WorldWideScience

Sample records for synthase ggsp1 predicts

  1. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Directory of Open Access Journals (Sweden)

    Roslyn D Noar

    Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that

  2. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Science.gov (United States)

    Noar, Roslyn D; Daub, Margaret E

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  3. Predicting the catalytic sites of isopenicillin N synthase (IPNS ...

    African Journals Online (AJOL)

    Isopenicillin N synthase (IPNS) related Non-haem iron-dependent oxygenases and oxidases (NHIDOX) demonstrated a striking structural conservativeness, even with low protein sequence homology. It is evident that these enzymes have an architecturally similar catalytic centre with active ligands lining the reactive pocket.

  4. Prediction of inter domain interactions in modular polyketide synthases by docking and correlated mutation analysis.

    Science.gov (United States)

    Yadav, Gitanjali; Anand, Swadha; Mohanty, Debasisa

    2013-01-01

    Polyketide synthases (PKSs) are huge multi-enzymatic protein complexes involved in the biosynthesis of one of the largest families of bioactive natural products, namely polyketides. The specificity of interactions between various catalytic domains of these megasynthases is one of the pivotal factors which control the precise order in which the extender units are joined during the biosynthetic process. Hence, understanding the molecular details of protein-protein interactions in the PKS megasynthases would be crucial for rational design of novel polyketides by domain swapping experiments involving engineered combinations of PKS catalytic domains. We have developed a computational method for exploring the binding interface between two proteins, and used it to identify the interacting residue pairs, which govern the specificity of recognition between acyl carrier protein (ACP) domain and two core catalytic domains, namely the ketosynthase (KS) and acyl transferase (AT). Both of these domain interactions i.e. the KS-ACP and the AT-ACP, are likely to play a major role in channelling of substrates and control of specificity during polyketide biosynthesis. The method, called interface scan, uses a combination of geometric docking and evolutionary information for the identification of the most appropriate mode of association between two proteins. The parameters of interface scan have been standardized based on analysis of contacts in the crystal structure of ACP in complex with ACP synthase (AcpS). Many of the contacts predicted for PKS domains are in agreement with available experiments.

  5. Predicted cycloartenol synthase protein from Kandelia obovata and Rhizophora stylosa using online software of Phyre2 and Swiss-model

    Science.gov (United States)

    Basyuni, M.; Sulistiyono, N.; Wati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

    2018-03-01

    Cloning of Kandelia obovata KcCAS gene (previously known as Kandelia candel) and Rhizophora stylosa RsCAS have already have been reported and encoded cycloartenol synthases. In this study, the predicted KcCAS and RsCAS protein were analyzed using online software of Phyre2 and Swiss-model. The protein modelling for KcCAS and RsCAS cycloartenol synthases was determined using Pyre2 had similar results with slightly different in sequence identity. By contrast, the Swiss-model for KcCAS slightly had higher sequence identity (47.31%) and Qmean (0.70) compared to RsCAS. No difference of ligands binding site which is considered as modulators for both cycloartenol synthases. The range of predicted protein derived from 91-757 amino acid residues with coverage sequence similarities 0.86, respectively from template model of lanosterol synthase from the human. Homology modelling revealed that 706 residues (93% of the amino acid sequence) had been modelled with 100.0% confidence by the single highest scoring template for both KcCAS and RsCAS using Phyre2. This coverage was more elevated than swiss-model predicted (86%). The present study suggested that both genes are responsible for the genesis of cycloartenol in these mangrove plants.

  6. Kernel based machine learning algorithm for the efficient prediction of type III polyketide synthase family of proteins

    Directory of Open Access Journals (Sweden)

    Mallika V

    2010-03-01

    Full Text Available Type III Polyketide synthases (PKS are family of proteins considered to have significant role in the biosynthesis of various polyketides in plants, fungi and bacteria. As these proteins show positive effects to human health, more researches are going on regarding this particular protein. Developing a tool to identify the probability of sequence, being a type III polyketide synthase will minimize the time consumption and manpower efforts. In this approach, we have designed and implemented PKSIIIpred, a high performance prediction server for type III PKS where the classifier is Support Vector Machine (SVM. Based on the limited training dataset, the tool efficiently predicts the type III PKS superfamily of proteins with high sensitivity and specificity. PKSIIIpred is available at http://type3pks.in/prediction/. We expect that this tool may serve as a useful resource for type III PKS researchers. Currently work is being progressed for further betterment of prediction accuracy by including more sequence features in the training dataset.

  7. In Silico Structure Prediction of Human Fatty Acid Synthase-Dehydratase: A Plausible Model for Understanding Active Site Interactions.

    Science.gov (United States)

    John, Arun; Umashankar, Vetrivel; Samdani, A; Sangeetha, Manoharan; Krishnakumar, Subramanian; Deepa, Perinkulam Ravi

    2016-01-01

    Fatty acid synthase (FASN, UniProt ID: P49327) is a multienzyme dimer complex that plays a critical role in lipogenesis. Consequently, this lipogenic enzyme has gained tremendous biomedical importance. The role of FASN and its inhibition is being extensively researched in several clinical conditions, such as cancers, obesity, and diabetes. X-ray crystallographic structures of some of its domains, such as β-ketoacyl synthase, acetyl transacylase, malonyl transacylase, enoyl reductase, β-ketoacyl reductase, and thioesterase, (TE) are already reported. Here, we have attempted an in silico elucidation of the uncrystallized dehydratase (DH) catalytic domain of human FASN. This theoretical model for DH domain was predicted using comparative modeling methods. Different stand-alone tools and servers were used to validate and check the reliability of the predicted models, which suggested it to be a highly plausible model. The stereochemical analysis showed 92.0% residues in favorable region of Ramachandran plot. The initial physiological substrate β-hydroxybutyryl group was docked into active site of DH domain using Glide. The molecular dynamics simulations carried out for 20 ns in apo and holo states indicated the stability and accuracy of the predicted structure in solvated condition. The predicted model provided useful biochemical insights into the substrate-active site binding mechanisms. This model was then used for identifying potential FASN inhibitors using high-throughput virtual screening of the National Cancer Institute database of chemical ligands. The inhibitory efficacy of the top hit ligands was validated by performing molecular dynamics simulation for 20 ns, where in the ligand NSC71039 exhibited good enzyme inhibition characteristics and exhibited dose-dependent anticancer cytotoxicity in retinoblastoma cancer cells in vitro.

  8. Thymidylate Synthase, Thymidine Phosphorylase and Orotate Phosphoribosyl Transferase Levels as Predictive Factors of Chemotherapy in Oral Squamous Cell Carcinoma

    International Nuclear Information System (INIS)

    Ogiuchi, Yosuke; Maruoka, Yasubumi; Ando, Tomohiro; Kobayashi, Makio; Ogiuchi, Hideki

    2008-01-01

    We conducted a clinicopathologic study on protein and mRNA levels of thymidylate synthase (TS), thymidine phosphorylase (TP) and orotate phosphoribosyl transferase (OPRT) using biopsy tissue specimens before treatment. The mRNA levels have been measured in tumor cells microdissected from paraffin-embedded specimens (Danenberg Tumor Profile method: DTP method). We studied the mRNA and protein expression as effect predictive factors in chemotherapy. The subjects consisted of 20 cases of untreated oral squamous cell carcinoma who had undergone chemotherapy with TS-1 (16 males and 4 females, tongue in 8 cases, upper gingiva in 3 cases, lower gingiva in 3 cases, buccal mucosa in 5 cases and floor of the mouth in 1 case). TS gene expressions of the responders were lower than those for the nonresponders. Furthermore, regarding males who were less than 70 years of age, stage I and II, well differentiated type and tongue, TS mRNA expression of the responders were lower than that for the nonresponders. The mRNA expression of OPRT for the male responders was lower than that for the nonresponders. No remarkable difference was observed by immunohistochemistry. In this study, the measurement of the TS levels using the DTP method may potentially act as a predictive factor of antitumor effectiveness

  9. Role of Endothelial Nitric Oxide Synthase Gene Polymorphisms in Predicting Aneurysmal Subarachnoid Hemorrhage in South Indian Patients

    Directory of Open Access Journals (Sweden)

    Linda Koshy

    2008-01-01

    Full Text Available Endothelial nitric oxide synthase (eNOS gene polymorphisms have been implicated as predisposing genetic factors that can predict aneurysmal subarachnoid hemorrhage (aSAH, but with controversial results from different populations. Using a case-control study design, we tested the hypothesis whether variants in eNOS gene can increase risk of aSAH among South Indian patients, either independently, or by interacting with other risk factors of the disease. We enrolled 122 patients, along with 224 ethnically matched controls. We screened the intron-4 27-bp VNTR, the promoter T-786C and the exon-7 G894T SNPs in the eNOS gene. We found marked interethnic differences in the genotype distribution of eNOS variants when comparing the South Indian population with the reported frequencies from Caucasian and Japanese populations. Genotype distributions in control and patient populations were found to be in Hardy-Weinberg equilibrium. In patients, the allele, genotype and estimated haplotype frequencies did not differ significantly from the controls. Multiple logistic regression indicated hypertension and smoking as risk factors for the disease, however the risk alleles did not have any interaction with these risk factors. Although the eNOS polymorphisms were not found to be a likely risk factor for aSAH, the role of factors such as ethnicity, gender, smoking and hypertension should be evaluated cautiously to understand the genotype to phenotype conversion.

  10. Acute intermittent porphyria: A single-base deletion and a nonsense mutation in the human hydroxymethylbilane synthase gene, predicting truncations of the enzyme polypeptide

    Energy Technology Data Exchange (ETDEWEB)

    Lee, G.L.; Astrin, K.H.; Desnick, R.J. [Mount Sinai School of Medicine, New York, NY (United States)

    1995-08-28

    Acute intermittent porphyria (AIP) is an autosomal-dominant inborn error of metabolism that results from the half-normal activity of the third enzyme in the heme biosynthetic pathway, hydroxymethylbilane synthase (HMB-synthase). AIP is an ecogenetic condition, since the life-threatening acute attacks are precipitated by various factors, including drugs, alcohol, fasting, and certain hormones. Biochemical diagnosis is problematic, and the identification of mutations in the HMB-synthase gene provides accurate detection of presymptomatic heterozygotes, permitting avoidance of the acute precipitating factors. By direct solid-phase sequencing, two mutations causing AIP were identified, an adenine deletion at position 629 in exon 11(629delA), which alters the reading frame and predicts premature truncation of the enzyme protein after amino acid 255, and a nonsense mutation in exon 12 (R225X). These mutations were confirmed by either restriction enzyme analysis or family studies of symptomatic patients, permitting accurate presymptomatic diagnosis of affected relatives. 29 refs., 2 figs.

  11. Two Predicted Transmembrane Domains Exclude Very Long Chain Fatty acyl-CoAs from the Active Site of Mouse Wax Synthase.

    Directory of Open Access Journals (Sweden)

    Steffen Kawelke

    Full Text Available Wax esters are used as coatings or storage lipids in all kingdoms of life. They are synthesized from a fatty alcohol and an acyl-CoA by wax synthases. In order to get insights into the structure-function relationships of a wax synthase from Mus musculus, a domain swap experiment between the mouse acyl-CoA:wax alcohol acyltransferase (AWAT2 and the homologous mouse acyl-CoA:diacylglycerol O-acyltransferase 2 (DGAT2 was performed. This showed that the substrate specificity of AWAT2 is partially determined by two predicted transmembrane domains near the amino terminus of AWAT2. Upon exchange of the two domains for the respective part of DGAT2, the resulting chimeric enzyme was capable of incorporating up to 20% of very long acyl chains in the wax esters upon expression in S. cerevisiae strain H1246. The amount of very long acyl chains in wax esters synthesized by wild type AWAT2 was negligible. The effect was narrowed down to a single amino acid position within one of the predicted membrane domains, the AWAT2 N36R variant. Taken together, we provide first evidence that two predicted transmembrane domains in AWAT2 are involved in determining its acyl chain length specificity.

  12. Benzalacetone Synthase

    Directory of Open Access Journals (Sweden)

    Ikuro eAbe

    2012-03-01

    Full Text Available Benzalacetone synthase, from the medicinal plant Rheum palmatum (Polygonaceae (RpBAS, is a plant-specific chalcone synthase (CHS superfamily of type III polyketide synthase (PKS. RpBAS catalyzes the one-step, decarboxylative condensation of 4-coumaroyl-CoA with malonyl-CoA to produce the C6-C4 benzalacetone scaffold. The X-ray crystal structures of RpBAS confirmed that the diketide-forming activity is attributable to the characteristic substitution of the conserved active-site "gatekeeper" Phe with Leu. Furthermore, the crystal structures suggested that RpBAS employs novel catalytic machinery for the thioester bond cleavage of the enzyme-bound diketide intermediate and the final decarboxylation reaction to produce benzalacetone. Finally, by exploiting the remarkable substrate tolerance and catalytic versatility of RpBAS, precursor-directed biosynthesis efficiently generated chemically and structurally divergent, unnatural novel polyketide scaffolds. These findings provided a structural basis for the functional diversity of the type III PKS enzymes.

  13. In silico peptide prediction for antibody generation to recognize 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) in genetically modified organisms.

    Science.gov (United States)

    Marani, Mariela M; Costa, Joana; Mafra, Isabel; Oliveira, Maria Beatriz P P; Camperi, Silvia A; Leite, José Roberto de Souza Almeida

    2015-03-01

    For the prospective immunorecognition of 5-enolpyruvylshikimate-3-phosphate synthase (CP4-EPSPS) as a biomarker protein expressed by transgenic soybean, an extensive in silico evaluation of the referred protein was performed. The main objective of this study was the selection of a set of peptides that could function as potential immunogens for the production of novel antibodies against CP4-EPSPS protein. For this purpose, the protein was in silico cleaved with trypsin/chymotrypsin and the resultant peptides were extensively analyzed for further selection of the best candidates for antibody production. The analysis enabled the successful proposal of four peptides with potential immunogenicity for their future use as screening biomarkers of genetically modified organisms. To our knowledge, this is the first attempt to select and define potential linear epitopes for the immunization of animals and, subsequently, to generate adequate antibodies for CP4-EPSPS recognition. The present work will be followed by the synthesis of the candidate peptides to be incubated in animals for antibody generation and potential applicability for the development of an immunosensor for CP4-EPSPS detection. © 2015 Wiley Periodicals, Inc.

  14. Morphometric evaluation of nitric oxide synthase isoforms and their cytokine regulators predict pulmonary dysfunction and survival in systemic sclerosis

    Directory of Open Access Journals (Sweden)

    E.R. Parra

    2013-01-01

    Full Text Available Because histopathological changes in the lungs of patients with systemic sclerosis (SSc are consistent with alveolar and vessel cell damage, we presume that this interaction can be characterized by analyzing the expression of proteins regulating nitric oxide (NO and plasminogen activator inhibitor-1 (PAI-1 synthesis. To validate the importance of alveolar-vascular interactions and to explore the quantitative relationship between these factors and other clinical data, we studied these markers in 23 cases of SSc nonspecific interstitial pneumonia (SSc-NSIP. We used immunohistochemistry and morphometry to evaluate the amount of cells in alveolar septa and vessels staining for NO synthase (NOS and PAI-1, and the outcomes of our study were cellular and fibrotic NSIP, pulmonary function tests, and survival time until death. General linear model analysis demonstrated that staining for septal inducible NOS (iNOS related significantly to staining of septal cells for interleukin (IL-4 and to septal IL-13. In univariate analysis, higher levels of septal and vascular cells staining for iNOS were associated with a smaller percentage of septal and vascular cells expressing fibroblast growth factor and myofibroblast proliferation, respectively. Multivariate Cox model analysis demonstrated that, after controlling for SSc-NSIP histological patterns, just three variables were significantly associated with survival time: septal iNOS (P=0.04, septal IL-13 (P=0.03, and septal basic fibroblast growth factor (bFGF; P=0.02. Augmented NOS, IL-13, and bFGF in SSc-NSIP histological patterns suggest a possible functional role for iNOS in SSc. In addition, the extent of iNOS, PAI-1, and IL-4 staining in alveolar septa and vessels provides a possible independent diagnostic measure for the degree of pulmonary dysfunction and fibrosis with an impact on the survival of patients with SSc.

  15. Sequence analysis and structure prediction of type II Pseudomonas sp. USM 4–55 PHA synthase and an insight into its catalytic mechanism

    Directory of Open Access Journals (Sweden)

    Ahmad Khairudin Nurul

    2006-11-01

    Full Text Available Abstract Background Polyhydroxyalkanoates (PHA, are biodegradable polyesters derived from many microorganisms such as the pseudomonads. These polyesters are in great demand especially in the packaging industries, the medical line as well as the paint industries. The enzyme responsible in catalyzing the formation of PHA is PHA synthase. Due to the limited structural information, its functional properties including catalysis are lacking. Therefore, this study seeks to investigate the structural properties as well as its catalytic mechanism by predicting the three-dimensional (3D model of the Type II Pseudomonas sp. USM 4–55 PHA synthase 1 (PhaC1P.sp USM 4–55. Results Sequence analysis demonstrated that PhaC1P.sp USM 4–55 lacked similarity with all known structures in databases. PSI-BLAST and HMM Superfamily analyses demonstrated that this enzyme belongs to the alpha/beta hydrolase fold family. Threading approach revealed that the most suitable template to use was the human gastric lipase (PDB ID: 1HLG. The superimposition of the predicted PhaC1P.sp USM 4–55 model with 1HLG covering 86.2% of the backbone atoms showed an RMSD of 1.15 Å. The catalytic residues comprising of Cys296, Asp451 and His479 were found to be conserved and located adjacent to each other. In addition to this, an extension to the catalytic mechanism was also proposed whereby two tetrahedral intermediates were believed to form during the PHA biosynthesis. These transition state intermediates were further postulated to be stabilized by the formation of oxyanion holes. Based on the sequence analysis and the deduced model, Ser297 was postulated to contribute to the formation of the oxyanion hole. Conclusion The 3D model of the core region of PhaC1P.sp USM 4–55 from residue 267 to residue 484 was developed using computational techniques and the locations of the catalytic residues were identified. Results from this study for the first time highlighted Ser297 potentially

  16. In silico Prediction and Docking of Tertiary Structure of LuxI, an Inducer Synthase of Vibrio fischeri

    Directory of Open Access Journals (Sweden)

    Mohammed Zaghlool Saeed Al-Khayyat

    2016-05-01

    Full Text Available Background: LuxI is a component of the quorum sensing signaling pathway in Vibrio fischeri responsible for the inducer synthesis that is essential for bioluminescence. Methods: Homology modeling of LuxI was carried out using Phyre2 and refined with the GalaxyWEB server. Five models were generated and evaluated by ERRAT, ANOLEA, QMEAN6, and Procheck. Results: Five refined models were generated by the GalaxyWEB server, with Model 4 having the greatest quality based on the QMEAN6 score of 0.732. ERRAT analysis revealed an overall quality of 98.9%, while the overall quality of the initial model was 54%. The mean force potential energy, as analyzed by ANOLEA, were better compared to the initial model. Sterochemical quality estimation by Procheck showed that the refined Model 4 had a reliable structure, and was therefore submitted to the protein model database. Drug Discovery Workbench V.2 was used to screen 2700 experimental compounds from the DrugBank database to identify inhibitors that can bind to the active site between amino acids 24 and 110. Ten compounds with high negative scores were selected as the best in binding. Conclusion: The model produced, and the predicted acteyltransferase binding site, could be useful in modeling homologous sequences from other microorganisms and the design of new antimicrobials.

  17. Implications of secondary structure prediction and amino acid sequence comparison of class I and class II phosphoribosyl diphosphate synthases on catalysis, regulation, and quaternary structure

    DEFF Research Database (Denmark)

    Krath, B N; Hove-Jensen, B

    2001-01-01

    Spinach 5-phospho-D-ribosyl alpha-1-diphosphate (PRPP) synthase isozyme 4 was synthesized in Escherichia coli and purified to near homogeneity. The activity of the enzyme is independent of P(i); it is inhibited by ADP in a competitive manner, indicating a lack of an allosteric site; and it accepts...

  18. Geranyl diphosphate synthase from mint

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, R.B.; Wildung, M.R.; Burke, C.C.; Gershenzon, J.

    1999-03-02

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate. 5 figs.

  19. Geranyl diphosphate synthase from mint

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, Rodney Bruce (Pullman, WA); Wildung, Mark Raymond (Colfax, WA); Burke, Charles Cullen (Moscow, ID); Gershenzon, Jonathan (Jena, DE)

    1999-01-01

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate.

  20. Polyketide synthase from Fusarium

    DEFF Research Database (Denmark)

    Kvesel, Kasper; Wimmer, Reinhard; Sørensen, Jens Laurids

    Fungi produce a wide array of secondary metabolites, with interesting bioactivities by help of a number of enzyme complexes. Polyketide synthases (PKS) are a class of multidomain enzymes, producing a class of secondary metabolites called polyketides1,2. Only few structures of PKS’s have been...

  1. Cleaning up polyketide synthases.

    Science.gov (United States)

    Kwan, Jason C; Schmidt, Eric W

    2012-03-23

    Complex biosynthetic enzymes such as polyketide synthases make mistakes. In this issue of Chemistry & Biology, Jensen et al. report that a discrete family of acyltransferases is responsible for error correction, hydrolyzing key biosynthetic intermediates from a multi-enzyme complex. This activity might find use in understanding polyketide biosynthesis, particularly in uncultivated organisms and in tailoring the synthesis of small molecules. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. Hybrid polyketide synthases

    Energy Technology Data Exchange (ETDEWEB)

    Fortman, Jeffrey L.; Hagen, Andrew; Katz, Leonard; Keasling, Jay D.; Poust, Sean; Zhang, Jingwei; Zotchev, Sergey

    2016-05-10

    The present invention provides for a polyketide synthase (PKS) capable of synthesizing an even-chain or odd-chain diacid or lactam or diamine. The present invention also provides for a host cell comprising the PKS and when cultured produces the even-chain diacid, odd-chain diacid, or KAPA. The present invention also provides for a host cell comprising the PKS capable of synthesizing a pimelic acid or KAPA, and when cultured produces biotin.

  3. [Advances in isoprene synthase research].

    Science.gov (United States)

    Gou, Yan; Liu, Zhongchuan; Wang, Ganggang

    2017-11-25

    Isoprene emission can lead to significant consequence for atmospheric chemistry. In addition, isoprene is a chemical compound for various industrial applications. In the organisms, isoprene is produced by isoprene synthase that eliminates the pyrophosphate from the dimethylallyl diphosphate. As a key enzyme of isoprene formation, isoprene synthase plays an important role in the process of natural emission and artificial synthesis of isoprene. So far, isoprene synthase has been found in various plants. Isoprene synthases from different sources are of conservative structural and similar biochemical properties. In this review, the biochemical and structural characteristics of isoprene synthases from different sources were compared, the catalytic mechanism of isoprene synthase was discussed, and the perspective application of the enzyme in bioengineering was proposed.

  4. Crystal structure of riboflavin synthase

    Energy Technology Data Exchange (ETDEWEB)

    Liao, D.-I.; Wawrzak, Z.; Calabrese, J.C.; Viitanen, P.V.; Jordan, D.B. (DuPont); (NWU)

    2010-03-05

    Riboflavin synthase catalyzes the dismutation of two molecules of 6,7-dimethyl-8-(1'-D-ribityl)-lumazine to yield riboflavin and 4-ribitylamino-5-amino-2,6-dihydroxypyrimidine. The homotrimer of 23 kDa subunits has no cofactor requirements for catalysis. The enzyme is nonexistent in humans and is an attractive target for antimicrobial agents of organisms whose pathogenicity depends on their ability to biosynthesize riboflavin. The first three-dimensional structure of the enzyme was determined at 2.0 {angstrom} resolution using the multiwavelength anomalous diffraction (MAD) method on the Escherichia coli protein containing selenomethionine residues. The homotrimer consists of an asymmetric assembly of monomers, each of which comprises two similar {beta} barrels and a C-terminal {alpha} helix. The similar {beta} barrels within the monomer confirm a prediction of pseudo two-fold symmetry that is inferred from the sequence similarity between the two halves of the protein. The {beta} barrels closely resemble folds found in phthalate dioxygenase reductase and other flavoproteins. The three active sites of the trimer are proposed to lie between pairs of monomers in which residues conserved among species reside, including two Asp-His-Ser triads and dyads of Cys-Ser and His-Thr. The proposed active sites are located where FMN (an analog of riboflavin) is modeled from an overlay of the {beta} barrels of phthalate dioxygenase reductase and riboflavin synthase. In the trimer, one active site is formed, and the other two active sites are wide open and exposed to solvent. The nature of the trimer configuration suggests that only one active site can be formed and be catalytically competent at a time.

  5. An Arabidopsis callose synthase

    DEFF Research Database (Denmark)

    Ostergaard, Lars; Petersen, Morten; Mattsson, Ole

    2002-01-01

    in the Arabidopsis mpk4 mutant which exhibits systemic acquired resistance (SAR), elevated beta-1,3-glucan synthase activity, and increased callose levels. In addition, AtGsl5 is a likely target of salicylic acid (SA)-dependent SAR, since AtGsl5 mRNA accumulation is induced by SA in wild-type plants, while...... expression of the nahG salicylate hydroxylase reduces AtGsl5 mRNA levels in the mpk4 mutant. These results indicate that AtGsl5 is likely involved in callose synthesis in flowering tissues and in the mpk4 mutant....

  6. Monoterpene synthases from common sage (Salvia officinalis)

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, Rodney Bruce (Pullman, WA); Wise, Mitchell Lynn (Pullman, WA); Katahira, Eva Joy (Pullman, WA); Savage, Thomas Jonathan (Christchurch 5, NZ)

    1999-01-01

    cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.

  7. Highly divergent mitochondrial ATP synthase complexes in Tetrahymena thermophila.

    Directory of Open Access Journals (Sweden)

    Praveen Balabaskaran Nina

    2010-07-01

    Full Text Available The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1 sector catalyzes ATP synthesis, whereas the F(o sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1 and F(o sectors are highly conserved across prokaryotes and eukaryotes. Therefore, it was a surprise that genes encoding the a and b subunits as well as other components of the F(o sector were undetectable in the sequenced genomes of a variety of apicomplexan parasites. While the parasitic existence of these organisms could explain the apparent incomplete nature of ATP synthase in Apicomplexa, genes for these essential components were absent even in Tetrahymena thermophila, a free-living ciliate belonging to a sister clade of Apicomplexa, which demonstrates robust oxidative phosphorylation. This observation raises the possibility that the entire clade of Alveolata may have invented novel means to operate ATP synthase complexes. To assess this remarkable possibility, we have carried out an investigation of the ATP synthase from T. thermophila. Blue native polyacrylamide gel electrophoresis (BN-PAGE revealed the ATP synthase to be present as a large complex. Structural study based on single particle electron microscopy analysis suggested the complex to be a dimer with several unique structures including an unusually large domain on the intermembrane side of the ATP synthase and novel domains flanking the c subunit rings. The two monomers were in a parallel configuration rather than the angled configuration previously observed in other organisms. Proteomic analyses of well-resolved ATP synthase complexes from 2-D BN/BN-PAGE identified orthologs of seven canonical ATP synthase subunits, and at least 13 novel proteins that constitute subunits apparently limited to the ciliate lineage. A mitochondrially encoded protein, Ymf66, with predicted eight transmembrane domains could be a

  8. Studies on the Expression of Sesquiterpene Synthases Using Promoter-?-Glucuronidase Fusions in Transgenic Artemisia annua L

    OpenAIRE

    Wang, Hongzhen; Han, Junli; Kanagarajan, Selvaraju; Lundgren, Anneli; Brodelius, Peter E.

    2013-01-01

    In order to better understand the influence of sesquiterpene synthases on artemisinin yield in Artemisia annua, the expression of some sesquiterpene synthases has been studied using transgenic plants expressing promoter-GUS fusions. The cloned promoter sequences were 923, 1182 and 1510 bp for β-caryophyllene (CPS), epi-cedrol (ECS) and β-farnesene (FS) synthase, respectively. Prediction of cis-acting regulatory elements showed that the promoters are involved in complex regulation of expressio...

  9. Glycogen Synthase Kinase-3β

    DEFF Research Database (Denmark)

    Munkholm, Klaus; Lenskjold, Toke; Jacoby, Anne Sophie

    2016-01-01

    Evidence indicates a role for glycogen synthase kinase-3β (GSK-3β) in the pathophysiology of mood disorders and in cognitive disturbances; however, the natural variation in GSK-3β activity over time is unknown. We aimed to investigate GSK-3β activity over time and its possible correlation...

