31
Acute respiratory disorders may lead to sustained alveolar hypoxia with hypercapnia resulting in impaired pulmonary gas exchange. Hypoxic pulmonary vasoconstriction (HPV) optimizes gas exchange during local acute (0-30 min), as well as sustained (> 30 min) hypoxia by matching blood perfusion to alveolar ventilation. Hypercapnia with acidosis improves pulmonary gas exchange in repetitive conditions of acute hypoxia by potentiating HPV and preventing pulmonary endothelial dysfunction. This study investigated, if the beneficial effects of hypercapnia with acidosis are preserved during sustained hypoxia as it occurs, e.g in permissive hypercapnic ventilation in intensive care units. Furthermore, the effects of NO synthase inhibitors under such conditions were examined. We employed isolated perfused and ventilated rabbit lungs to determine the influence of hypercapnia with or without acidosis (pH corrected with sodium bicarbonate), and inhibitors of endothelial as well as inducible NO synthase on acute or sustained HPV (180 min) and endothelial permeability. In hypercapnic acidosis, HPV was intensified in sustained hypoxia, in contrast to hypercapnia without acidosis when HPV was amplified during both phases. L-NG-Nitroarginine (L-NNA), a non-selective NO synthase inhibitor, enhanced acute as well as sustained HPV under all conditions, however, the amplification of sustained HPV induced by hypercapnia with or without acidosis compared to normocapnia disappeared. In contrast 1400 W, a selective inhibitor of inducible NO synthase (iNOS), decreased HPV in normocapnia and hypercapnia without acidosis at late time points of sustained HPV and selectively reversed the amplification of sustained HPV during hypercapnia without acidosis. Hypoxic hypercapnia without acidosis increased capillary filtration coefficient (Kfc). This increase disappeared after administration of 1400 W. Hypercapnia with and without acidosis increased HPV during conditions of sustained hypoxia. The
Pizer, E S; Thupari, J; Han, W F; Pinn, M L; Chrest, F J; Frehywot, G L; Townsend, C A; Kuhajda, F P
2000-01-15
A biologically aggressive subset of human breast cancers and other malignancies is characterized by elevated fatty-acid synthase (FAS) enzyme expression, elevated fatty acid (FA) synthesis, and selective sensitivity to pharmacological inhibition of FAS activity by cerulenin or the novel compound C75. In this study, inhibition of FA synthesis at the physiologically regulated step of carboxylation of acetyl-CoA to malonyl-CoA by 5-(tetradecyloxy)-2-furoic acid (TOFA) was not cytotoxic to breast cancer cells in clonogenic assays. FAS inhibitors induced a rapid increase in intracellular malonyl-CoA to several fold above control levels, whereas TOFA reduced intracellular malonyl-CoA by 60%. Simultaneous exposure of breast cancer cells to TOFA and an FAS inhibitor resulted in significantly reduced cytotoxicity and apoptosis. Subcutaneous xenografts of MCF7 breast cancer cells in nude mice treated with C75 showed FA synthesis inhibition, apoptosis, and inhibition of tumor growth to less than 1/8 of control volumes, without comparable toxicity in normal tissues. The data suggest that differences in intermediary metabolism render tumor cells susceptible to toxic fluxes in malonyl-CoA, both in vitro and in vivo.
Crous-Masó, Joan; Palomeras, Sònia; Relat, Joana; Camó, Cristina; Martínez-Garza, Úrsula; Planas, Marta; Feliu, Lidia; Puig, Teresa
2018-05-11
(-)-Epigallocatechin 3-gallate (EGCG) is a natural polyphenol from green tea with reported anticancer activity and capacity to inhibit the lipogenic enzyme fatty acid synthase (FASN), which is overexpressed in several human carcinomas. To improve the pharmacological profile of EGCG, we previously developed a family of EGCG derivatives and the lead compounds G28, G37 and G56 were characterized in HER2-positive breast cancer cells overexpressing FASN. Here, diesters G28, G37 and G56 and two G28 derivatives, monoesters M1 and M2, were synthesized and assessed in vitro for their cytotoxic, FASN inhibition and apoptotic activities in MDA-MB-231 triple-negative breast cancer (TNBC) cells. All compounds displayed moderate to high cytotoxicity and significantly blocked FASN activity, monoesters M1 and M2 being more potent inhibitors than diesters. Interestingly, G28, M1, and M2 also diminished FASN protein expression levels, but only monoesters M1 and M2 induced apoptosis. Our results indicate that FASN inhibition by such polyphenolic compounds could be a new strategy in TNBC treatment, and highlight the potential anticancer activities of monoesters. Thus, G28, G37, G56, and most importantly M1 and M2, are anticancer candidates (alone or in combination) to be further characterized in vitro and in vivo.
Giménez-Cassina, Alfredo; Lim, Filip; Díaz-Nido, Javier
2012-12-07
Mitochondrial dysfunction is a common feature of many neurodegenerative disorders. Likewise, activation of glycogen synthase kinase-3 (GSK-3) has been proposed to play an important role in neurodegeneration. This multifunctional protein kinase is involved in a number of cellular functions and we previously showed that chronic inhibition of GSK-3 protects neuronal cells against mitochondrial dysfunction-elicited cell death, through a mechanism involving increased glucose metabolism and the translocation of hexokinase II (HKII) to mitochondria. Here, we sought to gain deeper insight into the molecular basis of this neuroprotection. We found that chronic inhibition of GSK-3, either genetically or pharmacologically, elicited a marked increase in brain-derived neurotrophic factor (BDNF) secretion, which in turn conferred resistance to mitochondrial dysfunction through subcellular re-distribution of HKII. These results define a molecular pathway through which chronic inhibition of GSK-3 may protect neuronal cells from death. Moreover, they highlight the potential benefits of enhanced neurotrophic factor secretion as a therapeutic approach to treat neurodegenerative diseases. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Feyt, Christine; Kienlen-Campard, Pascal; Leroy, Karelle; N'Kuli, Francisca; Courtoy, Pierre J; Brion, Jean-Pierre; Octave, Jean-Noël
2005-09-30
Glycogen synthase kinase 3 (GSK3) is able to phosphorylate tau at many sites that are found to be phosphorylated in paired helical filaments in Alzheimer disease. Lithium chloride (LiCl) efficiently inhibits GSK3 and was recently reported to also decrease the production of amyloid-beta peptide (Abeta) from its precursor, the amyloid precursor protein. Therefore, lithium has been proposed as a combined therapeutic agent, inhibiting both the hyperphosphorylation of tau and the production of Abeta. Here, we demonstrate that the inhibition of GSK3 by LiCl induced the nuclear translocation of beta-catenin in Chinese hamster ovary cells and rat cultured neurons, in which a decrease in tau phosphorylation was observed. In both cellular models, a nontoxic concentration of LiCl increased the production of Abeta by increasing the beta-cleavage of amyloid precursor protein, generating more substrate for an unmodified gamma-secretase activity. SB415286, another GSK3 inhibitor, induced the nuclear translocation of beta-catenin and slightly decreased Abeta production. It is concluded that the LiCl-mediated increase in Abeta production is not related to GSK3 inhibition.
Reish, O; Townsend, D; Berry, S A; Tsai, M Y; King, R A
1995-01-01
Deficiency of cystathionine beta-synthase (CBS) is a genetic disorder of transsulfuration resulting in elevated plasma homocyst(e)ine and methionine and decreased cysteine. Affected patients have multisystem involvement, which may include light skin and hair. Reversible hypopigmentation in treated homocystinuric patients has been infrequently reported, and the mechanism is undefined. Two CBS-deficient homocystinuric patients manifested darkening of their hypopigmented hair following treatment that decreased plasma homocyst(e)ine. We hypothesized that homocyst(e)ine inhibits tyrosinase, the major pigment enzyme. The activity of tyrosinase extracted from pigmented human melanoma cells (MNT-1) that were grown in the presence of homocysteine was reduced in comparison to that extracted from cells grown without homocysteine. Copper sulfate restored homocyst(e)ine-inhibited tyrosinase activity when added to the culture cell media at a proportion of 1.25 mol of copper sulfate per 1 mol of DL-homocysteine. Holo-tyrosinase activity was inhibited by adding DL-homocysteine to the assay reaction mixture, and the addition of copper sulfate to the reaction mixture prevented this inhibition. Other tested compounds, L-cystine and betaine did not affect tyrosinase activity. Our data suggest that reversible hypopigmentation in homocystinuria is the result of tyrosinase inhibition by homocyst(e)ine and that the probable mechanism of this inhibition is the interaction of homocyst(e)ine with copper at the active site of tyrosinase. Images Figure 1 PMID:7611281
An, Jie; Woodward, Joshua J; Sasaki, Tomikazu; Minie, Mark; Elkon, Keith B
2015-05-01
Type I IFN is strongly implicated in the pathogenesis of systemic autoimmune diseases, such as lupus, and rare monogenic IFNopathies, including Aicardi-Goutières syndrome. Recently, a new DNA-activated pathway involving the enzyme cyclic GMP-AMP synthase (cGAS) was described and potentially linked to Aicardi-Goutières syndrome. To identify drugs that could potentially inhibit cGAS activity, we performed in silico screening of drug libraries. By computational analysis, we identified several antimalarial drugs (AMDs) that were predicted to interact with the cGAS/dsDNA complex. Our studies validated that several AMDs were effective inhibitors of IFN-β production and that they functioned by inhibiting dsDNA stimulation of cGAS. Because AMDs have been widely used in human diseases and have an excellent safety profile, our findings suggest new therapeutic strategies for the treatment of severe debilitating diseases associated with type I IFNs due to cGAS activation. Copyright © 2015 by The American Association of Immunologists, Inc.
Redox Switch for the Inhibited State of Yeast Glycogen Synthase Mimics Regulation by Phosphorylation
Energy Technology Data Exchange (ETDEWEB)
Mahalingan, Krishna K.; Baskaran, Sulochanadevi; DePaoli-Roach, Anna A.; Roach, Peter J.; Hurley, Thomas D. (Indiana-Med)
2017-01-10
Glycogen synthase (GS) is the rate limiting enzyme in the synthesis of glycogen. Eukaryotic GS is negatively regulated by covalent phosphorylation and allosterically activated by glucose-6-phosphate (G-6-P). To gain structural insights into the inhibited state of the enzyme, we solved the crystal structure of yGsy2-R589A/R592A to a resolution of 3.3 Å. The double mutant has an activity ratio similar to the phosphorylated enzyme and also retains the ability to be activated by G-6-P. When compared to the 2.88 Å structure of the wild-type G-6-P activated enzyme, the crystal structure of the low-activity mutant showed that the N-terminal domain of the inhibited state is tightly held against the dimer-related interface thereby hindering acceptor access to the catalytic cleft. On the basis of these two structural observations, we developed a reversible redox regulatory feature in yeast GS by substituting cysteine residues for two highly conserved arginine residues. When oxidized, the cysteine mutant enzyme exhibits activity levels similar to the phosphorylated enzyme but cannot be activated by G-6-P. Upon reduction, the cysteine mutant enzyme regains normal activity levels and regulatory response to G-6-P activation.
Michel, J B; Feron, O; Sase, K; Prabhakar, P; Michel, T
1997-10-10
Nitric oxide is synthesized in diverse mammalian tissues by a family of calmodulin-dependent nitric oxide synthases. The endothelial isoform of nitric oxide synthase (eNOS) is targeted to the specialized signal-transducing membrane domains termed plasmalemmal caveolae. Caveolin, the principal structural protein in caveolae, interacts with eNOS and leads to enzyme inhibition in a reversible process modulated by Ca2+-calmodulin (Michel, J. B., Feron, O., Sacks, D., and Michel, T. (1997) J. Biol. Chem. 272, 15583-15586). Caveolin also interacts with other structurally distinct signaling proteins via a specific region identified within the caveolin sequence (amino acids 82-101) that appears to subserve the role of a "scaffolding domain." We now report that the co-immunoprecipitation of eNOS with caveolin is completely and specifically blocked by an oligopeptide corresponding to the caveolin scaffolding domain. Peptides corresponding to this domain markedly inhibit nitric oxide synthase activity in endothelial membranes and interact directly with the enzyme to inhibit activity of purified recombinant eNOS expressed in Escherichia coli. The inhibition of purified eNOS by the caveolin scaffolding domain peptide is competitive and completely reversed by Ca2+-calmodulin. These studies establish that caveolin, via its scaffolding domain, directly forms an inhibitory complex with eNOS and suggest that caveolin inhibits eNOS by abrogating the enzyme's activation by calmodulin.
Kommareddy, M; McAllister, R M; Ganjam, V K; Turk, J R; Laughlin, M Harold
2011-11-01
The objective of this study was to investigate the effects of chronic inhibition of nitric oxide synthase (NOS) on cyclooxygenase-2 (COX-2) expression in the macula densa (MD) of swine, as well as the effects on expression of related proteins. Adult female Yucatan swine were given either tap water (control, n = 6) or water with N (G)-nitro-L-arginine methyl ester (L-NAME, 100 mg/liter, n = 5) for a minimum of 30 days. Duplicate samples of kidney were fixed or snap frozen. There was a significant (P = .0082) upregulation of COX-2 mRNA expression in the MD of L-NAME, as well as an apparent increase in COX-2 protein. Plasma renin activity also increased with L-NAME treatment (control, 0.34 ± 0.08 ng/ml; L-NAME, 1.26 ± 0.03 ng/ml; P = .00000003). There were no differences between groups in expression of either inducible NOS or renin protein or in serum electrolyte concentrations. In conclusion, with chronic inhibition of NOS, COX-2 in MD is upregulated, perhaps to compensate for loss of nitric oxide. Increases in COX-2 products may counteract renal arteriolar constriction and sustain renin release.
Directory of Open Access Journals (Sweden)
Joan Crous-Masó
2018-05-01
Full Text Available (−-Epigallocatechin 3-gallate (EGCG is a natural polyphenol from green tea with reported anticancer activity and capacity to inhibit the lipogenic enzyme fatty acid synthase (FASN, which is overexpressed in several human carcinomas. To improve the pharmacological profile of EGCG, we previously developed a family of EGCG derivatives and the lead compounds G28, G37 and G56 were characterized in HER2-positive breast cancer cells overexpressing FASN. Here, diesters G28, G37 and G56 and two G28 derivatives, monoesters M1 and M2, were synthesized and assessed in vitro for their cytotoxic, FASN inhibition and apoptotic activities in MDA-MB-231 triple-negative breast cancer (TNBC cells. All compounds displayed moderate to high cytotoxicity and significantly blocked FASN activity, monoesters M1 and M2 being more potent inhibitors than diesters. Interestingly, G28, M1, and M2 also diminished FASN protein expression levels, but only monoesters M1 and M2 induced apoptosis. Our results indicate that FASN inhibition by such polyphenolic compounds could be a new strategy in TNBC treatment, and highlight the potential anticancer activities of monoesters. Thus, G28, G37, G56, and most importantly M1 and M2, are anticancer candidates (alone or in combination to be further characterized in vitro and in vivo.
Purification and characterization of CDP-diacylglycerol synthase from Saccharomyces cerevisiae
International Nuclear Information System (INIS)
Kelley, M.J.; Carman, G.M.
1987-01-01
The membrane-associated phospholipid biosynthetic enzyme CDP-diacylglycerol synthase (CTP:phosphatidate cytidylyltransferase was purified 2300-fold from Saccharomyces cerevisiae. The purification procedure included Triton X-100 solubilization of mitochondrial membranes, CDP-diacylglycerol-Sepharose affinity chromatography, and hydroxylapatite chromatography. The procedure resulted in a nearly homogeneous enzyme preparation as determined by native and sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Radiation inactivation of mitochondrial associated and purified CDP-diacylglycerol synthase suggested that the molecular weight of the native enzyme was 114,000. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of the purified enzyme preparation yielded two subunits with molecular weights of 56,000 and 54,000. Antibodies prepared against the purified enzyme immunoprecipitated CDP-diacylglycerol synthase activity and subunits. CDP-diacylglycerol synthase activity was dependent on magnesium ions and Triton X-100 at pH 6.5. Thio-reactive agents inhibited activity. The activation energy for the reaction was 9 kcal/mol, and the enzyme was thermally labile above 30 degrees C. The Km values for CTP and phosphatidate were 1 and 0.5 mM, respectively, and the Vmax was 4700 nmol/min/mg. Results of kinetic and isotopic exchange reactions suggested that the enzyme catalyzes a sequential Bi Bi reaction mechanism
Jones, Sara E; Whitehead, Kristi; Saulnier, Delphine; Thomas, Carissa M; Versalovic, James; Britton, Robert A
2011-01-01
Although commensal microbes have been shown to modulate host immune responses, many of the bacterial factors that mediate immune regulation remain unidentified. Select strains of human-derived Lactobacillus reuteri synthesize immunomodulins that potently inhibit production of the inflammatory cytokine TNF. In this study, genetic and genomic approaches were used to identify and investigate L. reuteri genes required or human TNF immunomodulatory activity. Analysis of membrane fatty acids from multiple L. reuteri strains cultured in MRS medium showed that only TNF inhibitory strains produced the cyclopropane fatty acid (CFA) lactobacillic acid. The enzyme cyclopropane fatty acid synthase is required for synthesis of CFAs such as lactobacillic acid, therefore the cfa gene was inactivated and supernatants from the cfa mutant strain were assayed for TNF inhibitory activity. We found that supernatants from the wild-type strain, but not the cfa mutant, suppressed TNF production by activated THP-1 human monocytoid cells Although this suggested a direct role for lactobacillic acid in immunomodulation, purified lactobacillic acid did not suppress TNF at physiologically relevant concentrations. We further analyzed TNF inhibitory and TNF non-inhibitory strains under different growth conditions and found that lactobacillic acid production did not correlate with TNF inhibition. These results indicate that cfa indirectly contributed to L. reuter immunomodulatory activity and suggest that other mechanisms, such as decreased membrane fluidity or altered expression of immunomodulins, result in the loss of TNF inhibitory activity. By increasing our understanding of immunomodulation by probiotic species, beneficial microbes can be rationally selected to alleviate intestinal inflammation.
Directory of Open Access Journals (Sweden)
Stefanie V Schütz
Full Text Available In order to generate genomic signals, the androgen receptor (AR has to be transported into the nucleus upon androgenic stimuli. However, there is evidence from in vitro experiments that in castration-resistant prostate cancer (CRPC cells the AR is able to translocate into the nucleus in a ligand-independent manner. The recent finding that inhibition of the glycogen-synthase-kinase 3β (GSK-3β induces a rapid nuclear export of the AR in androgen-stimulated prostate cancer cells prompted us to analyze the effects of a GSK-3β inhibition in the castration-resistant LNCaP sublines C4-2 and LNCaP-SSR. Both cell lines exhibit high levels of nuclear AR in the absence of androgenic stimuli. Exposure of these cells to the maleimide SB216763, a potent GSK-3β inhibitor, resulted in a rapid nuclear export of the AR even under androgen-deprived conditions. Moreover, the ability of C4-2 and LNCaP-SSR cells to grow in the absence of androgens was diminished after pharmacological inhibition of GSK-3β in vitro. The ability of SB216763 to modulate AR signalling and function in CRPC in vivo was additionally demonstrated in a modified chick chorioallantoic membrane xenograft assay after systemic delivery of SB216763. Our data suggest that inhibition of GSK-3β helps target the AR for export from the nucleus thereby diminishing the effects of mislocated AR in CRPC cells. Therefore, inhibition of GSK-3β could be an interesting new strategy for the treatment of CRPC.
Tu, Chengyi; Xu, Robert; Koleti, Meghana; Zoldan, Janet
2017-08-01
Inhibition of glycogen synthase kinase 3 (GSK3) is an extensively used strategy to activate Wnt pathway for pluripotent stem cell (PSC) differentiation. However, the effects of such inhibition on PSCs, besides upregulating the Wnt pathway, have rarely been investigated despite that GSK3 is broadly involved in other cellular activities such as insulin signaling and cell growth/survival regulation. Here we describe a previously unknown synergistic effect between GSK3 inhibition (e.g., Chir99021 and LY2090314) and various normally non-toxic thiol-containing antioxidants (e.g., N-acetylcysteine, NAC) on the induction of apoptosis in human induced pluripotent stem cells (iPSCs). Neither Chir99021 nor the antioxidants individually induced significant apoptosis, whereas their combined treatment resulted in rapid and extensive apoptosis, with substantial caspase 3 activity observed within 3h and over 90% decrease in cell viability after 24h. We confirmed the generality of this phenomenon with multiple independent iPSCs lines, various thiol-based antioxidants and distinct GSK3 inhibitors. Mechanistically, we demonstrated that rapamycin treatment could substantially reduce cell death, suggesting the critical role of mammalian target of rapamycin (mTOR). Akt dysregulation was also found to partially contribute to cell apoptosis but was not the primary cause. Further, this coordinated proapoptotic effect was not detected in mouse ESCs but was present in another human cells line: a breast cancer cell line (MDA-MB-231). Given the wide use of GSK3 inhibition in biomedical research: from iPSC differentiation to cancer intervention and the treatment of neuronal diseases, researchers can potentially take advantage of or avoid this synergistic effect for improved experimental or clinical outcome. Copyright © 2017. Published by Elsevier B.V.
Xu, Yang; Wang, Guan; Li, Chunjie; Zhang, Min; Zhao, Hang; Sheng, Jun; Shi, Wei
2012-01-01
Pu-erh tea undergoes a unique fermentation process and contains theabrownins, polysaccharides and caffeine; although it is unclear about which component is associated with the down regulation of nitric oxide levels or how this process is mediated. To address this question we examined the effects of pu-erh tea on nitric oxide synthase (NOS) genes. Cohorts of rats were separately given four-week treatments of water as control, pu-erh tea, or the tea components: theabrownins, caffeine or polysaccharides. Five experimental groups were injected with lipopolysaccharides (LPS) to induce nitric oxide (NO) production, while the corresponding five control groups were injected with saline as a negative control. The serum and liver NO concentrations were examined and the NOS expression of both mRNA and protein was measured in liver. The results showed that the rats which were fed pu-erh tea or polysaccharides had lower levels of NO which corresponded with the down-regulation of inducible nitric oxide synthase (iNOS) expression. We further demonstrate that this effect is mediated through reduction of Toll-like receptor 4 (TLR4) signaling. Thus we find that the polysaccharide components in pu-erh tea reduce NO levels in an animal model by inhibiting the iNOS expression via signaling through TLR4. PMID:22837686
Moyo, Rejoice; Chimponda, Theresa; Mukanganyama, Stanley
2014-07-05
Hematopoietic prostaglandin D2 synthase (H-PGDS, GST Sigma) is a member of the glutathione S-transferase super family of enzymes that catalyses the conjugation of electrophilic substances with reduced glutathione. The enzyme catalyses the conversion of PGH2 to PGD2 which mediates inflammatory responses. The inhibition of H-PGDS is of importance in alleviating damage to tissues due to unwarranted synthesis of PGD2. Combretum molle has been used in African ethno medicinal practices and has been shown to reduce fever and pain. The effect of C. molle alkaloid extract on H-PGDS was thus, investigated. H-PGDS was expressed in Escherichia coli XL1-Blue cells and purified using nickel immobilized metal affinity chromatography. The effect of C. molle alkaloid extract on H-PGDS activity was determined with 1-chloro-2, 4-dinitrobenzene (CDNB) as substrate. The effect of C. molle alkaloid extract with time on H-PGDS was determined. The mechanism of inhibition was then investigated using CDNB and glutathione (GSH) as substrates. A specific activity of 24 μmol/mg/min was obtained after H-PGDS had been purified. The alkaloid extract exhibited a 70% inhibition on H-PGDS with an IC50 of 13.7 μg/ml. C. molle alkaloid extract showed an uncompetitive inhibition of H-PGDS with Ki = 41 μg/ml towards GSH, and non-competitive inhibition towards CDNB with Ki = 7.7 μg/ml and Ki' = 9.2 μg/ml. The data shows that C. molle alkaloid extract is a potent inhibitor of H-PGDS. This study thus supports the traditional use of the plant for inflammation.
Energy Technology Data Exchange (ETDEWEB)
Aslan, Mutay, E-mail: mutayaslan@akdeniz.edu.tr [Department of Medical Biochemistry, Akdeniz University Faculty of Medicine, Antalya (Turkey); Basaranlar, Goksun [Department of Biophysics, Akdeniz University Faculty of Medicine, Antalya (Turkey); Unal, Mustafa [Department of Ophthalmology, Akdeniz University Faculty of Medicine, Antalya (Turkey); Ciftcioglu, Akif [Department of Pathology, Akdeniz University Faculty of Medicine, Antalya (Turkey); Derin, Narin [Department of Biophysics, Akdeniz University Faculty of Medicine, Antalya (Turkey); Mutus, Bulent [Department of Chemistry and Biochemistry, University of Windsor, Windsor, Ontario (Canada)
2014-11-01
Endoplasmic reticulum (ER) stress and excessive nitric oxide production via induction of inducible nitric oxide synthase (NOS2) have been implicated in the pathogenesis of neuronal retinal cell death in ocular hypertension. Neutral sphingomyelinase (N-SMase)/ceramide pathway can regulate NOS2 expression, hence this study determined the role of selective neutral sphingomyelinase (N-SMase) inhibition on retinal NOS2 levels, ER stress, apoptosis and visual evoked potentials (VEPs) in a rat model of elevated intraocular pressure (EIOP). NOS2 expression and retinal protein nitration were significantly greater in EIOP and significantly decreased with N-SMase inhibition. A significant increase was observed in retinal ER stress markers pPERK, CHOP and GRP78 in EIOP, which were not significantly altered by N-SMase inhibition. Retinal TUNEL staining showed increased apoptosis in all EIOP groups; however N-SMase inhibition significantly decreased the percent of apoptotic cells in EIOP. Caspase-3, -8 and -9 activities were significantly increased in EIOP and returned to baseline levels following N-SMase inhibition. Latencies of all VEP components were significantly prolonged in EIOP and shortened following N-SMase inhibition. Data confirm the role of nitrative injury in EIOP and highlight the protective effect of N-SMase inhibition in EIOP via down-regulation of NOS2 levels and nitrative stress. - Highlights: • Inhibition of N-SMase decreases NOS2 levels in ocular hypertension. • Inhibition of N-SMase decreases protein nitration in ocular hypertension. • Inhibition of N-SMase decreases caspase activation in ocular hypertension. • Inhibition of N-SMase decreases apoptosis in ocular hypertension.
Petropoulos, Ioannis K; Pournaras, Jean-Antoine C; Stangos, Alexandros N; Pournaras, Constantin J
2009-01-01
To investigate the effect of systemic nitric oxide synthase (NOS) inhibition on optic disc oxygen partial pressure (PO(2)) in normoxia and hypercapnia. Intervascular optic disc PO(2) was measured in 12 anesthetized minipigs by using oxygen-sensitive microelectrodes placed 0.1), despite a 21% increase of mean arterial pressure. Optic disc PO(2) increase under hypercapnia was blunted after L-NAME injection (DeltaPO(2) = 0.6 +/- 1.1 mm Hg; 3%; P > 0.1), and this effect was reversible by L-arginine. Moreover, L-NAME reduced the response to carbogen by 29% (DeltaPO(2) = 9.1 +/- 4.4 mm Hg; 49%; P = 0.01 versus before L-NAME). The response to hyperoxia was not affected. Whereas systemic NOS inhibition did not affect optic disc PO(2) in normoxia, a blunting effect was noted on the CO(2)-induced optic disc PO(2) increase. Nitric oxide appears to mediate the hypercapnic optic disc PO(2) increase.
Activation of GABAB receptors inhibits protein kinase B /Glycogen Synthase Kinase 3 signaling
Directory of Open Access Journals (Sweden)
Lu Frances Fangjia
2012-11-01
Full Text Available Abstract Accumulated evidence has suggested that potentiation of cortical GABAergic inhibitory neurotransmission may be a key mechanism in the treatment of schizophrenia. However, the downstream molecular mechanisms related to GABA potentiation remain unexplored. Recent studies have suggested that dopamine D2 receptor antagonists, which are used in the clinical treatment of schizophrenia, modulate protein kinase B (Akt/glycogen synthase kinase (GSK-3 signaling. Here we report that activation of GABAB receptors significantly inhibits Akt/GSK-3 signaling in a β-arrestin-dependent pathway. Agonist stimulation of GABAB receptors enhances the phosphorylation of Akt (Thr-308 and enhances the phosphorylation of GSK-3α (Ser-21/β (Ser-9 in both HEK-293T cells expressing GABAB receptors and rat hippocampal slices. Furthermore, knocking down the expression of β-arrestin2 using siRNA abolishes the GABAB receptor-mediated modulation of GSK-3 signaling. Our data may help to identify potentially novel targets through which GABAB receptor agents may exert therapeutic effects in the treatment of schizophrenia.
Koo, Junghui; Yue, Ping; Gal, Anthony A; Khuri, Fadlo R; Sun, Shi-Yong
2014-05-01
mTOR kinase inhibitors that target both mTORC1 and mTORC2 are being evaluated in cancer clinical trials. Here, we report that glycogen synthase kinase-3 (GSK3) is a critical determinant for the therapeutic response to this class of experimental drugs. Pharmacologic inhibition of GSK3 antagonized their suppressive effects on the growth of cancer cells similarly to genetic attenuation of GSK3. Conversely, expression of a constitutively activated form of GSK3β sensitized cancer cells to mTOR inhibition. Consistent with these findings, higher basal levels of GSK3 activity in a panel of human lung cancer cell lines correlated with more efficacious responses. Mechanistic investigations showed that mTOR kinase inhibitors reduced cyclin D1 levels in a GSK3β-dependent manner, independent of their effects on suppressing mTORC1 signaling and cap binding. Notably, selective inhibition of mTORC2 triggered proteasome-mediated cyclin D1 degradation, suggesting that mTORC2 blockade is responsible for GSK3-dependent reduction of cyclin D1. Silencing expression of the ubiquitin E3 ligase FBX4 rescued this reduction, implicating FBX4 in mediating this effect of mTOR inhibition. Together, our findings define a novel mechanism by which mTORC2 promotes cell growth, with potential implications for understanding the clinical action of mTOR kinase inhibitors. ©2014 AACR.
DEFF Research Database (Denmark)
Christensen, Caspar Elo; Kragelund, Birthe B; von Wettstein-Knowles, Penny
2007-01-01
Two distinct ways of organizing fatty acid biosynthesis exist: the multifunctional type I fatty acid synthase (FAS) of mammals, fungi, and lower eukaryotes with activities residing on one or two polypeptides; and the dissociated type II FAS of prokaryotes, plastids, and mitochondria with individual...... activities encoded by discrete genes. The beta-ketoacyl [ACP] synthase (KAS) moiety of the mitochondrial FAS (mtKAS) is targeted by the antibiotic cerulenin and possibly by the other antibiotics inhibiting prokaryotic KASes: thiolactomycin, platensimycin, and the alpha-methylene butyrolactone, C75. The high...... degree of structural similarity between mitochondrial and prokaryotic KASes complicates development of novel antibiotics targeting prokaryotic KAS without affecting KAS domains of cytoplasmic FAS. KASes catalyze the C(2) fatty acid elongation reaction using either a Cys-His-His or Cys-His-Asn catalytic...
DEFF Research Database (Denmark)
Kjærsgaard, Gitte; Madsen, Kirsten; Marcussen, Niels
level significantly whereas total GSK-3β abundance was unaltered. Li+ treatment increased α-Smooth Muscle Actin (α-SMA) protein level significantly whereas E-cadherin expression was unaltered. In summary, Li+ treatment impairs postnatal development of the kidney cortex and outer medulla and increases pGSK......The postnatal rat kidney is highly susceptible to Lithium (Li+), which leads to significant tissue injury. We hypothesized that Li+ impairs development of the kidney through entry into epithelial cells of the distal nephron, inhibition of Glycogen Synthase Kinase-3β (GSK-3β) through phosphorylation...... on serine9 (pGSK-3β)and subsequent epithelial to mesenchymal dedifferentiation (EMT). GSK-3β immunoreactive protein was associated with collecting ducts in developing and adult human and rat kidney. Total GSK-3β protein abundance was stable in medulla while it decreased in cortex in the postnatal period...
Kobayashi, Soushi; Nakamura, Tomoe Y; Wakabayashi, Shigeo
2015-07-01
Cardiac hypertrophy is a leading cause of serious heart diseases. Although many signaling molecules are involved in hypertrophy, the functions of some proteins in this process are still unknown. Calcineurin B homologous protein 3 (CHP3)/tescalcin is an EF-hand Ca(2+)-binding protein that is abundantly expressed in the heart; however, the function of CHP3 is unclear. Here, we aimed to identify the cardiac functions of CHP3. CHP3 was expressed in hearts at a wide range of developmental stages and was specifically detected in neonatal rat ventricular myocytes (NRVMs) but not in cardiac fibroblasts in culture. Moreover, knockdown of CHP3 expression using adenoviral-based RNA interference in NRVMs resulted in enlargement of cardiomyocyte size, concomitant with increased expression of a pathological hypertrophy marker ANP. This same treatment elevated glycogen synthase kinase (GSK3α/β) phosphorylation, which is known to inhibit GSK3 function. In contrast, CHP3 overexpression blocked the insulin-induced phosphorylation of GSK3α/β without affecting the phosphorylation of Akt, which is an upstream kinase of GSK3α/β, in HEK293 cells, and it inhibited both IGF-1-induced phosphorylation of GSK3β and cardiomyocyte hypertrophy in NRVMs. Co-immunoprecipitation experiments revealed that GSK3β interacted with CHP3. However, a Ca(2+)-binding-defective mutation of CHP3 (CHP3-D123A) also interacted with GSK3β and had the same inhibitory effect on GSK3α/β phosphorylation, suggesting that the action of CHP3 was independent of Ca(2+). These findings suggest that CHP3 functions as a novel negative regulator of cardiomyocyte hypertrophy via inhibition of GSK3α/β phosphorylation and subsequent enzymatic activation of GSK3α/β. Copyright © 2015 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Manceur, Aziza P.; Tseng, Michael; Holowacz, Tamara; Witterick, Ian; Weksberg, Rosanna; McCurdy, Richard D.; Warsh, Jerry J.; Audet, Julie
2011-01-01
The olfactory epithelium (OE) contains neural precursor cells which can be easily harvested from a minimally invasive nasal biopsy, making them a valuable cell source to study human neural cell lineages in health and disease. Glycogen synthase kinase-3 (GSK-3) has been implicated in the etiology and treatment of neuropsychiatric disorders and also in the regulation of murine neural precursor cell fate in vitro and in vivo. In this study, we examined the impact of decreased GSK-3 activity on the fate of adult human OE neural precursors in vitro. GSK-3 inhibition was achieved using ATP-competitive (6-bromoindirubin-3'-oxime and CHIR99021) or substrate-competitive (TAT-eIF2B) inhibitors to eliminate potential confounding effects on cell fate due to off-target kinase inhibition. GSK-3 inhibitors decreased the number of neural precursor cells in OE cell cultures through a reduction in proliferation. Decreased proliferation was not associated with a reduction in cell survival but was accompanied by a reduction in nestin expression and a substantial increase in the expression of the neuronal differentiation markers MAP1B and neurofilament (NF-M) after 10 days in culture. Taken together, these results suggest that GSK-3 inhibition promotes the early stages of neuronal differentiation in cultures of adult human neural precursors and provide insights into the mechanisms by which alterations in GSK-3 signaling affect adult human neurogenesis, a cellular process strongly suspected to play a role in the etiology of neuropsychiatric disorders.
Longevity in vivo of primary cell wall cellulose synthases.
Hill, Joseph Lee; Josephs, Cooper; Barnes, William J; Anderson, Charles T; Tien, Ming
2018-02-01
Our work focuses on understanding the lifetime and thus stability of the three main cellulose synthase (CESA) proteins involved in primary cell wall synthesis of Arabidopsis. It had long been thought that a major means of CESA regulation was via their rapid degradation. However, our studies here have uncovered that AtCESA proteins are not rapidly degraded. Rather, they persist for an extended time in the plant cell. Plant cellulose is synthesized by membrane-embedded cellulose synthase complexes (CSCs). The CSC is composed of cellulose synthases (CESAs), of which three distinct isozymes form the primary cell wall CSC and another set of three isozymes form the secondary cell wall CSC. We determined the stability over time of primary cell wall (PCW) CESAs in Arabidopsis thaliana seedlings, using immunoblotting after inhibiting protein synthesis with cycloheximide treatment. Our work reveals very slow turnover for the Arabidopsis PCW CESAs in vivo. Additionally, we show that the stability of all three CESAs within the PCW CSC is altered by mutations in individual CESAs, elevated temperature, and light conditions. Together, these results suggest that CESA proteins are very stable in vivo, but that their lifetimes can be modulated by intrinsic and environmental cues.
Directory of Open Access Journals (Sweden)
Shailendra P. Singh
2015-08-01
Full Text Available Glycogen synthase kinase-3β (GSK3β is a serine/threonine protein kinase that plays an important role in renal tubular injury and regeneration in acute kidney injury. However, its role in the development of renal fibrosis, often a long-term consequence of acute kidney injury, is unknown. Using a mouse model of renal fibrosis induced by ischemia-reperfusion injury, we demonstrate increased GSK3β expression and activity in fibrotic kidneys, and its presence in myofibroblasts in addition to tubular epithelial cells. Pharmacological inhibition of GSK3 using TDZD-8 starting before or after ischemia-reperfusion significantly suppressed renal fibrosis by reducing the myofibroblast population, collagen-1 and fibronectin deposition, inflammatory cytokines, and macrophage infiltration. GSK3 inhibition in vivo reduced TGF-β1, SMAD3 activation and plasminogen activator inhibitor-1 levels. Consistently in vitro, TGF-β1 treatment increased GSK3β expression and GSK3 inhibition abolished TGF-β1-induced SMAD3 activation and α-smooth muscle actin (α-SMA expression in cultured renal fibroblasts. Importantly, overexpression of constitutively active GSK3β stimulated α-SMA expression even in the absence of TGF-β1 treatment. These results suggest that TGF-β regulates GSK3β, which in turn is important for TGF-β–SMAD3 signaling and fibroblast-to-myofibroblast differentiation. Overall, these studies demonstrate that GSK3 could promote renal fibrosis by activation of TGF-β signaling and the use of GSK3 inhibitors might represent a novel therapeutic approach for progressive renal fibrosis that develops as a consequence of acute kidney injury.
Effects and mechanism of acid rain on plant chloroplast ATP synthase.
Sun, Jingwen; Hu, Huiqing; Li, Yueli; Wang, Lihong; Zhou, Qing; Huang, Xiaohua
2016-09-01
Acid rain can directly or indirectly affect plant physiological functions, especially photosynthesis. The enzyme ATP synthase is the key in photosynthetic energy conversion, and thus, it affects plant photosynthesis. To clarify the mechanism by which acid rain affects photosynthesis, we studied the effects of acid rain on plant growth, photosynthesis, chloroplast ATP synthase activity and gene expression, chloroplast ultrastructure, intracellular H(+) level, and water content of rice seedlings. Acid rain at pH 4.5 remained the chloroplast structure unchanged but increased the expression of six chloroplast ATP synthase subunits, promoted chloroplast ATP synthase activity, and increased photosynthesis and plant growth. Acid rain at pH 4.0 or less decreased leaf water content, destroyed chloroplast structure, inhibited the expression of six chloroplast ATP synthase subunits, decreased chloroplast ATP synthase activity, and reduced photosynthesis and plant growth. In conclusion, acid rain affected the chloroplast ultrastructure, chloroplast ATPase transcription and activity, and P n by changing the acidity in the cells, and thus influencing the plant growth and development. Finally, the effects of simulated acid rain on the test indices were found to be dose-dependent.
Directory of Open Access Journals (Sweden)
Mamaghani Shadi
2009-04-01
Full Text Available Abstract Background Aberrant activation NF-kappaB has been proposed as a mechanism of drug resistance in pancreatic cancer. Recently, inhibition of glycogen synthase kinase-3 has been shown to exert anti-tumor effects on pancreatic cancer cells by suppressing NF-kappaB. Consequently, we investigated whether inhibition of GSK-3 sensitizes pancreatic cancer cells to the chemotherapeutic agent gemcitabine. Methods GSK-3 inhibition was achieved using the pharmacological agent AR-A014418 or siRNA against GSK-3 alpha and beta isoforms. Cytotoxicity was measured using a Sulphorhodamine B assay and clonogenic survival following exposure of six different pancreatic cancer cell lines to a range of doses of either gemcitabine, AR-A014418 or both for 24, 48 and 72 h. We measured protein expression levels by immunoblotting. Basal and TNF-alpha induced activity of NF-kappaB was assessed using a luciferase reporter assay in the presence or absence of GSK-3 inhibition. Results GSK-3 inhibition reduced both basal and TNF-alpha induced NF-kappaB luciferase activity. Knockdown of GSK-3 beta reduced nuclear factor kappa B luciferase activity to a greater extent than GSK-3 alpha, and the greatest effect was seen with dual knockdown of both GSK-3 isoforms. GSK-3 inhibition also resulted in reduction of the NF-kappaB target proteins XIAP, Bcl-XL, and cyclin D1, associated with growth inhibition and decreased clonogenic survival. In all cell lines, treatment with either AR-A014418, or gemcitabine led to growth inhibition in a dose- and time-dependent manner. However, with the exception of PANC-1 where drug synergy occurred with some dose schedules, the inhibitory effect of combined drug treatment was additive, sub-additive, or even antagonistic. Conclusion GSK-3 inhibition has anticancer effects against pancreatic cancer cells with a range of genetic backgrounds associated with disruption of NF-kappaB, but does not significantly sensitize these cells to the standard
The molecular motor F-ATP synthase is targeted by the tumoricidal protein HAMLET.
Ho, James; Sielaff, Hendrik; Nadeem, Aftab; Svanborg, Catharina; Grüber, Gerhard
2015-05-22
HAMLET (human alpha-lactalbumin made lethal to tumor cells) interacts with multiple tumor cell compartments, affecting cell morphology, metabolism, proteasome function, chromatin structure and viability. This study investigated if these diverse effects of HAMLET might be caused, in part, by a direct effect on the ATP synthase and a resulting reduction in cellular ATP levels. A dose-dependent reduction in cellular ATP levels was detected in A549 lung carcinoma cells, and by confocal microscopy, co-localization of HAMLET with the nucleotide-binding subunits α (non-catalytic) and β (catalytic) of the energy converting F1F0 ATP synthase was detected. As shown by fluorescence correlation spectroscopy, HAMLET binds to the F1 domain of the F1F0 ATP synthase with a dissociation constant (KD) of 20.5μM. Increasing concentrations of the tumoricidal protein HAMLET added to the enzymatically active α3β3γ complex of the F-ATP synthase lowered its ATPase activity, demonstrating that HAMLET binding to the F-ATP synthase effects the catalysis of this molecular motor. Single-molecule analysis was applied to study HAMLET-α3β3γ complex interaction. Whereas the α3β3γ complex of the F-ATP synthase rotated in a counterclockwise direction with a mean rotational rate of 3.8±0.7s(-1), no rotation could be observed in the presence of bound HAMLET. Our findings suggest that direct effects of HAMLET on the F-ATP synthase may inhibit ATP-dependent cellular processes. Copyright © 2015 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Manceur, Aziza P. [Institute of Biomaterials and Biomedical Engineering (IBBME), University of Toronto, Toronto, Ontario (Canada); Donnelly Centre, University of Toronto, Toronto, Ontario (Canada); Tseng, Michael [Laboratory of Cellular and Molecular Pathophysiology, Centre for Addiction and Mental Health (CAMH), University of Toronto, Toronto, Ontario (Canada); Department of Psychiatry, University of Toronto, Toronto, ON (Canada); Institute of Medical Science, University of Toronto, Toronto, ON (Canada); Holowacz, Tamara [Donnelly Centre, University of Toronto, Toronto, Ontario (Canada); Witterick, Ian [Institute of Medical Science, University of Toronto, Toronto, ON (Canada); Department of Otolaryngology, Head and Neck Surgery, University of Toronto, ON (Canada); Weksberg, Rosanna [Institute of Medical Science, University of Toronto, Toronto, ON (Canada); The Hospital for Sick Children, Research Institute, Program in Genetics and Genomic Biology, Toronto, Ontario Canada (Canada); McCurdy, Richard D. [The Hospital for Sick Children, Research Institute, Program in Genetics and Genomic Biology, Toronto, Ontario Canada (Canada); Warsh, Jerry J. [Laboratory of Cellular and Molecular Pathophysiology, Centre for Addiction and Mental Health (CAMH), University of Toronto, Toronto, Ontario (Canada); Department of Psychiatry, University of Toronto, Toronto, ON (Canada); Institute of Medical Science, University of Toronto, Toronto, ON (Canada); Audet, Julie, E-mail: julie.audet@utoronto.ca [Institute of Biomaterials and Biomedical Engineering (IBBME), University of Toronto, Toronto, Ontario (Canada); Donnelly Centre, University of Toronto, Toronto, Ontario (Canada)
2011-09-10
The olfactory epithelium (OE) contains neural precursor cells which can be easily harvested from a minimally invasive nasal biopsy, making them a valuable cell source to study human neural cell lineages in health and disease. Glycogen synthase kinase-3 (GSK-3) has been implicated in the etiology and treatment of neuropsychiatric disorders and also in the regulation of murine neural precursor cell fate in vitro and in vivo. In this study, we examined the impact of decreased GSK-3 activity on the fate of adult human OE neural precursors in vitro. GSK-3 inhibition was achieved using ATP-competitive (6-bromoindirubin-3'-oxime and CHIR99021) or substrate-competitive (TAT-eIF2B) inhibitors to eliminate potential confounding effects on cell fate due to off-target kinase inhibition. GSK-3 inhibitors decreased the number of neural precursor cells in OE cell cultures through a reduction in proliferation. Decreased proliferation was not associated with a reduction in cell survival but was accompanied by a reduction in nestin expression and a substantial increase in the expression of the neuronal differentiation markers MAP1B and neurofilament (NF-M) after 10 days in culture. Taken together, these results suggest that GSK-3 inhibition promotes the early stages of neuronal differentiation in cultures of adult human neural precursors and provide insights into the mechanisms by which alterations in GSK-3 signaling affect adult human neurogenesis, a cellular process strongly suspected to play a role in the etiology of neuropsychiatric disorders.
Zheng, Desen; Burr, Thomas J
2016-02-01
Agrobacterium vitis nontumorigenic strain F2/5 is able to inhibit crown gall disease on grapevines. The mechanism of grape tumor inhibition (GTI) by F2/5 has not been fully determined. In this study, we demonstrate that two nonribosomal peptide synthetase (NRPS) genes (F-avi3342 and F-avi5730) and one polyketide synthase gene (F-avi4330) are required for GTI. Knockout of any one of them resulted in F/25 losing GTI capacity. We previously reported that F-avi3342 and F-avi4330 but not F-avi5730 are required for induction of grape tissue necrosis and tobacco hypersensitive response. F-avi5730 is predicted to encode a single modular NRPS. It is located in a cluster that is homologous to the siderophore vicibactin biosynthesis locus in Rhizobium species. Individual disruption of F-avi5730 and two immediate downstream genes, F-avi5731 and F-avi5732, all resulted in reduced siderophore production; however, only F-avi5730 was found to be required for GTI. Complemented F-avi5730 mutant (ΔF-avi5730(+)) restored a wild-type level of GTI activity. It was determined that, over time, populations of ΔF-avi4330, ΔF-avi3342, and ΔF-avi5730 at inoculated wound sites on grapevine did not differ from those of ΔF-avi5730(+) indicating that loss of GTI was not due to reduced colonization of wound sites by mutants.
Gas-Pascual, Elisabet; Simonovik, Biljana; Heintz, Dimitri; Bergdoll, Marc; Schaller, Hubert; Bach, Thomas J
2015-08-01
The effect of an inhibitor of cycloartenol synthase (CAS, EC 5.4.99.8) on the proteome of tobacco BY-2 cells has been examined. CAS catalyzes the first committed step in phytosterol synthesis in plants. BY-2 cells were treated with RO 48-8071, a potent inhibitor of oxidosqualene cyclization. Proteins were separated by two-dimensional electrophoresis and spots, that clearly looked differentially accumulated after visual inspection, were cut, in-gel trypsin digested, and peptides were analyzed by nano-HPLC-MS/MS. Distinct peptides were compared to sequences in the data banks and attributed to corresponding proteins and genes. Inhibition of CAS induced proteins that appear to mitigate the negative effects of the chemical exposure. However, as all enzymes that are directly involved in phytosterol biosynthesis are low-abundant proteins, significant changes in their levels could not be observed. Differences could be seen with enzymes involved in primary metabolism (glycolysis, pentose phosphate pathway etc.), in proteins of the chaperonin family, and those, like actin, that participate in formation and strengthening of the cytoskeleton and have some impact on cell growth and division.
Directory of Open Access Journals (Sweden)
Giselli Scaini
2011-06-01
fisiopatologia desta doença.OBJECTIVE: An extensive body of evidence from experimental studies indicates that sepsis is associated with increased reactive oxygen species production, depletion of antioxidants, and accumulation of markers of oxidative stress. Moreover, mitochondrial dysfunction has been implicated in the pathogenesis of multiple organ dysfunction syndrome (MODS. Citrate synthase is an enzyme localized in the mitochondrial matrix and an important component of the Krebs cycle; consequently, citrate synthase has been used as a quantitative enzyme marker for the presence of intact mitochondria. Thus, we investigated citrate synthase activity in the brains of rats submitted to a cecal ligation puncture model of sepsis. METHODS: At several times points (3, 6, 12, 24 and 48 hours after the cecal ligation puncture operation, six rats were killed by decapitation. Their brains were removed, and the hippocampus, striatum, cerebellum, cerebral cortex and prefrontal cortex were dissected and used to determine citrate synthase activity. RESULTS: We found that citrate synthase activity in the prefrontal cortex was inhibited 12, 24 and 48 hours after cecal ligation puncture. In the cerebral cortex, citrate synthase activity was inhibited 3, 12, 24 and 48 hours after cecal ligation puncture. Citrate synthase was not affected in the hippocampus, striatum or cerebellum up to 48 hours after cecal ligation puncture. CONCLUSION: Considering that energy impairment due to mitochondrial dysfunction in sepsis has been well described and that oxidative stress plays a crucial role in sepsis development, we believe that energy impairment may also be involved in these processes. If citrate synthase inhibition also occurs in a sepsis model, it is tempting to speculate that a reduction in brain metabolism may be related to the pathophysiology of this disease.
Tanaka, Takehiko; Tamada, Yoshitaka; Suwa, Fumihiko
2008-02-01
Age-related inhibition of salivary secretion has been demonstrated in rats, and the nitric oxide (NO) present in the supraoptic nucleus (SON) and the medial septal area has been reported to play an inhibitory role in the regulation of salivary secretion. In the present study, we investigated the age-related changes occurring in the NO synthase (NOS)-expressing neurons in the SON, which is related to the production of NO, and discussed the interrelation between the age-related changes in the NOS-expressing neurons and the age-related inhibition of salivary secretion. Nissl staining and reduced nicotinamide adenine dinucleotide phosphate diaphorase (NADPH-d) histochemistry were performed for young adult and aged rats. Quantitative analysis was also performed using the Nissl-stained and NADPH-d-positive neurons. Although the numbers of the Nissl-stained neurons did not change, significant age-related increases were detected in cell number, cell size and reactive density of the NADPH-d-positive neurons. Therefore, the production of NO in the SON neurons increased with age. We concluded that the age-related increase in the NO in the SON might be a factor that contributes to the age-related inhibition of salivary secretion.
Virtual Screening of Novel Glucosamine-6-Phosphate Synthase Inhibitors.
Lather, Amit; Sharma, Sunil; Khatkar, Anurag
2018-01-01
Infections caused by microorganisms are the major cause of death today. The tremendous and improper use of antimicrobial agents leads to antimicrobial resistance. Various currently available antimicrobial drugs are inadequate to control the infections and lead to various adverse drug reactions. Efforts based on computer-aided drug design (CADD) can excavate a large number of databases to generate new, potent hits and minimize the requirement of time as well as money for the discovery of newer antimicrobials. Pharmaceutical sciences also have made development with advances in drug designing concepts. The current research article focuses on the study of various G-6-P synthase inhibitors from literature cited molecular database. Docking analysis was conducted and ADMET data of various molecules was evaluated by Schrodinger Glide and PreADMET software, respectively. Here, the results presented efficacy of various inhibitors towards enzyme G-6-P synthase. Docking scores, binding energy and ADMET data of various molecules showed good inhibitory potential toward G-6-P synthase as compared to standard antibiotics. This novel antimicrobial drug target G-6-P synthase has not so extensively been explored for its application in antimicrobial therapy, so the work done so far proved highly essential. This article has helped the drug researchers and scientists to intensively explore about this wonderful antimicrobial drug target. The Schrodinger, Inc. (New York, USA) software was utilized to carry out the computational calculations and docking studies. The hardware configuration was Intel® core (TM) i5-4210U CPU @ 2.40GHz, RAM memory 4.0 GB under 64-bit window operating system. The ADMET data was calculated by using the PreADMET tool (PreADMET ver. 2.0). All the computational work was completed in the Laboratory for Enzyme Inhibition Studies, Department of Pharmaceutical Sciences, M.D. University, Rohtak, INDIA. Molecular docking studies were carried out to identify the binding
Energy Technology Data Exchange (ETDEWEB)
Morgunova, Ekaterina [Karolinska Institutet NOVUM, Center of Structural Biochemistry, Hälsovägen 7-9, 141 57 Huddinge (Sweden); Illarionov, Boris; Saller, Sabine [Institut für Lebensmittelchemie, Universität Hamburg, Grindelallee 117, 20146 Hamburg (Germany); Popov, Aleksander [European Synchrotron Radiation Facility, BP 220, F-38043 Grenoble CEDEX 09 (France); Sambaiah, Thota [Department of Medicinal Chemistry and Molecular Pharmacology, Purdue University (United States); Bacher, Adelbert [Chemistry Department, Technical University of Munich, 85747 Garching (Germany); Cushman, Mark [Department of Medicinal Chemistry and Molecular Pharmacology, Purdue University (United States); Fischer, Markus [Institut für Lebensmittelchemie, Universität Hamburg, Grindelallee 117, 20146 Hamburg (Germany); Ladenstein, Rudolf, E-mail: rudolf.ladenstein@ki.se [Karolinska Institutet NOVUM, Center of Structural Biochemistry, Hälsovägen 7-9, 141 57 Huddinge (Sweden)
2010-09-01
Crystallographic studies of lumazine synthase, the penultimate enzyme of the riboflavin-biosynthetic pathway in B. anthracis, provide a structural framework for the design of antibiotic inhibitors, together with calorimetric and kinetic investigations of inhibitor binding. The crystal structure of lumazine synthase from Bacillus anthracis was solved by molecular replacement and refined to R{sub cryst} = 23.7% (R{sub free} = 28.4%) at a resolution of 3.5 Å. The structure reveals the icosahedral symmetry of the enzyme and specific features of the active site that are unique in comparison with previously determined orthologues. The application of isothermal titration calorimetry in combination with enzyme kinetics showed that three designed pyrimidine derivatives bind to lumazine synthase with micromolar dissociation constants and competitively inhibit the catalytic reaction. Structure-based modelling suggested the binding modes of the inhibitors in the active site and allowed an estimation of the possible contacts formed upon binding. The results provide a structural framework for the design of antibiotics active against B. anthracis.
International Nuclear Information System (INIS)
Kultti, Anne; Pasonen-Seppaenen, Sanna; Jauhiainen, Marjo; Rilla, Kirsi J.; Kaernae, Riikka; Pyoeriae, Emma; Tammi, Raija H.; Tammi, Markku I.
2009-01-01
Hyaluronan accumulation on cancer cells and their surrounding stroma predicts an unfavourable disease outcome, suggesting that hyaluronan enhances tumor growth and spreading. 4-Methylumbelliferone (4-MU) inhibits hyaluronan synthesis and retards cancer spreading in experimental animals through mechanisms not fully understood. These mechanisms were studied in A2058 melanoma cells, MCF-7 and MDA-MB-361 breast, SKOV-3 ovarian and UT-SCC118 squamous carcinoma cells by analysing hyaluronan synthesis, UDP-glucuronic acid (UDP-GlcUA) content, and hyaluronan synthase (HAS) mRNA levels. The maximal inhibition in hyaluronan synthesis ranged 22-80% in the cell lines tested. Active glucuronidation of 4-MU produced large quantities of 4-MU-glucuronide, depleting the cellular UDP-GlcUA pool. The maximal reduction varied between 38 and 95%. 4-MU also downregulated HAS mRNA levels: HAS3 was 84-60% lower in MDA-MB-361, A2058 and SKOV-3 cells. HAS2 was the major isoenzyme in MCF-7 cells and lowered by 81%, similar to 88% in A2058 cells. These data indicate that both HAS substrate and HAS2 and/or HAS3 mRNA are targeted by 4-MU. Despite different target point sensitivities, the reduction of hyaluronan caused by 4-MU was associated with a significant inhibition of cell migration, proliferation and invasion, supporting the importance of hyaluronan synthesis in cancer, and the therapeutic potential of hyaluronan synthesis inhibition.
Energy Technology Data Exchange (ETDEWEB)
Kultti, Anne, E-mail: anne.kultti@uku.fi [Institute of Biomedicine, Anatomy, University of Kuopio, P.O.B. 1627, FIN-70211 Kuopio (Finland); Pasonen-Seppaenen, Sanna [Institute of Biomedicine, Anatomy, University of Kuopio, P.O.B. 1627, FIN-70211 Kuopio (Finland); Jauhiainen, Marjo [Department of Pharmaceutical Chemistry, University of Kuopio, FIN-70211 Kuopio (Finland); Rilla, Kirsi J.; Kaernae, Riikka; Pyoeriae, Emma; Tammi, Raija H.; Tammi, Markku I. [Institute of Biomedicine, Anatomy, University of Kuopio, P.O.B. 1627, FIN-70211 Kuopio (Finland)
2009-07-01
Hyaluronan accumulation on cancer cells and their surrounding stroma predicts an unfavourable disease outcome, suggesting that hyaluronan enhances tumor growth and spreading. 4-Methylumbelliferone (4-MU) inhibits hyaluronan synthesis and retards cancer spreading in experimental animals through mechanisms not fully understood. These mechanisms were studied in A2058 melanoma cells, MCF-7 and MDA-MB-361 breast, SKOV-3 ovarian and UT-SCC118 squamous carcinoma cells by analysing hyaluronan synthesis, UDP-glucuronic acid (UDP-GlcUA) content, and hyaluronan synthase (HAS) mRNA levels. The maximal inhibition in hyaluronan synthesis ranged 22-80% in the cell lines tested. Active glucuronidation of 4-MU produced large quantities of 4-MU-glucuronide, depleting the cellular UDP-GlcUA pool. The maximal reduction varied between 38 and 95%. 4-MU also downregulated HAS mRNA levels: HAS3 was 84-60% lower in MDA-MB-361, A2058 and SKOV-3 cells. HAS2 was the major isoenzyme in MCF-7 cells and lowered by 81%, similar to 88% in A2058 cells. These data indicate that both HAS substrate and HAS2 and/or HAS3 mRNA are targeted by 4-MU. Despite different target point sensitivities, the reduction of hyaluronan caused by 4-MU was associated with a significant inhibition of cell migration, proliferation and invasion, supporting the importance of hyaluronan synthesis in cancer, and the therapeutic potential of hyaluronan synthesis inhibition.
International Nuclear Information System (INIS)
Mamaghani, Shadi; Patel, Satish; Hedley, David W
2009-01-01
Aberrant activation NF-kappaB has been proposed as a mechanism of drug resistance in pancreatic cancer. Recently, inhibition of glycogen synthase kinase-3 has been shown to exert anti-tumor effects on pancreatic cancer cells by suppressing NF-kappaB. Consequently, we investigated whether inhibition of GSK-3 sensitizes pancreatic cancer cells to the chemotherapeutic agent gemcitabine. GSK-3 inhibition was achieved using the pharmacological agent AR-A014418 or siRNA against GSK-3 alpha and beta isoforms. Cytotoxicity was measured using a Sulphorhodamine B assay and clonogenic survival following exposure of six different pancreatic cancer cell lines to a range of doses of either gemcitabine, AR-A014418 or both for 24, 48 and 72 h. We measured protein expression levels by immunoblotting. Basal and TNF-alpha induced activity of NF-kappaB was assessed using a luciferase reporter assay in the presence or absence of GSK-3 inhibition. GSK-3 inhibition reduced both basal and TNF-alpha induced NF-kappaB luciferase activity. Knockdown of GSK-3 beta reduced nuclear factor kappa B luciferase activity to a greater extent than GSK-3 alpha, and the greatest effect was seen with dual knockdown of both GSK-3 isoforms. GSK-3 inhibition also resulted in reduction of the NF-kappaB target proteins XIAP, Bcl-X L , and cyclin D1, associated with growth inhibition and decreased clonogenic survival. In all cell lines, treatment with either AR-A014418, or gemcitabine led to growth inhibition in a dose- and time-dependent manner. However, with the exception of PANC-1 where drug synergy occurred with some dose schedules, the inhibitory effect of combined drug treatment was additive, sub-additive, or even antagonistic. GSK-3 inhibition has anticancer effects against pancreatic cancer cells with a range of genetic backgrounds associated with disruption of NF-kappaB, but does not significantly sensitize these cells to the standard chemotherapy agent gemcitabine. This lack of synergy might be
García, Celina; Nuñez-Anita, Rosa Elvira; Thebault, Stéphanie; Arredondo Zamarripa, David; Jeziorsky, Michael C; Martínez de la Escalera, Gonzalo; Clapp, Carmen
2014-03-01
Endothelial nitric oxide synthase (eNOS)-derived nitric oxide is a major vasorelaxing factor and a mediator of vasopermeability and angiogenesis. Vasoinhibins, a family of antiangiogenic prolactin fragments that include 16 K prolactin, block most eNOS-mediated vascular effects. Vasoinhibins activate protein phosphatase 2A, causing eNOS inactivation through dephosphorylation of eNOS at serine residue 1179 in bovine endothelial cells and thereby blocking vascular permeability. In this study, we examined whether human eNOS phosphorylation at S1177 (analogous to bovine S1179) influences other actions of vasoinhibins. Bovine umbilical vein endothelial cells were stably transfected with human wild-type eNOS (WT) or with phospho-mimetic (S1177D) or non-phosphorylatable (S1177A) eNOS mutants. Vasoinhibins inhibited the increases in eNOS activity, migration, and proliferation following the overexpression of WT eNOS but did not affect these responses in cells expressing S1177D and S1177A eNOS mutants. We conclude that eNOS inhibition by dephosphorylation of S1177 is fundamental for the inhibition of endothelial cell migration and proliferation by vasoinhibins.
Factors influencing gene silencing of granule-bound starch synthase in potato
Heilersig, H.J.B.
2005-01-01
In the past, antisense RNA technology was used to modify the composition of potato tuber starch. Potato starch comprises amylose and amylopectin, polymers of glucose. Amylose production in potato is completely dependent on the presence of granule-bound starch synthase I (GBSSI). Inhibition of GBSSI
A small-molecule allosteric inhibitor of Mycobacterium tuberculosis tryptophan synthase
Energy Technology Data Exchange (ETDEWEB)
Wellington, Samantha; Nag, Partha P.; Michalska, Karolina; Johnston, Stephen E.; Jedrzejczak, Robert P.; Kaushik, Virendar K.; Clatworthy, Anne E.; Siddiqi, Noman; McCarren, Patrick; Bajrami, Besnik; Maltseva, Natalia I.; Combs, Senya; Fisher, Stewart L.; Joachimiak, Andrzej; Schreiber, Stuart L.; Hung, Deborah T.
2017-07-03
New antibiotics with novel targets are greatly needed. Bacteria have numerous essential functions, but only a small fraction of such processes—primarily those involved in macromolecular synthesis—are inhibited by current drugs. Targeting metabolic enzymes has been the focus of recent interest, but effective inhibitors have been difficult to identify. We describe a synthetic azetidine derivative, BRD4592, that kills Mycobacterium tuberculosis (Mtb) through allosteric inhibition of tryptophan synthase (TrpAB), a previously untargeted, highly allosterically regulated enzyme. BRD4592 binds at the TrpAB a–b-subunit interface and affects multiple steps in the enzyme’s overall reaction, resulting in inhibition not easily overcome by changes in metabolic environment. We show that TrpAB is required for the survival of Mtb and Mycobacterium marinum in vivo and that this requirement may be independent of an adaptive immune response. This work highlights the effectiveness of allosteric inhibition for targeting proteins that are naturally highly dynamic and that are essential in vivo, despite their apparent dispensability under in vitro conditions, and suggests a framework for the discovery of a next generation of allosteric inhibitors.
Karuppiah, Vijaykumar; Ranaghan, Kara E.; Leferink, Nicole G. H.; Johannissen, Linus O.; Shanmugam, Muralidharan; Ní Cheallaigh, Aisling; Bennett, Nathan J.; Kearsey, Lewis J.; Takano, Eriko; Gardiner, John M.; van der Kamp, Marc W.; Hay, Sam; Mulholland, Adrian J.; Leys, David; Scrutton, Nigel S.
2017-01-01
Terpenoids form the largest and stereochemically most diverse class of natural products, and there is considerable interest in producing these by biocatalysis with whole cells or purified enzymes, and by metabolic engineering. The monoterpenes are an important class of terpenes and are industrially important as flavors and fragrances. We report here structures for the recently discovered Streptomyces clavuligerus monoterpene synthases linalool synthase (bLinS) and 1,8-cineole synthase (bCinS)...
Chen, Xujun; Chen, Hao; Yuan, Joshua S; Köllner, Tobias G; Chen, Yuying; Guo, Yufen; Zhuang, Xiaofeng; Chen, Xinlu; Zhang, Yong-Jun; Fu, Jianyu; Nebenführ, Andreas; Guo, Zejian; Chen, Feng
2018-03-06
Rice blast disease, caused by the fungus Magnaporthe oryzae, is the most devastating disease of rice. In our ongoing characterization of the defence mechanisms of rice plants against M. oryzae, a terpene synthase gene OsTPS19 was identified as a candidate defence gene. Here, we report the functional characterization of OsTPS19, which is up-regulated by M. oryzae infection. Overexpression of OsTPS19 in rice plants enhanced resistance against M. oryzae, while OsTPS19 RNAi lines were more susceptible to the pathogen. Metabolic analysis revealed that the production of a monoterpene (S)-limonene was increased and decreased in OsTPS19 overexpression and RNAi lines, respectively, suggesting that OsTPS19 functions as a limonene synthase in planta. This notion was further supported by in vitro enzyme assays with recombinant OsTPS19, in which OsTPS19 had both sesquiterpene activity and monoterpene synthase activity, with limonene as a major product. Furthermore, in a subcellular localization experiment, OsTPS19 was localized in plastids. OsTPS19 has a highly homologous paralog, OsTPS20, which likely resulted from a recent gene duplication event. We found that the variation in OsTPS19 and OsTPS20 enzyme activities was determined by a single amino acid in the active site cavity. The expression of OsTPS20 was not affected by M. oryzae infection. This indicates functional divergence of OsTPS19 and OsTPS20. Lastly, (S)-limonene inhibited the germination of M. oryzae spores in vitro. OsTPS19 was determined to function as an (S)-limonene synthase in rice and plays a role in defence against M. oryzae, at least partly, by inhibiting spore germination. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Hyo Jeong Kim
2013-01-01
Full Text Available Carbon monoxide (CO may exert important roles in physiological and pathophysiological states through the regulation of cellular signaling pathways. CO can protect organ tissues from ischemia/reperfusion (I/R injury by modulating intracellular redox status and by inhibiting inflammatory, apoptotic, and proliferative responses. However, the cellular mechanisms underlying the protective effects of CO in organ I/R injury remain incompletely understood. In this study, a murine model of hepatic warm I/R injury was employed to assess the role of glycogen synthase kinase-3 (GSK3 and phosphatidylinositol 3-kinase (PI3K-dependent signaling pathways in the protective effects of CO against inflammation and injury. Inhibition of GSK3 through the PI3K/Akt pathway played a crucial role in CO-mediated protection. CO treatment increased the phosphorylation of Akt and GSK3-beta (GSK3β in the liver after I/R injury. Furthermore, administration of LY294002, an inhibitor of PI3K, compromised the protective effect of CO and decreased the level of phospho-GSK3β after I/R injury. These results suggest that CO protects against liver damage by maintaining GSK3β phosphorylation, which may be mediated by the PI3K/Akt signaling pathway. Our study provides additional support for the therapeutic potential of CO in organ injury and identifies GSK3β as a therapeutic target for CO in the amelioration of hepatic injury.
Kim, Hyo Jeong; Joe, Yeonsoo; Kong, Jin Sun; Jeong, Sun-Oh; Cho, Gyeong Jae; Ryter, Stefan W; Chung, Hun Taeg
2013-01-01
Carbon monoxide (CO) may exert important roles in physiological and pathophysiological states through the regulation of cellular signaling pathways. CO can protect organ tissues from ischemia/reperfusion (I/R) injury by modulating intracellular redox status and by inhibiting inflammatory, apoptotic, and proliferative responses. However, the cellular mechanisms underlying the protective effects of CO in organ I/R injury remain incompletely understood. In this study, a murine model of hepatic warm I/R injury was employed to assess the role of glycogen synthase kinase-3 (GSK3) and phosphatidylinositol 3-kinase (PI3K)-dependent signaling pathways in the protective effects of CO against inflammation and injury. Inhibition of GSK3 through the PI3K/Akt pathway played a crucial role in CO-mediated protection. CO treatment increased the phosphorylation of Akt and GSK3-beta (GSK3β) in the liver after I/R injury. Furthermore, administration of LY294002, an inhibitor of PI3K, compromised the protective effect of CO and decreased the level of phospho-GSK3β after I/R injury. These results suggest that CO protects against liver damage by maintaining GSK3β phosphorylation, which may be mediated by the PI3K/Akt signaling pathway. Our study provides additional support for the therapeutic potential of CO in organ injury and identifies GSK3β as a therapeutic target for CO in the amelioration of hepatic injury.
Oslob, Johan D; Johnson, Russell J; Cai, Haiying; Feng, Shirley Q; Hu, Lily; Kosaka, Yuko; Lai, Julie; Sivaraja, Mohanram; Tep, Samnang; Yang, Hanbiao; Zaharia, Cristiana A; Evanchik, Marc J; McDowell, Robert S
2013-01-10
Potent imidazopyridine-based inhibitors of fatty acid synthase (FASN) are described. The compounds are shown to have antiviral (HCV replicon) activities that track with their biochemical activities. The most potent analogue (compound 19) also inhibits rat FASN and inhibits de novo palmitate synthesis in vitro (cell-based) as well as in vivo.
The Antimalarial Effect of Curcumin Is Mediated by the Inhibition of Glycogen Synthase Kinase-3β.
Ali, Amatul Hamizah; Sudi, Suhaini; Basir, Rusliza; Embi, Noor; Sidek, Hasidah Mohd
2017-02-01
Curcumin, a bioactive compound in Curcuma longa, exhibits various pharmacological activities, including antimalarial effects. In silico docking simulation studies suggest that curcumin possesses glycogen synthase kinase-3β (GSK3β)-inhibitory properties. The involvement of GSK3 in the antimalarial effects in vivo is yet to be demonstrated. In this study, we aimed to evaluate whether the antimalarial effects of curcumin involve phosphorylation of host GSK3β. Intraperitoneal administration of curcumin into Plasmodium berghei NK65-infected mice resulted in dose-dependent chemosuppression of parasitemia development. At the highest dose tested (30 mg/kg body weight), both therapeutic and prophylactic administrations of curcumin resulted in suppression exceeding 50% and improved median survival time of infected mice compared to control. Western analysis revealed a 5.5-fold (therapeutic group) and 1.8-fold (prophylactic group) increase in phosphorylation of Ser 9 GSK3β and 1.6-fold (therapeutic group) and 1.7-fold (prophylactic group) increase in Ser 473 Akt in liver of curcumin-treated infected animals. Following P. berghei infection, levels of pro- and anti-inflammatory cytokines, tumor necrosis factor (TNF)-α, interferon (IFN)-γ, interleukin (IL)-10, and IL-4 were elevated by 7.5-, 35.0-, 33.0-, and 2.2-fold, respectively. Curcumin treatment (therapeutic) caused a significant decrease (by 6.0- and 2.0-fold, respectively) in serum TNF-α and IFN-γ level, while IL-10 and IL-4 were elevated (by 1.4- and 1.8-fold). Findings from the present study demonstrate for the first time that the antimalarial action of curcumin involved inhibition of GSK3β.
A small-molecule allosteric inhibitor of Mycobacterium tuberculosis tryptophan synthase
Energy Technology Data Exchange (ETDEWEB)
Wellington, Samantha; Nag, Partha P.; Michalska, Karolina; Johnston, Stephen E.; Jedrzejczak, Robert P.; Kaushik, Virendar K.; Clatworthy, Anne E.; Siddiqi, Noman; McCarren, Patrick; Bajrami, Besnik; Maltseva, Natalia I.; Combs, Senya; Fisher, Stewart L.; Joachimiak, Andrzej; Schreiber, Stuart L.; Hung, Deborah T.
2017-07-03
New antibiotics with novel targets are greatly needed. Bacteria have numerous essential functions, but only a small fraction of such processes—primarily those involved in macromolecular synthesis—are inhibited by current drugs. Targeting metabolic enzymes has been the focus of recent interest, but effective inhibitors have been difficult to identify. We describe a synthetic azetidine derivative, BRD4592, that kills Mycobacterium tuberculosis (Mtb) through allosteric inhibition of tryptophan synthase (TrpAB), a previously untargeted, highly allosterically regulated enzyme. BRD4592 binds at the TrpAB α–β-subunit interface and affects multiple steps in the enzyme's overall reaction, resulting in inhibition not easily overcome by changes in metabolic environment. We show that TrpAB is required for the survival of Mtb and Mycobacterium marinum in vivo and that this requirement may be independent of an adaptive immune response. This work highlights the effectiveness of allosteric inhibition for targeting proteins that are naturally highly dynamic and that are essential in vivo, despite their apparent dispensability under in vitro conditions, and suggests a framework for the discovery of a next generation of allosteric inhibitors.
Chronic nitric oxide synthase inhibition exacerbates renal dysfunction in cirrhotic rats
DEFF Research Database (Denmark)
Graebe, M.; Brond, L.; Christensen, S.
2004-01-01
The present study investigated sodium balance and renal tubular function in cirrhotic rats with chronic blockade of the nitric oxide (NO) system. Rats were treated with the nonselective NO synthase inhibitor NG-nitro-l-arginine methyl ester (l-NAME) starting on the day of common bile duct ligation...... (CBL). Three weeks of daily sodium balance studies showed that CBL rats developed sodium retention compared with sham-operated rats and that l-NAME treatment dose dependently deteriorated cumulative sodium balance by reducing urinary sodium excretion. Five weeks after CBL, renal clearance studies were...
Monoterpene synthases from common sage (Salvia officinalis)
Energy Technology Data Exchange (ETDEWEB)
Croteau, Rodney Bruce (Pullman, WA); Wise, Mitchell Lynn (Pullman, WA); Katahira, Eva Joy (Pullman, WA); Savage, Thomas Jonathan (Christchurch 5, NZ)
1999-01-01
cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.
International Nuclear Information System (INIS)
Wang, Wenwen; Yang, Yanqin; Xiong, Zhewen; Kong, Jiamin; Fu, Xinlu; Shen, Feihai; Huang, Zhiying
2016-01-01
Triptolide (TP), a diterpene triepoxide, is a major active component of Tripterygium wilfordii extracts, which are prepared as tablets and has been used clinically for the treatment of inflammation and autoimmune disorders. However, TP's therapeutic potential is limited by severe adverse effects. In a previous study, we reported that TP induced mitochondria dependent apoptosis in cardiomyocytes. Glycogen synthase kinase-3β (GSK-3β) is a multifunctional serine/threonine kinase that plays important roles in the necrosis and apoptosis of cardiomyocytes. Our study aimed to investigate the role of GSK-3β in TP-induced cardiotoxicity. Inhibition of GSK-3β activity by SB 216763, a potent and selective GSK-3 inhibitor, prominently ameliorated the detrimental effects in C57BL/6J mice with TP administration, which was associated with a correction of GSK-3β overactivity. Consistently, in TP-treated H9c2 cells, SB 216763 treatment counteracted GSK-3β overactivity, improved cell viability, and prevented apoptosis by modulating the expression of Bcl-2 family proteins. Mechanistically, GSK-3β interacted with and phosphorylated cyclophilin F (Cyp-F), a key regulator of mitochondrial permeability transition pore (mPTP). GSK-3β inhibition prevented the phosphorylation and activation of Cyp-F, and desensitized mPTP. Our findings suggest that pharmacological targeting of GSK-3β could represent a promising therapeutic strategy for protecting against cardiotoxicity induced by TP. - Highlights: • GSK-3β inhibition ameliorates TP-induced cardiotoxicity in vitro and in vivo. • GSK-3β controls Cyp-F activation, and regulates mPTP and apoptosis in H9c2 cells. • The protective effect is attributed to GSK-3β activity rather than to protein level. • GSK-3β may be a promising target against TP-induced cardiotoxicity.
Energy Technology Data Exchange (ETDEWEB)
Wang, Wenwen; Yang, Yanqin; Xiong, Zhewen; Kong, Jiamin [School of Pharmaceutical Sciences, Sun Yat-sen University, Guangzhou 510006 (China); Fu, Xinlu [Laboratory Animals Center, Sun Yat-sen University, Guangzhou 510006 (China); Shen, Feihai, E-mail: shenfh3@mail.sysu.edu.cn [School of Pharmaceutical Sciences, Sun Yat-sen University, Guangzhou 510006 (China); Huang, Zhiying, E-mail: hzhiying@mail.sysu.edu.cn [School of Pharmaceutical Sciences, Sun Yat-sen University, Guangzhou 510006 (China)
2016-12-15
Triptolide (TP), a diterpene triepoxide, is a major active component of Tripterygium wilfordii extracts, which are prepared as tablets and has been used clinically for the treatment of inflammation and autoimmune disorders. However, TP's therapeutic potential is limited by severe adverse effects. In a previous study, we reported that TP induced mitochondria dependent apoptosis in cardiomyocytes. Glycogen synthase kinase-3β (GSK-3β) is a multifunctional serine/threonine kinase that plays important roles in the necrosis and apoptosis of cardiomyocytes. Our study aimed to investigate the role of GSK-3β in TP-induced cardiotoxicity. Inhibition of GSK-3β activity by SB 216763, a potent and selective GSK-3 inhibitor, prominently ameliorated the detrimental effects in C57BL/6J mice with TP administration, which was associated with a correction of GSK-3β overactivity. Consistently, in TP-treated H9c2 cells, SB 216763 treatment counteracted GSK-3β overactivity, improved cell viability, and prevented apoptosis by modulating the expression of Bcl-2 family proteins. Mechanistically, GSK-3β interacted with and phosphorylated cyclophilin F (Cyp-F), a key regulator of mitochondrial permeability transition pore (mPTP). GSK-3β inhibition prevented the phosphorylation and activation of Cyp-F, and desensitized mPTP. Our findings suggest that pharmacological targeting of GSK-3β could represent a promising therapeutic strategy for protecting against cardiotoxicity induced by TP. - Highlights: • GSK-3β inhibition ameliorates TP-induced cardiotoxicity in vitro and in vivo. • GSK-3β controls Cyp-F activation, and regulates mPTP and apoptosis in H9c2 cells. • The protective effect is attributed to GSK-3β activity rather than to protein level. • GSK-3β may be a promising target against TP-induced cardiotoxicity.
Ishikawa, Ken; Bellomo, Rinaldo; May, Clive N
2011-04-01
injury is not the result of decreased renal blood flow nor is it improved by nonspecific nitric oxide synthase inhibition.
Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants
Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE
2007-07-10
Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.
LENUS (Irish Health Repository)
Cathcart, Mary-Clare
2011-03-09
Abstract Background Thromboxane synthase (TXS) metabolises prostaglandin H2 into thromboxanes, which are biologically active on cancer cells. TXS over-expression has been reported in a range of cancers, and associated with a poor prognosis. TXS inhibition induces cell death in-vitro, providing a rationale for therapeutic intervention. We aimed to determine the expression profile of TXS in NSCLC and if it is prognostic and\\/or a survival factor in the disease. Methods TXS expression was examined in human NSCLC and matched controls by western analysis and IHC. TXS metabolite (TXB2) levels were measured by EIA. A 204-patient NSCLC TMA was stained for COX-2 and downstream TXS expression. TXS tissue expression was correlated with clinical parameters, including overall survival. Cell proliferation\\/survival and invasion was examined in NSCLC cells following both selective TXS inhibition and stable TXS over-expression. Results TXS was over-expressed in human NSCLC samples, relative to matched normal controls. TXS and TXB2 levels were increased in protein (p < 0.05) and plasma (p < 0.01) NSCLC samples respectively. TXS tissue expression was higher in adenocarcinoma (p < 0.001) and female patients (p < 0.05). No significant correlation with patient survival was observed. Selective TXS inhibition significantly reduced tumour cell growth and increased apoptosis, while TXS over-expression stimulated cell proliferation and invasiveness, and was protective against apoptosis. Conclusion TXS is over-expressed in NSCLC, particularly in the adenocarcinoma subtype. Inhibition of this enzyme inhibits proliferation and induces apoptosis. Targeting thromboxane synthase alone, or in combination with conventional chemotherapy is a potential therapeutic strategy for NSCLC.
Adiponectin inhibits insulin function in primary trophoblasts by PPARα-mediated ceramide synthesis.
Aye, Irving L M H; Gao, Xiaoli; Weintraub, Susan T; Jansson, Thomas; Powell, Theresa L
2014-04-01
Maternal adiponectin (ADN) levels are inversely correlated with birth weight, and ADN infusion in pregnant mice down-regulates placental nutrient transporters and decreases fetal growth. In contrast to the insulin-sensitizing effects in adipose tissue and muscle, ADN inhibits insulin signaling in the placenta. However, the molecular mechanisms involved are unknown. We hypothesized that ADN inhibits insulin signaling and insulin-stimulated amino acid transport in primary human trophoblasts by peroxisome proliferator-activated receptor-α (PPARα)-mediated ceramide synthesis. Primary human term trophoblast cells were treated with ADN and/or insulin. ADN increased the phosphorylation of p38 MAPK and PPARα. ADN inhibited insulin signaling and insulin-stimulated amino acid transport. This effect was dependent on PPARα, because activation of PPARα with an agonist (GW7647) inhibited insulin signaling and function, whereas PPARα-small interfering RNA reversed the effects of ADN on the insulin response. ADN increased ceramide synthase expression and stimulated ceramide production. C2-ceramide inhibited insulin signaling and function, whereas inhibition of ceramide synthase (with Fumonisin B1) reversed the effects of ADN on insulin signaling and amino acid transport. These findings are consistent with the model that maternal ADN limits fetal growth mediated by activation of placental PPARα and ceramide synthesis, which inhibits placental insulin signaling and amino acid transport, resulting in reduced fetal nutrient availability.
Threonine phosphorylation of rat liver glycogen synthase
International Nuclear Information System (INIS)
Arino, J.; Arro, M.; Guinovart, J.J.
1985-01-01
32 P-labeled glycogen synthase specifically immunoprecipitated from 32 P-phosphate incubated rat hepatocytes contains, in addition to [ 32 P] phosphoserine, significant levels of [ 32 P] phosphothreonine. When the 32 P-immunoprecipitate was cleaved with CNBr, the [ 32 P] phosphothreonine was recovered in the large CNBr fragment (CB-2, Mapp 28 Kd). Homogeneous rat liver glycogen synthase was phosphorylated by all the protein kinases able to phosphorylate CB-2 in vitro. After analysis of the immunoprecipitated enzyme for phosphoaminoacids, it was observed that only casein kinase II was able to phosphorylate on threonine and 32 P-phosphate was only found in CB-2. These results demonstrate that rat liver glycogen synthase is phosphorylated at threonine site(s) contained in CB-2 and strongly indicate that casein kinase II may play a role in the ''in vivo'' phosphorylation of liver glycogen synthase. This is the first protein kinase reported to phosphorylate threonine residues in liver glycogen synthase
Cingolani, Francesca; Simbari, Fabio; Abad, Jose Luis; Casasampere, Mireia; Fabrias, Gemma; Futerman, Anthony H; Casas, Josefina
2017-08-01
Sphingolipids (SLs) have been extensively investigated in biomedical research due to their role as bioactive molecules in cells. Here, we describe the effect of a SL analog, jaspine B (JB), a cyclic anhydrophytosphingosine found in marine sponges, on the gastric cancer cell line, HGC-27. JB induced alterations in the sphingolipidome, mainly the accumulation of dihydrosphingosine, sphingosine, and their phosphorylated forms due to inhibition of ceramide synthases. Moreover, JB provoked atypical cell death in HGC-27 cells, characterized by the formation of cytoplasmic vacuoles in a time and dose-dependent manner. Vacuoles appeared to originate from macropinocytosis and triggered cytoplasmic disruption. The pan-caspase inhibitor, z-VAD, did not alter either cytotoxicity or vacuole formation, suggesting that JB activates a caspase-independent cell death mechanism. The autophagy inhibitor, wortmannin, did not decrease JB-stimulated LC3-II accumulation. In addition, cell vacuolation induced by JB was characterized by single-membrane vacuoles, which are different from double-membrane autophagosomes. These findings suggest that JB-induced cell vacuolation is not related to autophagy and it is also independent of its action on SL metabolism. Copyright © 2017 by the American Society for Biochemistry and Molecular Biology, Inc.
Krill, Christian; Barrow, Russell A.; Chen, Shasha; Trengove, Robert; Oliver, Richard P.; Solomon, Peter S.
2014-01-01
Parastagonospora nodorum is a pathogen of wheat that affects yields globally. Previous transcriptional analysis identified a partially reducing polyketide synthase (PR-PKS) gene, SNOG_00477 (SN477), in P. nodorum that is highly upregulated during infection of wheat leaves. Disruption of the corresponding SN477 gene resulted in the loss of production of two compounds, which we identified as (R)-mellein and (R)-O-methylmellein. Using a Saccharomyces cerevisiae yeast heterologous expression system, we successfully demonstrated that SN477 is the only enzyme required for the production of (R)-mellein. This is the first identification of a fungal PKS that is responsible for the synthesis of (R)-mellein. The P. nodorum ΔSN477 mutant did not show any significant difference from the wild-type strain in its virulence against wheat. However, (R)-mellein at 200 μg/ml inhibited the germination of wheat (Triticum aestivum) and barrel medic (Medicago truncatula) seeds. Comparative sequence analysis identified the presence of mellein synthase (MLNS) homologues in several Dothideomycetes and two sodariomycete genera. Phylogenetic analysis suggests that the MLNSs in fungi and bacteria evolved convergently from fungal and bacterial 6-methylsalicylic acid synthases. PMID:25326302
Amaryllidaceae Alkaloids as Potential Glycogen Synthase Kinase-3β Inhibitors
Directory of Open Access Journals (Sweden)
Daniela Hulcová
2018-03-01
Full Text Available Glycogen synthase kinase-3β (GSK-3β is a multifunctional serine/threonine protein kinase that was originally identified as an enzyme involved in the control of glycogen metabolism. It plays a key role in diverse physiological processes including metabolism, the cell cycle, and gene expression by regulating a wide variety of well-known substances like glycogen synthase, tau-protein, and β-catenin. Recent studies have identified GSK-3β as a potential therapeutic target in Alzheimer´s disease, bipolar disorder, stroke, more than 15 types of cancer, and diabetes. GSK-3β is one of the most attractive targets for medicinal chemists in the discovery, design, and synthesis of new selective potent inhibitors. In the current study, twenty-eight Amaryllidaceae alkaloids of various structural types were studied for their potency to inhibit GSK-3β. Promising results have been demonstrated by alkaloids of the homolycorine-{9-O-demethylhomolycorine (IC50 = 30.00 ± 0.71 µM, masonine (IC50 = 27.81 ± 0.01 μM}, and lycorine-types {caranine (IC50 = 30.75 ± 0.04 μM}.
Yu, Yan; Jin, Chongwei; Sun, Chengliang; Wang, Jinghong; Ye, Yiquan; Zhou, Weiwei; Lu, Lingli; Lin, Xianyong
2016-01-08
Inhibition of root elongation is one of the most distinct symptoms of aluminium (Al) toxicity. Although putrescine (Put) has been identified as an important signaling molecule involved in Al tolerance, it is yet unknown how Put mitigates Al-induced root inhibition. Here, the possible mechanism was investigated by using two wheat genotypes differing in Al resistance: Al-tolerant Xi Aimai-1 and Al-sensitive Yangmai-5. Aluminium caused more root inhibition in Yangmai-5 and increased ethylene production at the root apices compared to Xi Aimai-1, whereas the effects were significantly reversed by ethylene biosynthesis inhibitors. The simultaneous exposure of wheat seedlings to Al and ethylene donor, ethephon, or ethylene biosynthesis precursor, 1-aminocyclopropane-1-carboxylic acid (ACC), increased ethylene production and aggravated root inhibition, which was more pronounced in Xi Aimai-1. In contrast, Put treatment decreased ethylene production and alleviated Al-induced root inhibition in both genotypes, and the effects were more conspicuous in Yangmai-5. Furthermore, our results indicated that Al-induced ethylene production was mediated by ACC synthase (ACS) and ACC oxidase, and that Put decreased ethylene production by inhibiting ACS. Altogether, these findings indicate that ethylene is involved in Al-induced root inhibition and this process could be alleviated by Put through inhibiting ACS activity.
Heeringa, P; van Goor, H; Itoh-Lindstrom, Y; Maeda, N; Falk, RJ; Assmann, KJM; Kallenberg, CGM; Jennette, JC
Nitric oxide (NO) radicals generated by endothelial nitric oxide synthase (eNOS) are involved in the regulation of vascular tone. In addition, NO radicals derived from eNOS inhibit platelet aggregation and leukocyte adhesion to the endothelium and, thus, may have anti-inflammatory effects. To study
DEFF Research Database (Denmark)
Kadziola, Anders; Jepsen, Clemens H; Johansson, Eva
2005-01-01
The prs gene encoding phosphoribosyl diphosphate (PRPP) synthase of the hyperthermophilic autotrophic methanogenic archaeon Methanocaldococcus jannaschii has been cloned and expressed in Escherichia coli. Subsequently, M.jannaschii PRPP synthase has been purified, characterised, crystallised, and...
Zucker, Stephen D; Vogel, Megan E; Kindel, Tammy L; Smith, Darcey L H; Idelman, Gila; Avissar, Uri; Kakarlapudi, Ganesh; Masnovi, Michelle E
2015-11-15
Bilirubin is thought to exert anti-inflammatory effects by inhibiting vascular cell adhesion molecule-1 (VCAM-1)-dependent leukocyte migration and by suppressing the expression of inducible nitric oxide synthase (iNOS). As VCAM-1 and iNOS are important mediators of tissue injury in the dextran sodium sulfate (DSS) murine model of inflammatory colitis, we examined whether bilirubin prevents colonic injury in DSS-treated mice. Male C57BL/6 mice were administered 2.5% DSS in the drinking water for 7 days, while simultaneously receiving intraperitoneal injections of bilirubin (30 mg/kg) or potassium phosphate vehicle. Disease activity was monitored, peripheral blood counts and serum nitrate levels were determined, and intestinal specimens were analyzed for histological injury, leukocyte infiltration, and iNOS expression. The effect of bilirubin on IL-5 production by HSB-2 cells and on Jurkat cell transendothelial migration also was determined. DSS-treated mice that simultaneously received bilirubin lost less body weight, had lower serum nitrate levels, and exhibited reduced disease severity than vehicle-treated animals. Concordantly, histopathological analyses revealed that bilirubin-treated mice manifested significantly less colonic injury, including reduced infiltration of eosinophils, lymphocytes, and monocytes, and diminished iNOS expression. Bilirubin administration also was associated with decreased eosinophil and monocyte infiltration into the small intestine, with a corresponding increase in peripheral blood eosinophilia. Bilirubin prevented Jurkat migration but did not alter IL-5 production. In conclusion, bilirubin prevents DSS-induced colitis by inhibiting the migration of leukocytes across the vascular endothelium and by suppressing iNOS expression. Copyright © 2015 the American Physiological Society.
Directory of Open Access Journals (Sweden)
Yan Yang
2017-04-01
Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.
Energy Technology Data Exchange (ETDEWEB)
Nicholas C Carpita
2009-04-20
Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.
Directory of Open Access Journals (Sweden)
Cabrera-Luque Juan
2008-09-01
Full Text Available Abstract Background The efficient conversion of ammonia, a potent neurotoxin, into non-toxic metabolites was an essential adaptation that allowed animals to move from the aquatic to terrestrial biosphere. The urea cycle converts ammonia into urea in mammals, amphibians, turtles, snails, worms and many aquatic animals and requires N-acetylglutamate (NAG, an essential allosteric activator of carbamylphosphate synthetase I (CPSI in mammals and amphibians, and carbamylphosphate synthetase III (CPSIII in fish and invertebrates. NAG-dependent CPSI and CPSIII catalyze the formation of carbamylphosphate in the first and rate limiting step of ureagenesis. NAG is produced enzymatically by N-acetylglutamate synthase (NAGS, which is also found in bacteria and plants as the first enzyme of arginine biosynthesis. Arginine is an allosteric inhibitor of microbial and plant NAGS, and allosteric activator of mammalian NAGS. Results Information from mutagenesis studies of E. coli and P. aeruginosa NAGS was combined with structural information from the related bacterial N-acetylglutamate kinases to identify four residues in mammalian NAGS that interact with arginine. Substitutions of these four residues were engineered in mouse NAGS and into the vertebrate-like N-acetylglutamate synthase-kinase (NAGS-K of Xanthomonas campestris, which is inhibited by arginine. All mutations resulted in arginine losing the ability to activate mouse NAGS, and inhibit X. campestris NAGS-K. To examine at what point in evolution inversion of arginine effect on NAGS occur, we cloned NAGS from fish and frogs and examined the arginine response of their corresponding proteins. Fish NAGS were partially inhibited by arginine and frog NAGS were activated by arginine. Conclusion Difference in arginine effect on bacterial and mammalian NAGS most likely stems from the difference in the type of conformational change triggered by arginine binding to these proteins. The change from arginine
Directory of Open Access Journals (Sweden)
Wenxi Yu
Full Text Available Myo-inositol, the precursor of all inositol compounds, is essential for the viability of eukaryotes. Identifying the factors that regulate inositol homeostasis is of obvious importance to understanding cell function and the pathologies underlying neurological and metabolic resulting from perturbation of inositol metabolism. The current study identifies Mck1, a GSK3 homolog, as a novel positive regulator of inositol de novo synthesis in yeast. Mck1 was required for normal activity of myo-inositol phosphate synthase (MIPS, which catalyzes the rate-limiting step of inositol synthesis. mck1Δ cells exhibited a 50% decrease in MIPS activity and a decreased rate of incorporation of [13C6]glucose into [13C6]-inositol-3-phosphate and [13C6]-inositol compared to WT cells. mck1Δ cells also exhibited decreased growth in the presence of the inositol depleting drug valproate (VPA, which was rescued by supplementation of inositol. However, in contrast to wild type cells, which exhibited more than a 40% decrease in MIPS activity in the presence of VPA, the drug did not significantly decrease MIPS activity in mck1Δ cells. These findings indicate that VPA-induced MIPS inhibition is Mck1-dependent, and suggest a model that unifies two current hypotheses of the mechanism of action of VPA-inositol depletion and GSK3 inhibition.
Yu, Wenxi; Daniel, Joshua; Mehta, Dhara; Maddipati, Krishna Rao; Greenberg, Miriam L
2017-01-01
Myo-inositol, the precursor of all inositol compounds, is essential for the viability of eukaryotes. Identifying the factors that regulate inositol homeostasis is of obvious importance to understanding cell function and the pathologies underlying neurological and metabolic resulting from perturbation of inositol metabolism. The current study identifies Mck1, a GSK3 homolog, as a novel positive regulator of inositol de novo synthesis in yeast. Mck1 was required for normal activity of myo-inositol phosphate synthase (MIPS), which catalyzes the rate-limiting step of inositol synthesis. mck1Δ cells exhibited a 50% decrease in MIPS activity and a decreased rate of incorporation of [13C6]glucose into [13C6]-inositol-3-phosphate and [13C6]-inositol compared to WT cells. mck1Δ cells also exhibited decreased growth in the presence of the inositol depleting drug valproate (VPA), which was rescued by supplementation of inositol. However, in contrast to wild type cells, which exhibited more than a 40% decrease in MIPS activity in the presence of VPA, the drug did not significantly decrease MIPS activity in mck1Δ cells. These findings indicate that VPA-induced MIPS inhibition is Mck1-dependent, and suggest a model that unifies two current hypotheses of the mechanism of action of VPA-inositol depletion and GSK3 inhibition.
Directory of Open Access Journals (Sweden)
Wei Cui
Full Text Available SU5416 was originally designed as a potent and selective inhibitor of vascular endothelial growth factor receptor-2 (VEGFR-2 for cancer therapy. In this study, we have found for the first time that SU5416 unexpectedly prevented 1-methyl-4-phenylpyridinium ion (MPP(+-induced neuronal apoptosis in cerebellar granule neurons, and decreased 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP-induced loss of dopaminergic neurons and impairment of swimming behavior in zebrafish in a concentration-dependent manner. However, VEGFR-2 kinase inhibitor II, another specific VEGFR-2 inhibitor, failed to reverse neurotoxicity at the concentration exhibiting anti-angiogenic activity, strongly suggesting that the neuroprotective effect of SU5416 is independent from its anti-angiogenic action. SU5416 potently reversed MPP(+-increased intracellular nitric oxide level with an efficacy similar to 7-nitroindazole, a specific neuronal nitric oxide synthase (nNOS inhibitor. Western blotting analysis showed that SU5416 reduced the elevation of nNOS protein expression induced by MPP(+. Furthermore, SU5416 directly inhibited the enzyme activity of rat cerebellum nNOS with an IC(50 value of 22.7 µM. In addition, knock-down of nNOS expression using short hairpin RNA (shRNA abolished the neuroprotective effects of SU5416 against MPP(+-induced neuronal loss. Our results strongly demonstrate that SU5416 might exert its unexpected neuroprotective effects by concurrently reducing nNOS protein expression and directly inhibiting nNOS enzyme activity. In view of the capability of SU5416 to cross the blood-brain barrier and the safety for human use, our findings further indicate that SU5416 might be a novel drug candidate for neurodegenerative disorders, particularly those associated with NO-mediated neurotoxicity.
Ishikawa, Ken; Calzavacca, Paolo; Bellomo, Rinaldo; Bailey, Michael; May, Clive N
2012-08-01
Nitric oxide plays an important role in the control of renal blood flow and renal function. In sepsis, increased levels of inducible nitric oxide synthase produce excessive nitric oxide, which may contribute to the development of acute kidney injury. We, therefore, examined the effects of intrarenal infusion of selective inducible nitric oxide synthase inhibitors in a large animal model of hyperdynamic sepsis in which acute kidney injury occurs in the presence of increased renal blood flow. Prospective crossover randomized controlled interventional studies. University-affiliated research institute. Twelve unilaterally nephrectomized Merino ewes. Infusion of a selective (1400W) and a partially selective inducible nitric oxide synthase inhibitor (aminoguanidine) into the renal artery for 2 hrs after the induction of sepsis, and comparison with a nonselective inhibitor (Nω-nitro-L-arginine methyl ester). In sheep with nonhypotensive hyperdynamic sepsis, creatinine clearance halved (32 to 16 mL/min, ratio [95% confidence interval] 0.51 [0.28-0.92]) despite increased renal blood flow (241 to 343 mL/min, difference [95% confidence interval] 102 [78-126]). Infusion of 1400W did not change renal blood flow, urine output, or creatinine clearance, whereas infusion of Nω-nitro-L-arginine methyl ester and a high dose of aminoguanidine normalized renal blood flow, but did not alter creatinine clearance. In hyperdynamic sepsis, intrarenal infusion of a highly selective inducible nitric oxide synthase inhibitor did not reduce the elevated renal blood flow or improve renal function. In contrast, renal blood flow was reduced by infusion of a nonselective NOS inhibitor or a high dose of a partially selective inducible nitric oxide synthase inhibitor. The renal vasodilatation in septic acute kidney injury may be due to nitric oxide derived from the endothelial and neural isoforms of nitric oxide synthase, but their blockade did not restore renal function.
International Nuclear Information System (INIS)
Gil'yano, N.Ya.; Bondarev, G.N.; Bikineeva, E.G.; Krasotskaya, G.I.; Noskin, L.A.
2001-01-01
The effect of the serine-threonin kinase inhibitor - staurosporine and inhibitor of NO-synthase - L-NAME on the radiation-induced adaptive response were studied in fibroblasts of Chinese hamster in culture. It is shown that staurosporine and L-NAME inhibit cytogenetic adaptive response induced by β-particles in low doses. Inhibition is not connected with radiosensitizing effect of these agents. L-NAME decreases significantly the γ-rays-induced chromosome aberration yield also. Study confirms the role of protein kinase C in induction of the adaptive response and participation of NO-synthase in this process is noticed for the first time [ru
Directory of Open Access Journals (Sweden)
Yi-Hsuan Wu
Full Text Available ATP synthase is present on the plasma membrane of several types of cancer cells. Citreoviridin, an ATP synthase inhibitor, selectively suppresses the proliferation and growth of lung cancer without affecting normal cells. However, the global effects of targeting ectopic ATP synthase in vivo have not been well defined. In this study, we performed quantitative proteomic analysis using isobaric tags for relative and absolute quantitation (iTRAQ and provided a comprehensive insight into the complicated regulation by citreoviridin in a lung cancer xenograft model. With high reproducibility of the quantitation, we obtained quantitative proteomic profiling with 2,659 proteins identified. Bioinformatics analysis of the 141 differentially expressed proteins selected by their relative abundance revealed that citreoviridin induces alterations in the expression of glucose metabolism-related enzymes in lung cancer. The up-regulation of enzymes involved in gluconeogenesis and storage of glucose indicated that citreoviridin may reduce the glycolytic intermediates for macromolecule synthesis and inhibit cell proliferation. Using comprehensive proteomics, the results identify metabolic aspects that help explain the antitumorigenic effect of citreoviridin in lung cancer, which may lead to a better understanding of the links between metabolism and tumorigenesis in cancer therapy.
Directory of Open Access Journals (Sweden)
Nikolay Avtandilyan
2018-01-01
Full Text Available It is well established that, during development of malignancies, metabolic changes occur, including alterations of enzyme activities and isoenzyme expression. Arginase and nitric oxide (NO synthase (NOS are two of those enzymes considered to be involved in tumorigenesis. The goal of this article was to study the involvement of arginase and NOS in the development of different stages of breast cancer. Our results have shown that human serum arginase activity and NO (resp., and NOS activity and polyamines quantities increased in parallel with cancer stage progression and decreased after neoadjuvant chemotherapy. For breast cancer, the only isoenzyme of arginase expressed in serum before and after chemotherapy was in a cationic form. The data of Lineweaver-Burk plot with a Km value of 2 mM was calculated, which is characteristic for human liver type isoform of arginase. During electrophoresis at pH 8.9, the enzyme exhibited high electrophoretic mobility and was detected near the anode. The presented results demonstrated that arginase in human serum with breast cancer and after chemotherapy is not polymorphic. We suggest that arginase and NOS inhibition has antitumor effects on cancer development, as it can inhibit polyamines and NO levels, a precursor of cancer cell proliferation, metastasis, and tumor angiogenesis.
Relationship of tightly bound ADP and ATP to control and catalysis by chloroplast ATP synthase
Energy Technology Data Exchange (ETDEWEB)
Zhou, J.; Xue, Z.; Du, Z.; Melese, T.; Boyer, P.D.
1988-07-12
Whether the tightly bound ADP that can cause a pronounced inhibition of ATP hydrolysis by the chloroplast ATP synthase and F/sub 1/ ATPase (CF/sub 1/) is bound at catalytic sites or at noncatalytic regulatory sites or both has been uncertain. The authors have used photolabeling by 2-azido-ATP and 2-azido-ADP to ascertain the location, with Mg/sup 2 +/ activation, of tightly bound ADP (a) that inhibits the hydrolysis of ATP by chloroplast ATP synthase, (b) that can result in an inhibited form of CF/sub 1/ that slowly regains activity during ATP hydrolysis, and (c) that arises when low concentrations of ADP markedly inhibit the hydrolysis of GTP by CF/sub 1/. The data show that in all instances the inhibition is associated with ADP binding without inorganic phosphate (P/sub i/) at catalytic sites. After photophosphorylation of ADP or 2-azido-ADP with (/sup 32/P)P/sub i/, similar amounts of the corresponding triphosphates are present on washed thylakoid membranes. Trials with appropriately labeled substrates show that a small portion of the tightly bound 2-azido-ATP gives rise to covalent labeling with an ATP moiety at noncatalytic sites but that most of the bound 2-azido-ATP gives rise to covalent labeling with an ATP moiety at noncatalytic sites but that most of the bound 2-azido-ATP gives rise to covalent labeling by an ADP moiety at a catalytic site. They also report the occurrence of a 1-2-min delay in the onset of the Mg/sup 2 +/-induced inhibition after addition of CF/sub 1/ to solutions containing Mg/sup 2 +/ and ATP, and that this delay is not associated with the filling of noncatalytic sites. A rapid burst of P/sub i/ formation is followed by a much lower, constant steady-state rate. The burst is not observed with GTP as a substrate or with Ca/sup 2 +/ as the activating cation.
Pivotal role of glycogen synthase kinase-3: A therapeutic target for Alzheimer's disease.
Maqbool, Mudasir; Mobashir, Mohammad; Hoda, Nasimul
2016-01-01
Neurodegenerative diseases are among the most challenging diseases with poorly known mechanism of cause and paucity of complete cure. Out of all the neurodegenerative diseases, Alzheimer's disease is the most devastating and loosening of thinking and judging ability disease that occurs in the old age people. Many hypotheses came forth in order to explain its causes. In this review, we have enlightened Glycogen Synthase Kinase-3 which has been considered as a concrete cause for Alzheimer's disease. Plaques and Tangles (abnormal structures) are the basic suspects in damaging and killing of nerve cells wherein Glycogen Synthase Kinase-3 has a key role in the formation of these fatal accumulations. Various Glycogen Synthase Kinase-3 inhibitors have been reported to reduce the amount of amyloid-beta as well as the tau hyperphosphorylation in both neuronal and nonneuronal cells. Additionally, Glycogen Synthase Kinase-3 inhibitors have been reported to enhance the adult hippocampal neurogenesis in vivo as well as in vitro. Keeping the chemotype of the reported Glycogen Synthase Kinase-3 inhibitors in consideration, they may be grouped into natural inhibitors, inorganic metal ions, organo-synthetic, and peptide like inhibitors. On the basis of their mode of binding to the constituent enzyme, they may also be grouped as ATP, nonATP, and allosteric binding sites competitive inhibitors. ATP competitive inhibitors were known earlier inhibitors but they lack efficient selectivity. This led to find the new ways for the enzyme inhibition. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
International Nuclear Information System (INIS)
Kralj, Ana; Gurgui, Mihaela; Koenig, Gabriele M.; Echten-Deckert, Gerhild van
2007-01-01
Trichothecenes are sesquiterpenoid metabolites produced by several fungal strains that impair human and animal health. Since sphingolipids were connected with fungal toxicity the aim of the present study was to test the influence of fungal metabolites on sphingolipid metabolism in neural cells. The crude extract of fungal strain Spicellum roseum induced accumulation of glucosylceramide (GlcCer), and simultaneous reduction of the formation of lactosylceramide (LacCer) and complex gangliosides in primary cultured neurons. Following a bioassay-guided fractionation of the respective fungal extract we could demonstrate that the two isolated trichothecene derivatives, 8-deoxy-trichothecin (8-dT) and trichodermol (Td-ol) were responsible for this effect. Thus, incubation of primary cultured neurons as well as of neuroblastoma B104 cells for 24 h with 30 μM of either of the two fungal metabolites resulted in uncoupling of sphingolipid biosynthesis at the level of LacCer. For the observed reduction of LacCer synthase activity by about 90% cell integrity was crucial in both cell types. In neuroblastoma cells the amount of LacCer synthase mRNA was reduced in the presence of trichothecenes, whereas in primary cultured neurons this was not the case, suggesting a post-transcriptional mechanism of action in the latter cell type. The data also show that the compounds did not interfere with the translocation of GlcCer in neuroblastoma cells. Collectively, our results demonstrate that trichodermol and 8-deoxy-trichothecin inhibit LacCer synthase activity in a cell-type-specific manner
Beurel, Eléonore; Grieco, Steven F; Amadei, Celeste; Downey, Kimberlee; Jope, Richard S
2016-09-01
Sub-anesthetic doses of ketamine have been found to provide rapid antidepressant actions, indicating that the cellular signaling systems targeted by ketamine are potential sites for therapeutic intervention. Ketamine acts as an antagonist of N-methyl-D-aspartate (NMDA) receptors, and animal studies indicate that subsequent augmentation of signaling by α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptors is critical for the antidepressant outcome. In this study, we tested if the inhibitory effect of ketamine on glycogen synthase kinase-3 (GSK3) affected hippocampal cell-surface AMPA receptors using immunoblotting of membrane and synaptosomal extracts from wild-type and GSK3 knockin mice. Treatment with an antidepressant dose of ketamine increased the hippocampal membrane level of the AMPA glutamate receptor (GluA)1 subunit, but did not alter the localization of GluA2, GluA3, or GluA4. This effect of ketamine was abrogated in GSK3 knockin mice expressing mutant GSK3 that cannot be inhibited by ketamine, demonstrating that ketamine-induced inhibition of GSK3 is necessary for up-regulation of cell surface AMPA GluA1 subunits. AMPA receptor trafficking is regulated by post-synaptic density-95 (PSD-95), a substrate for GSK3. Ketamine treatment decreased the hippocampal membrane level of phosphorylated PSD-95 on Thr-19, the target of GSK3 that promotes AMPA receptor internalization. These results demonstrate that ketamine-induced inhibition of GSK3 causes reduced phosphorylation of PSD-95, diminishing the internalization of AMPA GluA1 subunits to allow for augmented signaling through AMPA receptors following ketamine treatment. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants
Energy Technology Data Exchange (ETDEWEB)
Somerville, Chris R.; Scieble, Wolf
2000-10-11
Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.
Directory of Open Access Journals (Sweden)
Ikuro eAbe
2012-03-01
Full Text Available Benzalacetone synthase, from the medicinal plant Rheum palmatum (Polygonaceae (RpBAS, is a plant-specific chalcone synthase (CHS superfamily of type III polyketide synthase (PKS. RpBAS catalyzes the one-step, decarboxylative condensation of 4-coumaroyl-CoA with malonyl-CoA to produce the C6-C4 benzalacetone scaffold. The X-ray crystal structures of RpBAS confirmed that the diketide-forming activity is attributable to the characteristic substitution of the conserved active-site "gatekeeper" Phe with Leu. Furthermore, the crystal structures suggested that RpBAS employs novel catalytic machinery for the thioester bond cleavage of the enzyme-bound diketide intermediate and the final decarboxylation reaction to produce benzalacetone. Finally, by exploiting the remarkable substrate tolerance and catalytic versatility of RpBAS, precursor-directed biosynthesis efficiently generated chemically and structurally divergent, unnatural novel polyketide scaffolds. These findings provided a structural basis for the functional diversity of the type III PKS enzymes.
DEFF Research Database (Denmark)
Krath, B N; Hove-Jensen, B
2001-01-01
Spinach 5-phospho-D-ribosyl alpha-1-diphosphate (PRPP) synthase isozyme 4 was synthesized in Escherichia coli and purified to near homogeneity. The activity of the enzyme is independent of P(i); it is inhibited by ADP in a competitive manner, indicating a lack of an allosteric site; and it accepts...... is consistent with a homotrimer. Secondary structure prediction shows that spinach PRPP synthase isozyme 4 has a general folding similar to that of Bacillus subtilis class I PRPP synthase, for which the three-dimensional structure has been solved, as the position and extent of helices and beta-sheets of the two...... in the spinach enzyme. In contrast, residues of the active site of B. subtilis PRPP synthase show extensive conservation in spinach PRPP synthase isozyme 4....
Directory of Open Access Journals (Sweden)
Xiang Zhou
2014-07-01
Full Text Available A set of bisphosphonate ethers has been prepared through sequential phosphonylation and alkylation of monophosphonate ethers. After formation of the corresponding phosphonic acid salts, these compounds were tested for their ability to inhibit the enzyme geranylgeranyl diphosphate synthase (GGDPS. Five of the new compounds show IC50 values of less than 1 μM against GGDPS with little to no activity against the related enzyme farnesyl diphosphate synthase (FDPS. The most active compound displayed an IC50 value of 82 nM when assayed with GGDPS, and no activity against FDPS even at a 10 μM concentration.
Grieco, Steven F; Velmeshev, Dmitry; Magistri, Marco; Eldar-Finkelman, Hagit; Faghihi, Mohammad A; Jope, Richard S; Beurel, Eleonore
2017-09-01
We examined mechanisms that contribute to the rapid antidepressant effect of ketamine in mice that is dependent on glycogen synthase kinase-3 (GSK3) inhibition. We measured serotonergic (5HT)-2C-receptor (5HTR2C) cluster microRNA (miRNA) levels in mouse hippocampus after administering an antidepressant dose of ketamine (10 mg/kg) in wild-type and GSK3 knockin mice, after GSK3 inhibition with L803-mts, and in learned helpless mice. Ketamine up-regulated cluster miRNAs 448-3p, 764-5p, 1264-3p, 1298-5p and 1912-3p (2- to 11-fold). This up-regulation was abolished in GSK3 knockin mice that express mutant constitutively active GSK3. The GSK3 specific inhibitor L803-mts was antidepressant in the learned helplessness and novelty suppressed feeding depression-like behaviours and up-regulated the 5HTR2C miRNA cluster in mouse hippocampus. After administration of the learned helplessness paradigm mice were divided into cohorts that were resilient (non-depressed) or were susceptible (depressed) to learned helplessness. The resilient, but not depressed, mice displayed increased hippocampal levels of miRNAs 448-3p and 1264-3p. Administration of an antagonist to miRNA 448-3p diminished the antidepressant effect of ketamine in the learned helplessness paradigm, indicating that up-regulation of miRNA 448-3p provides an antidepressant action. These findings identify a new outcome of GSK3 inhibition by ketamine that may contribute to antidepressant effects.
Zhu, J J; Luo, J; Sun, Y T; Shi, H B; Li, J; Wu, M; Yu, K; Haile, A B; Loor, J J
2015-05-01
The role of fatty acid synthase (FASN) on de novo fatty acid synthesis has been well established. In monogastrics, unlike acetyl-coenzyme A carboxylase, FASN is primarily controlled at the transcriptional level. However, no data exist on ruminant mammary cells evaluating effects of FASN knockdown on mRNA expression of lipogenic genes. Inhibition of FASN in mammary cells by C75-mediated interference, a synthetic inhibitor of FASN activity, and short hairpin RNA-mediated interference markedly reduced cellular triglyceride content at least in part by decreasing the expression of genes related to triglyceride synthesis (GPAT, AGPAT6, and DGAT2) and enhancing the expression of lipolysis-related genes (ATGL and HSL). Consistent with the markedly lower expression of genes related to lipid droplet formation and secretion (TIP47, ADFP, BTN1A1, and XDH), cellular lipid droplets also were reduced sharply after incubation with C75 or adenovirus-short-hairpin-RNA. The results underscored the essential role of FASN in the overall process of milk-fat formation in goat mammary epithelial cells. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Charles F Zwemer
Full Text Available We determined, for packed red blood cells (PRBC and fresh frozen plasma, the maximum content, and ability to release the endogenous nitric oxide synthase (NOS inhibitors asymmetric dimethylarginine (ADMA and monomethylarginine (LNMMA.ADMA and LNMMA are near equipotent NOS inhibitors forming blood's total NOS inhibitory content. The balance between removal from, and addition to plasma determines their free concentrations. Removal from plasma is by well-characterized specific hydrolases while formation is restricted to posttranslational protein methylation. When released into plasma they can readily enter endothelial cells and inhibit NOS. Fresh rat and human whole blood contain substantial protein incorporated ADMA however; the maximum content of ADMA and LNMMA in PRBC and fresh frozen plasma has not been determined.We measured total (free and protein incorporated ADMA and LNMMA content in PRBCs and fresh frozen plasma, as well as their incubation induced release, using HPLC with fluorescence detection. We tested the hypothesis that PRBC and fresh frozen plasma contain substantial inhibitory methylarginines that can be released chemically by complete in vitro acid hydrolysis or physiologically at 37°C by enzymatic blood proteolysis.In vitro strong-acid-hydrolysis revealed a large PRBC reservoir of ADMA (54.5 ± 9.7 µM and LNMMA (58.9 ± 28.9 μM that persisted over 42-d at 6° or -80°C. In vitro 5h incubation at 37°C nearly doubled free ADMA and LNMMNA concentration from PRBCs while no change was detected in fresh frozen plasma.The compelling physiological ramifications are that regardless of storage age, 1 PRBCs can rapidly release pathologically relevant quantities of ADMA and LNMMA when incubated and 2 PRBCs have a protein-incorporated inhibitory methylarginines reservoir 100 times that of normal free inhibitory methylarginines in blood and thus could represent a clinically relevant and proximate risk for iatrogenic NOS inhibition upon
Fatty Acid Synthase Activity as a Target for c-Met Driven Prostate Cancer
2013-07-01
cancer potentially due to increased fecal fat excretion. In addition, several families of plant-derived flavonoid compounds including...Apoptosis by Flavonoids Is Associated with Their Ability to Inhibit Fatty Acid Synthase Activity. J. Biol. Chem., 2005. 280(7): p. 5636-5645. 156... flavonoids , represent a source of relatively nontoxic, orally available and affordable compounds that are known to affect a number of different
Rehman, Ajijur; Akhtar, Salman; Siddiqui, Mohd Haris; Sayeed, Usman; Ahmad, Syed Sayeed; Arif, Jamal M.; Khan, M. Kalim A.
2016-01-01
4-hydroxy-tetrahydrodipicolinate synthase (DHDPS) is an important enzyme needed for the biosynthesis of lysine and many more key metabolites in Mycobacterium tuberculosis (Mtb). Inhibition of DHDPS is supposed to a promising therapeutic target due to its specific role in sporulation, cross-linking of the peptidiglycan polymers and biosynthesis of amino acids. In this work, a known inhibitor-based similarity search was carried out against a natural products database (Super Natural II) towards ...
wALADin benzimidazoles differentially modulate the function of porphobilinogen synthase orthologs.
Lentz, Christian S; Halls, Victoria S; Hannam, Jeffrey S; Strassel, Silke; Lawrence, Sarah H; Jaffe, Eileen K; Famulok, Michael; Hoerauf, Achim; Pfarr, Kenneth M
2014-03-27
The heme biosynthesis enzyme porphobilinogen synthase (PBGS) is a potential drug target in several human pathogens. wALADin1 benzimidazoles have emerged as species-selective PBGS inhibitors against Wolbachia endobacteria of filarial worms. In the present study, we have systematically tested wALADins against PBGS orthologs from bacteria, protozoa, metazoa, and plants to elucidate the inhibitory spectrum. However, the effect of wALADin1 on different PBGS orthologs was not limited to inhibition: several orthologs were stimulated by wALADin1; others remained unaffected. We demonstrate that wALADins allosterically modulate the PBGS homooligomeric equilibrium with inhibition mediated by favoring low-activity oligomers, while 5-aminolevulinic acid, Mg(2+), or K(+) stabilized high-activity oligomers. Pseudomonas aeruginosa PBGS could be inhibited or stimulated by wALADin1 depending on these factors and pH. We have defined the wALADin chemotypes responsible for either inhibition or stimulation, facilitating the design of tailored PBGS modulators for potential application as antimicrobial agents, herbicides, or drugs for porphyric disorders.
The affinity purification and characterization of ATP synthase complexes from mitochondria.
Runswick, Michael J; Bason, John V; Montgomery, Martin G; Robinson, Graham C; Fearnley, Ian M; Walker, John E
2013-02-13
The mitochondrial F₁-ATPase inhibitor protein, IF₁, inhibits the hydrolytic, but not the synthetic activity of the F-ATP synthase, and requires the hydrolysis of ATP to form the inhibited complex. In this complex, the α-helical inhibitory region of the bound IF₁ occupies a deep cleft in one of the three catalytic interfaces of the enzyme. Its N-terminal region penetrates into the central aqueous cavity of the enzyme and interacts with the γ-subunit in the enzyme's rotor. The intricacy of forming this complex and the binding mode of the inhibitor endow IF₁ with high specificity. This property has been exploited in the development of a highly selective affinity procedure for purifying the intact F-ATP synthase complex from mitochondria in a single chromatographic step by using inhibitor proteins with a C-terminal affinity tag. The inhibited complex was recovered with residues 1-60 of bovine IF₁ with a C-terminal green fluorescent protein followed by a His-tag, and the active enzyme with the same inhibitor with a C-terminal glutathione-S-transferase domain. The wide applicability of the procedure has been demonstrated by purifying the enzyme complex from bovine, ovine, porcine and yeast mitochondria. The subunit compositions of these complexes have been characterized. The catalytic properties of the bovine enzyme have been studied in detail. Its hydrolytic activity is sensitive to inhibition by oligomycin, and the enzyme is capable of synthesizing ATP in vesicles in which the proton-motive force is generated from light by bacteriorhodopsin. The coupled enzyme has been compared by limited trypsinolysis with uncoupled enzyme prepared by affinity chromatography. In the uncoupled enzyme, subunits of the enzyme's stator are degraded more rapidly than in the coupled enzyme, indicating that uncoupling involves significant structural changes in the stator region.
Jullien, Frédéric; Moja, Sandrine; Bony, Aurélie; Legrand, Sylvain; Petit, Cécile; Benabdelkader, Tarek; Poirot, Kévin; Fiorucci, Sébastien; Guitton, Yann; Nicolè, Florence; Baudino, Sylvie; Magnard, Jean-Louis
2014-01-01
In this paper we characterize three sTPSs: a germacrene D (LaGERDS), a (E)-β-caryophyllene (LaCARS) and a τ-cadinol synthase (LaCADS). τ-cadinol synthase is reported here for the first time and its activity was studied in several biological models including transiently or stably transformed tobacco species. Three dimensional structure models of LaCADS and Ocimum basilicum γ-cadinene synthase were built by homology modeling using the template structure of Gossypium arboreum δ-cadinene synthase. The depiction of their active site organization provides evidence of the global influence of the enzymes on the formation of τ-cadinol: instead of a unique amino-acid, the electrostatic properties and solvent accessibility of the whole active site in LaCADS may explain the stabilization of the cadinyl cation intermediate. Quantitative PCR performed from leaves and inflorescences showed two patterns of expression. LaGERDS and LaCARS were mainly expressed during early stages of flower development and, at these stages, transcript levels paralleled the accumulation of the corresponding terpene products (germacrene D and (E)-β-caryophyllene). By contrast, the expression level of LaCADS was constant in leaves and flowers. Phylogenetic analysis provided informative results on potential duplication process leading to sTPS diversification in lavender.
International Nuclear Information System (INIS)
Grum, Daniel; Boom, Johannes van den; Neumann, Daniel; Matena, Anja; Link, Nina M.; Mueller, Jonathan W.
2010-01-01
3'-Phospho-adenosine-5'-phosphosulphate (PAPS) synthases are fundamental to mammalian sulphate metabolism. These enzymes have recently been linked to a rising number of human diseases. Despite many studies, it is not yet understood how the mammalian PAPS synthases 1 and 2 interact with each other. We provide first evidence for heterodimerisation of these two enzymes by pull-down assays and Foerster resonance energy transfer (FRET) measurements. Kinetics of dimer dissociation/association indicates that these heterodimers form as soon as PAPSS1 and -S2 encounter each other in solution. Affinity of the homo- and heterodimers were found to be in the low nanomolar range using anisotropy measurements employing proteins labelled with the fluorescent dye IAEDANS that - in spite of its low quantum yield - is well suited for anisotropy due to its large Stokes shift. Within its kinase domain, the PAPS synthase heterodimer displays similar substrate inhibition by adenosine-5'-phosphosulphate (APS) as the homodimers. Due to divergent catalytic efficacies of PAPSS1 and -S2, the heterodimer might be a way of regulating PAPS synthase function within mammalian cells.
Pagel, Paul S.; Krolikowski, John G.; Pratt, Phillip F.; Shim, Yon Hee; Amour, Julien; Warltier, David C.; Weihrauch, Dorothee
2008-01-01
BACKGROUND Prosurvival signaling kinases inhibit glycogen synthase kinase-3β (GSK-3β) activity and stimulate apoptotic protein p53 degradation. Helium produces cardioprotection by activating prosurvival kinases, but whether GSK and p53 inhibition mediate this process is unknown. We tested the hypothesis that inhibition of GSK or p53 lowers the threshold of helium cardioprotection via a mitochondrial permeability transition pore (mPTP)-dependent mechanism. METHODS Rabbits (n = 85) instrumented for hemodynamic measurement and subjected to a 30 min left anterior descending coronary artery (LAD) occlusion and 3 h reperfusion received 0.9% saline (control), or 1, 3, or 5 cycles of 70% helium-30% oxygen administered for 5 min interspersed with 5 min of an air-oxygen mixture (fraction of inspired oxygen concentration = 0.30) before LAD occlusion. Other rabbits received the GSK inhibitor SB 216763 (SB21; 0.2 or 0.6 mg/kg), the p53 inhibitor pifithrin-α (PIF; 1.5 or 3.0 mg/kg), or SB21 (0.2 mg/kg) or PIF (1.5 mg/kg) plus helium (1 cycle) before LAD occlusion in the presence or absence of the mPTP opener atractyloside (5 mg/kg). RESULTS Helium reduced (P < 0.05) myocardial infarct size (35 ± 6 [n = 7], 25 ± 4 [n = 7], and 20 ± 3% [n = 6] of area at risk, 1, 3, and 5 cycles, respectively) compared with control (44 ± 6% [n = 7]). SB21 (0.6 [n = 7] but not 0.2 mg/kg [n = 6]) and PIF (3.0 [n = 6] but not 1.5 mg/kg [n = 7]) also reduced necrosis. SB21 (0.2 mg/kg) or 1.5 mg/kg PIF (1.5 mg/kg) plus helium (1 cycle; n = 6 per group) decreased infarct size to an equivalent degree as three cycles of helium alone, and this cardioprotection was blocked by atractyloside (n = 7 per group). CONCLUSIONS Inhibition of GSK or p53 lowers the threshold of helium-induced preconditioning via a mPTP-dependent mechanism in vivo. PMID:18713881
Gonzalez, Veronica; Touchet, Sabrina; Grundy, Daniel J; Faraldos, Juan A; Allemann, Rudolf K
2014-10-15
Germacrene A synthase (GAS) from Solidago canadensis catalyzes the conversion of farnesyl diphosphate (FDP) to the plant sesquiterpene (+)-germacrene A. After diphosphate expulsion, farnesyl cation reacts with the distal 10,11-double bond to afford germacrene A (>96%) and <2% α-humulene, which arises from 1,11-cyclization of FDP. The origin of the 1,11-activity of GAS was investigated by amino acid sequence alignments of 1,10- and 1,11-synthases and comparisons of X-ray crystal structures with the homology model of GAS; a triad [Thr 401-Gly 402-Gly 403] that might be responsible for the predominant 1,10-cyclization activity of GAS was identified. Replacement of Gly 402 with residues of increasing size led to a progressive increase of 1,11-cyclization. The catalytic robustness of these 1,10- /1,11-GAS variants point to Gly 402 as a functional switch of evolutionary significance and suggests that enzymes with strict functionalities have evolved from less specific ancestors through a small number of substitutions. Similar results were obtained with germacrene D synthase (GDS) upon replacement of the homologous active-site residue Gly 404: GDS-G404V generated approximately 20% bicyclogermacrene, a hydrocarbon with a cyclopropane ring that underlines the dual 1,10-/1,11-cyclization activity of this mutant. This suggests that the reaction pathways to germacrenes and humulenes might be connected through a bridged 1,10,11-carbocation intermediate or transition state that resembles bicyclogermacrene. Mechanistic studies using [1-(3)H1]-10-fluorofarnesyl diphosphate and deuterium-labeling experiments with [12,13-(2)H6]-FDP support a germacrene-humulene rearrangement linking 1,10- and 1,11-pathways. These results support the bioinformatics proposal that modern 1,10-synthases could have evolved from promiscuous 1,11-sesquiterpene synthases.
Directory of Open Access Journals (Sweden)
Gea Guerriero
Full Text Available Oomycetes represent some of the most devastating plant and animal pathogens. Typical examples are Phytophthora infestans, which causes potato and tomato late blight, and Saprolegnia parasitica, responsible for fish diseases. Despite the economical and environmental importance of oomycete diseases, their control is difficult, particularly in the aquaculture industry. Carbohydrate synthases are vital for hyphal growth and represent interesting targets for tackling the pathogens. The existence of 2 different chitin synthase genes (SmChs1 and SmChs2 in Saprolegnia monoica was demonstrated using bioinformatics and molecular biology approaches. The function of SmCHS2 was unequivocally demonstrated by showing its catalytic activity in vitro after expression in Pichia pastoris. The recombinant SmCHS1 protein did not exhibit any activity in vitro, suggesting that it requires other partners or effectors to be active, or that it is involved in a different process than chitin biosynthesis. Both proteins contained N-terminal Microtubule Interacting and Trafficking domains, which have never been reported in any other known carbohydrate synthases. These domains are involved in protein recycling by endocytosis. Enzyme kinetics revealed that Saprolegnia chitin synthases are competitively inhibited by nikkomycin Z and quantitative PCR showed that their expression is higher in presence of the inhibitor. The use of nikkomycin Z combined with microscopy showed that chitin synthases are active essentially at the hyphal tips, which burst in the presence of the inhibitor, leading to cell death. S. parasitica was more sensitive to nikkomycin Z than S. monoica. In conclusion, chitin synthases with species-specific characteristics are involved in tip growth in Saprolegnia species and chitin is vital for the micro-organisms despite its very low abundance in the cell walls. Chitin is most likely synthesized transiently at the apex of the cells before cellulose, the major
Directory of Open Access Journals (Sweden)
Kawamukai Makoto
2004-11-01
Full Text Available Abstract Background Isopentenyl diphosphate (IPP, a common biosynthetic precursor to the labdane diterpene forskolin, has been biosynthesised via a non-mevalonate pathway. Geranylgeranyl diphosphate (GGPP synthase is an important branch point enzyme in terpenoid biosynthesis. Therefore, GGPP synthase is thought to be a key enzyme in biosynthesis of forskolin. Herein we report the first confirmation of the GGPP synthase gene in Coleus forskohlii Briq. Results The open reading frame for full-length GGPP synthase encodes a protein of 359 amino acids, in which 1,077 nucleotides long with calculated molecular mass of 39.3 kDa. Alignments of C. forskohlii GGPP synthase amino acid sequences revealed high homologies with other plant GGPP synthases. Several highly conserved regions, including two aspartate-rich motifs were identified. Transient expression of the N-terminal region of C. forskohlii GGPP synthase-GFP fusion protein in tobacco cells demonstrated subcellular localization in the chloroplast. Carotenoid production was observed in Escherichia coli harboring pACCAR25ΔcrtE from Erwinia uredovora and plasmid carrying C. forskohlii GGPP synthase. These results suggested that cDNA encoded functional GGPP synthase. Furthermore, C. forskohlii GGPP synthase expression was strong in leaves, decreased in stems and very little expression was observed in roots. Conclusion This investigation proposed that forskolin was synthesised via a non-mevalonate pathway. GGPP synthase is thought to be involved in the biosynthesis of forskolin, which is primarily synthesised in the leaves and subsequently accumulates in the stems and roots.
Ye, Shoudong; Tan, Li; Yang, Rongqing; Fang, Bo; Qu, Su; Schulze, Eric N.; Song, Houyan; Ying, Qilong; Li, Ping
2012-01-01
Background Inhibition of glycogen synthase kinase-3 (GSK-3) improves the efficiency of embryonic stem (ES) cell derivation from various strains of mice and rats, as well as dramatically promotes ES cell self-renewal potential. β-catenin has been reported to be involved in the maintenance of self-renewal of ES cells through TCF dependent and independent pathway. But the intrinsic difference between ES cell lines from different species and strains has not been characterized. Here, we dissect the mechanism of GSK-3 inhibition by CHIR99021 in mouse ES cells from refractory mouse strains. Methodology/Principal Findings We found that CHIR99021, a GSK-3 specific inhibitor, promotes self-renewal of ES cells from recalcitrant C57BL/6 (B6) and BALB/c mouse strains through stabilization of β-catenin and c-Myc protein levels. Stabilized β-catenin promoted ES self-renewal through two mechanisms. First, β-catenin translocated into the nucleus to maintain stem cell pluripotency in a lymphoid-enhancing factor/T-cell factor–independent manner. Second, β-catenin binds plasma membrane-localized E-cadherin, which ensures a compact, spherical morphology, a hallmark of ES cells. Further, elevated c-Myc protein levels did not contribute significantly to CH-mediated ES cell self-renewal. Instead, the role of c-Myc is dependent on its transformation activity and can be replaced by N-Myc but not L-Myc. β-catenin and c-Myc have similar effects on ES cells derived from both B6 and BALB/c mice. Conclusions/Significance Our data demonstrated that GSK-3 inhibition by CH promotes self-renewal of mouse ES cells with non-permissive genetic backgrounds by regulation of multiple signaling pathways. These findings would be useful to improve the availability of normally non-permissive mouse strains as research tools. PMID:22540008
Czech Academy of Sciences Publication Activity Database
Kyselková, Martina; Janata, Jiří; Ságová-Marečková, M.; Kopecký, J.
2010-01-01
Roč. 192, č. 3 (2010), s. 195-200 ISSN 0302-8933 R&D Projects: GA MŠk 2B08064 Institutional research plan: CEZ:AV0Z50200510 Keywords : Streptomyces cinnamonensis * Acetohydroxy acid synthase * Subunit-subunit interaction Subject RIV: EE - Microbiology, Virology Impact factor: 1.754, year: 2010
Tomatidine Is a Lead Antibiotic Molecule That Targets Staphylococcus aureus ATP Synthase Subunit C.
Lamontagne Boulet, Maxime; Isabelle, Charles; Guay, Isabelle; Brouillette, Eric; Langlois, Jean-Philippe; Jacques, Pierre-Étienne; Rodrigue, Sébastien; Brzezinski, Ryszard; Beauregard, Pascale B; Bouarab, Kamal; Boyapelly, Kumaraswamy; Boudreault, Pierre-Luc; Marsault, Éric; Malouin, François
2018-06-01
Methicillin-resistant Staphylococcus aureus (MRSA) is a leading cause of deadly hospital-acquired infections. The discovery of anti- Staphylococcus antibiotics and new classes of drugs not susceptible to the mechanisms of resistance shared among bacteria is imperative. We recently showed that tomatidine (TO), a steroidal alkaloid from solanaceous plants, possesses potent antibacterial activity against S. aureus small-colony variants (SCVs), the notoriously persistent form of this bacterium that has been associated with recurrence of infections. Here, using genomic analysis of in vitro -generated TO-resistant S. aureus strains to identify mutations in genes involved in resistance, we identified the bacterial ATP synthase as the cellular target. Sequence alignments were performed to highlight the modified sequences, and the structural consequences of the mutations were evaluated in structural models. Overexpression of the atpE gene in S. aureus SCVs or introducing the mutation found in the atpE gene of one of the high-level TO-resistant S. aureus mutants into the Bacillus subtilis atpE gene provided resistance to TO and further validated the identity of the cellular target. FC04-100, a TO derivative which also possesses activity against non-SCV strains, prevents high-level resistance development in prototypic strains and limits the level of resistance observed in SCVs. An ATP synthesis assay allowed the observation of a correlation between antibiotic potency and ATP synthase inhibition. The selectivity index (inhibition of ATP production by mitochondria versus that of bacterial ATP synthase) is estimated to be >10 5 -fold for FC04-100. Copyright © 2018 American Society for Microbiology.
Ye, Yanfang; Fujii, Makoto; Hirata, Aiko; Kawamukai, Makoto; Shimoda, Chikashi; Nakamura, Taro
2007-09-01
Both farnesyl diphosphate synthase (FPS) and geranylgeranyl diphosphate synthase (GGPS) are key enzymes in the synthesis of various isoprenoid-containing compounds and proteins. Here, we describe two novel Schizosaccharomyces pombe genes, fps1(+) and spo9(+), whose products are similar to FPS in primary structure, but whose functions differ from one another. Fps1 is essential for vegetative growth, whereas, a spo9 null mutant exhibits temperature-sensitive growth. Expression of fps1(+), but not spo9(+), suppresses the lethality of a Saccharomyces cerevisiae FPS-deficient mutant and also restores ubiquinone synthesis in an Escherichia coli ispA mutant, which lacks FPS activity, indicating that S. pombe Fps1 in fact functions as an FPS. In contrast to a typical FPS gene, no apparent GGPS homologues have been found in the S. pombe genome. Interestingly, although neither fps1(+) nor spo9(+) expression alone in E. coli confers clear GGPS activity, coexpression of both genes induces such activity. Moreover, the GGPS activity is significantly reduced in the spo9 mutant. In addition, the spo9 mutation perturbs the membrane association of a geranylgeranylated protein, but not that of a farnesylated protein. Yeast two-hybrid and coimmunoprecipitation analyses indicate that Fps1 and Spo9 physically interact. Thus, neither Fps1 nor Spo9 alone functions as a GGPS, but the two proteins together form a complex with GGPS activity. Because spo9 was originally identified as a sporulation-deficient mutant, we show here that expansion of the forespore membrane is severely inhibited in spo9Delta cells. Electron microscopy revealed significant accumulation membrane vesicles in spo9Delta cells. We suggest that lack of GGPS activity in a spo9 mutant results in impaired protein prenylation in certain proteins responsible for secretory function, thereby inhibiting forespore membrane formation.