  10. STRUCTURAL ENZYMOLOGY OF POLYKETIDE SYNTHASES

    OpenAIRE

    Tsai, Shiou-Chuan (Sheryl); Ames, Brian Douglas

    2009-01-01

    This chapter describes structural and associated enzymological studies of polyketide synthases, including isolated single domains and multidomain fragments. The sequence–structure–function relationship of polyketide biosynthesis, compared with homologous fatty acid synthesis, is discussed in detail. Structural enzymology sheds light on sequence and structural motifs that are important for the precise timing, substrate recognition, enzyme catalysis, and protein–protein interactions leading to ...

  11. Plasticity and evolution of (+)-3-carene synthase and (-)-sabinene synthase functions of a sitka spruce monoterpene synthase gene family associated with weevil resistance.

    Science.gov (United States)

    Roach, Christopher R; Hall, Dawn E; Zerbe, Philipp; Bohlmann, Jörg

    2014-08-22

    The monoterpene (+)-3-carene is associated with resistance of Sitka spruce against white pine weevil, a major North American forest insect pest of pine and spruce. High and low levels of (+)-3-carene in, respectively, resistant and susceptible Sitka spruce genotypes are due to variation of (+)-3-carene synthase gene copy number, transcript and protein expression levels, enzyme product profiles, and enzyme catalytic efficiency. A family of multiproduct (+)-3-carene synthase-like genes of Sitka spruce include the three (+)-3-carene synthases, PsTPS-3car1, PsTPS-3car2, PsTPS-3car3, and the (-)-sabinene synthase PsTPS-sab. Of these, PsTPS-3car2 is responsible for the relatively higher levels of (+)-3-carene in weevil-resistant trees. Here, we identified features of the PsTPS-3car1, PsTPS-3car2, PsTPS-3car3, and PsTPS-sab proteins that determine different product profiles. A series of domain swap and site-directed mutations, supported by structural comparisons, identified the amino acid in position 596 as critical for product profiles dominated by (+)-3-carene in PsTPS-3car1, PsTPS-3car2, and PsTPS-3car3, or (-)-sabinene in PsTPS-sab. A leucine in this position promotes formation of (+)-3-carene, whereas phenylalanine promotes (-)-sabinene. Homology modeling predicts that position 596 directs product profiles through differential stabilization of the reaction intermediate. Kinetic analysis revealed position 596 also plays a role in catalytic efficiency. Mutations of position 596 with different side chain properties resulted in a series of enzymes with different product profiles, further highlighting the inherent plasticity and potential for evolution of alternative product profiles of these monoterpene synthases of conifer defense against insects. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. PKMiner: a database for exploring type II polyketide synthases

    OpenAIRE

    Kim Jinki; Yi Gwan-Su

    2012-01-01

    Abstract Background Bacterial aromatic polyketides are a pharmacologically important group of natural products synthesized by type II polyketide synthases (type II PKSs) in actinobacteria. Isolation of novel aromatic polyketides from microbial sources is currently impeded because of the lack of knowledge about prolific taxa for polyketide synthesis and the difficulties in finding and optimizing target microorganisms. Comprehensive analysis of type II PKSs and the prediction of possible polyke...

  13. Structural Basis of Catalysis in the Bacterial Monoterpene Synthases Linalool Synthase and 1,8-Cineole Synthase

    OpenAIRE

    Karuppiah, Vijaykumar; Ranaghan, Kara E.; Leferink, Nicole G. H.; Johannissen, Linus O.; Shanmugam, Muralidharan; Ní Cheallaigh, Aisling; Bennett, Nathan J.; Kearsey, Lewis J.; Takano, Eriko; Gardiner, John M.; van der Kamp, Marc W.; Hay, Sam; Mulholland, Adrian J.; Leys, David; Scrutton, Nigel S.

    2017-01-01

    Terpenoids form the largest and stereochemically most diverse class of natural products, and there is considerable interest in producing these by biocatalysis with whole cells or purified enzymes, and by metabolic engineering. The monoterpenes are an important class of terpenes and are industrially important as flavors and fragrances. We report here structures for the recently discovered Streptomyces clavuligerus monoterpene synthases linalool synthase (bLinS) and 1,8-cineole synthase (bCinS)...

  14. Virtual Screening of Novel Glucosamine-6-Phosphate Synthase Inhibitors.

    Science.gov (United States)

    Lather, Amit; Khatkar, Anurag; Sharma, Sunil

    2018-03-29

    affinities and interaction between the inhibitors and the target proteins (G-6-P synthase) by using Glide software (Schrodinger Inc. U.S.A.-Maestro version 10.2). Grid-based Ligand Docking with Energetic (Glide) is one of the most accurate docking softwares available for ligand-protein, protein-protein binding studies. A library of hundreds of available ligands was docked against targeted proteins G-6-P synthase having PDB ID 1moq. Results of docking are shown in Table 1 and Table 2. Results of G-6-P synthase docking showed that some compounds were found to have comparable docking score and binding energy (kj/mol) as compared to standard antibiotics. Many of the ligands showed hydrogen bond interaction, hydrophobic interactions, electrostatic interactions, ionic interactions and π- π stacking with the various amino acid residues in the binding pockets of G-6-P synthase. The docking study estimated free energy of binding, binding pose andglide score and all these parameters provide a promising tool for the discovery of new potent natural inhibitors of G-6-P synthase. These G-6-P synthase inhibitors could further be used as antimicrobials. Here, a detailed binding analysis and new insights of inhibitors from various classes of molecules were docked in binding cavity of G-6-P synthase. ADME and toxicity prediction of these compounds will further accentuate us to study these compounds in vivo. This information will possibly present further expansion of effective antimicrobials against several microbial infections. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  15. Producing biofuels using polyketide synthases

    Science.gov (United States)

    Katz, Leonard; Fortman, Jeffrey L; Keasling, Jay D

    2013-04-16

    The present invention provides for a non-naturally occurring polyketide synthase (PKS) capable of synthesizing a carboxylic acid or a lactone, and a composition such that a carboxylic acid or lactone is included. The carboxylic acid or lactone, or derivative thereof, is useful as a biofuel. The present invention also provides for a recombinant nucleic acid or vector that encodes such a PKS, and host cells which also have such a recombinant nucleic acid or vector. The present invention also provides for a method of producing such carboxylic acids or lactones using such a PKS.

  16. A multilevel prediction of physiological response to challenge: Interactions among child maltreatment, neighborhood crime, endothelial nitric oxide synthase gene (eNOS), and GABA(A) receptor subunit alpha-6 gene (GABRA6).

    Science.gov (United States)

    Lynch, Michael; Manly, Jody Todd; Cicchetti, Dante

    2015-11-01

    Physiological response to stress has been linked to a variety of healthy and pathological conditions. The current study conducted a multilevel examination of interactions among environmental toxins (i.e., neighborhood crime and child maltreatment) and specific genetic polymorphisms of the endothelial nitric oxide synthase gene (eNOS) and GABA(A) receptor subunit alpha-6 gene (GABRA6). One hundred eighty-six children were recruited at age 4. The presence or absence of child maltreatment as well as the amount of crime that occurred in their neighborhood during the previous year were determined at that time. At age 9, the children were brought to the lab, where their physiological response to a cognitive challenge (i.e., change in the amplitude of the respiratory sinus arrhythmia) was assessed and DNA samples were collected for subsequent genotyping. The results confirmed that complex Gene × Gene, Environment × Environment, and Gene × Environment interactions were associated with different patterns of respiratory sinus arrhythmia reactivity. The implications for future research and evidence-based intervention are discussed.

  17. Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne

    2004-01-01

    The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...

  18. Iterative polyketide biosynthesis by modular polyketide synthases in bacteria.

    Science.gov (United States)

    Chen, Haotong; Du, Liangcheng

    2016-01-01

    Modular polyketide synthases (type I PKSs) in bacteria are responsible for synthesizing a significant percentage of bioactive natural products. This group of synthases has a characteristic modular organization, and each module within a PKS carries out one cycle of polyketide chain elongation; thus each module is non-iterative in function. It was possible to predict the basic structure of a polyketide product from the module organization of the PKSs, since there generally existed a co-linearity between the number of modules and the number of chain elongations. However, more and more bacterial modular PKSs fail to conform to the canonical rules, and a particularly noteworthy group of non-canonical PKSs is the bacterial iterative type I PKSs. This review covers recent examples of iteratively used modular PKSs in bacteria. These non-canonical PKSs give rise to a large array of natural products with impressive structural diversity. The molecular mechanism behind the iterations is often unclear, presenting a new challenge to the rational engineering of these PKSs with the goal of generating new natural products. Structural elucidation of these synthase complexes and better understanding of potential PKS-PKS interactions as well as PKS-substrate recognition may provide new prospects and inspirations for the discovery and engineering of new bioactive polyketides.

  19. Analysis of the Thiocapsa pfennigii polyhydroxyalkanoate synthase: subcloning, molecular characterization and generation of hybrid synthases with the corresponding Chromatium vinosum enzyme.

    Science.gov (United States)

    Liebergesell, M; Rahalkar, S; Steinbüchel, A

    2000-08-01

    The PHA synthase structural gene of Thiocapsa pfennigii was identified and subcloned on a 2.8-kbp BamHI restriction fragment, which was cloned recently from a genomic 15.6-kbp EcoRI restriction fragment. Nucleotide sequence analysis of this fragment revealed three open reading frames (ORFs), representing coding regions. Two ORFs encoded for the PhaE (Mr 40,950) and PhaC (Mr 40,190) subunits of the PHA synthase from T. pfennigii and exhibited high homology with the corresponding proteins of the Chromatium vinosum (52.8% and 85.2% amino acid identity) and the Thiocystis violacea (52.5% and 82.4%) PHA synthases, respectively. This confirmed that the T. pfennigii PHA synthase was composed of two different subunits. Also, with respect to the molecular organization of phaE and phaC, this region of the T. pfennigii genome resembled very much the corresponding regions of C. vinosum and of Thiocystis violacea. A recombinant strain of Pseudomonas putida, which overexpressed phaE and phaC from T. pfennigii, was used to isolate the PHA synthase by a two-step procedure including chromatography on Procion Blue H-ERD and hydroxyapatite. The isolated PHA synthase consisted of two proteins exhibiting the molecular weights predicted for PhaE and PhaC. Hybrid PHA synthases composed of PhaE from T. pfennigii and PhaC from C. vinosum and vice versa were constructed and functionally expressed in a PHA-negative mutant of P. putida; and the resulting PHAs were analyzed.

  20. Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model

    Science.gov (United States)

    Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

    2018-03-01

    Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.

  1. Structural Basis of Catalysis in the Bacterial Monoterpene Synthases Linalool Synthase and 1,8-Cineole Synthase

    Science.gov (United States)

    2017-01-01

    Terpenoids form the largest and stereochemically most diverse class of natural products, and there is considerable interest in producing these by biocatalysis with whole cells or purified enzymes, and by metabolic engineering. The monoterpenes are an important class of terpenes and are industrially important as flavors and fragrances. We report here structures for the recently discovered Streptomyces clavuligerus monoterpene synthases linalool synthase (bLinS) and 1,8-cineole synthase (bCinS), and we show that these are active biocatalysts for monoterpene production using biocatalysis and metabolic engineering platforms. In metabolically engineered monoterpene-producing E. coli strains, use of bLinS leads to 300-fold higher linalool production compared with the corresponding plant monoterpene synthase. With bCinS, 1,8-cineole is produced with 96% purity compared to 67% from plant species. Structures of bLinS and bCinS, and their complexes with fluorinated substrate analogues, show that these bacterial monoterpene synthases are similar to previously characterized sesquiterpene synthases. Molecular dynamics simulations suggest that these monoterpene synthases do not undergo large-scale conformational changes during the reaction cycle, making them attractive targets for structured-based protein engineering to expand the catalytic scope of these enzymes toward alternative monoterpene scaffolds. Comparison of the bLinS and bCinS structures indicates how their active sites steer reactive carbocation intermediates to the desired acyclic linalool (bLinS) or bicyclic 1,8-cineole (bCinS) products. The work reported here provides the analysis of structures for this important class of monoterpene synthase. This should now guide exploitation of the bacterial enzymes as gateway biocatalysts for the production of other monoterpenes and monoterpenoids. PMID:28966840

  2. Fungal type III polyketide synthases.

    Science.gov (United States)

    Hashimoto, Makoto; Nonaka, Takamasa; Fujii, Isao

    2014-10-01

    This article covers the literature on fungal type III polyketide synthases (PKSs) published from 2005 to 2014. Since the first discovery of fungal type III PKS genes in Aspergillus oryzae, reported in 2005, putative genes for type III PKSs have been discovered in fungal genomes. Compared with type I PKSs, type III PKSs are much less abundant in fungi. However, type III PKSs could have some critical roles in fungi. This article summarizes the studies on fungal type III PKS functional analysis, including Neurospora crassa ORAS, Aspergillus niger AnPKS, Botrytis cinerea BPKS and Aspergillus oryzae CsyA and CsyB. It is mostly in vitro analysis using their recombinant enzymes that has revealed their starter and product specificities. Of these, CsyB was found to be a new kind of type III PKS that catalyses the coupling of two β-keto fatty acyl CoAs. Homology modelling reported in this article supports the importance of the capacity of the acyl binding tunnel and active site cavity in fungal type III PKSs.

  3. Terpene synthases from Cannabis sativa.

    Directory of Open Access Journals (Sweden)

    Judith K Booth

    Full Text Available Cannabis (Cannabis sativa plants produce and accumulate a terpene-rich resin in glandular trichomes, which are abundant on the surface of the female inflorescence. Bouquets of different monoterpenes and sesquiterpenes are important components of cannabis resin as they define some of the unique organoleptic properties and may also influence medicinal qualities of different cannabis strains and varieties. Transcriptome analysis of trichomes of the cannabis hemp variety 'Finola' revealed sequences of all stages of terpene biosynthesis. Nine cannabis terpene synthases (CsTPS were identified in subfamilies TPS-a and TPS-b. Functional characterization identified mono- and sesqui-TPS, whose products collectively comprise most of the terpenes of 'Finola' resin, including major compounds such as β-myrcene, (E-β-ocimene, (--limonene, (+-α-pinene, β-caryophyllene, and α-humulene. Transcripts associated with terpene biosynthesis are highly expressed in trichomes compared to non-resin producing tissues. Knowledge of the CsTPS gene family may offer opportunities for selection and improvement of terpene profiles of interest in different cannabis strains and varieties.

  4. Type III Polyketide Synthases: Functional Classification and Phylogenomics.

    Science.gov (United States)

    Shimizu, Yugo; Ogata, Hiroyuki; Goto, Susumu

    2017-01-03

    Polyketide synthases (PKSs) catalyze the sequential condensation of simple acetate units to produce a large class of natural products, including pharmacologically valuable compounds. PKSs are classified into three types on the basis of their domain structures; type III PKSs have the simplest domain structure, although their products have various structures and functions. The sequence-function relationship is fundamental for predicting enzyme functions, but it has not been well investigated in type III PKSs to date. Consequently, the current methods for predicting type III PKS functions are still immature in comparison with those that target type I/II PKSs. In this review we summarize the current functional and phylogenomic knowledge about type III PKSs and propose a new classification of their enzymatic reactions. We also discuss possible directions for the development of better computational tools for functional prediction of type III PKS homologues. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Aromatic Polyketide Synthases (Purification, Characterization, and Antibody Development to Benzalacetone Synthase from Raspberry Fruits).

    Science.gov (United States)

    Borejsza-Wysocki, W.; Hrazdina, G.

    1996-03-01

    p-Hydroxyphenylbutan-2-one, the characteristic aroma compound of raspberries (Rubus idaeus L.), is synthesized from p-coumaryl-coenzyme A and malonyl-coenzyme A in a two-step reaction sequence that is catalyzed by benzalacetone synthase and benzalacetone reductase (W. Borejsza-Wysocki and G. Hrazdina [1994] Phytochemistry 35: 623-628). Benzalacetone synthase condenses one malonate with p-coumarate to form the pathway intermediate p-hydroxyphenylbut-3-ene-2-one (p-hydroxybenzalacetone) in a reaction that is similar to those catalyzed by chalcone and stilbene synthases. We have obtained an enzyme preparation from ripe raspberries that was preferentially enriched in benzalacetone synthase (approximately 170-fold) over chalcone synthase (approximately 14-fold) activity. This preparation was used to characterize benzalacetone synthase and to develop polyclonal antibodies in rabbits. Benzalacetone synthase showed similarity in its molecular properties to chalcone synthase but differed distinctly in its substrate specificity, response to 2-mercaptoethanol and ethylene glycol, and induction in cell-suspension cultures. The product of the enzyme, p-hydroxybenzalacetone, inhibited mycelial growth of the raspberry pathogen Phytophthora fragariae var rubi at 250 [mu]M. We do not know whether the dual activity in the benzalacetone synthase preparation is the result of a bifunctional enzyme or is caused by contamination with chalcone synthase that was also present. The rapid induction of the enzyme in cell-suspension cultures upon addition of yeast extract and the toxicity of its product, p-hydroxybenzalacetone, to phytopathogenic fungi also suggest that the pathway may be part of a plant defense response.

  6. Chromosomal localization of the human and mouse hyaluronan synthase genes

    Energy Technology Data Exchange (ETDEWEB)

    Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  7. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  8. Noncovalent Intermediate of Thymidylate Synthase: Fact or Fiction?

    Science.gov (United States)

    Kholodar, Svetlana A; Kohen, Amnon

    2016-07-06

    Thymidylate synthase is an attractive target for antibiotic and anticancer drugs due to its essential role in the de novo biosynthesis of the DNA nucleotide thymine. The enzymatic reaction is initiated by a nucleophilic activation of the substrate via formation of a covalent bond to an active site cysteine. The traditionally accepted mechanism is then followed by a series of covalently bound intermediates, where that bond is only cleaved upon product release. Recent computational and experimental studies suggest that the covalent bond between the protein and substrate is actually quite labile. Importantly, these findings predict the existence of a noncovalently bound bisubstrate intermediate, not previously anticipated, which could be the target of a novel class of drugs inhibiting DNA biosynthesis. Here we report the synthesis of the proposed intermediate and findings supporting its chemical and kinetic competence. These findings substantiate the predicted nontraditional mechanism and the potential of this intermediate as a new drug lead.

  9. Class II recombinant phosphoribosyl diphosphate synthase from spinach

    DEFF Research Database (Denmark)

    Krath, B N; Hove-Jensen, B

    2001-01-01

    to other PRPP synthases the activity of spinach PRPP synthase isozyme 3 is independent of P(i), and the enzyme is inhibited by ribonucleoside diphosphates in a purely competitive manner, which indicates a lack of allosteric inhibition by these compounds. In addition spinach PRPP synthase isozyme 3 shows...

  10. Evolutionary and mechanistic insights from the reconstruction of (+)-humulene synthases from a modern (+)-Germacrene A Synthase

    OpenAIRE

    Gonzalez Gonzalez, Veronica; Touchet, Sabrina; Grundy, Daniel J.; Faraldos, Juan A.; Allemann, Rudolf Konrad

    2014-01-01

    Germacrene A synthase (GAS) from Solidago canadensis catalyzes the conversion of farnesyl diphosphate (FDP) to the plant sesquiterpene (+)-germacrene A. After diphosphate expulsion, farnesyl cation reacts with the distal 10,11-double bond to afford germacrene A (>96%) and

  11. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)

    Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...

  12. Glutamate synthase: An archaeal horizontal gene transfer?

    Indian Academy of Sciences (India)

    (GOGAT) which is a key enzyme in ammonia assimilation in bacteria, algae and plants. It catalyzes the reductive transamidation of amido nitrogen from glutamine to 2-oxoglutarate to form two molecules of glutamate (Temple et al 1998). Glutamate synthases differ according to their molecular weights, subunit compositions, ...

  13. Relationship between endothelial nitric oxide synthase gene ...

    African Journals Online (AJOL)

    Introduction: Endothelial nitric oxide synthase (eNOS), the enzyme in charge of nitric oxide production, plays a crucial role in vascular biology. However, the impact of single nucleotide polymorphisms (SNPs) affecting the gene encoding for eNOS (eNOS) on coronary artery diseases remains under debate and no data were ...

  14. Producing alpha-olefins using polyketide synthases

    Energy Technology Data Exchange (ETDEWEB)

    Fortman, Jeffrey L.; Katz, Leonard; Steen, Eric J.; Keasling, Jay D.

    2018-01-02

    The present invention provides for a polyketide synthase (PKS) capable of synthesizing an .alpha.-olefin, such as 1-hexene or butadiene. The present invention also provides for a host cell comprising the PKS and when cultured produces the .alpha.-olefin.

  15. Expression of Deinococcus geothermalis trehalose synthase gene ...

    African Journals Online (AJOL)

    A novel trehalose synthase gene from Deinococcus geothermalis (DSMZ 11300) containing 1692 bp reading-frame encoding 564 amino acids was amplified using polymerase chain reaction (PCR). The gene was ligated into pET30Ek/LIC vector and expressed after isopropyl β-D-thiogalactopyranoside induction in ...

  16. Cloning and expression of pineapple sucrosephosphate synthase ...

    African Journals Online (AJOL)

    A 1132-base pairs (bp) polymerase-chain-reaction product of sucrose-phosphate synthase (SPS) (EC 2.3.1.14) from pineapple (Ananas comosus cv. Comte de paris) fruit was cloned and nominated as Ac- SPS1. The sequence encodes a putative 377 amino acids protein containing two serine conserved features that had ...

  17. Cryptic polyketide synthase genes in non-pathogenic Clostridium SPP.

    Directory of Open Access Journals (Sweden)

    Swantje Behnken

    Full Text Available Modular type I polyketide synthases (PKS produce a vast array of bacterial metabolites with highly diverse biological functions. Notably, all known polyketides were isolated from aerobic bacteria, and yet no example has been reported for strict anaerobes. In this study we explored the diversity and distribution of PKS genes in the genus Clostridium. In addition to comparative genomic analyses combined with predictions of modular type I polyketide synthase (PKS gene clusters in sequenced genomes of Clostridium spp., a representative selection of other species inhabiting a variety of ecological niches was investigated by PCR screening for PKS genes. Our data reveal that all studied pathogenic Clostridium spp. are devoid of putative PKS genes. In stark contrast, cryptic PKS genes are widespread in genomes of non-pathogenic Clostridium species. According to phylogenetic analyses, the Clostridium PKS genes have unusual and diverse origins. However, reverse transcription quantitative PCR demonstrates that these genes are silent under standard cultivation conditions, explaining why the related metabolites have been overlooked until now. This study presents clostridia as a putative source for novel bioactive polyketides.

  18. Studies on the expression of sesquiterpene synthases using promoter-β-glucuronidase fusions in transgenic Artemisia annua L.

    Directory of Open Access Journals (Sweden)

    Hongzhen Wang

    Full Text Available In order to better understand the influence of sesquiterpene synthases on artemisinin yield in Artemisia annua, the expression of some sesquiterpene synthases has been studied using transgenic plants expressing promoter-GUS fusions. The cloned promoter sequences were 923, 1182 and 1510 bp for β-caryophyllene (CPS, epi-cedrol (ECS and β-farnesene (FS synthase, respectively. Prediction of cis-acting regulatory elements showed that the promoters are involved in complex regulation of expression. Transgenic A. annua plants carrying promoter-GUS fusions were studied to elucidate the expression pattern of the three sesquiterpene synthases and compared to the previously studied promoter of amorpha-4,11-diene synthase (ADS, a key enzyme of artemisinin biosynthesis. The CPS and ECS promoters were active in T-shaped trichomes of leaves and stems, basal bracts of flower buds and also in some florets cells but not in glandular secretory trichome while FS promoter activity was only observed in leaf cells and trichomes of transgenic shoots. ADS, CPS, ECS and FS transcripts were induced by wounding in a time depended manner. The four sesquiterpene synthases may be involved in responsiveness of A. annua to herbivory. Methyl jasmonate treatment triggered activation of the promoters of all four sesquiterpene synthases in a time depended manner. Southern blot result showed that the GUS gene was inserted into genomic DNA of transgenic lines as a single copy or two copies. The relative amounts of CPS and ECS as well as germacrene A synthase (GAS transcripts are much lower than that of ADS transcript. Consequently, down-regulation of the expression of the CPS, ECS or GAS gene may not improve artemsinin yield. However, blocking the expression of FS may have effects on artemisinin production.

  19. Studies on the expression of sesquiterpene synthases using promoter-β-glucuronidase fusions in transgenic Artemisia annua L.

    Science.gov (United States)

    Wang, Hongzhen; Han, Junli; Kanagarajan, Selvaraju; Lundgren, Anneli; Brodelius, Peter E

    2013-01-01

    In order to better understand the influence of sesquiterpene synthases on artemisinin yield in Artemisia annua, the expression of some sesquiterpene synthases has been studied using transgenic plants expressing promoter-GUS fusions. The cloned promoter sequences were 923, 1182 and 1510 bp for β-caryophyllene (CPS), epi-cedrol (ECS) and β-farnesene (FS) synthase, respectively. Prediction of cis-acting regulatory elements showed that the promoters are involved in complex regulation of expression. Transgenic A. annua plants carrying promoter-GUS fusions were studied to elucidate the expression pattern of the three sesquiterpene synthases and compared to the previously studied promoter of amorpha-4,11-diene synthase (ADS), a key enzyme of artemisinin biosynthesis. The CPS and ECS promoters were active in T-shaped trichomes of leaves and stems, basal bracts of flower buds and also in some florets cells but not in glandular secretory trichome while FS promoter activity was only observed in leaf cells and trichomes of transgenic shoots. ADS, CPS, ECS and FS transcripts were induced by wounding in a time depended manner. The four sesquiterpene synthases may be involved in responsiveness of A. annua to herbivory. Methyl jasmonate treatment triggered activation of the promoters of all four sesquiterpene synthases in a time depended manner. Southern blot result showed that the GUS gene was inserted into genomic DNA of transgenic lines as a single copy or two copies. The relative amounts of CPS and ECS as well as germacrene A synthase (GAS) transcripts are much lower than that of ADS transcript. Consequently, down-regulation of the expression of the CPS, ECS or GAS gene may not improve artemsinin yield. However, blocking the expression of FS may have effects on artemisinin production.

  20. Enhanced Symbiotic Performance by Rhizobium tropici Glycogen Synthase Mutants

    Science.gov (United States)

    Marroquí, Silvia; Zorreguieta, Angeles; Santamaría, Carmen; Temprano, Francisco; Soberón, Mario; Megías, Manuel; Downie, J. Allan

    2001-01-01

    We isolated a Tn5-induced Rhizobium tropici mutant that has enhanced capacity to oxidize N,N-dimethyl-p-phenylendiamine (DMPD) and therefore has enhanced respiration via cytochrome oxidase. The mutant had increased levels of the cytochromes c1 and CycM and a small increase in the amount of cytochrome aa3. In plant tests, the mutant increased the dry weight of Phaseolus vulgaris plants by 20 to 38% compared with the control strain, thus showing significantly enhanced symbiotic performance. The predicted product of the mutated gene is homologous to glycogen synthases from several bacteria, and the mutant lacked glycogen. The DNA sequence of the adjacent gene region revealed six genes predicted to encode products homologous to the following gene products from Escherichia coli: glycogen phosphorylase (glgP), glycogen branching enzyme (glgB), ADP glucose pyrophosphorylase (glgC), glycogen synthase (glgA), phosphoglucomutase (pgm), and glycogen debranching enzyme (glgX). All six genes are transcribed in the same direction, and analysis with lacZ gene fusions suggests that the first five genes are organized in one operon, although pgm appears to have an additional promoter; glgX is transcribed independently. Surprisingly, the glgA mutant had decreased levels of high-molecular-weight exopolysaccharide after growth on glucose, but levels were normal after growth on galactose. A deletion mutant was constructed in order to generate a nonpolar mutation in glgA. This mutant had a phenotype similar to that of the Tn5 mutant, indicating that the enhanced respiration and symbiotic nitrogen fixation and decreased exopolysaccharide were due to mutation of glgA and not to a polar effect on a downstream gene. PMID:11208782

  1. Engineering of plant type III polyketide synthases.

    Science.gov (United States)

    Wakimoto, Toshiyuki; Morita, Hiroyuki; Abe, Ikuro

    2012-01-01

    Members of the chalcone synthase superfamily of type III polyketide synthases (PKSs) catalyze iterative condensations of CoA thioesters to produce a variety of polyketide scaffolds with remarkable structural diversity and biological activities. The homodimeric type III PKSs share a common three-dimensional overall fold with a conserved Cys-His-Asn catalytic triad; notably, only a slight modification of the active site dramatically expands the catalytic repertoire of the enzymes. In addition, the enzymes exhibit extremely promiscuous substrate specificities, and accept a variety of nonphysiological substrates, making the type III PKSs an excellent platform for the further production of unnatural, novel polyketide scaffolds with promising biological activities. This chapter summarizes recent advances in the engineering of plant type III PKS enzymes in our laboratories, using approaches combining structure-based enzyme engineering and precursor-directed biosynthesis with rationally designed substrate analogs. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. Engineering cotton (+)-delta-cadinene synthase to an altered function: germacrene D-4-ol synthase.

    Science.gov (United States)

    Yoshikuni, Yasuo; Martin, Vincent J J; Ferrin, Thomas E; Keasling, Jay D

    2006-01-01

    The combined approaches of rational design and random mutagenesis were applied to generate a sesquiterpene synthase with an altered activity. Due to the lack of a convenient screen for sesquiterpene synthase activity, a high-throughput dual-activity screen was used by fusing (+)-delta-cadinene synthase to chloramphenicol acetyltransferase (CAT). The gene encoding (+)-delta-cadinene synthase was mutagenized using error-prone PCR. The resulting mutant fusion proteins were screened for CAT activity and altered sesquiterpene selectivity. Twenty-one clones producing (+)-delta-cadinene and germacrene D-4-ol in different ratios were isolated from the library. Analysis using a homology model of (+)-delta-cadinene synthase suggested that the G helix plays a very important role in (+)-delta-cadinene formation. Reconstruction of the G helix using site-directed, saturation mutagenesis yielded a mutant, N403P/L405H, that maintained its specific activity and showed higher selectivity to germacrene D-4-ol in vivo (up to 93%).

  3. CTP synthase forms cytoophidia in the cytoplasm and nucleus

    Energy Technology Data Exchange (ETDEWEB)

    Gou, Ke-Mian [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); State Key Laboratory for Agrobiotechnology, College of Biological Sciences, China Agricultural University, Beijing 100193 (China); Chang, Chia-Chun [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Shen, Qing-Ji [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); Sung, Li-Ying, E-mail: liyingsung@ntu.edu.tw [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei 115, Taiwan, ROC (China); Liu, Ji-Long, E-mail: jilong.liu@dpag.ox.ac.uk [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom)

    2014-04-15

    CTP synthase is an essential metabolic enzyme responsible for the de novo synthesis of CTP. Multiple studies have recently showed that CTP synthase protein molecules form filamentous structures termed cytoophidia or CTP synthase filaments in the cytoplasm of eukaryotic cells, as well as in bacteria. Here we report that CTP synthase can form cytoophidia not only in the cytoplasm, but also in the nucleus of eukaryotic cells. Both glutamine deprivation and glutamine analog treatment promote formation of cytoplasmic cytoophidia (C-cytoophidia) and nuclear cytoophidia (N-cytoophidia). N-cytoophidia are generally shorter and thinner than their cytoplasmic counterparts. In mammalian cells, both CTP synthase 1 and CTP synthase 2 can form cytoophidia. Using live imaging, we have observed that both C-cytoophidia and N-cytoophidia undergo multiple rounds of fusion upon glutamine analog treatment. Our study reveals the coexistence of cytoophidia in the cytoplasm and nucleus, therefore providing a good opportunity to investigate the intracellular compartmentation of CTP synthase. - Highlights: • CTP synthase forms cytoophidia not only in the cytoplasm but also in the nucleus. • Glutamine deprivation and Glutamine analogs promotes cytoophidium formation. • N-cytoophidia exhibit distinct morphology when compared to C-cytoophidia. • Both CTP synthase 1 and CTP synthase 2 form cytoophidia in mammalian cells. • Fusions of cytoophidia occur in the cytoplasm and nucleus.

  4. Heme A synthase in bacteria depends on one pair of cysteinyls for activity.

    Science.gov (United States)

    Lewin, Anna; Hederstedt, Lars

    2016-02-01

    Heme A is a prosthetic group unique for cytochrome a-type respiratory oxidases in mammals, plants and many microorganisms. The poorly understood integral membrane protein heme A synthase catalyzes the synthesis of heme A from heme O. In bacteria, but not in mitochondria, this enzyme contains one or two pairs of cysteine residues that are present in predicted hydrophilic polypeptide loops on the extracytoplasmic side of the membrane. We used heme A synthase from the eubacterium Bacillus subtilis and the hyperthermophilic archeon Aeropyrum pernix to investigate the functional role of these cysteine residues. Results with B. subtilis amino acid substituted proteins indicated the pair of cysteine residues in the loop connecting transmembrane segments I and II as being essential for catalysis but not required for binding of the enzyme substrate, heme O. Experiments with isolated A. pernix and B. subtilis heme A synthase demonstrated that a disulfide bond can form between the cysteine residues in the same loop and also between loops showing close proximity of the two loops in the folded enzyme protein. Based on the findings, we propose a classification scheme for the four discrete types of heme A synthase found so far in different organisms and propose that essential cysteinyls mediate transfer of reducing equivalents required for the oxygen-dependent catalysis of heme A synthesis from heme O. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Localization of nitric oxide synthase in human skeletal muscle

    DEFF Research Database (Denmark)

    Frandsen, Ulrik; Lopez-Figueroa, M.; Hellsten, Ylva

    1996-01-01

    The present study investigated the cellular localization of the neuronal type I and endothelial type III nitric oxide synthase in human skeletal muscle. Type I NO synthase immunoreactivity was found in the sarcolemma and the cytoplasm of all muscle fibres. Stronger immunoreactivity was expressed...... in the sarcolemma as well as the cytoplasm of type I muscle fibres. NADPH diaphorase activity confirmed a higher level of NO synthase activity in the sarcolemma as well as the cytoplasm of type I muscle fibers. Histochemical staining for cytochrome oxidase showed a staining pattern similar to that observed for type...... I NO synthase immunoreactivity and NADPH diaphorase activity. Type III NO synthase immunoreactivity was observed both in the endothelium of larger vessels and of microvessels. The results establish that human skeletal muscle expresses two different constitutive isoforms of NO synthase in different...

  6. Identification and functional analysis of the geranylgeranyl pyrophosphate synthase gene (crtE) and phytoene synthase gene (crtB) for carotenoid biosynthesis in Euglena gracilis.

    Science.gov (United States)

    Kato, Shota; Takaichi, Shinichi; Ishikawa, Takahiro; Asahina, Masashi; Takahashi, Senji; Shinomura, Tomoko

    2016-01-05

    Euglena gracilis, a unicellular phytoflagellate within Euglenida, has attracted much attention as a potential feedstock for renewable energy production. In outdoor open-pond cultivation for biofuel production, excess direct sunlight can inhibit photosynthesis in this alga and decrease its productivity. Carotenoids play important roles in light harvesting during photosynthesis and offer photoprotection for certain non-photosynthetic and photosynthetic organisms including cyanobacteria, algae, and higher plants. Although, Euglenida contains β-carotene and xanthophylls (such as zeaxanthin, diatoxanthin, diadinoxanthin and 9'-cis neoxanthin), the pathway of carotenoid biosynthesis has not been elucidated. To clarify the carotenoid biosynthetic pathway in E. gracilis, we searched for the putative E. gracilis geranylgeranyl pyrophosphate (GGPP) synthase gene (crtE) and phytoene synthase gene (crtB) by tblastn searches from RNA-seq data and obtained their cDNAs. Complementation experiments in Escherichia coli with carotenoid biosynthetic genes of Pantoea ananatis showed that E. gracilis crtE (EgcrtE) and EgcrtB cDNAs encode GGPP synthase and phytoene synthase, respectively. Phylogenetic analyses indicated that the predicted proteins of EgcrtE and EgcrtB belong to a clade distinct from a group of GGPP synthase and phytoene synthase proteins, respectively, of algae and higher plants. In addition, we investigated the effects of light stress on the expression of crtE and crtB in E. gracilis. Continuous illumination at 460 or 920 μmol m(-2) s(-1) at 25 °C decreased the E. gracilis cell concentration by 28-40 % and 13-91 %, respectively, relative to the control light intensity (55 μmol m(-2) s(-1)). When grown under continuous light at 920 μmol m(-2) s(-1), the algal cells turned reddish-orange and showed a 1.3-fold increase in the crtB expression. In contrast, EgcrtE expression was not significantly affected by the light-stress treatments examined. We identified genes

  7. Functional plasticity of paralogous diterpene synthases involved in conifer defense

    OpenAIRE

    Keeling, Christopher I.; Weisshaar, Sabrina; Lin, Roy P. C.; Bohlmann, Jörg

    2008-01-01

    The diversity of terpenoid compounds produced by plants plays an important role in mediating various plant–herbivore, plant–pollinator, and plant–pathogen interactions. This diversity has resulted from gene duplication and neofunctionalization of the enzymes that synthesize and subsequently modify terpenes. Two diterpene synthases in Norway spruce (Picea abies), isopimaradiene synthase and levopimaradiene/abietadiene synthase, provide the hydrocarbon precursors for most of the diterpene resin...

  8. Geranyl diphosphate synthase molecules, and nucleic acid molecules encoding same

    Science.gov (United States)

    Croteau, Rodney Bruce [Pullman, WA; Burke, Charles Cullen [Moscow, ID

    2008-06-24

    In one aspect, the present invention provides isolated nucleic acid molecules that each encode a geranyl diphosphate synthase protein, wherein each isolated nucleic acid molecule hybridizes to a nucleic acid molecule consisting of the sequence set forth in SEQ ID NO:1 under conditions of 5.times.SSC at 45.degree. C. for one hour. The present invention also provides isolated geranyl diphosphate synthase proteins, and methods for altering the level of expression of geranyl diphosphate synthase protein in a host cell.

  9. Clinical significance of Phosphatidyl Inositol Synthase overexpression in oral cancer

    International Nuclear Information System (INIS)

    Kaur, Jatinder; Sawhney, Meenakshi; DattaGupta, Siddartha; Shukla, Nootan K; Srivastava, Anurag; Ralhan, Ranju

    2010-01-01

    We reported increased levels of Phosphatidyl Inositol synthase (PI synthase), (enzyme that catalyses phosphatidyl inositol (PI) synthesis-implicated in intracellular signaling and regulation of cell growth) in smokeless tobacco (ST) exposed oral cell cultures by differential display. This study determined the clinical significance of PI synthase overexpression in oral squamous cell carcinoma (OSCC) and premalignant lesions (leukoplakia), and identified the downstream signaling proteins in PI synthase pathway that are perturbed by smokeless tobacco (ST) exposure. Tissue microarray (TMA) Immunohistochemistry, Western blotting, Confocal laser scan microscopy, RT-PCR were performed to define the expression of PI synthase in clinical samples and in oral cell culture systems. Significant increase in PI synthase immunoreactivity was observed in premalignant lesions and OSCCs as compared to oral normal tissues (p = 0.000). Further, PI synthase expression was significantly associated with de-differentiation of OSCCs, (p = 0.005) and tobacco consumption (p = 0.03, OR = 9.0). Exposure of oral cell systems to smokeless tobacco (ST) in vitro confirmed increase in PI synthase, Phosphatidylinositol 3-kinase (PI3K) and cyclin D1 levels. Collectively, increased PI synthase expression was found to be an early event in oral cancer and a target for smokeless tobacco

  10. Divinyl ether synthase gene and protein, and uses thereof

    Science.gov (United States)

    Howe, Gregg A [East Lansing, MI; Itoh, Aya [Tsuruoka, JP

    2011-09-13

    The present invention relates to divinyl ether synthase genes, proteins, and methods of their use. The present invention encompasses both native and recombinant wild-type forms of the synthase, as well as mutants and variant forms, some of which possess altered characteristics relative to the wild-type synthase. The present invention also relates to methods of using divinyl ether synthase genes and proteins, including in their expression in transgenic organisms and in the production of divinyl ether fatty acids, and to methods of suing divinyl ether fatty acids, including in the protection of plants from pathogens.

  11. Vitis vinifera terpenoid cyclases: functional identification of two sesquiterpene synthase cDNAs encoding (+)-valencene synthase and (-)-germacrene D synthase and expression of mono- and sesquiterpene synthases in grapevine flowers and berries.

    Science.gov (United States)

    Lücker, Joost; Bowen, Pat; Bohlmann, Jörg

    2004-10-01

    Valencene is a volatile sesquiterpene emitted from flowers of grapevine, Vitis vinifera L. A full-length cDNA from the cultivar Gewürztraminer was functionally expressed in Escherichia coli and found to encode valencene synthase (VvVal). The two major products formed by recombinant VvVal enzyme activity with farnesyl diphosphate (FPP) as substrate are (+)-valencene and (-)-7-epi-alpha-selinene. Grapevine valencene synthase is closely related to a second sesquiterpene synthase from this species, (-)-germacrene D synthase (VvGerD). VvVal and VvGerD cDNA probes revealed strong signals in Northern hybridizations with RNA isolated from grapevine flower buds. Transcript levels were lower in open pre-anthesis flowers, flowers after anthesis, or at early onset of fruit development. Similar results were obtained using a third probe, (-)-alpha-terpineol synthase, a monoterpenol synthase. Sesquiterpene synthase and monoterpene synthase transcripts were not detected in the mesocarp and exocarp during early stages of fruit development, but transcripts hybridizing with VvVal appeared during late ripening of the berries. Sesquiterpene synthase transcripts were also detected in young seeds.

  12. Molecular and biochemical characterization of caffeine synthase and purine alkaloid concentration in guarana fruit.

    Science.gov (United States)

    Schimpl, Flávia Camila; Kiyota, Eduardo; Mayer, Juliana Lischka Sampaio; Gonçalves, José Francisco de Carvalho; da Silva, José Ferreira; Mazzafera, Paulo

    2014-09-01

    Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Chrysanthemyl diphosphate synthase operates in planta as a bifunctional enzyme with chrysanthemol synthase activity

    DEFF Research Database (Denmark)

    Yang, Ting; Gao, Liping; Hu, Hao

    2014-01-01

    Chrysanthemyl diphosphate synthase (CDS) is the first path-way-specific enzyme in the biosynthesis of pyrethrins, the most widely used plant-derived pesticide. CDS catalyzes c1′-2-3 cyclopropanation reactions of two molecules of dimethylallyl diphosphate (DMAPP) to yield chrysanthemyl diphosphate...

  14. Impaired ATP synthase assembly associated with a mutation in the human ATP synthase subunit 6 gene.

    NARCIS (Netherlands)

    Nijtmans, L.G.J.; Henderson, N.S.; Attardi, G.; Holt, L.J.

    2001-01-01

    Mutations in human mitochondrial DNA are a well recognized cause of disease. A mutation at nucleotide position 8993 of human mitochondrial DNA, located within the gene for ATP synthase subunit 6, is associated with the neurological muscle weakness, ataxia, and retinitis pigmentosa (NARP) syndrome.

  15. Interaction with the small subunit of geranyl diphosphate synthase modifies the chain length specificity of geranylgeranyl diphosphate synthase to produce geranyl diphosphate.

    Science.gov (United States)

    Burke, Charles; Croteau, Rodney

    2002-02-01

    Geranyl diphosphate synthase belongs to a subgroup of prenyltransferases, including farnesyl diphosphate synthase and geranylgeranyl diphosphate synthase, that catalyzes the specific formation, from C(5) units, of the respective C(10), C(15), and C(20) precursors of monoterpenes, sesquiterpenes, and diterpenes. Unlike farnesyl diphosphate synthase and geranylgeranyl diphosphate synthase, which are homodimers, geranyl diphosphate synthase from Mentha is a heterotetramer in which the large subunit shares functional motifs and a high level of amino acid sequence identity (56-75%) with geranylgeranyl diphosphate synthases of plant origin. The small subunit, however, shares little sequence identity with other isoprenyl diphosphate synthases; yet it is absolutely required for geranyl diphosphate synthase catalysis. Coexpression in Escherichia coli of the Mentha geranyl diphosphate synthase small subunit with the phylogenetically distant geranylgeranyl diphosphate synthases from Taxus canadensis and Abies grandis yielded a functional hybrid heterodimer that generated geranyl diphosphate as product in each case. These results indicate that the geranyl diphosphate synthase small subunit is capable of modifying the chain length specificity of geranylgeranyl diphosphate synthase (but not, apparently, farnesyl diphosphate synthase) to favor the production of C(10) chains. Comparison of the kinetic behavior of the parent prenyltransferases with that of the hybrid enzyme revealed that the hybrid possesses characteristics of both geranyl diphosphate synthase and geranylgeranyl diphosphate synthase.

  16. SUCROSE SYNTHASE: ELUCIDATION OF COMPLEX POST-TRANSLATIONAL REGULATORY MECHANISMS

    Energy Technology Data Exchange (ETDEWEB)

    Steven C. Huber

    2009-05-12

    Studies have focused on the enzyme sucrose synthase, which plays an important role in the metabolism of sucrose in seeds and tubers. There are three isoforms of SUS in maize, referred to as SUS1, SUS-SH1, and SUS2. SUS is generally considered to be tetrameric protein but recent evidence suggests that SUS can also occur as a dimeric protein. The formation of tetrameric SUS is regulated by sucrose concentration in vitro and this could also be an important factor in the cellular localization of the protein. We found that high sucrose concentrations, which promote tetramer formation, also inhibit the binding of SUS1 to actin filaments in vitro. Previously, high sucrose concentrations were shown to promote SUS association with the plasma membrane. The specific regions of the SUS molecule involved in oligomerization are not known, but we identified a region of the SUS1 moelcule by bioinformatic analysis that was predicted to form a coiled coil. We demonstrated that this sequence could, in fact, self-associate as predicted for a coiled coil, but truncation analysis with the full-length recombinant protein suggested that it was not responsible for formation of dimers or tetramers. However, the coiled coil may function in binding of other proteins to SUS1. Overall, sugar availability may differentially influence the binding of SUS to cellular structures, and these effects may be mediated by changes in the oligomeric nature of the enzyme.

  17. Uncovering the structures of modular polyketide synthases.

    Science.gov (United States)

    Weissman, Kira J

    2015-03-01

    The modular polyketide synthases (PKSs) are multienzyme proteins responsible for the assembly of diverse secondary metabolites of high economic and therapeutic importance. These molecular 'assembly lines' consist of repeated functional units called 'modules' organized into gigantic polypeptides. For several decades, concerted efforts have been made to understand in detail the structure and function of PKSs in order to facilitate genetic engineering of the systems towards the production of polyketide analogues for evaluation as drug leads. Despite this intense activity, it has not yet been possible to solve the crystal structure of a single module, let alone a multimodular subunit. Nonetheless, on the basis of analysis of the structures of modular fragments and the study of the related multienzyme of animal fatty acid synthase (FAS), several models of modular PKS architecture have been proposed. This year, however, the situation has changed - three modular structures have been characterized, not by X-ray crystallography, but by the complementary methods of single-particle cryo-electron microscopy and small-angle X-ray scattering. This review aims to compare the cryo-EM structures and SAXS-derived structural models, and to interpret them in the context of previously obtained data and existing architectural proposals. The consequences for genetic engineering of the systems will also be discussed, as well as unresolved questions and future directions.

  18. Investigating sesquiterpene biosynthesis in Ginkgo biloba: molecular cloning and functional characterization of (E,E)-farnesol and α-bisabolene synthases.

    Science.gov (United States)

    Parveen, Iffat; Wang, Mei; Zhao, Jianping; Chittiboyina, Amar G; Tabanca, Nurhayat; Ali, Abbas; Baerson, Scott R; Techen, Natascha; Chappell, Joe; Khan, Ikhlas A; Pan, Zhiqiang

    2015-11-01

    Ginkgo biloba is one of the oldest living tree species and has been extensively investigated as a source of bioactive natural compounds, including bioactive flavonoids, diterpene lactones, terpenoids and polysaccharides which accumulate in foliar tissues. Despite this chemical diversity, relatively few enzymes associated with any biosynthetic pathway from ginkgo have been characterized to date. In the present work, predicted transcripts potentially encoding enzymes associated with the biosynthesis of diterpenoid and terpenoid compounds, including putative terpene synthases, were first identified by mining publicly-available G. biloba RNA-seq data sets. Recombinant enzyme studies with two of the TPS-like sequences led to the identification of GbTPS1 and GbTPS2, encoding farnesol and bisabolene synthases, respectively. Additionally, the phylogenetic analysis revealed the two terpene synthase genes as primitive genes that might have evolved from an ancestral diterpene synthase.

  19. Prostaglandin H synthase immunoreactivity in human gut. An immunohistochemical study

    DEFF Research Database (Denmark)

    Mikkelsen, H B; Rumessen, J J; Qvortrup, K

    1991-01-01

    Prostaglandins exhibit a variety of actions on intestinal smooth muscle depending upon the type, dose and muscle layer studied. As the cellular origin of prostaglandin H (PGH) synthase has not been established with certainty in the human gut wall, we studied the localization of PGH synthase...

  20. Localization of nitric oxide synthase in human skeletal muscle

    DEFF Research Database (Denmark)

    Frandsen, Ulrik; Lopez-Figueroa, M.; Hellsten, Ylva

    1996-01-01

    The present study investigated the cellular localization of the neuronal type I and endothelial type III nitric oxide synthase in human skeletal muscle. Type I NO synthase immunoreactivity was found in the sarcolemma and the cytoplasm of all muscle fibres. Stronger immunoreactivity was expressed ...

  1. Sequence analysis of cereal sucrose synthase genes and isolation ...

    African Journals Online (AJOL)

    SERVER

    2007-10-18

    Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.

  2. Nitric oxide synthase expression and enzymatic activity in multiple sclerosis

    DEFF Research Database (Denmark)

    Broholm, H; Andersen, B; Wanscher, B

    2004-01-01

    and endothelial nitric oxide synthase (NOS)], and enzymatic NO synthase activity. MRI guided biopsies documented more active plaques than macroscopic examination, and histological examination revealed further lesions. Inducible NOS (iNOS) was the dominant IR isoform, while reactive astrocytes were the dominant i...

  3. A Comparison of the Effects of Neuronal Nitric Oxide Synthase and Inducible Nitric Oxide Synthase Inhibition on Cartilage Damage

    Directory of Open Access Journals (Sweden)

    Nevzat Selim Gokay

    2016-01-01

    Full Text Available The objective of this study was to investigate the effects of selective inducible nitric oxide synthase and neuronal nitric oxide synthase inhibitors on cartilage regeneration. The study involved 27 Wistar rats that were divided into five groups. On Day 1, both knees of 3 rats were resected and placed in a formalin solution as a control group. The remaining 24 rats were separated into 4 groups, and their right knees were surgically damaged. Depending on the groups, the rats were injected with intra-articular normal saline solution, neuronal nitric oxide synthase inhibitor 7-nitroindazole (50 mg/kg, inducible nitric oxide synthase inhibitor amino-guanidine (30 mg/kg, or nitric oxide precursor L-arginine (200 mg/kg. After 21 days, the right and left knees of the rats were resected and placed in formalin solution. The samples were histopathologically examined by a blinded evaluator and scored on 8 parameters. Although selective neuronal nitric oxide synthase inhibition exhibited significant (P=0.044 positive effects on cartilage regeneration following cartilage damage, it was determined that inducible nitric oxide synthase inhibition had no statistically significant effect on cartilage regeneration. It was observed that the nitric oxide synthase activation triggered advanced arthrosis symptoms, such as osteophyte formation. The fact that selective neuronal nitric oxide synthase inhibitors were observed to have mitigating effects on the severity of the damage may, in the future, influence the development of new agents to be used in the treatment of cartilage disorders.

  4. Homospermidine synthase, the first pathway-specific enzyme of pyrrolizidine alkaloid biosynthesis, evolved from deoxyhypusine synthase

    Science.gov (United States)

    Ober, Dietrich; Hartmann, Thomas

    1999-01-01

    Pyrrolizidine alkaloids are preformed plant defense compounds with sporadic phylogenetic distribution. They are thought to have evolved in response to the selective pressure of herbivory. The first pathway-specific intermediate of these alkaloids is the rare polyamine homospermidine, which is synthesized by homospermidine synthase (HSS). The HSS gene from Senecio vernalis was cloned and shown to be derived from the deoxyhypusine synthase (DHS) gene, which is highly conserved among all eukaryotes and archaebacteria. DHS catalyzes the first step in the activation of translation initiation factor 5A (eIF5A), which is essential for eukaryotic cell proliferation and which acts as a cofactor of the HIV-1 Rev regulatory protein. Sequence comparison provides direct evidence for the evolutionary recruitment of an essential gene of primary metabolism (DHS) for the origin of the committing step (HSS) in the biosynthesis of pyrrolizidine alkaloids. PMID:10611289

  5. Novel applications of plant polyketide synthases.

    Science.gov (United States)

    Abe, Ikuro

    2012-04-01

    The structurally and mechanistically simple type III polyketide synthases (PKSs) catalyze iterative condensations of CoA thioesters to produce a variety of polyketide scaffolds with remarkably diverse structures and biological activities. By exploiting the enzymes, we combined precursor-directed biosynthesis with nitrogen-containing substrates and structure-based enzyme engineering and generated unnatural, novel polyketide-alkaloid scaffolds with promising biological activities. The nucleophilic nitrogen atom and the engineered enzymes thus facilitated the formation of additional CC and CN bonds during the enzymatic transformations. The methodology will contribute to the further production of chemically and structurally divergent, unnatural natural products, as well as the rational design of novel biocatalysts with unprecedented catalytic functions. Copyright © 2011 Elsevier Ltd. All rights reserved.

  6. Tyrosine nitration affects thymidylate synthase properties.

    Science.gov (United States)

    Dąbrowska-Maś, Elżbieta; Frączyk, Tomasz; Ruman, Tomasz; Radziszewska, Karolina; Wilk, Piotr; Cieśla, Joanna; Zieliński, Zbigniew; Jurkiewicz, Agata; Gołos, Barbara; Wińska, Patrycja; Wałajtys-Rode, Elżbieta; Leś, Andrzej; Nizioł, Joanna; Jarmuła, Adam; Stefanowicz, Piotr; Szewczuk, Zbigniew; Rode, Wojciech

    2012-01-14

    Highly purified preparations of thymidylate synthase, isolated from calf thymus, and L1210 parental and FdUrd-resistant cells, were found to be nitrated, as indicated by a specific reaction with anti-nitro-tyrosine antibodies, suggesting this modification to appear endogenously in normal and tumor tissues. Each human, mouse and Ceanorhabditis elegans recombinant TS preparation, incubated in vitro in the presence of NaHCO(3), NaNO(2) and H(2)O(2) at pH 7.5, underwent tyrosine nitration, leading to a V(max)(app) 2-fold lower following nitration of 1 (with human or C. elegans TS) or 2 (with mouse TS) tyrosine residues per monomer. Enzyme interactions with dUMP, meTHF or 5-fluoro-dUMP were not distinctly influenced. Nitration under the same conditions of model tripeptides of a general formula H(2)N-Gly-X-Gly-COOH (X = Phe, Tyr, Trp, Lys, Arg, His, Ser, Thr, Cys, Gly), monitored by NMR spectroscopy, showed formation of nitro-species only for H-Gly-Tyr-Gly-OH and H-Gly-Phe-Gly-OH peptides, the chemical shifts for nitrated H-Gly-Tyr-Gly-OH peptide being in a very good agreement with the strongest peak found in (15)N-(1)H HMBC spectrum of nitrated protein. MS analysis of nitrated human and C. elegans proteins revealed several thymidylate synthase-derived peptides containing nitro-tyrosine (at positions 33, 65, 135, 213, 230, 258 and 301 in the human enzyme) and oxidized cysteine (human protein Cys(210), with catalytically critical Cys(195) remaining apparently unmodified) residues.

  7. CLYBL is a polymorphic human enzyme with malate synthase and β-methylmalate synthase activity

    Science.gov (United States)

    Strittmatter, Laura; Li, Yang; Nakatsuka, Nathan J.; Calvo, Sarah E.; Grabarek, Zenon; Mootha, Vamsi K.