International Nuclear Information System (INIS)
Nishimoto, Tomoyuki; Ishikawa, Eiichiro; Anayama, Hisashi; Hamajyo, Hitomi; Nagai, Hirofumi; Hirakata, Masao; Tozawa, Ryuichi
2007-01-01
High-dose statin treatment has been recommended as a primary strategy for aggressive reduction of LDL cholesterol levels and protection against coronary artery disease. The effectiveness of high-dose statins may be limited by their potential for myotoxic side effects. There is currently little known about the molecular mechanisms of statin-induced myotoxicity. Previously we showed that T-91485, an active metabolite of the squalene synthase inhibitor lapaquistat acetate (lapaquistat: a previous name is TAK-475), attenuated statin-induced cytotoxicity in human skeletal muscle cells [Nishimoto, T., Tozawa, R., Amano, Y., Wada, T., Imura, Y., Sugiyama, Y., 2003a. Comparing myotoxic effects of squalene synthase inhibitor, T-91485, and 3-hydroxy-3-methylglutaryl coenzyme A. Biochem. Pharmacol. 66, 2133-2139]. In the current study, we investigated the effects of lapaquistat administration on statin-induced myotoxicity in vivo. Guinea pigs were treated with either high-dose cerivastatin (1 mg/kg) or cerivastatin together with lapaquistat (30 mg/kg) for 14 days. Treatment with cerivastatin alone decreased plasma cholesterol levels by 45% and increased creatine kinase (CK) levels by more than 10-fold (a marker of myotoxicity). The plasma CK levels positively correlated with the severity of skeletal muscle lesions as assessed by histopathology. Co-administration of lapaquistat almost completely prevented the cerivastatin-induced myotoxicity. Administration of mevalonolactone (100 mg/kg b.i.d.) prevented the cerivastatin-induced myotoxicity, confirming that this effect is directly related to HMG-CoA reductase inhibition. These results strongly suggest that cerivastatin-induced myotoxicity is due to depletion of mevalonate derived isoprenoids. In addition, squalene synthase inhibition could potentially be used clinically to prevent statin-induced myopathy
Ren, Feng; Zhang, Hai-yan; Piao, Zheng-fu; Zheng, Su-jun; Chen, Yu; Chen, De-xi; Duan, Zhong-ping
2012-09-01
To determine the mechanism underlying the therapeutic activities of glycogen synthase kinase 3b (GSK3b) against hepatic ischemia-reperfusion (H-IR) injury by investigating the inhibitive effects of GSK3b on inflammation mediated by Toll-like receptor 4 (TLR4). C57BL/6 male mice were subjected to 90 min of warm liver cephalad lobe ischemia, followed by reperfusion for various lengths of time. The mice were divided into three groups: the H-IR untreated model (control group), and the H-IR inflammation-induced models that received an intraperitoneal injection of purified lipopolysaccharide (LPS) endotoxin alone (inflammation group) or with pretreatment of the SB216763 GSK3b-specific inhibitor (intervention group). To create a parallel isolated cell system for detailed investigations of macrophages, marrow-derived stem cells were isolated from femurs of the H-IR control group of mice and used to derive primary macrophages. The cells were then divided into the same three groups as the whole mouse system: control, LPS-induced inflammation model, and inflammation model with SB216763 intervention. Differential expressions of inflammation-related proteins and genes were detected by Western blotting and real-time quantitative PCR, respectively. The phosphorylation levels of ERK, JNK and p38 MAPK were induced in liver at 1 h after reperfusion, but then steadily decreased and returned to baseline levels by 4 h after reperfusion. In addition, the phosphorylation levels of ERK and JNK were induced in macrophages at 15 min after LPS stimulation, while the phosphorylation level of p38 MAPK was induced at 1 h; SB216763 pretreatment suppressed the LPS-stimulated ERK, JNK and p38 phosphorylation in macrophages. In the mouse model, GSK3b activity was found to promote the gene expression of anti-inflammatory cytokine IL-10 (control: 0.21 ± 0.08, inflammation: 0.83 ± 0.21, intervention: 1.76 ± 0.67; F = 3.16, P = 0.027) but to significantly inhibit the gene expression of pro
DEFF Research Database (Denmark)
Ebbesson, Lars O E; Tipsmark, Christian K; Holmqvist, Bo
2005-01-01
We investigated the relationship between nitric oxide (NO) and Na(+),K(+)-ATPase (NKA) in the gill of anadromous Atlantic salmon. Cells containing NO-producing enzymes were revealed by means of nitric oxide synthase (NOS) immunocytochemistry and nicotinamide adenine dinucleotide phosphate diaphor...
Endler, Anne; Schneider, Rene; Kesten, Christopher; Lampugnani, Edwin R.; Persson, Staffan
2016-01-01
Cellulose is a cell wall constituent that is essential for plant growth and development, and an important raw material for a range of industrial applications. Cellulose is synthesized at the plasma membrane by massive cellulose synthase (CesA) complexes that track along cortical microtubules in elongating cells of Arabidopsis through the activity of the protein CELLULOSE SYNTHASE INTERACTING1 (CSI1). In a recent study we identified another family of proteins that also are associated with the ...
Sphingomyelin synthases regulate protein trafficking and secretion.
Directory of Open Access Journals (Sweden)
Marimuthu Subathra
Full Text Available Sphingomyelin synthases (SMS1 and 2 represent a class of enzymes that transfer a phosphocholine moiety from phosphatidylcholine onto ceramide thus producing sphingomyelin and diacylglycerol (DAG. SMS1 localizes at the Golgi while SMS2 localizes both at the Golgi and the plasma membrane. Previous studies from our laboratory showed that modulation of SMS1 and, to a lesser extent, of SMS2 affected the formation of DAG at the Golgi apparatus. As a consequence, down-regulation of SMS1 and SMS2 reduced the localization of the DAG-binding protein, protein kinase D (PKD, to the Golgi. Since PKD recruitment to the Golgi has been implicated in cellular secretion through the trans golgi network (TGN, the effect of down-regulation of SMSs on TGN-to-plasma membrane trafficking was studied. Down regulation of either SMS1 or SMS2 significantly retarded trafficking of the reporter protein vesicular stomatitis virus G protein tagged with GFP (VSVG-GFP from the TGN to the cell surface. Inhibition of SMSs also induced tubular protrusions from the trans Golgi network reminiscent of inhibited TGN membrane fission. Since a recent study demonstrated the requirement of PKD activity for insulin secretion in beta cells, we tested the function of SMS in this model. Inhibition of SMS significantly reduced insulin secretion in rat INS-1 cells. Taken together these results provide the first direct evidence that both enzymes (SMS1 and 2 are capable of regulating TGN-mediated protein trafficking and secretion, functions that are compatible with PKD being a down-stream target for SMSs in the Golgi.
DEFF Research Database (Denmark)
Ørskov, Lotte; Bak, Jens Friis; Abildgaard, Ulrik
1996-01-01
The purpose of the present study was to evaluate the role of muscle glycogen synthase activity in the reduction of glucose uptake during hypoglycaemia. Six healthy young men were examined twice; during 120 min of hyperinsulinaemic (1.5 mU.kg-1. min-1) euglycaemia followed by: 1)240 min of graded ...
Directory of Open Access Journals (Sweden)
Virginie Frings
Full Text Available OBJECTIVES: Pemetrexed is a thymidylate synthase (TS inhibitor and is effective in non-small cell lung cancer (NSCLC. 3'-deoxy-3'-[¹⁸F]fluorothymidine (¹⁸F-FLT, a proliferation marker, could potentially identify tumor specific TS-inhibition. The aim of this study was to investigate the effect of pemetrexed-induced TS-inhibition on ¹⁸F-FLT uptake 4 hours after pemetrexed administration in metastatic NSCLC patients. METHODS: Fourteen NSCLC patients underwent dynamic ¹⁸F-FLT positron emission tomography (PET scans at baseline and 4 hours after the first dose of pemetrexed. Volumes of interest were defined with a 41%, 50% and 70% threshold of the maximum pixel. Kinetic analysis and simplified measures were performed. At one, two, four and six hours after pemetrexed, plasma deoxyuridine was measured as systemic indicator of TS-inhibition. Tumor response measured with response evaluation criteria in solid tumors (RECIST, time to progression (TTP and overall survival (OS were determined. RESULTS: Eleven patients had evaluable ¹⁸F-FLT PET scans at baseline and 4 hours after pemetrexed. Two patients had increased ¹⁸F-FLT uptake of 35% and 31% after pemetrexed, whereas two other patients had decreased uptake of 31%. In the remaining seven patients ¹⁸F-FLT uptake did not change beyond test-retest borders. In all patients deoxyuridine levels raised after administration of pemetrexed, implicating pemetrexed-induced TS-inhibition. ¹⁸F-FLT uptake in bone marrow was significantly increased 4 hours after pemetrexed administration. Six weeks after the start of treatment 5 patients had partial response, 4 stable disease and 2 progressive disease. Median TTP was 4.2 months (range 3.0-7.4 months; median OS was 13.0 months (range 5.1-30.8 months. Changes in ¹⁸F-FLT uptake were not predictive for tumor response, TTP or OS. CONCLUSIONS: Measuring TS-inhibition in a clinical setting 4 hours after pemetrexed revealed a non-systematic change in
Farb, Melissa G.; Tiwari, Stephanie; Karki, Shakun; Ngo, Doan TM; Carmine, Brian; Hess, Donald T.; Zuriaga, Maria A.; Walsh, Kenneth; Fetterman, Jessica L.; Hamburg, Naomi M.; Vita, Joseph A.; Apovian, Caroline M.; Gokce, Noyan
2013-01-01
Objective The purpose of this study was to determine whether cyclooxygenase inhibition improves vascular dysfunction of adipose microvessels from obese humans. Design and Methods In 20 obese subjects (age 37±12 yrs, BMI 47±8 kg/m2) we collected subcutaneous and visceral fat during bariatric surgery and characterized adipose depot-specific gene expression, endothelial cell phenotype, and microvascular function. Vasomotor function was assessed in response to endothelium-dependent agonists using videomicroscopy of small arterioles from fat. Results Arterioles from visceral fat exhibited impaired endothelium-dependent, acetylcholine-mediated vasodilation, compared to the subcutaneous depot (p<0.001). Expression of mRNA transcripts relevant to the cyclooxygenase pathway were upregulated in visceral compared to subcutaneous fat. Pharmacological inhibition of cyclooxygenase with indomethacin improved endothelium-dependent vasodilator function of arterioles from visceral fat by 2-fold (p=0.01), whereas indomethacin had no effect in the subcutaneous depot. Indomethacin increased activation via serine-1177 phosphorylation of endothelial nitric oxide synthase in response to acetylcholine in endothelial cells from visceral fat. Inhibition of endothelial nitric oxide synthase with Nω-nitro-L-arginine methyl ester abrogated the effects of cyclooxygenase-inhibition suggesting that vascular actions of indomethacin were related to increased nitric oxide bioavailability. Conclusions Our findings suggest that cyclooxygenase-mediated vasoconstrictor prostanoids partly contribute to endothelial dysfunction of visceral adipose arterioles in human obesity. PMID:23640904
Directory of Open Access Journals (Sweden)
Begoña Pellicer
2011-01-01
Full Text Available Cerebral palsy is a major neonatal handicap with unknown aetiology. There is evidence that prenatal brain injury is the leading cause of CP. Severe placental pathology accounts for a high percentage of cases. Several factors predispose to prenatal brain damage but when and how they act is unclear. The aim of this paper was to determine if hypoxia during pregnancy leads to damage in fetal brain and to evaluate the localization of this injury. An animal model of chronic hypoxia produced by chronic administration of a nitric oxide synthase inhibitor (L-NAME was used to evaluate apoptotic activity in fetal brains and to localize the most sensitive areas. L-NAME reproduces a preeclamptic-like condition with increased blood pressure, proteinuria, growth restriction and intrauterine mortality. Apoptotic activity was increased in L-NAME brains and the most sensitive areas were the subventricular and pallidum zone. These results may explain the clinical features of CP. Further studies are needed.
Inhibition of Cycloartenol Synthase (CAS) Function in Tobacco BY-2 Cells.
Gas-Pascual, Elisabet; Simonovik, Biljana; Schaller, Hubert; Bach, Thomas J
2015-08-01
Tobacco BY-2 cell suspensions are our preferred model for studying isoprenoid biosynthesis pathways, due to their easy genetic transformation and the efficient absorption of metabolic precursors, intermediates, and/or inhibitors. Using this model system, we have analyzed the effects of chemical and genetic blockage of cycloartenol synthase (CAS, EC 5.4.99.8), an oxidosqualene cyclase that catalyzes the first committed step in the sterol pathway of plants. BY-2 cells were treated with RO 48-8071, a potent inhibitor of oxidosqualene cyclization. Short-term treatments (24 h) resulted in accumulation of oxidosqualene with no changes in the final sterol products. Interestingly, long-term treatments (6 days) induced down-regulation in gene expression not only of CAS but also of the SMT2 gene coding sterol methyltransferase 2 (EC 2.1.1.41). This explains some of the increase in 24-methyl sterols at the expense of the 24-ethyl sterols stigmasterol and sitosterol. In our alternative strategy, CAS gene expression was partially blocked by using an inducible artificial microRNA. The limited effectiveness of this approach might be explained by some dependence of the machinery for RNAi formation on an operating MVA/sterol pathway. For comparison we checked the effect of RO 48-8071 on a green cell suspension of Arabidopsis and on seedlings, containing a small spectrum of triterpenes besides phytosterols. Triterpenes remained essentially unaffected, but phytosterol accumulation was clearly diminished.
Sun, Qi; Chen, Ling; Gao, Mengyu; Jiang, Wenwen; Shao, Fangxian; Li, Jingjing; Wang, Jun; Kou, Junping; Yu, Boyang
2012-01-01
Acute lung injury is still a significant clinical problem with a high mortality rate and there are few effective therapies in clinic. Here, we studied the inhibitory effect of ruscogenin, an anti-inflammatory and anti-thrombotic natural product, on lipopolysaccharide (LPS)-induced acute lung injury in mice basing on our previous studies. The results showed that a single oral administration of ruscogenin significantly decreased lung wet to dry weight (W/D) ratio at doses of 0.3, 1.0 and 3.0 mg/kg 1 h prior to LPS challenge (30 mg/kg, intravenous injection). Histopathological changes such as pulmonary edema, coagulation and infiltration of inflammatory cells were also attenuated by ruscogenin. In addition, ruscogenin markedly decreased LPS-induced myeloperoxidase (MPO) activity and nitrate/nitrite content, and also downregulated expression of tissue factor (TF), inducible NO synthase (iNOS) and nuclear factor (NF)-κB p-p65 (Ser 536) in the lung tissue at three doses. Furthermore, ruscogenin reduced plasma TF procoagulant activity and nitrate/nitrite content in LPS-induced ALI mice. These findings confirmed that ruscogenin significantly attenuate LPS-induced acute lung injury via inhibiting expressions of TF and iNOS and NF-κB p65 activation, indicating it as a potential therapeutic agent for ALI or sepsis. Copyright © 2011 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Patrick W. Geier
2013-04-01
Full Text Available A study was conducted for three seasons in northwest Kansas, USA to evaluate acetolactate synthase (ALS-inhibiting herbicides for downy brome (Bromus tectorum L. and winter annual broadleaf weed control in winter wheat. Herbicides included pyroxsulam at 18.4 g ai ha−1, propoxycarbazone-Na at 44 g ai ha−1, premixed propoxycarbazone-Na & mesosulfuron-methyl at 27 g ai ha−1, and sulfosulfuron at 35 g ai ha−1. The herbicides were applied postemergence in fall and spring seasons. Averaged over time of application, no herbicide controlled downy brome more than 78% in any year. When downy brome densities were high, control was less than 60%. Pyroxsulam controlled downy brome greater than or similar to other herbicides tested. Flixweed (Descurainia sophia L., blue mustard [Chorispora tenella (Pallas DC.], and henbit (Lamium amplexicaule L. control did not differ among herbicide treatments. All herbicides tested controlled flixweed and blue mustard at least 87% and 94%, respectively. However, none of the herbicides controlled henbit more than 73%. Fall herbicide applications improved weed control compared to early spring applications; improvement ranged from 3% to 31% depending on the weed species. Henbit control was greatly decreased by delaying herbicide applications until spring compared to fall applications (49% vs. 80% control. Herbicide injury was observed in only two instances. The injury was ≤13% with no difference between herbicides and the injury did not impact final plant height or grain yield.
Zhou, Mingjie; Ren, Huanhuan; Wang, Wenjuan; Zheng, Qiusheng; Wang, Dong
2015-01-01
Objective. This study aimed to evaluate the protective effect of kaempferol against myocardial ischemia/reperfusion (I/R) injury in rats. Method. Left ventricular developed pressure (LVDP) and its maximum up/down rate (±dp/dt max) were recorded as myocardial function. Infarct size was detected with 2,3,5-triphenyltetrazolium chloride staining. Cardiomyocyte apoptosis was determined using terminal deoxynucleotidyl nick-end labeling (TUNEL). The levels of creatine kinase (CK), lactate dehydrogenase (LDH), malondialdehyde (MDA), superoxide dismutase (SOD), glutathione/glutathione disulfide (GSH/GSSG) ratio, and tumor necrosis factor-alpha (TNF-α) were determined using enzyme linked immunosorbent assay (ELISA). Moreover, total glycogen synthase kinase-3β (GSK-3β), phospho-GSK-3β (P-GSK-3β), precaspase-3, cleaved caspase-3, and cytoplasm cytochrome C were assayed using Western blot analysis. Results. Pretreatment with kaempferol significantly improved the recovery of LVDP and ±dp/dt max, as well as increased the levels of SOD and P-GSK-3β and GSH/GSSG ratio. However, the pretreatment reduced myocardial infarct size and TUNEL-positive cell rate, as well as decreased the levels of cleaved caspase-3, cytoplasm cytochrome C, CK, LDH, MDA, and TNF-α. Conclusion. These results suggested that kaempferol provides cardioprotection via antioxidant activity and inhibition of GSK-3β activity in rats with I/R. PMID:26265983
Setiawan, Melina; Tan, Xiao-Wei; Goh, Tze-Wei; Hin-Fai Yam, Gary; Mehta, Jodhbir S
2017-09-02
This study was aimed to investigate the epithelial differentiation of human adipose-derived mesenchymal stem cells (ADSCs) by inhibiting glycogen synthase kinase-3 (GSK3) and transforming growth factor β (TGFβ) signaling. STEMPRO human ADSCs at passage 2 were treated with CHIR99021 (GSK3 inhibitor), E-616452 (TGFβ1 receptor kinase inhibitor), A-83-01 (TGFβ type 1 receptor inhibitor), valproic acid (histone deacetylase inhibitor), tranylcypromine (monoamine oxidase inhibitor) and all-trans retinoic acid for 72 h. The mesenchymal-epithelial transition was shown by down-regulation of mesenchymal genes (Slug, Zinc Finger E-box Binding Homeobox 1 ZEB1, integrin α5 ITGA5 and vimentin VIM) and up-regulation of epithelial genes (E-cadherin, Epithelial Cell Adhesion Molecule EpCAM, Zonula Occludens-1 ZO-1, occludin, deltaN p63 δNp63, Transcription Factor 4 TCF4 and Twist Family bHLH Transcription Factor TWIST), compared to untreated ADSCs. Cell morphology and stress fiber pattern were examined and the treated cells became less migratory in scratch wound closure assay. The formation of cell junction complexes was observed under transmission electron microscopy. Global gene expression using GeneChip ® Human Genome U133 Array (Affymetrix) showed that the treatment up-regulated 540 genes (containing genes for cell cycle, cytoskeleton reorganization, chemotaxis, epithelium development and regulation of cell migration) and down-regulated 483 genes. Human ADSCs were transited to epithelial lineage by inhibiting GSK3 and TGFβ signaling. It can be an adult stem cell source for epithelial cell-based therapy. Copyright © 2017 Elsevier Inc. All rights reserved.
Xu, Jinkun; Ai, Ying; Wang, Jianhui; Xu, Jingwei; Zhang, Yongkang; Yang, Dong
2017-05-01
S-limonene synthase is a model monoterpene synthase that cyclizes geranyl pyrophosphate (GPP) to form S-limonene. It is a relatively specific enzyme as the majority of its products are composed of limonene. In this study, we converted it to pinene or phellandrene synthases after introducing N345A/L423A/S454A or N345I mutations. Further studies on N345 suggest the polarity of this residue plays a critical role in limonene production by stabilizing the terpinyl cation intermediate. If it is mutated to a non-polar residue, further cyclization or hydride shifts occurs so the carbocation migrates towards the pyrophosphate, leading to the production of pinene or phellandrene. On the other hand, mutant enzymes that still possess a polar residue at this position produce limonene as the major product. N345 is not the only polar residue that may stabilize the terpinyl cation because it is not strictly conserved among limonene synthases across species and there are also several other polar residues in this area. These residues could form a "polar pocket" that may collectively play this stabilizing role. Our study provides important insights into the catalytic mechanism of limonene synthases. Furthermore, it also has wider implications on the evolution of terpene synthases. Copyright © 2017 Elsevier Ltd. All rights reserved.
Glycogen synthase kinase 3: more than a namesake.
Rayasam, Geetha Vani; Tulasi, Vamshi Krishna; Sodhi, Reena; Davis, Joseph Alex; Ray, Abhijit
2009-03-01
Glycogen synthase kinase 3 (GSK3), a constitutively acting multi-functional serine threonine kinase is involved in diverse physiological pathways ranging from metabolism, cell cycle, gene expression, development and oncogenesis to neuroprotection. These diverse multiple functions attributed to GSK3 can be explained by variety of substrates like glycogen synthase, tau protein and beta catenin that are phosphorylated leading to their inactivation. GSK3 has been implicated in various diseases such as diabetes, inflammation, cancer, Alzheimer's and bipolar disorder. GSK3 negatively regulates insulin-mediated glycogen synthesis and glucose homeostasis, and increased expression and activity of GSK3 has been reported in type II diabetics and obese animal models. Consequently, inhibitors of GSK3 have been demonstrated to have anti-diabetic effects in vitro and in animal models. However, inhibition of GSK3 poses a challenge as achieving selectivity of an over achieving kinase involved in various pathways with multiple substrates may lead to side effects and toxicity. The primary concern is developing inhibitors of GSK3 that are anti-diabetic but do not lead to up-regulation of oncogenes. The focus of this review is the recent advances and the challenges surrounding GSK3 as an anti-diabetic therapeutic target.
Geranylfarnesyl diphosphate synthase from Methanosarcina mazei: Different role, different evolution
International Nuclear Information System (INIS)
Ogawa, Takuya; Yoshimura, Tohru; Hemmi, Hisashi
2010-01-01
The gene of (all-E) geranylfarnesyl diphosphate synthase that is responsible for the biosynthesis of methanophenazine, an electron carrier utilized for methanogenesis, was cloned from a methanogenic archaeon Methanosarcina mazei Goe1. The properties of the recombinant enzyme and the results of phylogenetic analysis suggest that the enzyme is closely related to (all-E) prenyl diphosphate synthases that are responsible for the biosynthesis of respiratory quinones, rather than to the enzymes involved in the biosynthesis of archaeal membrane lipids, including (all-E) geranylfarnesyl diphosphate synthase from a thermophilic archaeon.
Beta-Glucan Synthase Gene Expression in Pleurotus sp
International Nuclear Information System (INIS)
Azhar Mohamad; Nie, H.J.
2016-01-01
Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)
Directory of Open Access Journals (Sweden)
Fonovich de Schroeder T.M.
1998-01-01
Full Text Available Nitric oxide synthase activity was measured in Langerhans islets isolated from control and streptozotocin diabetic rats. The activity of the enzyme was linear up to 150 µg of protein from control rats and was optimal at 0.1 µM calcium, when it was measured after 45 min of incubation at 37oC in the presence of 200 µM arginine. Specific activity of the enzyme was 25 x 10-4 nmol [3H]citrulline 45 min-1 mg protein-1. Streptozotocin diabetic rats exhibited less enzyme activity both in total pancreas homogenate and in isolated Langerhans islets when compared to control animals. Nitric oxide synthase activity measured in control and diabetic rats 15 days after the last streptozotocin injection in the second group of animals corresponded only to a constitutive enzyme since it was not inhibited by aminoguanidine in any of the mentioned groups. Hyperglycemia in diabetic rats may be the consequence of impaired insulin release caused at least in part by reduced positive modulation mediated by constitutive nitric oxide synthase activity, which was dramatically reduced in islets severely damaged after streptozotocin treatment.
Directory of Open Access Journals (Sweden)
Karthi Shanmugam
2018-01-01
Full Text Available Acute myocardial infarction (AMI is the leading cause of morbidity and mortality worldwide. Timely reperfusion is considered an optimal treatment for AMI. Paradoxically, the procedure of reperfusion can itself cause myocardial tissue injury. Therefore, a strategy to minimize the reperfusion-induced myocardial tissue injury is vital for salvaging the healthy myocardium. Herein, we investigated the cardioprotective effects of fisetin, a natural flavonoid, against ischemia/reperfusion (I/R injury (IRI using a Langendorff isolated heart perfusion system. I/R produced significant myocardial tissue injury, which was characterized by elevated levels of lactate dehydrogenase and creatine kinase in the perfusate and decreased indices of hemodynamic parameters. Furthermore, I/R resulted in elevated oxidative stress, uncoupling of the mitochondrial electron transport chain, increased mitochondrial swelling, a decrease of the mitochondrial membrane potential, and induction of apoptosis. Moreover, IRI was associated with a loss of the mitochondrial structure and decreased mitochondrial biogenesis. However, when the animals were pretreated with fisetin, it significantly attenuated the I/R-induced myocardial tissue injury, blunted the oxidative stress, and restored the structure and function of mitochondria. Mechanistically, the fisetin effects were found to be mediated via inhibition of glycogen synthase kinase 3β (GSK3β, which was confirmed by a biochemical assay and molecular docking studies.
Shanmugam, Karthi; Ravindran, Sriram; Kurian, Gino A; Rajesh, Mohanraj
2018-01-01
Acute myocardial infarction (AMI) is the leading cause of morbidity and mortality worldwide. Timely reperfusion is considered an optimal treatment for AMI. Paradoxically, the procedure of reperfusion can itself cause myocardial tissue injury. Therefore, a strategy to minimize the reperfusion-induced myocardial tissue injury is vital for salvaging the healthy myocardium. Herein, we investigated the cardioprotective effects of fisetin, a natural flavonoid, against ischemia/reperfusion (I/R) injury (IRI) using a Langendorff isolated heart perfusion system. I/R produced significant myocardial tissue injury, which was characterized by elevated levels of lactate dehydrogenase and creatine kinase in the perfusate and decreased indices of hemodynamic parameters. Furthermore, I/R resulted in elevated oxidative stress, uncoupling of the mitochondrial electron transport chain, increased mitochondrial swelling, a decrease of the mitochondrial membrane potential, and induction of apoptosis. Moreover, IRI was associated with a loss of the mitochondrial structure and decreased mitochondrial biogenesis. However, when the animals were pretreated with fisetin, it significantly attenuated the I/R-induced myocardial tissue injury, blunted the oxidative stress, and restored the structure and function of mitochondria. Mechanistically, the fisetin effects were found to be mediated via inhibition of glycogen synthase kinase 3 β (GSK3 β ), which was confirmed by a biochemical assay and molecular docking studies.
DEFF Research Database (Denmark)
Bernal Giraldo, Adriana Jimena; Jensen, Jacob Krüger; Harholt, Jesper
2007-01-01
Members of a large family of cellulose synthase-like genes (CSLs) are predicted to encode glycosyl transferases (GTs) involved in the biosynthesis of plant cell walls. The CSLA and CSLF families are known to contain mannan and glucan synthases, respectively, but the products of other CSLs...... are unknown. Here we report the effects of disrupting ATCSLD5 expression in Arabidopsis. Both stem and root growth were significantly reduced in ATCSLD5 knock-out plants, and these plants also had increased susceptibility to the cellulose synthase inhibitor isoxaben. Antibody and carbohydrate-binding module...
Topoisomerase 1 Inhibition Promotes Cyclic GMP-AMP Synthase-Dependent Antiviral Responses
Pépin, Geneviève; Nejad, Charlotte; Ferrand, Jonathan; Thomas, Belinda J.; Stunden, H. James; Sanij, Elaine; Foo, Chwan-Hong; Stewart, Cameron R.; Cain, Jason E.; Bardin, Philip G.; Williams, Bryan R. G.; Gantier, Michael P.
2017-01-01
ABSTRACT Inflammatory responses, while essential for pathogen clearance, can also be deleterious to the host. Chemical inhibition of topoisomerase 1 (Top1) by low-dose camptothecin (CPT) can suppress transcriptional induction of antiviral and inflammatory genes and protect animals from excessive and damaging inflammatory responses. We describe the unexpected finding that minor DNA damage from topoisomerase 1 inhibition with low-dose CPT can trigger a strong antiviral immune response through c...
Directory of Open Access Journals (Sweden)
DURDI QUJEQ
1999-10-01
Full Text Available A deficiency of the phenylalanine hydroxylase activity or its cofactor tetrahydrobiopterin may"nlead to hyperphenylalamnemia and as a result, loss of IQ, poor school performance, and"nbehavior problems occurs. Deficiency in 6-pyruvoyl-tetrahydropterin synthase activity is the"nmajor cause of tetrahydrobiopterin deficient phenylketonuria. In this study, blood specimens"nfrom 165 healthy volunteers and 127 children with phenylketonuria were used to determine"nthe 6-pyruvoyl-tetrahydropterin synthase activity. It was found that the activity of 6-"npyruvoyl- tetrahydropterin synthase was decreased in comparison with control [23.46 +/-"n2.94, (mean +/- SD, mmol/ ml/h, n=I27 vs. 127.63 +/- 4.52, n=165, p<0.05]. Results of"nthis study indicate that examination of 6-pyruvoyl-tetrahydropterin synthase activity is helpful"nand may lead to the diagnosis cause of hyperphenylalaninemia.
Wang, Jialing; Zheng, Jiachen; Huang, Chunhui; Zhao, Jiaying; Lin, Jiajia; Zhou, Xuezhen; Naman, C Benjamin; Wang, Ning; Gerwick, William H; Wang, Qinwen; Yan, Xiaojun; Cui, Wei; He, Shan
2018-04-10
Alzheimer's disease is a progressive neurodegenerative disorder that mainly affects the elderly. Soluble β-amyloid oligomer, which can induce neurotoxicity, is generally regarded as the main neurotoxin in Alzheimer's disease. Here we report that eckmaxol, a phlorotannin extracted from the brown alga Ecklonia maxima, could produce neuroprotective effects in SH-SY5Y cells. Eckmaxol effectively prevented but did not rescue β-amyloid oligomer-induced neuronal apoptosis and increase of intracellular reactive oxygen species. Eckmaxol also significantly reversed the decreased expression of phospho-Ser9-glycogen synthase kinase 3β and increased expression of phospho-extracellular signal-regulated kinase, which was induced by Aβ oligomer. Moreover, both glycogen synthase kinase 3β and mitogen activated protein kinase inhibitors produced neuroprotective effects in SH-SY5Y cells. Furthermore, eckmaxol showed favorable interaction in the ATP binding site of glycogen synthase kinase 3β and mitogen activated protein kinase. These results suggested that eckmaxol might produce neuroprotective effects via concurrent inhibition of glycogen synthase kinase 3β and extracellular signal-regulated kinase pathways, possibly via directly acting on glycogen synthase kinase 3β and mitogen activated protein kinase. Based on the central role that β-amyloid oligomers play in the pathogenesis of Alzheimer's disease and the high annual production of Ecklonia maxima for alginate and other nutritional ingredients, this report represents a new candidate for the treatment of Alzheimer's disease, and also expands the potential application of Ecklonia maxima and its constituents in the field of pharmacology.
Santos, Glaciane D; Ferri, Pedro H; Santos, Suzana C; Bao, Sônia N; Soares, Célia M A; Pereira, Maristela
2007-11-01
The fungus Paracoccidioides brasiliensis is the causative agent of paracoccidioidomycosis (PCM), the most prevalent human systemic mycosis in Latin America. Drug toxicity and the appearance of resistant strains have created the need to search for new therapeutic approaches. Plants with reputed antimicrobial properties represent a rich screening source of potential antifungal compounds. In this work, the growth of P. brasiliensis yeast cells was evaluated in the presence of oenothein B extracted from Eugenia uniflora. The oenothein B dosage that most effectively inhibited the development (74%) of P. brasiliensis yeast cells in vitro was 500 microg/ml. To verify if oenothein B interferes with cell morphology, we observed oenothein B-treated yeast cells by electron microscopy. The micrographs showed characteristic cell changes noted with glucan synthesis inhibition, including squashing, rough surface, cell wall rupture and cell membrane recess. The expression of P. brasiliensis genes was evaluated in order to investigate the action of oenothein B. Here we report that oenothein B inhibits 1,3-beta-glucan synthase (PbFKS1) transcript accumulation. The results indicate that oenothein B interferes with the cell morphology of P. brasiliensis, probably by inhibiting the transcription of 1,3-beta-glucan synthase gene, which is involved in the cell wall synthesis.
Inhibition of Glycogen Synthase Kinase-3ß Enhances Cognitive Recovery after Stroke: The Role of TAK1
Venna, Venugopal Reddy; Benashski, Sharon E.; Chauhan, Anjali; McCullough, Louise D.
2015-01-01
Memory deficits are common among stroke survivors. Identifying neuroprotective agents that can prevent memory impairment or improve memory recovery is a vital area of research. Glycogen synthase kinase-3ß (GSK-3ß) is involved in several essential intracellular signaling pathways. Unlike many other kinases, GSK-3ß is active only when…
Rota, Paola; Cirillo, Federica; Piccoli, Marco; Gregorio, Antonio; Tettamanti, Guido; Allevi, Pietro; Anastasia, Luigi
2015-10-05
Previous studies demonstrated that reducing the GM3 content in myoblasts increased the cell resistance to hypoxic stress, suggesting that a pharmacological inhibition of the GM3 synthesis could be instrumental for the development of new treatments for ischemic diseases. Herein, the synthesis of several dephosphonated CMP-Neu5Ac congeners and their anti-GM3-synthase activity is reported. Biological activity testes revealed that some inhibitors almost completely blocked the GM3-synthase activity in vitro and reduced the GM3 content in living embryonic kidney 293A cells, eventually activating the epidermal growth factor receptor (EGFR) signaling cascade. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A
2015-12-01
Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides
Li, Jian; Li, Mei; Gao, Xingxiang; Fang, Feng
2017-12-01
Crabgrass (Digitaria sanguinalis) is an annual monocotyledonous weed. In recent years, field applications of nicosulfuron have been ineffective in controlling crabgrass populations in Shandong Province, China. To investigate the mechanisms of resistance to nicosulfuron in crabgrass populations, the acetolactate synthase (ALS) gene fragment covering known resistance-confering mutation sites was amplified and sequenced. Dose-response experiments suggested that the resistant population SD13 (R) was highly resistant to nicosulfuron (resistance index R/S = 43.7) compared with the sensitive population SD22 (S). ALS gene sequencing revealed a Trp574Arg substitution in the SD13 population, and no other known resistance-conferring mutations were found. In vitro ALS enzyme assays further confirmed that the SD13 population was resistant to all tested ALS-inhibiting herbicides. The resistance pattern experiments revealed that, compared with SD22, the SD13 population exhibited broad-spectrum resistance to nicosulfuron (43.7-fold), imazethapyr (11.4-fold) and flumetsulam (16.1-fold); however, it did not develop resistance to atrazine, mesotrione and topramezone. This study demonstrated that Trp574Arg substitution was the main reason for crabgrass resistance to ALS-inhibiting herbicides. To our knowledge, this is the first report of Trp574Arg substitution in a weed species, and is the first report of target-site mechanisms of herbicide resistance for crabgrass. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Directory of Open Access Journals (Sweden)
Venkatesh KV
2005-05-01
Full Text Available Abstract Background Signaling pathways include intricate networks of reversible covalent modification cycles. Such multicyclic enzyme cascades amplify the input stimulus, cause integration of multiple signals and exhibit sensitive output responses. Regulation of glycogen synthase and phosphorylase by reversible covalent modification cycles exemplifies signal transduction by enzyme cascades. Although this system for regulating glycogen synthesis and breakdown appears similar in all tissues, subtle differences have been identified. For example, phosphatase-1, a dephosphorylating enzyme of the system, is regulated quite differently in muscle and liver. Do these small differences in regulatory architecture affect the overall performance of the glycogen cascade in a specific tissue? We address this question by analyzing the regulatory structure of the glycogen cascade system in liver and muscle cells at steady state. Results The glycogen cascade system in liver and muscle cells was analyzed at steady state and the results were compared with literature data. We found that the cascade system exhibits highly sensitive switch-like responses to changes in cyclic AMP concentration and the outputs are surprisingly different in the two tissues. In muscle, glycogen phosphorylase is more sensitive than glycogen synthase to cyclic AMP, while the opposite is observed in liver. Furthermore, when the liver undergoes a transition from starved to fed-state, the futile cycle of simultaneous glycogen synthesis and degradation switches to reciprocal regulation. Under such a transition, different proportions of active glycogen synthase and phosphorylase can coexist due to the varying inhibition of glycogen-synthase phosphatase by active phosphorylase. Conclusion The highly sensitive responses of glycogen synthase in liver and phosphorylase in muscle to primary stimuli can be attributed to distinctive regulatory designs in the glycogen cascade system. The different
Glycogen synthase kinase-3β promotes cyst expansion in polycystic kidney disease.
Tao, Shixin; Kakade, Vijayakumar R; Woodgett, James R; Pandey, Pankaj; Suderman, Erin D; Rajagopal, Madhumitha; Rao, Reena
2015-06-01
Polycystic kidney diseases (PKDs) are inherited disorders characterized by the formation of fluid filled renal cysts. Elevated cAMP levels in PKDs stimulate progressive cyst enlargement involving cell proliferation and transepithelial fluid secretion often leading to end-stage renal disease. The glycogen synthase kinase-3 (GSK3) family of protein kinases consists of GSK3α and GSK3β isoforms and has a crucial role in multiple cellular signaling pathways. We previously found that GSK3β, a regulator of cell proliferation, is also crucial for cAMP generation and vasopressin-mediated urine concentration by the kidneys. However, the role of GSK3β in the pathogenesis of PKDs is not known. Here we found that GSK3β expression and activity were markedly upregulated and associated with cyst-lining epithelia in the kidneys of mice and humans with PKD. Renal collecting duct-specific gene knockout of GSK3β or pharmacological inhibition of GSK3 effectively slowed down the progression of PKD in mouse models of autosomal recessive or autosomal dominant PKD. GSK3 inactivation inhibited cAMP generation and cell proliferation resulting in reduced cyst expansion, improved renal function, and extended life span. GSK3β inhibition also reduced pERK, c-Myc, and cyclin-D1, known mitogens in proliferation of cystic epithelial cells. Thus, GSK3β has a novel functional role in PKD pathophysiology, and its inhibition may be therapeutically useful to slow down cyst expansion and progression of PKD.
CTP synthase forms cytoophidia in the cytoplasm and nucleus
International Nuclear Information System (INIS)
Gou, Ke-Mian; Chang, Chia-Chun; Shen, Qing-Ji; Sung, Li-Ying; Liu, Ji-Long
2014-01-01
CTP synthase is an essential metabolic enzyme responsible for the de novo synthesis of CTP. Multiple studies have recently showed that CTP synthase protein molecules form filamentous structures termed cytoophidia or CTP synthase filaments in the cytoplasm of eukaryotic cells, as well as in bacteria. Here we report that CTP synthase can form cytoophidia not only in the cytoplasm, but also in the nucleus of eukaryotic cells. Both glutamine deprivation and glutamine analog treatment promote formation of cytoplasmic cytoophidia (C-cytoophidia) and nuclear cytoophidia (N-cytoophidia). N-cytoophidia are generally shorter and thinner than their cytoplasmic counterparts. In mammalian cells, both CTP synthase 1 and CTP synthase 2 can form cytoophidia. Using live imaging, we have observed that both C-cytoophidia and N-cytoophidia undergo multiple rounds of fusion upon glutamine analog treatment. Our study reveals the coexistence of cytoophidia in the cytoplasm and nucleus, therefore providing a good opportunity to investigate the intracellular compartmentation of CTP synthase. - Highlights: • CTP synthase forms cytoophidia not only in the cytoplasm but also in the nucleus. • Glutamine deprivation and Glutamine analogs promotes cytoophidium formation. • N-cytoophidia exhibit distinct morphology when compared to C-cytoophidia. • Both CTP synthase 1 and CTP synthase 2 form cytoophidia in mammalian cells. • Fusions of cytoophidia occur in the cytoplasm and nucleus
CTP synthase forms cytoophidia in the cytoplasm and nucleus
Energy Technology Data Exchange (ETDEWEB)
Gou, Ke-Mian [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); State Key Laboratory for Agrobiotechnology, College of Biological Sciences, China Agricultural University, Beijing 100193 (China); Chang, Chia-Chun [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Shen, Qing-Ji [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); Sung, Li-Ying, E-mail: liyingsung@ntu.edu.tw [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei 115, Taiwan, ROC (China); Liu, Ji-Long, E-mail: jilong.liu@dpag.ox.ac.uk [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom)
2014-04-15
CTP synthase is an essential metabolic enzyme responsible for the de novo synthesis of CTP. Multiple studies have recently showed that CTP synthase protein molecules form filamentous structures termed cytoophidia or CTP synthase filaments in the cytoplasm of eukaryotic cells, as well as in bacteria. Here we report that CTP synthase can form cytoophidia not only in the cytoplasm, but also in the nucleus of eukaryotic cells. Both glutamine deprivation and glutamine analog treatment promote formation of cytoplasmic cytoophidia (C-cytoophidia) and nuclear cytoophidia (N-cytoophidia). N-cytoophidia are generally shorter and thinner than their cytoplasmic counterparts. In mammalian cells, both CTP synthase 1 and CTP synthase 2 can form cytoophidia. Using live imaging, we have observed that both C-cytoophidia and N-cytoophidia undergo multiple rounds of fusion upon glutamine analog treatment. Our study reveals the coexistence of cytoophidia in the cytoplasm and nucleus, therefore providing a good opportunity to investigate the intracellular compartmentation of CTP synthase. - Highlights: • CTP synthase forms cytoophidia not only in the cytoplasm but also in the nucleus. • Glutamine deprivation and Glutamine analogs promotes cytoophidium formation. • N-cytoophidia exhibit distinct morphology when compared to C-cytoophidia. • Both CTP synthase 1 and CTP synthase 2 form cytoophidia in mammalian cells. • Fusions of cytoophidia occur in the cytoplasm and nucleus.
Effects of Cerebral Ischemia in Mice Deficient in Neuronal Nitric Oxide Synthase
Huang, Zhihong; Huang, Paul L.; Panahian, Nariman; Dalkara, Turgay; Fishman, Mark C.; Moskowitz, Michael A.
1994-09-01
The proposal that nitric oxide (NO) or its reactant products mediate toxicity in brain remains controversial in part because of the use of nonselective agents that block NO formation in neuronal, glial, and vascular compartments. In mutant mice deficient in neuronal NO synthase (NOS) activity, infarct volumes decreased significantly 24 and 72 hours after middle cerebral artery occlusion, and the neurological deficits were less than those in normal mice. This result could not be accounted for by differences in blood flow or vascular anatomy. However, infarct size in the mutant became larger after endothelial NOS inhibition by nitro-L-arginine administration. Hence, neuronal NO production appears to exacerbate acute ischemic injury, whereas vascular NO protects after middle cerebral artery occlusion. The data emphasize the importance of developing selective inhibitors of the neuronal isoform.
Glycogen synthase activation by sugars in isolated hepatocytes.
Ciudad, C J; Carabaza, A; Bosch, F; Gòmez I Foix, A M; Guinovart, J J
1988-07-01
We have investigated the activation by sugars of glycogen synthase in relation to (i) phosphorylase a activity and (ii) changes in the intracellular concentration of glucose 6-phosphate and adenine nucleotides. All the sugars tested in this work present the common denominator of activating glycogen synthase. On the other hand, phosphorylase a activity is decreased by mannose and glucose, unchanged by galactose and xylitol, and increased by tagatose, glyceraldehyde, and fructose. Dihydroxyacetone exerts a biphasic effect on phosphorylase. These findings provide additional evidence proving that glycogen synthase can be activated regardless of the levels of phosphorylase a, clearly establishing that a nonsequential mechanism for the activation of glycogen synthase occurs in liver cells. The glycogen synthase activation state is related to the concentrations of glucose 6-phosphate and adenine nucleotides. In this respect, tagatose, glyceraldehyde, and fructose deplete ATP and increase AMP contents, whereas glucose, mannose, galactose, xylitol, and dihydroxyacetone do not alter the concentration of these nucleotides. In addition, all these sugars, except glyceraldehyde, increase the intracellular content of glucose 6-phosphate. The activation of glycogen synthase by sugars is reflected in decreases on both kinetic constants of the enzyme, M0.5 (for glucose 6-phosphate) and S0.5 (for UDP-glucose). We propose that hepatocyte glycogen synthase is activated by monosaccharides by a mechanism triggered by changes in glucose 6-phosphate and adenine nucleotide concentrations which have been described to modify glycogen synthase phosphatase activity. This mechanism represents a metabolite control of the sugar-induced activation of hepatocyte glycogen synthase.
Kanit, L; Koylu, E O; Erdogan, O; Pogun, S
2005-08-15
The aim of the present study was to investigate sex differences in learning strategies and to elucidate the mechanisms, which may underlie these differences. In two separate experiments, rats were presented with different strategies that could be employed to learn the position of a platform in a water maze (WM); furthermore, rats received treatments that could influence these strategies. In the first experiment, we demonstrated that the response-learning paradigm can be applied to the WM and can be compared with visually cued learning and reversal learning. Naïve rats of either sex could acquire this protocol relatively easily. On the probe trial, where the rats are presented with a choice between using response versus visually cued learning, initially response learning was preferred, however, during these experiments, laterality emerged as a significant factor and rats trained to turn right had difficulty in reversing the learned pattern to find the platform. The second part of our study evaluated the effects of nicotine and nitric oxide synthase (NOS) inhibition on the aforementioned parameters. Drug treatments impaired acquisition compared to saline treatments and the effect was more pronounced with NOS inhibition. During the probe trial, while NOS inhibition enhanced the right-side bias in both sexes, nicotine treatment had the same effect only in males. In conclusion, naïve rats can acquire place learning using visible cues or response learning; however, there is a right side bias in both sexes and the laterality effect is more pronounced in male rats. In drug-treated animals, while NOS inhibition enhances laterality (right bias) in both sexes similarly, nicotine modifies the cognitive strategy in a sexually dimorphic manner by augmenting the right bias only in male rats.
Dupont, Christian; Viljoen, Albertus; Thomas, Sangeeta; Roquet-Banères, Françoise; Herrmann, Jean-Louis; Pethe, Kevin; Kremer, Laurent
2017-11-01
Pulmonary infections caused by Mycobacterium abscessus are emerging as a global threat, especially in cystic fibrosis patients. Further intensifying the concern of M. abscessus infection is the recent evidence of human-to-human transmission of the infection. M. abscessus is a naturally multidrug-resistant fast-growing pathogen for which pharmacological options are limited. Repurposing antitubercular drugs represents an attractive option for the development of chemotherapeutic alternatives against M. abscessus infections. Bedaquiline (BDQ), an ATP synthase inhibitor, has recently been approved for the treatment of multidrug-resistant tuberculosis. Herein, we show that BDQ has a very low MIC against a vast panel of clinical isolates. Despite being bacteriostatic in vitro , BDQ was highly efficacious in a zebrafish model of M. abscessus infection. Remarkably, a very short period of treatment was sufficient to protect the infected larvae from M. abscessus -induced killing. This was corroborated with reduced numbers of abscesses and cords, considered to be major pathophysiological signs in infected zebrafish. Mode-of-action studies revealed that BDQ triggered a rapid depletion of ATP in M. abscessus in vitro , consistent with the drug targeting the F o F 1 ATP synthase. Importantly, despite a failure to select in vitro for spontaneous mutants that are highly resistant to BDQ, the transfer of single nucleotide polymorphisms leading to D29V or A64P substitutions in atpE conferred high resistance, thus resolving the target of BDQ in M. abscessus Overall, this study indicates that BDQ is active against M. abscessus in vitro and in vivo and should be considered for clinical use against the difficult-to-manage M. abscessus pulmonary infections. Copyright © 2017 American Society for Microbiology.
Galea, E; Regunathan, S; Eliopoulos, V; Feinstein, D L; Reis, D J
1996-01-01
Agmatine, decarboxylated arginine, is a metabolic product of mammalian cells. Considering the close structural similarity between L-arginine and agmatine, we investigated the interaction of agmatine and nitric oxide synthases (NOSs), which use L-arginine to generate nitric oxide (NO) and citrulline. Brain, macrophages and endothelial cells were respectively used as sources for NOS isoforms I, II and III. Enzyme activity was measured by the production of nitrites or L-citrulline. Agmatine was ...
Deng, Wei; Yang, Qian; Zhang, Yongzhi; Jiao, Hongtao; Mei, Yu; Li, Xuefeng; Zheng, Mingqi
2017-03-01
Acetolactate synthase (ALS) is the common target of ALS-inhibiting herbicides, and target-site ALS mutations are the main mechanism of resistance to ALS-inhibiting herbicides. In this study, ALS1 and ALS2 genes with full lengths of 2004bp and 1998bp respectively were cloned in individual plants of susceptible (S) or resistant (R) flixweed (Descurainia sophia L.) populations. Two ALS mutations of Pro-197-Thr and/or Trp-574-Leu were identified in plants of three R biotypes (HB24, HB30 and HB42). In order to investigate the function of ALS isozymes in ALS-inhibiting herbicide resistance, pHB24 (a Pro-197-Thr mutation in ALS1 and a wild type ALS2), pHB42 (a Trp-574-Leu mutation in ALS1 and a wild type ALS2) and pHB30 (a Trp-574-Leu mutation in ALS1 and a Pro-197-Thr mutation in ALS2) subpopulations individually homozygous for different ALS mutations were generated. Individuals of pHB30 had mutations in each isozyme of ALS and had higher resistance than pHB24 and pHB42 populations containing mutations in only one ALS isozyme. Moreover, the pHB24 had resistance to SU, TP and SCT herbicides, whereas pHB24 and pHB42 had resistance to these classes of herbicides as well as IMI and PTB herbicides. The sensitivity of isolated ALS enzyme to inhibition by herbicides in these populations correlated with whole plant resistance levels. Therefore, reduced ALS sensitivity resulting from the mutations in ALS was responsible for resistance to ALS-inhibiting herbicides in flixweed. Copyright © 2016 Elsevier Inc. All rights reserved.
Hurd, Matthew C; Kwon, Moonhyuk; Ro, Dae-Kyun
2017-08-26
Lippia dulcis (Aztec sweet herb) contains the potent natural sweetener hernandulcin, a sesquiterpene ketone found in the leaves and flowers. Utilizing the leaves for agricultural application is challenging due to the presence of the bitter-tasting and toxic monoterpene, camphor. To unlock the commercial potential of L. dulcis leaves, the first step of camphor biosynthesis by a bornyl diphosphate synthase needs to be elucidated. Two putative monoterpene synthases (LdTPS3 and LdTPS9) were isolated from L. dulcis leaf cDNA. To elucidate their catalytic functions, E. coli-produced recombinant enzymes with truncations of their chloroplast transit peptides were assayed with geranyl diphosphate (GPP). In vitro enzyme assays showed that LdTPS3 encodes bornyl diphosphate synthase (thus named LdBPPS) while LdTPS9 encodes linalool synthase. Interestingly, the N-terminus of LdBPPS possesses two arginine-rich (RRX 8 W) motifs, and enzyme assays showed that the presence of both RRX 8 W motifs completely inhibits the catalytic activity of LdBPPS. Only after the removal of the putative chloroplast transit peptide and the first RRX 8 W, LdBPPS could react with GPP to produce bornyl diphosphate. LdBPPS is distantly related to the known bornyl diphosphate synthase from sage in a phylogenetic analysis, indicating a converged evolution of camphor biosynthesis in sage and L. dulcis. The discovery of LdBPPS opens up the possibility of engineering L. dulcis to remove the undesirable product, camphor. Copyright © 2017 Elsevier Inc. All rights reserved.
Regulation of mouse brain glycogen synthase kinase-3 by atypical antipsychotics.
Li, Xiaohua; Rosborough, Kelley M; Friedman, Ari B; Zhu, Wawa; Roth, Kevin A
2007-02-01
Glycogen synthase kinase-3 (GSK3) has been recognized as an important enzyme that modulates many aspects of neuronal function. Accumulating evidence implicates abnormal activity of GSK3 in mood disorders and schizophrenia, and GSK3 is a potential protein kinase target for psychotropics used in these disorders. We previously reported that serotonin, a major neurotransmitter involved in mood disorders, regulates GSK3 by acutely increasing its N-terminal serine phosphorylation. The present study was undertaken to further determine if atypical antipsychotics, which have therapeutic effects in both mood disorders and schizophrenia, can regulate phospho-Ser-GSK3 and inhibit its activity. The results showed that acute treatment of mice with risperidone rapidly increased the level of brain phospho-Ser-GSK3 in the cortex, hippocampus, striatum, and cerebellum in a dose-dependent manner. Regulation of phospho-Ser-GSK3 was a shared effect among several atypical antipsychotics, including olanzapine, clozapine, quetiapine, and ziprasidone. In addition, combination treatment of mice with risperidone and a monoamine reuptake inhibitor antidepressant imipramine or fluoxetine elicited larger increases in brain phospho-Ser-GSK3 than each agent alone. Taken together, these results provide new information suggesting that atypical antipsychotics, in addition to mood stabilizers and antidepressants, can inhibit the activity of GSK3. These findings may support the pharmacological mechanisms of atypical antipsychotics in the treatment of mood disorders.
Terzuoli, Erika; Donnini, Sandra; Giachetti, Antonio; Iñiguez, Miguel A; Fresno, Manuel; Melillo, Giovanni; Ziche, Marina
2010-08-15
2-(3,4-dihydroxyphenil)-ethanol (DPE), a polyphenol present in olive oil, has been found to attenuate the growth of colon cancer cells, an effect presumably related to its anti-inflammatory activity. To further explore the effects of DPE on angiogenesis and tumor growth we investigated the in vivo efficacy of DPE in a HT-29 xenograft model and in vitro activities in colon cancer cells exposed to interleukin-1beta (IL-1beta) and prostaglandin E-2 (PGE-2). DPE (10 mg/kg/day for 14 days) inhibited tumor growth, reducing vessel lumina and blood perfusion to tumor, and diminished expression of hypoxia inducible factor-1alpha (HIF-1alpha), vascular endothelial growth factor (VEGF), and microsomal prostaglandin-E synthase-1 (mPGEs-1). In vitro, DPE (100 mumol/L) neither affected cell proliferation nor induced apoptosis in HT-29 and WiDr cells. DPE prevented the IL-1beta-mediated increase of mPGEs-1 expression and PGE-2 generation, as it did the silencing of HIF-1alpha. Moreover, DPE blocked mPGEs-1-dependent expression of VEGF and inhibited endothelial sprouting induced by tumor cells in a coculture system. PGE-2 triggers a feed-forward loop involving HIF-1alpha, which impinges on mPGEs-1 and VEGF expression, events prevented by DPE via extracellular signal-related kinase 1/2. The reduction of PGE-2 and VEGF levels, caused by DPE, was invariably associated with a marked decrease in HIF-1alpha expression and activity, independent of proteasome activity, indicating that the DPE effects on tumor growth and angiogenesis are dependent on the inhibition of HIF-1alpha translation. We show that the in vivo DPE antitumor effect is associated with anti-inflammatory and antiangiogenic activities resulting from the downregulation of the HIF-1alpha/mPGEs-1/VEGF axis.
Flynn, Christopher M; Schmidt-Dannert, Claudia
2018-06-01
The wood-rotting mushroom Stereum hirsutum is a known producer of a large number of namesake hirsutenoids, many with important bioactivities. Hirsutenoids form a structurally diverse and distinct class of sesquiterpenoids. No genes involved in hirsutenoid biosynthesis have yet been identified or their enzymes characterized. Here, we describe the cloning and functional characterization of a hirsutene synthase as an unexpected fusion protein of a sesquiterpene synthase (STS) with a C-terminal 3-hydroxy-3-methylglutaryl-coenzyme A (3-hydroxy-3-methylglutaryl-CoA) synthase (HMGS) domain. Both the full-length fusion protein and truncated STS domain are highly product-specific 1,11-cyclizing STS enzymes with kinetic properties typical of STSs. Complementation studies in Saccharomyces cerevisiae confirmed that the HMGS domain is also functional in vivo Phylogenetic analysis shows that the hirsutene synthase domain does not form a clade with other previously characterized sesquiterpene synthases from Basidiomycota. Comparative gene structure analysis of this hirsutene synthase with characterized fungal enzymes reveals a significantly higher intron density, suggesting that this enzyme may be acquired by horizontal gene transfer. In contrast, the HMGS domain is clearly related to other fungal homologs. This STS-HMGS fusion protein is part of a biosynthetic gene cluster that includes P450s and oxidases that are expressed and could be cloned from cDNA. Finally, this unusual fusion of a terpene synthase to an HMGS domain, which is not generally recognized as a key regulatory enzyme of the mevalonate isoprenoid precursor pathway, led to the identification of additional HMGS duplications in many fungal genomes, including the localization of HMGSs in other predicted sesquiterpenoid biosynthetic gene clusters. IMPORTANCE Hirsutenoids represent a structurally diverse class of bioactive sesquiterpenoids isolated from fungi. Identification of their biosynthetic pathways will provide
Directory of Open Access Journals (Sweden)
Saito Koji
2005-08-01
Full Text Available Abstract Background In Arabidopsis, ETO1 (ETHYLENE-OVERPRODUCER1 is a negative regulator of ethylene evolution by interacting with AtACS5, an isoform of the rate-limiting enzyme, 1-aminocyclopropane-1-carboxylate synthases (ACC synthase or ACS, in ethylene biosynthetic pathway. ETO1 directly inhibits the enzymatic activity of AtACS5. In addition, a specific interaction between ETO1 and AtCUL3, a constituent of a new type of E3 ubiquitin ligase complex, suggests the molecular mechanism in promoting AtACS5 degradation by the proteasome-dependent pathway. Because orthologous sequences to ETO1 are found in many plant species including tomato, we transformed tomato with Arabidopsis ETO1 to evaluate its ability to suppress ethylene production in tomato fruits. Results Transgenic tomato lines that overexpress Arabidopsis ETO1 (ETO1-OE did not show a significant delay of fruit ripening. So, we performed yeast two-hybrid assays to investigate potential heterologous interaction between ETO1 and three isozymes of ACC synthases from tomato. In the yeast two-hybrid system, ETO1 interacts with LE-ACS3 as well as AtACS5 but not with LE-ACS2 or LE-ACS4, two major isozymes whose gene expression is induced markedly in ripening fruits. According to the classification of ACC synthases, which is based on the C-terminal amino acid sequences, both LE-ACS3 and AtACS5 are categorized as type 2 isozymes and possess a consensus C-terminal sequence. In contrast, LE-ACS2 and LE-ACS4 are type 1 and type 3 isozymes, respectively, both of which do not possess this specific C-terminal sequence. Yeast two-hybrid analysis using chimeric constructs between LE-ACS2 and LE-ACS3 revealed that the type-2-ACS-specific C-terminal tail is required for interaction with ETO1. When treated with auxin to induce LE-ACS3, seedlings of ETO1-OE produced less ethylene than the wild type, despite comparable expression of the LE-ACS3 gene in the wild type. Conclusion These results suggest that ETO1
Clinical significance of Phosphatidyl Inositol Synthase overexpression in oral cancer
International Nuclear Information System (INIS)
Kaur, Jatinder; Sawhney, Meenakshi; DattaGupta, Siddartha; Shukla, Nootan K; Srivastava, Anurag; Ralhan, Ranju
2010-01-01
We reported increased levels of Phosphatidyl Inositol synthase (PI synthase), (enzyme that catalyses phosphatidyl inositol (PI) synthesis-implicated in intracellular signaling and regulation of cell growth) in smokeless tobacco (ST) exposed oral cell cultures by differential display. This study determined the clinical significance of PI synthase overexpression in oral squamous cell carcinoma (OSCC) and premalignant lesions (leukoplakia), and identified the downstream signaling proteins in PI synthase pathway that are perturbed by smokeless tobacco (ST) exposure. Tissue microarray (TMA) Immunohistochemistry, Western blotting, Confocal laser scan microscopy, RT-PCR were performed to define the expression of PI synthase in clinical samples and in oral cell culture systems. Significant increase in PI synthase immunoreactivity was observed in premalignant lesions and OSCCs as compared to oral normal tissues (p = 0.000). Further, PI synthase expression was significantly associated with de-differentiation of OSCCs, (p = 0.005) and tobacco consumption (p = 0.03, OR = 9.0). Exposure of oral cell systems to smokeless tobacco (ST) in vitro confirmed increase in PI synthase, Phosphatidylinositol 3-kinase (PI3K) and cyclin D1 levels. Collectively, increased PI synthase expression was found to be an early event in oral cancer and a target for smokeless tobacco
Inhibition of AMPK catabolic action by GSK3
Suzuki, Tsukasa; Bridges, Dave; Nakada, Daisuke; Skiniotis, Georgios; Morrison, Sean J.; Lin, Jiandie; Saltiel, Alan R.; Inoki, Ken
2013-01-01
SUMMARY AMP-activated protein kinase (AMPK) regulates cellular energy homeostasis by inhibiting anabolic and activating catabolic processes. While AMPK activation has been extensively studied, mechanisms that inhibit AMPK remain elusive. Here we report that glycogen synthase kinase 3 (GSK3) inhibits AMPK function. GSK3 forms a stable complex with AMPK through interactions with the AMPK β regulatory subunit and phosphorylates the AMPK α catalytic subunit. This phosphorylation enhances the accessibility of the activation loop of the α subunit to phosphatases, thereby inhibiting AMPK kinase activity. Surprisingly, PI3K-Akt signaling, which is a major anabolic signaling and normally inhibits GSK3 activity, promotes GSK3 phosphorylation and inhibition of AMPK, thus revealing how AMPK senses anabolic environments in addition to cellular energy levels. Consistently, disrupting GSK3 function within the AMPK complex sustains higher AMPK activity and cellular catabolic processes even under anabolic conditions, indicating that GSK3 acts as a critical sensor for anabolic signaling to regulate AMPK. PMID:23623684
Directory of Open Access Journals (Sweden)
Irina Petrache
Full Text Available Increases in ceramide levels have been implicated in the pathogenesis of both acute or chronic lung injury models. However, the role of individual ceramide species, or of the enzymes that are responsible for their synthesis, in lung health and disease has not been clarified. We now show that C24- and C16-ceramides are the most abundant lung ceramide species, paralleled by high expression of their synthetic enzymes, ceramide synthase 2 (CerS2 and CerS5, respectively. Furthermore, the ceramide species synthesis in the lung is homeostatically regulated, since mice lacking very long acyl chain C24-ceramides due to genetic deficiency of CerS2 displayed a ten-fold increase in C16-ceramides and C16-dihydroceramides along with elevation of acid sphingomyelinase and CerS5 activities. Despite relatively preserved total lung ceramide levels, inhibition of de novo sphingolipid synthesis at the level of CerS2 was associated with significant airflow obstruction, airway inflammation, and increased lung volumes. Our results suggest that ceramide species homeostasis is crucial for lung health and that CerS2 dysfunction may predispose to inflammatory airway and airspace diseases.
International Nuclear Information System (INIS)
Choi, Cheol-Hee; Lee, Byung-Hoon; Ahn, Sang-Gun; Oh, Seon-Hee
2012-01-01
Highlights: ► MG132 induces the phosphorylation of GSK3β Ser9 and, to a lesser extent, of GSK3β Thr390 . ► MG132 induces dephosphorylation of p70S6K Thr389 and phosphorylation of p70S6K Thr421/Ser424 . ► Inactivation of p38 dephosphorylates GSK3β Ser9 and phosphorylates GSK3β Thr390 . ► Inactivation of p38 phosphorylates p70S6K Thr389 and increases the phosphorylation of p70S6K Thr421/Ser424 . ► Inactivation of p38 decreases autophagy and increases apoptosis induced by MG132. -- Abstract: Proteasome inhibition is a promising approach for cancer treatment; however, the underlying mechanisms involved have not been fully elucidated. Here, we show that proteasome inhibition-induced p38 mitogen-activated protein kinase regulates autophagy and apoptosis by modulating the phosphorylation status of glycogen synthase kinase 3β (GSK3β) and 70 kDa ribosomal S6 kinase (p70S6K). The treatment of MDA-MB-231 cells with MG132 induced endoplasmic reticulum stress through the induction of ATF6a, PERK phosphorylation, and CHOP, and apoptosis through the cleavage of Bax and procaspase-3. MG132 caused the phosphorylation of GSK3β at Ser 9 and, to a lesser extent, Thr 390 , the dephosphorylation of p70S6K at Thr 389 , and the phosphorylation of p70S6K at Thr 421 and Ser 424 . The specific p38 inhibitor SB203080 reduced the p-GSK3β Ser9 and autophagy through the phosphorylation of p70S6K Thr389 ; however, it augmented the levels of p-ERK, p-GSK3β Thr390 , and p-70S6K Thr421/Ser424 induced by MG132, and increased apoptotic cell death. The GSK inhibitor SB216763, but not lithium, inhibited the MG132-induced phosphorylation of p38, and the downstream signaling pathway was consistent with that in SB203580-treated cells. Taken together, our data show that proteasome inhibition regulates p38/GSK Ser9 /p70S6K Thr380 and ERK/GSK3β Thr390 /p70S6K Thr421/Ser424 kinase signaling, which is involved in cell survival and cell death.
Haines, Ricci J; Corbin, Karen D; Pendleton, Laura C; Eichler, Duane C
2012-07-27
Endothelial nitric-oxide synthase (eNOS) utilizes l-arginine as its principal substrate, converting it to l-citrulline and nitric oxide (NO). l-Citrulline is recycled to l-arginine by two enzymes, argininosuccinate synthase (AS) and argininosuccinate lyase, providing the substrate arginine for eNOS and NO production in endothelial cells. Together, these three enzymes, eNOS, AS, and argininosuccinate lyase, make up the citrulline-NO cycle. Although AS catalyzes the rate-limiting step in NO production, little is known about the regulation of AS in endothelial cells beyond the level of transcription. In this study, we showed that AS Ser-328 phosphorylation was coordinately regulated with eNOS Ser-1179 phosphorylation when bovine aortic endothelial cells were stimulated by either a calcium ionophore or thapsigargin to produce NO. Furthermore, using in vitro kinase assay, kinase inhibition studies, as well as protein kinase Cα (PKCα) knockdown experiments, we demonstrate that the calcium-dependent phosphorylation of AS Ser-328 is mediated by PKCα. Collectively, these findings suggest that phosphorylation of AS at Ser-328 is regulated in accordance with the calcium-dependent regulation of eNOS under conditions that promote NO production and are in keeping with the rate-limiting role of AS in the citrulline-NO cycle of vascular endothelial cells.
LENUS (Irish Health Repository)
Cathcart, Mary-Clare
2011-03-01
Thromboxane synthase (TXS) metabolises prostaglandin H2 into thromboxanes, which are biologically active on cancer cells. TXS over-expression has been reported in a range of cancers, and associated with a poor prognosis. TXS inhibition induces cell death in-vitro, providing a rationale for therapeutic intervention. We aimed to determine the expression profile of TXS in NSCLC and if it is prognostic and\\/or a survival factor in the disease.
Momilactone B Inhibits Ketosis In Vitro by Regulating the ANGPTL3-LPL Pathway and Inhibiting HMGCS2.