    2014-01-01

    CLYBL is a human mitochondrial enzyme of unknown function that is found in multiple eukaryotic taxa and conserved to bacteria. The protein is expressed in the mitochondria of all mammalian organs, with highest expression in brown fat and kidney. Approximately 5% of all humans harbor a premature stop polymorphism in CLYBL that has been associated with reduced levels of circulating vitamin B12. Using comparative genomics, we now show that CLYBL is strongly co-expressed with and co-evolved specifically with other components of the mitochondrial B12 pathway. We confirm that the premature stop polymorphism in CLYBL leads to a loss of protein expression. To elucidate the molecular function of CLYBL, we used comparative operon analysis, structural modeling and enzyme kinetics. We report that CLYBL encodes a malate/β-methylmalate synthase, converting glyoxylate and acetyl-CoA to malate, or glyoxylate and propionyl-CoA to β-methylmalate. Malate synthases are best known for their established role in the glyoxylate shunt of plants and lower organisms and are traditionally described as not occurring in humans. The broader role of a malate/β-methylmalate synthase in human physiology and its mechanistic link to vitamin B12 metabolism remain unknown. PMID:24334609

  8. Discriminating the reaction types of plant type III polyketide synthases.

    Science.gov (United States)

    Shimizu, Yugo; Ogata, Hiroyuki; Goto, Susumu

    2017-07-01

    Functional prediction of paralogs is challenging in bioinformatics because of rapid functional diversification after gene duplication events combined with parallel acquisitions of similar functions by different paralogs. Plant type III polyketide synthases (PKSs), producing various secondary metabolites, represent a paralogous family that has undergone gene duplication and functional alteration. Currently, there is no computational method available for the functional prediction of type III PKSs. We developed a plant type III PKS reaction predictor, pPAP, based on the recently proposed classification of type III PKSs. pPAP combines two kinds of similarity measures: one calculated by profile hidden Markov models (pHMMs) built from functionally and structurally important partial sequence regions, and the other based on mutual information between residue positions. pPAP targets PKSs acting on ring-type starter substrates, and classifies their functions into four reaction types. The pHMM approach discriminated two reaction types with high accuracy (97.5%, 39/40), but its accuracy decreased when discriminating three reaction types (87.8%, 43/49). When combined with a correlation-based approach, all 49 PKSs were correctly discriminated, and pPAP was still highly accurate (91.4%, 64/70) even after adding other reaction types. These results suggest pPAP, which is based on linear discriminant analyses of similarity measures, is effective for plant type III PKS function prediction. pPAP is freely available at ftp://ftp.genome.jp/pub/tools/ppap/. goto@kuicr.kyoto-u.ac.jp. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  9. Acetolactate Synthase Activity in Developing Maize (Zea mays L.) Kernels

    Science.gov (United States)

    Muhitch, Michael J.

    1988-01-01

    Acetolactate synthase (EC 4.1.3.18) activity was examined in maize (Zea mays L.) endosperm and embryos as a function of kernel development. When assayed using unpurified homogenates, embryo acetolactate synthase activity appeared less sensitive to inhibition by leucine + valine and by the imidazolinone herbicide imazapyr than endosperm acetolactate synthase activity. Evidence is presented to show that pyruvate decarboxylase contributes to apparent acetolactate synthase activity in crude embryo extracts and a modification of the acetolactate synthase assay is proposed to correct for the presence of pyruvate decarboxylase in unpurified plant homogenates. Endosperm acetolactate synthase activity increased rapidly during early kernel development, reaching a maximum of 3 micromoles acetoin per hour per endosperm at 25 days after pollination. In contrast, embryo activity was low in young kernels and steadily increased throughout development to a maximum activity of 0.24 micromole per hour per embryo by 45 days after pollination. The sensitivity of both endosperm and embryo acetolactate synthase activities to feedback inhibition by leucine + valine did not change during kernel development. The results are compared to those found for other enzymes of nitrogen metabolism and discussed with respect to the potential roles of the embryo and endosperm in providing amino acids for storage protein synthesis. PMID:16665871

  10. Plasmodium falciparum dolichol phosphate mannose synthase represents a novel clade

    International Nuclear Information System (INIS)

    Shams-Eldin, Hosam; Santos de Macedo, Cristiana; Niehus, Sebastian; Dorn, Caroline; Kimmel, Juergen; Azzouz, Nahid; Schwarz, Ralph T.

    2008-01-01

    Dolichol phosphate mannose synthase (DPM) catalyzes the reaction between dolichol phosphate (Dol-P) and guanosine diphosphate mannose (GDP-Man) to form dolichol-phosphate-mannose (Dol-P-Man). This molecule acts as mannose donor for N-glycosylation and glycosylphosphatidylinositol (GPI) biosynthesis. The Plasmodium falciparum DPM1 (Pfdpm1) possesses a single predicted transmembrane region near the N-, but not the C-terminus. Here we show that the cloned Pfdpm1 gene failed to complement a Saccharomyces cerevisiae mutant indicating that the parasite gene does not belong to the baker's yeast group, as was previously assumed. Furthermore, Pfdpm1 was unable to complement a mouse mutant deficient in DPM but efficiently complements the Schizosaccharomyces pombe fission yeast mutant, indicating a difference between fission yeast and mammalian DPM genes. Therefore, we reanalyzed the hydrophobicity scales of all known DPMs and consequently reclassify the DPM clade into six major novel subgroups. Furthermore, we show that Pfdpm1 represents a unique enzyme among these subgroups

  11. ASMPKS: an analysis system for modular polyketide synthases

    Directory of Open Access Journals (Sweden)

    Kong Eun-Bae

    2007-09-01

    Full Text Available Abstract Background Polyketides are secondary metabolites of microorganisms with diverse biological activities, including pharmacological functions such as antibiotic, antitumor and agrochemical properties. Polyketides are synthesized by serialized reactions of a set of enzymes called polyketide synthase(PKSs, which coordinate the elongation of carbon skeletons by the stepwise condensation of short carbon precursors. Due to their importance as drugs, the volume of data on polyketides is rapidly increasing and creating a need for computational analysis methods for efficient polyketide research. Moreover, the increasing use of genetic engineering to research new kinds of polyketides requires genome wide analysis. Results We describe a system named ASMPKS (Analysis System for Modular Polyketide Synthesis for computational analysis of PKSs against genome sequences. It also provides overall management of information on modular PKS, including polyketide database construction, new PKS assembly, and chain visualization. ASMPKS operates on a web interface to construct the database and to analyze PKSs, allowing polyketide researchers to add their data to this database and to use it easily. In addition, the ASMPKS can predict functional modules for a protein sequence submitted by users, estimate the chemical composition of a polyketide synthesized from the modules, and display the carbon chain structure on the web interface. Conclusion ASMPKS has powerful computation features to aid modular PKS research. As various factors, such as starter units and post-processing, are related to polyketide biosynthesis, ASMPKS will be improved through further development for study of the factors.

  12. PKMiner: a database for exploring type II polyketide synthases

    Directory of Open Access Journals (Sweden)

    Kim Jinki

    2012-08-01

    Full Text Available Abstract Background Bacterial aromatic polyketides are a pharmacologically important group of natural products synthesized by type II polyketide synthases (type II PKSs in actinobacteria. Isolation of novel aromatic polyketides from microbial sources is currently impeded because of the lack of knowledge about prolific taxa for polyketide synthesis and the difficulties in finding and optimizing target microorganisms. Comprehensive analysis of type II PKSs and the prediction of possible polyketide chemotypes in various actinobacterial genomes will thus enable the discovery or synthesis of novel polyketides in the most plausible microorganisms. Description We performed a comprehensive computational analysis of type II PKSs and their gene clusters in actinobacterial genomes. By identifying type II PKS subclasses from the sequence analysis of 280 known type II PKSs, we developed highly accurate domain classifiers for these subclasses and derived prediction rules for aromatic polyketide chemotypes generated by different combinations of type II PKS domains. Using 319 available actinobacterial genomes, we predicted 231 type II PKSs from 40 PKS gene clusters in 25 actinobacterial genomes, and polyketide chemotypes corresponding to 22 novel PKS gene clusters in 16 genomes. These results showed that the microorganisms capable of producing aromatic polyketides are specifically distributed within a certain suborder of Actinomycetales such as Catenulisporineae, Frankineae, Micrococcineae, Micromonosporineae, Pseudonocardineae, Streptomycineae, and Streptosporangineae. Conclusions We could identify the novel candidates of type II PKS gene clusters and their polyketide chemotypes in actinobacterial genomes by comprehensive analysis of type II PKSs and prediction of aromatic polyketides. The genome analysis results indicated that the specific suborders in actinomycetes could be used as prolific taxa for polyketide synthesis. The chemotype-prediction rules with

  13. PKMiner: a database for exploring type II polyketide synthases.

    Science.gov (United States)

    Kim, Jinki; Yi, Gwan-Su

    2012-08-08

    Bacterial aromatic polyketides are a pharmacologically important group of natural products synthesized by type II polyketide synthases (type II PKSs) in actinobacteria. Isolation of novel aromatic polyketides from microbial sources is currently impeded because of the lack of knowledge about prolific taxa for polyketide synthesis and the difficulties in finding and optimizing target microorganisms. Comprehensive analysis of type II PKSs and the prediction of possible polyketide chemotypes in various actinobacterial genomes will thus enable the discovery or synthesis of novel polyketides in the most plausible microorganisms. We performed a comprehensive computational analysis of type II PKSs and their gene clusters in actinobacterial genomes. By identifying type II PKS subclasses from the sequence analysis of 280 known type II PKSs, we developed highly accurate domain classifiers for these subclasses and derived prediction rules for aromatic polyketide chemotypes generated by different combinations of type II PKS domains. Using 319 available actinobacterial genomes, we predicted 231 type II PKSs from 40 PKS gene clusters in 25 actinobacterial genomes, and polyketide chemotypes corresponding to 22 novel PKS gene clusters in 16 genomes. These results showed that the microorganisms capable of producing aromatic polyketides are specifically distributed within a certain suborder of Actinomycetales such as Catenulisporineae, Frankineae, Micrococcineae, Micromonosporineae, Pseudonocardineae, Streptomycineae, and Streptosporangineae. We could identify the novel candidates of type II PKS gene clusters and their polyketide chemotypes in actinobacterial genomes by comprehensive analysis of type II PKSs and prediction of aromatic polyketides. The genome analysis results indicated that the specific suborders in actinomycetes could be used as prolific taxa for polyketide synthesis. The chemotype-prediction rules with the suggested type II PKS modules derived using this resource

  14. Functional and evolutionary relationships between terpene synthases from Australian Myrtaceae.

    Science.gov (United States)

    Keszei, Andras; Brubaker, Curt L; Carter, Richard; Köllner, Tobias; Degenhardt, Jörg; Foley, William J

    2010-06-01

    Myrtaceae is one of the chemically most variable and most significant essential oil yielding plant families. Despite an abundance of chemical information, very little work has focussed on the biochemistry of terpene production in these plants. We describe 70 unique partial terpene synthase transcripts and eight full-length cDNA clones from 21 myrtaceous species, and compare phylogenetic relationships and leaf oil composition to reveal clades defined by common function. We provide further support for the correlation between function and phylogenetic relationships by the first functional characterisation of terpene synthases from Myrtaceae: a 1,8-cineole synthase from Eucalyptus sideroxylon and a caryophyllene synthase from Eucalyptusdives. Copyright 2010 Elsevier Ltd. All rights reserved.

  15. Chalcone synthase genes from milk thistle (Silybum marianum ...

    Indian Academy of Sciences (India)

    Leyva et al. 1995), UV treatments and blue light (Hartmann et al. 1998; Wade et al. 2001; Zhou et al. 2007), elicitor treatments such as salicylic acid and. Keywords. chalcone synthase; real-time PCR; silymarin; anthocyanin; Silybum marianum.

  16. A Therapeutic Connection between Dietary Phytochemicals and ATP Synthase.

    Science.gov (United States)

    Ahmad, Zulfiqar; Hassan, Sherif S; Azim, Sofiya

    2017-11-20

    For centuries, phytochemicals have been used to prevent and cure multiple health ailments. Phytochemicals have been reported to have antioxidant, antidiabetic, antitussive, antiparasitic, anticancer, and antimicrobial properties. Generally, the therapeutic use of phytochemicals is based on tradition or word of mouth with few evidence-based studies. Moreover, molecular level interactions or molecular targets for the majority of phytochemicals are unknown. In recent years, antibiotic resistance by microbes has become a major healthcare concern. As such, the use of phytochemicals with antimicrobial properties has become pertinent. Natural compounds from plants, vegetables, herbs, and spices with strong antimicrobial properties present an excellent opportunity for preventing and combating antibiotic resistant microbial infections. ATP synthase is the fundamental means of cellular energy. Inhibition of ATP synthase may deprive cells of required energy leading to cell death, and a variety of dietary phytochemicals are known to inhibit ATP synthase. Structural modifications of phytochemicals have been shown to increase the inhibitory potency and extent of inhibition. Sitedirected mutagenic analysis has elucidated the binding site(s) for some phytochemicals on ATP synthase. Amino acid variations in and around the phytochemical binding sites can result in selective binding and inhibition of microbial ATP synthase. In this review, the therapeutic connection between dietary phytochemicals and ATP synthase is summarized based on the inhibition of ATP synthase by dietary phytochemicals. Research suggests selective targeting of ATP synthase is a valuable alternative molecular level approach to combat antibiotic resistant microbial infections. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  17. Engineering fatty acid synthases for directed polyketide production.

    Science.gov (United States)

    Gajewski, Jan; Buelens, Floris; Serdjukow, Sascha; Janßen, Melanie; Cortina, Niña; Grubmüller, Helmut; Grininger, Martin

    2017-04-01

    In this study, we engineered fatty acid synthases (FAS) for the biosynthesis of short-chain fatty acids and polyketides, guided by a combined in vitro and in silico approach. Along with exploring the synthetic capability of FAS, we aim to build a foundation for efficient protein engineering, with the specific goal of harnessing evolutionarily related megadalton-scale polyketide synthases (PKS) for the tailored production of bioactive natural compounds.

  18. Regulation of CDP-diacylglycerol synthase activity in Saccharomyces cerevisiae.

    OpenAIRE

    Homann, M J; Henry, S A; Carman, G M

    1985-01-01

    The addition of ethanolamine or choline to inositol-containing growth medium resulted in a reduction of CTP:phosphatidate cytidylyltransferase (CDP-diacylglycerol synthase; EC 2.7.7.41) activity in Saccharomyces cerevisiae. The reduction of activity did not occur in the absence of inositol. CDP-diacylglycerol synthase activity was not regulated in a S. cerevisiae mutant strain (opi1; an inositol biosynthesis regulatory mutant) by the addition of phospholipid precursors to the growth medium.

  19. Understanding plant cellulose synthases through a comprehensive investigation of the cellulose synthase family sequences.

    Directory of Open Access Journals (Sweden)

    Andrew eCarroll

    2011-03-01

    Full Text Available The development of cellulose as an organizing structure in the plant cell wall was a key event in both the initial colonization and the subsequent domination of the terrestrial ecosystem by vascular plants. A wealth of experimental data has demonstrated the complicated genetic interactions required to form the large synthetic complex that synthesizes cellulose. However, these results are lacking an extensive analysis of the evolution, specialization, and regulation of the proteins that compose this complex. Here we perform an in-depth analysis of the sequences in the cellulose synthase (CesA family. We investigate the phylogeny of the CesA family, with emphasis on evolutionary specialization. We define specialized subfamilies and identify the class-specific regions within the CesA sequence that may explain this specialization. We investigate changes in regulation of CesAs by looking at the conservation of proposed phosphorylation sites. We investigate the conservation of sites where mutations have been documented that impair cellulose synthase function, and compare these sites to those observed in the closest cellulose synthase-like (Csl families to better understand what regions may separate the CesAs from other Csls. Finally we identify two positions with strong conservation of the aromatic trait, but lacking conservation of amino acid identity, which may represent residues important for positioning the sugar substrate for catalysis. These analyses provide useful tools for understanding characterized mutations and post-translational modifications, and for informing further experiments to probe CesA assembly, regulation, and function through site-directed mutagenesis or domain swapping experiments.

  20. Homocystinuria due to cystathionine beta synthase deficiency

    Directory of Open Access Journals (Sweden)

    Rao T

    2008-01-01

    Full Text Available A two year-old male child presented with cutis marmorata congenita universalis, brittle hair, mild mental retardation, and finger spasms. Biochemical findings include increased levels of homocysteine in the blood-106.62 µmol/L (normal levels: 5.90-16µmol/L. Biochemical tests such as the silver nitroprusside and nitroprusside tests were positive suggesting homocystinuria. The patient was treated with oral pyridoxine therapy for three months. The child responded well to this therapy and the muscle spasms as well as skin manifestations such as cutis marmorata subsided. The treatment is being continued; the case is reported here because of its rarity. Homocysteinuria arising due to cystathionine beta-synthase (CBS deficiency is an autosomal recessive disorder of methionine metabolism that produces increased levels of urinary homocysteine and methionine It manifests itself in vascular, central nervous system, cutaneous, and connective tissue disturbances and phenotypically resembles Marfan′s syndrome. Skin manifestations include malar flush, thin hair, and cutis reticulata / marmorata.

  1. Type III polyketide synthases in microorganisms.

    Science.gov (United States)

    Katsuyama, Yohei; Ohnishi, Yasuo

    2012-01-01

    Type III polyketide synthases (PKSs) are simple homodimers of ketosynthases which catalyze the condensation of one to several molecules of extender substrate onto a starter substrate through iterative decarboxylative Claisen condensation reactions. Type III PKSs have been found in bacteria and fungi, as well as plants. Microbial type III PKSs, which are involved in the biosynthesis of some lipidic compounds and various secondary metabolites, have several interesting characteristics that are not shared by plant type III PKSs. Further, many compounds produced by microbial type III PKSs have significant biological functions and/or important pharmaceutical activities. Thus, studies on this class of enzymes will expand our knowledge of the biosynthetic machineries that generate natural products and generate new findings about microbial physiology. The recent development of next-generation DNA sequencing has allowed for an increase in the number of microbial genomes sequenced and the discovery of many microbial type III PKS genes. Here, we describe basic methods to study microbial type III PKSs whose genes are easy to clone. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. Undecaprenyl diphosphate synthase inhibitors: antibacterial drug leads.

    Science.gov (United States)

    Sinko, William; Wang, Yang; Zhu, Wei; Zhang, Yonghui; Feixas, Ferran; Cox, Courtney L; Mitchell, Douglas A; Oldfield, Eric; McCammon, J Andrew

    2014-07-10

    There is a significant need for new antibiotics due to the rise in drug resistance. Drugs such as methicillin and vancomycin target bacterial cell wall biosynthesis, but methicillin-resistant Staphylococcus aureus (MRSA) and vancomycin-resistant Enterococci (VRE) have now arisen and are of major concern. Inhibitors acting on new targets in cell wall biosynthesis are thus of particular interest since they might also restore sensitivity to existing drugs, and the cis-prenyl transferase undecaprenyl diphosphate synthase (UPPS), essential for lipid I, lipid II, and thus, peptidoglycan biosynthesis, is one such target. We used 12 UPPS crystal structures to validate virtual screening models and then assayed 100 virtual hits (from 450,000 compounds) against UPPS from S. aureus and Escherichia coli. The most promising inhibitors (IC50 ∼2 μM, Ki ∼300 nM) had activity against MRSA, Listeria monocytogenes, Bacillus anthracis, and a vancomycin-resistant Enterococcus sp. with MIC or IC50 values in the 0.25-4 μg/mL range. Moreover, one compound (1), a rhodanine with close structural similarity to the commercial diabetes drug epalrestat, exhibited good activity as well as a fractional inhibitory concentration index (FICI) of 0.1 with methicillin against the community-acquired MRSA USA300 strain, indicating strong synergism.

  3. Nitric oxide synthase in ferret brain: localization and characterization.

    Science.gov (United States)

    Matsumoto, T.; Mitchell, J. A.; Schmidt, H. H.; Kohlhaas, K. L.; Warner, T. D.; Förstermann, U.; Murad, F.

    1992-01-01

    1. In the present study, we have investigated the distribution of nitric oxide synthase in the ferret brain. Nitric oxide synthase was determined biochemically and immunochemically. 2. In the rat brain, the highest nitric oxide synthase activity has been detected in the cerebellum. However, in the ferret brain, the highest activity was found in the striatum and the lowest in the cerebellum and cerebral cortex. The enzymatic activity was localized predominantly in the cytosolic fractions, it was dependent on NADPH and Ca2+, and inhibited by NG-nitro-L-arginine or NG-methyl-L-arginine. 3. Western blot analysis revealed that all regions of the ferret brain contained a 160 kD protein crossreacting with an antibody to nitric oxide synthase purified from the rat cerebellum, and the levels of relative intensity of staining by the antibody correlated with the distribution of nitric oxide synthase activity. 4. These results indicate that the ferret brain contains a nitric oxide synthase similar to the rat brain, but the distribution of enzymatic activity in the ferret brain differs markedly from the rat brain. Images Figure 1 PMID:1282076

  4. Human uroporphyrinogen III synthase: Molecular cloning, nucleotide sequence, and expression of a full-length cDNA

    International Nuclear Information System (INIS)

    Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J.

    1988-01-01

    Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 x 10 6 recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria

  5. Converting S-limonene synthase to pinene or phellandrene synthases reveals the plasticity of the active site.

    Science.gov (United States)

    Xu, Jinkun; Ai, Ying; Wang, Jianhui; Xu, Jingwei; Zhang, Yongkang; Yang, Dong

    2017-05-01

    S-limonene synthase is a model monoterpene synthase that cyclizes geranyl pyrophosphate (GPP) to form S-limonene. It is a relatively specific enzyme as the majority of its products are composed of limonene. In this study, we converted it to pinene or phellandrene synthases after introducing N345A/L423A/S454A or N345I mutations. Further studies on N345 suggest the polarity of this residue plays a critical role in limonene production by stabilizing the terpinyl cation intermediate. If it is mutated to a non-polar residue, further cyclization or hydride shifts occurs so the carbocation migrates towards the pyrophosphate, leading to the production of pinene or phellandrene. On the other hand, mutant enzymes that still possess a polar residue at this position produce limonene as the major product. N345 is not the only polar residue that may stabilize the terpinyl cation because it is not strictly conserved among limonene synthases across species and there are also several other polar residues in this area. These residues could form a "polar pocket" that may collectively play this stabilizing role. Our study provides important insights into the catalytic mechanism of limonene synthases. Furthermore, it also has wider implications on the evolution of terpene synthases. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Starter unit flexibility for engineered product synthesis by the nonreducing polyketide synthase PksA.

    Science.gov (United States)

    Huitt-Roehl, Callie R; Hill, Eric A; Adams, Martina M; Vagstad, Anna L; Li, Jesse W; Townsend, Craig A

    2015-06-19

    Nonreducing polyketide synthases (NR-PKSs) are unique among PKSs in their domain structure, notably including a starter unit:acyl-carrier protein (ACP) transacylase (SAT) domain that selects an acyl group as the primer for biosynthesis, most commonly acetyl-CoA from central metabolism. This clan of mega-enzymes resembles fatty acid synthases (FASs) by sharing both their central chain elongation steps and their capacity for iterative catalysis. In this mode of synthesis, catalytic domains involved in chain extension exhibit substrate plasticity to accommodate growing chains as small as two carbons to 20 or more. PksA is the NR-PKS central to the biosynthesis of the mycotoxin aflatoxin B1 whose SAT domain accepts an unusual hexanoyl starter from a dedicated yeast-like FAS. Explored in this paper is the ability of PksA to utilize a selection of potential starter units as substrates to initiate and sustain extension and cyclization to on-target, programmed polyketide synthesis. Most of these starter units were successfully accepted and properly processed by PksA to achieve biosynthesis of the predicted naphthopyrone product. Analysis of the on-target and derailment products revealed trends of tolerance by individual PksA domains to alternative starter units. In addition, natural and un-natural variants of the active site cysteine were examined and found to be capable of biosynthesis, suggesting possible direct loading of starter units onto the β-ketoacyl synthase (KS) domain. In light of the data assembled here, the predictable synthesis of unnatural products by NR-PKSs is more fully defined.

  7. A Molecular Dynamics Investigation of Mycobacterium tuberculosis Prenyl Synthases: Conformational Flexibility and Implications for Computer-aided Drug Discovery.

    Science.gov (United States)

    Kim, Meekyum Olivia; Feng, Xinxin; Feixas, Ferran; Zhu, Wei; Lindert, Steffen; Bogue, Shannon; Sinko, William; de Oliveira, César; Rao, Guodong; Oldfield, Eric; McCammon, James Andrew

    2015-06-01

    With the rise in antibiotic resistance, there is interest in discovering new drugs active against new targets. Here, we investigate the dynamic structures of three isoprenoid synthases from Mycobacterium tuberculosis using molecular dynamics (MD) methods with a view to discovering new drug leads. Two of the enzymes, cis-farnesyl diphosphate synthase (cis-FPPS) and cis-decaprenyl diphosphate synthase (cis-DPPS), are involved in bacterial cell wall biosynthesis, while the third, tuberculosinyl adenosine synthase (Rv3378c), is involved in virulence factor formation. The MD results for these three enzymes were then compared with previous results on undecaprenyl diphosphate synthase (UPPS) by means of active site volume fluctuation and principal component analyses. In addition, an analysis of the binding of prenyl diphosphates to cis-FPPS, cis-DPPS, and UPPS utilizing the new MD results is reported. We also screened libraries of inhibitors against cis-DPPS, finding ~1 μm inhibitors, and used the receiver operating characteristic-area under the curve (ROC-AUC) method to test the predictive power of X-ray and MD-derived cis-DPPS receptors. We found that one compound with potent M. tuberculosis cell growth inhibition activity was an IC(50) ~0.5- to 20-μm inhibitor (depending on substrate) of cis-DPPS, a ~660-nm inhibitor of Rv3378c as well as a 4.8-μm inhibitor of cis-FPPS, opening up the possibility of multitarget inhibition involving both cell wall biosynthesis and virulence factor formation. © 2014 John Wiley & Sons A/S.

  8. Characterization of Squalene synthase gene from Chlorophytum borivilianum (Sant. and Fernand.).

    Science.gov (United States)

    Kalra, Shikha; Kumar, Sunil; Lakhanpal, Neha; Kaur, Jagdeep; Singh, Kashmir

    2013-07-01

    Saponins are important group of secondary metabolites known for their pharmacological properties. Chlorophytum borivilianum contains high amount of saponins and is thus, recognized as an important medicinal plant with aphrodisiac properties. Though the plant is well known for its pharmaceutical properties, there is meager information available about the genes and enzymes responsible for biosynthesis of saponins from this plant. Squalene synthase (SqS) is the key enzyme of saponin biosynthesis pathway and here, we report cloning and characterization of SqS gene from C. borivilianum. A full-length CbSqS cDNA consisting of 1,760 bp was cloned which contained an open reading frame (ORF) of 1,233 bp, encoding a protein of 411 amino acids. Analysis of deduced amino acid sequence of CbSqS predicted the presence of conserved isoprenoid family domain and catalytic sites. Phylogenetic analysis revealed that CbSqS is closer to Glycine max and monocotyledonous plants. 3D structure prediction using various programs showed CbSqS structure to be similar to SqS from other species. C-terminus truncated recombinant squalene synthase (TruncCbSqS) was expressed in E. coli M15 cells with optimum expression induced with 1 mM IPTG at 37 °C. The gene expression level was analyzed through semi-quantitative RT-PCR and was found to be higher in leaves as compared to the roots.

  9. Sucrose Phosphate Synthase and Sucrose Accumulation at Low Temperature 1

    Science.gov (United States)

    Guy, Charles L.; Huber, Joan L. A.; Huber, Steven C.

    1992-01-01

    The influence of growth temperature on the free sugar and sucrose phosphate synthase content and activity of spinach (Spinacia oleracea) leaf tissue was studied. When plants were grown at 25°C for 3 weeks and then transferred to a constant 5°C, sucrose, glucose, and fructose accumulated to high levels during a 14-d period. Predawn sugar levels increased from 14- to 20-fold over the levels present at the outset of the low-temperature treatment. Sucrose was the most abundant free sugar before, during, and after exposure to 5°C. Leaf sucrose phosphate synthase activity was significantly increased by the low-temperature treatment, whereas sucrose synthase and invertases were not. Synthesis of the sucrose phosphate synthase subunit was increased during and after low-temperature exposure and paralleled an increase in the steady-state level of the subunit. The increases in sucrose and its primary biosynthetic enzyme, sucrose phosphate synthase, are discussed in relation to adjustment of metabolism to low nonfreezing temperature and freezing stress tolerance. Images Figure 1 Figure 2 Figure 3 PMID:16652990

  10. A Comparative Analysis of Acyl-Homoserine Lactone Synthase Assays.

    Science.gov (United States)

    Shin, Daniel; Frane, Nicole D; Brecht, Ryan M; Keeler, Jesse; Nagarajan, Rajesh

    2015-12-01

    Quorum sensing is cell-to-cell communication that allows bacteria to coordinate attacks on their hosts by inducing virulent gene expression, biofilm production, and other cellular functions, including antibiotic resistance. AHL synthase enzymes synthesize N-acyl-l-homoserine lactones, commonly referred to as autoinducers, to facilitate quorum sensing in Gram-negative bacteria. Studying the synthases, however, has proven to be a difficult road. Two assays, including a radiolabeled assay and a colorimetric (DCPIP) assay are well-documented in literature to study AHL synthases. In this paper, we describe additional methods that include an HPLC-based, C-S bond cleavage and coupled assays to investigate this class of enzymes. In addition, we compare and contrast each assay for both acyl-CoA- and acyl-ACP-utilizing synthases. The expanded toolkit described in this study should facilitate mechanistic studies on quorum sensing signal synthases and expedite discovery of antivirulent compounds. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Heterologous expression of an active chitin synthase from Rhizopus oryzae.

    Science.gov (United States)

    Salgado-Lugo, Holjes; Sánchez-Arreguín, Alejandro; Ruiz-Herrera, José

    2016-12-01

    Chitin synthases are highly important enzymes in nature, where they synthesize structural components in species belonging to different eukaryotic kingdoms, including kingdom Fungi. Unfortunately, their structure and the molecular mechanism of synthesis of their microfibrilar product remain largely unknown, probably because no fungal active chitin synthases have been isolated, possibly due to their extreme hydrophobicity. In this study we have turned to the heterologous expression of the transcript from a small chitin synthase of Rhizopus oryzae (RO3G_00942, Chs1) in Escherichia coli. The enzyme was active, but accumulated mostly in inclusion bodies. High concentrations of arginine or urea solubilized the enzyme, but their dilution led to its denaturation and precipitation. Nevertheless, use of urea permitted the purification of small amounts of the enzyme. The properties of Chs1 (Km, optimum temperature and pH, effect of GlcNAc) were abnormal, probably because it lacks the hydrophobic transmembrane regions characteristic of chitin synthases. The product of the enzyme showed that, contrasting with chitin made by membrane-bound Chs's and chitosomes, was only partially in the form of short microfibrils of low crystallinity. This approach may lead to future developments to obtain active chitin synthases that permit understanding their molecular mechanism of activity, and microfibril assembly. Copyright © 2016. Published by Elsevier Inc.

  12. Bornyl-diphosphate synthase from Lavandula angustifolia: A major monoterpene synthase involved in essential oil quality.

    Science.gov (United States)

    Despinasse, Yolande; Fiorucci, Sébastien; Antonczak, Serge; Moja, Sandrine; Bony, Aurélie; Nicolè, Florence; Baudino, Sylvie; Magnard, Jean-Louis; Jullien, Frédéric

    2017-05-01

    Lavender essential oils (EOs) of higher quality are produced by a few Lavandula angustifolia cultivars and mainly used in the perfume industry. Undesirable compounds such as camphor and borneol are also synthesized by lavender leading to a depreciated EO. Here, we report the cloning of bornyl diphosphate synthase of lavender (LaBPPS), an enzyme that catalyzes the production of bornyl diphosphate (BPP) and then by-products such as borneol or camphor, from an EST library. Compared to the BPPS of Salvia officinalis, the functional characterization of LaBPPS showed several differences in amino acid sequence, and the distribution of catalyzed products. Molecular modeling of the enzyme's active site suggests that the carbocation intermediates are more stable in LaBPPS than in SoBPPS leading probably to a lower efficiency of LaBPPS to convert GPP into BPP. Quantitative RT-PCR performed from leaves and flowers at different development stages of L. angustifolia samples show a clear correlation between transcript level of LaBPPS and accumulation of borneol/camphor, suggesting that LaBPPS is mainly responsible of in vivo biosynthesis of borneol/camphor in fine lavender. A phylogenetic analysis of terpene synthases (TPS) pointed out the basal position of LaBPPS in the TPSb clade, suggesting that LaBPPS could be an ancestor of others lavender TPSb. Finally, borneol could be one of the first monoterpenes to be synthesized in the Lavandula subgenus. Knowledge gained from these experiments will facilitate future studies to improve the lavender oils through metabolic engineering or plant breeding. Accession numbers: LaBPPS: KM015221. Copyright © 2017. Published by Elsevier Ltd.

  13. Understanding Plant Cellulose Synthases through a Comprehensive Investigation of the Cellulose Synthase Family Sequences.

    Science.gov (United States)

    Carroll, Andrew; Specht, Chelsea D

    2011-01-01

    The development of cellulose as an organizing structure in the plant cell wall was a key event in both the initial colonization and the subsequent domination of the terrestrial ecosystem by vascular plants. A wealth of experimental data has demonstrated the complicated genetic interactions required to form the large synthetic complex that synthesizes cellulose. However, these results are lacking an extensive analysis of the evolution, specialization, and regulation of the proteins that compose this complex. Here we perform an in-depth analysis of the sequences in the cellulose synthase (CesA) family. We investigate the phylogeny of the CesA family, with emphasis on evolutionary specialization. We define specialized clades and identify the class-specific regions within the CesA sequence that may explain this specialization. We investigate changes in regulation of CesAs by looking at the conservation of proposed phosphorylation sites. We investigate the conservation of sites where mutations have been documented that impair CesA function, and compare these sites to those observed in the closest cellulose synthase-like (Csl) families to better understand what regions may separate the CesAs from other Csls. Finally we identify two positions with strong conservation of the aromatic trait, but lacking conservation of amino acid identity, which may represent residues important for positioning the sugar substrate for catalysis. These analyses provide useful tools for understanding characterized mutations and post-translational modifications, and for informing further experiments to probe CesA assembly, regulation, and function through site-directed mutagenesis or domain swapping experiments.

  14. Enzymatic Assays to Investigate Acyl-Homoserine Lactone Autoinducer Synthases.

    Science.gov (United States)

    Shin, Daniel; Nagarajan, Rajesh

    2018-01-01

    Bacteria use chemical molecules called autoinducers as votes to poll their numerical strength in a colony. This polling mechanism, commonly referred to as quorum sensing, enables bacteria to build a social network and provide a collective response for fighting off common threats. In Gram-negative bacteria, AHL synthases synthesize acyl-homoserine lactone (AHL) autoinducers to turn on the expression of several virulent genes including biofilm formation, protease secretion, and toxin production. Therefore, inhibiting AHL signal synthase would limit quorum sensing and virulence. In this chapter, we describe four enzymatic methods that could be adopted to investigate a broad array of AHL synthases. The enzymatic assays described here should accelerate our mechanistic understanding of quorum-sensing signal synthesis that could pave the way for discovery of potent antivirulence compounds.

  15. Impaired glycogen synthase activity and mitochondrial dysfunction in skeletal muscle

    DEFF Research Database (Denmark)

    Højlund, Kurt; Beck-Nielsen, Henning

    2006-01-01

    Insulin resistance in skeletal muscle is a major hallmark of type 2 diabetes and an early detectable abnormality in the development of this disease. The cellular mechanisms of insulin resistance include impaired insulin-mediated muscle glycogen synthesis and increased intramyocellular lipid content......, whereas impaired insulin activation of muscle glycogen synthase represents a consistent, molecular defect found in both type 2 diabetic and high-risk individuals. Despite several studies of the insulin signaling pathway believed to mediate dephosphorylation and hence activation of glycogen synthase......, the molecular mechanisms responsible for this defect remain unknown. Recently, the use of phospho-specific antibodies in human diabetic muscle has revealed hyperphosphorylation of glycogen synthase at sites not regulated by the classical insulin signaling pathway. In addition, novel approaches such as gene...

  16. Identification and characterization of a chondroitin synthase from Avibacterium paragallinarum.

    Science.gov (United States)

    Wang, Ting-Ting; Zhu, Chen-Ye; Zheng, Shuang; Meng, Cai-Cai; Wang, Tian-Tian; Meng, Dan-Hua; Li, Yi-Jun; Zhu, Hao-Miao; Wang, Feng-Shan; Sheng, Ju-Zheng

    2018-04-03

    Avibacterium paragallinarum is a Gram-negative bacterium that causes infectious coryza in chicken. It was reported that the capsule polysaccharides extracted from Av. paragallinarum genotype A contained chondroitin. Chondroitin synthase of Av. paragallinarum (ApCS) encoded by one gene within the presumed capsule biosynthesis gene cluster exhibited considerable homology to identified bacterial chondroitin synthases. Herein, we report the identification and characterization of ApCS. This enzyme indeed displays chondroitin synthase activity involved in the biosynthesis of the capsule. ApCS is a bifunctional protein catalyzing the elongation of the chondroitin chain by alternatively transferring the glucuronic acid (GlcA) and N-acetyl-D-galactosamine (GalNAc) residues from their nucleotide forms to the non-reducing ends of the saccharide chains. GlcA with a para-nitrophenyl group (pNP) could serve as the acceptor for ApCS; this enzyme shows a stringent donor tolerance when the acceptor is as small as this monosaccharide. Then, UDP-GalNAc and GlcA-pNP were injected sequentially through the chip-immobilized chondroitin synthases, and the surface plasmon resonance data demonstrated that the up-regulated extent caused by the binding of the donor is one possibly essential factor in successful polymerization reaction. This conclusion will, therefore, enhance the understanding of the mode of action of glycosyltransferase. Surprisingly, high activity at near-zero temperature as well as weak temperature dependence of this novel bacterial chondroitin synthase indicate that ApCS was a cold-active enzyme. From all accounts, ApCS becomes the fourth known bacterial chondroitin synthase, and the potential applications in artificial chondroitin sulfate and glycosaminoglycan synthetic approaches make it an attractive glycosyltransferase for further investigation.

  17. Lipophilic Bisphosphonates as Dual Farnesyl/Geranylgeranyl Diphosphate Synthase Inhibitors: An X-ray and NMR Investigation

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Y.; Cao, R; Yin, F; Hudock, M; Guo, R; Song, Y; No, J; Bergan, K; Leon, A; et al,

    2009-01-01

    Considerable effort has focused on the development of selective protein farnesyl transferase (FTase) and protein geranylgeranyl transferase (GGTase) inhibitors as cancer chemotherapeutics. Here, we report a new strategy for anticancer therapeutic agents involving inhibition of farnesyl diphosphate synthase (FPPS) and geranylgeranyl diphosphate synthase (GGPPS), the two enzymes upstream of FTase and GGTase, by lipophilic bisphosphonates. Due to dual site targeting and decreased polarity, the compounds have activities far greater than do current bisphosphonate drugs in inhibiting tumor cell growth and invasiveness, both in vitro and in vivo. We explore how these compounds inhibit cell growth and how cell activity can be predicted based on enzyme inhibition data, and using X-ray diffraction, solid state NMR, and isothermal titration calorimetry, we show how these compounds bind to FPPS and/or GGPPS.

  18. Exploiting the Biosynthetic Potential of Type III Polyketide Synthases

    Directory of Open Access Journals (Sweden)

    Yan Ping Lim

    2016-06-01

    Full Text Available Polyketides are structurally and functionally diverse secondary metabolites that are biosynthesized by polyketide synthases (PKSs using acyl-CoA precursors. Recent studies in the engineering and structural characterization of PKSs have facilitated the use of target enzymes as biocatalysts to produce novel functionally optimized polyketides. These compounds may serve as potential drug leads. This review summarizes the insights gained from research on type III PKSs, from the discovery of chalcone synthase in plants to novel PKSs in bacteria and fungi. To date, at least 15 families of type III PKSs have been characterized, highlighting the utility of PKSs in the development of natural product libraries for therapeutic development.

  19. Inhibitors of Fatty Acid Synthase for Prostate Cancer

    Science.gov (United States)

    2010-05-31

    inhibitors into the clinic. fatty acid synthase, thioesterase, inhibitors, drug development U U U UU 44 USAMRMC Table of Contents ...targeting. Ursolic acid , a pentacyclic triterpenoid acid , as well as the tea polyphenols, epigallocatechin gallate (EGCG) and epicatechin gallate...2007,  6(7), 2120‐2126.  73.  Liu, Y., Tian, W., Ma, X., and Ding, W. Evaluation of  inhibition of  fatty  acid  synthase by  ursolic   acid : positive

  20. The Polymorphisms in Methylenetetrahydrofolate Reductase, Methionine Synthase, Methionine Synthase Reductase, and the Risk of Colorectal Cancer

    Science.gov (United States)

    Zhou, Daijun; Mei, Qiang; Luo, Han; Tang, Bo; Yu, Peiwu

    2012-01-01

    Polymorphisms in genes involved in folate metabolism may modulate the risk of colorectal cancer (CRC), but data from published studies are conflicting. The current meta-analysis was performed to address a more accurate estimation. A total of 41 (17,552 cases and 26,238 controls), 24(8,263 cases and 12,033 controls), 12(3,758 cases and 5,646 controls), and 13 (5,511 cases and 7,265 controls) studies were finally included for the association between methylenetetrahydrofolate reductase (MTHFR) C677T and A1289C, methione synthase reductase (MTRR) A66G, methionine synthase (MTR) A2756G polymorphisms and the risk of CRC, respectively. The data showed that the MTHFR 677T allele was significantly associated with reduced risk of CRC (OR = 0.93, 95%CI 0.90-0.96), while the MTRR 66G allele was significantly associated with increased risk of CRC (OR = 1.11, 95%CI 1.01-1.18). Sub-group analysis by ethnicity revealed that MTHFR C677T polymorphism was significantly associated with reduced risk of CRC in Asians (OR = 0.80, 95%CI 0.72-0.89) and Caucasians (OR = 0.84, 95%CI 0.76-0.93) in recessive genetic model, while the MTRR 66GG genotype was found to significantly increase the risk of CRC in Caucasians (GG vs. AA: OR = 1.18, 95%CI 1.03-1.36). No significant association was found between MTHFR A1298C and MTR A2756G polymorphisms and the risk of CRC. Cumulative meta-analysis showed no particular time trend existed in the summary estimate. Probability of publication bias was low across all comparisons illustrated by the funnel plots and Egger's test. Collectively, this meta-analysis suggested that MTHFR 677T allele might provide protection against CRC in worldwide populations, while MTRR 66G allele might increase the risk of CRC in Caucasians. Since potential confounders could not be ruled out completely, further studies were needed to confirm these results. PMID:22719222

  1. Clinical aspects of endothelial NO-synthase gene polymorphism in professional sportsmen (literature review

    Directory of Open Access Journals (Sweden)

    S. N. Malakhova

    2016-08-01

    Full Text Available The article deals the questions of properties and biological role of nitric oxide molecule, which is characterized with vasodilating, stress limiting and neurotransmitter properties, and participates in reactions of oxidative stress, glutamate and calcium cascade and inflammation. Researches of the relationship of endothelial NO-synthase and the risk of cardiovascular, ischemic and respiratory diseases in population of untrained persons and athletes continue. The aim of this study was to establish, according to the literature, the present state of the influence of endothelial NO-synthase gene polymorphism on the formation of the physical qualities of strength, endurance and speed in professional athletes, its changes and influence on functional state of athlete. At the present stage of development of medical genetics it is proved, that the implementation of the action of each individual isoform of the enzyme NO-synthase is caused by the presence of polymorphism. The most studied are the T-786С polymorphism of the eNOS gene promoter, G894T (Glu298Asp polymorphism of the 7th exon, 4a/b–4th intron of eNOS, but their influence is not definitively proven, and is caused by the presence of homo- or heterozygotes. Genetic researches among professional athletes prove the significant role of nitric oxide system in enhancing of physical working capacity, but do not allow evaluating the characteristics of this effect, taking into account multi-directional training process and the level of sports qualification, as well as predicting future professional success and the preservation of the proper functioning of the cardiovascular, respiratory and other body systems. Conclusions. Thus, contemporary researches allow stating that oxide synthesis has a leading role in the functioning of the organism, and in particular athletes, but do not allow assessing its effects on the body of athletes of different sports qualification. It is proved that polymorphism of the

  2. Isolation of developing secondary xylem specific cellulose synthase ...

    Indian Academy of Sciences (India)

    Division of Plant Biotechnology, Institute of Forest Genetics and Tree Breeding, P.B. No. 1061 ... known as forest red gum has an extensive natural distribu- ...... mechanical stress. Plant J. 22, 495–502. Wu A., Hu J. S. and Liu J. 2009 Functional analysis of a cotton cel- lulose synthase A4 gene promoter in transgenic tobacco ...

  3. Beta-Glucan Synthase Gene Expression in Pleurotus sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

  4. Isolation of developing secondary xylem specific cellulose synthase ...

    Indian Academy of Sciences (India)

    The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from Eucalyptus tereticornis, a species predominantly used in paper and pulp industries in the tropics. The differential expression analysis of the three EtCesA genes using qRT-PCR revealed 49 to 87 fold relative ...

  5. Aldosterone synthase C-344T, angiotensin II type 1 receptor ...

    Indian Academy of Sciences (India)

    2014-12-26

    Dec 26, 2014 ... RESEARCH ARTICLE. Aldosterone synthase C-344T, angiotensin II type 1 receptor A1166C and 11-β hydroxysteroid dehydrogenase G534A gene polymorphisms and essential hypertension in the population of Odisha, India. MANISHA PATNAIK1,5, PALLABI PATI1, SURENDRA N. SWAIN2, MANOJ K.

  6. Chalcone synthase genes from milk thistle (Silybum marianum ...

    Indian Academy of Sciences (India)

    coumaroyl-CoA with three acetyl-CoA units, followed by folding, and initial cyclization; all catalyzed by a single enzyme, chalcone synthase (CHS). Further ring closure catalyzed by chalcone isomerase (CHI) yields naringenin. Coupling follows a ...

  7. Contribution of granule bound starch synthase in kernel modification

    African Journals Online (AJOL)

    ACSS

    The stability of both GBSS and zein proteins coupled with the use of SDS-PAGE implied that only one was more reliable and required further validation. It was clear from this study, that kernel modification was regulated by complex genetic interactions. Fairly distinct systems such as the starch synthases, zein proteins and ...

  8. Biosynthesis of polyketides by trans-AT polyketide synthases.

    OpenAIRE

    Helfrich Eric J N; Piel Jörn

    2016-01-01

    This review discusses the biosynthesis of natural products that are generated by trans AT polyketide synthases a family of catalytically versatile enzymes that represents one of the major group of proteins involved in the production of bioactive polyketides. The article includes 609 references and covers the literature from 2009 through June 2015.

  9. Biosynthesis of polyketides by trans-AT polyketide synthases.

    Science.gov (United States)

    Helfrich, Eric J N; Piel, Jörn

    2016-02-01

    This review discusses the biosynthesis of natural products that are generated by trans-AT polyketide synthases, a family of catalytically versatile enzymes that represents one of the major group of proteins involved in the production of bioactive polyketides. The article includes 609 references and covers the literature from 2009 through June 2015.

  10. Inhibition of Inducible Nitric Oxide Synthase, Cycleooxygenase-2 ...

    African Journals Online (AJOL)

    HP

    Purpose: To explore the antioxidant properties of the methanol extract of Pericarpium Zanthoxyli and its effect on inducible nitric oxide synthase (iNOS), cycleooxygenase-2 (COX-2) and lipopolysaccharides (LPS)-induced cell damage in macrophage cells. Methods: Anti-oxidant activities were tested by measuring free ...

  11. Inhibition of Inducible Nitric Oxide Synthase, Cycleooxygenase-2 ...

    African Journals Online (AJOL)

    Inhibition of Inducible Nitric Oxide Synthase, Cycleooxygenase-2 and Lipid Peroxidation by Methanol Extract of Pericarpium Zanthoxyli. ... Production of iNOS induced by LPS was significantly (p < 0.05) inhibited by the extract, suggesting that the extract inhibits nitric oxide (NO) production by suppressing iNOS expression.

  12. Role of Endothelial Nitric Oxide Synthase Gene Polymorphisms ...

    African Journals Online (AJOL)

    Background: Previous studies indicated an association between endothelial nitric oxide synthase (eNOS) activity and maintenance of pregnancy, but it is rather controversial whether polymorphisms of the gene encoding for eNOS are associated with recurrent spontaneous abortions (RSAs). Aim: The aim was to investigate ...

  13. Aldosterone synthase C-344T, angiotensin II type 1 receptor ...

    Indian Academy of Sciences (India)

    This study was undertaken to investigate the association of aldosterone synthase C-344T, angiotensin II type I receptor A1166C and 11- hydroxysteroid dehydrogenase type 2 G534A polymorphisms with essential hypertension in the population of Odisha, India. A total of 246 hypertensive subjects (males, 159; females, ...

  14. Highly Divergent Mitochondrial ATP Synthase Complexes in Tetrahymena thermophila

    NARCIS (Netherlands)

    Nina, Praveen Balabaskaran; Dudkina, Natalya V.; Kane, Lesley A.; van Eyk, Jennifer E.; Boekema, Egbert J.; Mather, Michael W.; Vaidya, Akhil B.; Eisen, Jonathan A.

    The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1) sector catalyzes ATP synthesis, whereas the F(o) sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1) and F(o) sectors are

  15. A functional isopenicillin N synthase in an animal genome

    NARCIS (Netherlands)

    Roelofs, D.; Timmermans, M.J.T.N.; Hensbergen, P.J.; van Leeuwen, H.; Koopman, J.; Faddeeva-Vakhrusheva, A.; Suring, W.J.; de Boer, T.E.; Mariën, A.G.H.; Boer, R.; Bovenberg, R.; van Straalen, N.M.

    Horizontal transfer of genes is widespread among prokaryotes, but is less common between microorganisms and animals. Here, we present evidence for the presence of a gene encoding functional isopenicillin N synthase, an enzyme in the β-lactam antibiotics biosynthesis pathway, in the genome of the

  16. Functional isopenicillin N synthase in an animal genome

    NARCIS (Netherlands)

    Roelofs, D.; Timmermans, M.J.T.N.; Hensbergen, P.; van Leeuwen, H.; Koopman, J.; Faddeeva, A.; Suring, W.; de Boer, T.E.; Mariën, J.; Boer, R.; Bovenberg, R.; van Straalen, N.M.

    2013-01-01

    Horizontal transfer of genes is widespread among prokaryotes, but is less common between microorganisms and animals. Here, we present evidence for the presence of a gene encoding functional isopenicillin N synthase, an enzyme in the β-lactam antibiotics biosynthesis pathway, in the genome of the

  17. Insight into Biochemical Characterization of Plant Sesquiterpene Synthases

    DEFF Research Database (Denmark)

    Manczak, Tom; Simonsen, Henrik Toft

    2016-01-01

    A fast and reproducible protocol was established for enzymatic characterization of plant sesquiterpene synthases that can incorporate radioactivity in their products. The method utilizes the 96-well format in conjunction with cluster tubes and enables processing of >200 samples a day. Along with ...

  18. Functional plasticity of paralogous diterpene synthases involved in conifer defense.

    Science.gov (United States)

    Keeling, Christopher I; Weisshaar, Sabrina; Lin, Roy P C; Bohlmann, Jörg

    2008-01-22

    The diversity of terpenoid compounds produced by plants plays an important role in mediating various plant-herbivore, plant-pollinator, and plant-pathogen interactions. This diversity has resulted from gene duplication and neofunctionalization of the enzymes that synthesize and subsequently modify terpenes. Two diterpene synthases in Norway spruce (Picea abies), isopimaradiene synthase and levopimaradiene/abietadiene synthase, provide the hydrocarbon precursors for most of the diterpene resin acids found in the defensive oleoresin of conifers. Although these paralogous enzymes are 91% identical at the amino acid level, one is a single-product enzyme, whereas the other is a multiproduct enzyme that forms completely different products. We used a rational approach of homology modeling, protein sequence comparison, domain swapping, and a series of reciprocal site-directed mutagenesis to identify the specific residues that direct the different product outcomes. A one-amino acid mutation switched the levopimaradiene/abietadiene synthase into producing isopimaradiene and sandaracopimaradiene and none of its normal products. Four mutations were sufficient to reciprocally reverse the product profiles for both of these paralogous enzymes while maintaining catalytic efficiencies similar to the wild-type enzymes. This study illustrates how neofunctionalization can result from relatively minor changes in protein sequence, increasing the diversity of secondary metabolites important for conifer defense.

  19. Expression of Inducible Nitric Oxide Synthase in the Epithelial ...

    African Journals Online (AJOL)

    Conclusion: iNOS was over expressed in OKCs when compared with DC and RC suggesting that iNOS may contribute to the aggressive behavior of OKC. This is yet another evidence to support that OKC is the neoplasm. Keywords: Dentigerous cyst, Immunohistochemistry, Inducible nitric oxide synthase, Odontogenic ...

  20. Cloning and expression analysis of chalcone synthase gene from ...

    Indian Academy of Sciences (India)

    Chalcone synthase (CHS) catalyses the first committed step of flavonoid biosynthetic pathway. Full-length cDNA, showing homology with plantCHS gene was isolated from leaves of C. forskohlii and named CfCHS (GenBank accession no. KF643243). Theoretical translation of CfCHS nucleotide sequence shows that it ...

  1. Characterising the cellulose synthase complexes of cell walls

    NARCIS (Netherlands)

    Mansoori Zangir, N.

    2012-01-01

    One of the characteristics of the plant kingdom is the presence of a structural cell wall. Cellulose is a major component in both the primary and secondary cell walls of plants. In higher plants cellulose is synthesized by so called rosette protein complexes with cellulose synthases (CESAs) as

  2. Analysis of genetic variation of inducible nitric oxide synthase and ...

    African Journals Online (AJOL)

    The genetic diversity of 100 Malaysian native chickens was investigated using polymerase chain reaction-restriction fragment polymorphism (PCR-RFLP) for two candidate genes: inducible nitric oxide synthase (INOS) and natural resistance-associated macrophage protein 1 (NRAMP1). The two genes were selected ...

  3. Molecular cloning and characterization of strictosidine synthase, a ...

    African Journals Online (AJOL)

    Mitragynine is one of the most dominant indole alkaloids present in the leaves of Mitragyna speciosa, a species of Rubiaceae. This alkaloid is believed to be synthesized via condensation of the amino acid derivative, tryptamine and secologanine by the action of strictosidine synthase (STR). The cDNA clone encoding STR ...

  4. Cryo-EM structure of the yeast ATP synthase.

    Science.gov (United States)

    Lau, Wilson C Y; Baker, Lindsay A; Rubinstein, John L

    2008-10-24

    We have used electron cryomicroscopy of single particles to determine the structure of the ATP synthase from Saccharomyces cerevisiae. The resulting map at 24 A resolution can accommodate atomic models of the F(1)-c(10) subcomplex, the peripheral stalk subcomplex, and the N-terminal domain of the oligomycin sensitivity conferral protein. The map is similar to an earlier electron cryomicroscopy structure of bovine mitochondrial ATP synthase but with important differences. It resolves the internal structure of the membrane region of the complex, especially the membrane embedded subunits b, c, and a. Comparison of the yeast ATP synthase map, which lacks density from the dimer-specific subunits e and g, with a map of the bovine enzyme that included e and g indicates where these subunits are located in the intact complex. This new map has allowed construction of a model of subunit arrangement in the F(O) motor of ATP synthase that dictates how dimerization of the complex via subunits e and g might occur.

  5. Identification of the trehalose-6-phosphate synthase gene family in ...

    Indian Academy of Sciences (India)

    2015-03-04

    Mar 4, 2015 ... Abstract. Trehalose plays an important role in metabolic regulation and abiotic stress tolerance in plants. Trehalose contents are poten- tially modulated by trehalose-6-phosphate synthase (TPS), which is a key enzyme in the trehalose biosynthetic pathway. Using available wheat expressed sequence tag ...

  6. Characterising the cellulose synthase complexes of cell walls

    NARCIS (Netherlands)

    Mansoori Zangir, N.