Kang, Dong Young; S P, Nipin; Darvin, Pramod; Joung, Youn Hee; Byun, Hyo Joo; Do, Chang Hee; Park, Kyung Do; Park, Mi Na; Cho, Kwang Hyun; Yang, Young Mok
2017-07-03
Ketogenesis is the production of ketone bodies, which provide energy when the body lacks glucose. Under ketogenic conditions, the body switches from primarily carbohydrate to fat metabolism to maintain energy balance. However, accumulation of high levels of ketone bodies in the blood results in ketosis. Treating ketosis with natural substances is preferable, because they are unlikely to cause side-effects. Momilactone B is an active compound isolated from Korean rice. Based on previous studies, we hypothesized that momilactone B could inhibit ketosis. We constructed an in vitro ketosis model by glucose starvation. We used this model to test the anti-ketosis effects of momilactone B. A primary target for treating ketosis is angiopoietin-like-3 (ANGPTL3), which modulates lipoprotein metabolism by inhibiting lipoprotein lipase (LPL), a multifunctional enzyme that breaks down stored fat to produce triglycerides. We showed that momilactone B could regulate the ANGPTL3-LPL pathway. However, a strong anti-ketosis candidate drug should also inhibit ketogenesis. Ketogenesis can be suppressed by inhibiting the expression of 3-hydroxy-3-methylglutaryl-CoA synthase-2 (HMGCS2), a mitochondrial enzyme that converts acetyl-CoA to ketone bodies. We found that momilactone B suppressed the expression of HMGCS2 through the increased expression of STAT5b. We also elucidated the relationship of STAT5b to ANGPTL3 and LPL expression.
Role of glycogen synthase kinase-3 beta in the inflammatory response caused by bacterial pathogens.
Cortés-Vieyra, Ricarda; Bravo-Patiño, Alejandro; Valdez-Alarcón, Juan J; Juárez, Marcos Cajero; Finlay, B Brett; Baizabal-Aguirre, Víctor M
2012-06-12
Glycogen synthase kinase 3β (GSK3β) plays a fundamental role during the inflammatory response induced by bacteria. Depending on the pathogen and its virulence factors, the type of cell and probably the context in which the interaction between host cells and bacteria takes place, GSK3β may promote or inhibit inflammation. The goal of this review is to discuss recent findings on the role of the inhibition or activation of GSK3β and its modulation of the inflammatory signaling in monocytes/macrophages and epithelial cells at the transcriptional level, mainly through the regulation of nuclear factor-kappaB (NF-κB) activity. Also included is a brief overview on the importance of GSK3 in non-inflammatory processes during bacterial infection.
Oxide Synthase Expression by p38 MAP Kinase
Directory of Open Access Journals (Sweden)
Tuija Turpeinen
2011-01-01
Full Text Available The role of dual specificity phosphatase 1 (DUSP1 in inducible nitric oxide synthase (iNOS expression in A549 human pulmonary epithelial cells, J774 mouse macrophages and primary mouse bone marrow-derived macrophages (BMMs was investigated. iNOS expression was induced by a cytokine mixture (TNF, IFNγ and IL-1β in A549 cells and by LPS in J774 cells, and it was inhibited by p38 MAPK inhibitors SB202190 and BIRB 796. Stimulation with cytokine mixture or LPS enhanced also DUSP1 expression. Down-regulation of DUSP1 by siRNA increased p38 MAPK phosphorylation and iNOS expression in A549 and J774 cells. In addition, LPS-induced iNOS expression was enhanced in BMMs from DUSP1(−/− mice as compared to that in BMMs from wild-type mice. The results indicate that DUSP1 suppresses iNOS expression by limiting p38 MAPK activity in human and mouse cells. Compounds that enhance DUSP1 expression or modulate its function may be beneficial in diseases complicated with increased iNOS-mediated NO production.
Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne
2004-01-01
The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...
DEFF Research Database (Denmark)
Sällström, Johan; Jensen, Boye L; Skøtt, Ole
2010-01-01
NOS supports renin release by cyclic guanosine monophosphate (cGMP)-mediated inhibition of cyclic adenosine monophosphate (cAMP)-specific phosphodiesterase 3 (PDE3) in juxtaglomerular (JG) cells. METHODS: The experiments were performed in conscious nNOS⁻(/)⁻ and wild types after 10 days on a low-sodium diet...... by measurements of inulin- and para-amino hippuric acid (PAH) clearances, respectively. RESULTS: The basal PRC was reduced in nNOS⁻(/)⁻ compared to the wild types. Administration of milrinone caused a more pronounced PRC increase in nNOS⁻(/)⁻, resulting in normalized renin levels, whereas PDE5 inhibition did...... not affect PRC in any genotype. The blood pressure was similar in both genotypes, and milrinone did not affect blood pressure compared to vehicle. GFR and RPF were similar at baseline and were reduced by milrinone. CONCLUSIONS: The present study provides in vivo evidence supporting the view that NO...
Bifunctional effects of fucoidan on the expression of inducible nitric oxide synthase
International Nuclear Information System (INIS)
Yang, Jin Won; Yoon, Se Young; Oh, Soo Jin; Kim, Sang Kyum; Kang, Keon Wook
2006-01-01
Algal fucoidan is a marine sulfated polysaccharide with a wide variety of biological activities including anti-thrombotic and anti-inflammatory effects. This study evaluated the effect of fucoidan on the expression of inducible nitric oxide synthase (iNOS) in a macrophage cell line, RAW264.7. Low concentration range of fucoidan (10 μg/ml) increased the basal expression level of iNOS in quiescent macrophages. However, we found for the first time that fucoidan inhibited the release of nitric oxide (NO) in RAW264.7 cells stimulated with lipopolysaccharide (LPS). Western blot analysis revealed that fucoidan suppressed the LPS-induced expression of the inducible nitric oxide synthase (iNOS) gene. Moreover, the activation of both nuclear factor-κB (NF-κB) and activator protein 1 (AP-1) are key steps in the transcriptional activation of the iNOS gene. Here, it was revealed that fucoidan selectively suppressed AP-1 activation, and that the activation of AP-1 appears to be essential for the induction of iNOS in activated macrophages. This inhibitory effect on AP-1 activation by fucoidan might be associated with its NO blocking and anti-inflammatory effects
Directory of Open Access Journals (Sweden)
Hyo-Jin An
2015-12-01
Full Text Available Phytochemical studies on the constituents of the rhizomes of Imperata cylindrica (Gramineae were performed using high-performance liquid chromatography (HPLC. We also aimed to search for any biologically active substance capable of inhibiting nitric oxide (NO formation in lipopolysaccharide (LPS-activated macrophage 264.7 cells, by testing four compounds isolated from this plant. Four compounds, including a new chromone, isoeugenin, along with ferulic acid, p-coumaric acid, and caffeic acid were isolated and identified by NMR spectroscopy. The structure of isoeugenin was determined as 7-hydroxy-5-methoxy-2-methylchromone by the 2D-NMR technique. Among the four compounds, isoeugenin has the lowest IC50 value on the inhibition of NO production in LPS-activated macrophage RAW264.7 cells (IC50, 9.33 μg/mL. In addition, isoeugenin significantly suppressed the LPS-induced expressions of inducible nitric oxide synthase (iNOS, cyclooxygenase-2 (COX-2, and proinflammatory cytokines mRNA levels. Taken together, these results suggest that the anti-inflammatory activity of isoeugenin is associated with the down-regulation of iNOS, COX-2, and pro-inflammatory cytokines in RAW264.7 cells. Accordingly, our results suggest that the new chromone isoegenin should be considered a potential treatment for inflammatory disease.
An, Hyo-Jin; Nugroho, Agung; Song, Byong-Min; Park, Hee-Juhn
2015-12-01
Phytochemical studies on the constituents of the rhizomes of Imperata cylindrica (Gramineae) were performed using high-performance liquid chromatography (HPLC). We also aimed to search for any biologically active substance capable of inhibiting nitric oxide (NO) formation in lipopolysaccharide (LPS)-activated macrophage 264.7 cells, by testing four compounds isolated from this plant. Four compounds, including a new chromone, isoeugenin, along with ferulic acid, p-coumaric acid, and caffeic acid were isolated and identified by NMR spectroscopy. The structure of isoeugenin was determined as 7-hydroxy-5-methoxy-2-methylchromone by the 2D-NMR technique. Among the four compounds, isoeugenin has the lowest IC50 value on the inhibition of NO production in LPS-activated macrophage RAW264.7 cells (IC50, 9.33 μg/mL). In addition, isoeugenin significantly suppressed the LPS-induced expressions of inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), and proinflammatory cytokines mRNA levels. Taken together, these results suggest that the anti-inflammatory activity of isoeugenin is associated with the down-regulation of iNOS, COX-2, and pro-inflammatory cytokines in RAW264.7 cells. Accordingly, our results suggest that the new chromone isoegenin should be considered a potential treatment for inflammatory disease.
Effects of Tributyltin Chloride on Cybrids with or without an ATP Synthase Pathologic Mutation.
López-Gallardo, Ester; Llobet, Laura; Emperador, Sonia; Montoya, Julio; Ruiz-Pesini, Eduardo
2016-09-01
The oxidative phosphorylation system (OXPHOS) includes nuclear chromosome (nDNA)- and mitochondrial DNA (mtDNA)-encoded polypeptides. Many rare OXPHOS disorders, such as striatal necrosis syndromes, are caused by genetic mutations. Despite important advances in sequencing procedures, causative mutations remain undetected in some patients. It is possible that etiologic factors, such as environmental toxins, are the cause of these cases. Indeed, the inhibition of a particular enzyme by a poison could imitate the biochemical effects of pathological mutations in that enzyme. Moreover, environmental factors can modify the penetrance or expressivity of pathological mutations. We studied the interaction between mitochondrially encoded ATP synthase 6 (p.MT-ATP6) subunit and an environmental exposure that may contribute phenotypic differences between healthy individuals and patients suffering from striatal necrosis syndromes or other mitochondriopathies. We analyzed the effects of the ATP synthase inhibitor tributyltin chloride (TBTC), a widely distributed environmental factor that contaminates human food and water, on transmitochondrial cell lines with or without an ATP synthase mutation that causes striatal necrosis syndrome. Doses were selected based on TBTC concentrations previously reported in human whole blood samples. TBTC modified the phenotypic effects caused by a pathological mtDNA mutation. Interestingly, wild-type cells treated with this xenobiotic showed similar bioenergetics when compared with the untreated mutated cells. In addition to the known genetic causes, our findings suggest that environmental exposure to TBTC might contribute to the etiology of striatal necrosis syndromes. López-Gallardo E, Llobet L, Emperador S, Montoya J, Ruiz-Pesini E. 2016. Effects of tributyltin chloride on cybrids with or without an ATP synthase pathologic mutation. Environ Health Perspect 124:1399-1405; http://dx.doi.org/10.1289/EHP182.
Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un
2016-12-01
Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.
Energy Technology Data Exchange (ETDEWEB)
Fujimura, Masatake, E-mail: fujimura@nimd.go.jp [Department of Basic Medical Science, National Institute for Minamata Disease, Kumamoto (Japan); Usuki, Fusako [Department of Clinical Medicine, National Institute for Minamata Disease, Kumamoto (Japan)
2015-10-01
Methylmercury (MeHg) is an environmental neurotoxicant. The developing nervous system is susceptible to low concentrations of MeHg; however, the effect of MeHg on neural progenitor cell (NPC) proliferation, a key stage of neurogenesis during development, remains to be clarified. In this study, we investigated the effect of low concentrations of MeHg on NPCs by using a primary culture system developed using the embryonic rat cerebral cortex. NPC proliferation was suppressed 48 h after exposure to 10 nM MeHg, but cell death was not observed. Western blot analyses for cyclins A, B, D1, and E demonstrated that MeHg down-regulated cyclin E, a promoter of the G1/S cell cycle transition. Cyclin E has been shown to be degraded following the phosphorylation by glycogen synthase kinase 3β (GSK-3β). The time course study showed that GSK-3β was up-regulated 3 h after exposure to 10 nM MeHg, and cyclin E degradation 48 h after MeHg exposure. We further demonstrated that GSK-3β inhibitors, lithium and SB-415286, suppressed MeHg-induced inhibition of NPC proliferation by preventing cyclin E degradation. These results suggest that the inhibition of NPC proliferation induced by low concentration of MeHg was associated with up-regulation of GSK-3β at the early stage and subsequent degeneration of cyclin E. - Highlights: • NPC proliferation was suppressed by 10 nM MeHg, but cell death was not observed. • MeHg induced down-regulation of cyclin E, a promoter of cell cycle progression. • GSK-3β was up-regulated by 10 nM MeHg, leading to cyclin E degradation. • GSK-3β inhibitors suppressed MeHg-induced degradation of cyclin E.
International Nuclear Information System (INIS)
Ohashi, Koji; Kominami, Shiro; Yamazaki, Takeshi; Ohta, Shigeru; Kitamura, Shigeyuki
2004-01-01
Organotin compounds, triphenyltin (TPT), tributyltin, dibutyltin, and monobutyltin (MBT), showed potent inhibitory effects on both L-arginine oxidation to nitric oxide and L-citrulline, and cytochrome c reduction catalyzed by recombinant rat neuronal nitric oxide synthase (nNOS). The two inhibitory effects were almost parallel. MBT and TPT showed the highest inhibitory effects, followed by tributyltin and dibutyltin; TPT and MBT showed inhibition constant (IC 50 ) values of around 10 μM. Cytochrome c reduction activity was markedly decreased by removal of calmodulin (CaM) from the complete mixture, and the decrease was similar to the extent of inhibition by TPT and MBT. The inhibitory effect of MBT on the cytochrome c reducing activity was rapidly attenuated upon dilution of the inhibitor, and addition of a high concentration of CaM reactivated the cytochrome c reduction activity inhibited by MBT. However, other cofactors such as FAD, FMN or tetrahydrobiopterin had no such ability. The inhibitory effect of organotin compounds (100 μM) on L-arginine oxidation of nNOS almost vanished when the amount of CaM was sufficiently increased (150-300 μM). It was confirmed by CaM-agarose column chromatography that the dissociation of nNOS-CaM complex was induced by organotin compounds. These results indicate that organotin compounds disturb the interaction between CaM and nNOS, thereby inhibiting electron transfer from the reductase domain to cytochrome c and the oxygenase domain
Schmitzer, P. R.; Eilers, R. J.; Cseke, C.
1993-09-01
Acetolactate synthase (ALS) was isolated from a field population of cocklebur (Xanthium strumarium) that developed resistance to the herbicide Scepter following three consecutive years of application. The active ingredient of Scepter, imazaquin, gave an inhibitor concentration required to produce 50% inhibition of the enzyme activity that was more than 300 times greater for the resistant enzyme than for the wild-type cocklebur ALS. Tests with flumetsulam and chlorimuron show that the resistant ALS was not cross-resistant to these two other classes of ALS inhibitors.
Prostaglandin H synthase-mediated bioactivation of the amino acid pyrolysate product Trp P-2
Energy Technology Data Exchange (ETDEWEB)
Petry, T.W.; Krauss, R.S.; Eling, T.E.
1986-08-01
We report evidence that the mutagen and carcinogen 3-amino-1-methyl-5H pyrido(4,3b)indole (Trp P-2) is a substrate for co-oxidation by prostaglandin H synthase (PHS) in ram seminal vesicle (RSV) microsomes. Trp P-2 serves as a reducing cofactor for the hydroperoxidase activity of PHS as shown by the concentration-dependent inhibition of the hydroperoxidase catalyzed incorporation of molecular oxygen into phenylbutazone. Spectral data suggest that this metabolism results in disruption of the double bond conjugation within the nucleus of the molecule. A single metabolite peak which was dependent upon arachidonic acid and substrate concentration was separated from the parent compound by h.p.l.c. following incubation with RSV microsomes. Co-oxidation of Trp P-2 produced reactive intermediates which bound covalently to microsomal protein (9 nmol/mg) and to calf thymus DNA (475 pmol/mg). Binding was inhibited by indomethacin, and supported by substitution of hydrogen peroxide for arachidonic acid. These data suggest a possible role for PHS in the in situ activation of Trp P-2 to its ultimate carcinogenic form in tissues which contain PHS.
Exogenous iron and γ-irradiation induce NO-synthase synthesis in mouse liver
International Nuclear Information System (INIS)
Mikoyan, V.D.; Voevodskaya, N.V.; Kubrina, L.N.; Malenkova, I.V.; Vanin, A.F.
1994-01-01
Protein synthesis inhibitor (cycloheximide, CHI) and exogenous antioxidant (phenazan) suppress the synthesis of NO in mouse liver in vivo which is induced by administration to the animals of γ-irradiation, bacterial lipopolysaccharide (LPS), or Fe 2+ -citrate together with LPS. Biosynthesis of NO was monitored by the ESR signal of paramagnetic mononitrosyl iron complexes with the exogenous ligand diethyldithiocarbamate (MNIC-DETC) 30 min after addition of the ligand. The complexes arise from NO binding to DETC complexes with exogenous and endogenous Fe 2+ , which act as selective NO traps. The enhancement of NO biosynthesis after γ-irradiation or LPS or LPS + Fe 2+ -citrate is apparently due to the induction of the synthesis of NO-synthase, which is inhibited by cycloheximide. This process is triggered by reactive oxygen species, presumably through the activation of the transcription factor protein NFkB. The accumulation of free radical oxygen species is inhibited by the antioxidant phenazan
Directory of Open Access Journals (Sweden)
Yan Wang
2015-01-01
Full Text Available Rheumatoid arthritis (RA is characterized by inflammatory cell infiltration, fibroblast-like synoviocytes (FLS invasive proliferation, and joint destruction. Cyclic GMP-AMP synthase (cGAS is a cytosolic DNA sensor that induces immune activation. In this study, we examined whether cGAS plays a role in RA FLS. In this study, cGAS was overexpressed in RA-FLS compared with OA FLS. TNFα stimulation induced cGAS expression in RA FLS. Overexpression of cGAS promoted the proliferation and knockdown of cGAS inhibited the proliferation of RA FLS. cGAS overexpression enhanced the production of proinflammatory cytokines and matrix metalloproteinases (MMPs as well as AKT and ERK phosphorylation in TNFα-stimulated FLS. In contrast, cGAS silencing inhibited production of proinflammatory cytokines and matrix metalloproteinases (MMPs as well as AKT and ERK phosphorylation in TNFα-stimulated FLS. These results suggest that cGAS activates the AKT and ERK pathways to promote the inflammatory response of RA FLS, and the development of strategies targeting cGAS may have therapeutic potential for human RA.
Wang, Yan; Su, Guo-Hua; Zhang, Fang; Chu, Jing-Xue; Wang, Yun-Shan
2015-01-01
Rheumatoid arthritis (RA) is characterized by inflammatory cell infiltration, fibroblast-like synoviocytes (FLS) invasive proliferation, and joint destruction. Cyclic GMP-AMP synthase (cGAS) is a cytosolic DNA sensor that induces immune activation. In this study, we examined whether cGAS plays a role in RA FLS. In this study, cGAS was overexpressed in RA-FLS compared with OA FLS. TNFα stimulation induced cGAS expression in RA FLS. Overexpression of cGAS promoted the proliferation and knockdown of cGAS inhibited the proliferation of RA FLS. cGAS overexpression enhanced the production of proinflammatory cytokines and matrix metalloproteinases (MMPs) as well as AKT and ERK phosphorylation in TNFα-stimulated FLS. In contrast, cGAS silencing inhibited production of proinflammatory cytokines and matrix metalloproteinases (MMPs) as well as AKT and ERK phosphorylation in TNFα-stimulated FLS. These results suggest that cGAS activates the AKT and ERK pathways to promote the inflammatory response of RA FLS, and the development of strategies targeting cGAS may have therapeutic potential for human RA.
Directory of Open Access Journals (Sweden)
Berta Alquézar
2017-08-01
Full Text Available Citrus aroma and flavor, chief traits of fruit quality, are derived from their high content in essential oils of most plant tissues, including leaves, stems, flowers, and fruits. Accumulated in secretory cavities, most components of these oils are volatile terpenes. They contribute to defense against herbivores and pathogens, and perhaps also protect tissues against abiotic stress. In spite of their importance, our understanding of the physiological, biochemical, and genetic regulation of citrus terpene volatiles is still limited. The availability of the sweet orange (Citrus sinensis L. Osbeck genome sequence allowed us to characterize for the first time the terpene synthase (TPS family in a citrus type. CsTPS is one of the largest angiosperm TPS families characterized so far, formed by 95 loci from which just 55 encode for putative functional TPSs. All TPS angiosperm families, TPS-a, TPS-b, TPS-c, TPS-e/f, and TPS-g were represented in the sweet orange genome, with 28, 18, 2, 2, and 5 putative full length genes each. Additionally, sweet orange β-farnesene synthase, (Z-β-cubebene/α-copaene synthase, two β-caryophyllene synthases, and three multiproduct enzymes yielding β-cadinene/α-copaene, β-elemene, and β-cadinene/ledene/allo-aromandendrene as major products were identified, and functionally characterized via in vivo recombinant Escherichia coli assays.
Cyclophilin D Promotes Brain Mitochondrial F1FO ATP Synthase Dysfunction in Aging Mice.
Gauba, Esha; Guo, Lan; Du, Heng
2017-01-01
Brain aging is the known strongest risk factor for Alzheimer's disease (AD). In recent years, mitochondrial deficits have been proposed to be a common mechanism linking brain aging to AD. Therefore, to elucidate the causative mechanisms of mitochondrial dysfunction in aging brains is of paramount importance for our understanding of the pathogenesis of AD, in particular its sporadic form. Cyclophilin D (CypD) is a specific mitochondrial protein. Recent studies have shown that F1FO ATP synthase oligomycin sensitivity conferring protein (OSCP) is a binding partner of CypD. The interaction of CypD with OSCP modulates F1FO ATP synthase function and mediates mitochondrial permeability transition pore (mPTP) opening. Here, we have found that increased CypD expression, enhanced CypD/OSCP interaction, and selective loss of OSCP are prominent brain mitochondrial changes in aging mice. Along with these changes, brain mitochondria from the aging mice demonstrated decreased F1FO ATP synthase activity and defective F1FO complex coupling. In contrast, CypD deficient mice exhibited substantially mitigated brain mitochondrial F1FO ATP synthase dysfunction with relatively preserved mitochondrial function during aging. Interestingly, the aging-related OSCP loss was also dramatically attenuated by CypD depletion. Therefore, the simplest interpretation of this study is that CypD promotes F1FO ATP synthase dysfunction and the resultant mitochondrial deficits in aging brains. In addition, in view of CypD and F1FO ATP synthase alterations seen in AD brains, the results further suggest that CypD-mediated F1FO ATP synthase deregulation is a shared mechanism linking mitochondrial deficits in brain aging and AD.
Energy Technology Data Exchange (ETDEWEB)
Choi, Cheol-Hee [Research Center for Resistant Cells, Chosun University, Seosuk-dong, Dong-gu, Gwangju 501-759 (Korea, Republic of); Department of Pharmacology, College of Medicine, Chosun University, Seosuk-dong, Dong-gu, Gwangju 501-759 (Korea, Republic of); Lee, Byung-Hoon [College of Pharmacy and Multiscreening Center for Drug Development, Seoul National University, Seoul 151-742 (Korea, Republic of); Ahn, Sang-Gun [Department of Pathology, College of Dentistry, Chosun University, Gwangju 501-759 (Korea, Republic of); Oh, Seon-Hee, E-mail: oshccw@hanmail.net [Research Center for Resistant Cells, Chosun University, Seosuk-dong, Dong-gu, Gwangju 501-759 (Korea, Republic of)
2012-02-24
Highlights: Black-Right-Pointing-Pointer MG132 induces the phosphorylation of GSK3{beta}{sup Ser9} and, to a lesser extent, of GSK3{beta}{sup Thr390}. Black-Right-Pointing-Pointer MG132 induces dephosphorylation of p70S6K{sup Thr389} and phosphorylation of p70S6K{sup Thr421/Ser424}. Black-Right-Pointing-Pointer Inactivation of p38 dephosphorylates GSK3{beta}{sup Ser9} and phosphorylates GSK3{beta}{sup Thr390}. Black-Right-Pointing-Pointer Inactivation of p38 phosphorylates p70S6K{sup Thr389} and increases the phosphorylation of p70S6K{sup Thr421/Ser424}. Black-Right-Pointing-Pointer Inactivation of p38 decreases autophagy and increases apoptosis induced by MG132. -- Abstract: Proteasome inhibition is a promising approach for cancer treatment; however, the underlying mechanisms involved have not been fully elucidated. Here, we show that proteasome inhibition-induced p38 mitogen-activated protein kinase regulates autophagy and apoptosis by modulating the phosphorylation status of glycogen synthase kinase 3{beta} (GSK3{beta}) and 70 kDa ribosomal S6 kinase (p70S6K). The treatment of MDA-MB-231 cells with MG132 induced endoplasmic reticulum stress through the induction of ATF6a, PERK phosphorylation, and CHOP, and apoptosis through the cleavage of Bax and procaspase-3. MG132 caused the phosphorylation of GSK3{beta} at Ser{sup 9} and, to a lesser extent, Thr{sup 390}, the dephosphorylation of p70S6K at Thr{sup 389}, and the phosphorylation of p70S6K at Thr{sup 421} and Ser{sup 424}. The specific p38 inhibitor SB203080 reduced the p-GSK3{beta}{sup Ser9} and autophagy through the phosphorylation of p70S6K{sup Thr389}; however, it augmented the levels of p-ERK, p-GSK3{beta}{sup Thr390}, and p-70S6K{sup Thr421/Ser424} induced by MG132, and increased apoptotic cell death. The GSK inhibitor SB216763, but not lithium, inhibited the MG132-induced phosphorylation of p38, and the downstream signaling pathway was consistent with that in SB203580-treated cells. Taken together, our
Role of glycogen synthase kinase-3 beta in the inflammatory response caused by bacterial pathogens
Directory of Open Access Journals (Sweden)
Cortés-Vieyra Ricarda
2012-06-01
Full Text Available Abstract Glycogen synthase kinase 3β (GSK3β plays a fundamental role during the inflammatory response induced by bacteria. Depending on the pathogen and its virulence factors, the type of cell and probably the context in which the interaction between host cells and bacteria takes place, GSK3β may promote or inhibit inflammation. The goal of this review is to discuss recent findings on the role of the inhibition or activation of GSK3β and its modulation of the inflammatory signaling in monocytes/macrophages and epithelial cells at the transcriptional level, mainly through the regulation of nuclear factor-kappaB (NF-κB activity. Also included is a brief overview on the importance of GSK3 in non-inflammatory processes during bacterial infection.
An Arabidopsis callose synthase
DEFF Research Database (Denmark)
Ostergaard, Lars; Petersen, Morten; Mattsson, Ole
2002-01-01
in the Arabidopsis mpk4 mutant which exhibits systemic acquired resistance (SAR), elevated beta-1,3-glucan synthase activity, and increased callose levels. In addition, AtGsl5 is a likely target of salicylic acid (SA)-dependent SAR, since AtGsl5 mRNA accumulation is induced by SA in wild-type plants, while...... expression of the nahG salicylate hydroxylase reduces AtGsl5 mRNA levels in the mpk4 mutant. These results indicate that AtGsl5 is likely involved in callose synthesis in flowering tissues and in the mpk4 mutant....
Santo-Domingo, Jaime; Chareyron, Isabelle; Broenimann, Charlotte; Lassueur, Steve; Wiederkehr, Andreas
2017-08-15
Chloramphenicol and several other antibiotics targeting bacterial ribosomes inhibit mitochondrial protein translation. Inhibition of mitochondrial protein synthesis leads to mitonuclear protein imbalance and reduced respiratory rates as confirmed here in HeLa and PC12 cells. Unexpectedly, respiration in INS-1E insulinoma cells and primary human islets was unaltered in the presence of chloramphenicol. Resting respiratory rates and glucose stimulated acceleration of respiration were also not lowered when a range of antibiotics including, thiamphenicol, streptomycin, gentamycin and doxycycline known to interfere with bacterial protein synthesis were tested. However, chloramphenicol efficiently reduced mitochondrial protein synthesis in INS-1E cells, lowering expression of the mtDNA encoded COX1 subunit of the respiratory chain but not the nuclear encoded ATP-synthase subunit ATP5A. Despite a marked reduction of the essential respiratory chain subunit COX1, normal respiratory rates were maintained in INS-1E cells. ATP-synthase dependent respiration was even elevated in chloramphenicol treated INS-1E cells. Consistent with these findings, glucose-dependent calcium signaling reflecting metabolism-secretion coupling in beta-cells, was augmented. We conclude that antibiotics targeting mitochondria are able to cause mitonuclear protein imbalance in insulin secreting cells. We hypothesize that in contrast to other cell types, compensatory mechanisms are sufficiently strong to maintain normal respiratory rates and surprisingly even result in augmented ATP-synthase dependent respiration and calcium signaling following glucose stimulation. The result suggests that in insulin secreting cells only lowering COX1 below a threshold level may result in a measurable impairment of respiration. When focusing on mitochondrial function, care should be taken when including antibiotics targeting translation for long-term cell culture as depending on the sensitivity of the cell type analyzed
Inhibition of the adrenomedullin/nitric oxide signaling pathway in early diabetic retinopathy.
Blom, Jan J; Giove, Thomas J; Favazza, Tara L; Akula, James D; Eldred, William D
2011-06-01
The nitric oxide (NO) signaling pathway is integrally involved in visual processing and changes in the NO pathway are measurable in eyes of diabetic patients. The small peptide adrenomedullin (ADM) can activate a signaling pathway to increase the enzyme activity of neuronal nitric oxide synthase (nNOS). ADM levels are elevated in eyes of diabetic patients and therefore, ADM may play a role in the pathology of diabetic retinopathy. The goal of this research was to test the effects of inhibiting the ADM/NO signaling pathway in early diabetic retinopathy. Inhibition of this pathway decreased NO production in high-glucose retinal cultures. Treating diabetic mice with the PKC β inhibitor ruboxistaurin for 5 weeks lowered ADM mRNA levels and ADM-like immunoreactivity and preserved retinal function as assessed by electroretinography. The results of this study indicate that inhibiting the ADM/NO signaling pathway prevents neuronal pathology and functional losses in early diabetic retinopathy.
Energy Technology Data Exchange (ETDEWEB)
Biswas, Madhurima; Kwong, Erick K.; Park, Eujean; Nagra, Parminder; Chan, Jefferson Y., E-mail: jchan@uci.edu
2013-08-01
Nuclear factor E2-related factor-1 (Nrf1) is a basic leucine zipper transcription factor that is known to regulate antioxidant and cytoprotective gene expression. It was recently shown that Nrf1 is regulated by SCF–Fbw7 ubiquitin ligase. However our knowledge of upstream signals that targets Nrf1 for degradation by the UPS is not known. We report here that Nrf1 expression is negatively regulated by glycogen synthase kinase 3 (GSK3) in Fbw7-dependent manner. We show that GSK3 interacts with Nrf1 and phosphorylates the Cdc4 phosphodegron domain (CPD) in Nrf1. Mutation of serine residue in the CPD of Nrf1 to alanine (S350A), blocks Nrf1 from phosphorylation by GSK3, and stabilizes Nrf1. Knockdown of Nrf1 and expression of a constitutively active form of GSK3 results in increased apoptosis in neuronal cells in response to ER stress, while expression of the GSK3 phosphorylation resistant S350A–Nrf1 attenuates apoptotic cell death. Together these data suggest that GSK3 regulates Nrf1 expression and cell survival function in response to stress activation. Highlights: • The effect of GSK3 on Nrf1 expression was examined. • GSK3 destabilizes Nrf1 protein via Fbw7 ubiquitin ligase. • GSK3 binds and phosphorylates Nrf1. • Protection from stress-induced apoptosis by Nrf1 is inhibited by GSK3.
Hamelet, J; Aït-Yahya-Graison, E; Matulewicz, E; Noll, C; Badel-Chagnon, A; Camproux, A-C; Demuth, K; Paul, J-L; Delabar, J M; Janel, N
2007-12-01
Hyperhomocysteinaemia is a metabolic disorder associated with the development of premature atherosclerosis. Among the determinants which predispose to premature thromboembolic and atherothrombotic events, serum activity of paraoxonase 1, mainly synthesized in the liver, has been shown to be a predictor of cardiovascular disease and to be negatively correlated with serum homocysteine levels in human. Even though treatments of hyperhomocysteinaemic patients ongoing cardiovascular complications are commonly used, it still remains unclear above which homocysteine level a preventive therapy should be started. In order to establish a threshold of plasma homocysteine concentration we have analyzed the hepatic cystathionine beta synthase and paraoxonase 1 activities in a moderate to intermediate murine model of hyperhomocysteinaemia. Using wild type and heterozygous cystathionine beta synthase deficient mice fed a methionine enriched diet or a control diet, we first studied the link between cystathionine beta synthase and paraoxonase 1 activities and plasma homocysteine concentration. Among the animals used in this study, we observed a negative correlation between plasma homocysteine level and cystathionine beta synthase activity (rho=-0.52, P=0.0008) or paraoxonase 1 activity (rho=-0.49, P=0.002). Starting from these results, a homocysteine cut-off value of 15 microm has been found for both cystathionine beta synthase (P=0.0003) and paraoxonase 1 (P=0.0007) activities. Our results suggest that both cystathionine beta synthase and paraoxonase 1 activities are significantly decreased in mice with a plasma homocysteine value greater than 15 microm. In an attempt to set up preventive treatment for cardiovascular disease our results indicate that treatments should be started from 15 microm of plasma homocysteine.
Specht, Sabine; Sarite, Salem Ramadan; Hauber, Ilona; Hauber, Joachim; Görbig, Ulf F; Meier, Chris; Bevec, Dorian; Hoerauf, Achim; Kaiser, Annette
2008-05-01
Malaria is still a major cause of death in the tropics. There is an urgent need for new anti-malarial drugs because drug-resistant plasmodia frequently occur. Over recent years, we elucidated the biosynthesis of hypusine, a novel amino acid contained in eukaryotic initiation factor 5A (eIF-5A) in Plasmodium. Hypusine biosynthesis involves catalysis of deoxyhypusine synthase (DHS) in the first step of post-translational modification. In a screen for new inhibitors of purified plasmodium DHS, CNI-1493, a novel selective pro-inflammatory cytokine inhibitor used in clinical phase II for the treatment of Crohn's disease, inhibited the enzyme of the parasite 3-fold at a concentration of 2 microM. In vitro experiments with 200 microM CNI-1493 in Plasmodium-infected erythrocytes, which lack nuclei and DHS protein, showed a parasite clearance within 2 days. This can presumably be attributed to an anti-proliferating effect because of the inhibition of DHS by the parasite. The determined IC50 of CNI-1493 was 135.79 microM after 72 h. In vivo application of this substance in Plasmodium berghei ANKA-infected C57BL/6 mice significantly reduced parasitemia after dosage of 1 mg/kg or 4 mg/kg/body weight and prevented death of mice with cerebral malaria. This effect was paralleled by a decrease in serum TNF levels of the mice. We suggest that the new mechanism of CNI-1493 is caused by a decrease in modified eIF-5A biosynthesis with a downstream effect on the TNF synthesis of the host. From the current data, we consider CNI-1493 to be a promising drug for anti-malarial therapy because of its combined action, i.e., the decrease in eIF-5A biosynthesis of the parasite and host cell TNF biosynthesis.
Resveratrol suppresses growth of cancer stem-like cells by inhibiting fatty acid synthase.
Pandey, Puspa R; Okuda, Hiroshi; Watabe, Misako; Pai, Sudha K; Liu, Wen; Kobayashi, Aya; Xing, Fei; Fukuda, Koji; Hirota, Shigeru; Sugai, Tamotsu; Wakabayashi, Go; Koeda, Keisuke; Kashiwaba, Masahiro; Suzuki, Kazuyuki; Chiba, Toshimi; Endo, Masaki; Fujioka, Tomoaki; Tanji, Susumu; Mo, Yin-Yuan; Cao, Deliang; Wilber, Andrew C; Watabe, Kounosuke
2011-11-01
Resveratrol is a natural polyphenolic compound and has been shown to exhibit cardio-protective as well as anti-neoplastic effects on various types of cancers. However, the exact mechanism of its anti-tumor effect is not clearly defined. Resveratrol has been shown to have strong hypolipidemic effect on normal adipocytes and as hyper-lipogenesis is a hallmark of cancer cell physiology, the effect of resveratrol on lipid synthesis in cancer stem-like cells (CD24(-)/CD44(+)/ESA(+)) that were isolated from both ER+ and ER- breast cancer cell lines was examined. The authors found that resveratrol significantly reduced the cell viability and mammosphere formation followed by inducing apoptosis in cancer stem-like cells. This inhibitory effect of resveratrol is accompanied by a significant reduction in lipid synthesis which is caused by the down-regulation of the fatty acid synthase (FAS) gene followed by up-regulation of pro-apoptotic genes, DAPK2 and BNIP3. The activation of apoptotic pathway in the cancer stem-like cells was suppressed by TOFA and by Fumonisin B1, suggesting that resveratrol-induced apoptosis is indeed through the modulation of FAS-mediated cell survival signaling. Importantly, resveratrol was able to significantly suppress the growth of cancer stem-like cells in an animal model of xenograft without showing apparental toxicity. Taken together, the results of this study indicate that resveratrol is capable of inducing apoptosis in the cancer stem-like cells through suppression of lipogenesis by modulating FAS expression, which highlights a novel mechanism of anti-tumor effect of resveratrol.
Directory of Open Access Journals (Sweden)
Marquez Rodolfo
2004-09-01
Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.
The Tomato Terpene Synthase Gene Family1[W][OA
Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran
2011-01-01
Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655
Structure and mechanism of the diterpene cyclase ent-copalyl diphosphate synthase
Energy Technology Data Exchange (ETDEWEB)
Köksal, Mustafa; Hu, Huayou; Coates, Robert M.; Peters, Reuben J.; Christianson, David W. (UIUC); (Iowa State); (Penn)
2011-09-20
The structure of ent-copalyl diphosphate synthase reveals three {alpha}-helical domains ({alpha}, {beta} and {gamma}), as also observed in the related diterpene cyclase taxadiene synthase. However, active sites are located at the interface of the {beta}{gamma} domains in ent-copalyl diphosphate synthase but exclusively in the {alpha} domain of taxadiene synthase. Modular domain architecture in plant diterpene cyclases enables the evolution of alternative active sites and chemical strategies for catalyzing isoprenoid cyclization reactions.
Generation and Functional Evaluation of Designer Monoterpene Synthases.
Srividya, N; Lange, I; Lange, B M
2016-01-01
Monoterpene synthases are highly versatile enzymes that catalyze the first committed step in the pathways toward terpenoids, the structurally most diverse class of plant natural products. Recent advancements in our understanding of the reaction mechanism have enabled engineering approaches to develop mutant monoterpene synthases that produce specific monoterpenes. In this chapter, we are describing protocols to introduce targeted mutations, express mutant enzyme catalysts in heterologous hosts, and assess their catalytic properties. Mutant monoterpene synthases have the potential to contribute significantly to synthetic biology efforts aimed at producing larger amounts of commercially attractive monoterpenes. © 2016 Elsevier Inc. All rights reserved.
Yoshikawa, Noriko; Yamada, Shizuo; Takeuchi, Chihiro; Kagota, Satomi; Shinozuka, Kazumasa; Kunitomo, Masaru; Nakamura, Kazuki
2008-06-01
Cordyceps sinensis, a parasitic fungus on the larvae of Lepidoptera, has been used as a traditional Chinese medicine. We previously reported that the growth of B16-BL6 mouse melanoma (B16-BL6) cells was inhibited by cordycepin (3'-deoxyadenosine), an active ingredient of C. sinensis, and its effect was antagonized by MRS1191, a selective adenosine A3 receptor antagonist. In this study, the radioligand binding assay using [125I]-AB-MECA (a selective adenosine A3 receptor agonist) has shown that B16-BL6 cells express adenosine A3 receptors and that cordycepin binds to these receptors. We also confirmed the involvement of adenosine A3 receptors in the action of cordycepin using MRS1523 and MRS1220, specific adenosine A3 receptor antagonists. Next, indirubin, a glycogen synthase kinase-3beta (GSK-3beta) inhibitor, antagonized the growth suppression induced by cordycepin. Furthermore, the level of cyclin D1 protein in B16-BL6 cells was decreased by cordycepin using Western blot analysis. In conclusion, this study demonstrated that cordycepin inhibits the proliferation of B16-BL6 cells by stimulating adenosine A3 receptors followed by the Wnt signaling pathway, including GSK-3beta activation and cyclin D1 inhibition.
DEFF Research Database (Denmark)
Højlund, Kurt; Staehr, Peter; Hansen, Bo Falck
2003-01-01
In type 2 diabetes, insulin activation of muscle glycogen synthase (GS) is impaired. This defect plays a major role for the development of insulin resistance and hyperglycemia. In animal muscle, insulin activates GS by reducing phosphorylation at both NH(2)- and COOH-terminal sites......, but the mechanism involved in human muscle and the defect in type 2 diabetes remain unclear. We studied the effect of insulin at physiological concentrations on glucose metabolism, insulin signaling and phosphorylation of GS in skeletal muscle from type 2 diabetic and well-matched control subjects during euglycemic......-hyperinsulinemic clamps. Analysis using phospho-specific antibodies revealed that insulin decreases phosphorylation of sites 3a + 3b in human muscle, and this was accompanied by activation of Akt and inhibition of glycogen synthase kinase-3alpha. In type 2 diabetic subjects these effects of insulin were fully intact...
Thomson, Susan J; Rippon, Paula; Butts, Chrissie; Olsen, Sarah; Shaw, Martin; Joyce, Nigel I; Eady, Colin C
2013-11-06
Onion and garlic are renowned for their roles as functional foods. The health benefits of garlic are attributed to di-2-propenyl thiosulfinate (allicin), a sulfur compound found in disrupted garlic but not found in disrupted onion. Recently, onions have been grown with repressed lachrymatory factor synthase (LFS) activity, which causes these onions to produce increased amounts of di-1-propenyl thiosulfinate, an isomer of allicin. This investigation into the key health attributes of LFS-silenced (tearless) onions demonstrates that they have some attributes more similar to garlic and that this is likely due to the production of novel thiosulfinate or metabolites. The key finding was that collagen-induced in vitro platelet aggregation was significantly reduced by tearless onion extract over normal onion extract. Thiosulfinate or derived compounds were shown not to be responsible for the observed changes in the inflammatory response of AGS (stomach adenocarcinoma) cells to tumor necrosis factor alpha (TNFα) when pretreated with model onion juices. A preliminary rat feeding trial indicated that the tearless onions may also play a key role in reducing weight gain.
Kim, You-Mie; Song, Insun; Seo, Yong-Hak; Yoon, Gyesoon
2013-12-01
Enhanced lipogenesis plays a critical role in cell senescence via induction of expression of the mature form of sterol regulatory element binding protein 1 (SREBP1), which contributes to an increase in organellar mass, one of the indicators of senescence. We investigated the molecular mechanisms by which signaling molecules control SREBP1-mediated lipogenesis and senescence. We developed cellular models for stress-induced senescence, by exposing Chang cells, which are immortalized human liver cells, to subcytotoxic concentrations (200 µM) of deferoxamine (DFO) and H2O2. In this model of stress-induced cell senescence using DFO and H2O2, the phosphorylation profile of glycogen synthase kinase 3α (GSK3α) and β corresponded closely to the expression profile of the mature form of SREBP-1 protein. Inhibition of GSK3 with a subcytotoxic concentration of the selective GSK3 inhibitor SB415286 significantly increased mature SREBP1 expression, as well as lipogenesis and organellar mass. In addition, GSK3 inhibition was sufficient to induce senescence in Chang cells. Suppression of GSK3 expression with siRNAs specific to GSK3α and β also increased mature SREBP1 expression and induced senescence. Finally, blocking lipogenesis with fatty acid synthase inhibitors (cerulenin and C75) and siRNA-mediated silencing of SREBP1 and ATP citrate lyase (ACL) significantly attenuated GSK3 inhibition-induced senescence. GSK3 inactivation is an important upstream event that induces SREBP1-mediated lipogenesis and consequent cell senescence.
Directory of Open Access Journals (Sweden)
Bechard Matthew E.
2003-01-01
Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.
Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.
2003-01-01
Tetrahydromethanopterin (H(4)MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H(4)MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H(4)MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H(4)MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H(4)MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.
Flores-Sanchez, Isvett Josefina; Gang, David Roger
2013-11-01
Ginger (Zingiber officinale Rosc.) and turmeric (Curcuma longa L.), members of the Zingiberaceae, are widely used in traditional Asian cuisines and herbal medicine. Gingerols and diarylheptanoids, important compounds from these plants, appear to be produced by enzymes of the type III polyketide synthase class. Previous efforts to detect activity of such enzymes in tissues from these plants were only marginally successful in turmeric and completely unsuccessful in ginger because of very rapid hydrolysis of the hydroxycinnamoyl-CoA substrates (p-coumaroyl-CoA, feruloyl-CoA and caffeoyl-CoA) in these assays, presumably due to the presence of thioesterases in these tissues. In order to determine whether such thioesterase activities were specific and could be reduced so that the polyketide synthase activities could be better characterized, three inhibitors of the thioesterase domain of fatty acid synthase were tested in assays with leaf and rhizome crude protein extracts from these plants: orlistat, a reduced form of lipstatin, and peptide 1 and peptide 2 from hydrolysates of soybean β-conglycinin. Results of these analyses indicated that specific thioesterases do exist in these plants and that they could indeed be inhibited, with highest inhibition occurring with a mixture of these three compounds, leading for example to a reduction of caffeoyl-CoA hydrolysis in leaves and rhizomes of ginger by 40-fold and 27-fold, respectively. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Broad Substrate Specificity of the Loading Didomain of the Lipomycin Polyketide Synthase
Energy Technology Data Exchange (ETDEWEB)
Yuzawa, S; Eng, CH; Katz, L; Keasling, JD
2013-06-04
LipPks1, a polyketide synthase subunit of the lipomycin synthase, is believed to catalyze the polyketide chain initiation reaction using isobutyryl-CoA as a substrate, followed by an elongation reaction with methylmalonyl-CoA to start the biosynthesis of antibiotic alpha-lipomycin in Streptomyces aureofaciens Tu117. Recombinant LipPks1, containing the thioesterase domain from the 6-deoxyerythronolide B synthase, was produced in Escherichia coli, and its substrate specificity was investigated in vitro. Surprisingly, several different acyl-CoAs, including isobutyryl-CoA, were accepted as the starter substrates, while no product was observed with acetyl-CoA. These results demonstrate the broad substrate specificity of LipPks1 and may be applied to producing new antibiotics.
DEFF Research Database (Denmark)
Gaster, Michael; Brusgaard, Klaus; Handberg, Aa.
2004-01-01
The mechanism responsible for the diminished activation of glycogen synthase (GS) in diabetic myotubes remains unclear, but may involve increased activity and/or expression of glycogen synthase kinase-3 (GSK-3). In myotubes established from type 2 diabetic and healthy control subjects we determined...
Platelet-derived growth factor (PDGF) stimulates glycogen synthase activity in 3T3 cells
International Nuclear Information System (INIS)
Chan, C.P.; Bowen-Pope, D.F.; Ross, R.; Krebs, E.G.
1986-01-01
Hormonal regulation of glycogen synthase, an enzyme that can be phosphorylated on multiple sites, is often associated with changes in its phosphorylation state. Enzyme activation is conventionally monitored by determining the synthase activity ratio [(activity in the absence of glucose 6-P)/(activity in the presence of glucose 6-P)]. Insulin causes an activation of glycogen synthase with a concomitant decrease in its phosphate content. In a previous report, the authors showed that epidermal growth factor (EGF) increases the glycogen synthase activity ratio in Swiss 3T3 cells. The time and dose-dependency of this response was similar to that of insulin. Their recent results indicate that PDGF also stimulates glycogen synthase activity. Enzyme activation was maximal after 30 min. of incubation with PDGF; the time course observed was very similar to that with insulin and EGF. At 1 ng/ml (0.03nM), PDGF caused a maximal stimulation of 4-fold in synthase activity ratio. Half-maximal stimulation was observed at 0.2 ng/ml (6 pM). The time course of changes in enzyme activity ratio closely followed that of 125 I-PDGF binding. The authors data suggest that PDGF, as well as EFG and insulin, may be important in regulating glycogen synthesis through phosphorylation/dephosphorylation mechanisms
Insight into Biochemical Characterization of Plant Sesquiterpene Synthases
DEFF Research Database (Denmark)
Manczak, Tom; Simonsen, Henrik Toft
2016-01-01
A fast and reproducible protocol was established for enzymatic characterization of plant sesquiterpene synthases that can incorporate radioactivity in their products. The method utilizes the 96-well format in conjunction with cluster tubes and enables processing of >200 samples a day. Along...... with reduced reagent usage, it allows further reduction in the use of radioactive isotopes and flammable organic solvents. The sesquiterpene synthases previously characterized were expressed in yeast, and the plant-derived Thapsia garganica kunzeaol synthase TgTPS2 was tested in this method. KM for TgTPS2...... was found to be 0.55 μM; the turnover number, kcat, was found to be 0.29 s-1, kcat for TgTPS2 is in agreement with that of terpene synthases of other plants, and kcat/KM was found to be 0.53 s-1 μM-1 for TgTPS2. The kinetic parameters were in agreement with previously published data....
Yang, Aiqing; Ren, Guofeng; Tang, Ling; Jiang, Weiwei
2009-03-01
To explore the inhibitive effect of soybean isoflavone on the prostatic hyperplasia on the expressions of nitric oxid and nitric oxide synthase in the prostatic hyperplasia rats. Subcutaneously injected testosterone propionate were to induce prostate hyperplasia in rats. The changes of prostate wet weight, prostatic index, liver index, the changes of some biochemical indexes in rat prostate tissue in the control and the treatment, the low, moderate, high dose groups of soybean isoflavone groups were observed. The prostate wet weight and prostatic index in all dose groups were merely lower than those in the treatment and the moderate groups were lowest in all dose group. There were no significant differences in liver index, urea nitrogen, glutamic-pyruvic transaminase of each group. Acid phosphatase, prostatic acid phosphatase and lactate dehydrogenase in all dose groups were merely lower than those in the treatment group. Nitric oxide and nitric oxide synthase in all dose groups were merely higher than those in the treatment group. Soybean isoflavone could inhibit prostate hyperplasia and increase the expressions of nitric oxide and nitric oxide synthase in rats.
Directory of Open Access Journals (Sweden)
Hyun Jo Koo
Full Text Available The essential oils of ginger (Zingiber officinale and turmeric (Curcuma longa contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+-germacrene D synthase and (S-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (--caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+-α-turmerone and (+-β-turmerone, are produced from (--α-zingiberene and (--β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase.
Suites of Terpene Synthases Explain Differential Terpenoid Production in Ginger and Turmeric Tissues
Koo, Hyun Jo; Gang, David R.
2012-01-01
The essential oils of ginger (Zingiber officinale) and turmeric (Curcuma longa) contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+)-germacrene D synthase and (S)-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet) rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (−)-caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+)-α-turmerone and (+)-β-turmerone, are produced from (−)-α-zingiberene and (−)-β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase. PMID:23272109
Costunolide inhibits proinflammatory cytokines and iNOS in activated murine BV2 microglia.
Rayan, Nirmala Arul; Baby, Nimmi; Pitchai, Daisy; Indraswari, Fransisca; Ling, Eng-Ang; Lu, Jia; Dheen, Thameem
2011-06-01
Costunolide, a sesquiterpene lactone present in Costus speciosus root exerts a variety of pharmacological activity but its effects on neuroinflammation have not been studied. Microglia, the resident phagocytic cells in the central nervous system respond to neuroinflammation and their overwhelming response in turn aggravate brain damage during infection, ischemia and neurodegenerative diseases. In this study, we report the effect of Costunolide on the production of proinflammatory mediators and mechanisms involved in BV2 microglial cells stimulated with LPS. Costunolide attenuated the expression of tumour necrosis factor-alpha, interleukin-1,6, inducible nitric oxide synthase, monocyte chemotactic protein 1 and cyclooxygenase 2 in activated microglia. This Costunolide-mediated inhibition was correspondent with the inhibition of NFkappaB activation. It has been further shown that Costunolide suppressed MAPK pathway activation by inducing MKP-1 production. Collectively our results suggest that Costunolide shows an ability to inhibit expression of multiple neuroinflammatory mediators and this is attributable to the compounds inhibition of NFkappaB and MAPK activation. This novel role of Costunolide upon investigation may aid in developing better therapeutic strategies for treatment of neuroinflammatory diseases.
Sousa, Sérgio B; Jenkins, Dagan; Chanudet, Estelle; Tasseva, Guergana; Ishida, Miho; Anderson, Glenn; Docker, James; Ryten, Mina; Sa, Joaquim; Saraiva, Jorge M; Barnicoat, Angela; Scott, Richard; Calder, Alistair; Wattanasirichaigoon, Duangrurdee; Chrzanowska, Krystyna; Simandlová, Martina; Van Maldergem, Lionel; Stanier, Philip; Beales, Philip L; Vance, Jean E; Moore, Gudrun E
2014-01-01
Lenz-Majewski syndrome (LMS) is a syndrome of intellectual disability and multiple congenital anomalies that features generalized craniotubular hyperostosis. By using whole-exome sequencing and selecting variants consistent with the predicted dominant de novo etiology of LMS, we identified causative heterozygous missense mutations in PTDSS1, which encodes phosphatidylserine synthase 1 (PSS1). PSS1 is one of two enzymes involved in the production of phosphatidylserine. Phosphatidylserine synthesis was increased in intact fibroblasts from affected individuals, and end-product inhibition of PSS1 by phosphatidylserine was markedly reduced. Therefore, these mutations cause a gain-of-function effect associated with regulatory dysfunction of PSS1. We have identified LMS as the first human disease, to our knowledge, caused by disrupted phosphatidylserine metabolism. Our results point to an unexplored link between phosphatidylserine synthesis and bone metabolism.
Phosphorylation of glyoxysomal malate synthase from castor oil seed endosperm and cucumber cotyledon
International Nuclear Information System (INIS)
Yang, Y.P; Randall, D.D.
1989-01-01
Glyoxysomal malate synthase (MS) was purified to apparent homogeneity from 3-d germinating castor oil seed endosperm by a relatively simple procedure including two sucrose density gradient centrifugations. Antibodies raised to the caster oil seed MS crossreacted with MS from cucumber cotyledon. MS was phosphorylated in both tissues in an MgATP dependent reaction. The phosphorylation pattern was similar for both enzymes and both enzymes were inhibited by NaF, NaMo, (NH 4 )SO 4 , glyoxylate and high concentration of MgCl 2 (60 mM), but was not inhibited by NaCl and malate. Further characterization of the phosphorylation of MS from castor oil seed endosperms showed that the 5S form of MS is the form which is labelled by 32 P. The addition of exogenous alkaline phosphatase to MS not only decreased enzyme activity, but could also dephosphorylate phospho-MS. The relationship between dephosphorylation of MS and the decrease of MS activity is currently under investigation
Directory of Open Access Journals (Sweden)
Mirian Perez Maluf
2009-01-01
Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.
Nitric Oxide Synthases Reveal a Role for Calmodulin in Controlling Electron Transfer
Abu-Soud, Husam M.; Stuehr, Dennis J.
1993-11-01
Nitric oxide (NO) is synthesized within the immune, vascular, and nervous systems, where it acts as a wide-ranging mediator of mammalian physiology. The NO synthases (EC 1.14.13.39) isolated from neurons or endothelium are calmodulin dependent. Calmodulin binds reversibly to neuronal NO synthase in response to elevated Ca2+, triggering its NO production by an unknown mechanism. Here we show that calmodulin binding allows NADPH-derived electrons to pass onto the heme group of neuronal NO synthase. Calmodulin-triggered electron transfer to heme was independent of substrate binding, caused rapid enzymatic oxidation of NADPH in the presence of O_2, and was required for NO synthesis. An NO synthase isolated from cytokine-induced macrophages that contains tightly bound calmodulin catalyzed spontaneous electron transfer to its heme, consistent with bound calmodulin also enabling electron transfer within this isoform. Together, these results provide a basis for how calmodulin may regulate NO synthesis. The ability of calmodulin to trigger electron transfer within an enzyme is unexpected and represents an additional function for calcium-binding proteins in biology.
Zwaferink, Heather; Stockinger, Silvia; Reipert, Siegfried; Decker, Thomas
2008-01-01
Murine macrophage death upon infection with Listeria monocytogenes was previously shown to be increased by beta interferon, produced by the infected cells. We saw that interferon-upregulated caspase activation or other interferon-inducible, death-associated proteins, including TRAIL, protein kinase R, and p53, were not necessary for cell death. Macrophage death was reduced when inducible nitric oxide synthase (iNOS) was inhibited during infection, and iNOS-deficient macrophages were less susc...
Directory of Open Access Journals (Sweden)
D. M. Djuric
1996-01-01
Full Text Available The possible involvement of different effector systems (nitric oxide synthase, guanylate cyclase, β-adrenergic and muscarinic cholinergic receptors, cyclooxygenase and lipoxygenase, and Na+,K+-ATPase was evaluated in a histamine H3 receptor agonist-induced ((Rα-methylhistamine, (Rα-MeHA endothelium-dependent rat aorta relaxation assay. (Rα-MeHA (0.1 nM – 0.01 mM relaxed endothelium-dependent rat aorta, with a pD2 value of 8.22 ± 0.06, compared with a pD2 value of 7.98 ± 0.02 caused by histamine (50% and 70% relaxation, respectively. The effect of (Rα-MeHA (0.1 nM – 0.01 mM was competitively antagonized by thioperamide (1, 10 and 30 nM (pA2 = 9.21 ± 0.40; slope = 1.03 ± 0.35 but it was unaffected by pyrilamine (100 nM, cimetidine (1 μM, atropine (10 μM, propranolol (1 μM, indomethacin (10 μM or nordthydroguaiaretic acid (0.1 mM. Inhibitors of nitric oxide synthase, L-NG-monomethylarginine (L-NMMA, 10 μM and NG-nitro-L-arginine methylester (L-NOARG, 10 μM inhibited the relaxation effect of (Rα-MeHA, by approximately 52% and 70%, respectively. This inhibitory effect of L-NMMA was partially reversed by L-arginine (10 μM. Methylene blue (10 μM and ouabain (10 μM inhibited relaxation (Rα-MeHA-induced by approximately 50% and 90%, respectively. The products of cyclooxygenase and lipoxygenase are not involved in (Rα-MeHA-induced endothelium-dependent rat aorta relaxation nor are the muscarinic cholinergic and β-adrenergic receptors. The results also suggest the involvement of NO synthase, guanylate cyclase and Na+,K+-ATPase in (Rα-MeHA-induced endothelium-dependent rat aorta relaxation.
Pharmacological modulation of human platelet leukotriene C4-synthase.
Sala, A; Folco, G; Henson, P M; Murphy, R C
1997-03-21
The aim of this study was to test if human platelet leukotriene C4-synthase (LTC4-S) is pharmacologically different from cloned and expressed LTC4-S and, in light of the significant homologies between 5-lipoxygenase activating protein (FLAP) and LTC4-S, if different potencies of leukotriene synthesis inhibitors acting through binding with FLAP (FLAP inhibitors) reflect in different potencies as LTC4-S inhibitors. Leukotriene C4 (LTC4) synthesis by washed human platelets supplemented with synthetic leukotriene A4 (LTA4) was studied in the absence and presence of two different, structurally unrelated FLAP inhibitors (MK-886 and BAY-X1005) as well as a direct 5-lipoxygenase inhibitor (zileuton). LTC4 production was analyzed by RP-HPLC coupled to diode array detection. We report that human platelet LTC4-S was inhibited by MK-886 and BAY-X1005 (IC50 of 4.7 microM and 91.2 microM, respectively), but not by zileuton (inactive up to 300 microM); all 3 compounds were able to inhibit 5-lipoxygenase metabolite biosynthesis in intact human polymorphonuclear leukocytes (IC50 of 0.044 microM, 0.85 microM, and 1.5 microM, respectively). Platelet LTC4-S does not appear pharmacologically different from expression cloned LTC4-S. LTC4-S inhibition by FLAP inhibitors is in agreement with the significant homology reported for expression-cloned LTC4-S with FLAP, Furthermore, functional homology of the binding sites for inhibitors on LTC4-S and FLAP is suggested by the conservation of the relative potencies of MK-886 and BAY-X1005 vs FLAP-dependent 5-lipoxygenase activity and LTC4-S inhibition: MK-886 was 19.3-fold more potent than BAY-X1005 as FLAP inhibitor and 19.6-fold more potent than BAY-X1005 as LTC4-S inhibitor.
Inhibition of melanogenesis by Xanthium strumarium L.
Li, Hailan; Min, Young Sil; Park, Kyoung-Chan; Kim, Dong-Seok
2012-01-01
Xanthium strumarium L. (Asteraceae) is traditionally used in Korea to treat skin diseases. In this study, we investigated the effects of a X. strumarium stem extract on melanin synthesis. It inhibited melanin synthesis in a concentration-dependent manner, but it did not directly inhibit tyrosinase, the rate-limiting melanogenic enzyme, and instead downregulated microphthalmia-associated transcription factor (MITF) and tyrosinase expression. MITF, the master regulator of pigmentation, is a target of the Wnt signaling pathway, which includes glycogen synthase kinase 3β (GSK3β) and β-catenin. Hence, the influence of X. strumarium stem extract on GSK3β and β-catenin was further investigated. X. strumarium induced GSK3β phosphorylation (inactivation), but the level of β-catenin did not change. Moreover, a specific GSK3β inhibitor restored X. strumarium-induced melanin reduction. Hence, we suggest that X. strumarium inhibits melanin synthesis through downregulation of tyrosinase via GSK3β phosphorylation.
Highly divergent mitochondrial ATP synthase complexes in Tetrahymena thermophila.
Directory of Open Access Journals (Sweden)
Praveen Balabaskaran Nina
2010-07-01
Full Text Available The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1 sector catalyzes ATP synthesis, whereas the F(o sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1 and F(o sectors are highly conserved across prokaryotes and eukaryotes. Therefore, it was a surprise that genes encoding the a and b subunits as well as other components of the F(o sector were undetectable in the sequenced genomes of a variety of apicomplexan parasites. While the parasitic existence of these organisms could explain the apparent incomplete nature of ATP synthase in Apicomplexa, genes for these essential components were absent even in Tetrahymena thermophila, a free-living ciliate belonging to a sister clade of Apicomplexa, which demonstrates robust oxidative phosphorylation. This observation raises the possibility that the entire clade of Alveolata may have invented novel means to operate ATP synthase complexes. To assess this remarkable possibility, we have carried out an investigation of the ATP synthase from T. thermophila. Blue native polyacrylamide gel electrophoresis (BN-PAGE revealed the ATP synthase to be present as a large complex. Structural study based on single particle electron microscopy analysis suggested the complex to be a dimer with several unique structures including an unusually large domain on the intermembrane side of the ATP synthase and novel domains flanking the c subunit rings. The two monomers were in a parallel configuration rather than the angled configuration previously observed in other organisms. Proteomic analyses of well-resolved ATP synthase complexes from 2-D BN/BN-PAGE identified orthologs of seven canonical ATP synthase subunits, and at least 13 novel proteins that constitute subunits apparently limited to the ciliate lineage. A mitochondrially encoded protein, Ymf66, with predicted eight transmembrane domains could be a
Directory of Open Access Journals (Sweden)
Jae Woong Lee
2007-01-01
Full Text Available Inflexinol, an ent-kaurane diterpenoid, was isolated from the leaves of Isodon excisus. Many diterpenoids isolated from the genus Isodon (Labiatae have antitumor and antiinflammatory activities. We investigated the antiinflammatory effect of inflexinol in RAW 264.7 cells and astrocytes. As a result, we found that inflexinol (1, 5, 10 μM suppressed the expression of inducible nitric oxide synthase (iNOS and cyclooxygenase-2 (COX-2 as well as the production of nitric oxide (NO in LPS-stimulated RAW 264.7 cells and astrocytes. Consistent with the inhibitory effect on iNOS and COX-2 expression, inflexinol also inhibited transcriptional and DNA binding activity of NF-κB via inhibition of IκB degradation as well as p50 and p65 translocation into nucleus. These results suggest that inflexinol inhibits iNOS and COX-2 expression through inhibition of NF-κB activation, thereby inhibits generation of inflammatory mediators in RAW 264.7 cells and astrocytes, and may be useful for treatment of inflammatory diseases.
International Nuclear Information System (INIS)
Petri, Marcelo H.; Tellier, Céline; Michiels, Carine; Ellertsen, Ingvill; Dogné, Jean-Michel; Bäck, Magnus
2013-01-01
Highlights: •EV-077 reduced TNF-α induced inflammation in endothelial cells. •The thromboxane mimetic U69915 enhanced vascular smooth muscle cell proliferation. •EV-077 inhibited smooth muscle cell proliferation. -- Abstract: The prothrombotic mediator thromboxane A 2 is derived from arachidonic acid metabolism through the cyclooxygenase and thromboxane synthase pathways, and transduces its effect through the thromboxane prostanoid (TP) receptor. The aim of this study was to determine the effect of the TP receptor antagonist and thromboxane synthase inhibitor EV-077 on inflammatory markers in human umbilical vein endothelial cells and on human coronary artery smooth muscle cell proliferation. To this end, mRNA levels of different proinflammatory mediators were studied by real time quantitative PCR, supernatants were analyzed by enzyme immune assay, and cell proliferation was assessed using WST-1. EV-077 significantly decreased mRNA levels of ICAM-1 and PTX3 after TNFα incubation, whereas concentrations of 6-keto PGF1α in supernatants of endothelial cells incubated with TNFα were significantly increased after EV-077 treatment. Although U46619 did not alter coronary artery smooth muscle cell proliferation, this thromboxane mimetic enhanced the proliferation induced by serum, insulin and growth factors, which was significantly inhibited by EV-077. In conclusion, EV-077 inhibited TNFα-induced endothelial inflammation and reduced the enhancement of smooth muscle cell proliferation induced by a thromboxane mimetic, supporting that the thromboxane pathway may be associated with early atherosclerosis in terms of endothelial dysfunction and vascular hypertrophy
Energy Technology Data Exchange (ETDEWEB)
Petri, Marcelo H. [Department of Medicine, Karolinska Institutet and Center for Molecular Medicine, Karolinska University Hospital, Stockholm (Sweden); Tellier, Céline; Michiels, Carine [NARILIS, URBC, University of Namur, Namur (Belgium); Ellertsen, Ingvill [Department of Medicine, Karolinska Institutet and Center for Molecular Medicine, Karolinska University Hospital, Stockholm (Sweden); Dogné, Jean-Michel [Department of Pharmacy, Namur Thrombosis and Hemostasis Center, University of Namur, Namur (Belgium); Bäck, Magnus, E-mail: Magnus.Back@ki.se [Department of Medicine, Karolinska Institutet and Center for Molecular Medicine, Karolinska University Hospital, Stockholm (Sweden)
2013-11-15
Highlights: •EV-077 reduced TNF-α induced inflammation in endothelial cells. •The thromboxane mimetic U69915 enhanced vascular smooth muscle cell proliferation. •EV-077 inhibited smooth muscle cell proliferation. -- Abstract: The prothrombotic mediator thromboxane A{sub 2} is derived from arachidonic acid metabolism through the cyclooxygenase and thromboxane synthase pathways, and transduces its effect through the thromboxane prostanoid (TP) receptor. The aim of this study was to determine the effect of the TP receptor antagonist and thromboxane synthase inhibitor EV-077 on inflammatory markers in human umbilical vein endothelial cells and on human coronary artery smooth muscle cell proliferation. To this end, mRNA levels of different proinflammatory mediators were studied by real time quantitative PCR, supernatants were analyzed by enzyme immune assay, and cell proliferation was assessed using WST-1. EV-077 significantly decreased mRNA levels of ICAM-1 and PTX3 after TNFα incubation, whereas concentrations of 6-keto PGF1α in supernatants of endothelial cells incubated with TNFα were significantly increased after EV-077 treatment. Although U46619 did not alter coronary artery smooth muscle cell proliferation, this thromboxane mimetic enhanced the proliferation induced by serum, insulin and growth factors, which was significantly inhibited by EV-077. In conclusion, EV-077 inhibited TNFα-induced endothelial inflammation and reduced the enhancement of smooth muscle cell proliferation induced by a thromboxane mimetic, supporting that the thromboxane pathway may be associated with early atherosclerosis in terms of endothelial dysfunction and vascular hypertrophy.