    2012-01-01

    One of the characteristics of the plant kingdom is the presence of a structural cell wall. Cellulose is a major component in both the primary and secondary cell walls of plants. In higher plants cellulose is synthesized by so called rosette protein complexes with cellulose synthases (CESAs) as the

  7. Nucleotide variation at the methionine synthase locus in an ...

    African Journals Online (AJOL)

    Nucleotide variation at the methionine synthase (MetE) locus within and among populations of an endangered forest tree Fokienia hodginsii in Vietnam was investigated in the present study. A total of 12 populations were sampled across Vietnam. The length of the sequenced locus varied from 1567 to 1559 bp. A total of 42 ...

  8. Enzymatic Properties and Mutational Studies of Chalcone Synthase from Physcomitrella patens

    Directory of Open Access Journals (Sweden)

    Mahiran Basri

    2012-08-01

    Full Text Available PpCHS is a member of the type III polyketide synthase family and catalyses the synthesis of the flavonoid precursor naringenin chalcone from p-coumaroyl-CoA. Recent research reports the production of pyrone derivatives using either hexanoyl-CoA or butyryl-CoA as starter molecule. The Cys-His-Asn catalytic triad found in other plant chalcone synthase predicted polypeptides is conserved in PpCHS. Site directed mutagenesis involving these amino acids residing in the active-site cavity revealed that the cavity volume of the active-site plays a significant role in the selection of starter molecules as well as product formation. Substitutions of Cys 170 with Arg and Ser amino acids decreased the ability of the PpCHS to utilize hexanoyl-CoA as a starter molecule, which directly effected the production of pyrone derivatives (products. These substitutions are believed to have a restricted number of elongations of the growing polypeptide chain due to the smaller cavity volume of the mutant’s active site.

  9. Detailed characterization of the substrate specificity of mouse wax synthase.

    Science.gov (United States)

    Miklaszewska, Magdalena; Kawiński, Adam; Banaś, Antoni

    2013-01-01

    Wax synthases are membrane-associated enzymes catalysing the esterification reaction between fatty acyl-CoA and a long chain fatty alcohol. In living organisms, wax esters function as storage materials or provide protection against harmful environmental influences. In industry, they are used as ingredients for the production of lubricants, pharmaceuticals, and cosmetics. Currently the biological sources of wax esters are limited to jojoba oil. In order to establish a large-scale production of desired wax esters in transgenic high-yielding oilseed plants, enzymes involved in wax esters synthesis from different biological resources should be characterized in detail taking into consideration their substrate specificity. Therefore, this study aims at determining the substrate specificity of one of such enzymes -- the mouse wax synthase. The gene encoding this enzyme was expressed heterologously in Saccharomyces cerevisiae. In the in vitro assays (using microsomal fraction from transgenic yeast), we evaluated the preferences of mouse wax synthase towards a set of combinations of 11 acyl-CoAs with 17 fatty alcohols. The highest activity was observed for 14:0-CoA, 12:0-CoA, and 16:0-CoA in combination with medium chain alcohols (up to 5.2, 3.4, and 3.3 nmol wax esters/min/mg microsomal protein, respectively). Unsaturated alcohols longer than 18°C were better utilized by the enzyme in comparison to the saturated ones. Combinations of all tested alcohols with 20:0-CoA, 22:1-CoA, or Ric-CoA were poorly utilized by the enzyme, and conjugated acyl-CoAs were not utilized at all. Apart from the wax synthase activity, mouse wax synthase also exhibited a very low acyl-CoA:diacylglycerol acyltransferase activity. However, it displayed neither acyl-CoA:monoacylglycerol acyltransferase, nor acyl-CoA:sterol acyltransferase activity.

  10. Pseudouridine synthase 1: a site-specific synthase without strict sequence recognition requirements

    Science.gov (United States)

    Sibert, Bryan S.; Patton, Jeffrey R.

    2012-01-01

    Pseudouridine synthase 1 (Pus1p) is an unusual site-specific modification enzyme in that it can modify a number of positions in tRNAs and can recognize several other types of RNA. No consensus recognition sequence or structure has been identified for Pus1p. Human Pus1p was used to determine which structural or sequence elements of human tRNASer are necessary for pseudouridine (Ψ) formation at position 28 in the anticodon stem-loop (ASL). Some point mutations in the ASL stem of tRNASer had significant effects on the levels of modification and compensatory mutation, to reform the base pair, restored a wild-type level of Ψ formation. Deletion analysis showed that the tRNASer TΨC stem-loop was a determinant for modification in the ASL. A mini-substrate composed of the ASL and TΨC stem-loop exhibited significant Ψ formation at position 28 and a number of mutants were tested. Substantial base pairing in the ASL stem (3 out of 5 bp) is required, but the sequence of the TΨC loop is not required for modification. When all nucleotides in the ASL stem other than U28 were changed in a single mutant, but base pairing was retained, a near wild-type level of modification was observed. PMID:22102571

  11. Identifying the catalytic components of cellulose synthase and the maize mixed-linkage beta-glucan synthase

    Energy Technology Data Exchange (ETDEWEB)

    Nicholas C Carpita

    2009-04-20

    Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.

  12. Tetrahydrobiopterin, but not L-arginine, decreases NO synthase uncoupling in cells expressing high levels of endothelial NO synthase

    NARCIS (Netherlands)

    Bevers, LM; Braam, B; Post, JA; van Zonneveld, AJ; Rabelink, TJ; Koomans, HA; Verhaar, MC; Joles, JA

    Endothelial NO synthase (eNOS) produces superoxide when depleted of (6R)-5,6,7,8-tetrahydro-L-biopterin (BH4) and L-arginine by uncoupling the electron flow from NO production. High expression of eNOS has been reported to have beneficial effects in atherosclerotic arteries after relatively short

  13. Low plasma arginine:asymmetric dimethyl arginine ratios predict mortality after intracranial aneurysm rupture

    DEFF Research Database (Denmark)

    Staalsø, Jonatan Myrup; Bergström, Anita; Edsen, Troels

    2013-01-01

    Asymmetrical dimethylarginine (ADMA), an endogenous inhibitor of nitric oxide synthases, predicts mortality in cardiovascular disease and has been linked to cerebral vasospasm after aneurysmal subarachnoid hemorrhage (SAH). In this prospective study, we assessed whether circulating ADMA, arginine...

  14. Identification of a polyketide synthase required for alternariol (AOH and alternariol-9-methyl ether (AME formation in Alternaria alternata.

    Directory of Open Access Journals (Sweden)

    Debjani Saha

    Full Text Available Alternaria alternata produces more than 60 secondary metabolites, among which alternariol (AOH and alternariol-9-methyl ether (AME are important mycotoxins. Whereas the toxicology of these two polyketide-based compounds has been studied, nothing is known about the genetics of their biosynthesis. One of the postulated core enzymes in the biosynthesis of AOH and AME is polyketide synthase (PKS. In a draft genome sequence of A. alternata we identified 10 putative PKS-encoding genes. The timing of the expression of two PKS genes, pksJ and pksH, correlated with the production of AOH and AME. The PksJ and PksH proteins are predicted to be 2222 and 2821 amino acids in length, respectively. They are both iterative type I reducing polyketide synthases. PksJ harbors a peroxisomal targeting sequence at the C-terminus, suggesting that the biosynthesis occurs at least partly in these organelles. In the vicinity of pksJ we found a transcriptional regulator, altR, involved in pksJ induction and a putative methyl transferase, possibly responsible for AME formation. Downregulation of pksJ and altR caused a large decrease of alternariol formation, suggesting that PksJ is the polyketide synthase required for the postulated Claisen condensations during the biosynthesis. No other enzymes appeared to be required. PksH downregulation affected pksJ expression and thus caused an indirect effect on AOH production.

  15. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  16. Isolation of the GFA1 gene encoding glucosamine-6-phosphate synthase of Sporothrix schenckii and its expression in Saccharomyces cerevisiae.

    Science.gov (United States)

    Sánchez-López, Juan Francisco; González-Ibarra, Joaquín; Álvarez-Vargas, Aurelio; Milewski, Slawomir; Villagómez-Castro, Julio César; Cano-Canchola, Carmen; López-Romero, Everardo

    2015-06-01

    Glucosamine-6-phosphate synthase (GlcN-6-P synthase) is an essential enzyme involved in cell wall biogenesis that has been proposed as a strategic target for antifungal chemotherapy. Here we describe the cloning and functional characterization of Sporothrix schenckii GFA1 gene which was isolated from a genomic library of the fungus. The gene encodes a predicted protein of 708 amino acids that is homologous to GlcN-6-P synthases from other sources. The recombinant enzyme restored glucosamine prototrophy of the Saccharomyces cerevisiae gfa1 null mutant. Purification and biochemical analysis of the recombinant enzyme revealed some differences from the wild type enzyme, such as improved stability and less sensitivity to UDP-GlcNAc. The sensitivity of the recombinant enzyme to the selective inhibitor FMDP [N(3)-(4-methoxyfumaroyl)-l-2,3-diaminopropanoic acid] and other properties were similar to those previously reported for the wild type enzyme. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Cloning and characterization of Ginkgo biloba levopimaradiene synthase which catalyzes the first committed step in ginkgolide biosynthesis.

    Science.gov (United States)

    Schepmann, H G; Pang, J; Matsuda, S P

    2001-08-15

    Levopimaradiene synthase, which catalyzes the initial cyclization step in ginkgolide biosynthesis, was cloned and functionally characterized. A Ginkgo biloba cDNA library was prepared from seedling roots and a probe was amplified using primers corresponding to conserved gymnosperm terpene synthase sequences. Colony hybridization and rapid amplification of cDNA ends yielded a full-length clone encoding a predicted protein (873 amino acids, 100,289 Da) similar to known gymnosperm diterpene synthases. The sequence includes a putative N-terminal plastid transit peptide and three aspartate-rich regions. The full-length protein expressed in Escherichia coli cyclized geranylgeranyl diphosphate to levopimaradiene, which was identical to a synthetic standard by GC/MS analysis. Removing 60 or 79 N-terminal residues increased levopimaradiene production, but a 128-residue N-terminal deletion lacked detectable activity. This is the first cloned ginkgolide biosynthetic gene and the first in vitro observation of an isolated ginkgolide biosynthetic enzyme. Copyright 2001 Academic Press.

  18. Evolutionary and mechanistic insights from the reconstruction of α-humulene synthases from a modern (+)-germacrene A synthase.

    Science.gov (United States)

    Gonzalez, Veronica; Touchet, Sabrina; Grundy, Daniel J; Faraldos, Juan A; Allemann, Rudolf K

    2014-10-15

    Germacrene A synthase (GAS) from Solidago canadensis catalyzes the conversion of farnesyl diphosphate (FDP) to the plant sesquiterpene (+)-germacrene A. After diphosphate expulsion, farnesyl cation reacts with the distal 10,11-double bond to afford germacrene A (>96%) and <2% α-humulene, which arises from 1,11-cyclization of FDP. The origin of the 1,11-activity of GAS was investigated by amino acid sequence alignments of 1,10- and 1,11-synthases and comparisons of X-ray crystal structures with the homology model of GAS; a triad [Thr 401-Gly 402-Gly 403] that might be responsible for the predominant 1,10-cyclization activity of GAS was identified. Replacement of Gly 402 with residues of increasing size led to a progressive increase of 1,11-cyclization. The catalytic robustness of these 1,10- /1,11-GAS variants point to Gly 402 as a functional switch of evolutionary significance and suggests that enzymes with strict functionalities have evolved from less specific ancestors through a small number of substitutions. Similar results were obtained with germacrene D synthase (GDS) upon replacement of the homologous active-site residue Gly 404: GDS-G404V generated approximately 20% bicyclogermacrene, a hydrocarbon with a cyclopropane ring that underlines the dual 1,10-/1,11-cyclization activity of this mutant. This suggests that the reaction pathways to germacrenes and humulenes might be connected through a bridged 1,10,11-carbocation intermediate or transition state that resembles bicyclogermacrene. Mechanistic studies using [1-(3)H1]-10-fluorofarnesyl diphosphate and deuterium-labeling experiments with [12,13-(2)H6]-FDP support a germacrene-humulene rearrangement linking 1,10- and 1,11-pathways. These results support the bioinformatics proposal that modern 1,10-synthases could have evolved from promiscuous 1,11-sesquiterpene synthases.

  19. Biosynthesis of the oxygenated diterpene nezukol in the medicinal plant Isodon rubescens is catalyzed by a pair of diterpene synthases.

    Directory of Open Access Journals (Sweden)

    Kyle A Pelot

    Full Text Available Plants produce an immense diversity of natural products (i.e. secondary or specialized metabolites that offer a rich source of known and potentially new pharmaceuticals and other desirable bioproducts. The Traditional Chinese Medicinal plant Isodon rubescens (Lamiaceae contains an array of bioactive labdane-related diterpenoid natural products. Of these, the ent-kauranoid oridonin is the most prominent specialized metabolite that has been extensively studied for its potent antimicrobial and anticancer efficacy. Mining of a previously established transcriptome of I. rubescens leaf tissue identified seven diterpene synthase (diTPSs candidates. Here we report the functional characterization of four I. rubescens diTPSs. IrTPS5 and IrTPS3 were identified as an ent-copalyl diphosphate (CPP synthase and a (+-CPP synthase, respectively. Distinct transcript abundance of IrTPS5 and the predicted ent-CPP synthase IrTPS1 suggested a role of IrTPS5 in specialized ent-kaurene metabolism possibly en route to oridonin. Nicotiana benthamiana co-expression assays demonstrated that IrTPS4 functions sequentially with IrTPS3 to form miltiradiene. In addition, IrTPS2 converted the IrTPS3 product (+-CPP into the hydroxylated tricyclic diterpene nezukol not previously identified in I. rubescens. Metabolite profiling verified the presence of nezukol in I. rubescens leaf tissue. The proposed IrTPS2-catalyzed reaction mechanism proceeds via the common ionization of the diphosphate group of (+-CPP, followed by formation of an intermediary pimar-15-en-8-yl+ carbocation and neutralization of the carbocation by water capture at C-8 to yield nezukol, as confirmed by nuclear magnetic resonance (NMR analysis. Oxygenation activity is rare for the family of class I diTPSs and offers new catalysts for developing metabolic engineering platforms to produce a broader spectrum of bioactive diterpenoid natural products.

  20. Mechanism of Germacradien-4-ol Synthase-Controlled Water Capture

    Science.gov (United States)

    2016-01-01

    The sesquiterpene synthase germacradiene-4-ol synthase (GdolS) from Streptomyces citricolor is one of only a few known high-fidelity terpene synthases that convert farnesyl diphosphate (FDP) into a single hydroxylated product. Crystals of unliganded GdolS-E248A diffracted to 1.50 Å and revealed a typical class 1 sesquiterpene synthase fold with the active site in an open conformation. The metal binding motifs were identified as D80DQFD and N218DVRSFAQE. Some bound water molecules were evident in the X-ray crystal structure, but none were obviously positioned to quench a putative final carbocation intermediate. Incubations in H218O generated labeled product, confirming that the alcohol functionality arises from nucleophilic capture of the final carbocation by water originating from solution. Site-directed mutagenesis of amino acid residues from both within the metal binding motifs and without identified by sequence alignment with aristolochene synthase from Aspergillus terreus generated mostly functional germacradien-4-ol synthases. Only GdolS-N218Q generated radically different products (∼50% germacrene A), but no direct evidence of the mechanism of incorporation of water into the active site was obtained. Fluorinated FDP analogues 2F-FDP and 15,15,15-F3-FDP were potent noncompetitive inhibitors of GdolS. 12,13-DiF-FDP generated 12,13-(E)-β-farnesene upon being incubated with GdolS, suggesting stepwise formation of the germacryl cation during the catalytic cycle. Incubation of GdolS with [1-2H2]FDP and (R)-[1-2H]FDP demonstrated that following germacryl cation formation a [1,3]-hydride shift generates the final carbocation prior to nucleophilic capture. The stereochemistry of this shift is not defined, and the deuteron in the final product was scrambled. Because no clear candidate residue for binding of a nucleophilic water molecule in the active site and no significant perturbation of product distribution from the replacement of active site residues were

  1. The phytochelatin synthase gene in date palm (Phoenix dactylifera L.): Phylogeny, evolution and expression.

    Science.gov (United States)

    Zayneb, Chaâbene; Imen, Rekik Hakim; Walid, Kriaa; Grubb, C Douglas; Bassem, Khemakhem; Franck, Vandenbulcke; Hafedh, Mejdoub; Amine, Elleuch

    2017-06-01

    We studied date palm phytochelatin synthase type I (PdPCS1), which catalyzes the cytosolic synthesis of phytochelatins (PCs), a heavy metal binding protein, in plant cells. The gene encoding PdPCS1 (Pdpcs) consists of 8 exons and 7 introns and encodes a protein of 528 amino acids. PCs gene history was studied using Notung phylogeny. During evolution, gene loss from several lineages was predicted including Proteobacteria, Bilateria and Brassicaceae. In addition, eleven gene duplication events appeared toward interior nodes of the reconciled tree and four gene duplication events appeared toward the external nodes. These latter sequences belong to species with a second copy of PCs suggesting that this gene evolved through subfunctionalization. Pdpcs1 gene expression was measured in seedling hypocotyls exposed to Cd, Cu and Cr using quantitative real-time polymerase chain reaction (qPCR). A Pdpcs1 overexpression was evidenced in P. dactylifera seedlings exposed to metals suggesting that 1-the Pdpcs1 gene is functional, 2-there is an implication of the enzyme in metal detoxification mechanisms. Additionally, the structure of PdPCS1 was predicted using its homologue from Nostoc (cyanobacterium, NsPCS) as a template in Discovery studio and PyMol software. These analyses allowed us to identify the phytochelatin synthase type I enzyme in date palm (PdPCS1) via recognition of key consensus amino acids involved in the catalytic mechanism, and to propose a hypothetical binding and catalytic site for an additional substrate binding cavity. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. In vitro biochemical characterization of all barley endosperm starch synthases

    DEFF Research Database (Denmark)

    Cuesta-Seijo, Jose A.; Nielsen, Morten M.; Ruzanski, Christian

    2016-01-01

    Starch is the main storage polysaccharide in cereals and the major source of calories in the human diet. It is synthesized by a panel of enzymes including five classes of starch synthases (SSs). While the overall starch synthase (SS) reaction is known, the functional differences between the five SS...... define the mode of action of each SS class in unprecedented detail; we analyze their substrate selection, temperature dependence and stability, substrate affinity and temporal abundance during barley development. Our results are at variance with some generally accepted ideas about starch biosynthesis...... and might lead to the reinterpretation of results obtained in planta. In particular, they indicate that granule bound SS is capable of processive action even in the absence of a starch matrix, that SSI has no elongation limit, and that SSIV, believed to be critical for the initiation of starch granules, has...

  3. The multifunctional 6-methylsalicylic acid synthase gene of Penicillium patulum. Its gene structure relative to that of other polyketide synthases.

    Science.gov (United States)

    Beck, J; Ripka, S; Siegner, A; Schiltz, E; Schweizer, E

    1990-09-11

    6-Methylsalicylic acid synthase (MSAS) from Penicillium patulum is a homomultimer of a single, multifunctional protein subunit. The enzyme is induced, at the transcriptional level, during the end of the logarithmic growth phase. After approximately 150-fold purification, a homogeneous enzyme preparation was obtained exhibiting, upon SDS gel electrophoresis, a subunit molecular mass of 188 kDa. By immunological screening of a genomic P. patulum DNA expression library, the MSAS gene together with its flanking sequences was isolated; 7131 base pairs of the cloned genomic DNA were sequenced. Within this sequence the MSAS gene was identified as a 5322-bp-long open reading frame coding for a protein of 1774 amino acids and 190,731 Da molecular mass. Transcriptional initiation and termination sites were determined both by primer extension studies and from cDNA sequences specially prepared for the 5' and 3' portions of the gene. The same cDNA sequences revealed the presence of a 69-bp intron within the N-terminal part of the MSAS gene. The intron contains the canonical GT and AG dinucleotides at its 5'- and 3'-splice junctions. An internal TACTGAC sequence, resembling the TACTAAC consensus element of Saccharomyces cerevisiae introns is suggested to represent the branch point of the lariat splicing intermediate. When compared to other known polyketide synthases, distinct amino acid sequence similarities of limited lengths were observed with some, though not all, of them. A comparatively low degree of similarity was detected to the yeast and Penicillium FAS or to the plant chalcone and resveratrol synthases. In contrast, a significantly higher sequence similarity was found between MSAS and the rat fatty acid synthase, especially at their transacylase, 2-oxoacyl reductase, 2-oxoacyl synthase and acyl carrier protein domains. Besides several dissimilar, interspersed regions probably coding for MSAS- and FAS-specific functions, the sequential order of the similar domains was

  4. Use of linalool synthase in genetic engineering of scent production

    Science.gov (United States)

    Pichersky, Eran

    1998-01-01

    A purified S-linalool synthase polypeptide from Clarkia breweri is disclosed as is the recombinant polypeptide and nucleic acid sequences encoding the polypeptide. Also disclosed are antibodies immunoreactive with the purified peptide and with recombinant versions of the polypeptide. Methods of using the nucleic acid sequences, as well as methods of enhancing the smell and the flavor of plants expressing the nucleic acid sequences are also disclosed.

  5. Isolation and characterization of terpene synthases in cotton (Gossypium hirsutum).

    Science.gov (United States)

    Yang, Chang-Qing; Wu, Xiu-Ming; Ruan, Ju-Xin; Hu, Wen-Li; Mao, Yin-Bo; Chen, Xiao-Ya; Wang, Ling-Jian

    2013-12-01

    Cotton plants accumulate gossypol and related sesquiterpene aldehydes, which function as phytoalexins against pathogens and feeding deterrents to herbivorous insects. However, to date little is known about the biosynthesis of volatile terpenes in this crop. Herein is reported that 5 monoterpenes and 11 sesquiterpenes from extracts of a glanded cotton cultivar, Gossypium hirsutum cv. CCRI12, were detected by gas chromatography-mass spectrometry (GC-MS). By EST data mining combined with Rapid Amplification of cDNA Ends (RACE), full-length cDNAs of three terpene synthases (TPSs), GhTPS1, GhTPS2 and GhTPS3 were isolated. By in vitro assays of the recombinant proteins, it was found that GhTPS1 and GhTPS2 are sesquiterpene synthases: the former converted farnesyl pyrophosphate (FPP) into β-caryophyllene and α-humulene in a ratio of 2:1, whereas the latter produced several sesquiterpenes with guaia-1(10),11-diene as the major product. By contrast, GhTPS3 is a monoterpene synthase, which produced α-pinene, β-pinene, β-phellandrene and trace amounts of other monoterpenes from geranyl pyrophosphate (GPP). The TPS activities were also supported by Virus Induced Gene Silencing (VIGS) in the cotton plant. GhTPS1 and GhTPS3 were highly expressed in the cotton plant overall, whereas GhTPS2 was expressed only in leaves. When stimulated by mechanical wounding, Verticillium dahliae (Vde) elicitor or methyl jasmonate (MeJA), production of terpenes and expression of the corresponding synthase genes were induced. These data demonstrate that the three genes account for the biosynthesis of volatile terpenes of cotton, at least of this Upland cotton. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. Nitric oxide synthase expression and enzymatic activity in multiple sclerosis

    DEFF Research Database (Denmark)

    Broholm, H; Andersen, B; Wanscher, B

    2004-01-01

    We used post-mortem magnetic resonance imaging (MRI) guidance to obtain paired biopsies from the brains of four patients with clinical definite multiple sclerosis (MS). Samples were analyzed for the immunoreactivity (IR) of the three nitric oxide (NO) synthase isoforms [inducible, neuronal...... and sex showed no such changes. Our data support the hypothesis that NO is a pathogenic factor in MS, and that NOS IR is strongly expressed in brain regions appearing normal by MRI...

  7. Exploiting the Biosynthetic Potential of Type III Polyketide Synthases

    OpenAIRE

    Yan Ping Lim; Maybelle K. Go; Wen Shan Yew

    2016-01-01

    Polyketides are structurally and functionally diverse secondary metabolites that are biosynthesized by polyketide synthases (PKSs) using acyl-CoA precursors. Recent studies in the engineering and structural characterization of PKSs have facilitated the use of target enzymes as biocatalysts to produce novel functionally optimized polyketides. These compounds may serve as potential drug leads. This review summarizes the insights gained from research on type III PKSs, from the discovery of chalc...

  8. ASMPKS: an analysis system for modular polyketide synthases

    OpenAIRE

    Kong Eun-Bae; Tae Hongseok; Park Kiejung

    2007-01-01

    Abstract Background Polyketides are secondary metabolites of microorganisms with diverse biological activities, including pharmacological functions such as antibiotic, antitumor and agrochemical properties. Polyketides are synthesized by serialized reactions of a set of enzymes called polyketide synthase(PKS)s, which coordinate the elongation of carbon skeletons by the stepwise condensation of short carbon precursors. Due to their importance as drugs, the volume of data on polyketides is rapi...

  9. Deficiency of mitochondrial ATP synthase of nuclear genetic origin

    Czech Academy of Sciences Publication Activity Database

    Sperl, W.; Ješina, Pavel; Zeman, J.; Mayr, J. A.; DeMeirleir, L.; VanCoster, R.; Pícková, Andrea; Hansíková, H.; Houšťková, H.; Krejčík, Zdeněk; Koch, J.; Smet, J.; Muss, W.; Holme, E.; Houštěk, Josef

    2006-01-01

    Roč. 16, č. 11 (2006), s. 821-829 ISSN 0960-8966 R&D Projects: GA MZd(CZ) NR7790; GA MŠk(CZ) 1M0520 Grant - others:CZ-AT(CZ) 6-06-3 Institutional research plan: CEZ:AV0Z50110509 Keywords : mitochondria * ATP synthase * disease Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.615, year: 2006

  10. Trypanosoma brucei solanesyl-diphosphate synthase localizes to the mitochondrion

    Czech Academy of Sciences Publication Activity Database

    Lai, D.-H.; Bontempi, E. J.; Lukeš, Julius

    2012-01-01

    Roč. 183, č. 2 (2012), s. 189-192 ISSN 0166-6851 R&D Projects: GA ČR(CZ) GAP305/11/2179 Institutional support: RVO:60077344 Keywords : Trypanosoma brucei * Sleeping sickness * Ubiquinone * Solanesyl-diphosphate synthase * Digitonin permeabilization * In situ tagging Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.734, year: 2012 http://www.sciencedirect.com/science/article/pii/S0166685112000539

  11. Use of linalool synthase in genetic engineering of scent production

    Energy Technology Data Exchange (ETDEWEB)

    Pichersky, E.

    1998-12-15

    A purified S-linalool synthase polypeptide from Clarkia breweri is disclosed as is the recombinant polypeptide and nucleic acid sequences encoding the polypeptide. Also disclosed are antibodies immunoreactive with the purified peptide and with recombinant versions of the polypeptide. Methods of using the nucleic acid sequences, as well as methods of enhancing the smell and the flavor of plants expressing the nucleic acid sequences are also disclosed. 5 figs.

  12. Dihydrodipicolinate synthase in opaque and floury maize mutants

    NARCIS (Netherlands)

    Varisi, V.A.; Medici, L.O.; Meer, van der I.M.; Lea, P.J.; Azevedo, J.L.

    2007-01-01

    Dihydrodipicolinate synthase (DHDPS, EC 4.2.1.52) was isolated and studied in four high-lysine maize mutants (Oh43o1, Oh43o2, Oh43fl1 and Oh43fl2). The activity of DHDPS was analyzed at 16, 20, and 24 DAP and characterized in the presence of the amino acids, lysine, S-(2-aminoethyl)-l-cysteine

  13. Nitric oxide synthase isoforms in spontaneous and salt hypertension

    Czech Academy of Sciences Publication Activity Database

    Hojná, Silvie; Kuneš, Jaroslav; Zicha, Josef

    2007-01-01

    Roč. 25, Suppl. 2 (2007), S 338-S 338 ISSN 0263-6352. [European Meeting on Hypertension /17./. 15.06.2007-19.06.2007, Milan] R&D Projects: GA MŠk(CZ) 1M0510 Institutional research plan: CEZ:AV0Z50110509 Keywords : nitric oxide synthase isoforms * spontaneous and salt hypertension Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  14. The cellulose synthase superfamily in fully sequenced plants and algae

    Directory of Open Access Journals (Sweden)

    Xu Ying

    2009-07-01

    Full Text Available Abstract Background The cellulose synthase superfamily has been classified into nine cellulose synthase-like (Csl families and one cellulose synthase (CesA family. The Csl families have been proposed to be involved in the synthesis of the backbones of hemicelluloses of plant cell walls. With 17 plant and algal genomes fully sequenced, we sought to conduct a genome-wide and systematic investigation of this superfamily through in-depth phylogenetic analyses. Results A single-copy gene is found in the six chlorophyte green algae, which is most closely related to the CslA and CslC families that are present in the seven land plants investigated in our analyses. Six proteins from poplar, grape and sorghum form a distinct family (CslJ, providing further support for the conclusions from two recent studies. CslB/E/G/H/J families have evolved significantly more rapidly than their widely distributed relatives, and tend to have intragenomic duplications, in particular in the grape genome. Conclusion Our data suggest that the CslA and CslC families originated through an ancient gene duplication event in land plants. We speculate that the single-copy Csl gene in green algae may encode a mannan synthase. We confirm that the rest of the Csl families have a different evolutionary origin than CslA and CslC, and have proposed a model for the divergence order among them. Our study provides new insights about the evolution of this important gene family in plants.