Yang, Surong; Chen, Changrui; Li, Yiying; Ren, Zhenghua; Zhang, Yungang; Wu, Gantong; Wang, Hao; Hu, Zhenzhen; Yao, Minghui
2013-06-01
To evaluate whether saw palmetto extract (SPE) relaxes corpus cavernosum and explore the underlying mechanisms. Forty Sprague-Dawley rats and 30 New Zealand rabbits were randomly allocated into 3 SPE-treated groups (low-, middle-, and high-dose) and 1 saline-treated control group. SPE was administered intragastrically for 7 consecutive days. Another 23 rats treated with sildenafil were used to appraise the erectile response to electrical stimulation of nerves in the corpus cavernosum. The erectile functions of rats and rabbits were evaluated 24 hours after the last SPE administration or 15 minutes after intragastric sildenafil. Outcome measures included corpus cavernosum electrical activity recording, phosphodiesterase 5 (PDE5) activity detected by the colorimetric quantitative method, and messenger ribonucleic acid (mRNA) expression level for PDE5 and inducible nitric oxide synthase (iNOS) determined using real-time polymerase chain reaction. In the SPE-treated animals, the relaxant response to electrical stimulation of nerves in the corpus cavernosum, reflected by the amplitude of the electrical activity within the cavernosum, was significantly and dose-dependently augmented. Similar effects were observed in the sildenafil-treated rats. PDE5 activity in rat and rabbit corpus cavernosum tissues was significantly and dose-dependently inhibited in SPE-treated animals, whereas the iNOS mRNA level increased compared with the saline group. PDE5 mRNA, however, was only significantly enhanced in the rats treated with the middle dose of SPE. The results suggest that SPE may have potential application value for the prevention or treatment of erectile dysfunction through an increase in iNOS mRNA expression and inhibition of PDE5 activity in corpus cavernosum smooth muscles. Copyright © 2013 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Huang, T.-Y.; Chu, H.-C.; Lin, Y.-L.; Lin, C.-K.; Hsieh, T.-Y.; Chang, W.-K.; Chao, Y.-C.; Liao, C.-L.
2009-01-01
In addition to its antimicrobial activity, minocycline exerts anti-inflammatory effects in several disease models. However, whether minocycline affects the pathogenesis of inflammatory bowel disease has not been determined. We investigated the effects of minocycline on experimental colitis and its underlying mechanisms. Acute and chronic colitis were induced in mice by treatment with dextran sulfate sodium (DSS) or trinitrobenzene sulfonic acid (TNBS), and the effect of minocycline on colonic injury was assessed clinically and histologically. Prophylactic and therapeutic treatment of mice with minocycline significantly diminished mortality rate and attenuated the severity of DSS-induced acute colitis. Mechanistically, minocycline administration suppressed inducible nitric oxide synthase (iNOS) expression and nitrotyrosine production, inhibited proinflammatory cytokine expression, repressed the elevated mRNA expression of matrix metalloproteinases (MMPs) 2, 3, 9, and 13, diminished the apoptotic index in colonic tissues, and inhibited nitric oxide production in the serum of mice with DSS-induced acute colitis. In DSS-induced chronic colitis, minocycline treatment also reduced body weight loss, improved colonic histology, and blocked expression of iNOS, proinflammatory cytokines, and MMPs from colonic tissues. Similarly, minocycline could ameliorate the severity of TNBS-induced acute colitis in mice by decreasing mortality rate and inhibiting proinflammatory cytokine expression in colonic tissues. These results demonstrate that minocycline protects mice against DSS- and TNBS-induced colitis, probably via inhibition of iNOS and MMP expression in intestinal tissues. Therefore, minocycline is a potential remedy for human inflammatory bowel diseases.
Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1996-01-01
The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...
Corn silk induces nitric oxide synthase in murine macrophages.
Kim, Kyung A; Choi, Sang Kyu; Choi, Hye Seon
2004-12-31
Corn silk has been purified as an anticoagulant previously and the active component is a polysaccharide with a molecular mass of 135 kDa. It activates murine macrophages to induce nitric oxide synthase (NOS) and generate substantial amounts of NO in time and dose-dependent manners. It was detectable first at 15 h after stimulation by corn silk, peaked at 24 h, and undetectable by 48 h. Induction of NOS is inhibited by pyrolidine dithiocarbamate (PDTC) and genistein, an inhibitor of nuclear factor kappa B (NF-kappaB) and tyrosine kinase, respectively, indicating that iNOS stimulated by corn silk is associated with tyrosine kinase and NF-kappaB signaling pathways. IkappaB-alpha degradation was detectible at 10 min, and the level was restored at 120 min after treatment of corn silk. Corn silk induced nuclear translocation of NF-kappaB by phosphorylation and degradation of IkappaB-alpha.
Multi-substrate terpene synthases: their occurrence and physiological significance
Directory of Open Access Journals (Sweden)
Leila Pazouki
2016-07-01
Full Text Available Terpene synthases are responsible for synthesis of a large number of terpenes in plants using substrates provided by two distinct metabolic pathways, the mevalonate-dependent pathway that is located in cytosol and has been suggested to be responsible for synthesis of sesquiterpenes (C15, and 2-C-methyl-D-erythritol-4-phosphate pathway located in plastids and suggested to be responsible for the synthesis of hemi- (C5, mono- (C10 and diterpenes (C20. Recent advances in characterization of genes and enzymes responsible for substrate and end product biosynthesis as well as efforts in metabolic engineering have demonstrated existence of a number of multi-substrate terpene synthases. This review summarizes the progress in the characterization of such multi-substrate terpene synthases and suggests that the presence of multi-substrate use might have been significantly underestimated. Multi-substrate use could lead to important changes in terpene product profiles upon substrate profile changes under perturbation of metabolism in stressed plants as well as under certain developmental stages. We therefore argue that multi-substrate use can be significant under physiological conditions and can result in complicate modifications in terpene profiles.
Dynamics of meso and thermo citrate synthases with implicit solvation
Cordeiro, J. M. M.
The dynamics of hydration of meso and thermo citrate synthases has been investigated using the EEF1 methodology implemented with the CHARMM program. The native enzymes are composed of two identical subunits, each divided into a small and large domain. The dynamics behavior of both enzymes at 30°C and 60°C has been compared. The results of simulations show that during the hydration process, each subunit follows a different pathway of hydration, in spite of the identical sequence. The hydrated structures were compared with the crystalline structure, and the root mean square deviation (RMSD) of each residue along the trajectory was calculated. The regions with larger and smaller mobility were identified. In particular, helices belonging to the small domain are more mobile than those of the large domain. In contrast, the residues that constitute the active site show a much lower displacement compared with the crystalline structure. Hydration free energy calculations point out that Thermoplasma acidophilum citrate synthase (TCS) is more stable than chicken citrate synthase (CCS), at high temperatures. Such result has been ascribed to the higher number of superficial charges in the thermophilic homologue, which stabilizes the enzyme, while the mesophilic homologue denatures. These results are in accord with the experimental found that TCS keeps activity at temperatures farther apart from the catalysis regular temperature than the CCS.
Monoterpene synthase from Dracocephalum kotschyi and SPME-GC-MS analysis of its aroma profile
Directory of Open Access Journals (Sweden)
S. Saeidnia
2014-04-01
Full Text Available Dracocephalum kotschyi (Lamiaceae, as one of the remarkable aromatic plants, widely grows and also is cultivated in various temperate regions of Iran. There are diverse reports about the composition of the oil of this plant representing limonene derivatives as its major compounds. There is no report on cloning of mono- or sesquiterpene synthases from this plant. In the present study, the aroma profile of D. kotschyi has been extracted and analyzed via Headspace Solid-Phase Microextraction technique coupled with Gas Chromatography- Mass Spectroscopy. In order to determine the sequence of the active terpene synthase in this plant, first mRNA was prepared and cloning was performed by 3’ and 5’-RACEs-PCR method, then cDNA was sequenced and finally aligned with other recognized terpene synthases. The results showed that the plant leaves mainly comprised geranial (37.2%, limonene-10-al (28.5%, limonene (20.1% and 1,1-dimethoxy decane (14.5%. Sequencing the cDNA cloned from this plant revealed the presence of a monoterpene synthase absolutely similar to limonene synthase, responsible in formation of limonene, terpinolene, camphene and some other cyclic monoterpenes in its young leaves.
Fatty Acid Biosynthesis Inhibition Increases Reduction Potential in Neuronal Cells under Hypoxia
Directory of Open Access Journals (Sweden)
Stephen A Brose
2016-11-01
Full Text Available Recently, we have reported a novel neuronal specific pathway for adaptation to hypoxia through increased fatty acid (FA biosynthesis (FAS followed by esterification into lipids. However, the biological role of this pathway under hypoxia remains to be elucidated. In the presented study, we have tested our hypothesis that activation of FAS maintains reduction potential and reduces lactoacidosis in neuronal cells under hypoxia. To address this hypothesis, we measured the effect of FAS inhibition on NADH2+/NAD+ and NADPH2+/NADP+ ratios, and lactic acid levels in neuronal SH-SY5Y cells exposed to normoxic and hypoxic conditions. FAS inhibitors, TOFA (inhibits Acetyl-CoA carboxylase and cerulenin (inhibits FA synthase, increased NADH2+/NAD+ and NADPH2+/NADP+ ratios under hypoxia. Further, FAS inhibition increased lactic acid under both normoxic and hypoxic conditions, and caused cytotoxicity under hypoxia but not normoxia. These results indicate that FA may serve as hydrogen acceptors under hypoxia, thus supporting oxidation reactions including anaerobic glycolysis. These findings may help to identify a radically different approach to attenuate hypoxia related pathophysiology in the nervous system including stroke.
Fatty Acid Biosynthesis Inhibition Increases Reduction Potential in Neuronal Cells under Hypoxia.
Brose, Stephen A; Golovko, Svetlana A; Golovko, Mikhail Y
2016-01-01
Recently, we have reported a novel neuronal specific pathway for adaptation to hypoxia through increased fatty acid (FA) biosynthesis followed by esterification into lipids. However, the biological role of this pathway under hypoxia remains to be elucidated. In the presented study, we have tested our hypothesis that activation of FA synthesis maintains reduction potential and reduces lactoacidosis in neuronal cells under hypoxia. To address this hypothesis, we measured the effect of FA synthesis inhibition on [Formula: see text]/NAD + and [Formula: see text]/NADP + ratios, and lactic acid levels in neuronal SH-SY5Y cells exposed to normoxic and hypoxic conditions. FA synthesis inhibitors, TOFA (inhibits Acetyl-CoA carboxylase) and cerulenin (inhibits FA synthase), increased [Formula: see text]/NAD + and [Formula: see text]/NADP + ratios under hypoxia. Further, FA synthesis inhibition increased lactic acid under both normoxic and hypoxic conditions, and caused cytotoxicity under hypoxia but not normoxia. These results indicate that FA may serve as hydrogen acceptors under hypoxia, thus supporting oxidation reactions including anaerobic glycolysis. These findings may help to identify a radically different approach to attenuate hypoxia related pathophysiology in the nervous system including stroke.
Sequence analysis of cereal sucrose synthase genes and isolation ...
African Journals Online (AJOL)
SERVER
2007-10-18
Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.
Zhou, Haoming; Wang, Han; Ni, Ming; Yue, Shi; Xia, Yongxiang; Busuttil, Ronald W; Kupiec-Weglinski, Jerzy W; Lu, Ling; Wang, Xuehao; Zhai, Yuan
2018-02-13
Glycogen synthase kinase 3β (Gsk3β [Gsk3b]) is a ubiquitously expressed kinase with distinctive functions in different types of cells. Although its roles in regulating innate immune activation and ischaemia and reperfusion injuries (IRIs) have been well documented, the underlying mechanisms remain ambiguous, in part because of the lack of cell-specific tools in vivo. We created a myeloid-specific Gsk3b knockout (KO) strain to study the function of Gsk3β in macrophages in a murine liver partial warm ischaemia model. Compared with controls, myeloid Gsk3b KO mice were protected from IRI, with diminished proinflammatory but enhanced anti-inflammatory immune responses in livers. In bone marrow-derived macrophages, Gsk3β deficiency resulted in an early reduction of Tnf gene transcription but sustained increase of Il10 gene transcription on Toll-like receptor 4 stimulation in vitro. These effects were associated with enhanced AMP-activated protein kinase (AMPK) activation, which led to an accelerated and higher level of induction of the novel innate immune negative regulator small heterodimer partner (SHP [Nr0b2]). The regulatory function of Gsk3β on AMPK activation and SHP induction was confirmed in wild-type bone marrow-derived macrophages with a Gsk3 inhibitor. Furthermore, we found that this immune regulatory mechanism was independent of Gsk3β Ser9 phosphorylation and the phosphoinositide 3-kinase-Akt signalling pathway. In vivo, myeloid Gsk3β deficiency facilitated SHP upregulation by ischaemia-reperfusion in liver macrophages. Treatment of Gsk3b KO mice with either AMPK inhibitor or SHP small interfering RNA before the onset of liver ischaemia restored liver proinflammatory immune activation and IRI in these otherwise protected hosts. Additionally, pharmacological activation of AMPK protected wild-type mice from liver IRI, with reduced proinflammatory immune activation. Inhibition of the AMPK-SHP pathway by liver ischaemia was demonstrated in tumour resection
Localization of nitric oxide synthase in human skeletal muscle
DEFF Research Database (Denmark)
Frandsen, Ulrik; Lopez-Figueroa, M.; Hellsten, Ylva
1996-01-01
The present study investigated the cellular localization of the neuronal type I and endothelial type III nitric oxide synthase in human skeletal muscle. Type I NO synthase immunoreactivity was found in the sarcolemma and the cytoplasm of all muscle fibres. Stronger immunoreactivity was expressed...
International Nuclear Information System (INIS)
Nakanishi-Matsui, Mayumi; Kashiwagi, Sachiko; Kojima, Masaki; Nonaka, Takamasa; Futai, Masamitsu
2010-01-01
The ATP synthase β subunit hinge domain (βPhe148 ∼ βGly186, P-loop/α-helixB/loop/β-sheet4, Escherichia coli residue numbering) dramatically changes in conformation upon nucleotide binding. We previously reported that F 1 with the βSer174 to Phe mutation in the domain lowered the γ subunit rotation speed, and thus decreased the ATPase activity [M. Nakanishi-Matsui, S. Kashiwagi, T. Ubukata, A. Iwamoto-Kihara, Y. Wada, M. Futai, Rotational catalysis of Escherichia coli ATP synthase F 1 sector. Stochastic fluctuation and a key domain of the β subunit, J. Biol. Chem. 282 (2007) 20698-20704.]. Homology modeling indicates that the amino acid replacement induces a hydrophobic network, in which the βMet159, βIle163, and βAla167 residues of the β subunit are involved together with the mutant βPhe174. The network is expected to stabilize the conformation of β DP (nucleotide-bound form of the β subunit), resulting in increased activation energy for transition to β E (empty β subunit). The modeling further predicts that replacement of βMet159 with Ala or Ile weakens the hydrophobic network. As expected, these two mutations experimentally suppressed the ATPase activities as well as subunit rotation of βS174F. Furthermore, the rotation rate decreased with the increase of the strength in the hydrophobic network. These results indicate that the smooth conformational change of the β subunit hinge domain is pertinent for the rotational catalysis.
Gradual remapping results in early retinotopic and late spatiotopic inhibition of return.
Mathôt, S.; Theeuwes, J.
2010-01-01
Here we report that immediately following the execution of an eye movement, oculomotor inhibition of return resides in retinotopic (eye-centered) coordinates. At longer postsaccadic intervals, inhibition resides in spatiotopic (world-centered) coordinates. These results are explained in terms of
Sucrose Phosphate Synthase and Sucrose Accumulation at Low Temperature 1
Guy, Charles L.; Huber, Joan L. A.; Huber, Steven C.
1992-01-01
The influence of growth temperature on the free sugar and sucrose phosphate synthase content and activity of spinach (Spinacia oleracea) leaf tissue was studied. When plants were grown at 25°C for 3 weeks and then transferred to a constant 5°C, sucrose, glucose, and fructose accumulated to high levels during a 14-d period. Predawn sugar levels increased from 14- to 20-fold over the levels present at the outset of the low-temperature treatment. Sucrose was the most abundant free sugar before, during, and after exposure to 5°C. Leaf sucrose phosphate synthase activity was significantly increased by the low-temperature treatment, whereas sucrose synthase and invertases were not. Synthesis of the sucrose phosphate synthase subunit was increased during and after low-temperature exposure and paralleled an increase in the steady-state level of the subunit. The increases in sucrose and its primary biosynthetic enzyme, sucrose phosphate synthase, are discussed in relation to adjustment of metabolism to low nonfreezing temperature and freezing stress tolerance. Images Figure 1 Figure 2 Figure 3 PMID:16652990
Directory of Open Access Journals (Sweden)
Janny A Villa-Pulgarín
2017-08-01
Full Text Available Leishmaniasis is the world's second deadliest parasitic disease after malaria, and current treatment of the different forms of this disease is far from satisfactory. Alkylphospholipid analogs (APLs are a family of anticancer drugs that show antileishmanial activity, including the first oral drug (miltefosine for leishmaniasis and drugs in preclinical/clinical oncology trials, but their precise mechanism of action remains to be elucidated.Here we show that the tumor cell apoptosis-inducer edelfosine was the most effective APL, as compared to miltefosine, perifosine and erucylphosphocholine, in killing Leishmania spp. promastigotes and amastigotes as well as tumor cells, as assessed by DNA breakdown determined by flow cytometry. In studies using animal models, we found that orally-administered edelfosine showed a potent in vivo antileishmanial activity and diminished macrophage pro-inflammatory responses. Edelfosine was also able to kill Leishmania axenic amastigotes. Edelfosine was taken up by host macrophages and killed intracellular Leishmania amastigotes in infected macrophages. Edelfosine accumulated in tumor cell mitochondria and Leishmania kinetoplast-mitochondrion, and led to mitochondrial transmembrane potential disruption, and to the successive breakdown of parasite mitochondrial and nuclear DNA. Ectopic expression of Bcl-XL inhibited edelfosine-induced cell death in both Leishmania parasites and tumor cells. We found that the cytotoxic activity of edelfosine against Leishmania parasites and tumor cells was associated with a dramatic recruitment of FOF1-ATP synthase into lipid rafts following edelfosine treatment in both parasites and cancer cells. Raft disruption and specific FOF1-ATP synthase inhibition hindered edelfosine-induced cell death in both Leishmania parasites and tumor cells. Genetic deletion of FOF1-ATP synthase led to edelfosine drug resistance in Saccharomyces cerevisiae yeast.The present study shows that the
SEPAROVIC, DUSKA; BREEN, PAUL; BOPPANA, NITHIN B.; VAN BUREN, ERIC; JOSEPH, NICHOLAS; KRAVEKA, JACQUELINE M.; RAHMANIYAN, MEHRDAD; LI, LI; GUDZ, TATYANA I.; BIELAWSKA, ALICJA; BAI, AIPING; BIELAWSKI, JACEK; PIERCE, JASON S.; KORBELIK, MLADEN
2013-01-01
Photodynamic therapy (PDT) is not always effective as an anticancer treatment, therefore, PDT is combined with other anticancer agents for improved efficacy. The combination of dasatinib and PDT with the silicone phthalocyanine photosensitizer Pc 4 was assessed for increased killing of SCCVII mouse squamous cell carcinoma cells, a preclinical model of head and neck squamous cell carcinoma, using apoptotic markers and colony formation as experimental end-points. Because each of these treatments regulates the metabolism of the sphingolipid ceramide, their effects on mRNA levels of ceramide synthase, a ceramide-producing enzyme, and the sphingolipid profile were determined. PDT + dasatinib induced an additive loss of clonogenicity. Unlike PDT alone or PDT + dasatinib, dasatinib induced zVAD-fmk-dependent cell killing. PDT or dasatinib-induced caspase-3 activation was potentiated after the combination. PDT alone induced mitochondrial depolarization, and the effect was inhibited after the combination. Annexin V+ and propidium iodide+ cells remained at control levels after treatments. In contrast to PDT alone, dasatinib induced upregulation of ceramide synthase 1 mRNA, and the effect was enhanced after the combination. Dasatinib induced a modest increase in C20:1-and C22-ceramide but had no effect on total ceramide levels. PDT increased the levels of 12 individual ceramides and total ceramides, and the addition of dasatinib did not affect these increases. PDT alone decreased substantially sphingosine levels and inhibited the activity of acid ceramidase, an enzyme that converts ceramide to sphingosine. The data suggest that PDT-induced increases in ceramide levels do not correlate with ceramide synthase mRNA levels but rather with inhibition of ceramidase. Cell killing was zVAD-fmk-sensitive after dasatinib but not after either PDT or the combination and enhanced cell killing after the combination correlated with potentiated caspase-3 activation and upregulation of
Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B
2015-01-01
A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.
Aberrant glycogen synthase kinase 3β in the development of pancreatic cancer
Directory of Open Access Journals (Sweden)
Takeo Shimasaki
2012-01-01
Full Text Available Development and progression of pancreatic cancer involves general metabolic disorder, local chronic inflammation, and multistep activation of distinct oncogenic molecular pathways. These pathologic processes result in a highly invasive and metastatic tumor phenotype that is a major obstacle to curative surgical intervention, infusional gemcitabine-based chemotherapy, and radiation therapy. Many clinical trials with chemical compounds and therapeutic antibodies targeting growth factors, angiogenic factors, and matrix metalloproteinases have failed to demonstrate definitive therapeutic benefits to refractory pancreatic cancer patients. Glycogen synthase kinase 3β (GSK3β, a serine/threonine protein kinase, has emerged as a therapeutic target in common chronic and progressive diseases, including cancer. Here we review accumulating evidence for a pathologic role of GSK3β in promoting tumor cell survival, proliferation, invasion, and resistance to chemotherapy and radiation in pancreatic cancer. We also discuss the putative involvement of GSK3β in mediating metabolic disorder, local inflammation, and molecular alteration leading to pancreatic cancer development. Taken together, we highlight potential therapeutic as well as preventive effects of GSK3β inhibition in pancreatic cancer.
Directory of Open Access Journals (Sweden)
Janina Sprenger
Full Text Available The aminopropyltransferase spermidine synthase (SpdS is a promising drug target in cancer and in protozoan diseases including malaria. Plasmodium falciparum SpdS (PfSpdS transfers the aminopropyl group of decarboxylated S-adenosylmethionine (dcAdoMet to putrescine or to spermidine to form spermidine or spermine, respectively. In an effort to understand why efficient inhibitors of PfSpdS have been elusive, the present study uses enzyme activity assays and isothermal titration calorimetry with verified or predicted inhibitors of PfSpdS to analyze the relationship between binding affinity as assessed by KD and inhibitory activity as assessed by IC50. The results show that some predicted inhibitors bind to the enzyme with high affinity but are poor inhibitors. Binding studies with PfSpdS substrates and products strongly support an ordered sequential mechanism in which the aminopropyl donor (dcAdoMet site must be occupied before the aminopropyl acceptor (putrescine site can be occupied. Analysis of the results also shows that the ordered sequential mechanism adequately accounts for the complex relationship between IC50 and KD and may explain the limited success of previous efforts at structure-based inhibitor design for PfSpdS. Based on PfSpdS active-site occupancy, we suggest a classification of ligands that can help to predict the KD-IC50 relations in future design of new inhibitors. The present findings may be relevant for other drug targets that follow an ordered sequential mechanism.
Directory of Open Access Journals (Sweden)
Tomishima Yoshiro
2013-01-01
Full Text Available Abstract Background Overdosed acetaminophen (paracetamol, N-acetyl-p-aminophenol; APAP causes severe liver injury. We examined the effects of ozagrel, a selective thromboxane A2 (TXA2 synthase inhibitor, on liver injury induced by APAP overdose in mice. Methods Hepatotoxicity was induced to ICR male mice by an intraperitoneal injection with APAP (330 mg/kg. The effects of ozagrel (200 mg/kg treatment 30 min after the APAP injection were evaluated with mortality, serum alanine aminotransferase (ALT levels and hepatic changes, including histopathology, DNA fragmentation, mRNA expression and total glutathione contents. The impact of ozagrel (0.001-1 mg/mL on cytochrome P450 2E1 (CYP2E1 activity in mouse hepatic microsome was examined. RLC-16 cells, a rat hepatocytes cell line, were exposed to 0.25 mM N-acetyl-p-benzoquinone imine (NAPQI, a hepatotoxic metabolite of APAP. In this model, the cytoprotective effects of ozagrel (1–100 muM were evaluated by the WST-1 cell viability assay. Results Ozagel treatment significantly attenuated higher mortality, elevated serum alanine aminotransferase levels, excessive hepatic centrilobular necrosis, hemorrhaging and DNA fragmentation, as well as increase in plasma 2,3-dinor thromboxane B2 levels induced by APAP injection. Ozagrel also inhibited the hepatic expression of cell death-related mRNAs induced by APAP, such as jun oncogene, FBJ osteosarcoma oncogene (fos and C/EBP homologous protein (chop, but did not suppress B-cell lymphoma 2-like protein11 (bim expression and hepatic total glutathione depletion. These results show ozagrel can inhibit not all hepatic changes but can reduce the hepatic necrosis. Ozagrel had little impact on CYP2E1 activity involving the NAPQI production. In addition, ozagrel significantly attenuated cell injury induced by NAPQI in RLC-16. Conclusions We demonstrate that the TXA2 synthase inhibitor, ozagrel, dramatically alleviates liver injury induced by APAP in mice, and suggest
Kiss, A; Jurkovicova, D; Jezova, D; Krizanova, O
2001-06-01
To study functional interactions between angiotensin II AT1 receptors and nitric oxide (NO) activity in different brain areas in rats exposed to immobilization stress. Central inhibition of nitric oxide synthase (NOS) was provided by intracerebroventricular (i.c.v.) administration of (N-omega-nitro-L-arginine-methylester) L-NAME and analysis of AT1 receptor mRNA was performed using semiquantitative reverse transcription-polymerase chain reaction (RT-PCR) technique. The immobilization in prone position lasted 2 hrs and the rats were sacrificed 24 hr later. The hypothalamus, hippocampus, thalamus, and cortex were isolated from fresh brains. In the cortex, gene expression of AT1 receptors was unaffected either by L-NAME treatment, or by a single exposure to immobilization stress for 2 hours followed by 24 hours of rest. In the hippocampus, the repeated treatment with L-NAME increased mRNA levels of AT1 receptors approximately 9-times compared to those in the control (untreated) group. Immobilization also increased AT1 receptor mRNA levels in the hippocampus which was similar to that induced by the L-NAME. The increase of AT1 receptor mRNA levels in the hippocampus of immobilized rats was not further altered when the animals were pretreated with L-NAME. In control rats, exposure to immobilization resulted in a significant rise in mRNA levels coding for AT1 receptors in the hypothalamus, but not in the thalamus. L-NAME treatment showed a tendency of increase in AT1 receptor mRNA levels in the hypothalamus. Moreover, when animals treated with L-NAME were subjected to immobilization, a further increase in AT1 receptor mRNA levels was observed in the hypothalamus in comparison with corresponding controls. The present data indicate that a single immobilization stress results in increased gene expression of AT1 receptors in the hypothalamus and hippocampus. The rise in AT1 mRNA levels in the same brain structures after repeated treatment with L-NAME allow to suggest an
Inhibitors of Fatty Acid Synthase for Prostate Cancer
2012-05-01
compounds. For example, numerous classes of acetyl- cholinesterase inhibitors have been developed, m any with fe mtomolar binding affinities (7). This...AD_________________ Award Number: W81XWH-09-1-0204 TITLE: Inhibitors of Fatty Acid Synthase for...CONTRACT NUMBER Inhibitors of Fatty Acid Synthase for Prostate Cancer 5b. GRANT NUMBER W81XWH-09-1-0204 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR
Shaw, Jeffrey J.; Berbasova, Tetyana; Sasaki, Tomoaki; Jefferson-George, Kyra; Spakowicz, Daniel J.; Dunican, Brian F.; Portero, Carolina E.; Narváez-Trujillo, Alexandra; Strobel, Scott A.
2015-01-01
Terpenes are an important and diverse class of secondary metabolites widely produced by fungi. Volatile compound screening of a fungal endophyte collection revealed a number of isolates in the family Xylariaceae, producing a series of terpene molecules, including 1,8-cineole. This compound is a commercially important component of eucalyptus oil used in pharmaceutical applications and has been explored as a potential biofuel additive. The genes that produce terpene molecules, such as 1,8-cineole, have been little explored in fungi, providing an opportunity to explore the biosynthetic origin of these compounds. Through genome sequencing of cineole-producing isolate E7406B, we were able to identify 11 new terpene synthase genes. Expressing a subset of these genes in Escherichia coli allowed identification of the hyp3 gene, responsible for 1,8-cineole biosynthesis, the first monoterpene synthase discovered in fungi. In a striking example of convergent evolution, mutational analysis of this terpene synthase revealed an active site asparagine critical for water capture and specificity during cineole synthesis, the same mechanism used in an unrelated plant homologue. These studies have provided insight into the evolutionary relationship of fungal terpene synthases to those in plants and bacteria and further established fungi as a relatively untapped source of this important and diverse class of compounds. PMID:25648891
Glyphosate inhibits rust diseases in glyphosate-resistant wheat and soybean
Feng, Paul C. C.; Baley, G. James; Clinton, William P.; Bunkers, Greg J.; Alibhai, Murtaza F.; Paulitz, Timothy C.; Kidwell, Kimberlee K.
2005-01-01
Glyphosate is a broad-spectrum herbicide used for the control of weeds in glyphosate-resistant crops. Glyphosate inhibits 5-enolpyruvyl shikimate 3-phosphate synthase, a key enzyme in the synthesis of aromatic amino acids in plants, fungi, and bacteria. Studies with glyphosate-resistant wheat have shown that glyphosate provided both preventive and curative activities against Puccinia striiformis f. sp. tritici and Puccinia triticina, which cause stripe and leaf rusts, respectively, in wheat. ...
Energy Technology Data Exchange (ETDEWEB)
Kawazoe, Hisashi; Bilim, Vladimir N. [Laboratory of Molecular Oncology, Department of Urology, Yamagata University School of Medicine, Iida-nishi 2-2-2, Yamagata 990-9585 (Japan); Ugolkov, Andrey V., E-mail: ugolkov@northwestern.edu [Tumor Biology Core, Center for Developmental Therapeutics, Chemistry of Life Processes Institute, Silverman Hall B733, Northwestern University, Evanston, IL (United States); Yuuki, Kaori; Naito, Sei; Nagaoka, Akira; Kato, Tomoyuki [Laboratory of Molecular Oncology, Department of Urology, Yamagata University School of Medicine, Iida-nishi 2-2-2, Yamagata 990-9585 (Japan); Tomita, Yoshihiko, E-mail: ytomita@med.id.yamagata-u.ac.jp [Laboratory of Molecular Oncology, Department of Urology, Yamagata University School of Medicine, Iida-nishi 2-2-2, Yamagata 990-9585 (Japan)
2012-07-06
Highlights: Black-Right-Pointing-Pointer Sorafenib treatment upregulated GSK-3{beta} levels in RCC cells. Black-Right-Pointing-Pointer Pharmacologic inhibition of GSK-3 suppressed xenograft RCC tumor growth. Black-Right-Pointing-Pointer Inhibition of GSK-3 enhanced antitumor effect of sorafenib in vitro and in vivo. -- Abstract: Sorafenib is a multikinase inhibitor approved for the systemic treatment of renal cell carcinoma (RCC). However, sorafenib treatment has a limited effect due to acquired chemoresistance of RCC. Previously, we identified glycogen synthase kinase-3 (GSK-3) as a new therapeutic target in RCC. Here, we observed that sorafenib inhibits proliferation and survival of RCC cells. Significantly, we revealed that sorafenib enhances GSK-3 activity in RCC cells, which could be a potential mechanism of acquired chemoresistance. We found that pharmacological inhibition of GSK-3 potentiates sorafenib antitumor effect in vitro and in vivo. Our results suggest that combining GSK-3 inhibitor and sorafenib might be a potential new therapeutic approach for RCC treatment.
PCR cloning of Polyhydroxybutyrate Synthase Gene (phbC) from Aeromonashydrophila
International Nuclear Information System (INIS)
Enan, M. R.; Bashandy, S.A.
2006-01-01
Plastic wastes are considered to be severe environmental contaminantscausing waste disposal problems. Widespread use of biodegradable plastics isone of the solutions, but it is limited by high production cost. A polymerasechain reaction (PCR) protocol was developed for the specific for the specificdetection and isolation of full-length gene coding for polyhydroxybutyrate(PBH). (PCR) strategy using (PHB) primers resulted in the amplification of(DNA) fragments with the expected size from all isolated bacteria (PBH)synthase gene was cloned directly from Aeromonas hydrophila genome for thefirst time. The clonec fragment was named (phbCAh) gene exhibits similarly to(PHB) synthase genes of Alcaligenes latus and Pseudomonas oleovorans (97%),Alcaligenes sp. (81%) and Comamonas acidovorans (84%). (author)
Directory of Open Access Journals (Sweden)
Ro Dae-Kyun
2009-07-01
Full Text Available Abstract Background Sesquiterpene lactones are characteristic metabolites of Asteraceae (or Compositae which often display potent bioactivities and are sequestered in specialized organs such as laticifers, resin ducts, and trichomes. For characterization of sunflower sesquiterpene synthases we employed a simple method to isolate pure trichomes from anther appendages which facilitated the identification of these genes and investigation of their enzymatic functions and expression patterns during trichome development. Results Glandular trichomes of sunflower (Helianthus annuus L. were isolated, and their RNA was extracted to investigate the initial steps of sesquiterpene lactone biosynthesis. Reverse transcription-PCR experiments led to the identification of three sesquiterpene synthases. By combination of in vitro and in vivo characterization of sesquiterpene synthase gene products in Escherichia coli and Saccharomyces cerevisiae, respectively, two enzymes were identified as germacrene A synthases, the key enzymes of sesquiterpene lactone biosynthesis. Due to the very low in vitro activity, the third enzyme was expressed in vivo in yeast as a thioredoxin-fusion protein for functional characterization. In in vivo assays, it was identified as a multiproduct enzyme with the volatile sesquiterpene hydrocarbon δ-cadinene as one of the two main products with α-muuorlene, β-caryophyllene, α-humulene and α-copaene as minor products. The second main compound remained unidentified. For expression studies, glandular trichomes from the anther appendages of sunflower florets were isolated in particular developmental stages from the pre- to the post-secretory phase. All three sesquiterpene synthases were solely upregulated during the biosynthetically active stages of the trichomes. Expression in different aerial plant parts coincided with occurrence and maturity of trichomes. Young roots with root hairs showed expression of the sesquiterpene synthase genes
In vitro biochemical characterization of all barley endosperm starch synthases
DEFF Research Database (Denmark)
Cuesta-Seijo, Jose A.; Nielsen, Morten M.; Ruzanski, Christian
2016-01-01
Starch is the main storage polysaccharide in cereals and the major source of calories in the human diet. It is synthesized by a panel of enzymes including five classes of starch synthases (SSs). While the overall starch synthase (SS) reaction is known, the functional differences between the five SS....... Here we provide a detailed biochemical study of the activity of all five classes of SSs in barley endosperm. Each enzyme was produced recombinantly in E. coli and the properties and modes of action in vitro were studied in isolation from other SSs and other substrate modifying activities. Our results...... define the mode of action of each SS class in unprecedented detail; we analyze their substrate selection, temperature dependence and stability, substrate affinity and temporal abundance during barley development. Our results are at variance with some generally accepted ideas about starch biosynthesis...
Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing
2016-03-01
Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.
Wilson, Wayne A; Pradhan, Prajakta; Madhan, Nayasha; Gist, Galen C; Brittingham, Andrew
2017-07-01
Trichomonas vaginalis, a parasitic protist, is the causative agent of the common sexually-transmitted infection trichomoniasis. The organism has long been known to synthesize substantial glycogen as a storage polysaccharide, presumably mobilizing this compound during periods of carbohydrate limitation, such as might be encountered during transmission between hosts. However, little is known regarding the enzymes of glycogen metabolism in T. vaginalis. We had previously described the identification and characterization of two forms of glycogen phosphorylase in the organism. Here, we measure UDP-glucose-dependent glycogen synthase activity in cell-free extracts of T. vaginalis. We then demonstrate that the TVAG_258220 open reading frame encodes a glycosyltransferase that is presumably responsible for this synthetic activity. We show that expression of TVAG_258220 in a yeast strain lacking endogenous glycogen synthase activity is sufficient to restore glycogen accumulation. Furthermore, when TVAG_258220 is expressed in bacteria, the resulting recombinant protein has glycogen synthase activity in vitro, transferring glucose from either UDP-glucose or ADP-glucose to glycogen and using both substrates with similar affinity. This protein is also able to transfer glucose from UDP-glucose or ADP-glucose to maltose and longer oligomers of glucose but not to glucose itself. However, with these substrates, there is no evidence of processivity and sugar transfer is limited to between one and three glucose residues. Taken together with our earlier work on glycogen phosphorylase, we are now well positioned to define both how T. vaginalis synthesizes and utilizes glycogen, and how these processes are regulated. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Wang, Huizhi; Brown, Jonathan; Gu, Zhen; Garcia, Carlos A; Liang, Ruqiang; Alard, Pascale; Beurel, Eléonore; Jope, Richard S; Greenway, Terrance; Martin, Michael
2011-05-01
The PI3K pathway and its regulation of mammalian target of rapamycin complex 1 (mTORC1) and glycogen synthase kinase 3 (GSK3) play pivotal roles in controlling inflammation. In this article, we show that mTORC1 and GSK3-β converge and that the capacity of mTORC1 to affect the inflammatory response is due to the inactivation of GSK3-β. Inhibition of mTORC1 attenuated GSK3 phosphorylation and increased its kinase activity. Immunoprecipitation and in vitro kinase assays demonstrated that GSK3-β associated with a downstream target of mTORC1, p85S6K, and phosphorylated GSK3-β. Inhibition of S6K1 abrogated the phosphorylation of GSK3-β while increasing and decreasing the levels of IL-12 and IL-10, respectively, in LPS-stimulated monocytes. In contrast, the direct inhibition of GSK3 attenuated the capacity of S6K1 inhibition to influence the levels of IL-10 and IL-12 produced by LPS-stimulated cells. At the transcriptional level, mTORC1 inhibition reduced the DNA binding of CREB and this effect was reversed by GSK3 inhibition. As a result, mTORC1 inhibition increased the levels of NF-κB p65 associated with CREB-binding protein. Inhibition of NF-κB p65 attenuated rapamycin's ability to influence the levels of pro- or anti-inflammatory cytokine production in monocytes stimulated with LPS. These studies identify the molecular mechanism by which mTORC1 affects GSK3 and show that mTORC1 inhibition regulates pro- and anti-inflammatory cytokine production via its capacity to inactivate GSK3.
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
International Nuclear Information System (INIS)
Tian, Hongmei; Ma, Leyuan; Zhao, Cong; Hao, Hui; Gong, Biao; Yu, Xiyan; Wang, Xiufeng
2010-01-01
To unravel the roles of sucrose phosphate synthase (SPS) in muskmelon (Cucumis melo L.), we reduced its activity in transgenic muskmelon plants by an antisense approach. For this purpose, an 830 bp cDNA fragment of muskmelon sucrose phosphate synthase was expressed in antisense orientation behind the 35S promoter of the cauliflower mosaic virus. The phenotype of the antisense plants clearly differed from that of control plants. The transgenic plant leaves were markedly smaller, and the plant height and stem diameter were obviously shorter and thinner. Transmission electron microscope observation revealed that the membrane degradation of chloroplast happened in transgenic leaves and the numbers of grana and grana lamella in the chloroplast were significantly less, suggesting that the slow growth and weaker phenotype of transgenic plants may be due to the damage of the chloroplast ultrastructure, which in turn results in the decrease of the net photosynthetic rate. The sucrose concentration and levels of sucrose phosphate synthase decreased in transgenic mature fruit, and the fruit size was smaller than the control fruit. Together, our results suggest that sucrose phosphate synthase may play an important role in regulating the muskmelon plant growth and fruit development.
Energy Technology Data Exchange (ETDEWEB)
Tian, Hongmei; Ma, Leyuan; Zhao, Cong; Hao, Hui; Gong, Biao [College of Horticulture Science and Engineering, State Key Laboratory of Crop Biology, Shandong Agricultural University, Tai' an, Shandong 271018 (China); Yu, Xiyan, E-mail: yuxiyan@sdau.edu.cn [College of Horticulture Science and Engineering, State Key Laboratory of Crop Biology, Shandong Agricultural University, Tai' an, Shandong 271018 (China); Wang, Xiufeng, E-mail: xfwang@sdau.edu.cn [College of Horticulture Science and Engineering, State Key Laboratory of Crop Biology, Shandong Agricultural University, Tai' an, Shandong 271018 (China)
2010-03-12
To unravel the roles of sucrose phosphate synthase (SPS) in muskmelon (Cucumis melo L.), we reduced its activity in transgenic muskmelon plants by an antisense approach. For this purpose, an 830 bp cDNA fragment of muskmelon sucrose phosphate synthase was expressed in antisense orientation behind the 35S promoter of the cauliflower mosaic virus. The phenotype of the antisense plants clearly differed from that of control plants. The transgenic plant leaves were markedly smaller, and the plant height and stem diameter were obviously shorter and thinner. Transmission electron microscope observation revealed that the membrane degradation of chloroplast happened in transgenic leaves and the numbers of grana and grana lamella in the chloroplast were significantly less, suggesting that the slow growth and weaker phenotype of transgenic plants may be due to the damage of the chloroplast ultrastructure, which in turn results in the decrease of the net photosynthetic rate. The sucrose concentration and levels of sucrose phosphate synthase decreased in transgenic mature fruit, and the fruit size was smaller than the control fruit. Together, our results suggest that sucrose phosphate synthase may play an important role in regulating the muskmelon plant growth and fruit development.
Potent Inhibitory Effect of Chinese Dietary Spices on Fatty Acid Synthase.
Jiang, Bing; Liang, Yan; Sun, Xuebing; Liu, Xiaoxin; Tian, Weixi; Ma, Xiaofeng
2015-09-01
Dietary spices have been adopted in cooking since ancient times to enhance flavor and also as food preservatives and disease remedies. In China, the use of spices and other aromatic plants as food flavoring is an integral part of dietary behavior, but relatively little is known about their functions. Fatty acid synthase (FAS) has been recognized as a remedy target, and its inhibitors might be applied in disease treatment. The present work was designed to assess the inhibitory activities on FAS of spices extracts in Chinese menu. The in vitro inhibitory activities on FAS of 22 extracts of spices were assessed by spectrophotometrically monitoring oxidation of NADPH at 340 nm. Results showed that 20 spices extracts (90.9 %) exhibited inhibitory activities on FAS, with half inhibition concentration (IC(50)) values ranging from 1.72 to 810.7 μg/ml. Among them, seven spices showed strong inhibitory effect with IC(50) values lower than 10 μg/ml. These findings suggest that a large proportion of the dietary spices studied possess promising inhibitory activities on FAS, and subsequently might be applied in the treatment of obesity and obesity-related human diseases.
DEFF Research Database (Denmark)
Yang, Ting; Gao, Liping; Hu, Hao
2014-01-01
Chrysanthemyl diphosphate synthase (CDS) is the first path-way-specific enzyme in the biosynthesis of pyrethrins, the most widely used plant-derived pesticide. CDS catalyzes c1′-2-3 cyclopropanation reactions of two molecules of dimethylallyl diphosphate (DMAPP) to yield chrysanthemyl diphosphate...
Chen, Chong; Ge, Dongxia; Qu, Yine; Chen, Rongyi; Fan, Yi-Ming; Li, Nan; Tang, Wendell W.; Zhang, Wensheng; Zhang, Kun; Wang, Alun R.; Rowan, Brian G.; Hill, Steven M.; Sartor, Oliver; Abdel, Asim B.; Myers, Leann; Lin, Qishan; You, Zongbing
2016-01-01
Interleukin-17 (IL-17) plays important roles in inflammation, autoimmune diseases, and some cancers. Obese people are in a chronic inflammatory state with increased serum levels of IL-17, insulin, and insulin-like growth factor 1 (IGF1). How these factors contribute to the chronic inflammatory status that promotes development of aggressive prostate cancer in obese men is largely unknown. We found that, in obese mice, hyperinsulinemia enhanced IL-17-induced expression of downstream proinflammatory genes with increased levels of IL-17 receptor A (IL-17RA), resulting in development of more invasive prostate cancer. Glycogen synthase kinase 3 (GSK3) constitutively bound to and phosphorylated IL-17RA at T780, leading to ubiquitination and proteasome-mediated degradation of IL-17RA, thus inhibiting IL-17-mediated inflammation. IL-17RA phosphorylation was reduced, while the IL-17RA levels were increased in the proliferative human prostate cancer cells compared to the normal cells. Insulin and IGF1 enhanced IL-17-induced inflammatory responses through suppressing GSK3, which was shown in the cultured cell lines in vitro and obese mouse models of prostate cancer in vivo. These findings reveal a mechanism underlying the intensified inflammation in obesity and obesity-associated development of aggressive prostate cancer, suggesting that targeting GSK3 may be a potential therapeutic approach to suppress IL-17-mediated inflammation in the prevention and treatment of prostate cancer, particularly in obese men. PMID:26871944
Cyclic GMP-AMP Synthase is a Cytosolic DNA Sensor that Activates the Type-I Interferon Pathway
Sun, Lijun; Wu, Jiaxi; Du, Fenghe; Chen, Xiang; Chen, Zhijian J.
2013-01-01
The presence of DNA in the cytoplasm of mammalian cells is a danger signal that triggers the host immune responses such as the production of type-I interferons (IFN). Cytosolic DNA induces IFN through the production of cyclic-GMP-AMP (cGAMP), which binds to and activates the adaptor protein STING. Through biochemical fractionation and quantitative mass spectrometry, we identified a cGAMP synthase (cGAS), which belongs to the nucleotidyltransferase family. Overexpression of cGAS activated the transcription factor IRF3 and induced IFNβ in a STING-dependent manner. Knockdown of cGAS inhibited IRF3 activation and IFNβ induction by DNA transfection or DNA virus infection. cGAS bound to DNA in the cytoplasm and catalyzed cGAMP synthesis. These results indicate that cGAS is a cytosolic DNA sensor that induces interferons by producing the second messenger cGAMP. PMID:23258413
Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway.
Sun, Lijun; Wu, Jiaxi; Du, Fenghe; Chen, Xiang; Chen, Zhijian J
2013-02-15
The presence of DNA in the cytoplasm of mammalian cells is a danger signal that triggers host immune responses such as the production of type I interferons. Cytosolic DNA induces interferons through the production of cyclic guanosine monophosphate-adenosine monophosphate (cyclic GMP-AMP, or cGAMP), which binds to and activates the adaptor protein STING. Through biochemical fractionation and quantitative mass spectrometry, we identified a cGAMP synthase (cGAS), which belongs to the nucleotidyltransferase family. Overexpression of cGAS activated the transcription factor IRF3 and induced interferon-β in a STING-dependent manner. Knockdown of cGAS inhibited IRF3 activation and interferon-β induction by DNA transfection or DNA virus infection. cGAS bound to DNA in the cytoplasm and catalyzed cGAMP synthesis. These results indicate that cGAS is a cytosolic DNA sensor that induces interferons by producing the second messenger cGAMP.
Cho, Gyeongjun; Kim, Junheon; Park, Chung Gyoo; Nislow, Corey; Weller, David M; Kwak, Youn-Sig
2017-07-01
Streptomyces spp. have the ability to produce a wide variety of secondary metabolites that interact with the environment. This study aimed to discover antifungal volatiles from the genus Streptomyces and to determine the mechanisms of inhibition. Volatiles identified from Streptomyces spp. included three major terpenes, geosmin, caryolan-1-ol and an unknown sesquiterpene. antiSMASH and KEGG predicted that the volatile terpene synthase gene clusters occur in the Streptomyces genome. Growth inhibition was observed when fungi were exposed to the volatiles. Biological activity of caryolan-1-ol has previously not been investigated. Fungal growth was inhibited in a dose-dependent manner by a mixture of the main volatiles, caryolan-1-ol and the unknown sesquiterpene, from Streptomyces sp. S4-7. Furthermore, synthesized caryolan-1-ol showed similar antifungal activity. Results of chemical-genomics profiling assays showed that caryolan-1-ol affected the endomembrane system by disrupting sphingolipid synthesis and normal vesicle trafficking in the fungi. © 2017 The Authors.
Glycogen Synthase Kinase 3 Inhibitors in the Next Horizon for Alzheimer's Disease Treatment
Directory of Open Access Journals (Sweden)
Ana Martinez
2011-01-01
Full Text Available Glycogen synthase kinase 3 (GSK-3, a proline/serine protein kinase ubiquitously expressed and involved in many cellular signaling pathways, plays a key role in the pathogenesis of Alzheimer's disease (AD being probably the link between β-amyloid and tau pathology. A great effort has recently been done in the discovery and development of different new molecules, of synthetic and natural origin, able to inhibit this enzyme, and several kinetics mechanisms of binding have been described. The small molecule called tideglusib belonging to the thiadiazolidindione family is currently on phase IIb clinical trials for AD. The potential risks and benefits of this new kind of disease modifying drugs for the future therapy of AD are discussed in this paper.
Ko, Jen-Chung; Zheng, Hao-Yu; Chen, Wen-Ching; Peng, Yi-Shuan; Wu, Chia-Hung; Wei, Chia-Li; Chen, Jyh-Cheng; Lin, Yun-Wei
2016-12-15
Salinomycin, a polyether antibiotic, acts as a highly selective potassium ionophore and has anticancer activity on various cancer cell lines. Cisplatin has been proved as chemotherapy drug for advanced human non-small cell lung cancer (NSCLC). Thymidylate synthase (TS) is a key enzyme in the pyrimidine salvage pathway, and increased expression of TS is thought to be associated with resistance to cisplatin. In this study, we showed that salinomycin (0.5-2μg/mL) treatment down-regulating of TS expression in an AKT inactivation manner in two NSCLC cell lines, human lung adenocarcinoma A549 and squamous cell carcinoma H1703 cells. Knockdown of TS using small interfering RNA (siRNA) or inhibiting AKT activity with PI3K inhibitor LY294002 enhanced the cytotoxicity and cell growth inhibition of salinomycin. A combination of cisplatin and salinomycin resulted in synergistic enhancement of cytotoxicity and cell growth inhibition in NSCLC cells, accompanied with reduced activation of phospho-AKT, and TS expression. Overexpression of a constitutive active AKT (AKT-CA) expression vector reversed the salinomycin and cisplatin-induced synergistic cytotoxicity. In contrast, pretreatment with LY294002 further decreased the cell viability in salinomycin and cisplatin cotreated cells. Our findings suggested that the down-regulation of AKT-mediated TS expression by salinomycin enhanced the cisplatin-induced cytotoxicity in NSCLC cells. These results may provide a rationale to combine salinomycin with cisplatin for lung cancer treatment. Copyright © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Yi-Chun eYen
2015-03-01
Full Text Available Psychostimulants show therapeutic efficacy in the treatment of attention-deficit hyperactivity disorder (ADHD. It is generally assumed that they ameliorate ADHD symptoms via interfering with monoaminergic signaling. We combined behavioral pharmacology, neurochemistry and molecular analyses to identify mechanisms underlying the paradoxical calming effect of amphetamine in low trait anxiety behavior (LAB mice, a novel multigenetic animal model of ADHD. Amphetamine (1 mg/kg and methylphenidate (10 mg/kg elicited similar dopamine and norepinephrine release in the medial prefrontal cortex (mPFC and in the striatum of LAB mice. In contrast, amphetamine decreased, while methylphenidate increased locomotor activity. This argues against changes in dopamine and/or norepinephrine release as mediators of amphetamine paradoxical effects. Instead, the calming activity of amphetamine corresponded to the inhibition of glycogen synthase kinase3β (GSK3β activity, specifically in the mPFC. Accordingly, not only systemic administration of the GSK3β inhibitor TDZD-8 (20 mg/kg, but also local microinjections of TDZD-8 and amphetamine into the mPFC, but not into the striatum, decreased locomotor activity in LAB mice. Amphetamine effects seem to depend on NMDA receptor signaling, since pre- or co-treatment with MK-801 (0.3 mg/kg abolished the effects of amphetamine (1 mg/kg on the locomotion and on the phosphorylation of GSK3β at the level of the mPFC. Taken together, the paradoxical calming effect of amphetamine in hyperactive LAB mice concurs with a decreased GSK3β activity in the mPFC. This effect appears to be independent of dopamine or norepinephrine release, but contingent on NMDA receptor signaling.
A human fatty acid synthase inhibitor binds β-ketoacyl reductase in the keto-substrate site.
Hardwicke, Mary Ann; Rendina, Alan R; Williams, Shawn P; Moore, Michael L; Wang, Liping; Krueger, Julie A; Plant, Ramona N; Totoritis, Rachel D; Zhang, Guofeng; Briand, Jacques; Burkhart, William A; Brown, Kristin K; Parrish, Cynthia A
2014-09-01
Human fatty acid synthase (hFAS) is a complex, multifunctional enzyme that is solely responsible for the de novo synthesis of long chain fatty acids. hFAS is highly expressed in a number of cancers, with low expression observed in most normal tissues. Although normal tissues tend to obtain fatty acids from the diet, tumor tissues rely on de novo fatty acid synthesis, making hFAS an attractive metabolic target for the treatment of cancer. We describe here the identification of GSK2194069, a potent and specific inhibitor of the β-ketoacyl reductase (KR) activity of hFAS; the characterization of its enzymatic and cellular mechanism of action; and its inhibition of human tumor cell growth. We also present the design of a new protein construct suitable for crystallography, which resulted in what is to our knowledge the first co-crystal structure of the human KR domain and includes a bound inhibitor.
Hyaluronan synthase mediates dye translocation across liposomal membranes
Directory of Open Access Journals (Sweden)
Medina Andria P
2012-01-01
Full Text Available Abstract Background Hyaluronan (HA is made at the plasma membrane and secreted into the extracellular medium or matrix by phospolipid-dependent hyaluronan synthase (HAS, which is active as a monomer. Since the mechanism by which HA is translocated across membranes is still unresolved, we assessed the presence of an intraprotein pore within HAS by adding purified Streptococcus equisimilis HAS (SeHAS to liposomes preloaded with the fluorophore Cascade Blue (CB. Results CB translocation (efflux was not observed with mock-purified material from empty vector control E. coli membranes, but was induced by SeHAS, purified from membranes, in a time- and dose-dependent manner. CB efflux was eliminated or greatly reduced when purified SeHAS was first treated under conditions that inhibit enzyme activity: heating, oxidization or cysteine modification with N-ethylmaleimide. Reduced CB efflux also occurred with SeHAS K48E or K48F mutants, in which alteration of K48 within membrane domain 2 causes decreased activity and HA product size. The above results used liposomes containing bovine cardiolipin (BCL. An earlier study testing many synthetic lipids found that the best activating lipid for SeHAS is tetraoleoyl cardiolipin (TO-CL and that, in contrast, tetramyristoyl cardiolipin (TM-CL is an inactivating lipid (Weigel et al, J. Biol. Chem. 281, 36542, 2006. Consistent with the effects of these CL species on SeHAS activity, CB efflux was more than 2-fold greater in liposomes made with TO-CL compared to TM-CL. Conclusions The results indicate the presence of an intraprotein pore in HAS and support a model in which HA is translocated to the exterior by HAS itself.
Energy Technology Data Exchange (ETDEWEB)
Fortman, Jeffrey L.; Hagen, Andrew; Katz, Leonard; Keasling, Jay D.; Poust, Sean; Zhang, Jingwei; Zotchev, Sergey
2016-05-10
The present invention provides for a polyketide synthase (PKS) capable of synthesizing an even-chain or odd-chain diacid or lactam or diamine. The present invention also provides for a host cell comprising the PKS and when cultured produces the even-chain diacid, odd-chain diacid, or KAPA. The present invention also provides for a host cell comprising the PKS capable of synthesizing a pimelic acid or KAPA, and when cultured produces biotin.
Neuroglobin Overexpression Inhibits AMPK Signaling and Promotes Cell Anabolism.
Cai, Bin; Li, Wenjun; Mao, XiaoOu; Winters, Ali; Ryou, Myoung-Gwi; Liu, Ran; Greenberg, David A; Wang, Ning; Jin, Kunlin; Yang, Shao-Hua
2016-03-01
Neuroglobin (Ngb) is a recently discovered globin with preferential localization to neurons. Growing evidence indicates that Ngb has distinct physiological functions separate from the oxygen storage and transport roles of other globins, such as hemoglobin and myoglobin. We found increased ATP production and decreased glycolysis in Ngb-overexpressing immortalized murine hippocampal cell line (HT-22), in parallel with inhibition of AMP-activated protein kinase (AMPK) signaling and activation of acetyl-CoA carboxylase (ACC). In addition, lipid and glycogen content was increased in Ngb-overexpressing HT-22 cells. AMPK signaling was also inhibited in the brain and heart from Ngb-overexpressing transgenic mice. Although Ngb overexpression did not change glycogen content in whole brain, glycogen synthase was activated in cortical neurons of Ngb-overexpressing mouse brain and Ngb overexpression primary neurons. Moreover, lipid and glycogen content was increased in hearts derived from Ngb-overexpressing mice. These findings suggest that Ngb functions as a metabolic regulator and enhances cellular anabolism through the inhibition of AMPK signaling.
Inhibitors of Fatty Acid Synthase for Prostate Cancer. Revision
2013-05-01
acetyl- cholinesterase inhibitors have been developed, many with femtomolar binding affinities (7). This body of literature also confirms that the...AD_________________ Award Number: W81XWH-09-1-0204 TITLE: Inhibitors of Fatty Acid Synthase for...May 2013 2. REPORT TYPE Revised Final 3. DATES COVERED 01 May 2009-30 Apr 2013 4. TITLE AND SUBTITLE Inhibitors of Fatty Acid Synthase for
Prostaglandin H synthase immunoreactivity in human gut. An immunohistochemical study
DEFF Research Database (Denmark)
Mikkelsen, H B; Rumessen, J J; Qvortrup, Klaus
1991-01-01
Prostaglandins exhibit a variety of actions on intestinal smooth muscle depending upon the type, dose and muscle layer studied. As the cellular origin of prostaglandin H (PGH) synthase has not been established with certainty in the human gut wall, we studied the localization of PGH synthase...
Lücker, J.; Bouwmeester, H.J.; Schwab, W.; Blaas, J.; Plas, van der L.H.W.; Verhoeven, H.A.
2001-01-01
Petunia hybrida W115 was transformed with a Clarkia breweri S-linalool synthase cDNA (lis). Lis was expressed in all tissues analysed, and linalool was detected in leaves, sepals, corolla, stem and ovary, but not in nectaries, roots, pollen and style. However, the S-linalool produced by the plant in
Faguy, David; Lawson, Darion; Hochstein, Lawrence I.; Chang, Sherwood (Technical Monitor)
1996-01-01
Vesicles prepared in a buffer containing ADP, Mg(2+) and Pi synthesized ATP at an initial rate of 2 nmols/min/mg protein after acidification of the bulk medium (pH 8 (right arrow) 4). The intravesicular ATP concentration reached a steady state after about 30 seconds and slowly declined thereafter. ATP synthesis was inhibited by low concentrations of dicyclohexylcarbodiimide and m-chlorophenylhydrazone indicating that synthesis took place in response to the proton gradient. NEM and PCMS, which inhibit vacuolar ATPases and the vacuolar-like ATPases of extreme halophiles, did not affect ATP synthesis, and, in fact, produced higher steady state levels of ATP. This suggested that two ATPase activities were present, one which catalyzed ATP synthesis and one that caused its hydrolysis. Azide, a specific inhibitor of F0F1 ATP Synthases, inhibited halobacterial ATP synthesis. The distribution of acridine orange as imposed by a delta pH demonstrated that azide inhibition was not due to the collapse of the proton gradient due to azide acting as a protonophore. Such an effect was observed, but only at azide concentrations higher than those that inhibited ATP synthesis. These results confirm the earler observations with cells of H. saccharovorum and other extreme halophiles that ATP synthesis is inconsistent with the operation of a vacuolar-like ATPase. Therefore, the observation that a vacuolar-like enzyme is responsible for ATP synthesis (and which serves as the basis for imputing ATP synthesis to the vacuolar-like ATPases of the extreme halophiles, and the Archaea in general) should be taken with some degree of caution.
Directory of Open Access Journals (Sweden)
Ayako Kitano
Full Text Available BACKGROUND AND PURPOSE: The major obstacles to treatment of pancreatic cancer are the highly invasive capacity and resistance to chemo- and radiotherapy. Glycogen synthase kinase 3β (GSK3β regulates multiple cellular pathways and is implicated in various diseases including cancer. Here we investigate a pathological role for GSK3β in the invasive and treatment resistant phenotype of pancreatic cancer. METHODS: Pancreatic cancer cells were examined for GSK3β expression, phosphorylation and activity using Western blotting and in vitro kinase assay. The effects of GSK3β inhibition on cancer cell survival, proliferation, invasive ability and susceptibility to gemcitabine and radiation were examined following treatment with a pharmacological inhibitor or by RNA interference. Effects of GSK3β inhibition on cancer cell xenografts were also examined. RESULTS: Pancreatic cancer cells showed higher expression and activity of GSK3β than non-neoplastic cells, which were associated with changes in its differential phosphorylation. Inhibition of GSK3β significantly reduced the proliferation and survival of cancer cells, sensitized them to gemcitabine and ionizing radiation, and attenuated their migration and invasion. These effects were associated with decreases in cyclin D1 expression and Rb phosphorylation. Inhibition of GSK3β also altered the subcellular localization of Rac1 and F-actin and the cellular microarchitecture, including lamellipodia. Coincident with these changes were the reduced secretion of matrix metalloproteinase-2 (MMP-2 and decreased phosphorylation of focal adhesion kinase (FAK. The effects of GSK3β inhibition on tumor invasion, susceptibility to gemcitabine, MMP-2 expression and FAK phosphorylation were observed in tumor xenografts. CONCLUSION: The targeting of GSK3β represents an effective strategy to overcome the dual challenges of invasiveness and treatment resistance in pancreatic cancer.
Effects of ceramide inhibition on radiation-induced apoptosis in human leukemia MOLT-4 cells
Energy Technology Data Exchange (ETDEWEB)
Takahashi, Eriko; Inanami, Osamu; Asanuma, Taketoshi; Kuwabara, Mikinori [Hokkaido Univ., Graduate School of Veterinary Medicine, Sapporo, Hokkaido (Japan)
2006-03-15
In the present study, using inhibitors of ceramide synthase (fumonisin B{sub 1}), ketosphinganine synthetase (L-cycloserine), acid sphingomyelinase (D609 and desipramine) and neutral sphingomyelinase (GW4869), the role of ceramide in X-ray-induced apoptosis was investigated in MOLT-4 cells. The diacylglycerol kinase (DGK) assay showed that the intracellular concentration of ceramide increased time-dependently after X irradiation of cells, and this radiation-induced accumulation of ceramide did not occur prior to the appearance of apoptotic cells. Treatment with D609 significantly inhibited radiation-induced apoptosis, but did not inhibit the increase of intracellular ceramide. Treatment with desipramine or GW4869 prevented neither radiation-induced apoptosis nor the induced increase of ceramide. On the other hand, fumonisin B{sub 1} and L-cycloserine had no effect on the radiation-induced induction of apoptosis, in spite of significant inhibition of the radiation-induced ceramide. From these results, it was suggested that the increase of the intracellular concentration of ceramide was not essential for radiation-induced apoptosis in MOLT-4 cells. (author)
Effects of ceramide inhibition on radiation-induced apoptosis in human leukemia MOLT-4 cells
International Nuclear Information System (INIS)
Takahashi, Eriko; Inanami, Osamu; Asanuma, Taketoshi; Kuwabara, Mikinori
2006-01-01
In the present study, using inhibitors of ceramide synthase (fumonisin B 1 ), ketosphinganine synthetase (L-cycloserine), acid sphingomyelinase (D609 and desipramine) and neutral sphingomyelinase (GW4869), the role of ceramide in X-ray-induced apoptosis was investigated in MOLT-4 cells. The diacylglycerol kinase (DGK) assay showed that the intracellular concentration of ceramide increased time-dependently after X irradiation of cells, and this radiation-induced accumulation of ceramide did not occur prior to the appearance of apoptotic cells. Treatment with D609 significantly inhibited radiation-induced apoptosis, but did not inhibit the increase of intracellular ceramide. Treatment with desipramine or GW4869 prevented neither radiation-induced apoptosis nor the induced increase of ceramide. On the other hand, fumonisin B 1 and L-cycloserine had no effect on the radiation-induced induction of apoptosis, in spite of significant inhibition of the radiation-induced ceramide. From these results, it was suggested that the increase of the intracellular concentration of ceramide was not essential for radiation-induced apoptosis in MOLT-4 cells. (author)
Functional Characterization of Sesquiterpene Synthase from Polygonum minus
Directory of Open Access Journals (Sweden)
Su-Fang Ee
2014-01-01
Full Text Available Polygonum minus is an aromatic plant, which contains high abundance of terpenoids, especially the sesquiterpenes C15H24. Sesquiterpenes were believed to contribute to the many useful biological properties in plants. This study aimed to functionally characterize a full length sesquiterpene synthase gene from P. minus. P. minus sesquiterpene synthase (PmSTS has a complete open reading frame (ORF of 1689 base pairs encoding a 562 amino acid protein. Similar to other sesquiterpene synthases, PmSTS has two large domains: the N-terminal domain and the C-terminal metal-binding domain. It also consists of three conserved motifs: the DDXXD, NSE/DTE, and RXR. A three-dimensional protein model for PmSTS built clearly distinguished the two main domains, where conserved motifs were highlighted. We also constructed a phylogenetic tree, which showed that PmSTS belongs to the angiosperm sesquiterpene synthase subfamily Tps-a. To examine the function of PmSTS, we expressed this gene in Arabidopsis thaliana. Two transgenic lines, designated as OE3 and OE7, were further characterized, both molecularly and functionally. The transgenic plants demonstrated smaller basal rosette leaves, shorter and fewer flowering stems, and fewer seeds compared to wild type plants. Gas chromatography-mass spectrometry analysis of the transgenic plants showed that PmSTS was responsible for the production of β-sesquiphellandrene.
Garza, Luis A.; Liu, Yaping; Yang, Zaixin; Alagesan, Brinda; Lawson, John A.; Norberg, Scott M.; Loy, Dorothy E.; Zhao, Tailun; Blatt, Hanz B.; Stanton, David C.; Carrasco, Lee; Ahluwalia, Gurpreet; Fischer, Susan M.; FitzGerald, Garret A.; Cotsarelis, George
2012-01-01
Testosterone is necessary for the development of male pattern baldness, known as androgenetic alopecia (AGA); yet, the mechanisms for decreased hair growth in this disorder are unclear. We show that prostaglandin D2 synthase (PTGDS) is elevated at the mRNA and protein levels in bald scalp compared to haired scalp of men with AGA. The product of PTGDS enzyme activity, prostaglandin D2 (PGD2), is similarly elevated in bald scalp. During normal follicle cycling in mice, Ptgds and PGD2 levels increase immediately preceding the regression phase, suggesting an inhibitory effect on hair growth. We show that PGD2 inhibits hair growth in explanted human hair follicles and when applied topically to mice. Hair growth inhibition requires the PGD2 receptor G protein (heterotrimeric guanine nucleotide)–coupled receptor 44 (GPR44), but not the PGD2 receptor 1 (PTGDR). Furthermore, we find that a transgenic mouse, K14-Ptgs2, which targets prostaglandin-endoperoxide synthase 2 expression to the skin, demonstrates elevated levels of PGD2 in the skin and develops alopecia, follicular miniaturization, and sebaceous gland hyperplasia, which are all hallmarks of human AGA. These results define PGD2 as an inhibitor of hair growth in AGA and suggest the PGD2-GPR44 pathway as a potential target for treatment. PMID:22440736
Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).
Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes
2012-03-01
Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively). Copyright © 2011 Elsevier GmbH. All rights reserved.