  15. Wounding stimulates ALLENE OXIDE SYNTHASE gene and increases the level of jasmonic acid in Ipomoea nil cotyledons

    Directory of Open Access Journals (Sweden)

    Emilia Wilmowicz

    2016-03-01

    Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.

  16. Regulation of expression, activity and localization of fungal chitin synthases

    Science.gov (United States)

    Rogg, Luise E.; Fortwendel, Jarrod R.; Juvvadi, Praveen R.; Steinbach, William J.

    2013-01-01

    The fungal cell wall represents an attractive target for pharmacologic inhibition, as many of the components are fungal-specific. Though targeted inhibition of β-glucan synthesis is effective treatment for certain fungal infections, the ability of the cell wall to dynamically compensate via the cell wall integrity pathway may limit overall efficacy. To date, chitin synthesis inhibitors have not been successfully deployed in the clinical setting. Fungal chitin synthesis is a complex and highly regulated process. Regulation of chitin synthesis occurs on multiple levels, thus targeting of these regulatory pathways may represent an exciting alternative approach. A variety of signaling pathways have been implicated in chitin synthase regulation, at both transcriptional and post-transcriptional levels. Recent research suggests that localization of chitin synthases likely represents a major regulatory mechanism. However, much of the regulatory machinery is not necessarily shared among different chitin synthases. Thus, an in depth understanding of the precise roles of each protein in cell wall maintenance and repair will be essential to identifying the most likely therapeutic targets. PMID:21526913

  17. The Structural Basis of Erwinia rhapontici Isomaltulose Synthase

    Science.gov (United States)

    Xu, Zheng; Li, Sha; Li, Jie; Li, Yan; Feng, Xiaohai; Wang, Renxiao; Xu, Hong; Zhou, Jiahai

    2013-01-01

    Sucrose isomerase NX-5 from Erwiniarhapontici efficiently catalyzes the isomerization of sucrose to isomaltulose (main product) and trehalulose (by-product). To investigate the molecular mechanism controlling sucrose isomer formation, we determined the crystal structures of native NX-5 and its mutant complexes E295Q/sucrose and D241A/glucose at 1.70 Å, 1.70 Å and 2.00 Å, respectively. The overall structure and active site architecture of NX-5 resemble those of other reported sucrose isomerases. Strikingly, the substrate binding mode of NX-5 is also similar to that of trehalulose synthase from Pseudomonasmesoacidophila MX-45 (MutB). Detailed structural analysis revealed the catalytic RXDRX motif and the adjacent 10-residue loop of NX-5 and isomaltulose synthase PalI from Klebsiella sp. LX3 adopt a distinct orientation from those of trehalulose synthases. Mutations of the loop region of NX-5 resulted in significant changes of the product ratio between isomaltulose and trehalulose. The molecular dynamics simulation data supported the product specificity of NX-5 towards isomaltulose and the role of the loop330-339 in NX-5 catalysis. This work should prove useful for the engineering of sucrose isomerase for industrial carbohydrate biotransformations. PMID:24069347

  18. Longevity in vivo of primary cell wall cellulose synthases.

    Science.gov (United States)

    Hill, Joseph Lee; Josephs, Cooper; Barnes, William J; Anderson, Charles T; Tien, Ming

    2018-02-01

    Our work focuses on understanding the lifetime and thus stability of the three main cellulose synthase (CESA) proteins involved in primary cell wall synthesis of Arabidopsis. It had long been thought that a major means of CESA regulation was via their rapid degradation. However, our studies here have uncovered that AtCESA proteins are not rapidly degraded. Rather, they persist for an extended time in the plant cell. Plant cellulose is synthesized by membrane-embedded cellulose synthase complexes (CSCs). The CSC is composed of cellulose synthases (CESAs), of which three distinct isozymes form the primary cell wall CSC and another set of three isozymes form the secondary cell wall CSC. We determined the stability over time of primary cell wall (PCW) CESAs in Arabidopsis thaliana seedlings, using immunoblotting after inhibiting protein synthesis with cycloheximide treatment. Our work reveals very slow turnover for the Arabidopsis PCW CESAs in vivo. Additionally, we show that the stability of all three CESAs within the PCW CSC is altered by mutations in individual CESAs, elevated temperature, and light conditions. Together, these results suggest that CESA proteins are very stable in vivo, but that their lifetimes can be modulated by intrinsic and environmental cues.

  19. Suites of terpene synthases explain differential terpenoid production in ginger and turmeric tissues.

    Directory of Open Access Journals (Sweden)

    Hyun Jo Koo

    Full Text Available The essential oils of ginger (Zingiber officinale and turmeric (Curcuma longa contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+-germacrene D synthase and (S-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (--caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+-α-turmerone and (+-β-turmerone, are produced from (--α-zingiberene and (--β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase.

  20. Structural Analysis of Thymidylate Synthase from Kaposi's Sarcoma-Associated Herpesvirus with the Anticancer Drug Raltitrexed.

    Directory of Open Access Journals (Sweden)

    Yong Mi Choi

    Full Text Available Kaposi's sarcoma-associated herpesvirus (KSHV is a highly infectious human herpesvirus that causes Kaposi's sarcoma. KSHV encodes functional thymidylate synthase, which is a target for anticancer drugs such as raltitrexed or 5-fluorouracil. Thymidylate synthase catalyzes the conversion of 2'-deoxyuridine-5'-monophosphate (dUMP to thymidine-5'-monophosphate (dTMP using 5,10-methylenetetrahydrofolate (mTHF as a co-substrate. The crystal structures of thymidylate synthase from KSHV (apo, complexes with dUMP (binary, and complexes with both dUMP and raltitrexed (ternary were determined at 1.7 Å, 2.0 Å, and 2.4 Å, respectively. While the ternary complex structures of human thymidylate synthase and E. coli thymidylate synthase had a closed conformation, the ternary complex structure of KSHV thymidylate synthase was observed in an open conformation, similar to that of rat thymidylate synthase. The complex structures of KSHV thymidylate synthase did not have a covalent bond between the sulfhydryl group of Cys219 and C6 atom of dUMP, unlike the human thymidylate synthase. The catalytic Cys residue demonstrated a dual conformation in the apo structure, and its sulfhydryl group was oriented toward the C6 atom of dUMP with no covalent bond upon ligand binding in the complex structures. These structural data provide the potential use of antifolates such as raltitrexed as a viral induced anticancer drug and structural basis to design drugs for targeting the thymidylate synthase of KSHV.

  1. Suites of Terpene Synthases Explain Differential Terpenoid Production in Ginger and Turmeric Tissues

    Science.gov (United States)

    Koo, Hyun Jo; Gang, David R.

    2012-01-01

    The essential oils of ginger (Zingiber officinale) and turmeric (Curcuma longa) contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+)-germacrene D synthase and (S)-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet) rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (−)-caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+)-α-turmerone and (+)-β-turmerone, are produced from (−)-α-zingiberene and (−)-β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase. PMID:23272109

  2. Structure of the human beta-ketoacyl [ACP] synthase from the mitochondrial type II fatty acid synthase

    DEFF Research Database (Denmark)

    Christensen, Caspar Elo; Kragelund, Birthe Brandt; Von Wettstein-Knowles, Penny

    2007-01-01

    Two distinct ways of organizing fatty acid biosynthesis exist: the multifunctional type I fatty acid synthase (FAS) of mammals, fungi, and lower eukaryotes with activities residing on one or two polypeptides; and the dissociated type II FAS of prokaryotes, plastids, and mitochondria with individual...... activities encoded by discrete genes. The beta-ketoacyl [ACP] synthase (KAS) moiety of the mitochondrial FAS (mtKAS) is targeted by the antibiotic cerulenin and possibly by the other antibiotics inhibiting prokaryotic KASes: thiolactomycin, platensimycin, and the alpha-methylene butyrolactone, C75. The high...... degree of structural similarity between mitochondrial and prokaryotic KASes complicates development of novel antibiotics targeting prokaryotic KAS without affecting KAS domains of cytoplasmic FAS. KASes catalyze the C(2) fatty acid elongation reaction using either a Cys-His-His or Cys-His-Asn catalytic...

  3. CELLULOSE SYNTHASE INTERACTIVE1 Is Required for Fast Recycling of Cellulose Synthase Complexes to the Plasma Membrane in Arabidopsis

    Energy Technology Data Exchange (ETDEWEB)

    Lei, Lei; Singh, Abhishek; Bashline, Logan; Li, Shundai; Yingling, Yaroslava G.; Gu, Ying

    2015-10-06

    Plants are constantly subjected to various biotic and abiotic stresses and have evolved complex strategies to cope with these stresses. For example, plant cells endocytose plasma membrane material under stress and subsequently recycle it back when the stress conditions are relieved. Cellulose biosynthesis is a tightly regulated process that is performed by plasma membrane-localized cellulose synthase (CESA) complexes (CSCs). However, the regulatory mechanism of cellulose biosynthesis under abiotic stress has not been well explored. In this study, we show that small CESA compartments (SmaCCs) or microtubule-associated cellulose synthase compartments (MASCs) are critical for fast recovery of CSCs to the plasma membrane after stress is relieved in Arabidopsis thaliana. This SmaCC/MASC-mediated fast recovery of CSCs is dependent on CELLULOSE SYNTHASE INTERACTIVE1 (CSI1), a protein previously known to represent the link between CSCs and cortical microtubules. Independently, AP2M, a core component in clathrin-mediated endocytosis, plays a role in the formation of SmaCCs/MASCs. Together, our study establishes a model in which CSI1-dependent SmaCCs/MASCs are formed through a process that involves endocytosis, which represents an important mechanism for plants to quickly regulate cellulose synthesis under abiotic stress.

  4. Structure of the Cellulose Synthase Complex of Gluconacetobacter hansenii at 23.4 Å Resolution.

    Directory of Open Access Journals (Sweden)

    Juan Du

    Full Text Available Bacterial crystalline cellulose is used in biomedical and industrial applications, but the molecular mechanisms of synthesis are unclear. Unlike most bacteria, which make non-crystalline cellulose, Gluconacetobacter hansenii extrudes profuse amounts of crystalline cellulose. Its cellulose synthase (AcsA exists as a complex with accessory protein AcsB, forming a 'terminal complex' (TC that has been visualized by freeze-fracture TEM at the base of ribbons of crystalline cellulose. The catalytic AcsAB complex is embedded in the cytoplasmic membrane. The C-terminal portion of AcsC is predicted to form a translocation channel in the outer membrane, with the rest of AcsC possibly interacting with AcsD in the periplasm. It is thus believed that synthesis from an organized array of TCs coordinated with extrusion by AcsC and AcsD enable this bacterium to make crystalline cellulose. The only structural data that exist for this system are the above mentioned freeze-fracture TEM images, fluorescence microscopy images revealing that TCs align in a row, a crystal structure of AcsD bound to cellopentaose, and a crystal structure of PilZ domain of AcsA. Here we advance our understanding of the structural basis for crystalline cellulose production by bacterial cellulose synthase by determining a negative stain structure resolved to 23.4 Å for highly purified AcsAB complex that catalyzed incorporation of UDP-glucose into β-1,4-glucan chains, and responded to the presence of allosteric activator cyclic diguanylate. Although the AcsAB complex was functional in vitro, the synthesized cellulose was not visible in TEM. The negative stain structure revealed that AcsAB is very similar to that of the BcsAB synthase of Rhodobacter sphaeroides, a non-crystalline cellulose producing bacterium. The results indicate that the crystalline cellulose producing and non-crystalline cellulose producing bacteria share conserved catalytic and membrane translocation components, and

  5. Structure of the dimeric form of CTP synthase from Sulfolobus solfataricus

    DEFF Research Database (Denmark)

    Lauritsen, Iben; Willemoës, Martin; Jensen, Kaj Frank

    2011-01-01

    CTP synthase catalyzes the last committed step in de novo pyrimidine-nucleotide biosynthesis. Active CTP synthase is a tetrameric enzyme composed of a dimer of dimers. The tetramer is favoured in the presence of the substrate nucleotides ATP and UTP; when saturated with nucleotide, the tetramer c....... solfataricus CTP synthase according to a structural alignment with the E. coli enzyme all have large thermal parameters in the dimeric form. Furthermore, they are seen to undergo substantial movement upon tetramerization....

  6. Biosynthesis of aliphatic polyketides by type III polyketide synthase and methyltransferase in Bacillus subtilis.

    Science.gov (United States)

    Nakano, Chiaki; Ozawa, Hiroki; Akanuma, Genki; Funa, Nobutaka; Horinouchi, Sueharu

    2009-08-01

    Type III polyketide synthases (PKSs) synthesize a variety of aromatic polyketides in plants, fungi, and bacteria. The bacterial genome projects predicted that probable type III PKS genes are distributed in a wide variety of gram-positive and -negative bacteria. The gram-positive model microorganism Bacillus subtilis contained the bcsA-ypbQ operon, which appeared to encode a type III PKS and a methyltransferase, respectively. Here, we report the characterization of bcsA (renamed bpsA, for Bacillus pyrone synthase, on the basis of its function) and ypbQ, which are involved in the biosynthesis of aliphatic polyketides. In vivo analysis demonstrated that BpsA was a type III PKS catalyzing the synthesis of triketide pyrones from long-chain fatty acyl-coenzyme A (CoA) thioesters as starter substrates and malonyl-CoA as an extender substrate, and YpbQ was a methyltransferase acting on the triketide pyrones to yield alkylpyrone methyl ethers. YpbQ thus was named BpsB because of its functional relatedness to BpsA. In vitro analysis with histidine-tagged BpsA revealed that it used broad starter substrates and produced not only triketide pyrones but also tetraketide pyrones and alkylresorcinols. Although the aliphatic polyketides were expected to localize in the membrane and play some role in modulating the rigidity and properties of the membrane, no detectable phenotypic changes were observed for a B. subtilis mutant containing a whole deletion of the bpsA-bpsB operon.

  7. Functional Analysis of the Brassica napus L. Phytoene Synthase (PSY) Gene Family

    Science.gov (United States)

    López-Emparán, Ada; Quezada-Martinez, Daniela; Zúñiga-Bustos, Matías; Cifuentes, Víctor; Iñiguez-Luy, Federico; Federico, María Laura

    2014-01-01

    Phytoene synthase (PSY) has been shown to catalyze the first committed and rate-limiting step of carotenogenesis in several crop species, including Brassica napus L. Due to its pivotal role, PSY has been a prime target for breeding and metabolic engineering the carotenoid content of seeds, tubers, fruits and flowers. In Arabidopsis thaliana, PSY is encoded by a single copy gene but small PSY gene families have been described in monocot and dicotyledonous species. We have recently shown that PSY genes have been retained in a triplicated state in the A- and C-Brassica genomes, with each paralogue mapping to syntenic locations in each of the three “Arabidopsis-like” subgenomes. Most importantly, we have shown that in B. napus all six members are expressed, exhibiting overlapping redundancy and signs of subfunctionalization among photosynthetic and non photosynthetic tissues. The question of whether this large PSY family actually encodes six functional enzymes remained to be answered. Therefore, the objectives of this study were to: (i) isolate, characterize and compare the complete protein coding sequences (CDS) of the six B. napus PSY genes; (ii) model their predicted tridimensional enzyme structures; (iii) test their phytoene synthase activity in a heterologous complementation system and (iv) evaluate their individual expression patterns during seed development. This study further confirmed that the six B. napus PSY genes encode proteins with high sequence identity, which have evolved under functional constraint. Structural modeling demonstrated that they share similar tridimensional protein structures with a putative PSY active site. Significantly, all six B. napus PSY enzymes were found to be functional. Taking into account the specific patterns of expression exhibited by these PSY genes during seed development and recent knowledge of PSY suborganellar localization, the selection of transgene candidates for metabolic engineering the carotenoid content of

  8. Incorporation of phosphate into glycogen by glycogen synthase.

    Science.gov (United States)

    Contreras, Christopher J; Segvich, Dyann M; Mahalingan, Krishna; Chikwana, Vimbai M; Kirley, Terence L; Hurley, Thomas D; DePaoli-Roach, Anna A; Roach, Peter J

    2016-05-01

    The storage polymer glycogen normally contains small amounts of covalently attached phosphate as phosphomonoesters at C2, C3 and C6 atoms of glucose residues. In the absence of the laforin phosphatase, as in the rare childhood epilepsy Lafora disease, the phosphorylation level is elevated and is associated with abnormal glycogen structure that contributes to the pathology. Laforin therefore likely functions in vivo as a glycogen phosphatase. The mechanism of glycogen phosphorylation is less well-understood. We have reported that glycogen synthase incorporates phosphate into glycogen via a rare side reaction in which glucose-phosphate rather than glucose is transferred to a growing polyglucose chain (Tagliabracci et al. (2011) Cell Metab13, 274-282). We proposed a mechanism to account for phosphorylation at C2 and possibly at C3. Our results have since been challenged (Nitschke et al. (2013) Cell Metab17, 756-767). Here we extend the evidence supporting our conclusion, validating the assay used for the detection of glycogen phosphorylation, measurement of the transfer of (32)P from [β-(32)P]UDP-glucose to glycogen by glycogen synthase. The (32)P associated with the glycogen fraction was stable to ethanol precipitation, SDS-PAGE and gel filtration on Sephadex G50. The (32)P-signal was not affected by inclusion of excess unlabeled UDP before analysis or by treatment with a UDPase, arguing against the signal being due to contaminating [β-(32)P]UDP generated in the reaction. Furthermore, [(32)P]UDP did not bind non-covalently to glycogen. The (32)P associated with glycogen was released by laforin treatment, suggesting that it was present as a phosphomonoester. The conclusion is that glycogen synthase can mediate the introduction of phosphate into glycogen, thereby providing a possible mechanism for C2, and perhaps C3, phosphorylation. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Fatty acid synthase inhibitors isolated from Punica granatum L

    International Nuclear Information System (INIS)

    Jiang, He-Zhong; Ma, Qing-Yun; Liang, Wen-Juan; Huang, Sheng-Zhuo; Dai, Hao-Fu; Wang, Peng-Cheng; Zhao, You-Xing; Fan, Hui-Jin; Ma, Xiao-Feng

    2012-01-01

    The aim of this work is the isolation of fatty acid synthase (FAS) inhibitors from the ethyl acetate extracts of fruit peels of Punica granatum L. Bioassay-guided chemical investigation of the fruit peels resulted in the isolation of seventeen compounds mainly including triterpenoids and phenolic compounds, from which one new oleanane-type triterpene (punicaone) along with fourteen known compounds were isolated for the first time from this plant. Seven isolates were evaluated for inhibitory activities of FAS and two compounds showed to be active. Particularly, flavogallonic acid exhibited strong FAS inhibitory activity with IC 50 value of 10.3 μmol L -1 . (author)

  10. Fatty acid synthase inhibitors isolated from Punica granatum L

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, He-Zhong [School of Life Science and Engineering, Southwest Jiaotong University, Chengdu, (China); Ma, Qing-Yun; Liang, Wen-Juan; Huang, Sheng-Zhuo; Dai, Hao-Fu; Wang, Peng-Cheng; Zhao, You-Xing, E-mail: zhaoyx1011@163.com [Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural Sciences, Haikou (China); Fan, Hui-Jin; Ma, Xiao-Feng, E-mail: maxiaofeng@gucas.ac.cn [College of Life Sciences, Graduate University of Chinese Academy of Sciences, Beijing (China)

    2012-05-15

    The aim of this work is the isolation of fatty acid synthase (FAS) inhibitors from the ethyl acetate extracts of fruit peels of Punica granatum L. Bioassay-guided chemical investigation of the fruit peels resulted in the isolation of seventeen compounds mainly including triterpenoids and phenolic compounds, from which one new oleanane-type triterpene (punicaone) along with fourteen known compounds were isolated for the first time from this plant. Seven isolates were evaluated for inhibitory activities of FAS and two compounds showed to be active. Particularly, flavogallonic acid exhibited strong FAS inhibitory activity with IC{sub 50} value of 10.3 {mu}mol L{sup -1}. (author)

  11. Molecular cloning and functional expression of geranylgeranyl pyrophosphate synthase from Coleus forskohlii Briq

    Directory of Open Access Journals (Sweden)

    Kawamukai Makoto

    2004-11-01

    Full Text Available Abstract Background Isopentenyl diphosphate (IPP, a common biosynthetic precursor to the labdane diterpene forskolin, has been biosynthesised via a non-mevalonate pathway. Geranylgeranyl diphosphate (GGPP synthase is an important branch point enzyme in terpenoid biosynthesis. Therefore, GGPP synthase is thought to be a key enzyme in biosynthesis of forskolin. Herein we report the first confirmation of the GGPP synthase gene in Coleus forskohlii Briq. Results The open reading frame for full-length GGPP synthase encodes a protein of 359 amino acids, in which 1,077 nucleotides long with calculated molecular mass of 39.3 kDa. Alignments of C. forskohlii GGPP synthase amino acid sequences revealed high homologies with other plant GGPP synthases. Several highly conserved regions, including two aspartate-rich motifs were identified. Transient expression of the N-terminal region of C. forskohlii GGPP synthase-GFP fusion protein in tobacco cells demonstrated subcellular localization in the chloroplast. Carotenoid production was observed in Escherichia coli harboring pACCAR25ΔcrtE from Erwinia uredovora and plasmid carrying C. forskohlii GGPP synthase. These results suggested that cDNA encoded functional GGPP synthase. Furthermore, C. forskohlii GGPP synthase expression was strong in leaves, decreased in stems and very little expression was observed in roots. Conclusion This investigation proposed that forskolin was synthesised via a non-mevalonate pathway. GGPP synthase is thought to be involved in the biosynthesis of forskolin, which is primarily synthesised in the leaves and subsequently accumulates in the stems and roots.

  12. Glycogen synthase from the parabasalian parasite Trichomonas vaginalis: An unusual member of the starch/glycogen synthase family.

    Science.gov (United States)

    Wilson, Wayne A; Pradhan, Prajakta; Madhan, Nayasha; Gist, Galen C; Brittingham, Andrew

    2017-07-01

    Trichomonas vaginalis, a parasitic protist, is the causative agent of the common sexually-transmitted infection trichomoniasis. The organism has long been known to synthesize substantial glycogen as a storage polysaccharide, presumably mobilizing this compound during periods of carbohydrate limitation, such as might be encountered during transmission between hosts. However, little is known regarding the enzymes of glycogen metabolism in T. vaginalis. We had previously described the identification and characterization of two forms of glycogen phosphorylase in the organism. Here, we measure UDP-glucose-dependent glycogen synthase activity in cell-free extracts of T. vaginalis. We then demonstrate that the TVAG_258220 open reading frame encodes a glycosyltransferase that is presumably responsible for this synthetic activity. We show that expression of TVAG_258220 in a yeast strain lacking endogenous glycogen synthase activity is sufficient to restore glycogen accumulation. Furthermore, when TVAG_258220 is expressed in bacteria, the resulting recombinant protein has glycogen synthase activity in vitro, transferring glucose from either UDP-glucose or ADP-glucose to glycogen and using both substrates with similar affinity. This protein is also able to transfer glucose from UDP-glucose or ADP-glucose to maltose and longer oligomers of glucose but not to glucose itself. However, with these substrates, there is no evidence of processivity and sugar transfer is limited to between one and three glucose residues. Taken together with our earlier work on glycogen phosphorylase, we are now well positioned to define both how T. vaginalis synthesizes and utilizes glycogen, and how these processes are regulated. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  13. Molecular cloning and spatiotemporal expression of prostaglandin F synthase and microsomal prostaglandin E synthase-1 in porcine endometrium.

    Science.gov (United States)

    Waclawik, Agnieszka; Rivero-Muller, Adolfo; Blitek, Agnieszka; Kaczmarek, Monika M; Brokken, Leon J S; Watanabe, Kikuko; Rahman, Nafis A; Ziecik, Adam J

    2006-01-01

    Endometrial prostaglandins (PGs) and the PGE2/PGF2alpha ratio play an important role in regulating the estrous cycle and establishment of pregnancy. The enzymes downstream of cyclooxygenase-2 may determine the PGE2/PGF2alpha ratio in the porcine uterus. Thus, we have cloned porcine PGF synthase (PGFS) and microsomal PGE synthase-1 (mPGES-1) and characterized their expression in porcine endometrium during the estrous cycle and early pregnancy. PGFS and mPGES-1 amino acid sequences possessed a high degree (>67% and >77%, respectively) of identity with the other mammalian homologs. There was little modulation of mPGES-1 throughout the estrous cycle; however, PGFS expression was highly up-regulated in endometrium around the time of luteolysis. During early pregnancy, PGFS at the protein level showed a time-dependent increase (low on d 10-13, intermediate on d 14-23, and high on d 24-25). In pregnancy, expression of mPGES-1 was intermediate on d 10-11 and low on d 14-17 and then increased after d 22, reaching the maximum on d 24-25. Immunohistochemistry showed localization of PGFS and mPGES-1 proteins mainly in luminal and glandular epithelium. Concluding, the spatiotemporal expression of PGFS throughout the estrous cycle indicates an involvement of PGFS in regulating luteolysis in the pig. The comparison of endometrial PGFS and mPGES-1 expression on d 10-13 of the estrous cycle and pregnancy suggest a supportive role of these enzymes in determining the increase of uterine PGE2/PGF2alpha ratio during maternal recognition of pregnancy. Moreover, high expression of both PG synthases after initiation of implantation may indicate their significant role in placentation.

  14. Direct transfer of starter substrates from type I fatty acid synthase to type III polyketide synthases in phenolic lipid synthesis.

    Science.gov (United States)

    Miyanaga, Akimasa; Funa, Nobutaka; Awakawa, Takayoshi; Horinouchi, Sueharu

    2008-01-22

    Alkylresorcinols and alkylpyrones, which have a polar aromatic ring and a hydrophobic alkyl chain, are phenolic lipids found in plants, fungi, and bacteria. In the Gram-negative bacterium Azotobacter vinelandii, phenolic lipids in the membrane of dormant cysts are essential for encystment. The aromatic moieties of the phenolic lipids in A. vinelandii are synthesized by two type III polyketide synthases (PKSs), ArsB and ArsC, which are encoded by the ars operon. However, details of the synthesis of hydrophobic acyl chains, which might serve as starter substrates for the type III polyketide synthases (PKSs), were unknown. Here, we show that two type I fatty acid synthases (FASs), ArsA and ArsD, which are members of the ars operon, are responsible for the biosynthesis of C(22)-C(26) fatty acids from malonyl-CoA. In vivo and in vitro reconstitution of phenolic lipid synthesis systems with the Ars enzymes suggested that the C(22)-C(26) fatty acids produced by ArsA and ArsD remained attached to the ACP domain of ArsA and were transferred hand-to-hand to the active-site cysteine residues of ArsB and ArsC. The type III PKSs then used the fatty acids as starter substrates and carried out two or three extensions with malonyl-CoA to yield the phenolic lipids. The phenolic lipids in A. vinelandii were thus found to be synthesized solely from malonyl-CoA by the four members of the ars operon. This is the first demonstration that a type I FAS interacts directly with a type III PKS through substrate transfer.

  15. Functional characterization of nine Norway Spruce TPS genes and evolution of gymnosperm terpene synthases of the TPS-d subfamily.