Ober, Dietrich; Hartmann, Thomas
1999-01-01
Pyrrolizidine alkaloids are preformed plant defense compounds with sporadic phylogenetic distribution. They are thought to have evolved in response to the selective pressure of herbivory. The first pathway-specific intermediate of these alkaloids is the rare polyamine homospermidine, which is synthesized by homospermidine synthase (HSS). The HSS gene from Senecio vernalis was cloned and shown to be derived from the deoxyhypusine synthase (DHS) gene, which is highly conserved among all eukaryotes and archaebacteria. DHS catalyzes the first step in the activation of translation initiation factor 5A (eIF5A), which is essential for eukaryotic cell proliferation and which acts as a cofactor of the HIV-1 Rev regulatory protein. Sequence comparison provides direct evidence for the evolutionary recruitment of an essential gene of primary metabolism (DHS) for the origin of the committing step (HSS) in the biosynthesis of pyrrolizidine alkaloids. PMID:10611289
Inhibition of fatty acid biosynthesis prevents adipocyte lipotoxicity on human osteoblasts in vitro
Elbaz, Alexandre; Wu, Xiying; Rivas, Daniel; Gimble, Jeffrey M; Duque, Gustavo
2010-01-01
Abstract Although increased bone marrow fat in age-related bone loss has been associated with lower trabecular mass, the underlying mechanism responsible remains unknown. We hypothesized that marrow adipocytes exert a lipotoxic effect on osteoblast function and survival through the reversible biosynthesis of fatty acids (FA) into the bone marrow microenvironment. We have used a two-chamber system to co-culture normal human osteoblasts (NHOst) with differentiating pre-adipocytes in the absence or presence of an inhibitor of FA synthase (cerulenin) and separated by an insert that allowed unidirectional trafficking of soluble factors only and prevented direct cell–cell contact. Supernatants were assayed for the presence of FA using mass spectophotometry. After 3 weeks in co-culture, NHOst showed significantly lower levels of differentiation and function based on lower mineralization and expression of alkaline phosphatase, osterix, osteocalcin and Runx2. In addition, NHOst survival was affected by the presence of adipocytes as determined by MTS-formazan and TUNEL assays as well as higher activation of caspases 3/7. These toxic effects were inhibited by addition of cerulenin. Furthermore, culture of NHOst with either adipocyte-conditioned media alone in the absence of adipocytes themselves or with the addition of the most predominant FA (stearate or palmitate) produced similar toxic results. Finally, Runx2 nuclear binding was affected by addition of either adipocyte conditioned media or FA into the osteogenic media. We conclude that the presence of FA within the marrow milieu can contribute to the age-related changes in bone mass and can be prevented by the inhibition of FA synthase. PMID:19382912
Inhibition of Fatty Acid Synthase in Prostate Cancer by Olristat, a Novel Therapeutic
2006-11-01
is a natural antibiotic product of the fungus Cephalosporium ceruleans (Omura, 1976). Cerulenin irreversibly inhibits FAS by binding covalently to the...toxicity in normal tissues (Pizer et al, 2000). More recently, an activity-based proteomics strategy revealed in vitro and in vivo antitumour activity for
Structure of the dimeric form of CTP synthase from Sulfolobus solfataricus
DEFF Research Database (Denmark)
Lauritsen, Iben; Willemoës, Martin; Jensen, Kaj Frank
2011-01-01
CTP synthase catalyzes the last committed step in de novo pyrimidine-nucleotide biosynthesis. Active CTP synthase is a tetrameric enzyme composed of a dimer of dimers. The tetramer is favoured in the presence of the substrate nucleotides ATP and UTP; when saturated with nucleotide, the tetramer...... completely dominates the oligomeric state of the enzyme. Furthermore, phosphorylation has been shown to regulate the oligomeric states of the enzymes from yeast and human. The crystal structure of a dimeric form of CTP synthase from Sulfolobus solfataricus has been determined at 2.5 Å resolution...
Renton, Paul; Green, Brenda; Maddaford, Shawn; Rakhit, Suman; Andrews, John S
2012-03-08
A novel series of benzimidazole designed multiple ligands (DMLs) with activity at the neuronal nitric oxide synthase (nNOS) enzyme and the μ-opioid receptor was developed. Targeting of the structurally dissimilar heme-containing enzyme and the μ-opioid GPCR was predicated on the modulatory role of nitric oxide on μ-opioid receptor function. Structure-activity relationship studies yielded lead compound 24 with excellent nNOS inhibitory activity (IC50 = 0.44 μM), selectivity over both endothelial nitric oxide synthase (10-fold) and inducible nitric oxide synthase (125-fold), and potent μ-opioid binding affinity, K i = 5.4 nM. The functional activity as measured in the cyclic adenosine monosphospate secondary messenger assay resulted in full agonist activity (EC50 = 0.34 μM). This work represents a novel approach in the development of new analgesics for the treatment of pain.
Monoterpene and sesquiterpene synthases and the origin of terpene skeletal diversity in plants.
Degenhardt, Jörg; Köllner, Tobias G; Gershenzon, Jonathan
2009-01-01
The multitude of terpene carbon skeletons in plants is formed by enzymes known as terpene synthases. This review covers the monoterpene and sesquiterpene synthases presenting an up-to-date list of enzymes reported and evidence for their ability to form multiple products. The reaction mechanisms of these enzyme classes are described, and information on how terpene synthase proteins mediate catalysis is summarized. Correlations between specific amino acid motifs and terpene synthase function are described, including an analysis of the relationships between active site sequence and cyclization type and a discussion of whether specific protein features might facilitate multiple product formation.
Xie, Ling; Zheng, Wei; Xin, Na; Xie, Jing-Wei; Wang, Tao; Wang, Zhan-You
2012-08-01
Dysregulation of iron homeostasis is involved in the pathological process of Alzheimer's disease (AD). We have recently reported that divalent metal transporter 1 (DMT1) is upregulated in an AD transgenic mouse brain, and that silencing of DMT1, which reduces cellular iron influx, results in inhibition of amyloidogenesis in vitro, suggesting a potential target of DMT1 for AD therapy. In the present study, we tested the hypothesis that inhibition of DMT1 with ebselen, a DMT1 transport inhibitor, could affect tau phosphorylation. Human neuroblastoma SH-SY5Y cells were pre-treated with ebselen and then treated with ferrous sulfate (dissolved in ascorbic acid), and the effects of ebselen on tau phosphorylation and the relative signaling pathways were examined. Our results showed that ebselen decreased iron influx, reduced iron-induced ROS production, inhibited the activities of cyclin-dependent kinase 5 and glycogen synthase kinase 3β, and ultimately attenuated the levels of tau phosphorylation at the sites of Thr205, Ser396 and Thr231. The present study indicates that the neuroprotective effect of ebselen on AD is not only related to its antioxidant activity as reported previously, but is also associated with a reduction in tau phosphorylation by inhibition of DMT1. Copyright © 2012 Elsevier Ltd. All rights reserved.
Liang, Jing; Han, Qian; Ding, Haizhen; Li, Jianyong
2017-12-01
O; thereby avoiding oxidative stress by H 2 O 2 . Results of our structural and functional analyses provide a reasonable explanation of mechanisms involved in DHPA synthase-mediated reactions. Based on the key active site residue Asn192, identified in Drosophila DHPA synthase, we were able to distinguish all available insect DHPA synthases from DDC sequences primarily. Copyright © 2017. Published by Elsevier Ltd.
Compound C inhibits macrophage chemotaxis through an AMPK-independent mechanism
Energy Technology Data Exchange (ETDEWEB)
Lee, Youngyi [College of Pharmacy, Woosuk University, Wanju, Jeonbuk 55338 (Korea, Republic of); Department of Biochemistry, Chonbuk National University Medical School, Jeonju, Jeonbuk 54896 (Korea, Republic of); Park, Byung-Hyun, E-mail: bhpark@jbnu.ac.kr [Department of Biochemistry, Chonbuk National University Medical School, Jeonju, Jeonbuk 54896 (Korea, Republic of); Bae, Eun Ju, E-mail: ejbae@woosuk.ac.kr [College of Pharmacy, Woosuk University, Wanju, Jeonbuk 55338 (Korea, Republic of)
2016-01-15
Macrophage infiltration in adipose tissue is a well-established cause of obesity-linked insulin resistance. AMP-activated protein kinase (AMPK) activation in peripheral tissues such as adipose tissue has beneficial effects on the protection against obesity-induced insulin resistance, which is mainly mediated by prevention of adipose tissue macrophage infiltration and inflammation. In examining the role of AMPK on adipose tissue inflammation, we unexpectedly found that compound C (CC), despite its inhibition of AMPK, robustly inhibited macrophage chemotaxis in RAW 264.7 cells when adipocyte conditioned medium (CM) was used as a chemoattractant. Here, we report that CC inhibition of macrophage migration occurred independently of AMPK. Mechanistically, this inhibitory effect of cell migration by CC was mediated by inhibition of the focal adhesion kinase, AKT, nuclear factor κB pathways. Moreover, the expression of chemokine monocyte chemoattractant protein-1 and pro-inflammatory genes such as tumor necrosis factor α and inducible nitric oxide synthase were prevented by CC treatment in RAW 264.7 cells stimulated with either adipocyte CM or lipopolysaccharide. Lastly, in accord with the findings of the anti-inflammatory effect of CC, we demonstrated that CC functioned as a repressor of macrophage CM-mediated insulin resistance in adipocytes. Taken together, our results suggest that CC serves as a useful inhibitory molecule against macrophage chemotaxis into adipose tissue and thus might have therapeutic potential for the treatment of obesity-linked adipose inflammation. - Highlights: • Compound C (CC) inhibits macrophage chemotaxis regardless of AMPK suppression. • CC enhances insulin sensitivity in adipocytes. • CC inhibits focal adhesion kinase, AKT, and NF-κB signaling in RAW 264.7 cells.
Directory of Open Access Journals (Sweden)
Chun-Hsien eHung
2016-01-01
Full Text Available Phosphatidylglycerol (PG and cardiolipin (CL are two essential classes of phospholipid in plants and algae. Phosphatidylglycerophosphate synthase (PGPS and cardiolipin synthase (CLS involved in the biosynthesis of PG and CL belong to CDP-alcohol phosphotransferase and share overall amino acid sequence homology. However, it remains elusive whether PGPS and CLS are functionally distinct in vivo. Here, we report identification of a gene encoding CLS in Chlamydomonas reinhardtii, CrCLS1, and its functional compatibility. Whereas CrCLS1 did not complement the growth phenotype of a PGPS mutant of Synechocystis sp. PCC 6803, it rescued the temperature-sensitive growth phenotype, growth profile with different carbon sources, phospholipid composition and enzyme activity of ∆crd1, a CLS mutant of Saccharomyces cerevisiae. These results suggest that CrCLS1 encodes a functional CLS of C. reinhardtii as the first identified algal CLS, whose enzyme function is distinct from that of PGPSs from C. reinhardtii. Comparison of CDP-alcohol phosphotransferase motif between PGPS and CLS among different species revealed a possible additional motif that might define the substrate specificity of these closely related enzymes.
Prosser, Ian; Phillips, Andy L; Gittings, Simon; Lewis, Mervyn J; Hooper, Antony M; Pickett, John A; Beale, Michael H
2002-08-01
Profiling of sesquiterpene hydrocarbons in extracts of goldenrod, Solidago canadensis, by GC-MS revealed the presence of both enantiomers of germacrene D and lesser amounts of germacrene A, alpha-humulene, and beta-caryophyllene. A similarity-based cloning strategy using degenerate oligonucleotide primers, based on conserved amino acid sequences in known plant sesquiterpene synthases and RT-PCR, resulted in the isolation of a full length sesquiterpene synthase cDNA. Functional expression of the cDNA in E. coli, as an N-terminal thioredoxin fusion protein using the pET32b vector yielded an enzyme that was readily purified by nickel-chelate affinity chromatography. Chiral GC-MS analysis of products from of (3)H- and (2)H-labelled farnesyl diphosphate identified the enzyme as (+)-(10R)-germacrene A synthase. Sequence analysis and molecular modelling was used to compare this enzyme with the mechanistically related epi-aristolochene synthase from tobacco.
Gupta, Dinesh; Ip, Tina; Summers, Michael L; Basu, Chhandak
2015-01-01
Phytol is a diterpene alcohol of medicinal importance and it also has potential to be used as biofuel. We found over production of phytol in Nostoc punctiforme by expressing a 2-Methyl-3-buten-2-ol (MBO) synthase gene. MBO synthase catalyzes the conversion of dimethylallyl pyrophosphate (DMAPP) into MBO, a volatile hemiterpene alcohol, in Pinus sabiniana. The result of enhanced phytol production in N. punctiforme, instead of MBO, could be explained by one of the 2 models: either the presence of a native prenyltransferase enzyme with a broad substrate specificity, or appropriation of a MBO synthase metabolic intermediate by a native geranyl diphosphate (GDP) synthase. In this work, an expression vector with an indigenous petE promoter for gene expression in the cyanobacterium N. punctiforme was constructed and MBO synthase gene expression was successfully shown using reverse transcriptase (RT)-PCR and SDS-PAGE. Gas chromatography--mass spectrophotometry (GC-MS) was performed to confirm phytol production from the transgenic N. punctiforme strains. We conclude that the expression of MBO synthase in N. punctiforme leads to overproduction of an economically important compound, phytol. This study provides insights about metabolic channeling of isoprenoids in cyanobacteria and also illustrates the challenges of bioengineering non-native hosts to produce economically important compounds.
Wang, Huizhi; Brown, Jonathan; Gu, Zhen; Garcia, Carlos A.; Liang, Ruqiang; Alard, Pascale; Beurel, Eléonore; Jope, Richard S.; Greenway, Terrance; Martin, Michael
2011-01-01
The PI3K pathway and its regulation of mammalian target of rapamycin complex 1 (mTORC1) and glycogen synthase kinase 3 (GSK3) play pivotal roles in controlling inflammation. In this article, we show that mTORC1 and GSK3-β converge and that the capacity of mTORC1 to affect the inflammatory response is due to the inactivation of GSK3-β. Inhibition of mTORC1 attenuated GSK3 phosphorylation and increased its kinase activity. Immunoprecipitation and in vitro kinase assays demonstrated that GSK3-β associated with a downstream target of mTORC1, p85S6K, and phosphorylated GSK3-β. Inhibition of S6K1 abrogated the phosphorylation of GSK3-β while increasing and decreasing the levels of IL-12 and IL-10, respectively, in LPS-stimulated monocytes. In contrast, the direct inhibition of GSK3 attenuated the capacity of S6K1 inhibition to influence the levels of IL-10 and IL-12 produced by LPS-stimulated cells. At the transcriptional level, mTORC1 inhibition reduced the DNA binding of CREB and this effect was reversed by GSK3 inhibition. As a result, mTORC1 inhibition increased the levels of NF-κB p65 associated with CREB-binding protein. Inhibition of NF-κB p65 attenuated rapamycin’s ability to influence the levels of pro- or anti-inflammatory cytokine production in monocytes stimulated with LPS. These studies identify the molecular mechanism by which mTORC1 affects GSK3 and show that mTORC1 inhibition regulates pro- and anti-inflammatory cytokine production via its capacity to inactivate GSK3. PMID:21422248
Directory of Open Access Journals (Sweden)
Andrea Müllebner
2018-01-01
Full Text Available BackgroundMacrophages are cells of the innate immune system that populate every organ. They are required not only for defense against invading pathogens and tissue repair but also for maintenance of tissue homeostasis and iron homeostasis.AimThe aim of this study is to understand whether heme oxygenase (HO and nitric oxide synthase (NOS contribute to the regulation of nicotinamide adenine dinucleotide phosphate oxidase (NOX activity and phagocytosis, two key components of macrophage function.MethodsThis study was carried out using resting J774A.1 macrophages treated with hemin or vehicle. Activity of NOS, HO, or NOX was inhibited using specific inhibitors. Reactive oxygen species (ROS formation was determined by Amplex® red assay, and phagocytosis was measured using fluorescein isothiocyanate-labeled bacteria. In addition, we analyzed the fate of the intracellular heme by using electron spin resonance.ResultsWe show that both enzymes NOS and HO are essential for phagocytic activity of macrophages. NOS does not directly affect phagocytosis, but stimulates NOX activity via nitric oxide-triggered ROS production of mitochondria. Treatment of macrophages with hemin results in intracellular accumulation of ferrous heme and an inhibition of phagocytosis. In contrast to NOS, HO products, including carbon monoxide, neither clearly affect NOX activity nor clearly affect phagocytosis, but phagocytosis is accelerated by HO-mediated degradation of heme.ConclusionBoth enzymes contribute to the bactericidal activity of macrophages independently, by controlling different pathways.
Pfeiffer, Tomas; Wallich, Martina; Sandmann, Wilhelm; Schrader, Jürgen; Gödecke, Axel
2006-05-01
Intimal hyperplasia (IH) is most commonly the cause of graft occlusion in infrainguinal bypass grafting for arterial occlusive disease. We investigated the influence of nitric oxide on the IH of the arterial vessel wall at the region of prosthetic bypass anastomoses. Experiments were performed in 10 Foxhound dogs. We used a technique of inducible nitric oxide synthase (iNOS) overexpression by a non-virus-mediated, liposome-based iNOS gene transfer. The plasmid pSCMV-iNOS, which drives the expression of iNOS under control of the cytomegalovirus promoter, was complexed with cationic liposomes (lipoplexes). Segments of both carotid arteries were pretreated by intramural injection of a lipoplex solution by using an infiltrator balloon catheter (Infiltrator Drug Delivery Balloon System). In each dog, iNOS was administered at one side, and a control vector (pSCMV2) was administered at the contralateral side. Carotid arteries were ligated, and bypass grafts (expanded polytetrafluoroethylene, 6-mm, ring enforced) were implanted on both sides. The proximal and distal anastomoses (end-to-side fashion; running nonabsorbable sutures) were placed in the pretreated regions. After 6 months, the prostheses were excised, and the intimal thicknesses of 50 cross sections (orcein staining) of each anastomosis were measured planimetrically. The average reduction of the neointima thickness of the iNOS side in proximal anastomoses at the prosthetic wall, suture region, and arterial wall was 43%, 52%, and 81%, respectively. In distal anastomoses, the average reduction was 40%, 47%, and 52%, respectively. All differences of neointima thickness between the iNOS and control sides were statistically significant (Wilcoxon test; P < or = .05). Inducible NOS expression is an efficient approach for inhibition of IH. In contrast to earlier studies, which investigated the efficacy of gene therapeutic NOS expression at 3 to 4 weeks after intervention, the novelty of our findings is that a single
Phytochelatin synthase activity as a marker of metal pollution
Energy Technology Data Exchange (ETDEWEB)
Zitka, Ondrej; Krystofova, Olga; Sobrova, Pavlina [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Adam, Vojtech [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Central European Institute of Technology, Brno University of Technology, Technicka 3058/10, CZ-616 00 Brno (Czech Republic); Zehnalek, Josef; Beklova, Miroslava [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Kizek, Rene, E-mail: kizek@sci.muni.cz [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Central European Institute of Technology, Brno University of Technology, Technicka 3058/10, CZ-616 00 Brno (Czech Republic)
2011-08-30
Highlights: {yields} New tool for determination of phytochelatin synthase activity. {yields} The optimization of experimental condition for determination of the enzyme activity. {yields} First evaluation of K{sub m} for the enzyme. {yields} The effects of cadmium (II) not only on the activity of the enzyme but also on K{sub m}. -- Abstract: The synthesis of phytochelatins is catalyzed by {gamma}-Glu-Cys dipeptidyl transpeptidase called phytochelatin synthase (PCS). Aim of this study was to suggest a new tool for determination of phytochelatin synthase activity in the tobacco BY-2 cells treated with different concentrations of the Cd(II). After the optimization steps, an experiment on BY-2 cells exposed to different concentrations of Cd(NO{sub 3}){sub 2} for 3 days was performed. At the end of the experiment, cells were harvested and homogenized. Reduced glutathione and cadmium (II) ions were added to the cell suspension supernatant. These mixtures were incubated at 35 {sup o}C for 30 min and analysed using high performance liquid chromatography coupled with electrochemical detector (HPLC-ED). The results revealed that PCS activity rises markedly with increasing concentration of cadmium (II) ions. The lowest concentration of the toxic metal ions caused almost three fold increase in PCS activity as compared to control samples. The activity of PCS (270 fkat) in treated cells was more than seven times higher in comparison to control ones. K{sub m} for PCS was estimated as 2.3 mM.
Phytochelatin synthase activity as a marker of metal pollution
International Nuclear Information System (INIS)
Zitka, Ondrej; Krystofova, Olga; Sobrova, Pavlina; Adam, Vojtech; Zehnalek, Josef; Beklova, Miroslava; Kizek, Rene
2011-01-01
Highlights: → New tool for determination of phytochelatin synthase activity. → The optimization of experimental condition for determination of the enzyme activity. → First evaluation of K m for the enzyme. → The effects of cadmium (II) not only on the activity of the enzyme but also on K m . -- Abstract: The synthesis of phytochelatins is catalyzed by γ-Glu-Cys dipeptidyl transpeptidase called phytochelatin synthase (PCS). Aim of this study was to suggest a new tool for determination of phytochelatin synthase activity in the tobacco BY-2 cells treated with different concentrations of the Cd(II). After the optimization steps, an experiment on BY-2 cells exposed to different concentrations of Cd(NO 3 ) 2 for 3 days was performed. At the end of the experiment, cells were harvested and homogenized. Reduced glutathione and cadmium (II) ions were added to the cell suspension supernatant. These mixtures were incubated at 35 o C for 30 min and analysed using high performance liquid chromatography coupled with electrochemical detector (HPLC-ED). The results revealed that PCS activity rises markedly with increasing concentration of cadmium (II) ions. The lowest concentration of the toxic metal ions caused almost three fold increase in PCS activity as compared to control samples. The activity of PCS (270 fkat) in treated cells was more than seven times higher in comparison to control ones. K m for PCS was estimated as 2.3 mM.
Nakata, Daisuke; Koyama, Ryokichi; Nakayama, Kazuhide; Kitazawa, Satoshi; Watanabe, Tatsuya; Hara, Takahito
2017-06-01
Recent evidence suggests that androgen receptor (AR) splice variants, including AR-V7, play a pivotal role in resistance to androgen blockade in prostate cancer treatment. The development of new therapeutic agents that can suppress the transcriptional activities of AR splice variants has been anticipated as the next generation treatment of castration-resistant prostate cancer. High-throughput screening of AR-V7 signaling inhibitors was performed using an AR-V7 reporter system. The effects of a glycogen synthase kinase-3 (GSK3) inhibitor, LY-2090314, on endogenous AR-V7 signaling were evaluated in an AR-V7-positive cell line, JDCaP-hr, by quantitative reverse transcription polymerase chain reaction. The relationship between AR-V7 signaling and β-catenin signaling was assessed using RNA interference. The effect of LY-2090314 on cell growth in various prostate cancer cell lines was also evaluated. We identified GSK3 inhibitors as transcriptional suppressors of AR-V7 using a high-throughput screen with an AR-V7 reporter system. LY-2090314 suppressed the reporter activity and endogenous AR-V7 activity in JDCaP-hr cells. Because silencing of β-catenin partly rescued the suppression, it was evident that the suppression was mediated, at least partially, via the activation of β-catenin signaling. AR-V7 signaling and β-catenin signaling reciprocally regulate each other in JDCaP-hr cells, and therefore, GSK3 inhibition can repress AR-V7 transcriptional activity by accumulating intracellular β-catenin. Notably, LY-2090314 selectively inhibited the growth of AR-V7-positive prostate cancer cells in vitro. Our findings demonstrate the potential of GSK3 inhibitors in treating advanced prostate cancer driven by AR splice variants. In vivo evaluation of AR splice variant-positive prostate cancer models will help illustrate the overall significance of GSK3 inhibitors in treating prostate cancer. © 2017 Wiley Periodicals, Inc.
Azarpira, Negar; Namazi, Soha; Malahi, Sayan; Kazemi, Kourosh
2016-06-01
Polymorphisms of the endothelial nitric oxide synthase gene have been associated with altered endothelial nitric oxide synthase activity. The purpose of this study was to investigate the relation between endothelial nitric oxide synthase -786T/C and 894G/T polymorphism and their haplotypes on the occurrence of acute rejection episodes in liver transplant recipients. We conducted a case control study in which 100 liver transplant recipients and 100 healthy controls were recruited from Shiraz Transplant Center. The patients used triple therapy including tacrolimus, mycophenolate mofetil, and prednisolone for immunosuppression maintenance. DNA was extracted from peripheral blood and endothelial nitric oxide synthase polymorphisms were determined by polymerase chain reaction and restriction fragment length polymorphism. Patients included 60 men and 40 women (mean age, 32.35 ± 10.2 y). There was a significant association of endothelial nitric oxide synthase 894G/T and acute rejection episode. The GT* gen-otype and acute rejection episodes had a significant association (odds ratio, 2.42; 95% confidence interval, 0.97-6.15; P = .03). The GG and GT* genotype and T* allele frequency were significantly different between patients and control subjects (P = .001). Haplotype TT* was higher in recipients than control subjects (odds ratio, 2.17; 95% confidence interval, 1.12-4.25; P = .01). Haplotype TG was higher in the control group (odds ratio, 0.62; 95% confidence interval, 0.40-0.96; P = .02). Our results suggest a relation between different endothelial nitric oxide synthase geno-types and risk of acute rejection episodes. However, further study is necessary to determine genetic susceptibility for transplant patients.
Molecular size estimation of plasma membrane β-glucan synthase from red beet root
International Nuclear Information System (INIS)
Sloan, M.E.; Eiberger, L.L.; Wasserman, B.P.
1986-01-01
Cellulose and cell wall β-D-glucans in higher plants are thought to be synthesized by the plasma membrane enzyme, β-glucan synthase. This enzyme has never been purified to homogeneity, hence its subunit composition is unknown. Partial purification of red beet root glucan synthase by glycerol density gradient centrifugation followed by SDS-PAGE yielded a highly enriched subunit of 68 kDa. Radiation inactivation of plasma membranes gave a molecular size the 450 kDa for the holoenzyme complex. This suggests that glucan synthase consists of 6 to 7 subunits and confirms electron microscope studies showing that glucan synthases exist as multi-subunit complexes embedded within the membrane
DEFF Research Database (Denmark)
Guarino, Carla; Hamon, Yveline; Croix, Cécile
2017-01-01
cyclopropyl nitrile CatC inhibitor almost totally lack elastase. We confirmed the elimination of neutrophil elastase-like proteases by prolonged inhibition of CatC in a non-human primate. We also showed that neutrophils lacking elastase-like protease activities were still recruited to inflammatory sites....... These preclinical results demonstrate that the disappearance of neutrophil elastase-like proteases as observed in PLS patients can be achieved by pharmacological inhibition of bone marrow CatC. Such a transitory inhibition of CatC might thus help to rebalance the protease load during chronic inflammatory diseases...
International Nuclear Information System (INIS)
Jacobson, J.A.
1988-01-01
This study describes the characterization and localization of the first enzyme of arginine biosynthesis in Neurospora crassa. A radioactive assay was developed to detect this enzyme whereby radioactive substrate and product molecules could be separated by ion-exchange chromatography. The enzyme was found to have a pH optimum of 9.0 and K/sub m/ values for glutamate and acetyl-CoA of approximately 4.7 and 0.45 mM, respectively. The enzyme was shown to be feedback inhibited by arginine. Half-maximal inhibition was observed at 0.13 mM arginine, a concentration which is similar to be in vivo cytosolic concentration of 0.2 mM. Arginine was found to act as a competitive inhibitor with respect to acetyl-CoA. Acetylglutamate synthase was localized to the mitochondrion. However, in contrast to the mitochondrial matrix location of the other ornithine biosynthetic enzymes, this enzyme was found to reside on the mitochondrial inner membrane
Berberine improves glucose metabolism in diabetic rats by inhibition of hepatic gluconeogenesis.
Directory of Open Access Journals (Sweden)
Xuan Xia
2011-02-01
Full Text Available Berberine (BBR is a compound originally identified in a Chinese herbal medicine Huanglian (Coptis chinensis French. It improves glucose metabolism in type 2 diabetic patients. The mechanisms involve in activation of adenosine monophosphate activated protein kinase (AMPK and improvement of insulin sensitivity. However, it is not clear if BBR reduces blood glucose through other mechanism. In this study, we addressed this issue by examining liver response to BBR in diabetic rats, in which hyperglycemia was induced in Sprague-Dawley rats by high fat diet. We observed that BBR decreased fasting glucose significantly. Gluconeogenic genes, Phosphoenolpyruvate carboxykinase (PEPCK and Glucose-6-phosphatase (G6Pase, were decreased in liver by BBR. Hepatic steatosis was also reduced by BBR and expression of fatty acid synthase (FAS was inhibited in liver. Activities of transcription factors including Forkhead transcription factor O1 (FoxO1, sterol regulatory element-binding protein 1c (SREBP1 and carbohydrate responsive element-binding protein (ChREBP were decreased. Insulin signaling pathway was not altered in the liver. In cultured hepatocytes, BBR inhibited oxygen consumption and reduced intracellular adenosine triphosphate (ATP level. The data suggest that BBR improves fasting blood glucose by direct inhibition of gluconeogenesis in liver. This activity is not dependent on insulin action. The gluconeogenic inhibition is likely a result of mitochondria inhibition by BBR. The observation supports that BBR improves glucose metabolism through an insulin-independent pathway.
Post-irradiation inactivation, protection, and repair of the sulfhydryl enzyme malate synthase
International Nuclear Information System (INIS)
Durchschlag, H.; Zipper, P.
1985-01-01
Malate synthase from baker's yeast, a trimeric sulfhydryl enzyme with one essential sulfhydryl group per subunit, was inactivated by 2 kGy X-irradiation in air-saturated aqueous solution (enzyme concentration: 0.5 mg/ml). The radiation induced changes of enzymic activity were registered at about 0,30,60 h after irradiation. To elucidate the role of OH - , O 2 , and H 2 O 2 in the X-ray inactivation of the enzyme, experiments were performed in the absence of presence of different concentrations of specific additives (formate, superoxide dismutase, catalase). These additives were added to malate synthase solutions before or after X-irradiation. Moreover, repairs of inactivated malate synthase were initiated at about 0 or 30 h after irradiation by means of the sulfhydryl agent dithiothreitol. Experiments yielded the following results: 1. Irradiation of malate synthase in the absence of additives inactivated the enzyme immediately to a residual activity Asub(r)=3% (corresponding to a D 37 =0.6 kGy), and led to further slow inactivation in the post-irradiation phase. Repairs, initiated at different times after irradiation, restored enzymic activity considerably. The repair initiated at t=0 led to Asub(r)=21%; repairs started later on resulted in somewhat lower activities. The decay of reparability, however, was found to progress more slowly than post-irradiation inactivation itself. After completion of repair the activities of repaired samples did not decrease significantly. 2. The presence of specific additives during irradiation caused significant protective effects against primary inactivation. The protection by formate was very pronounced (e.g., Asub(r)=72% and D 37 =6 kGy for 100 mM formate). The presence of catalytic amounts of superoxide dismutase and/or catalase exhibited only minor effects, depending on the presence and concentration of formate. (orig.)
Heme A synthase in bacteria depends on one pair of cysteinyls for activity.
Lewin, Anna; Hederstedt, Lars
2016-02-01
Heme A is a prosthetic group unique for cytochrome a-type respiratory oxidases in mammals, plants and many microorganisms. The poorly understood integral membrane protein heme A synthase catalyzes the synthesis of heme A from heme O. In bacteria, but not in mitochondria, this enzyme contains one or two pairs of cysteine residues that are present in predicted hydrophilic polypeptide loops on the extracytoplasmic side of the membrane. We used heme A synthase from the eubacterium Bacillus subtilis and the hyperthermophilic archeon Aeropyrum pernix to investigate the functional role of these cysteine residues. Results with B. subtilis amino acid substituted proteins indicated the pair of cysteine residues in the loop connecting transmembrane segments I and II as being essential for catalysis but not required for binding of the enzyme substrate, heme O. Experiments with isolated A. pernix and B. subtilis heme A synthase demonstrated that a disulfide bond can form between the cysteine residues in the same loop and also between loops showing close proximity of the two loops in the folded enzyme protein. Based on the findings, we propose a classification scheme for the four discrete types of heme A synthase found so far in different organisms and propose that essential cysteinyls mediate transfer of reducing equivalents required for the oxygen-dependent catalysis of heme A synthesis from heme O. Copyright © 2015 Elsevier B.V. All rights reserved.
Impaired glycogen synthase activity and mitochondrial dysfunction in skeletal muscle
DEFF Research Database (Denmark)
Højlund, Kurt; Beck-Nielsen, Henning
2006-01-01
Insulin resistance in skeletal muscle is a major hallmark of type 2 diabetes and an early detectable abnormality in the development of this disease. The cellular mechanisms of insulin resistance include impaired insulin-mediated muscle glycogen synthesis and increased intramyocellular lipid content......, whereas impaired insulin activation of muscle glycogen synthase represents a consistent, molecular defect found in both type 2 diabetic and high-risk individuals. Despite several studies of the insulin signaling pathway believed to mediate dephosphorylation and hence activation of glycogen synthase......, the molecular mechanisms responsible for this defect remain unknown. Recently, the use of phospho-specific antibodies in human diabetic muscle has revealed hyperphosphorylation of glycogen synthase at sites not regulated by the classical insulin signaling pathway. In addition, novel approaches such as gene...
DEFF Research Database (Denmark)
Willemoës, Martin; Hove-Jensen, Bjarne; Larsen, Sine
2000-01-01
A steady state kinetic investigation of the Pi activation of 5-phospho-D-ribosyl α-1-diphosphate synthase from Escherichia coli suggests that Pi can bind randomly to the enzyme either before or after an ordered addition of free Mg2+ and substrates. Unsaturation with ribose 5-phosphate increased...... the apparent cooperativity of Pi activation. At unsaturating Pi concentrations partial substrate inhibition by ribose 5-phosphate was observed. Together these results suggest that saturation of the enzyme with Pi directs the subsequent ordered binding of Mg2+ and substrates via a fast pathway, whereas...... saturation with ribose 5-phosphate leads to the binding of Mg2+ and substrates via a slow pathway where Pi binds to the enzyme last. The random mechanism for Pi binding was further supported by studies with competitive inhibitors of Mg2+, MgATP, and ribose 5-phosphate that all appeared noncompetitive when...
Modulation of hyaluronan synthase activity in cellular membrane fractions
Vigetti, Davide; Genasetti, A; Karousou, Evgenia; Viola, Manuela; Clerici, M; Bartolini, B; Moretto, Paola; DE LUCA, Giancarlo; Hascall, Vc; Passi, Alberto
2009-01-01
Hyaluronan (HA), the only non-sulfated glycosaminoglycan, is involved in morphogenesis, wound healing, inflammation, angiogenesis, and cancer. In mammals, HA is synthesized by three homologous HA synthases, HAS1, HAS2, and HAS3, that polymerize the HA chain using UDP-glucuronic acid and UDP-N-acetylglucosamine as precursors. Since the amount of HA is critical in several pathophysiological conditions, we developed a non-radioactive assay for measuring the activity of HA synthases (HASs) in euk...
Stereochemical course of enzyme-catalyzed aminopropyl transfer: spermidine synthase
International Nuclear Information System (INIS)
Kullberg, D.W.; Orr, G.R.; Coward, J.K.
1986-01-01
The R and S enantionmers of S-adenosyl-3-[ 2 H]3-(methylthio)-1-propylamine (decarboxylated S-adenosylmethionine), previously synthesized in this laboratory, were incubated with [1,4- 2 H 4 ]-putrescine in the presence of spermidine synthase from E. coli. The resulting chiral [ 2 H 5 ]spermidines were isolated and converted to their N 1 ,N 7 -dibocspermidine-N 4 -(1S,4R)-camphanamides. The derivatives were analyzed by 500 MHz 1 H-NMR and the configuration of the chiral center assigned by correlation with the spectra of synthetic chiral [ 2 H 3 ]dibocspermidine camphanamide standards. The enzyme-catalyzed aminopropyl transfer was shown to occur with net retention of configuration, indicative of a double-displacement mechanism. This result concurs with that of a previous steady-state kinetics study of spermidine synthase isolated from E. coli, but contradicts the single-displacement mechanism suggested by a stereochemical analysis of chiral spermidines biosynthesized in E. coli treated with chirally deuterated methionines. It also indicates that this aminopropyltransferase is mechanistically distinct from the methyltransferases, which have been shown to act via a single-displacement mechanism (net inversion at -CH 3 ) in all cases studied to date
Directory of Open Access Journals (Sweden)
Maiko Furubayashi
Full Text Available Terpene synthases catalyze the formation of a variety of terpene chemical structures. Systematic mutagenesis studies have been effective in providing insights into the characteristic and complex mechanisms of C-C bond formations and in exploring the enzymatic potential for inventing new chemical structures. In addition, there is growing demand to increase terpene synthase activity in heterologous hosts, given the maturation of metabolic engineering and host breeding for terpenoid synthesis. We have developed a simple screening method for the cellular activities of terpene synthases by scoring their substrate consumption based on the color loss of the cell harboring carotenoid pathways. We demonstrate that this method can be used to detect activities of various terpene synthase or prenyltransferase genes in a high-throughput manner, irrespective of the product type, enabling the mutation analysis and directed evolution of terpene synthases. We also report the possibility for substrate-specific screening system of terpene synthases by taking advantage of the substrate-size specificity of C30 and C40 carotenoid pathways.
Cloning and sequence analysis of putative type II fatty acid synthase ...
Indian Academy of Sciences (India)
Prakash
Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. ... acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP .... Helix II plays a dominant role in the interaction ... main distinguishing features of plant ACPs in plastids and ..... synthase component; J. Biol.
Landmann, Christian; Fink, Barbara; Festner, Maria; Dregus, Márta; Engel, Karl-Heinz; Schwab, Wilfried
2007-09-15
The essential oil of lavender (Lavandula angustifolia) is mainly composed of mono- and sesquiterpenes. Using a homology-based PCR strategy, two monoterpene synthases (LaLIMS and LaLINS) and one sesquiterpene synthase (LaBERS) were cloned from lavender leaves and flowers. LaLIMS catalyzed the formation of (R)-(+)-limonene, terpinolene, (1R,5S)-(+)-camphene, (1R,5R)-(+)-alpha-pinene, beta-myrcene and traces of alpha-phellandrene. The proportions of these products changed significantly when Mn(2+) was supplied as the cofactor instead of Mg(2+). The second enzyme LaLINS produced exclusively (R)-(-)-linalool, the main component of lavender essential oil. LaBERS transformed farnesyl diphosphate and represents the first reported trans-alpha-bergamotene synthase. It accepted geranyl diphosphate with higher affinity than farnesyl diphosphate and also produced monoterpenes, albeit at low rates. LaBERS is probably derived from a parental monoterpene synthase by the loss of the plastidial signal peptide and by broadening its substrate acceptance spectrum. The identification and description of the first terpene synthases from L. angustifolia forms the basis for the biotechnological modification of essential oil composition in lavender.
Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw
Directory of Open Access Journals (Sweden)
Yanjing Su
2012-06-01
Full Text Available Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase and its wild type (WT were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p0.05 was detected in neutral detergent fiber (NDFom and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05. The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05, but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants.
Directory of Open Access Journals (Sweden)
Aboukhatwa Marwa A
2010-01-01
Full Text Available Abstract Background Recent studies demonstrate that diverse antidepressant agents increase the cellular production of the nucleolipid CDP-diacylglycerol and its synthetic derivative, phosphatidylinositol, in depression-relevant brain regions. Pharmacological blockade of downstream phosphatidylinositide signaling disrupted the behavioral antidepressant effects in rats. However, the nucleolipid responses were resistant to inhibition by serotonin receptor antagonists, even though antidepressant-facilitated inositol phosphate accumulation was blocked. Could the neurochemical effects be additional to the known effects of the drugs on monoamine transmitter transporters? To examine this question, we tested selected agents in serotonin-depleted brain tissues, in PC12 cells devoid of serotonin transporters, and on the enzymatic activity of brain CDP-diacylglycerol synthase - the enzyme that catalyzes the physiological synthesis of CDP-diacylglycerol. Results Imipramine, paroxetine, and maprotiline concentration-dependently increased the levels of CDP-diacylglycerol and phosphatidylinositides in PC12 cells. Rat forebrain tissues depleted of serotonin by pretreatment with p-chlorophenylalanine showed responses to imipramine or maprotiline that were comparable to respective responses from saline-injected controls. With fluoxetine, nucleolipid responses in the serotonin-depleted cortex or hippocampus were significantly reduced, but not abolished. Each drug significantly increased the enzymatic activity of CDP-diacylglycerol synthase following incubations with cortical or hippocampal brain tissues. Conclusion Antidepressants probably induce the activity of CDP-diacylglycerol synthase leading to increased production of CDP-diacylglycerol and facilitation of downstream phosphatidylinositol synthesis. Phosphatidylinositol-dependent signaling cascades exert diverse salutary effects in neural cells, including facilitation of BDNF signaling and neurogenesis. Hence
Nitric oxide synthase inhibition does not improve renal function in cirrhotic patients with ascites
DEFF Research Database (Denmark)
Thiesson, Helle C; Skøtt, Ole; Jespersen, Bente
2003-01-01
because of a reduction in renal blood flow of up to 29.1 +/- 8.1% (p inhibition of NO synthesis does not improve sodium and water excretion in decompensated cirrhosis, probably because of an accompanying decrease in renal...
Motta-Mejia, Carolina; Kandzija, Neva; Zhang, Wei; Mhlomi, Vuyane; Cerdeira, Ana Sofia; Burdujan, Alexandra; Tannetta, Dionne; Dragovic, Rebecca; Sargent, Ian L; Redman, Christopher W; Kishore, Uday; Vatish, Manu
2017-08-01
Preeclampsia, a multisystem hypertensive disorder of pregnancy, is associated with increased systemic vascular resistance. Placentae from patients with preeclampsia have reduced levels of endothelial nitric oxide synthase (eNOS) and, thus, less nitric oxide (NO). Syncytiotrophoblast extracellular vesicles (STBEV), comprising microvesicles (STBMV) and exosomes, carry signals from the syncytiotrophoblast to the mother. We hypothesized that STBEV-bound eNOS (STBEV-eNOS), capable of producing NO, are released into the maternal circulation. Dual-lobe ex vivo placental perfusion and differential centrifugation was used to isolate STBEV from preeclampsia (n=8) and normal pregnancies (NP; n=11). Plasma samples of gestational age-matched preeclampsia and NP (n=6) were used to isolate circulating STBMV. STBEV expressed placental alkaline phosphatase, confirming placental origin. STBEV coexpressed eNOS, but not inducible nitric oxide synthase, confirmed using Western blot, flow cytometry, and immunodepletion. STBEV-eNOS produced NO, which was significantly inhibited by N G -nitro-l-arginine methyl ester (eNOS inhibitor; P preeclampsia-perfused placentae had lower levels of STBEV-eNOS (STBMV; P preeclampsia women had lower STBEV-eNOS expression compared with that from NP women ( P preeclampsia placentae, as well as in plasma. The lower STBEV-eNOS NO production seen in preeclampsia may contribute to the decreased NO bioavailability in this disease. © 2017 The Authors.
DEFF Research Database (Denmark)
von Wettstein, Penny
2017-01-01
The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...
Fluoxetine Inhibits Natural Decay of Long-Term Memory via Akt/GSK-3β Signaling.
Yi, Jee Hyun; Zhang, JiaBao; Ko, Sang Yoon; Kwon, Huiyoung; Jeon, Se Jin; Park, Se Jin; Jung, Jiwook; Kim, Byung C; Lee, Young Choon; Kim, Dong Hyun; Ryu, Jong Hoon
2018-02-09
Understanding the mechanisms underlying the natural decay of long-term memory can help us find means of extending the duration of long-term memory. However, the neurobiological processes involved in the decay of long-term memory are poorly understood. In the present study, we examined the effect of acute and chronic treatment of fluoxetine on natural decay of long-term memory and the possible mechanism. Late administration of fluoxetine prolonged the persistence of long-term memory in mice, as demonstrated by object location recognition and Barnes maze tests. Fluoxetine altered Akt/glycogen synthase kinase-3β (GSK-3β)/β-catenin signaling in the hippocampus. Late short- and long-term pharmacological inhibition of GSK-3β mimicked the effect of fluoxetine on memory persistence. Pharmacological inhibition of Akt blocked the effect of fluoxetine on memory persistence. Finally, late infusion of fluoxetine increased hippocampal long-term potentiation (LTP) and pharmacological inhibition of GSK-3β blocked the natural decline in LTP. These results demonstrate that GSK-3β might be a key molecule in memory decay process, and fluoxetine extends the period of long-term memory maintenance via Akt/GSK-3β signaling.
Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase
International Nuclear Information System (INIS)
Dotson, G.D.; Woodard, R.W.
1994-01-01
The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3 2 H)PEP, (2- 13 C)PEP, and (2- 13 C, 18 O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our 1 H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3- 2 H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3- 2 H)PEP gave predominantly (3S)-(3 2 H)KDO 8-P and (E)-(3- 2 H)PEP gave predominantly (3R)-(3 2 H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2- 13 C, 18 O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both 13 C- and 31 P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the 18 O
Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase
Energy Technology Data Exchange (ETDEWEB)
Dotson, G.D.; Woodard, R.W. [Univ. of Michigan, Ann Arbor, MI (United States)
1994-12-01
The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3{sup 2}H)PEP, (2-{sup 13}C)PEP, and (2-{sup 13}C,{sup 18}O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our {sup 1}H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3-{sup 2}H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3-{sup 2}H)PEP gave predominantly (3S)-(3{sup 2}H)KDO 8-P and (E)-(3-{sup 2}H)PEP gave predominantly (3R)-(3{sup 2}H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2-{sup 13}C, {sup 18}O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both {sup 13}C- and {sup 31}P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the {sup 18}O.
Czech Academy of Sciences Publication Activity Database
Holáň, Vladimír; Pindjáková, Jana; Zajícová, Alena; Krulová, Magdalena; Železná, Blanka; Matoušek, Petr; Svoboda, Petr
2005-01-01
Roč. 12, č. 3 (2005), s. 227-234 ISSN 0908-665X R&D Projects: GA MZd(CZ) NR7816; GA ČR(CZ) GP310/02/D162; GA ČR(CZ) GD310/03/H147; GA MŠk(CZ) ME 300; GA AV ČR KSK5020115 Institutional research plan: CEZ:AV0Z5052915; CEZ:AV0Z50110509 Keywords : inducible nitric oxide synthase production * nitric oxide * suppressive molecule Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.114, year: 2005
Crystallization of Δ1-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa
International Nuclear Information System (INIS)
Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi; Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota; Shoyama, Yukihiro; Morimoto, Satoshi
2005-01-01
Δ 1 -Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ 1 -Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å 3 Da −1 assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively
Directory of Open Access Journals (Sweden)
Abir U Igamberdiev
2015-01-01
Full Text Available The bulk of ATP synthesis in plants is performed by ATP synthase, the main bioenergetics engine of cells, operating both in mitochondria and in chloroplasts. The reaction mechanism of ATP synthase has been studied in detail for over half a century; however, its optimal performance depends also on the steady delivery of ATP synthase substrates and the removal of its products. For mitochondrial ATP synthase, we analyze here the provision of stable conditions for (i the supply of ADP and Mg2+, supported by adenylate kinase (AK equilibrium in the intermembrane space, (ii the supply of phosphate via membrane transporter in symport with H+, and (iii the conditions of outflow of ATP by adenylate transporter carrying out the exchange of free adenylates. We also show that, in chloroplasts, AK equilibrates adenylates and governs Mg2+ contents in the stroma, optimizing ATP synthase and Calvin cycle operation, and affecting the import of inorganic phosphate in exchange with triose phosphates. It is argued that chemiosmosis is not the sole component of ATP synthase performance, which also depends on AK-mediated equilibrium of adenylates and Mg2+, adenylate transport and phosphate release and supply.
Incorporation of phosphate into glycogen by glycogen synthase.
Contreras, Christopher J; Segvich, Dyann M; Mahalingan, Krishna; Chikwana, Vimbai M; Kirley, Terence L; Hurley, Thomas D; DePaoli-Roach, Anna A; Roach, Peter J
2016-05-01
The storage polymer glycogen normally contains small amounts of covalently attached phosphate as phosphomonoesters at C2, C3 and C6 atoms of glucose residues. In the absence of the laforin phosphatase, as in the rare childhood epilepsy Lafora disease, the phosphorylation level is elevated and is associated with abnormal glycogen structure that contributes to the pathology. Laforin therefore likely functions in vivo as a glycogen phosphatase. The mechanism of glycogen phosphorylation is less well-understood. We have reported that glycogen synthase incorporates phosphate into glycogen via a rare side reaction in which glucose-phosphate rather than glucose is transferred to a growing polyglucose chain (Tagliabracci et al. (2011) Cell Metab13, 274-282). We proposed a mechanism to account for phosphorylation at C2 and possibly at C3. Our results have since been challenged (Nitschke et al. (2013) Cell Metab17, 756-767). Here we extend the evidence supporting our conclusion, validating the assay used for the detection of glycogen phosphorylation, measurement of the transfer of (32)P from [β-(32)P]UDP-glucose to glycogen by glycogen synthase. The (32)P associated with the glycogen fraction was stable to ethanol precipitation, SDS-PAGE and gel filtration on Sephadex G50. The (32)P-signal was not affected by inclusion of excess unlabeled UDP before analysis or by treatment with a UDPase, arguing against the signal being due to contaminating [β-(32)P]UDP generated in the reaction. Furthermore, [(32)P]UDP did not bind non-covalently to glycogen. The (32)P associated with glycogen was released by laforin treatment, suggesting that it was present as a phosphomonoester. The conclusion is that glycogen synthase can mediate the introduction of phosphate into glycogen, thereby providing a possible mechanism for C2, and perhaps C3, phosphorylation. Copyright © 2016 Elsevier Inc. All rights reserved.
Magi, Shigeyuki; Shitara, Tetsuo; Takemoto, Yasushi; Sawada, Masato; Kitagawa, Mitsuhiro; Tashiro, Etsu; Takahashi, Yoshikazu; Imoto, Masaya
2013-03-01
In the course of screening for an inhibitor of farnesyl transferase (FTase), we identified two compounds, N-benzyl-aclacinomycin A (ACM) and N-allyl-ACM, which are new derivatives of ACM. N-benzyl-ACM and N-allyl-ACM inhibited FTase activity with IC50 values of 0.86 and 2.93 μM, respectively. Not only ACM but also C-10 epimers of each ACM derivative failed to inhibit FTase. The inhibition of FTase by N-benzyl-ACM and N-allyl-ACM seems to be specific, because these two compounds did not inhibit geranylgeranyltransferase or geranylgeranyl pyrophosphate (GGPP) synthase up to 100 μM. In cultured A431 cells, N-benzyl-ACM and N-allyl-ACM also blocked both the membrane localization of H-Ras and activation of the H-Ras-dependent PI3K/Akt pathway. In addition, they inhibited epidermal growth factor (EGF)-induced migration of A431 cells. Thus, N-benzyl-ACM and N-allyl-ACM inhibited EGF-induced migration of A431 cells by inhibiting the farnesylation of H-Ras and subsequent H-Ras-dependent activation of the PI3K/Akt pathway.
International Nuclear Information System (INIS)
Takabe, Piia; Bart, Geneviève; Ropponen, Antti; Rilla, Kirsi; Tammi, Markku; Tammi, Raija; Pasonen-Seppänen, Sanna
2015-01-01
Malignant skin melanoma is one of the most deadly human cancers. Extracellular matrix (ECM) influences the growth of malignant tumors by modulating tumor cells adhesion and migration. Hyaluronan is an essential component of the ECM, and its amount is altered in many tumors, suggesting an important role for hyaluronan in tumorigenesis. Nonetheless its role in melanomagenesis is not understood. In this study we produced a MV3 melanoma cell line with inducible expression of the hyaluronan synthase 3 (HAS3) and studied its effect on the behavior of the melanoma cells. HAS3 overexpression expanded the cell surface hyaluronan coat and decreased melanoma cell adhesion, migration and proliferation by cell cycle arrest at G1/G0. Melanoma cell migration was restored by removal of cell surface hyaluronan by Streptomyces hyaluronidase and by receptor blocking with hyaluronan oligosaccharides, while the effect on cell proliferation was receptor independent. Overexpression of HAS3 decreased ERK1/2 phosphorylation suggesting that inhibition of MAP-kinase signaling was responsible for these suppressive effects on the malignant phenotype of MV3 melanoma cells. - Highlights: • Inducible HAS3-MV3 melanoma cell line was generated using Lentiviral transduction. • HAS3 overexpression inhibits MV3 cell migration via hyaluronan–receptor interaction. • HAS3 overexpression decreases MV3 melanoma cell proliferation and adhesion. • ERK1/2 phosphorylation is downregulated by 50% in HAS3 overexpressing cells. • The results suggest that hyaluronan has anti-cancer like effects in melanoma
Energy Technology Data Exchange (ETDEWEB)
Takabe, Piia, E-mail: piia.takabe@uef.fi [University of Eastern Finland, Institute of Biomedicine, 70211 Kuopio (Finland); Bart, Geneviève [University of Eastern Finland, Institute of Biomedicine, 70211 Kuopio (Finland); Ropponen, Antti [University of Eastern Finland, Institute of Clinical Medicine, 70211 Kuopio (Finland); Rilla, Kirsi; Tammi, Markku; Tammi, Raija; Pasonen-Seppänen, Sanna [University of Eastern Finland, Institute of Biomedicine, 70211 Kuopio (Finland)
2015-09-10
Malignant skin melanoma is one of the most deadly human cancers. Extracellular matrix (ECM) influences the growth of malignant tumors by modulating tumor cells adhesion and migration. Hyaluronan is an essential component of the ECM, and its amount is altered in many tumors, suggesting an important role for hyaluronan in tumorigenesis. Nonetheless its role in melanomagenesis is not understood. In this study we produced a MV3 melanoma cell line with inducible expression of the hyaluronan synthase 3 (HAS3) and studied its effect on the behavior of the melanoma cells. HAS3 overexpression expanded the cell surface hyaluronan coat and decreased melanoma cell adhesion, migration and proliferation by cell cycle arrest at G1/G0. Melanoma cell migration was restored by removal of cell surface hyaluronan by Streptomyces hyaluronidase and by receptor blocking with hyaluronan oligosaccharides, while the effect on cell proliferation was receptor independent. Overexpression of HAS3 decreased ERK1/2 phosphorylation suggesting that inhibition of MAP-kinase signaling was responsible for these suppressive effects on the malignant phenotype of MV3 melanoma cells. - Highlights: • Inducible HAS3-MV3 melanoma cell line was generated using Lentiviral transduction. • HAS3 overexpression inhibits MV3 cell migration via hyaluronan–receptor interaction. • HAS3 overexpression decreases MV3 melanoma cell proliferation and adhesion. • ERK1/2 phosphorylation is downregulated by 50% in HAS3 overexpressing cells. • The results suggest that hyaluronan has anti-cancer like effects in melanoma.
Kellogg, Dean L; McCammon, Karen M; Hinchee-Rodriguez, Kathryn S; Adamo, Martin L; Roman, Linda J
2017-09-01
Previously published studies strongly suggested that insulin- and exercise-induced skeletal muscle glucose uptake require nitric oxide (NO) production. However, the signal transduction mechanisms by which insulin and contraction regulated NO production and subsequent glucose transport are not known. In the present study, we utilized the myotube cell lines treated with insulin or hydrogen peroxide, the latter to mimic contraction-induced oxidative stress, to characterize these mechanisms. We found that insulin stimulation of neuronal nitric oxide synthase (nNOS) phosphorylation, NO production, and GLUT4 translocation were all significantly reduced by inhibition of either nNOS or Akt2. Hydrogen peroxide (H 2 O 2 ) induced phosphorylation of nNOS at the same residue as did insulin, and also stimulated NO production and GLUT4 translocation. nNOS inhibition prevented H 2 O 2 -induced GLUT4 translocation. AMP activated protein kinase (AMPK) inhibition prevented H 2 O 2 activation and phosphorylation of nNOS, leading to reduced NO production and significantly attenuated GLUT4 translocation. We conclude that nNOS phosphorylation and subsequently increased NO production are required for both insulin- and H 2 O 2 -stimulated glucose transport. Although the two stimuli result in phosphorylation of the same residue on nNOS, they do so through distinct protein kinases. Thus, insulin and H 2 O 2 -activated signaling pathways converge on nNOS, which is a common mediator of glucose uptake in both pathways. However, the fact that different kinases are utilized provides a basis for the use of exercise to activate glucose transport in the face of insulin resistance. Copyright © 2017. Published by Elsevier Inc.
Structure of dimeric, recombinant Sulfolobus solfataricus phosphoribosyl diphosphate synthase
DEFF Research Database (Denmark)
Andersen, Rune W.; Lo Leggio, Leila; Hove-Jensen, Bjarne
2015-01-01
The enzyme 5-phosphoribosyl-1-α-diphosphate (PRPP) synthase (EC 2.7.6.1) catalyses the Mg2+-dependent transfer of a diphosphoryl group from ATP to the C1 hydroxyl group of ribose 5-phosphate resulting in the production of PRPP and AMP. A nucleotide sequence specifying Sulfolobus solfataricus PRPP...
International Nuclear Information System (INIS)
Barchowsky, A.; Tabrizi, K.; Kent, R.S.; Whorton, A.R.
1989-01-01
We have examined the effects of menadione on porcine aortic endothelial cell prostaglandin synthesis. Addition of 1-20 microM menadione caused a dose- and time-dependent inhibition of stimulated prostaglandin synthesis with an IC50 of 5 microM at 15 min. Concentrations greater than 100 microM menadione were necessary to increase 51 Cr release from prelabeled cells. Recovery of enzyme inactivated by menadione required a 6-h incubation in 1% serum. In a microsomal preparation, menadione was shown to have no direct effect on conversion of arachidonic acid to prostaglandins. In intact cells menadione caused only a 40% inhibition of the conversion of PGH2 to prostacyclin. Enzymes involved in the incorporation and the release of arachidonic acid were not affected by menadione (20 microM, 15 min). Menadione undergoes oxidation/reduction reactions in intact cells leading to partial reduction of oxygen-forming, reactive oxygen species. In our cells menadione was found to increase KCN-resistant oxygen consumption. Further, an increased accumulation of H 2 O 2 was observed with a time course consistent with menadione-induced inhibition of prostaglandin synthesis. We conclude that menadione at sublethal doses caused inhibition of prostaglandin synthesis. The mechanism involves inactivation of PGH2 synthase by a reactive species resulting from metabolism of menadione by endothelial cells
Gaucher-Wieczorek, Florence; Guérineau, Vincent; Touboul, David; Thétiot-Laurent, Sophie; Pelissier, Franck; Badet-Denisot, Marie-Ange; Badet, Bernard; Durand, Philippe
2014-08-01
Glucosamine-6-phosphate synthase (GlmS, EC 2.6.1.16) catalyzes the first and rate-limiting step in the hexosamine biosynthetic pathway, leading to the synthesis of uridine-5'-diphospho-N-acetyl-D-glucosamine, the major building block for the edification of peptidoglycan in bacteria, chitin in fungi, and glycoproteins in mammals. This bisubstrate enzyme converts D-fructose-6-phosphate (Fru-6P) and L-glutamine (Gln) into D-glucosamine-6-phosphate (GlcN-6P) and L-glutamate (Glu), respectively. We previously demonstrated that matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) allows determination of the kinetic parameters of the synthase activity. We propose here to refine the experimental protocol to quantify Glu and GlcN-6P, allowing determination of both hemisynthase and synthase parameters from a single assay kinetic experiment, while avoiding interferences encountered in other assays. It is the first time that MALDI-MS is used to survey the activity of a bisubstrate enzyme. Copyright © 2014 Elsevier Inc. All rights reserved.
Enhancement of vascular targeting by inhibitors of nitric oxide synthase
International Nuclear Information System (INIS)
Davis, Peter D.; Tozer, Gillian M.; Naylor, Matthew A.; Thomson, Peter; Lewis, Gemma; Hill, Sally A.
2002-01-01
Purpose: This study investigates the enhancement of the vascular targeting activity of the tubulin-binding agent combretastatin A4 phosphate (CA4P) by various inhibitors of nitric oxide synthases. Methods and Materials: The syngeneic tumors CaNT and SaS growing in CBA mice were used for this study. Reduction in perfused vascular volume was measured by injection of Hoechst 33342 24 h after drug administration. Necrosis (hematoxylin and eosin stain) was assessed also at 24 h after treatment. Combretastatin A4 phosphate was synthesized by a modification of the published procedure and the nitric oxide synthase inhibitors L-NNA, L-NMMA, L-NIO, L-NIL, S-MTC, S-EIT, AMP, AMT, and L-TC, obtained from commercial sources. Results: A statistically significant augmentation of the reduction in perfused vascular volume by CA4P in the CaNT tumor was observed with L-NNA, AMP, and AMT. An increase in CA4P-induced necrosis in the same tumor achieved significance with L-NNA, L-NMMA, L-NIL, and AMT. CA4P induced little necrosis in the SaS tumor, but combination with the inhibitors L-NNA, L-NMMA, L-NIO, S-EIT, and L-TC was effective. Conclusions: Augmentation of CA4P activity by nitric oxide synthase inhibitors of different structural classes supports a nitric oxide-related mechanism for this effect. L-NNA was the most effective inhibitor studied
Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.
Directory of Open Access Journals (Sweden)
Kattina Zavala
Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.
Isolation and Characterization of Three New Monoterpene Synthases from Artemisia annua
Ruan, Ju-Xin; Li, Jian-Xu; Fang, Xin; Wang, Ling-Jian; Hu, Wen-Li; Chen, Xiao-Ya; Yang, Chang-Qing
2016-01-01
Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5, and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography–mass spectrometry detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate, salicylic acid, and gibberellin, suggesting a role of these monoterpene synthases in plant–environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant. PMID:27242840
Isolation and characterization of three new monoterpene synthases from Artemisia annua
Directory of Open Access Journals (Sweden)
Ju-Xin eRuan
2016-05-01
Full Text Available Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5 and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography-mass spectrometry (GC-MS detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate (MeJA, salicylic acid (SA and gibberellin (GA, suggesting a role of these monoterpene synthases in plant-environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant.
Endothelial nitric oxide synthase gene polymorphisms associated ...
African Journals Online (AJOL)
STORAGESEVER
2010-05-24
May 24, 2010 ... chronic periodontitis (CP), 31 with gingivitis (G) and 50 healthy controls. Probing depth ..... Periodontal disease in pregnancy I. Prevalence and severity. ... endothelial nitric oxide synthase gene in premenopausal women with.
Stochastic thermodynamics of a chemical nanomachine: The channeling enzyme tryptophan synthase.
Loutchko, Dimitri; Eisbach, Maximilian; Mikhailov, Alexander S
2017-01-14
The enzyme tryptophan synthase is characterized by a complex pattern of allosteric interactions that regulate the catalytic activity of its two subunits and opening or closing of their ligand gates. As a single macromolecule, it implements 13 different reaction steps, with an intermediate product directly channeled from one subunit to another. Based on experimental data, a stochastic model for the operation of tryptophan synthase has been earlier constructed [D. Loutchko, D. Gonze, and A. S. Mikhailov, J. Phys. Chem. B 120, 2179 (2016)]. Here, this model is used to consider stochastic thermodynamics of such a chemical nanomachine. The Gibbs energy landscape of the internal molecular states is determined, the production of entropy and its flow within the enzyme are analyzed, and the information exchange between the subunits resulting from allosteric cross-regulations and channeling is discussed.
Polyketide synthases from poison hemlock (Conium maculatum L.).
Hotti, Hannu; Seppänen-Laakso, Tuulikki; Arvas, Mikko; Teeri, Teemu H; Rischer, Heiko
2015-11-01
Coniine is a toxic alkaloid, the biosynthesis of which is not well understood. A possible route, supported by evidence from labelling experiments, involves a polyketide formed by the condensation of one acetyl-CoA and three malonyl-CoAs catalysed by a polyketide synthase (PKS). We isolated PKS genes or their fragments from poison hemlock (Conium maculatum L.) by using random amplification of cDNA ends (RACE) and transcriptome analysis, and characterized three full-length enzymes by feeding different starter-CoAs in vitro. On the basis of our in vitro experiments, two of the three characterized PKS genes in poison hemlock encode chalcone synthases (CPKS1 and CPKS2), and one encodes a novel type of PKS (CPKS5). We show that CPKS5 kinetically favours butyryl-CoA as a starter-CoA in vitro. Our results suggest that CPKS5 is responsible for the initiation of coniine biosynthesis by catalysing the synthesis of the carbon backbone from one butyryl-CoA and two malonyl-CoAs. © 2015 FEBS.
Yamane, Satoshi; Kanno, Toshio; Nakamura, Hiroyuki; Fujino, Hiromichi; Murayama, Toshihiko
2014-10-05
Hydrogen sulfide (H2S) is considered to be a signaling molecule. The precise mechanisms underlying H2S-related events, including the producing enzymes and target molecules in gastrointestinal tissues, have not been elucidated in detail. We herein examined the involvement of H2S in contractions induced by repeated electrical stimulations (ES). ES-induced contractions were neurotoxin-sensitive and increased by aminooxyacetic acid, an inhibitor of cystathionine β-synthase (CBS) and cystathionine γ-lyase, but not by D,L-propargylglycine, a selective inhibitor of cystathionine γ-lyase, in an ES trial-dependent manner. ES-induced contractions were markedly decreased in the presence of L-cysteine. This response was inhibited by aminooxyacetic acid and an antioxidant, and accelerated by L-methionine, an activator of CBS. The existence of CBS was confirmed. NaHS transiently inhibited ES- and acetylcholine-induced contractions, and sustainably decreased basal tone for at least 20 min after its addition. The treatment with glibenclamide, an ATP-sensitive K+ channel blocker, reduced both the L-cysteine response and NaHS-induced inhibition of contractions. The NaHS-induced decrease in basal tone was inhibited by apamin, a small conductance Ca2+-activated K+ channel blocker. These results suggest that H2S may be endogenously produced via CBS in ES-activated enteric neurons, and regulates contractility via multiple K+ channels in the ileum. Copyright © 2014 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Hildgund Schrempf
2010-09-01
Full Text Available A new assay system for chitin has been developed. It comprises the chitin-binding protein ChbB in fusion with a His-tag as well as with a Strep-tag, the latter of which was chemically coupled to horseradish peroxidase. With the resulting complex, minimal quantities of chitin are photometrically detectable. In addition, the assay allows rapid scoring of the activity of chitin-synthases. As a result, a refined procedure for the rapid purification of yeast chitosomes (nano-machineries for chitin biosynthesis has been established. Immuno-electronmicroscopical studies of purified chitosomes, gained from a yeast strain carrying a chitin-synthase gene fused to that for GFP (green-fluorescence protein, has led to the in situ localization of chitin-synthase-GFP molecules within chitosomes.
Directory of Open Access Journals (Sweden)
Irene Mavelli
2012-02-01
Full Text Available Warburg’s hypothesis has been challenged by a number of studies showing that oxidative phosphorylation is repressed in some tumors, rather than being inactive per se. Thus, treatments able to shift energy metabolism by activating mitochondrial pathways have been suggested as an intriguing basis for the optimization of antitumor strategies. In this study, HepG2 hepatocarcinoma cells were cultivated with different metabolic substrates under conditions mimicking “positive” (activation/biogenesis or “negative” (silencing mitochondrial adaptation. In addition to the expected up-regulation of mitochondrial biogenesis, glucose deprivation caused an increase in phosphorylating respiration and a rise in the expression levels of the ATP synthase β subunit and Inhibitor Factor 1 (IF1. Hyperglycemia, on the other hand, led to a markedly decreased level of the transcriptional coactivator PGC-α suggesting down-regulation of mitochondrial biogenesis, although no change in mitochondrial mass and no impairment of phosphorylating respiration were observed. Moreover, a reduction in mitochondrial networking and in ATP synthase dimer stability was produced. No effect on β-ATP synthase expression was elicited. Notably, hyperglycemia caused an increase in IF1 expression levels, but it did not alter the amount of IF1 associated with ATP synthase. These results point to a new role of IF1 in relation to high glucose utilization by tumor cells, in addition to its well known effect upon mitochondrial ATP synthase regulation.
Lücker, Joost; Schwab, Wilfried; van Hautum, Bianca; Blaas, Jan; van der Plas, Linus H. W.; Bouwmeester, Harro J.; Verhoeven, Harrie A.
2004-01-01
Wild-type tobacco (Nicotiana tabacum) plants emit low levels of terpenoids, particularly from the flowers. By genetic modification of tobacco cv Petit Havana SR1 using three different monoterpene synthases from lemon (Citrus limon L. Burm. f.) and the subsequent combination of these three into one plant by crossings, we show that it is possible to increase the amount and alter the composition of the blend of monoterpenoids produced in tobacco plants. The transgenic tobacco plant line with the three introduced monoterpene synthases is emitting β-pinene, limonene, and γ-terpinene and a number of side products of the introduced monoterpene synthases, from its leaves and flowers, in addition to the terpenoids emitted by wild-type plants. The results show that there is a sufficiently high level of substrate accessible for the introduced enzymes. PMID:14718674
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne; Bentsen, Ann-Kristin K; Harlow, Kenneth W
2005-01-01
Eleven of the codons specifying the amino acids of the flexible catalytic loop [KRRPRPNVAEVM(197-208)] of Bacillus subtilis phosphoribosyl diphosphate synthase have been changed individually to specify alanine. The resulting variant enzyme forms, as well as the wildtype enzyme, were produced...... in an Escherichia coli strain lacking endogenous phosphoribosyl diphosphate synthase activity and purified to near homogeneity. The B. subtilis phosphoribosyl diphosphate synthase mutant variants K197A and R199A were studied in detail. The physical properties of the two enzymes were similar to those of the wildtype...
Prosser, Ian; Altug, Iris G; Phillips, Andy L; König, Wilfried A; Bouwmeester, Harro J; Beale, Michael H
2004-12-15
The naturally occurring, volatile sesquiterpene hydrocarbon germacrene D has strong effects on insect behaviour and genes encoding enzymes that produce this compound are of interest in the study of plant-insect interactions and in a number of biotechnological approaches to pest control. Goldenrod, Solidago canadensis, is unusual in that it produces both enantiomers of germacrene D. Two new sesquiterpene synthase cDNAs, designated Sc11 and Sc19, have been isolated from goldenrod and functional expression in Escherichia coli identified Sc11 as (+)-germacrene D synthase and Sc19 as (-)-germacrene D synthase. Thus, the enantiomers of germacrene D are the products of separate, but closely related (85% amino-acid identity), enzymes. Unlike other sesquiterpene synthases and the related monoterpene synthases and prenyl transferases, which contain the characteristic amino-acid motif DDXX(D,E), Sc11 is unusual in that this motif occurs as (303)NDTYD. Mutagenesis of this motif to (303)DDTYD gave rise to an enzyme that fully retained (+)-germacrene D synthase activity. The converse mutation in Sc19 (D303N) resulted in a less efficient but functional enzyme. Mutagenesis of position 303 to glutamate in both enzymes resulted in loss of activity. These results indicate that the magnesium ion-binding role of the first aspartate in the DDXXD motif may not be as critical as previously thought. Further amino-acid sequence comparisons and molecular modelling of the enzyme structures revealed that very subtle changes to the active site of this family of enzymes are required to alter the reaction pathway to form, in this case, different enantiomers from the same enzyme-bound carbocationic intermediate.
Sitthithaworn, W; Kojima, N; Viroonchatapan, E; Suh, D Y; Iwanami, N; Hayashi, T; Noji, M; Saito, K; Niwa, Y; Sankawa, U
2001-02-01
cDNAs encoding geranylgeranyl diphosphate synthase (GGPPS) of two diterpene-producing plants, Scoparia dulcis and Croton sublyratus, have been isolated using the homology-based polymerase chain reaction (PCR) method. Both clones contained highly conserved aspartate-rich motifs (DDXX(XX)D) and their N-terminal residues exhibited the characteristics of chloroplast targeting sequence. When expressed in Escherichia coli, both the full-length and truncated proteins in which the putative targeting sequence was deleted catalyzed the condensation of farnesyl diphosphate and isopentenyl diphosphate to produce geranylgeranyl diphosphate (GGPP). The structural factors determining the product length in plant GGPPSs were investigated by constructing S. dulcis GGPPS mutants on the basis of sequence comparison with the first aspartate-rich motif (FARM) of plant farnesyl diphosphate synthase. The result indicated that in plant GGPPSs small amino acids, Met and Ser, at the fourth and fifth positions before FARM and Pro and Cys insertion in FARM play essential roles in determination of product length. Further, when a chimeric gene comprised of the putative transit peptide of the S. dulcis GGPPS gene and a green fluorescent protein was introduced into Arabidopsis leaves by particle gun bombardment, the chimeric protein was localized in chloroplasts, indicating that the cloned S. dulcis GGPPS is a chloroplast protein.
Kundu, Juthika; Wahab, S M Riajul; Kundu, Joydeb Kumar; Choi, Yoon-La; Erkin, Ozgur Cem; Lee, Hun Seok; Park, Sang Gyu; Shin, Young Kee
2012-09-01
Transducer of ErbB-2.1 (Tob1), a tumor suppressor protein, is inactivated in a variety of cancers including stomach cancer. However, the role of Tob1 in gastric carcinogenesis remains elusive. The present study aimed to investigate whether Tob1 could inhibit gastric cancer progression in vitro, and to elucidate its underlying molecular mechanisms. We found differential expression of Tob1 in human gastric cancer (MKN28, AGS and MKN1) cells. The overexpression of Tob1 induced apoptosis in MKN28 and AGS cells, which was associated with sub-G1 arrest, activation of caspase-3, induction of Bax, inhibition of Bcl-2 and cleavage of poly (ADP-ribose) polymerase (PARP). In addition, Tob1 inhibited proliferation, migration and invasion, which were reversed in MKN1 and AGS cells transfected with Tob1 siRNA. Overexpression of Tob1 in MKN28 and AGS cells induced the expression of Smad4, leading to the increased expression and the promoter activity of p15, which was diminished by silencing of Tob1 using specific siRNA. Tob1 decreased the phosphorylation of Akt and glycogen synthase kinase-3β (GSK3β) in MKN28 and AGS cells, resulting in the reduced protein expression and the transcriptional activity of β‑catenin, which in turn decreased the expression of cyclin D1, cyclin-dependent kinase-4 (CDK4), urokinase plasminogen activator receptor (uPAR) and peroxisome proliferator and activator receptor-δ (PPARδ). Conversely, silencing of Tob1 induced the phosphorylation of Akt and GSK-3β, and increased the expression of β‑catenin and its target genes. Collectively, our study demonstrates that the overexpression of Tob1 inhibits gastric cancer progression by activating Smad4- and inhibiting β‑catenin-mediated signaling pathways.
Directory of Open Access Journals (Sweden)
Wen-Qin Bai
Full Text Available Bioactive gibberellins (GAs comprise an important class of natural plant growth regulators and play essential roles in cotton fiber development. To date, the molecular base of GAs' functions in fiber development is largely unclear. To address this question, the endogenous bioactive GA levels in cotton developing fibers were elevated by specifically up-regulating GA 20-oxidase and suppressing GA 2-oxidase via transgenic methods. Higher GA levels in transgenic cotton fibers significantly increased micronaire values, 1000-fiber weight, cell wall thickness and cellulose contents of mature fibers. Quantitative RT-PCR and biochemical analysis revealed that the transcription of sucrose synthase gene GhSusA1 and sucrose synthase activities were significantly enhanced in GA overproducing transgenic fibers, compared to the wild-type cotton. In addition, exogenous application of bioactive GA could promote GhSusA1 expression in cultured fibers, as well as in cotton hypocotyls. Our results suggested that bioactive GAs promoted secondary cell wall deposition in cotton fibers by enhancing sucrose synthase expression.
Morfini, Gerardo; Szebenyi, Gyorgyi; Elluru, Ravindhra; Ratner, Nancy; Brady, Scott T.
2002-01-01
Membrane-bounded organelles (MBOs) are delivered to different domains in neurons by fast axonal transport. The importance of kinesin for fast antero grade transport is well established, but mechanisms for regulating kinesin-based motility are largely unknown. In this report, we provide biochemical and in vivo evidence that kinesin light chains (KLCs) interact with and are in vivo substrates for glycogen synthase kinase 3 (GSK3). Active GSK3 inhibited anterograde, but not retrograde, transport in squid axoplasm and reduced the amount of kinesin bound to MBOs. Kinesin microtubule binding and microtubule-stimulated ATPase activities were unaffected by GSK3 phosphorylation of KLCs. Active GSK3 was also localized preferentially to regions known to be sites of membrane delivery. These data suggest that GSK3 can regulate fast anterograde axonal transport and targeting of cargos to specific subcellular domains in neurons.
Kumar, Anil; Hou, Xu; Lee, Chunsik; Li, Yang; Maminishkis, Arvydas; Tang, Zhongshu; Zhang, Fan; Langer, Harald F; Arjunan, Pachiappan; Dong, Lijin; Wu, Zhijian; Zhu, Linda Y; Wang, Lianchun; Min, Wang; Colosi, Peter; Chavakis, Triantafyllos; Li, Xuri
2010-05-14
Platelet-derived growth factor-DD (PDGF-DD) is a recently discovered member of the PDGF family. The role of PDGF-DD in pathological angiogenesis and the underlying cellular and molecular mechanisms remain largely unexplored. In this study, using different animal models, we showed that PDGF-DD expression was up-regulated during pathological angiogenesis, and inhibition of PDGF-DD suppressed both choroidal and retinal neovascularization. We also demonstrated a novel mechanism mediating the function of PDGF-DD. PDGF-DD induced glycogen synthase kinase-3beta (GSK3beta) Ser(9) phosphorylation and Tyr(216) dephosphorylation in vitro and in vivo, leading to increased cell survival. Consistently, GSK3beta activity was required for the antiangiogenic effect of PDGF-DD targeting. Moreover, PDGF-DD regulated the expression of GSK3beta and many other genes important for angiogenesis and apoptosis. Thus, we identified PDGF-DD as an important target gene for antiangiogenic therapy due to its pleiotropic effects on vascular and non-vascular cells. PDGF-DD inhibition may offer new therapeutic options to treat neovascular diseases.
Selectivity of the surface binding site (SBS) on barley starch synthase I
DEFF Research Database (Denmark)
Wilkens, Casper; Cuesta-Seijo, Jose A.; Palcic, Monica
2014-01-01
Starch synthase I (SSI) from various sources has been shown to preferentially elongate branch chains of degree of polymerisation (DP) from 6–7 to produce chains of DP 8–12. In the recently determined crystal structure of barley starch synthase I (HvSSI) a so-called surface binding site (SBS) was ...
International Nuclear Information System (INIS)
Hwang, Yong Pil; Kim, Hyung Gyun; Hien, Tran Thi; Jeong, Myung Ho; Jeong, Tae Cheon; Jeong, Hye Gwang
2011-01-01
The cardioprotective properties of puerarin, a natural product, have been attributed to the endothelial nitric oxide synthase (eNOS)-mediated production of nitric oxide (NO) in EA.hy926 endothelial cells. However, the mechanism by which puerarin activates eNOS remains unclear. In this study, we sought to identify the intracellular pathways underlying eNOS activation by puerarin. Puerarin induced the activating phosphorylation of eNOS on Ser1177 and the production of NO in EA.hy926 cells. Puerarin-induced eNOS phosphorylation required estrogen receptor (ER)-mediated phosphatidylinositol 3-kinase (PI3K)/Akt signaling and was reversed by AMP-activated protein kinase (AMPK) and calcium/calmodulin-dependent kinase II (CaMKII) inhibition. Importantly, puerarin inhibited the adhesion of tumor necrosis factor (TNF)-α-stimulated monocytes to endothelial cells and suppressed the TNF-α induced expression of intercellular cell adhesion molecule-1. Puerarin also inhibited the TNF-α-induced nuclear factor-κB activation, which was attenuated by pretreatment with N G -nitro-L-arginine methyl ester, a NOS inhibitor. These results indicate that puerarin stimulates eNOS phosphorylation and NO production via activation of an estrogen receptor-mediated PI3K/Akt- and CaMKII/AMPK-dependent pathway. Puerarin may be useful for the treatment or prevention of endothelial dysfunction associated with diabetes and cardiovascular disease. -- Highlights: ► Puerarin induced the phosphorylation of eNOS and the production of NO. ► Puerarin activated eNOS through ER-dependent PI3-kinase and Ca 2+ -dependent AMPK. ► Puerarin-induced NO was involved in the inhibition of NF-kB activation. ► Puerarin may help for prevention of vascular dysfunction and diabetes.
Mousa, Ahmad A; Strauss, Jerome F; Walsh, Scott W
2012-06-01
Preeclampsia is characterized by increased thromboxane and decreased prostacyclin levels, which predate symptoms, and can explain some of the clinical manifestations of preeclampsia, including hypertension and thrombosis. In this study, we examined DNA methylation of the promoter region of the thromboxane synthase gene (TBXAS1) and the expression of thromboxane synthase in systemic blood vessels of normal pregnant and preeclamptic women. Thromboxane synthase is responsible for the synthesis of thromboxane A(2), a potent vasoconstrictor and activator of platelets. We also examined the effect of experimentally induced DNA hypomethylation on the expression of thromboxane synthase in a neutrophil-like cell line (HL-60 cells) and in cultured vascular smooth muscle and endothelial cells. We found that DNA methylation of the TBXAS1 promoter was decreased and thromboxane synthase expression was increased in omental arteries of preeclamptic women as compared with normal pregnant women. Increased thromboxane synthase expression was observed in vascular smooth muscles cells, endothelial cells, and infiltrating neutrophils. Experimentally induced DNA hypomethylation only increased expression of thromboxane synthase in the neutrophil-like cell line, whereas tumor necrosis factor-α, a neutrophil product, increased its expression in cultured vascular smooth muscle cells. Our study suggests that epigenetic mechanisms and release of tumor necrosis factor-α by infiltrating neutrophils could contribute to the increased expression of thromboxane synthase in maternal systemic blood vessels, contributing to the hypertension and coagulation abnormalities associated with preeclampsia.
von Wettstein-Knowles, Penny
2017-07-10
The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c , -q and -u genes forming the 101 kb Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms long, thin crystalline tubes. A pathway branch leads to the formation of esterified alkan-2-ols.
DEFF Research Database (Denmark)
Heo, Min-Ji; Jung, Hwi-Min; Um, Jaeyong
2017-01-01
Genome editing using CRISPR/Cas9 was successfully demonstrated in Esherichia coli to effectively produce n-butanol in a defined medium under microaerobic condition. The butanol synthetic pathway genes including those encoding oxygen-tolerant alcohol dehydrogenase were overexpressed in metabolically...... prediction program, UTR designer, and modified using the CRISPR/Cas9 genome editing method to reduce its expression level. E. coli strains with decreased citrate synthase expression produced more butanol and the citrate synthase activity was correlated with butanol production. These results demonstrate...
Yahyaa, Mosaab; Matsuba, Yuki; Brandt, Wolfgang; Doron-Faigenboim, Adi; Bar, Einat; McClain, Alan; Davidovich-Rikanati, Rachel; Lewinsohn, Efraim; Pichersky, Eran; Ibdah, Mwafaq
2015-01-01
Bay laurel (Laurus nobilis) is an agriculturally and economically important dioecious tree in the basal dicot family Lauraceae used in food and drugs and in the cosmetics industry. Bay leaves, with their abundant monoterpenes and sesquiterpenes, are used to impart flavor and aroma to food, and have also drawn attention in recent years because of their potential pharmaceutical applications. To identify terpene synthases (TPSs) involved in the production of these volatile terpenes, we performed RNA sequencing to profile the transcriptome of L. nobilis leaves. Bioinformatic analysis led to the identification of eight TPS complementary DNAs. We characterized the enzymes encoded by three of these complementary DNAs: a monoterpene synthase that belongs to the TPS-b clade catalyzes the formation of mostly 1,8-cineole; a sesquiterpene synthase belonging to the TPS-a clade catalyzes the formation of mainly cadinenes; and a diterpene synthase of the TPS-e/f clade catalyzes the formation of geranyllinalool. Comparison of the sequences of these three TPSs indicated that the TPS-a and TPS-b clades of the TPS gene family evolved early in the evolution of the angiosperm lineage, and that geranyllinalool synthase activity is the likely ancestral function in angiosperms of genes belonging to an ancient TPS-e/f subclade that diverged from the kaurene synthase gene lineages before the split of angiosperms and gymnosperms. PMID:26157114
Strub, Andreas; Ulrich, Wolf-Rüdiger; Hesslinger, Christian; Eltze, Manfrid; Fuchss, Thomas; Strassner, Jochen; Strand, Susanne; Lehner, Martin D; Boer, Rainer
2006-01-01
We have identified imidazopyridine derivatives as a novel class of NO synthase inhibitors with high selectivity for the inducible isoform. 2-[2-(4-Methoxy-pyridin-2-yl)-ethyl]-3H-imidazo[4,5-b]pyridine (BYK191023) showed half-maximal inhibition of crudely purified human inducible (iNOS), neuronal (nNOS), and endothelial (eNOS) NO synthases at 86 nM, 17 microM, and 162 microM, respectively. Inhibition of inducible NO synthase was competitive with l-arginine, pointing to an interaction of BYK191023 with the catalytic center of the enzyme. In radioligand and surface plasmon resonance experiments, BYK191023 exhibited an affinity for iNOS, nNOS, and eNOS of 450 nM, 30 microM, and >500 microM, respectively. Inhibition of cellular nitrate/nitrite synthesis in RAW, rat mesangium, and human embryonic kidney 293 cells after iNOS induction showed 40- to 100-fold higher IC(50) values than at the isolated enzyme, in agreement with the much higher l-arginine concentrations in cell culture media and inside intact cells. BYK191023 did not show any toxicity in various rodent and human cell lines up to high micromolar concentrations. The inhibitory potency of BYK191023 was tested in isolated organ models of iNOS (lipopolysaccharide-treated and phenylephrine-precontracted rat aorta; IC(50) = 7 microM), eNOS (arecaidine propargyl ester-induced relaxation of phenylephrine-precontracted rat aorta; IC(50) > 100 microM), and nNOS (field-stimulated relaxation of phenylephrine-precontracted rabbit corpus cavernosum; IC(50) > 100 microM). These data confirm the high selectivity of BYK191023 for iNOS over eNOS and nNOS found at isolated enzymes. In summary, we have identified a new highly selective iNOS inhibitor structurally unrelated to known compounds and l-arginine. BYK191023 is a valuable tool for the investigation of iNOS-mediated effects in vitro and in vivo.
Zhang, Conggang; Liu, Zeyu; Bunker, Eric; Ramirez, Adrian; Lee, Schuyler; Peng, Yinghua; Tan, Aik-Choon; Eckhardt, S Gail; Chapnick, Douglas A; Liu, Xuedong
2017-09-08
Sorafenib (Nexavar) is a broad-spectrum multikinase inhibitor that proves effective in treating advanced renal-cell carcinoma and liver cancer. Despite its well-characterized mechanism of action on several established cancer-related protein kinases, sorafenib causes variable responses among human tumors, although the cause for this variation is unknown. In an unbiased screening of an oncology drug library, we found that sorafenib activates recruitment of the ubiquitin E3 ligase Parkin to damaged mitochondria. We show that sorafenib inhibits the activity of both complex II/III of the electron transport chain and ATP synthase. Dual inhibition of these complexes, but not inhibition of each individual complex, stabilizes the serine-threonine protein kinase PINK1 on the mitochondrial outer membrane and activates Parkin. Unlike the protonophore carbonyl cyanide m -chlorophenylhydrazone, which activates the mitophagy response, sorafenib treatment triggers PINK1/Parkin-dependent cellular apoptosis, which is attenuated upon Bcl-2 overexpression. In summary, our results reveal a new mechanism of action for sorafenib as a mitocan and suggest that high Parkin activity levels could make tumor cells more sensitive to sorafenib's actions, providing one possible explanation why Parkin may be a tumor suppressor gene. These insights could be useful in developing new rationally designed combination therapies with sorafenib. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Directory of Open Access Journals (Sweden)
Ji-Hee Kim
2014-01-01
Full Text Available Crocin is a water-soluble carotenoid pigment that is primarily used in various cuisines as a seasoning and coloring agent, as well as in traditional medicines for the treatment of edema, fever, and hepatic disorder. In this study, we demonstrated that crocin markedly induces the expression of heme oxygenase-1 (HO-1 which leads to an anti-inflammatory response. Crocin inhibited inducible nitric oxide synthase (iNOS expression and nitric oxide production via downregulation of nuclear factor kappa B activity in lipopolysaccharide- (LPS- stimulated RAW 264.7 macrophages. These effects were abrogated by blocking of HO-1 expression or activity. Crocin also induced Ca2+ mobilization from intracellular pools and phosphorylation of Ca2+/calmodulin-dependent protein kinase 4 (CAMK4. CAMK4 knockdown and kinase-dead mutant inhibited crocin-mediated HO-1 expression, Nrf2 activation, and phosphorylation of Akt, indicating that HO-1 expression is mediated by CAMK4 and that Akt is a downstream mediator of CAMK4 in crocin signaling. Moreover, crocin-mediated suppression of iNOS expression was blocked by CAMK4 inhibition. Overall, these results suggest that crocin suppresses LPS-stimulated expression of iNOS by inducing HO-1 expression via Ca2+/calmodulin-CAMK4-PI3K/Akt-Nrf2 signaling cascades. Our findings provide a novel molecular mechanism for the inhibitory effects of crocin against endotoxin-mediated inflammation.
Cytidine triphosphate synthase activity and mRNA expression in normal human blood cells
Verschuur, A. C.; van Gennip, A. H.; Muller, E. J.; Voûte, P. A.; Vreken, P.; van Kuilenburg, A. B.
1999-01-01
Cytidine triphosphate (CTP) synthase is one of the key enzymes in pyrimidine nucleotide anabolic pathways. The activity of this enzyme is elevated in various malignancies including acute lymphocytic leukemia (ALL). In this study we investigated the activity of CTP synthase in various human blood
Trypanosoma brucei TbIF1 inhibits the essential F1-ATPase in the infectious form of the parasite.
Directory of Open Access Journals (Sweden)
Brian Panicucci
2017-04-01
Full Text Available The mitochondrial (mt FoF1-ATP synthase of the digenetic parasite, Trypanosoma brucei, generates ATP during the insect procyclic form (PF, but becomes a perpetual consumer of ATP in the mammalian bloodstream form (BF, which lacks a canonical respiratory chain. This unconventional dependence on FoF1-ATPase is required to maintain the essential mt membrane potential (Δψm. Normally, ATP hydrolysis by this rotary molecular motor is restricted to when eukaryotic cells experience sporadic hypoxic conditions, during which this compulsory function quickly depletes the cellular ATP pool. To protect against this cellular treason, the highly conserved inhibitory factor 1 (IF1 binds the enzyme in a manner that solely inhibits the hydrolytic activity. Intriguingly, we were able to identify the IF1 homolog in T. brucei (TbIF1, but determined that its expression in the mitochondrion is tightly regulated throughout the life cycle as it is only detected in PF cells. TbIF1 appears to primarily function as an emergency brake in PF cells, where it prevented the restoration of the Δψm by FoF1-ATPase when respiration was chemically inhibited. In vitro, TbIF1 overexpression specifically inhibits the hydrolytic activity but not the synthetic capability of the FoF1-ATP synthase in PF mitochondria. Furthermore, low μM amounts of recombinant TbIF1 achieve the same inhibition of total mt ATPase activity as the FoF1-ATPase specific inhibitors, azide and oligomycin. Therefore, even minimal ectopic expression of TbIF1 in BF cells proved lethal as the indispensable Δψm collapsed due to inhibited FoF1-ATPase. In summary, we provide evidence that T. brucei harbors a natural and potent unidirectional inhibitor of the vital FoF1-ATPase activity that can be exploited for future structure-based drug design.
Directory of Open Access Journals (Sweden)
Dullat Harpreet K
2011-03-01
Full Text Available Abstract Background In conifers, terpene synthases (TPSs of the gymnosperm-specific TPS-d subfamily form a diverse array of mono-, sesqui-, and diterpenoid compounds, which are components of the oleoresin secretions and volatile emissions. These compounds contribute to defence against herbivores and pathogens and perhaps also protect against abiotic stress. Results The availability of extensive transcriptome resources in the form of expressed sequence tags (ESTs and full-length cDNAs in several spruce (Picea species allowed us to estimate that a conifer genome contains at least 69 unique and transcriptionally active TPS genes. This number is comparable to the number of TPSs found in any of the sequenced and well-annotated angiosperm genomes. We functionally characterized a total of 21 spruce TPSs: 12 from Sitka spruce (P. sitchensis, 5 from white spruce (P. glauca, and 4 from hybrid white spruce (P. glauca × P. engelmannii, which included 15 monoterpene synthases, 4 sesquiterpene synthases, and 2 diterpene synthases. Conclusions The functional diversity of these characterized TPSs parallels the diversity of terpenoids found in the oleoresin and volatile emissions of Sitka spruce and provides a context for understanding this chemical diversity at the molecular and mechanistic levels. The comparative characterization of Sitka spruce and Norway spruce diterpene synthases revealed the natural occurrence of TPS sequence variants between closely related spruce species, confirming a previous prediction from site-directed mutagenesis and modelling.
Weterings, Koen; Pezzotti, Mario; Cornelissen, Marc; Mariani, Celestina
2002-11-01
In flowering plants, pollination of the stigma sets off a cascade of responses in the distal flower organs. Ethylene and its biosynthetic precursor 1-aminocyclopropane-1-carboxylate (ACC) play an important role in regulating these responses. Because exogenous application of ethylene or ACC does not invoke the full postpollination syndrome, the pollination signal probably consists of a more complex set of stimuli. We set out to study how and when the pollination signal moves through the style of tobacco (Nicotiana tabacum) by analyzing the expression patterns of pistil-expressed ACC-synthase and -oxidase genes. Results from this analysis showed that pollination induces high ACC-oxidase transcript levels in all cells of the transmitting tissue. ACC-synthase mRNA accumulated only in a subset of transmitting tract cells and to lower levels as compared with ACC-oxidase. More significantly, we found that although ACC-oxidase transcripts accumulate to uniform high levels, the ACC-synthase transcripts accumulate in a wave-like pattern in which the peak coincides with the front of the ingrowing pollen tube tips. This wave of ACC-synthase expression can also be induced by incongruous pollination and (partially) by wounding. This indicates that wounding-like features of pollen tube invasion might be part of the stimuli evoking the postpollination response and that these stimuli are interpreted differently by the regulatory mechanisms of the ACC-synthase and -oxidase genes.
Schmidt, C O; Bouwmeester, H J; Bülow, N; König, W A
1999-04-15
The leaves of the composite Solidago canadensis (goldenrod) were shown to contain (-)-alpha-gurjunene synthase activity. This sesquiterpene is likely to be the precursor for cyclocolorenone, a sesquiterpene ketone present in high amounts in S. canadensis leaves. (-)-alpha-Gurjunene synthase was purified to apparent homogeneity (741-fold) by anion-exchange chromatography (on several matrices), dye ligand chromatography, hydroxylapatite chromatography, and gel filtration. Chromatography on a gel filtration matrix indicated a native molecular mass of 48 kDa, and SDS-PAGE showed the enzyme to be composed of one subunit with a denatured mass of 60 kDa. Its maximum activity was observed at pH 7.8 in the presence of 10 mM Mg2+ and the KM value for the substrate farnesyl diphosphate was 5.5 microM. Over a range of purification steps (-)-alpha-gurjunene and (+)-gamma-gurjunene synthase activities copurified. In addition, the product ratio of the enzyme activity under several different assay conditions was always 91% (-)-alpha-gurjunene and 9% (+)-gamma-gurjunene. This suggests that the formation of these two structurally related products is catalyzed by one enzyme. For further confirmation, we carried out a number of mechanistic studies with (-)-alpha-gurjunene synthase, in which an enzyme preparation was incubated with deuterated substrate analogues. Based on mass spectrometry analysis of the products formed, a cyclization mechanism was postulated which makes it plausible that the synthase catalyzes the formation of both sesquiterpenes. Copyright 1999 Academic Press.
Rottman, Jeffrey N; Bracy, Deanna; Malabanan, Carlo; Yue, Zou; Clanton, Jeff; Wasserman, David H
2002-07-01
Isotopic techniques were used to test the hypothesis that exercise and nitric oxide synthase (NOS) inhibition have distinct effects on tissue-specific fatty acid and glucose uptakes in a conscious, chronically catheterized mouse model. Uptakes were measured using the radioactive tracers (125)I-labeled beta-methyl-p-iodophenylpentadecanoic acid (BMIPP) and deoxy-[2-(3)H]glucose (DG) during treadmill exercise with and without inhibition of NOS. [(125)I]BMIPP uptake at rest differed substantially among tissues with the highest levels in heart. With exercise, [(125)I]BMIPP uptake increased in both heart and skeletal muscles. In sedentary mice, NOS inhibition induced by nitro-L-arginine methyl ester (L-NAME) feeding increased heart and soleus [(125)I]BMIPP uptake. In contrast, exercise, but not L-NAME feeding, resulted in increased heart and skeletal muscle [2-(3)H]DG uptake. Significant interactions were not observed in the effects of combined exercise and L-NAME feeding on [(125)I]BMIPP and [2-(3)H]DG uptakes. In the conscious mouse, exercise and NOS inhibition produce distinct patterns of tissue-specific fatty acid and glucose uptake; NOS is not required for important components of exercise-associated metabolic signaling, or other mechanisms compensate for the absence of this regulatory mechanism.
International Nuclear Information System (INIS)
Raetz, C.R.H.; Carman, G.M.; Dowhan, W.; Jiang, R.T.; Waszkuc, W.; Loffredo, W.; Tsai, M.D.
1987-01-01
The steric courses of the reactions catalyzed by phosphatidylserine (PS) synthase from Escherichia coli and yeast were elucidated by the following procedure. R/sub P/ and S/sub P/ isomers of 1,2-dipalmitoyl-sn-glycero-3-[ 17 O, 18 O]phosphoethanolamine ([ 17 O, 18 O]DPPE) were synthesized and converted to (R/sub P/)- and (S/sub P/)-1,2-dipalmitoyl-sn-glycero-3-[ 16 O, 17 O, 18 O]DPPA), respectively, by incubating with phospholipase D. Condensation of [ 16 O, 17 O, 18 O]DPPA with cytidine 5'-monophosphomorpholidate in pyridine gave the desired substrate for PS synthase, [ 17 O, 18 O]cytidine 5'-diphospho-1,2-dipalmitoyl-sn-glycerol ([ 17 O, 18 O]CDP-DPG), as a mixture of several isotopic and configurational isomers. Incubation of [ 17 O, 18 O]CDP-DPG), as a mixture of several isotopic and configurational isomers. Incubation of [ 17 O, 18 O] CDP-DPG with a mixture of L-serine, PS synthase and PS decarboxylase gave [ 17 O, 18 O]DPPE. The configuration and isotopic enrichments of the starting [ 17 O, 18 O]DPPE and the product were analyzed by 31 P NMR following trimethylsilylation of the DPPE. The results indicate that the reaction of E. coli PS synthase proceeds with retention of configuration at phosphorus, which suggests a two-step mechanism involving a phosphatidyl-enzyme intermediate, while the yeast PS synthase catalyzes the reaction with inversion of configuration, which suggests a single-displacement mechanism. Such results lend strong support to the ping-pong mechanism proposed for the E. coli enzyme and the sequential Bi-Bi mechanism proposed for the yeast enzyme, both based on previous isotopic exchange experiments
The effect of high pressure on the intracellular trehalose synthase activity of Thermus aquaticus.
Dong, Yongsheng; Ma, Lei; Duan, Yuanliang
2016-01-01
To understand the effect of high pressure on the intracellular trehalose synthase activity, Thermus aquaticus (T. aquaticus) in the logarithmic growth phase was treated with high-pressure air, and its intracellular trehalose synthase (TSase) activity was determined. Our results indicated that pressure is a factor strongly affecting the cell growth. High pressure significantly attenuated the growth rate of T. aquaticus and shortened the duration of stationary phase. However, after 2 h of culture under 1.0 MPa pressure, the activity of intracellular TSase in T. aquaticus reached its maximum value, indicating that pressure can significantly increase the activity of intracellular TSase in T. aquaticus. Thus the present study provides an important guide for the enzymatic production of trehalose.
Cloning and expression of pineapple sucrose- phosphate synthase ...
African Journals Online (AJOL)
hope&shola
2010-12-06
Dec 6, 2010 ... phosphate; EDTA, ethylene diamine tetraacetic acid; Ivr, invertase; SS .... phenolics, tannins and artifacts due to differences of tissue composition ..... Banana sucrose-phosphate synthase gene expression during fruit ripening.
Aschenbrenner, Anna-Katharina; Kwon, Moonhyuk; Conrad, Jürgen; Ro, Dae-Kyun; Spring, Otmar
2016-04-01
Sunflower is known to produce a variety of bisabolene-type sesquiterpenes and accumulates these substances in trichomes of leaves, stems and flowering parts. A bioinformatics approach was used to identify the enzyme responsible for the initial step in the biosynthesis of these compounds from its precursor farnesyl pyrophosphate. Based on sequence similarity with a known bisabolene synthases from Arabidopsis thaliana AtTPS12, candidate genes of Helianthus were searched in EST-database and used to design specific primers. PCR experiments identified two candidates in the RNA pool of linear glandular trichomes of sunflower. Their sequences contained the typical motifs of sesquiterpene synthases and their expression in yeast functionally characterized them as bisabolene synthases. Spectroscopic analysis identified the stereochemistry of the product of both enzymes as (Z)-γ-bisabolene. The origin of the two sunflower bisabolene synthase genes from the transcripts of linear trichomes indicates that they may be involved in the synthesis of sesquiterpenes produced in these trichomes. Comparison of the amino acid sequences of the sunflower bisabolene synthases showed high similarity with sesquiterpene synthases from other Asteracean species and indicated putative evolutionary origin from a β-farnesene synthase. Copyright © 2016 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Lassen, L H; Christiansen, I; Iversen, Helle Klingenberg
2003-01-01
-decrease in MCA blood velocity, or dilatation of neither the temporal nor the radial artery. L-NMMA constricted the temporal artery by 8% before histamine infusion, whereas the radial artery was unaffected. The temporal artery dilated 4-5 times more than the radial artery during histamine infusion. In conclusion...... the use of a NOS inhibitor in the highest possible dose did not block the histamine-induced headache response or arterial dilatation. Either the concentration of L-NMMA reaching the smooth muscle cell was insufficient or, histamine dilates arteries and causes headache via NO independent mechanisms. Our...... results showed for the first time a craniospecificity for the vasodilating effect of histamine and for the arterial effects of NOS inhibition....
Use of octaketide synthases to produce kermesic acid and flavokermesic acid
DEFF Research Database (Denmark)
2017-01-01
A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....
Use of octaketide synthases to produce kermesic acid and flavokermesic acid
DEFF Research Database (Denmark)
2016-01-01
A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....
International Nuclear Information System (INIS)
Kim, Young-Ho; Woo, Kyung Jin; Lim, Jun Hee; Kim, Shin; Lee, Tae Jin; Jung, Eun Mi; Lee, Jin-Man; Park, Jong-Wook; Kwon, Taeg Kyu
2005-01-01
In activated macrophage, large amounts of nitric oxide (NO) are generated by inducible nitric oxide synthase (iNOS), resulting in acute or chronic inflammatory disorders. In Raw 264.7 cells stimulated with lipopolysaccharide (LPS) to mimic inflammation, 8-hydroxyquinoline (8HQ) inhibited the LPS-induced expression of both iNOS protein and mRNA in a parallel dose-dependent manner. 8HQ did not enhance the degradation of iNOS mRNA. To investigate the mechanism by which 8HQ inhibits iNOS gene expression, we examined the activation of MAP kinases in Raw 264.7 cells. We did not observe any significant change in the phosphorylation of MAPKs between LPS alone and LPS plus 8HQ-treated cells. Moreover, 8HQ significantly inhibited the DNA-binding activity of nuclear factor-κB (NF-κB) and CCAAT/enhancer-binding protein β (C/EBPβ), but not activator protein-1 and cAMP response element-binding protein. Taken together, these results suggest that 8HQ acts to inhibit inflammation through inhibition of NO production and iNOS expression through blockade of C/EBPβ DNA-binding activity and NF-κB activation
Kuzmanoff, K. M.
1984-01-01
In plants, gravity stimulates differential growth in the upper and lower halves of horizontally oriented organs. Auxin regulation of cell wall loosening and elongation is the basis for most models of this phenomenon. Auxin treatment of pea stem tissue rapidly increases the activity of Golgi-localized Beta-1,4-glucan synthase, an enzyme involved in biosynthesis of wall xyloglucan which apparently constitutes the substrate for the wall loosening process. The primary objective is to determine if auxin induces de novo formation of Golgi glucan synthase and increases the level of this glucan synthase mRNA. This shall be accomplished by (a) preparation of a monoclonal antibody to the synthase, (b) isolation, and characterization of the glucan synthase, and (c) examination for cross reactivity between the antibody and translation products of auxin induced mRNAs in pea tissue. The antibody will also be used to localize the glucan synthase in upper and lower halves of pea stem tissue before, during and after the response to gravity.
Hall, Justin; Ralph, Erik C; Shanker, Suman; Wang, Hong; Byrnes, Laura J; Horst, Reto; Wong, Jimson; Brault, Amy; Dumlao, Darren; Smith, James F; Dakin, Leslie A; Schmitt, Daniel C; Trujillo, John; Vincent, Fabien; Griffor, Matt; Aulabaugh, Ann E
2017-12-01
Cyclic GMP-AMP synthase (cGAS) is activated by ds-DNA binding to produce the secondary messenger 2',3'-cGAMP. cGAS is an important control point in the innate immune response; dysregulation of the cGAS pathway is linked to autoimmune diseases while targeted stimulation may be of benefit in immunoncology. We report here the structure of cGAS with dinucleotides and small molecule inhibitors, and kinetic studies of the cGAS mechanism. Our structural work supports the understanding of how ds-DNA activates cGAS, suggesting a site for small molecule binders that may cause cGAS activation at physiological ATP concentrations, and an apparent hotspot for inhibitor binding. Mechanistic studies of cGAS provide the first kinetic constants for 2',3'-cGAMP formation, and interestingly, describe a catalytic mechanism where 2',3'-cGAMP may be a minor product of cGAS compared with linear nucleotides. © 2017 The Authors Protein Science published by Wiley Periodicals, Inc. on behalf of The Protein Society.
Institute of Scientific and Technical Information of China (English)
Shu-gang Zhang; Xiao-shan Wang; Ying-dong Zhang; Qing Di; Jing-ping Shi; Min Qian; Li-gang Xu; Xing-jian Lin; Jie Lu
2016-01-01
Indirubin-3′-monoxime is an effective inhibitor of cyclin-dependent protein kinases, and may play an obligate role in neuronal apopto-sis in Alzheimer’s disease. Here, we found that indirubin-3′-monoxime improved the morphology and increased the survival rate of SH-SY5Y cells exposed to amyloid-beta 25–35 (Aβ25–35), and also suppressed apoptosis by reducing tau phosphorylation at Ser199 and Thr205. Furthermore, indirubin-3′-monoxime inhibited phosphorylation of glycogen synthase kinase-3β (GSK-3β). Our results suggest that in-dirubin-3′-monoxime reduced Aβ25–35-induced apoptosis by suppressing tau hyperphosphorylationvia a GSK-3β-mediated mechanism. Indirubin-3′-monoxime is a promising drug candidate for Alzheimer’s disease.
DEFF Research Database (Denmark)
Gerber, Lucie; Madsen, Steffen S; Jensen, Frank B
2017-01-01
Cortisol and nitric oxide (NO) are regulators of ion transport and metabolic functions in fish. In the gill, they show opposite effects on Na(+)/K(+)-ATPase (NKA) activity: cortisol stimulates NKA activity while NO inhibits NKA activity. We hypothesized that cortisol may impact NO production...... in osmoregulatory tissues by regulating NO synthase (NOS) expression. We evaluated the influence of cortisol treatment on mRNA expression of Nos1 and Nos2 in gill, kidney and middle intestine of both freshwater (FW) and seawater (SW) acclimated rainbow trout and found both tissue- and salinity-dependent effects....... Nos2 expression was down-regulated in the gill by cortisol injection in both FW and SW trout. This was substantiated by incubating gill tissue with cortisol ex vivo. Similarly, cortisol injection significantly down-regulated Nos2 expression in kidney of SW fish but not in FW fish. In the middle...
Crystallization of Δ{sup 1}-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa
Energy Technology Data Exchange (ETDEWEB)
Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi [Faculty of Pharmaceutical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota [Neutron Science Research Center, Japan Atomic Energy Research Institute, 2-4 Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Shoyama, Yukihiro; Morimoto, Satoshi [Faculty of Pharmaceutical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan)
2005-08-01
Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å{sup 3} Da{sup −1} assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively.
DEFF Research Database (Denmark)
Müller, Christian; Hjort, C.M.; Hansen, K.
2002-01-01
In Aspergillus oryzae, one full-length chitin synthase (chsB) and fragments of two other chitin synthases (csmA and chsC) were identified. The deduced amino acid sequence of chsB was similar (87% identity) to chsB from Aspergillus nidulans, which encodes a class III chitin synthase. The sequence...
Cheng, Jiujun; Charles, Trevor C
2016-09-01
Bacterially produced biodegradable polyhydroxyalkanoates (PHAs) with versatile properties can be achieved using different PHA synthases (PhaCs). This work aims to expand the diversity of known PhaCs via functional metagenomics and demonstrates the use of these novel enzymes in PHA production. Complementation of a PHA synthesis-deficient Pseudomonas putida strain with a soil metagenomic cosmid library retrieved 27 clones expressing either class I, class II, or unclassified PHA synthases, and many did not have close sequence matches to known PhaCs. The composition of PHA produced by these clones was dependent on both the supplied growth substrates and the nature of the PHA synthase, with various combinations of short-chain-length (SCL) and medium-chain-length (MCL) PHA. These data demonstrate the ability to isolate diverse genes for PHA synthesis by functional metagenomics and their use for the production of a variety of PHA polymer and copolymer mixtures.
Human METTL12 is a mitochondrial methyltransferase that modifies citrate synthase.
Rhein, Virginie F; Carroll, Joe; Ding, Shujing; Fearnley, Ian M; Walker, John E
2017-06-01
The protein methylome in mammalian mitochondria has been little studied until recently. Here, we describe that lysine-368 of human citrate synthase is methylated and that the modifying enzyme, localized in the mitochondrial matrix, is methyltransferase-like protein 12 (METTL12), a member of the family of 7β-strand methyltransferases. Lysine-368 is near the active site of citrate synthase, but removal of methylation has no effect on its activity. In mitochondria, it is possible that some or all of the enzymes of the citric acid cycle, including citrate synthase, are organized in metabolons to facilitate the channelling of substrates between participating enzymes. Thus, possible roles for the methylation of Lys-368 are in controlling substrate channelling itself, or in influencing protein-protein interactions in the metabolon. © 2017 The Authors FEBS Letters published by John Wiley & Sons Ltd on behalf of Federation of European Biochemical Societies.
Directory of Open Access Journals (Sweden)
Eun-Jin Yang
2013-01-01
Full Text Available During our ongoing screening program designed to determine the anti-inflammatory potential of natural compounds, we isolated sargachromenol from Sargassum micracanthum. In the present study, we investigated the anti-inflammatory effects of sargachromenol on lipopolysaccharide (LPS-induced inflammation in murine RAW 264.7 macrophage cells and the underlying mechanisms. Sargachromenol significantly inhibited the LPS-induced production of nitric oxide (NO and prostaglandin E2 (PGE2 in a dose-dependent manner. It also significantly inhibited the protein expression of inducible NO synthase (iNOS and cyclooxygenase-2 (COX-2 in a dose-dependent manner in LPS-stimulated macrophage cells. Further analyses showed that sargachromenol decreased the cytoplasmic loss of inhibitor κBα (IκBα protein. These results suggest that sargachromenol may exert its anti-inflammatory effects on LPS-stimulated macrophage cells by inhibiting the activation of the NF-κB signaling pathway. In conclusion, to our knowledge, this is the first study to show that sargachromenol isolated from S. micracanthum has an effective anti-inflammatory activity. Therefore, sargachromenol might be useful for cosmetic, food, or medical applications requiring anti-inflammatory properties.
Wang, De-Shen; Patel, Atish; Shukla, Suneet; Zhang, Yun-Kai; Wang, Yi-Jun; Kathawala, Rishil J; Robey, Robert W; Zhang, Li; Yang, Dong-Hua; Talele, Tanaji T; Bates, Susan E; Ambudkar, Suresh V; Xu, Rui-Hua; Chen, Zhe-Sheng
2014-06-30
ABCG2 is a potential biomarker causing multidrug resistance (MDR) in Non-Small Cell Lung Cancer (NSCLC). We conducted this study to investigate whether Icotinib, a small-molecule inhibitor of EGFR tyrosine kinase, could interact with ABCG2 transporter in NSCLC. Our results showed that Icotinib reversed ABCG2-mediated MDR by antagonizing the drug efflux function of ABCG2. Icotinib stimulated the ATPase activity in a concentration-dependent manner and inhibited the photolabeling of ABCG2 with [125I]-Iodoarylazidoprazosin, demonstrating that it interacts at the drug-binding pocket. Homology modeling predicted the binding conformation of Icotinib at Asn629 centroid-based grid of ABCG2. However, Icotinib at reversal concentration did not affect the expression levels of AKT and ABCG2. Furthermore, a combination of Icotinib and topotecan exhibited significant synergistic anticancer activity against NCI-H460/MX20 tumor xenografts. However, the inhibition of transport activity of ABCG2 was insufficient to overcome pemetrexed resistance in NCI-H460/MX20 cells, which was due to the co-upregulated thymidylate synthase (TS) and ABCG2 expression. This is the first report to show that the up-regulation of TS in ABCG2-overexpressing cell line NCI-H460/MX20 may play a role of resistance to pemetrexate. Our findings suggested different possible strategies of overcoming the resistance of topotecan and pemetrexed in the NSCLC patients.
International Nuclear Information System (INIS)
Shirasaki, Takashi; Maruya, Shin-ichiro; Mizukami, Hiroki; Kakehata, Seiji; Kurotaki, Hidekachi; Yagihashi, Soroku; Shinkawa, Hideichi
2008-01-01
Thymidylate synthase (TS) is an important target for chemotherapeutic treatment of cancer and high expression of TS has been associated with poor prognosis or refractory disease in several cancers including colorectal and head and neck cancer. Although TS is known to regulate cell cycles and transcription factors, its potency as a therapeutic target has not been fully explored in adenoid cystic carcinoma (ACC). An ACC cell line (ACC3) was transfected with siRNA targeting the TS gene and inhibition of cell growth and induction of apoptosis-associated molecules were evaluated in vitro. In addition, the in vivo effect of TS siRNA on tumor progression was assessed using a xenograft model. Our results demonstrated that ACC3 cells showed significantly higher TS expression than non-cancer cell lines and the induction of TS siRNA led to inhibition of cell proliferation. The effect was associated with an increase in p53, p21, and active caspase-3 and S-phase accumulation. We also found up-regulation of spermidine/spermine N1-acetyltransferase (SSAT), a polyamine metabolic enzyme. Furthermore, treatment with TS siRNA delivered by atelocollagen showed a significant cytostatic effect through the induction of apoptosis in a xenograft model. TS may be an important therapeutic target and siRNA targeting TS may be of potential therapeutic value in ACC
Glycogen synthase kinase-3 regulation of urinary concentrating ability.
Rao, Reena
2012-09-01
Glycogen synthase kinase-3 (GSK3) is an enzyme that is gaining prominence as a critical signaling molecule in the epithelial cells of renal tubules. This review will focus on recent findings exploring the role of GSK3 in renal collecting ducts, especially its role in urine concentration involving vasopressin signaling. Recent studies using inhibition or tissue-specific gene deletion of GSK3 revealed the mechanism by which GSK3 regulates aquaporin 2 water channels via adenylate cyclase or the prostaglandin-E2 pathway. In other studies, postnatal treatment with lithium, an inhibitor of GSK3, increased cell proliferation and led to microcyst formation in rat kidneys. These studies suggest that loss of GSK3 activity could interfere with renal water transport at two levels. In the short term, it could disrupt vasopressin signaling in collecting duct cells and in the long term it could alter the structure of the collecting ducts, making them less responsive to the hydro-osmotic effects of vasopressin. Ongoing studies reveal the crucial role played by GSK3 in the regulation of vasopressin action in the renal collecting ducts and suggest a possible use of GSK3 inhibitors in disease conditions associated with disrupted vasopressin signaling.
Glycogen synthase kinase-3 regulates inflammatory tolerance in astrocytes
Beurel, Eléonore; Jope, Richard S.
2010-01-01
Inflammatory tolerance is the down-regulation of inflammation upon repeated stimuli, which is well-established to occur in peripheral immune cells. However, less is known about inflammatory tolerance in the brain although it may provide an important protective mechanism from detrimental consequences of prolonged inflammation, which appears to occur in many psychiatric and neurodegenerative conditions. Array analysis of 308 inflammatory molecules produced by mouse primary astrocytes after two sequential stimulations with lipopolysaccharide (LPS) distinguished three classes, tolerant, sensitized and unaltered groups. For many of these inflammatory molecules, inhibition of glycogen synthase kinase-3 (GSK3) increased tolerance and reduced sensitization. Focusing on LPS-tolerance in interleukin-6 (IL-6) production, we found that microglia exhibited a strong tolerance response that matched that of macrophages, whereas astrocytes exhibited only partial tolerance. The astrocyte semi-tolerance was found to be regulated by GSK3. GSK3 inhibitors or knocking down GSK3 levels promoted LPS-tolerance and astrocytes expressing constitutively active GSK3 did not develop LPS-tolerance. These findings identify the critical role of GSK3 in counteracting IL-6 inflammatory tolerance in cells of the CNS, supporting the therapeutic potential of GSK3 inhibitors to reduce neuroinflammation by promoting tolerance. PMID:20553816
Su, Kuo-Hui; Tsai, Jin-Yi; Kou, Yu Ru; Chiang, An-Na; Hsiao, Sheng-Huang; Wu, Yuh-Lin; Hou, Hsin-Han; Pan, Ching-Chian; Shyue, Song-Kun; Lee, Tzong-Shyuan
2009-06-01
Valsartan, a selective angiotensin II type 1 receptor (AT1R) blocker, has beneficial effects in the cardiovascular system in part by its increase of nitric oxide (NO) bioavailability, yet the mechanisms are unclear. We investigated the molecular mechanisms underlying this effect in endothelial cells (ECs). NO production was examined by Griess reagent assay, DAF-2 DA fluorescence staining and cGMP ELISA kits. Protein interaction was determined by western blotting and immunoprecipitation. Treating bovine or human aortic ECs with valsartan increased NO production, as evidenced by elevated level of stable NO metabolites and intracellular cGMP. Valsartan increased the phosphorylation but not the protein level of endothelial NO synthase (eNOS). Inhibition of phosphoinositide-3 kinase (PI3K)/Akt and Src pathways by specific inhibitors suppressed valsartan-induced NO release. In addition, valsartan increased the tyrosine residue phosphorylation of AT1R, which was attenuated by inhibition of Src but not PI3K activities. Valsartan also suppressed the interaction of eNOS and AT1R, which was blocked by Src or PI3K inhibition. Valsartan-induced NO production in ECs is mediated through Src/PI3K/Akt-dependent phosphorylation of eNOS. Valsartan-induced AT1R phosphorylation depends on Src but not PI3K, whereas valsartan-induced suppression of AT1R-eNOS interaction depends on Src/PI3K/Akt signalling. These results indicate a novel vasoprotective mechanism of valsartan in upregulating NO production in ECs.
Energy Technology Data Exchange (ETDEWEB)
Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)
2014-03-07
Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.
International Nuclear Information System (INIS)
Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko
2014-01-01
Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes
Zhao, Jing; Wei, Jianxin; Bowser, Rachel K; Traister, Russell S; Fan, Ming-Hui; Zhao, Yutong
2015-01-15
IL-33, a relatively new member of the IL-1 cytokine family, plays a crucial role in allergic inflammation and acute lung injury. Long form ST2 (ST2L), the receptor for IL-33, is expressed on immune effector cells and lung epithelia and plays a critical role in triggering inflammation. We have previously shown that ST2L stability is regulated by the ubiquitin-proteasome system; however, its upstream internalization has not been studied. In this study, we demonstrate that glycogen synthase kinase 3β (GSK3β) regulates ST2L internalization and IL-33 signaling. IL-33 treatment induced ST2L internalization, and an effect was attenuated by inhibition or downregulation of GSK3β. GSK3β was found to interact with ST2L on serine residue 446 in response to IL-33 treatment. GSK3β binding site mutant (ST2L(S446A)) and phosphorylation site mutant (ST2L(S442A)) are resistant to IL-33-induced ST2L internalization. We also found that IL-33 activated focal adhesion kinase (FAK). Inhibition of FAK impaired IL-33-induced GSK3β activation and ST2L internalization. Furthermore, inhibition of ST2L internalization enhanced IL-33-induced cytokine release in lung epithelial cells. These results suggest that modulation of the ST2L internalization by FAK/GSK3β might serve as a unique strategy to lessen pulmonary inflammation. Copyright © 2015 by The American Association of Immunologists, Inc.
Methionine synthase A2756G and reduced folate carrier1 A80G ...
African Journals Online (AJOL)
Background: Polymorphisms of genes encoding enzymes involved in folate metabolism have long been hypothesized to be maternal risk factors for Down syndrome, however, results are conflicting and inconclusive. Aim of the study: To analyze the effect of methionine synthase (MTR) A2756G, and reduced folate carrier ...
Endothelial nitric oxide synthase gene polymorphisms associated ...
African Journals Online (AJOL)
Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...
Lee, Hyo-Jin; Jeong, Yun-Jeong; Lee, Tae-Sung; Park, Yoon-Yub; Chae, Whi-Gun; Chung, Il-Kyung; Chang, Hyeun-Wook; Kim, Cheorl-Ho; Choi, Yung-Hyun; Kim, Wun-Jae; Moon, Sung-Kwon; Chang, Young-Chae
2013-01-01
In this study, we evaluated the anti-inflammatory effects of moringa (Moringa oleifera Lam.), a natural biologically active substance, by determining its inhibitory effects on pro-inflammatory mediators in lipopolysaccharide (LPS)-stimulated macrophage RAW264.7 cells. Extracts from different parts of moringa (root, leaf, and fruit) reduced LPS-induced nitric oxide (NO) release in a dose-dependent manner. The moringa fruit extract most effectively inhibited LPS-induced NO production and levels of inducible nitric oxide synthase (iNOS). The moringa fruit extract also was shown to suppress the production of inflammatory cytokines including IL-1β, TNF-α, and IL-6. Furthermore, moringa fruit extract inhibited the cytoplasmic degradation of I κ B -α and the nuclear translocation of p65 proteins, resulting in lower levels of NF -κ B transactivation. Collectively, the results of this study demonstrate that moringa fruit extract reduces the levels of pro-inflammatory mediators including NO , IL-1β, TNF-α, and IL-6 via the inhibition of NF -κ B activation in RAW264.7 cells. These findings reveal, in part, the molecular basis underlying the anti-inflammatory properties of moringa fruit extract.
International Nuclear Information System (INIS)
Hartwig, S.; Frister, T.; Alemdar, S.; Li, Z.; Scheper, T.; Beutel, S.
2015-01-01
An uncharacterized plant cDNA coding for a polypeptide presumably having sesquiterpene synthase activity, was expressed in soluble and active form. Two expression strategies were evaluated in Escherichia coli. The enzyme was fused to a highly soluble SUMO domain, in addition to being produced in an unfused form by a cold-shock expression system. Yields up to ∼325 mg/L −1 were achieved in batch cultivations. The 6x-His-tagged enzyme was purified employing an Ni 2+ -IMAC-based procedure. Identity of the protein was established by Western Blot analysis as well as peptide mass fingerprinting. A molecular mass of 64 kDa and an isoelectric point of pI 4.95 were determined by 2D gel electrophoresis. Cleavage of the fusion domain was possible by digestion with specific SUMO protease. The synthase was active in Mg 2+ containing buffer and catalyzed the production of (+)-zizaene (syn. khusimene), a precursor of khusimol, from farnesyl diphosphate. Product identity was confirmed by GC–MS and comparison of retention indices. Enzyme kinetics were determined by measuring initial reaction rates for the product, using varying substrate concentrations. By assuming a Michaelis–Menten model, kinetic parameters of K M = 1.111 μM (±0.113), v max = 0.3245 μM min −1 (±0.0035), k cat = 2.95 min −1 , as well as a catalytic efficiency k cat /K M = 4.43 × 10 4 M −1 s −1 were calculated. Fusion to a SUMO moiety can substantially increase soluble expression levels of certain hard to express terpene synthases in E. coli. The kinetic data determined for the recombinant synthase are comparable to other described plant sesquiterpene synthases and in the typical range of enzymes belonging to the secondary metabolism. This leaves potential for optimizing catalytic parameters through methods like directed evolution. - Highlights: • Uncharacterized (+)-zizaene synthase from C. zizanoides was cloned and expressed. • Fusion to SUMO and cold-shock induction
Energy Technology Data Exchange (ETDEWEB)
Hartwig, S.; Frister, T.; Alemdar, S.; Li, Z.; Scheper, T.; Beutel, S., E-mail: beutel@iftc.uni-hannover.de
2015-03-20
An uncharacterized plant cDNA coding for a polypeptide presumably having sesquiterpene synthase activity, was expressed in soluble and active form. Two expression strategies were evaluated in Escherichia coli. The enzyme was fused to a highly soluble SUMO domain, in addition to being produced in an unfused form by a cold-shock expression system. Yields up to ∼325 mg/L{sup −1} were achieved in batch cultivations. The 6x-His-tagged enzyme was purified employing an Ni{sup 2+}-IMAC-based procedure. Identity of the protein was established by Western Blot analysis as well as peptide mass fingerprinting. A molecular mass of 64 kDa and an isoelectric point of pI 4.95 were determined by 2D gel electrophoresis. Cleavage of the fusion domain was possible by digestion with specific SUMO protease. The synthase was active in Mg{sup 2+} containing buffer and catalyzed the production of (+)-zizaene (syn. khusimene), a precursor of khusimol, from farnesyl diphosphate. Product identity was confirmed by GC–MS and comparison of retention indices. Enzyme kinetics were determined by measuring initial reaction rates for the product, using varying substrate concentrations. By assuming a Michaelis–Menten model, kinetic parameters of K{sub M} = 1.111 μM (±0.113), v{sub max} = 0.3245 μM min{sup −1} (±0.0035), k{sub cat} = 2.95 min{sup −1}, as well as a catalytic efficiency k{sub cat}/K{sub M} = 4.43 × 10{sup 4} M{sup −1} s{sup −1} were calculated. Fusion to a SUMO moiety can substantially increase soluble expression levels of certain hard to express terpene synthases in E. coli. The kinetic data determined for the recombinant synthase are comparable to other described plant sesquiterpene synthases and in the typical range of enzymes belonging to the secondary metabolism. This leaves potential for optimizing catalytic parameters through methods like directed evolution. - Highlights: • Uncharacterized (+)-zizaene synthase from C. zizanoides was cloned
Energy Technology Data Exchange (ETDEWEB)
Hwang, Yong Pil; Kim, Hyung Gyun [Department of Toxicology, College of Pharmacy, Chungnam National University, Daejeon (Korea, Republic of); Hien, Tran Thi [College of Pharmacy, Chosun University, Gwangju (Korea, Republic of); Jeong, Myung Ho [Heart Research Center, Chonnam National University Hospital, Gwangju (Korea, Republic of); Jeong, Tae Cheon, E-mail: taecheon@ynu.ac.kr [College of Pharmacy, Yeungnam University, Gyungsan (Korea, Republic of); Jeong, Hye Gwang, E-mail: hgjeong@cnu.ac.kr [Department of Toxicology, College of Pharmacy, Chungnam National University, Daejeon (Korea, Republic of)
2011-11-15
The cardioprotective properties of puerarin, a natural product, have been attributed to the endothelial nitric oxide synthase (eNOS)-mediated production of nitric oxide (NO) in EA.hy926 endothelial cells. However, the mechanism by which puerarin activates eNOS remains unclear. In this study, we sought to identify the intracellular pathways underlying eNOS activation by puerarin. Puerarin induced the activating phosphorylation of eNOS on Ser1177 and the production of NO in EA.hy926 cells. Puerarin-induced eNOS phosphorylation required estrogen receptor (ER)-mediated phosphatidylinositol 3-kinase (PI3K)/Akt signaling and was reversed by AMP-activated protein kinase (AMPK) and calcium/calmodulin-dependent kinase II (CaMKII) inhibition. Importantly, puerarin inhibited the adhesion of tumor necrosis factor (TNF)-{alpha}-stimulated monocytes to endothelial cells and suppressed the TNF-{alpha} induced expression of intercellular cell adhesion molecule-1. Puerarin also inhibited the TNF-{alpha}-induced nuclear factor-{kappa}B activation, which was attenuated by pretreatment with N{sup G}-nitro-L-arginine methyl ester, a NOS inhibitor. These results indicate that puerarin stimulates eNOS phosphorylation and NO production via activation of an estrogen receptor-mediated PI3K/Akt- and CaMKII/AMPK-dependent pathway. Puerarin may be useful for the treatment or prevention of endothelial dysfunction associated with diabetes and cardiovascular disease. -- Highlights: Black-Right-Pointing-Pointer Puerarin induced the phosphorylation of eNOS and the production of NO. Black-Right-Pointing-Pointer Puerarin activated eNOS through ER-dependent PI3-kinase and Ca{sup 2+}-dependent AMPK. Black-Right-Pointing-Pointer Puerarin-induced NO was involved in the inhibition of NF-kB activation. Black-Right-Pointing-Pointer Puerarin may help for prevention of vascular dysfunction and diabetes.
GSK-3 Inhibition Sensitizes Acute Myeloid Leukemia Cells to 1,25D-Mediated Differentiation
Gupta, Kalpana; Stefan, Tammy; Ignatz-Hoover, James; Moreton, Stephen; Parizher, Gary; Saunthararajah, Yogen; Wald, David N.
2017-01-01
1,25-dihydroxyvitamin D3 (1,25D), the biologically active form of vitamin D, is widely considered a promising therapy for acute myeloid leukemia (AML) based on its ability to drive differentiation of leukemic cells. However, clinical trials have been disappointing in part to dose-limiting hypercalcemia. Here we show how inhibiting glycogen synthase kinase 3 (GSK3) can improve the differentiation response of AML cells to 1,25D-mediated differentiation. GSK3 inhibition in AML cells enhanced the differentiating effects of low concentrations of 1,25D. In addition, GSK3 inhibition augmented the ability of 1,25D to induce irreversible growth inhibition and slow the progression of AML in mouse models. Mechanistic studies revealed that GSK3 inhibition led to the hyperphosphorylation of the vitamin D receptor (VDR), enabling an interaction between VDR and the coactivator, SRC-3 (NCOA3), thereby increasing transcriptional activity. We also found that activation of JNK-mediated pathways in response to GSK3 inhibition contributed to the potentiation of 1,25D-induced differentiation. Taken together, our findings offer a preclinical rationale to explore the repositioning of GSK3 inhibitors to enhance differentiation-based therapy for AML treatment. PMID:26964622
Directory of Open Access Journals (Sweden)
Roman eGangl
2015-09-01
Full Text Available Stachyose is among the raffinose family oligosaccharides one of the major water-soluble carbohydrates next to sucrose in seeds of a number of plant species. Especially in leguminous seeds, e.g. chickpea, stachyose is reported as the major component. In contrast to their ambiguous potential as essential source of carbon for germination, raffinose family oligosaccharides are indigestible for humans and can contribute to diverse abdominal disorders.In the genome of Arabidopsis thaliana, six putative raffinose synthase genes are reported, whereas little is known about these putative raffinose synthases and their biochemical characteristics or their contribution to the raffinose family oligosaccharide physiology in A. thaliana.In this paper, we report on the molecular cloning, functional expression in Escherichia coli and purification of recombinant AtRS4 from A. thaliana and the biochemical characterisation of the putative stachyose synthase (AtSTS, At4g01970 as a raffinose and high affinity stachyose synthase (Km for raffinose 259.2 ± 21.15 µM as well as stachyose and galactinol specific galactosylhydrolase. A T-DNA insertional mutant in the AtRS4 gene was isolated. Only sqPCR from WT siliques showed a specific transcriptional AtRS4 PCR product. Metabolite measurements in seeds of ΔAtRS4 mutant plants revealed a total loss of stachyose in ΔAtRS4 mutant seeds. We conclude that AtRS4 is the only stachyose synthase in the genome of A. thaliana that AtRS4 represents a key regulation mechanism in the raffinose family oligosaccharide physiology of A. thaliana due to its multifunctional enzyme activity and that AtRS4 is possibly the second seed specific raffinose synthase beside AtRS5, which is responsible for Raf-accumulation under abiotic stress.
Isolation of developing secondary xylem specific cellulose synthase ...
Indian Academy of Sciences (India)
The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from .... the First strand cDNA synthesis kit (Fermentas, Pittsburgh,. USA). .... ing height of the rooted cutting, girth of the stem, leaf area.
Fan, Yuan-Jie; Ye, Yan-Bin; Gao, Wen; Zhang, Feng; Zhang, Ying-Xia
2010-11-01
To study the dynamic variations of the contents of total polyphenols, flvonoids and chlorogenic acid from Acer truncatum leaves in different months, and their inhibitory activities on fatty acid synthase. Spectrophotometry was used to determine the contents of total polyphenols, flavonoids and chlorogenic acid in extracts and the extracts' inhibitory effects were also investigated. All Leaves picked from May to November have inhibitory effect. But the contents of polyphenols in leaves of July appeared to be higher than other months', and consequently exhibited stronger inhibition against FAS. A positive correlation between the content of polyphenols in leaves extract and the inhibitory efficacy on FAS could be established.
Tang, Xiaoli; Zheng, Dong; Hu, Ping; Zeng, Zongyue; Li, Ming; Tucker, Lynne; Monahan, Renee; Resnick, Murray B; Liu, Manran; Ramratnam, Bharat
2014-03-01
Glycogen synthase kinase 3 beta (GSK3β) is a critical protein kinase that phosphorylates numerous proteins in cells and thereby impacts multiple pathways including the β-Catenin/TCF/LEF-1 pathway. MicroRNAs (miRs) are a class of noncoding small RNAs of ∼22 nucleotides in length. Both GSK3β and miR play myriad roles in cell functions including stem cell development, apoptosis, embryogenesis and tumorigenesis. Here we show that GSK3β inhibits the expression of miR-96, miR-182 and miR-183 through the β-Catenin/TCF/LEF-1 pathway. Knockout of GSK3β in mouse embryonic fibroblast cells increases expression of miR-96, miR-182 and miR-183, coinciding with increases in the protein level and nuclear translocation of β-Catenin. In addition, overexpression of β-Catenin enhances the expression of miR-96, miR-182 and miR-183 in human gastric cancer AGS cells. GSK3β protein levels are decreased in human gastric cancer tissue compared with surrounding normal gastric tissue, coinciding with increases of β-Catenin protein, miR-96, miR-182, miR-183 and primary miR-183-96-182 cluster (pri-miR-183). Furthermore, suppression of miR-183-96-182 cluster with miRCURY LNA miR inhibitors decreases the proliferation and migration of AGS cells. Knockdown of GSK3β with siRNA increases the proliferation of AGS cells. Mechanistically, we show that β-Catenin/TCF/LEF-1 binds to the promoter of miR-183-96-182 cluster gene and thereby activates the transcription of the cluster. In summary, our findings identify a novel role for GSK3β in the regulation of miR-183-96-182 biogenesis through β-Catenin/TCF/LEF-1 pathway in gastric cancer cells.
Isolation and characterization of three new monoterpene synthases from Artemisia annua
Ju-Xin eRuan; Jian-Xu eLi; Xin eFang; Ling-Jian eWang; Wen-Li eHu; Xiao-Ya eChen; Changqing eYang
2016-01-01
Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5 and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with...
In Vitro Biochemical Characterization of All Barley Endosperm Starch Synthases
Directory of Open Access Journals (Sweden)
Jose Antonio Cuesta-Seijo
2016-01-01
Full Text Available Starch is the main storage polysaccharide in cereals and the major source of calories in the human diet. It is synthesized by a panel of enzymes including five classes of starch synthases (SSs. While the overall starch synthase (SS reaction is known, the functional differences between the five SS classes are poorly understood. Much of our knowledge comes from analyzing mutant plants with altered SS activities, but the resulting data are often difficult to interpret as a result of pleitropic effects, competition between enzymes, overlaps in enzyme activity and disruption of multi-enzyme complexes. Here we provide a detailed biochemical study of the activity of all five classes of SSs in barley endosperm. Each enzyme was produced recombinantly in E. coli and the properties and modes of action in vitro were studied in isolation from other SSs and other substrate modifying activities. Our results define the mode of action of each SS class in unprecedented detail; we analyze their substrate selection, temperature dependence and stability, substrate affinity and temporal abundance during barley development. Our results are at variance with some generally accepted ideas about starch biosynthesis and might lead to the reinterpretation of results obtained in planta. In particular, they indicate that granule bound SS is capable of processive action even in the absence of a starch matrix, that SSI has no elongation limit, and that SSIV, believed to be critical for the initiation of starch granules, has maltoligosaccharides and not polysaccharides as its preferred substrates.
Directory of Open Access Journals (Sweden)
Ardala Breda
Full Text Available The 5-phospho-α-D-ribose 1-diphosphate (PRPP metabolite plays essential roles in several biosynthetic pathways, including histidine, tryptophan, nucleotides, and, in mycobacteria, cell wall precursors. PRPP is synthesized from α-D-ribose 5-phosphate (R5P and ATP by the Mycobacterium tuberculosis prsA gene product, phosphoribosylpyrophosphate synthase (MtPRS. Here, we report amplification, cloning, expression and purification of wild-type MtPRS. Glutaraldehyde cross-linking results suggest that MtPRS predominates as a hexamer, presenting varied oligomeric states due to distinct ligand binding. MtPRS activity measurements were carried out by a novel coupled continuous spectrophotometric assay. MtPRS enzyme activity could be detected in the absence of P(i. ADP, GDP and UMP inhibit MtPRS activity. Steady-state kinetics results indicate that MtPRS has broad substrate specificity, being able to accept ATP, GTP, CTP, and UTP as diphosphoryl group donors. Fluorescence spectroscopy data suggest that the enzyme mechanism for purine diphosphoryl donors follows a random order of substrate addition, and for pyrimidine diphosphoryl donors follows an ordered mechanism of substrate addition in which R5P binds first to free enzyme. An ordered mechanism for product dissociation is followed by MtPRS, in which PRPP is the first product to be released followed by the nucleoside monophosphate products to yield free enzyme for the next round of catalysis. The broad specificity for diphosphoryl group donors and detection of enzyme activity in the absence of P(i would suggest that MtPRS belongs to Class II PRS proteins. On the other hand, the hexameric quaternary structure and allosteric ADP inhibition would place MtPRS in Class I PRSs. Further data are needed to classify MtPRS as belonging to a particular family of PRS proteins. The data here presented should help augment our understanding of MtPRS mode of action. Current efforts are toward experimental structure
Breda, Ardala; Martinelli, Leonardo K. B.; Bizarro, Cristiano V.; Rosado, Leonardo A.; Borges, Caroline B.; Santos, Diógenes S.; Basso, Luiz A.
2012-01-01
The 5-phospho-α-D-ribose 1-diphosphate (PRPP) metabolite plays essential roles in several biosynthetic pathways, including histidine, tryptophan, nucleotides, and, in mycobacteria, cell wall precursors. PRPP is synthesized from α-D-ribose 5-phosphate (R5P) and ATP by the Mycobacterium tuberculosis prsA gene product, phosphoribosylpyrophosphate synthase (MtPRS). Here, we report amplification, cloning, expression and purification of wild-type MtPRS. Glutaraldehyde cross-linking results suggest that MtPRS predominates as a hexamer, presenting varied oligomeric states due to distinct ligand binding. MtPRS activity measurements were carried out by a novel coupled continuous spectrophotometric assay. MtPRS enzyme activity could be detected in the absence of Pi. ADP, GDP and UMP inhibit MtPRS activity. Steady-state kinetics results indicate that MtPRS has broad substrate specificity, being able to accept ATP, GTP, CTP, and UTP as diphosphoryl group donors. Fluorescence spectroscopy data suggest that the enzyme mechanism for purine diphosphoryl donors follows a random order of substrate addition, and for pyrimidine diphosphoryl donors follows an ordered mechanism of substrate addition in which R5P binds first to free enzyme. An ordered mechanism for product dissociation is followed by MtPRS, in which PRPP is the first product to be released followed by the nucleoside monophosphate products to yield free enzyme for the next round of catalysis. The broad specificity for diphosphoryl group donors and detection of enzyme activity in the absence of Pi would suggest that MtPRS belongs to Class II PRS proteins. On the other hand, the hexameric quaternary structure and allosteric ADP inhibition would place MtPRS in Class I PRSs. Further data are needed to classify MtPRS as belonging to a particular family of PRS proteins. The data here presented should help augment our understanding of MtPRS mode of action. Current efforts are toward experimental structure determination of Mt
Lai, Yu-Chiang; Liu, Yang; Jacobs, Roxane; Rider, Mark H
2012-10-01
PKB (protein kinase B), also known as Akt, is a key component of insulin signalling. Defects in PKB activation lead to insulin resistance and metabolic disorders, whereas PKB overactivation has been linked to tumour growth. Small-molecule PKB inhibitors have thus been developed for cancer treatment, but also represent useful tools to probe the roles of PKB in insulin action. In the present study, we examined the acute effects of two allosteric PKB inhibitors, MK-2206 and Akti 1/2 (Akti) on PKB signalling in incubated rat soleus muscles. We also assessed the effects of the compounds on insulin-stimulated glucose uptake, glycogen and protein synthesis. MK-2206 dose-dependently inhibited insulin-stimulated PKB phosphorylation, PKBβ activity and phosphorylation of PKB downstream targets (including glycogen synthase kinase-3α/β, proline-rich Akt substrate of 40 kDa and Akt substrate of 160 kDa). Insulin-stimulated glucose uptake, glycogen synthesis and glycogen synthase activity were also decreased by MK-2206 in a dose-dependent manner. Incubation with high doses of MK-2206 (10 μM) inhibited insulin-induced p70 ribosomal protein S6 kinase and 4E-BP1 (eukaryotic initiation factor 4E-binding protein-1) phosphorylation associated with increased eEF2 (eukaryotic elongation factor 2) phosphorylation. In contrast, Akti only modestly inhibited insulin-induced PKB and mTOR (mammalian target of rapamycin) signalling, with little or no effect on glucose uptake and protein synthesis. MK-2206, rather than Akti, would thus be the tool of choice for studying the role of PKB in insulin action in skeletal muscle. The results point to a key role for PKB in mediating insulin-stimulated glucose uptake, glycogen synthesis and protein synthesis in skeletal muscle.
Oh, Sang-Seok; Park, Soojong; Lee, Ki-Won; Madhi, Hamadi; Park, Sae Gwang; Lee, Hee Gu; Cho, Yong-Yeon; Yoo, Jiyun; Dong Kim, Kwang
2017-04-06
Cystatin SN (CST1), a known inhibitor of cathepsin B (CatB), has important roles in tumor development. Paradoxically, CatB is a member of the cysteine cathepsin family that acts in cellular processes, such as tumor development and invasion. However, the relationship between CST1 and CatB, and their roles in tumor development are poorly understood. In this study, we observed that the knockdown of CST1 induced the activity of senescence-associated β-galactosidase, a marker of cellular senescence, and expression of senescence-associated secretory phenotype genes, including interleukin-6 and chemokine (C-C motif) ligand 20, in MDA-MB-231 and SW480 cancer cells. Furthermore, CST1 knockdown decreased extracellular CatB activity, and direct CatB inhibition, using specific inhibitors or shCatB, induced cellular senescence. Reconstitution of CST1 restored CatB activity and inhibited cellular senescence in CST1 knockdown cells. CST1 knockdown or CatB inhibition increased glycogen synthase (GS) kinase 3β phosphorylation at serine 9, resulting in the activation of GS and the induction of glycogen accumulation associated with cellular senescence. Importantly, CST1 knockdown suppressed cancer cell proliferation, soft agar colony growth and tumor growth in a xenograft model. These results indicate that CST1-mediated extracellular CatB activity enhances tumor development by preventing cellular senescence. Our findings suggest that antagonists of CST1 or inhibitors of CatB are potential anticancer agents.
Energy Technology Data Exchange (ETDEWEB)
Zylberman, V.; Craig, P.O.; Klinke, S.; Cauerhff, A.; Goldbaum, F.A. [Instituto Leloir, Buenos Aires (Argentina); Braden, B.C. [Bowie State Univ., Maryland (United States)
2004-07-01
The penultimate step in the pathway of riboflavin biosynthesis is catalyzed by the enzyme lumazine synthase (LS). One of the most distinctive characteristics of this enzyme is the structural quaternary divergence found in different species. The protein exists as pentameric and icosahedral forms, built from practically the same structural monomeric unit. The pentameric structure is formed by five 18 kDa monomers, each extensively contacting neighboring monomers. The icosahedral structure consists of 60 LS monomers arranged as twelve pentamers giving rise to a capsid exhibiting icosahedral 532 symmetry. In all lumazine synthases studied, the topologically equivalent active sites are located at the interfaces between adjacent subunits in the pentameric modules. The Brucella spp. lumazine synthase (BLS) sequence clearly diverges from pentameric and icosahedral enzymes. This unusual divergence prompted to further investigate on its quaternary arrangement. In the present work, we demonstrate by means of solution Light Scattering and X-ray structural analyses that BLS assembles as a very stable dimer of pentamers representing a third category of quaternary assembly for lumazine synthases. We also describe by spectroscopic studies the thermodynamic stability of this oligomeric protein, and postulate a mechanism for dissociation/unfolding of this macromolecular assembly. The higher molecular order of BLS increases its stability 20 deg C compared to pentameric lumazine synthases. The decameric arrangement described in this work highlights the importance of quaternary interactions in the stabilization of proteins. (author)
International Nuclear Information System (INIS)
Zylberman, V.; Craig, P.O.; Klinke, S.; Cauerhff, A.; Goldbaum, F.A.; Braden, B.C.
2004-01-01
The penultimate step in the pathway of riboflavin biosynthesis is catalyzed by the enzyme lumazine synthase (LS). One of the most distinctive characteristics of this enzyme is the structural quaternary divergence found in different species. The protein exists as pentameric and icosahedral forms, built from practically the same structural monomeric unit. The pentameric structure is formed by five 18 kDa monomers, each extensively contacting neighboring monomers. The icosahedral structure consists of 60 LS monomers arranged as twelve pentamers giving rise to a capsid exhibiting icosahedral 532 symmetry. In all lumazine synthases studied, the topologically equivalent active sites are located at the interfaces between adjacent subunits in the pentameric modules. The Brucella spp. lumazine synthase (BLS) sequence clearly diverges from pentameric and icosahedral enzymes. This unusual divergence prompted to further investigate on its quaternary arrangement. In the present work, we demonstrate by means of solution Light Scattering and X-ray structural analyses that BLS assembles as a very stable dimer of pentamers representing a third category of quaternary assembly for lumazine synthases. We also describe by spectroscopic studies the thermodynamic stability of this oligomeric protein, and postulate a mechanism for dissociation/unfolding of this macromolecular assembly. The higher molecular order of BLS increases its stability 20 deg C compared to pentameric lumazine synthases. The decameric arrangement described in this work highlights the importance of quaternary interactions in the stabilization of proteins. (author)
Inhibition of STAT-3 results in radiosensitization of human squamous cell carcinoma
International Nuclear Information System (INIS)
Bonner, James A.; Trummell, Hoa Q.; Willey, Christopher D.; Plants, Brian A.; Raisch, Kevin P.
2009-01-01
Background: Signal transducer and activator of transcription-3 (STAT-3) is a downstream component of the Epidermal Growth Factor Receptor (EGFr) signaling process that may facilitate the resistance of tumor cells to conventional cancer treatments. Studies were performed to determine if inhibition of this downstream protein produces radiosensitization. Methods/Results: A431 cells (human squamous cell carcinoma cells with EGFr overexpression) were found to be sensitized to radiation after treatment with STAT-3 small interfering RNA (siRNA). Therefore, a short hairpin RNA (shRNA) against STAT-3 was designed and cloned into a pBABE vector system modified for shRNA expression. Following transfection, clone 2.1 was selected for further study as it showed a dramatic reduction of STAT-3 protein (and mRNA) when compared to A431 parental cells or a negative control shRNA cell line (transfected with STAT-3 shRNA with 2 base pairs mutated). A431 2.1 showed doubling times of 25-31 h as compared to 18-24 h for the parental cell line. The A431 shRNA knockdown STAT-3 cells A431 were more sensitive to radiation than A431 parental or negative STAT-3 control cells. Conclusion: A431 cells stably transfected with shRNA against STAT-3 resulted in enhanced radiosensitivity. Further work will be necessary to determine whether the inhibition of STAT-3 phosphorylation is a necessary step for the radiosensitization that is induced by the inhibition of EGFr.
Wang, Zheng; Wen, Lijun; Zhu, Fei; Wang, Yanping; Xie, Qing; Chen, Zijun; Li, Yunsen
2017-01-01
Ceramide synthase 1 (CERS1) is the most highly expressed CERS in the central nervous system, and ceramide with an 18-carbon–containing fatty acid chain (C18-ceramide) in the brain plays important roles in signaling and sphingolipid development. However, the roles of CERS1 and C18-ceramide in glioma are largely unknown. In the present study, measured by electrospray ionization linear ion trap mass spectrometry, C18-ceramide was significantly lower in glioma tumor tissues compared with controls (P overexpression of CERS1, which has been shown to specifically induce the generation of C18-ceramide. Overexpression of CERS1 or adding exogenous C18-ceramide inhibited cell viability and induced cell death by activating endoplasmic reticulum stress, which induced lethal autophagy and inhibited PI3K/AKT signal pathway in U251 and A172 glioma cells. Moreover, overexpression of CERS1 or adding exogenous C18-ceramide increased the sensitivity of U251 and A172 glioma cells to teniposide (VM-26). Thus, the combined therapy of CERS1/C18-ceramide and VM-26 may be a novel therapeutic strategy for the treatment of human glioma. PMID:29262618
Demissie, Zerihun A; Erland, Lauren A E; Rheault, Mark R; Mahmoud, Soheil S
2013-03-01
Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s(-1), respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering.
Directory of Open Access Journals (Sweden)
Xiudao Yu
2013-10-01
Full Text Available Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E-β-farnesene (EβF is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piperita, two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint (Mentha asiatica. Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d− 1 g− 1 of fresh tissue. Tritrophic interactions involving peach aphids (Myzus persicae, and predatory lacewing (Chrysopa septempunctata larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.
Azuma, Yusuke; Zschoche, Reinhard; Hilvert, Donald
2017-06-23
Encapsulation of specific enzymes in self-assembling protein cages is a hallmark of bacterial compartments that function as counterparts to eukaryotic organelles. The cage-forming enzyme lumazine synthase (LS) from Bacillus subtilis (BsLS), for example, encapsulates riboflavin synthase (BsRS), enabling channeling of lumazine from the site of its generation to the site of its conversion to vitamin B 2 Elucidating the molecular mechanisms underlying the assembly of these supramolecular complexes could help inform new approaches for metabolic engineering, nanotechnology, and drug delivery. To that end, we investigated a thermostable LS from Aquifex aeolicus (AaLS) and found that it also forms cage complexes with the cognate riboflavin synthase (AaRS) when both proteins are co-produced in the cytosol of Escherichia coli A 12-amino acid-long peptide at the C terminus of AaRS serves as a specific localization sequence responsible for targeting the guest to the protein compartment. Sequence comparisons suggested that analogous peptide segments likely direct RS complexation by LS cages in other bacterial species. Covalent fusion of this peptide tag to heterologous guest molecules led to their internalization into AaLS assemblies both in vivo and in vitro , providing a firm foundation for creating tailored biomimetic nanocompartments for medical and biotechnological applications. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model
Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.
2018-03-01
Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.
Beekwilder, Jules; van Houwelingen, Adèle; Cankar, Katarina; van Dijk, Aalt D J; de Jong, René M; Stoopen, Geert; Bouwmeester, Harro; Achkar, Jihane; Sonke, Theo; Bosch, Dirk
2014-02-01
Nootkatone is one of the major terpenes in the heartwood of the Nootka cypress Callitropsis nootkatensis. It is an oxidized sesquiterpene, which has been postulated to be derived from valencene. Both valencene and nootkatone are used for flavouring citrus beverages and are considered among the most valuable terpenes used at commercial scale. Functional evaluation of putative terpene synthase genes sourced by large-scale EST sequencing from Nootka cypress wood revealed a valencene synthase gene (CnVS). CnVS expression in different tissues from the tree correlates well with nootkatone content, suggesting that CnVS represents the first dedicated gene in the nootkatone biosynthetic pathway in C. nootkatensis The gene belongs to the gymnosperm-specific TPS-d subfamily of terpenes synthases and its protein sequence has low similarity to known citrus valencene synthases. In vitro, CnVS displays high robustness under different pH and temperature regimes, potentially beneficial properties for application in different host and physiological conditions. Biotechnological production of sesquiterpenes has been shown to be feasible, but productivity of microbial strains expressing valencene synthase from Citrus is low, indicating that optimization of valencene synthase activity is needed. Indeed, expression of CnVS in Saccharomyces cerevisiae indicated potential for higher yields. In an optimized Rhodobacter sphaeroides strain, expression of CnVS increased valencene yields 14-fold to 352 mg/L, bringing production to levels with industrial potential. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.
2003-01-01
Tetrahydromethanopterin (H4MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and...
Prasanna, Sivaprakasam; Daga, Pankaj R.; Xie, Aihua; Doerksen, Robert J.
2009-02-01
Glycogen synthase kinase-3, a serine/threonine kinase, has been implicated in a wide variety of pathological conditions such as diabetes, Alzheimer's disease, stroke, bipolar disorder, malaria and cancer. Herein we report 3D-QSAR analyses using CoMFA and CoMSIA and molecular docking studies on 3-anilino-4-phenylmaleimides as GSK-3α inhibitors, in order to better understand the mechanism of action and structure-activity relationship of these compounds. Comparison of the active site residues of GSK-3α and GSK-3β isoforms shows that all the key amino acids involved in polar interactions with the maleimides for the β isoform are the same in the α isoform, except that Asp133 in the β isoform is replaced by Glu196 in the α isoform. We prepared a homology model for GSK-3α, and showed that the change from Asp to Glu should not affect maleimide binding significantly. Docking studies revealed the binding poses of three subclasses of these ligands, namely anilino, N-methylanilino and indoline derivatives, within the active site of the β isoform, and helped to explain the difference in their inhibitory activity.
Shibata, Haruki; Katsuki, Hiroshi; Nishiwaki, Mayumi; Kume, Toshiaki; Kaneko, Shuji; Akaike, Akinori
2003-09-01
Glial cell activation associated with inflammatory reaction may contribute to pathogenic processes of neurodegenerative disorders, through production of several cytotoxic molecules. We investigated the consequences of glial activation by interferon-gamma (IFN-gamma)/lipopolysaccharide (LPS) in rat midbrain slice cultures. Application of IFN-gamma followed by LPS caused dopaminergic cell death and accompanying increases in nitrite production and lactate dehydrogenase release. Aminoguanidine, an inhibitor of inducible nitric oxide synthase (iNOS), or SB203580, an inhibitor of p38 mitogen-activated protein kinase, prevented dopaminergic cell loss as well as nitrite production. SB203580 also suppressed expression of iNOS and cyclooxygenase-2 (COX-2) induced by IFN-gamma/LPS. A COX inhibitor indomethacin protected dopaminergic neurons from IFN-gamma/LPS-induced injury, whereas selective COX-2 inhibitors such as NS-398 and nimesulide did not. Notably, indomethacin was able to attenuate neurotoxicity of a nitric oxide (NO) donor. Neutralizing antibodies against tumour necrosis factor-alpha and interleukin-1beta did not inhibit dopaminergic cell death caused by IFN-gamma/LPS, although combined application of these antibodies blocked lactate dehydrogenase release and decrease in the number of non-dopaminergic neurons. These results indicate that iNOS-derived NO plays a crucial role in IFN-gamma/LPS-induced dopaminergic cell death, and that indomethacin exerts protective effect by mechanisms probably related to NO neurotoxicity rather than through COX inhibition.
Li, J N; Mahmoud, M A; Han, W F; Ripple, M; Pizer, E S
2000-11-25
Endogenous fatty acid synthesis has been observed in certain rapidly proliferating normal and neoplastic tissues. Sterol regulatory element-binding proteins (SREBPs) are transcription factors that regulate the expression of lipogenic genes including fatty acid synthase (FAS), the major biosynthetic enzyme for fatty acid synthesis. We have previously shown that SREBP-1, FAS, and Ki-67, a proliferation marker, colocalized in the crypts of the fetal gastrointestinal tract epithelium. This study sought to determine whether SREBP-1 participates in the regulation of proliferation-associated fatty acid synthesis in colorectal neoplasia. An immunohistochemical analysis of SREBP-1, FAS, and Ki-67 expression in 25 primary human colorectal carcinoma specimens showed colocalization in 22 of these. To elucidate a functional linkage between SREBP-1 activation and proliferation-associated FA synthesis, SREBP-1 and FAS content were assayed during the adaptive response of cultured HCT116 colon carcinoma cells to pharmacological inhibition of FA synthesis. Cerulenin and TOFA each inhibited the endogenous synthesis of fatty acids in a dose-dependent manner and each induced increases in both precursor and mature forms of SREBP-1. Subsequently, both the transcriptional activity of the FAS promoter in a luciferase reporter gene construct and the FAS expression increased. These results demonstrate that tumor cells recognize and respond to a deficiency in endogenous fatty acid synthesis by upregulating both SREBP-1 and FAS expression and support the model that SREBP-1 participates in the transcriptional regulation of lipogenic genes in colorectal neoplasia. Copyright 2000 Academic Press.
DEFF Research Database (Denmark)
Gojkovic, Zoran; Sandrini, Michael; Piskur, Jure
2001-01-01
no pyrimidine catabolic pathway, it enabled growth on N-carbamyl- beta -alanine as the sole nitrogen source. The D. discoideum and D. melanogaster PYD3 gene products are similar to mammalian beta -alanine synthases. In contrast, the S. kluyveri protein is quite different from these and more similar to bacterial......beta -Alanine synthase (EC 3.5.1.6), which catalyzes the final step of pyrimidine catabolism, has only been characterized in mammals. A Saccharomyces kluyveri pyd3 mutant that is unable to grow on N-carbamy-beta -alanine as the sole nitrogen source and exhibits diminished beta -alanine synthase...... N- carbamyl amidohydrolases. All three beta -alanine synthases are to some degree related to various aspartate transcarbamylases, which catalyze the second step of the de novo pyrimidine biosynthetic pathway. PYD3 expression in yeast seems to be inducible by dihydrouracil and N...
Directory of Open Access Journals (Sweden)
Arnaud Duhoux
2017-08-01
Full Text Available Herbicides are currently pivotal to control weeds and sustain food security. Herbicides must efficiently kill weeds while being as harmless as possible for crops, even crops taxonomically close to weeds. To increase their selectivity toward crops, some herbicides are sprayed in association with safeners that are bioactive compounds exacerbating herbicide-degrading pathways reputedly specifically in crops. However, exacerbated herbicide metabolism is also a key mechanism underlying evolved non-target-site-based resistance to herbicides (NTSR in weeds. This raised the issue of a possible role of safeners on NTSR evolution in weeds. We investigated a possible effect of the respective field rates of the two broadly used safeners cloquintocet-mexyl and mefenpyr-diethyl on the sensitivity of the troublesome global weed Lolium sp. (rye-grass to the major herbicides inhibiting acetolactate-synthase (ALS pyroxsulam and iodosulfuron + mesosulfuron, respectively. Three Lolium sp. populations were studied in three series of experiments. The first experiment series compared the frequencies of plants surviving application of each herbicide alone or in association with its safener. Safener co-application caused a net increase ranging from 5.0 to 46.5% in the frequency of plants surviving the field rate of their associated herbicide. In a second series of experiments, safener effect was assessed on individual plant sensitivity using vegetative propagation. A reduction in sensitivity to pyroxsulam and to iodosulfuron + mesosulfuron was observed for 44.4 and 11.1% of the plants in co-treatment with cloquintocet-mexyl and mefenpyr-diethyl, respectively. A third series of experiments investigated safener effect on the expression level of 19 Lolium sp. NTSR marker genes. Safeners showed an enhancing effect on the expression level of 10 genes. Overall, we demonstrated that cloquintocet-mexyl and mefenpyr-diethyl both reduced the sensitivity of Lolium sp. to their
Duhoux, Arnaud; Pernin, Fanny; Desserre, Diane; Délye, Christophe
2017-01-01
Herbicides are currently pivotal to control weeds and sustain food security. Herbicides must efficiently kill weeds while being as harmless as possible for crops, even crops taxonomically close to weeds. To increase their selectivity toward crops, some herbicides are sprayed in association with safeners that are bioactive compounds exacerbating herbicide-degrading pathways reputedly specifically in crops. However, exacerbated herbicide metabolism is also a key mechanism underlying evolved non-target-site-based resistance to herbicides (NTSR) in weeds. This raised the issue of a possible role of safeners on NTSR evolution in weeds. We investigated a possible effect of the respective field rates of the two broadly used safeners cloquintocet-mexyl and mefenpyr-diethyl on the sensitivity of the troublesome global weed Lolium sp. (rye-grass) to the major herbicides inhibiting acetolactate-synthase (ALS) pyroxsulam and iodosulfuron + mesosulfuron, respectively. Three Lolium sp. populations were studied in three series of experiments. The first experiment series compared the frequencies of plants surviving application of each herbicide alone or in association with its safener. Safener co-application caused a net increase ranging from 5.0 to 46.5% in the frequency of plants surviving the field rate of their associated herbicide. In a second series of experiments, safener effect was assessed on individual plant sensitivity using vegetative propagation. A reduction in sensitivity to pyroxsulam and to iodosulfuron + mesosulfuron was observed for 44.4 and 11.1% of the plants in co-treatment with cloquintocet-mexyl and mefenpyr-diethyl, respectively. A third series of experiments investigated safener effect on the expression level of 19 Lolium sp. NTSR marker genes. Safeners showed an enhancing effect on the expression level of 10 genes. Overall, we demonstrated that cloquintocet-mexyl and mefenpyr-diethyl both reduced the sensitivity of Lolium sp. to their associated ALS-inhibiting
Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.
Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako
2009-02-01
Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.
Isolation and characterization of terpene synthases in cotton (Gossypium hirsutum).
Yang, Chang-Qing; Wu, Xiu-Ming; Ruan, Ju-Xin; Hu, Wen-Li; Mao, Yin-Bo; Chen, Xiao-Ya; Wang, Ling-Jian
2013-12-01
Cotton plants accumulate gossypol and related sesquiterpene aldehydes, which function as phytoalexins against pathogens and feeding deterrents to herbivorous insects. However, to date little is known about the biosynthesis of volatile terpenes in this crop. Herein is reported that 5 monoterpenes and 11 sesquiterpenes from extracts of a glanded cotton cultivar, Gossypium hirsutum cv. CCRI12, were detected by gas chromatography-mass spectrometry (GC-MS). By EST data mining combined with Rapid Amplification of cDNA Ends (RACE), full-length cDNAs of three terpene synthases (TPSs), GhTPS1, GhTPS2 and GhTPS3 were isolated. By in vitro assays of the recombinant proteins, it was found that GhTPS1 and GhTPS2 are sesquiterpene synthases: the former converted farnesyl pyrophosphate (FPP) into β-caryophyllene and α-humulene in a ratio of 2:1, whereas the latter produced several sesquiterpenes with guaia-1(10),11-diene as the major product. By contrast, GhTPS3 is a monoterpene synthase, which produced α-pinene, β-pinene, β-phellandrene and trace amounts of other monoterpenes from geranyl pyrophosphate (GPP). The TPS activities were also supported by Virus Induced Gene Silencing (VIGS) in the cotton plant. GhTPS1 and GhTPS3 were highly expressed in the cotton plant overall, whereas GhTPS2 was expressed only in leaves. When stimulated by mechanical wounding, Verticillium dahliae (Vde) elicitor or methyl jasmonate (MeJA), production of terpenes and expression of the corresponding synthase genes were induced. These data demonstrate that the three genes account for the biosynthesis of volatile terpenes of cotton, at least of this Upland cotton. Copyright © 2013 Elsevier Ltd. All rights reserved.
Cloning and expression of pineapple sucrosephosphate synthase ...
African Journals Online (AJOL)
A 1132-base pairs (bp) polymerase-chain-reaction product of sucrose-phosphate synthase (SPS) (EC 2.3.1.14) from pineapple (Ananas comosus cv. Comte de paris) fruit was cloned and nominated as Ac- SPS1. The sequence encodes a putative 377 amino acids protein containing two serine conserved features that had ...
Radwan, Alzahraa; Kleinwächter, Maik; Selmar, Dirk
2017-09-01
In previous experiments, we demonstrated that the amount of monoterpenes in sage is increased massively by drought stress. Our current study is aimed to elucidate whether this increase is due, at least in part, to elevated activity of the monoterpene synthases responsible for the biosynthesis of essential oils in sage. Accordingly, the transcription rates of the monoterpene synthases were analyzed. Salvia officinalis plants were cultivated under moderate drought stress. The concentrations of monoterpenes as well as the expression of the monoterpene synthases were analyzed. The amount of monoterpenes massively increased in response to drought stress; it doubled after just two days of drought stress. The observed changes in monoterpene content mostly match with the patterns of monoterpene synthase expressions. The expression of bornyl diphosphate synthase was strongly up-regulated; its maximum level was reached after two days. Sabinene synthase increased gradually and reached a maximum after two weeks. In contrast, the transcript level of cineole synthase continuously declined. This study revealed that the stress related increase of biosynthesis is not only due to a "passive" shift caused by the stress related over-reduced status, but also is due - at least in part-to an "active" up-regulation of the enzymes involved. Copyright © 2017 Elsevier Ltd. All rights reserved.
Creation of a high-amylose durum wheat through mutagenesis of starch synthase II (SSIIa)
In cereal seeds mutations in one or more starch synthases lead to decreased amylopectin and increased amylose content. Here, the impact of starch synthase IIa (SSIIa or SGP-1) mutations upon durum starch was investigated. A screen of durum accessions identified two lines lacking SGP-A1, the A geno...
Directory of Open Access Journals (Sweden)
Zhonglu Peng
Full Text Available Hedgehog signaling pathway plays a critical role in the initiation and development of pancreatic ductal adenocarcinoma (PDA and represents an attractive target for PDA treatment. Lithium, a clinical mood stabilizer for mental disorders, potently inhibits the activity of glycogen synthase kinase 3β (GSK3β that promotes the ubiquitin-dependent proteasome degradation of GLI1, an important downstream component of hedgehog signaling. Herein, we report that lithium inhibits cell proliferation, blocks G1/S cell-cycle progression, induces cell apoptosis and suppresses tumorigenic potential of PDA cells through down-regulation of the expression and activity of GLI1. Moreover, lithium synergistically enhances the anti-cancer effect of gemcitabine. These findings further our knowledge of mechanisms of action for lithium and provide a potentially new therapeutic strategy for PDA through targeting GLI1.
Fructose effect to enhance liver glycogen deposition is due to inhibition of glycogenolysis
International Nuclear Information System (INIS)
Youn, J.; Kaslow, H.; Bergman, R.
1987-01-01
The effect of fructose on glycogen degradation was examined by measuring flux of [ 14 C] from prelabeled glycogen in perfused rat livers. During 2 h refeeding of fasted rats hepatic glycogen was labeled by injection of [U 14 C] galactose (0.1 mg and 0.02 μCi/g of body weight). Refed livers were perfused for 30 min with glucose only (10 mM) and for 60 min with glucose (10 mM) without (n=5) or with fructose (1, 2, 10 mM; n=5 for each). With fructose, label production immediately declined and remained suppressed through the end of perfusion (P < 0.05). Suppression was dose-dependent: steady state label production was suppressed 45, 64, and 72% by 1, 2, and 10 mM fructose (P < 0.0001), without significant changes in glycogen synthase or phosphorylase. These results suggest the existence of allosteric inhibition of phosphorylase in the presence of fructose. Fructose 1-phosphate (F1P) accumulated in proportion to fructose (0.11 +/- 0.01 without fructose, 0.86 +/- 0.03, 1.81 +/- 0.18, and 8.23 +/- 0.6 μmoles/g of liver with 1, 2, and 10 mM fructose. Maximum inhibition of phosphorylase was 82%; FIP concentration for half inhibition was 0.57 μmoles/g of liver, well within the concentration of F1P attained in refeeding. Fructose enhances net glycogen synthesis in liver by suppressing glycogenolysis and the suppression is presumably caused by allosteric inhibition of phosphorylase by F1P
Caffeine inhibits cell proliferation by G0/G1 phase arrest in JB6 cells.
Hashimoto, Takashi; He, Zhiwei; Ma, Wei-Ya; Schmid, Patricia C; Bode, Ann M; Yang, Chung S; Dong, Zigang
2004-05-01
Caffeine is a major biologically active constituent in coffee and tea. Because caffeine has been reported to inhibit carcinogenesis in UVB-exposed mice, the cancer-preventing effect of caffeine has attracted considerable attention. In the present study, the effect of caffeine in quiescent (G0 phase) cells was investigated. Pretreatment with caffeine suppressed cell proliferation in a dose-dependent manner 36 h after addition of fetal bovine serum as a cell growth stimulator. Analysis by flow cytometry showed that caffeine suppressed cell cycle progression at the G0/G1 phase, i.e., 18 h after addition of fetal bovine serum, the percentages of cells in G0/G1 phase in 1 mM caffeine-treated cells and in caffeine-untreated cells were 61.7 and 29.0, respectively. The percentage of cells in G0/G1 phase at 0 h was 75.5. Caffeine inhibited phosphorylation of retinoblastoma protein at Ser780 and Ser807/Ser811, the sites where retinoblastoma protein has been reported to be phosphorylated by cyclin-dependent kinase 4 (cdk4). Furthermore, caffeine inhibited the activation of the cyclin D1-cdk4 complex in a dose-dependent manner. However this compound did not directly inhibit the activity of this complex. In addition, caffeine did not affect p16INK4 or p27Kip1 protein levels, but inhibited the phosphorylation of protein kinase B (Akt) and glycogen synthase kinase 3beta. Our results showed that caffeine suppressed the progression of quiescent cells into the cell cycle. The inhibitory mechanism may be due to the inhibition of cell growth signal-induced activation of cdk4, which may be involved in the inhibition of carcinogenesis in vivo.
Identification of a novel CoA synthase isoform, which is primarily expressed in Brain
International Nuclear Information System (INIS)
Nemazanyy, Ivan; Panasyuk, Ganna; Breus, Oksana; Zhyvoloup, Alexander; Filonenko, Valeriy; Gout, Ivan T.
2006-01-01
CoA and its derivatives Acetyl-CoA and Acyl-CoA are important players in cellular metabolism and signal transduction. CoA synthase is a bifunctional enzyme which mediates the final stages of CoA biosynthesis. In previous studies, we have reported molecular cloning, biochemical characterization, and subcellular localization of CoA synthase (CoASy). Here, we describe the existence of a novel CoA synthase isoform, which is the product of alternative splicing and possesses a 29aa extension at the N-terminus. We termed it CoASy β and originally identified CoA synthase, CoASy α. The transcript specific for CoASy β was identified by electronic screening and by RT-PCR analysis of various rat tissues. The existence of this novel isoform was further confirmed by immunoblot analysis with antibodies directed to the N-terminal peptide of CoASy β. In contrast to CoASy α, which shows ubiquitous expression, CoASy β is primarily expressed in Brain. Using confocal microscopy, we demonstrated that both isoforms are localized on mitochondria. The N-terminal extension does not affect the activity of CoA synthase, but possesses a proline-rich sequence which can bring the enzyme into complexes with signalling proteins containing SH3 or WW domains. The role of this novel isoform in CoA biosynthesis, especially in Brain, requires further elucidation
Cong, Ling; Wang, Cheng; Chen, Ling; Liu, Huijuan; Yang, Guangxiao; He, Guangyuan
2009-09-23
Dietary micronutrient deficiencies, such as the lack of vitamin A, are a major source of morbidity and mortality worldwide. Carotenoids in food can function as provitamin A in humans, while grains of Chinese elite wheat cultivars generally have low carotenoid contents. To increase the carotenoid contents in common wheat endosperm, transgenic wheat has been generated by expressing the maize y1 gene encoding phytoene synthase driven by a endosperm-specific 1Dx5 promoter in the elite wheat (Triticum aestivum L.) variety EM12, together with the bacterial phytoene desaturase crtI gene from Erwinia uredovora under the constitutive CaMV 35S promoter control. A clear increase of the carotenoid content was detected in the endosperms of transgenic wheat that visually showed a light yellow color. The total carotenoids content was increased up to 10.8-fold as compared with the nontransgenic EM12 cultivar. To test whether the variability of total carotenoid content in different transgenic lines was due to differences in the transgene copy number or expression pattern, Southern hybridization and semiquantitative reverse transcriptase polymerase chain reaction analyses were curried out. The results showed that transgene copy numbers and transcript levels did not associate well with carotenoid contents. The expression patterns of endogenous carotenoid genes, such as the phytoene synthases and carotene desaturases, were also investigated in wild-type and transgenic wheat lines. No significant changes in expression levels of these genes were detected in the transgenic endosperms, indicating that the increase in carotenoid transgenic wheat endosperms resulted from the expression of transgenes.
The subcellular localization of yeast glycogen synthase is dependent upon glycogen content
Wilson, Wayne A.; Boyer, Michael P.; Davis, Keri D.; Burke, Michael; Roach, Peter J.
2010-01-01
The budding yeast, Saccharomyces cerevisiae, accumulates the storage polysaccharide glycogen in response to nutrient limitation. Glycogen synthase, the major form of which is encoded by the GSY2 gene, catalyzes the key regulated step in glycogen storage. Here, we utilize Gsy2p fusions to green fluorescent protein (GFP) to determine where glycogen synthase is located within cells. We demonstrate that the localization pattern of Gsy2-GFP depends upon the glycogen content of the cell. When glyco...
Directory of Open Access Journals (Sweden)
Mostafa Waly
2016-01-01
Full Text Available The folate and cobalamin (Cbl- dependent enzyme methionine synthase (MS is highly sensitive to oxidation and its activity affects all methylation reactions. Recent studies have revealed alternative splicing of MS mRNA in human brain and patient-derived fibroblasts. Here we show that MS mRNA in SH-SY5Y human neuroblastoma cells is alternatively spliced, resulting in three primary protein species, thus providing a useful model to examine cofactor dependence of these variant enzymes. MS activity was dependent upon methylcobalamin (MeCbl or the combination of hydroxocobalamin (OHCbl and S-adenosylmethionine (SAM. OHCbl-based activity was eliminated by depletion of the antioxidant glutathione (GSH but could be rescued by provision of either glutathionylcobalamin (GSCbl or MeCbl. Pretreatment of cells with lead, arsenic, aluminum, mercury, or the ethylmercury-containing preservative thimerosal lowered GSH levels and inhibited MS activity in association with decreased uptake of cysteine, which is rate-limiting for GSH synthesis. Thimerosal treatment decreased cellular levels of GSCbl and MeCbl. These findings indicate that the alternatively spliced form of MS expressed in SH-SY5Y human neuronal cells is sensitive to inhibition by thimerosal and neurotoxic metals, and lower GSH levels contribute to their inhibitory action.
International Nuclear Information System (INIS)
Sheorain, V.S.; Ramakrishna, S.; Benjamin, W.B.; Soderling, T.R.
1985-01-01
A multifunctional protein kinase, purified from rat liver as ATP-citrate lyase kinase, has been identified as a glycogen synthase kinase. This kinase catalyzed incorporation of up to 1.5 mol of and]2number 2 PO 4 /mol of synthase subunit associated with a decrease in the glycogen synthase activity ratio from 0.85 to a value of 0.15. Approximately 65-70% of the 34 PO 4 was incorporated into site 3 and 30-35% into site 2 as determined by reverse phase high performance liquid chromatography. This multifunctional kinase was distinguished from glycogen synthase kinase-3 on the basis of nucleotide and protein substrate specificities. Since the phosphate contents in glycogen synthase of sites 3 and 2 are altered in diabetes and by insulin administration, the possible involvement of the multifunctional kinase was explored. Glycogen synthase purified from diabetic rabbits was phosphorylated in vitro by this multifunctional kinase at only 10% of the rate compared to synthase purified from control rabbits. Treatment of the diabetics with insulin restored the synthase to a form that was readily phosphorylated in vitro
Energy Technology Data Exchange (ETDEWEB)
Bian, Yong, E-mail: drbiany@126.com [Department of Science and Technology, Nanjing University of Chinese Medicine, 210023 (China); Yu, Yun [College of Pharmacy, Nanjing University of Chinese Medicine, 210023 (China); Wang, Shanshan; Li, Lin [Department of Science and Technology, Nanjing University of Chinese Medicine, 210023 (China)
2015-08-07
Lipid metabolism is dysregulated in many human diseases including atherosclerosis, type 2 diabetes and cancers. Fatty acid synthase (FASN), a key lipogenic enzyme involved in de novo lipid biosynthesis, is significantly upregulated in multiple types of human cancers and associates with tumor progression. However, limited data is available to understand underlying biological functions and clinical significance of overexpressed FASN in pancreatic ductal adenocarcinoma (PDAC). Here, upregulated FASN was more frequently observed in PDAC tissues compared with normal pancreas in a tissue microarray. Kaplan–Meier survival analysis revealed that high expression level of FASN resulted in a significantly poor prognosis of PDAC patients. Knockdown or inhibition of endogenous FASN decreased cell proliferation and increased cell apoptosis in HPAC and AsPC-1 cells. Furthermore, we demonstrated that EGFR/ERK signaling accounts for elevated FASN expression in PDAC as ascertained by performing siRNA assays and using specific pharmacological inhibitors. Collectively, our results indicate that FASN exhibits important roles in tumor growth and EGFR/ERK pathway is responsible for upregulated expression of FASN in PDAC. - Highlights: • Increased expression of FASN indicates a poor prognosis in PDAC. • Elevated FASN favors tumor growth in PDAC in vitro. • Activation of EGFR signaling contributes to elevated FASN expression.
International Nuclear Information System (INIS)
Bian, Yong; Yu, Yun; Wang, Shanshan; Li, Lin
2015-01-01
Lipid metabolism is dysregulated in many human diseases including atherosclerosis, type 2 diabetes and cancers. Fatty acid synthase (FASN), a key lipogenic enzyme involved in de novo lipid biosynthesis, is significantly upregulated in multiple types of human cancers and associates with tumor progression. However, limited data is available to understand underlying biological functions and clinical significance of overexpressed FASN in pancreatic ductal adenocarcinoma (PDAC). Here, upregulated FASN was more frequently observed in PDAC tissues compared with normal pancreas in a tissue microarray. Kaplan–Meier survival analysis revealed that high expression level of FASN resulted in a significantly poor prognosis of PDAC patients. Knockdown or inhibition of endogenous FASN decreased cell proliferation and increased cell apoptosis in HPAC and AsPC-1 cells. Furthermore, we demonstrated that EGFR/ERK signaling accounts for elevated FASN expression in PDAC as ascertained by performing siRNA assays and using specific pharmacological inhibitors. Collectively, our results indicate that FASN exhibits important roles in tumor growth and EGFR/ERK pathway is responsible for upregulated expression of FASN in PDAC. - Highlights: • Increased expression of FASN indicates a poor prognosis in PDAC. • Elevated FASN favors tumor growth in PDAC in vitro. • Activation of EGFR signaling contributes to elevated FASN expression
Exendin-4 Inhibits Hepatic Lipogenesis by Increasing β-Catenin Signaling.
Directory of Open Access Journals (Sweden)
Mi Hae Seo
Full Text Available The aim of this study is to investigate whether the beneficial effect of exendin-4 on hepatic steatosis is mediated by β-catenin signaling. After the HepG2 human hepatoma cells were treated with PA for 24 hours, total triglycerides levels were increased in a dose-dependent manner, and the expression levels of perilipin family members were upregulated in cells treated with 400 μM PA. For our in vitro model of hepatic steatosis, HepG2 cells were treated with 400 μM palmitic acid (PA in the presence or absence of 100 nM exendin-4 for 24 hours. PA increased the expression of lipogenic genes, such as sterol regulatory element-binding protein 1c (SREBP-1c, peroxisome proliferator-activated receptor gamma (PPARγ, stearoyl-CoA desaturase 1 (SCD1, fatty acid synthase (FAS, and acetyl-CoA carboxylase (ACC and triglyceride synthesis-involved genes, such as diacylglycerol acyltransferase 1 (DGAT1 and diacylglycerol acyltransferase 2 (DGAT2 in HepG2 cells, whereas exendin-4 treatment significantly prevented the upregulation of SREBP-1c, PPARγ, SCD1, FAS, ACC, DGAT1 and DGAT2. Moreover, exendin-4 treatment increased the expression of phosphorylated glycogen synthase kinase-3 beta (GSK-3β in the cytosolic fraction and the expression of β-catenin and transcription factor 4 (TCF4 in the nuclear fraction. In addition, siRNA-mediated inhibition of β-catenin upregulated the expression of lipogenic transcription factors. The protective effects of exendin-4 on intracellular triglyceride content and total triglyceride levels were not observed in cells treated with the β-catenin inhibitor IWR-1. These data suggest that exendin-4 treatment improves hepatic steatosis by inhibiting lipogenesis via activation of Wnt/β-catenin signaling.
From bacterial to human dihydrouridine synthase: automated structure determination
Energy Technology Data Exchange (ETDEWEB)
Whelan, Fiona, E-mail: fiona.whelan@york.ac.uk; Jenkins, Huw T., E-mail: fiona.whelan@york.ac.uk [The University of York, Heslington, York YO10 5DD (United Kingdom); Griffiths, Samuel C. [University of Oxford, Headington, Oxford OX3 7BN (United Kingdom); Byrne, Robert T. [Ludwig-Maximilians-University Munich, Feodor-Lynen-Strasse 25, 81377 Munich (Germany); Dodson, Eleanor J.; Antson, Alfred A., E-mail: fiona.whelan@york.ac.uk [The University of York, Heslington, York YO10 5DD (United Kingdom)
2015-06-30
The crystal structure of a human dihydrouridine synthase, an enzyme associated with lung cancer, with 18% sequence identity to a T. maritima enzyme, has been determined at 1.9 Å resolution by molecular replacement after extensive molecular remodelling of the template. The reduction of uridine to dihydrouridine at specific positions in tRNA is catalysed by dihydrouridine synthase (Dus) enzymes. Increased expression of human dihydrouridine synthase 2 (hDus2) has been linked to pulmonary carcinogenesis, while its knockdown decreased cancer cell line viability, suggesting that it may serve as a valuable target for therapeutic intervention. Here, the X-ray crystal structure of a construct of hDus2 encompassing the catalytic and tRNA-recognition domains (residues 1–340) determined at 1.9 Å resolution is presented. It is shown that the structure can be determined automatically by phenix.mr-rosetta starting from a bacterial Dus enzyme with only 18% sequence identity and a significantly divergent structure. The overall fold of the human Dus2 is similar to that of bacterial enzymes, but has a larger recognition domain and a unique three-stranded antiparallel β-sheet insertion into the catalytic domain that packs next to the recognition domain, contributing to domain–domain interactions. The structure may inform the development of novel therapeutic approaches in the fight against lung cancer.
From bacterial to human dihydrouridine synthase: automated structure determination
International Nuclear Information System (INIS)
Whelan, Fiona; Jenkins, Huw T.; Griffiths, Samuel C.; Byrne, Robert T.; Dodson, Eleanor J.; Antson, Alfred A.
2015-01-01
The crystal structure of a human dihydrouridine synthase, an enzyme associated with lung cancer, with 18% sequence identity to a T. maritima enzyme, has been determined at 1.9 Å resolution by molecular replacement after extensive molecular remodelling of the template. The reduction of uridine to dihydrouridine at specific positions in tRNA is catalysed by dihydrouridine synthase (Dus) enzymes. Increased expression of human dihydrouridine synthase 2 (hDus2) has been linked to pulmonary carcinogenesis, while its knockdown decreased cancer cell line viability, suggesting that it may serve as a valuable target for therapeutic intervention. Here, the X-ray crystal structure of a construct of hDus2 encompassing the catalytic and tRNA-recognition domains (residues 1–340) determined at 1.9 Å resolution is presented. It is shown that the structure can be determined automatically by phenix.mr-rosetta starting from a bacterial Dus enzyme with only 18% sequence identity and a significantly divergent structure. The overall fold of the human Dus2 is similar to that of bacterial enzymes, but has a larger recognition domain and a unique three-stranded antiparallel β-sheet insertion into the catalytic domain that packs next to the recognition domain, contributing to domain–domain interactions. The structure may inform the development of novel therapeutic approaches in the fight against lung cancer
Energy Technology Data Exchange (ETDEWEB)
Richard L. Blanton
2004-02-19
OAK-B135 The major accomplishments of this project were: (1) the initial characterization of dcsA, the gene for the putative catalytic subunit of cellulose synthase in the cellular slime mold Dictyostelium discoideum; (2) the detection of a developmentally regulated event (unidentified, but perhaps a protein modification or association with a protein partner) that is required for cellulose synthase activity (i.e., the dcsA product is necessary, but not sufficient for cellulose synthesis); (3) the continued exploration of the developmental context of cellulose synthesis and DcsA; (4) the isolation of a GFP-DcsA-expressing strain (work in progress); and (5) the identification of Dictyostelium homologues for plant genes whose products play roles in cellulose biosynthesis. Although our progress was slow and many of our results negative, we did develop a number of promising avenues of investigation that can serve as the foundation for future projects.
Directory of Open Access Journals (Sweden)
Max Hirte
2018-04-01
Full Text Available Diterpene synthases catalyze complex, multi-step C-C coupling reactions thereby converting the universal, aliphatic precursor geranylgeranyl diphosphate into diverse olefinic macrocylces that form the basis for the structural diversity of the diterpene natural product family. Since catalytically relevant crystal structures of diterpene synthases are scarce, homology based biomolecular modeling techniques offer an alternative route to study the enzyme's reaction mechanism. However, precise identification of catalytically relevant amino acids is challenging since these models require careful preparation and refinement techniques prior to substrate docking studies. Targeted amino acid substitutions in this protein class can initiate premature quenching of the carbocation centered reaction cascade. The structural characterization of those alternative cyclization products allows for elucidation of the cyclization reaction cascade and provides a new source for complex macrocyclic synthons. In this study, new insights into structure and function of the fungal, bifunctional Aphidicolan-16-ß-ol synthase were achieved using a simplified biomolecular modeling strategy. The applied refinement methodologies could rapidly generate a reliable protein-ligand complex, which provides for an accurate in silico identification of catalytically relevant amino acids. Guided by our modeling data, ACS mutations lead to the identification of the catalytically relevant ACS amino acid network I626, T657, Y658, A786, F789, and Y923. Moreover, the ACS amino acid substitutions Y658L and D661A resulted in a premature termination of the cyclization reaction cascade en-route from syn-copalyl diphosphate to Aphidicolan-16-ß-ol. Both ACS mutants generated the diterpene macrocycle syn-copalol and a minor, non-hydroxylated labdane related diterpene, respectively. Our biomolecular modeling and mutational studies suggest that the ACS substrate cyclization occurs in a spatially
Hirte, Max; Meese, Nicolas; Mertz, Michael; Fuchs, Monika; Brück, Thomas B
2018-01-01
Diterpene synthases catalyze complex, multi-step C-C coupling reactions thereby converting the universal, aliphatic precursor geranylgeranyl diphosphate into diverse olefinic macrocylces that form the basis for the structural diversity of the diterpene natural product family. Since catalytically relevant crystal structures of diterpene synthases are scarce, homology based biomolecular modeling techniques offer an alternative route to study the enzyme's reaction mechanism. However, precise identification of catalytically relevant amino acids is challenging since these models require careful preparation and refinement techniques prior to substrate docking studies. Targeted amino acid substitutions in this protein class can initiate premature quenching of the carbocation centered reaction cascade. The structural characterization of those alternative cyclization products allows for elucidation of the cyclization reaction cascade and provides a new source for complex macrocyclic synthons. In this study, new insights into structure and function of the fungal, bifunctional Aphidicolan-16-ß-ol synthase were achieved using a simplified biomolecular modeling strategy. The applied refinement methodologies could rapidly generate a reliable protein-ligand complex, which provides for an accurate in silico identification of catalytically relevant amino acids. Guided by our modeling data, ACS mutations lead to the identification of the catalytically relevant ACS amino acid network I626, T657, Y658, A786, F789, and Y923. Moreover, the ACS amino acid substitutions Y658L and D661A resulted in a premature termination of the cyclization reaction cascade en-route from syn-copalyl diphosphate to Aphidicolan-16-ß-ol. Both ACS mutants generated the diterpene macrocycle syn-copalol and a minor, non-hydroxylated labdane related diterpene, respectively. Our biomolecular modeling and mutational studies suggest that the ACS substrate cyclization occurs in a spatially restricted location of
Hirte, Max; Meese, Nicolas; Mertz, Michael; Fuchs, Monika; Brück, Thomas B.
2018-04-01
Diterpene synthases catalyze complex, multi-step C-C coupling reactions thereby converting the universal, aliphatic precursor geranylgeranyl diphosphate into diverse olefinic macrocylces that form the basis for the structural diversity of the diterpene natural product family. Since catalytically relevant crystal structures of diterpene synthases are scarce, homology based biomolecular modelling techniques offer an alternative route to study the enzyme’s reaction mechanism. However, precise identification of catalytically relevant amino acids is challenging since these models require careful preparation and refinement techniques prior to substrate docking studies. Targeted amino acid substitutions in this protein class can initiate premature quenching of the carbocation centered reaction cascade. The structural characterization of those alternative cyclization products allows for elucidation of the cyclization reaction cascade and provides a new source for complex macrocyclic synthons. In this study, new insights into structure and function of the fungal, bifunctional Aphidicolan-16-ß-ol synthase were achieved using a simplified biomolecular modelling strategy. The applied refinement methodologies could rapidly generate a reliable protein-ligand complex, which provides for an accurate in silico identification of catalytically relevant amino acids. Guided by our modelling data, ACS mutations lead to the identification of the catalytically relevant ACS amino acid network I626, T657, Y658, A786, F789 and Y923. Moreover, the ACS amino acid substitutions Y658L and D661A resulted in a premature termination of the cyclization reaction cascade en-route from syn-copalyl diphosphate to Aphidicolan-16-ß-ol. Both ACS mutants generated the diterpene macrocycle syn-copalol and a minor, non-hydroxylated labdane related diterpene, respectively. Our biomolecular modelling and mutational studies suggest that the ACS substrate cyclization occurs in a spatially restricted location
Directory of Open Access Journals (Sweden)
Pornpimon Jantaruk
Full Text Available Antimicrobial peptides (AMPs are attractive alternatives to antibiotics. Due to their immune modulatory properties, AMPs are at present emerging as promising agents for controlling inflammatory-mediated diseases. In this study, anti-inflammatory potential of an antimicrobial peptide, KLK (KLKLLLLLKLK and its analogs was evaluated in lipopolysaccharide (LPS-induced RAW 264.7 macrophages. The results herein demonstrated that KLK peptide as well as its analogs significantly inhibited the pro-inflammatory mediator nitric oxide (NO, interleukin-1β (IL-1β and tumor necrosis factor-α (TNF-α production in LPS-stimulated RAW 264.7 macrophages in dose-dependent manners, and such inhibitory effects were not due to direct cytotoxicity. When considering inhibition potency, KLK among the test peptides exhibited the most effective activity. The inhibitory activity of KLK peptide also extended to include suppression of LPS-induced production of prostaglandin E2 (PGE2. KLK significantly decreased mRNA and protein expression of inducible nitric oxide synthase (iNOS and cyclooxygenase-2 (COX-2 as well as mRNA expression of IL-1β and TNF-α. Moreover, KLK inhibited nuclear translocation of nuclear factor-κB (NF-κB p65 and blocked degradation and phosphorylation of inhibitor of κB (IκB. Taken together, these results suggested that the KLK peptide inhibited inflammatory response through the down-regulation of NF-κB mediated activation in macrophages. Since peptide analogs with different amino acid sequences and arrangement were investigated for their anti-inflammatory activities, the residues/structures required for activity were also discussed. Our findings therefore proved anti-inflammatory potential of the KLK peptide and provide direct evidence for therapeutic application of KLK as a novel anti-inflammatory agent.
Energy Technology Data Exchange (ETDEWEB)
Morita, Hiroyuki [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan); Kondo, Shin; Kato, Ryohei [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Wanibuchi, Kiyofumi; Noguchi, Hiroshi [School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka 422-8526 (Japan); Sugio, Shigetoshi, E-mail: sugio.shigetoshi@mw.m-kagaku.co.jp [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Abe, Ikuro, E-mail: sugio.shigetoshi@mw.m-kagaku.co.jp [School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka 422-8526 (Japan); PRESTO, Japan Science and Technology Agency, Kawaguchi, Saitama 332-0012 (Japan); Kohno, Toshiyuki, E-mail: sugio.shigetoshi@mw.m-kagaku.co.jp [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan)
2007-11-01
Octaketide synthase from A. arborescens has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.6 Å. Octaketide synthase (OKS) from Aloe arborescens is a plant-specific type III polyketide synthase that produces SEK4 and SEK4b from eight molecules of malonyl-CoA. Recombinant OKS expressed in Escherichia coli was crystallized by the hanging-drop vapour-diffusion method. The crystals belonged to space group I422, with unit-cell parameters a = b = 110.2, c = 281.4 Å, α = β = γ = 90.0°. Diffraction data were collected to 2.6 Å resolution using synchrotron radiation at BL24XU of SPring-8.
Non-target-site resistance to ALS-inhibiting herbicides in a Sagittaria trifolia L. population.
Zhao, Bochui; Fu, Danni; Yu, Yang; Huang, Chengtian; Yan, Kecheng; Li, Pingsheng; Shafi, Jamil; Zhu, He; Wei, Songhong; Ji, Mingshan
2017-08-01
Sagittaria trifolia L. is one of the most competitive weeds in rice fields in northeastern China. The continuous use of acetolactate synthase (ALS)-inhibitors has led to the evolution of herbicide resistant S. trifolia. A subpopulation BC1, which was derived from the L1 population, was analyzed using DNA sequencing and ALS enzyme activity assays and levels of resistance to five ALS-inhibiting herbicides was determined. DNA sequencing and ALS enzyme assays revealed no amino acid substitutions and no significant differences in enzyme sensitivity between susceptible and resistant populations. Whole-plant dose-response experiments showed that the BC1 population exhibited different levels of resistance (resistance ratios ranging from 2.14 to 51.53) to five ALS herbicides, and the addition of malathion (P450 inhibitor) to bensulfuron-methyl, penoxsulam and bispyribac-sodium strongly reduced the dry weight accumulation of the BC1 population compared with the effects of the three herbicides alone. The results of the present study demonstrated that the BC1 population has evolved non-target-site resistance to ALS-inhibiting herbicides. Copyright © 2017 Elsevier Inc. All rights reserved.
Souza-Moreira, Tatiana M.; Alves, Thaís B.; Pinheiro, Karina A.; Felippe, Lidiane G.; de Lima, Gustavo M. A.; Watanabe, Tatiana F.; Barbosa, Cristina C.; Santos, Vânia A. F. F. M.; Lopes, Norberto P.; Valentini, Sandro R.; Guido, Rafael V. C.; Furlan, Maysa; Zanelli, Cleslei F.
2016-11-01
Among the biologically active triterpenes, friedelin has the most-rearranged structure produced by the oxidosqualene cyclases and is the only one containing a cetonic group. In this study, we cloned and functionally characterized friedelin synthase and one cycloartenol synthase from Maytenus ilicifolia (Celastraceae). The complete coding sequences of these 2 genes were cloned from leaf mRNA, and their functions were characterized by heterologous expression in yeast. The cycloartenol synthase sequence is very similar to other known OSCs of this type (approximately 80% identity), although the M. ilicifolia friedelin synthase amino acid sequence is more related to β-amyrin synthases (65-74% identity), which is similar to the friedelin synthase cloned from Kalanchoe daigremontiana. Multiple sequence alignments demonstrated the presence of a leucine residue two positions upstream of the friedelin synthase Asp-Cys-Thr-Ala-Glu (DCTAE) active site motif, while the vast majority of OSCs identified so far have a valine or isoleucine residue at the same position. The substitution of the leucine residue with valine, threonine or isoleucine in M. ilicifolia friedelin synthase interfered with substrate recognition and lead to the production of different pentacyclic triterpenes. Hence, our data indicate a key role for the leucine residue in the structure and function of this oxidosqualene cyclase.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Rudolf, Jeffrey D; Dong, Liao-Bin; Cao, Hongnan; Hatzos-Skintges, Catherine; Osipiuk, Jerzy; Endres, Michael; Chang, Chin-Yuan; Ma, Ming; Babnigg, Gyorgy; Joachimiak, Andrzej; Phillips, George N; Shen, Ben
2016-08-31
Terpenoids are the largest and most structurally diverse family of natural products found in nature, yet their presence in bacteria is underappreciated. The carbon skeletons of terpenoids are generated through carbocation-dependent cyclization cascades catalyzed by terpene synthases (TSs). Type I and type II TSs initiate cyclization via diphosphate ionization and protonation, respectively, and protein structures of both types are known. Most plant diterpene synthases (DTSs) possess three α-helical domains (αβγ), which are thought to have arisen from the fusion of discrete, ancestral bacterial type I TSs (α) and type II TSs (βγ). Type II DTSs of bacterial origin, of which there are no structurally characterized members, are a missing piece in the structural evolution of TSs. Here, we report the first crystal structure of a type II DTS from bacteria. PtmT2 from Streptomyces platensis CB00739 was verified as an ent-copalyl diphosphate synthase involved in the biosynthesis of platensimycin and platencin. The crystal structure of PtmT2 was solved at a resolution of 1.80 Å, and docking studies suggest the catalytically active conformation of geranylgeranyl diphosphate (GGPP). Site-directed mutagenesis confirmed residues involved in binding the diphosphate moiety of GGPP and identified DxxxxE as a potential Mg(2+)-binding motif for type II DTSs of bacterial origin. Finally, both the shape and physicochemical properties of the active sites are responsible for determining specific catalytic outcomes of TSs. The structure of PtmT2 fundamentally advances the knowledge of bacterial TSs, their mechanisms, and their role in the evolution of TSs.
Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T
2017-01-01
Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.
Gas-Pascual, Elisabet; Berna, Anne; Bach, Thomas J; Schaller, Hubert
2014-01-01
The plant sterol pathway exhibits a major biosynthetic difference as compared with that of metazoans. The committed sterol precursor is the pentacyclic cycloartenol (9β,19-cyclolanost-24-en-3β-ol) and not lanosterol (lanosta-8,24-dien-3β-ol), as it was shown in the late sixties. However, plant genome mining over the last years revealed the general presence of lanosterol synthases encoding sequences (LAS1) in the oxidosqualene cyclase repertoire, in addition to cycloartenol synthases (CAS1) and to non-steroidal triterpene synthases that contribute to the metabolic diversity of C30H50O compounds on earth. Furthermore, plant LAS1 proteins have been unambiguously identified by peptidic signatures and by their capacity to complement the yeast lanosterol synthase deficiency. A dual pathway for the synthesis of sterols through lanosterol and cycloartenol was reported in the model Arabidopsis thaliana, though the contribution of a lanosterol pathway to the production of 24-alkyl-Δ(5)-sterols was quite marginal (Ohyama et al. (2009) PNAS 106, 725). To investigate further the physiological relevance of CAS1 and LAS1 genes in plants, we have silenced their expression in Nicotiana benthamiana. We used virus induced gene silencing (VIGS) based on gene specific sequences from a Nicotiana tabacum CAS1 or derived from the solgenomics initiative (http://solgenomics.net/) to challenge the respective roles of CAS1 and LAS1. In this report, we show a CAS1-specific functional sterol pathway in engineered yeast, and a strict dependence on CAS1 of tobacco sterol biosynthesis.
Non-bilayer structures in mitochondrial membranes regulate ATP synthase activity.
Gasanov, Sardar E; Kim, Aleksandr A; Yaguzhinsky, Lev S; Dagda, Ruben K
2018-02-01
Cardiolipin (CL) is an anionic phospholipid at the inner mitochondrial membrane (IMM) that facilitates the formation of transient non-bilayer (non-lamellar) structures to maintain mitochondrial integrity. CL modulates mitochondrial functions including ATP synthesis. However, the biophysical mechanisms by which CL generates non-lamellar structures and the extent to which these structures contribute to ATP synthesis remain unknown. We hypothesized that CL and ATP synthase facilitate the formation of non-bilayer structures at the IMM to stimulate ATP synthesis. By using 1 H NMR and 31 P NMR techniques, we observed that increasing the temperature (8°C to 37°C), lowering the pH (3.0), or incubating intact mitochondria with CTII - an IMM-targeted toxin that increases the formation of immobilized non-bilayer structures - elevated the formation of non-bilayer structures to stimulate ATP synthesis. The F 0 sector of the ATP synthase complex can facilitate the formation of non-bilayer structures as incubating model membranes enriched with IMM-specific phospholipids with exogenous DCCD-binding protein of the F 0 sector (DCCD-BPF) elevated the formation of immobilized non-bilayer structures to a similar manner as CTII. Native PAGE assays revealed that CL, but not other anionic phospholipids, specifically binds to DCCD-BPF to promote the formation of stable lipid-protein complexes. Mechanistically, molecular docking studies identified two lipid binding sites for CL in DCCD-BPF. We propose a new model of ATP synthase regulation in which CL mediates the formation of non-bilayer structures that serve to cluster protons and ATP synthase complexes as a mechanism to enhance proton translocation to the F 0 sector, and thereby increase ATP synthesis. Copyright © 2017 Elsevier B.V. All rights reserved.
Chen, Hai-Bo; Wu, Wen-Ning; Wang, Wei; Gu, Xun-Hu; Yu, Bin; Wei, Bo; Yang, Yuan-Jian
2017-04-01
Hydrogen sulfide (H 2 S) is an endogenous gaseous molecule that functions as a neuromodulator in the brain. We previously reported that H 2 S regulated amygdalar synaptic plasticity and cued fear memory in rats. However, whether endogenous H 2 S is required for amygdalar long-term potentiation (LTP) induction and cued fear memory formation remains unclear. Here, we show that cystathionine-β-synthase (CBS), the predominant H 2 S-producing enzyme in the brain, was highly expressed in the amygdala of rats. Suppressing CBS activity by inhibitor prevented activity-triggered generation of H 2 S in the lateral amygdala (LA) region. Incubating brain slices with CBS inhibitor significantly prevented the induction of NMDA receptors (NMDARs)-dependent LTP in the thalamo-LA pathway, and intra-LA infusion of CBS inhibitor impaired cued fear memory in rats. Notably, treatment with H 2 S donor, but not CBS activator, significantly reversed the impairments of LTP and fear memory caused by CBS inhibition. Mechanismly, inhibition of CBS activity led to a reduction in NMDAR-mediated synaptic response in the thalamo-LA pathway, and treatment with H 2 S donor restored the function of NMDARs. Collectively, these results indicate that CBS-derived H 2 S is required for amygdalar synaptic plasticity and cued fear memory in rats, and the effects of endogenous H 2 S might involve the regulation of NMDAR function. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Gaoyi Cao
Full Text Available A key enzyme in the shikimate pathway, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS is the primary target of the broad-spectrum herbicide glyphosate. Identification of new aroA genes coding for EPSPS with a high level of glyphosate tolerance is essential for the development of glyphosate-tolerant crops. In the present study, the glyphosate tolerance of five bacterial aroA genes was evaluated in the E. coli aroA-defective strain ER2799 and in transgenic tobacco plants. All five aroA genes could complement the aroA-defective strain ER2799, and AM79 aroA showed the highest glyphosate tolerance. Although glyphosate treatment inhibited the growth of both WT and transgenic tobacco plants, transgenic plants expressing AM79 aroA tolerated higher concentration of glyphosate and had a higher fresh weight and survival rate than plants expressing other aroA genes. When treated with high concentration of glyphosate, lower shikimate content was detected in the leaves of transgenic plants expressing AM79 aroA than transgenic plants expressing other aroA genes. These results suggest that AM79 aroA could be a good candidate for the development of transgenic glyphosate-tolerant crops.
Inhibition of Fatty Acid Synthesis Induces Apoptosis of Human Pancreatic Cancer Cells.
Nishi, Koji; Suzuki, Kenta; Sawamoto, Junpei; Tokizawa, Yuma; Iwase, Yumiko; Yumita, Nagahiko; Ikeda, Toshihiko
2016-09-01
Cancer cells tend to have a high requirement for lipids, including fatty acids, cholesterol and triglyceride, because of their rapid proliferative rate compared to normal cells. In this study, we investigated the effects of inhibition of lipid synthesis on the proliferation and viability of human pancreatic cancer cells. Of the inhibitors of lipid synthesis that were tested, 5-(tetradecyloxy)-2-furoic acid (TOFA), which is an inhibitor of acetyl-CoA carboxylase, and the fatty acid synthase (FAS) inhibitors cerulenin and irgasan, significantly suppressed the proliferation of MiaPaCa-2 and AsPC-1 cells. Treatment of MiaPaCa-2 cells with these inhibitors significantly increased the number of apoptotic cells. In addition, TOFA increased caspase-3 activity and induced cleavage of poly (ADP-ribose) polymerase in MiaPaCa-2 cells. Moreover, addition of palmitate to MiaPaCa-2 cells treated with TOFA rescued cells from apoptotic cell death. These results suggest that TOFA induces apoptosis via depletion of fatty acids and that, among the various aspects of lipid metabolism, inhibition of fatty acid synthesis may be a notable target for the treatment of human pancreatic cancer cells. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.