    Science.gov (United States)

    Martin, Diane M; Fäldt, Jenny; Bohlmann, Jörg

    2004-08-01

    Constitutive and induced terpenoids are important defense compounds for many plants against potential herbivores and pathogens. In Norway spruce (Picea abies L. Karst), treatment with methyl jasmonate induces complex chemical and biochemical terpenoid defense responses associated with traumatic resin duct development in stems and volatile terpenoid emissions in needles. The cloning of (+)-3-carene synthase was the first step in characterizing this system at the molecular genetic level. Here we report the isolation and functional characterization of nine additional terpene synthase (TPS) cDNAs from Norway spruce. These cDNAs encode four monoterpene synthases, myrcene synthase, (-)-limonene synthase, (-)-alpha/beta-pinene synthase, and (-)-linalool synthase; three sesquiterpene synthases, longifolene synthase, E,E-alpha-farnesene synthase, and E-alpha-bisabolene synthase; and two diterpene synthases, isopimara-7,15-diene synthase and levopimaradiene/abietadiene synthase, each with a unique product profile. To our knowledge, genes encoding isopimara-7,15-diene synthase and longifolene synthase have not been previously described, and this linalool synthase is the first described from a gymnosperm. These functionally diverse TPS account for much of the structural diversity of constitutive and methyl jasmonate-induced terpenoids in foliage, xylem, bark, and volatile emissions from needles of Norway spruce. Phylogenetic analyses based on the inclusion of these TPS into the TPS-d subfamily revealed that functional specialization of conifer TPS occurred before speciation of Pinaceae. Furthermore, based on TPS enclaves created by distinct branching patterns, the TPS-d subfamily is divided into three groups according to sequence similarities and functional assessment. Similarities of TPS evolution in angiosperms and modeling of TPS protein structures are discussed.

  16. Cloning and Characterization of Farnesyl Diphosphate Synthase Gene Involved in Triterpenoids Biosynthesis from Poria cocos

    Directory of Open Access Journals (Sweden)

    Jianrong Wang

    2014-12-01

    Full Text Available Poria cocos (P. cocos has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%. The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP from geranyl diphosphate (GPP and isopentenyl diphosphate (IPP. Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos.

  17. A computational screen for type I polyketide synthases in metagenomics shotgun data.

    Directory of Open Access Journals (Sweden)

    Konrad U Foerstner

    Full Text Available BACKGROUND: Polyketides are a diverse group of biotechnologically important secondary metabolites that are produced by multi domain enzymes called polyketide synthases (PKS. METHODOLOGY/PRINCIPAL FINDINGS: We have estimated frequencies of type I PKS (PKS I - a PKS subgroup - in natural environments by using Hidden-Markov-Models of eight domains to screen predicted proteins from six metagenomic shotgun data sets. As the complex PKS I have similarities to other multi-domain enzymes (like those for the fatty acid biosynthesis we increased the reliability and resolution of the dataset by maximum-likelihood trees. The combined information of these trees was then used to discriminate true PKS I domains from evolutionary related but functionally different ones. We were able to identify numerous novel PKS I proteins, the highest density of which was found in Minnesota farm soil with 136 proteins out of 183,536 predicted genes. We also applied the protocol to UniRef database to improve the annotation of proteins with so far unknown function and identified some new instances of horizontal gene transfer. CONCLUSIONS/SIGNIFICANCE: The screening approach proved powerful in identifying PKS I sequences in large sequence data sets and is applicable to many other protein families.

  18. Homology modeling of Homo sapiens lipoic acid synthase: Substrate docking and insights on its binding mode.

    Science.gov (United States)

    Krishnamoorthy, Ezhilarasi; Hassan, Sameer; Hanna, Luke Elizabeth; Padmalayam, Indira; Rajaram, Rama; Viswanathan, Vijay

    2017-05-07

    Lipoic acid synthase (LIAS) is an iron-sulfur cluster mitochondrial enzyme which catalyzes the final step in the de novo pathway for the biosynthesis of lipoic acid, a potent antioxidant. Recently there has been significant interest in its role in metabolic diseases and its deficiency in LIAS expression has been linked to conditions such as diabetes, atherosclerosis and neonatal-onset epilepsy, suggesting a strong inverse correlation between LIAS reduction and disease status. In this study we use a bioinformatics approach to predict its structure, which would be helpful to understanding its role. A homology model for LIAS protein was generated using X-ray crystallographic structure of Thermosynechococcus elongatus BP-1 (PDB ID: 4U0P). The predicted structure has 93% of the residues in the most favour region of Ramachandran plot. The active site of LIAS protein was mapped and docked with S-Adenosyl Methionine (SAM) using GOLD software. The LIAS-SAM complex was further refined using molecular dynamics simulation within the subsite 1 and subsite 3 of the active site. To the best of our knowledge, this is the first study to report a reliable homology model of LIAS protein. This study will facilitate a better understanding mode of action of the enzyme-substrate complex for future studies in designing drugs that can target LIAS protein. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Human farnesyl pyrophosphate synthase inhibition by nitrogen bisphosphonates: a 3D-QSAR study

    Science.gov (United States)

    Fernández, David; Ortega-Castro, Joaquín; Frau, Juan

    2013-08-01

    We report the results of a comparative molecular field analysis and comparative molecular similarity index analysis of the human farnesyl pyrophosphate synthase (FPPS) inhibition by nitrogen bisphosphonates (NBPs) taking into account their time-dependent inhibition efficacies. The 3D-QSAR models obtained provide steric, electrostatic and hydrophobic contour maps consistent with the interactions into the active site of human FPPS observed in available crystallographic structures. Furthermore, the 3D-QSAR models obtained provide accurately IC50 values of the NBPs of the training set. The predictive ability of these 3D-QSAR models was found to rely on the choice of biologically active conformations of the target molecules and on a careful examination of the protonation status of the NBPs in the training set. The best models obtained can be useful to predict biological values of a high number of NBPs that have been used for the treatment of different diseases as potential inhibitors of the activity of the FPPS enzyme.

  20. Stereochemical course of enzyme-catalyzed aminopropyl transfer: spermidine synthase

    Energy Technology Data Exchange (ETDEWEB)

    Kullberg, D.W.; Orr, G.R.; Coward, J.K.

    1986-05-01

    The R and S enantionmers of S-adenosyl-3-(/sup 2/H)3-(methylthio)-1-propylamine (decarboxylated S-adenosylmethionine), previously synthesized in this laboratory, were incubated with (1,4-/sup 2/H/sub 4/)-putrescine in the presence of spermidine synthase from E. coli. The resulting chiral (/sup 2/H/sub 5/)spermidines were isolated and converted to their N/sub 1/,N/sub 7/-dibocspermidine-N/sub 4/-(1S,4R)-camphanamides. The derivatives were analyzed by 500 MHz /sup 1/H-NMR and the configuration of the chiral center assigned by correlation with the spectra of synthetic chiral (/sup 2/H/sub 3/)dibocspermidine camphanamide standards. The enzyme-catalyzed aminopropyl transfer was shown to occur with net retention of configuration, indicative of a double-displacement mechanism. This result concurs with that of a previous steady-state kinetics study of spermidine synthase isolated from E. coli, but contradicts the single-displacement mechanism suggested by a stereochemical analysis of chiral spermidines biosynthesized in E. coli treated with chirally deuterated methionines. It also indicates that this aminopropyltransferase is mechanistically distinct from the methyltransferases, which have been shown to act via a single-displacement mechanism (net inversion at -CH/sub 3/) in all cases studied to date.

  1. Ack kinase regulates CTP synthase filaments during Drosophila oogenesis.

    Science.gov (United States)

    Strochlic, Todd I; Stavrides, Kevin P; Thomas, Sam V; Nicolas, Emmanuelle; O'Reilly, Alana M; Peterson, Jeffrey R

    2014-11-01

    The enzyme CTP synthase (CTPS) dynamically assembles into macromolecular filaments in bacteria, yeast, Drosophila, and mammalian cells, but the role of this morphological reorganization in regulating CTPS activity is controversial. During Drosophila oogenesis, CTPS filaments are transiently apparent in ovarian germline cells during a period of intense genomic endoreplication and stockpiling of ribosomal RNA. Here, we demonstrate that CTPS filaments are catalytically active and that their assembly is regulated by the non-receptor tyrosine kinase DAck, the Drosophila homologue of mammalian Ack1 (activated cdc42-associated kinase 1), which we find also localizes to CTPS filaments. Egg chambers from flies deficient in DAck or lacking DAck catalytic activity exhibit disrupted CTPS filament architecture and morphological defects that correlate with reduced fertility. Furthermore, ovaries from these flies exhibit reduced levels of total RNA, suggesting that DAck may regulate CTP synthase activity. These findings highlight an unexpected function for DAck and provide insight into a novel pathway for the developmental control of an essential metabolic pathway governing nucleotide biosynthesis. © 2014 The Authors.

  2. Tomato linalool synthase is induced in trichomes by jasmonic acid

    Science.gov (United States)

    van Schie, Chris C. N.; Haring, Michel A.

    2007-01-01

    Tomato (Lycopersicon esculentum) plants emit a blend of volatile organic compounds, which mainly consists of terpenes. Upon herbivory or wounding, the emission of several terpenes increases. We have identified and characterized the first two tomato monoterpene synthases, LeMTS1 and LeMTS2. Although these proteins were highly homologous, recombinant LeMTS1 protein produced (R)-linalool from geranyl diphosphate (GPP) and (E)-nerolidol from farnesyl diphosphate (FPP), while recombinant LeMTS2 produced β-phellandrene, β-myrcene, and sabinene from GPP. In addition, these genes were expressed in different tissues: LeMTS1 was expressed in flowers, young leaves, stems, and petioles, while LeMTS2 was strongest expressed in stems and roots. LeMTS1 expression in leaves was induced by spider mite-infestation, wounding and jasmonic acid (JA)-treatment, while LeMTS2 did not respond to these stimuli. The expression of LeMTS1 in stems and petioles was predominantly detected in trichomes and could be induced by JA. Because JA treatment strongly induced emission of linalool and overexpression of LeMTS1 in tomato resulted in increased production of linalool, we propose that LeMTS1 is a genuine linalool synthase. Our results underline the importance of trichomes in JA-induced terpene emission in tomato. PMID:17440821

  3. Inhibition of the ATP Synthase Eliminates the Intrinsic Resistance of Staphylococcus aureus towards Polymyxins

    DEFF Research Database (Denmark)

    Vestergaard, Martin; Nøhr-Meldgaard, Katrine; Bojer, Martin Saxtorph

    2017-01-01

    , linezolid, daptomycin, and oxacillin were unchanged. ATP synthase activity is known to be inhibited by oligomycin A, and the presence of this compound increased polymyxin B-mediated killing of S. aureus Our results demonstrate that the ATP synthase contributes to intrinsic resistance of S. aureus towards...

  4. Cytidine triphosphate synthase activity and mRNA expression in normal human blood cells

    NARCIS (Netherlands)

    Verschuur, A. C.; van Gennip, A. H.; Muller, E. J.; Voûte, P. A.; Vreken, P.; van Kuilenburg, A. B.

    1999-01-01

    Cytidine triphosphate (CTP) synthase is one of the key enzymes in pyrimidine nucleotide anabolic pathways. The activity of this enzyme is elevated in various malignancies including acute lymphocytic leukemia (ALL). In this study we investigated the activity of CTP synthase in various human blood

  5. Expression of prostaglandin synthases (pgds and pges) duringzebrafishgonadal differentiation

    DEFF Research Database (Denmark)

    Jørgensen, Anne; Nielsen, John E.; Nielsen, Betina F.

    2010-01-01

    The present study aimed at elucidating whether the expression pattern of the membrane bound form of prostaglandin E-2 synthase (pges) and especially the lipocalin-type prostaglandin D-2 synthase (pgds) indicates involvement in gonadal sex differentiation in zebrafish as has previously been found ...

  6. Use of octaketide synthases to produce kermesic acid and flavokermesic acid

    DEFF Research Database (Denmark)

    2016-01-01

    A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...

  7. Selectivity of the surface binding site (SBS) on barley starch synthase I

    DEFF Research Database (Denmark)

    Wilkens, Casper; Cuesta-Seijo, Jose A.; Palcic, Monica

    2014-01-01

    Starch synthase I (SSI) from various sources has been shown to preferentially elongate branch chains of degree of polymerisation (DP) from 6–7 to produce chains of DP 8–12. In the recently determined crystal structure of barley starch synthase I (HvSSI) a so-called surface binding site (SBS) was ...

  8. The localization of chitin synthase in membranous vesicles (chitosomes) in Neurospora crassa

    NARCIS (Netherlands)

    Sietsma, JH; Din, AB; Ziv, [No Value; Sjollema, KA; Yarden, O

    Polyclonal anti-chitin synthase antibodies raised against the Saccharomyces cerevisiae CHS2 gene product were used to identify and localize chitin synthase in the filamentous ascomycete Neurospora crassa. A single band of approximately 110 kDa was observed in Western blots of total protein extracts

  9. Organellar and cytosolic localization of four phosphoribosyl diphosphate synthase isozymes in spinach

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1999-01-01

    ) required inorganic phosphate for activity, whereas the others were phosphate independent. PRPP synthase isozymes 2 and 3 contained 76 and 87 amino acid extensions, respectively, at their N-terminal ends in comparison with other PRPP synthases. Isozyme 2 was synthesized in vitro and shown to be imported...

  10. Domain swapping of Citrus limon monoterpene synthases: impact on enzymatic activity and product specifity.

    NARCIS (Netherlands)

    Tamer, el M.K.; Lucker, J.; Bosch, D.; Verhoeven, H.A.; Verstappen, F.W.A.; Schwab, W.; Tunen, van A.J.; Voragen, A.G.J.; Maagd, de R.A.; Bouwmeester, H.J.

    2003-01-01

    Monoterpene cyclases are the key enzymes in the monoterpene biosynthetic pathway, as they catalyze the cyclization of the ubiquitous geranyl diphosphate (GDP) to the specific monoterpene skeletons. From Citrus limon, four monoterpene synthase-encoding cDNAs for a P-pinene synthase named

  11. KORRIGAN1 Interacts Specifically with Integral Components of the Cellulose Synthase Machinery

    NARCIS (Netherlands)

    Mansoori Zangir, N.; Timmers, J.F.P.; Desprez, T.; Lessa Alvim Kamei, C.; Dees, D.C.T.; Vincken, J.P.; Visser, R.G.F.; Höfte, H.; Vernhettes, S.; Trindade, L.M.

    2014-01-01

    Cellulose is synthesized by the so called rosette protein complex and the catalytic subunits of this complex are the cellulose synthases (CESAs). It is thought that the rosette complexes in the primary and secondary cell walls each contains at least three different non-redundant cellulose synthases.

  12. The Primary Diterpene Synthase Products of Picea abies Levopimaradiene/Abietadiene Synthase (PaLAS) Are Epimers of a Thermally Unstable Diterpenol*

    OpenAIRE

    Keeling, Christopher I.; Madilao, Lina L.; Zerbe, Philipp; Dullat, Harpreet K.; Bohlmann, Jörg

    2011-01-01

    The levopimaradiene/abietadiene synthase from Norway spruce (Picea abies; PaLAS) has previously been reported to produce a mixture of four diterpene hydrocarbons when incubated with geranylgeranyl diphosphate as the substrate: levopimaradiene, abietadiene, neoabietadiene, and palustradiene. However, variability in the assay products observed by GC-MS of this and orthologous conifer diterpene synthases over the past 15 years suggested that these diterpenes may not be the initial enzyme assay p...

  13. cDNA isolation, functional expression, and characterization of (+)-alpha-pinene synthase and (-)-alpha-pinene synthase from loblolly pine (Pinus taeda): stereocontrol in pinene biosynthesis.

    Science.gov (United States)

    Phillips, Michael A; Wildung, Mark R; Williams, David C; Hyatt, David C; Croteau, Rodney

    2003-03-15

    The complex mixture of monoterpenes, sesquiterpenes, and diterpenes that comprises oleoresin provides the primary defense of conifers against bark beetles and their associated fungal pathogens. Monoterpene synthases produce the turpentine fraction of oleoresin, which allows mobilization of the diterpene resin acid component (rosin) and is also toxic toward invading insects; this is particularly the case for alpha-pinene, a prominent bicyclic monoterpene of pine turpentine. The stereochemistry of alpha-pinene is a critical determinant of host defense capability and has implications for host selection, insect pheromone biosynthesis, and tritrophic-level interactions. Pines produce both enantiomers of alpha-pinene, which appear to arise through antipodal reaction mechanisms by distinct enzymes. Using a cDNA library constructed with mRNA from flushing needles of loblolly pine (Pinus taeda), we employed a homology-based cloning strategy to isolate, and confirm by functional expression, the genes encoding (+)-(3R:5R)-alpha-pinene synthase, (-)-(3S:5S)-alpha-pinene synthase, and several other terpene synthases. The pinene synthases, which produce mirror-image products, share only 66% amino acid identity (72% similarity) but are similar in general properties to other monoterpene synthases of gymnosperms. The stereochemical control of monoterpene cyclization reactions, the evolution of "antipodal" enzymes, and the implications of turpentine composition in ecological interactions are discussed.

  14. 5,10-Methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTRR), and methionine synthase reductase (MTR) gene polymorphisms and adult meningioma risk.

    Science.gov (United States)

    Zhang, Jun; Zhou, Yan-Wen; Shi, Hua-Ping; Wang, Yan-Zhong; Li, Gui-Ling; Yu, Hai-Tao; Xie, Xin-You

    2013-11-01

    The causes of meningiomas are not well understood. Folate metabolism gene polymorphisms have been shown to be associated with various human cancers. It is still controversial and ambiguous between the functional polymorphisms of folate metabolism genes 5,10-methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTRR), and methionine synthase reductase (MTR) and risk of adult meningioma. A population-based case–control study involving 600 meningioma patients (World Health Organization [WHO] Grade I, 391 cases; WHO Grade II, 167 cases; WHO Grade III, 42 cases) and 600 controls was done for the MTHFR C677T and A1298C, MTRR A66G, and MTR A2756G variants in Chinese Han population. The folate metabolism gene polymorphisms were determined by using a polymerase chain reaction–restriction fragment length polymorphism assay. Meningioma cases had a significantly lower frequency of MTHFR 677 TT genotype [odds ratio (OR) = 0.49, 95 % confidence interval (CI) 0.33–0.74; P = 0.001] and T allele (OR = 0.80, 95 % CI 0.67–0.95; P = 0.01) than controls. A significant association between risk of meningioma and MTRR 66 GG (OR = 1.41, 95 % CI 1.02–1.96; P = 0.04) was also observed. When stratifying by the WHO grade of meningioma, no association was found. Our study suggested that MTHFR C677T and MTRR A66G variants may affect the risk of adult meningioma in Chinese Han population.

  15. Riboflavin accumulation and characterization of cDNAs encoding lumazine synthase and riboflavin synthase in bitter melon (Momordica charantia).

    Science.gov (United States)

    Tuan, Pham Anh; Kim, Jae Kwang; Lee, Sanghyun; Chae, Soo Cheon; Park, Sang Un

    2012-12-05

    Riboflavin (vitamin B2) is the universal precursor of the coenzymes flavin mononucleotide and flavin adenine dinucleotide--cofactors that are essential for the activity of a wide variety of metabolic enzymes in animals, plants, and microbes. Using the RACE PCR approach, cDNAs encoding lumazine synthase (McLS) and riboflavin synthase (McRS), which catalyze the last two steps in the riboflavin biosynthetic pathway, were cloned from bitter melon (Momordica charantia), a popular vegetable crop in Asia. Amino acid sequence alignments indicated that McLS and McRS share high sequence identity with other orthologous genes and carry an N-terminal extension, which is reported to be a plastid-targeting sequence. Organ expression analysis using quantitative real-time RT PCR showed that McLS and McRS were constitutively expressed in M. charantia, with the strongest expression levels observed during the last stage of fruit ripening (stage 6). This correlated with the highest level of riboflavin content, which was detected during ripening stage 6 by HPLC analysis. McLS and McRS were highly expressed in the young leaves and flowers, whereas roots exhibited the highest accumulation of riboflavin. The cloning and characterization of McLS and McRS from M. charantia may aid the metabolic engineering of vitamin B2 in crops.

  16. Fusion of farnesyldiphosphate synthase and epi-aristolochene synthase, a sesquiterpene cyclase involved in capsidiol biosynthesis in Nicotiana tabacum.

    Science.gov (United States)

    Brodelius, Maria; Lundgren, Anneli; Mercke, Per; Brodelius, Peter E

    2002-07-01

    A clone encoding farnesyl diphosphate synthase (FPPS) was obtained by PCR from a cDNA library made from young leaves of Artemisia annua. A cDNA clone encoding the tobacco epi-aristolochene synthase (eAS) was kindly supplied by J. Chappell (University of Kentucky, Lexington, KY, USA). Two fusions were constructed, i.e. FPPS/eAS and eAS/FPPS. The stop codon of the N-terminal enzyme was removed and replaced by a short peptide (Gly-Ser-Gly) to introduce a linker between the two ORFs. These two fusions and the two single cDNA clones were separately introduced into a bacterial expression vector (pET32). Escherichia coli was transformed with the expression vectors and enzymatically active soluble proteins were obtained after induction with isopropyl thio-beta-d-thiogalactoside. The recombinant enzymes were purified using immobilized metal affinity chromatography on Co2+ columns. The fusion enzymes produced epi-aristolochene from isopentenyl diphosphate through a coupled reaction. The Km values of FPPS and eAS for isopentenyl diphosphate and farnesyl diphosphate, respectively, were essentially the same for the single and fused enzymes. The bifunctional enzymes showed a more efficient conversion of isopentenyl diphosphate to epi-aristolochene than the corresponding amount of single enzymes.

  17. Expression, crystallization and structure elucidation of γ-terpinene synthase from Thymus vulgaris.

    Science.gov (United States)

    Rudolph, Kristin; Parthier, Christoph; Egerer-Sieber, Claudia; Geiger, Daniel; Muller, Yves A; Kreis, Wolfgang; Müller-Uri, Frieder

    2016-01-01

    The biosynthesis of γ-terpinene, a precursor of the phenolic isomers thymol and carvacrol found in the essential oil from Thymus sp., is attributed to the activitiy of γ-terpinene synthase (TPS). Purified γ-terpinene synthase from T. vulgaris (TvTPS), the Thymus species that is the most widely spread and of the greatest economical importance, is able to catalyze the enzymatic conversion of geranyl diphosphate (GPP) to γ-terpinene. The crystal structure of recombinantly expressed and purified TvTPS is reported at 1.65 Å resolution, confirming the dimeric structure of the enzyme. The putative active site of TvTPS is deduced from its pronounced structural similarity to enzymes from other species of the Lamiaceae family involved in terpenoid biosynthesis: to (+)-bornyl diphosphate synthase and 1,8-cineole synthase from Salvia sp. and to (4S)-limonene synthase from Mentha spicata.

  18. ATP synthase from slow and fast growing mycobacteria is active in ATP synthesis and blocked in ATP hydrolysis direction.

    NARCIS (Netherlands)

    Haagsma, A.C.; Driessen, N.N.; Hahn, M.M.; Lill, H.; Bald, D.

    2010-01-01

    ATP synthase is a validated drug target for the treatment of tuberculosis, and ATP synthase inhibitors are promising candidate drugs for the treatment of infections caused by other slow-growing mycobacteria, such as Mycobacterium leprae and Mycobacterium ulcerans. ATP synthase is an essential enzyme

  19. ATP synthase in slow- and fast-growing mycobacteria is active in ATP synthesis and blocked in ATP hydrolysis direction.

    NARCIS (Netherlands)

    Haagsma, A.C.; Driessen, N.N.; Hahn, M.M.; Lill, H.; Bald, D.

    2010-01-01

    ATP synthase is a validated drug target for the treatment of tuberculosis, and ATP synthase inhibitors are promising candidate drugs for the treatment of infections caused by other slow-growing mycobacteria, such as Mycobacterium leprae and Mycobacterium ulcerans. ATP synthase is an essential enzyme

  20. Cloning and heterologous expression of a novel subgroup of class IV polyhydroxyalkanoate synthase genes from the genus Bacillus.

    Science.gov (United States)

    Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T

    2017-01-01

    Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.

  1. Accurate prediction of secondary metabolite gene clusters in filamentous fungi

    DEFF Research Database (Denmark)

    Andersen, Mikael Rørdam; Nielsen, Jakob Blæsbjerg; Klitgaard, Andreas

    2013-01-01

    supporting enzymes for key synthases one cluster at a time. In this study, we design and apply a DNA expression array for Aspergillus nidulans in combination with legacy data to form a comprehensive gene expression compendium. We apply a guilt-by-association-based analysis to predict the extent...

  2. Illuminating the diversity of aromatic polyketide synthases in Aspergillus nidulans.

    Science.gov (United States)

    Ahuja, Manmeet; Chiang, Yi-Ming; Chang, Shu-Lin; Praseuth, Mike B; Entwistle, Ruth; Sanchez, James F; Lo, Hsien-Chun; Yeh, Hsu-Hua; Oakley, Berl R; Wang, Clay C C

    2012-05-16

    Genome sequencing has revealed that fungi have the ability to synthesize many more natural products (NPs) than are currently known, but methods for obtaining suitable expression of NPs have been inadequate. We have developed a successful strategy that bypasses normal regulatory mechanisms. By efficient gene targeting, we have replaced, en masse, the promoters of nonreducing polyketide synthase (NR-PKS) genes, key genes in NP biosynthetic pathways, and other genes necessary for NR-PKS product formation or release. This has allowed us to determine the products of eight NR-PKSs of Aspergillus nidulans, including seven novel compounds, as well as the NR-PKS genes required for the synthesis of the toxins alternariol (8) and cichorine (19).

  3. Tryptophan Synthase Uses an Atypical Mechanism To Achieve Substrate Specificity.

    Science.gov (United States)

    Buller, Andrew R; van Roye, Paul; Murciano-Calles, Javier; Arnold, Frances H

    2016-12-27

    Tryptophan synthase (TrpS) catalyzes the final steps in the biosynthesis of l-tryptophan from l-serine (Ser) and indole-3-glycerol phosphate (IGP). We report that native TrpS can also catalyze a productive reaction with l-threonine (Thr), leading to (2S,3S)-β-methyltryptophan. Surprisingly, β-substitution occurs in vitro with a 3.4-fold higher catalytic efficiency for Ser over Thr using saturating indole, despite a >82000-fold preference for Ser in direct competition using IGP. Structural data identify a novel product binding site, and kinetic experiments clarify the atypical mechanism of specificity: Thr binds efficiently but decreases the affinity for indole and disrupts the allosteric signaling that regulates the catalytic cycle.

  4. Catalysis and Sulfa Drug Resistance in Dihydropteroate Synthase

    Energy Technology Data Exchange (ETDEWEB)

    Yun, Mi-Kyung; Wu, Yinan; Li, Zhenmei; Zhao, Ying; Waddell, M. Brett; Ferreira, Antonio M.; Lee, Richard E.; Bashford, Donald; White, Stephen W. (SJCH)

    2013-04-08

    The sulfonamide antibiotics inhibit dihydropteroate synthase (DHPS), a key enzyme in the folate pathway of bacteria and primitive eukaryotes. However, resistance mutations have severely compromised the usefulness of these drugs. We report structural, computational, and mutagenesis studies on the catalytic and resistance mechanisms of DHPS. By performing the enzyme-catalyzed reaction in crystalline DHPS, we have structurally characterized key intermediates along the reaction pathway. Results support an S{sub N}1 reaction mechanism via formation of a novel cationic pterin intermediate. We also show that two conserved loops generate a substructure during catalysis that creates a specific binding pocket for p-aminobenzoic acid, one of the two DHPS substrates. This substructure, together with the pterin-binding pocket, explains the roles of the conserved active-site residues and reveals how sulfonamide resistance arises.

  5. Atomic model for the dimeric FOregion of mitochondrial ATP synthase.

    Science.gov (United States)

    Guo, Hui; Bueler, Stephanie A; Rubinstein, John L

    2017-11-17

    Mitochondrial adenosine triphosphate (ATP) synthase produces the majority of ATP in eukaryotic cells, and its dimerization is necessary to create the inner membrane folds, or cristae, characteristic of mitochondria. Proton translocation through the membrane-embedded F O region turns the rotor that drives ATP synthesis in the soluble F 1 region. Although crystal structures of the F 1 region have illustrated how this rotation leads to ATP synthesis, understanding how proton translocation produces the rotation has been impeded by the lack of an experimental atomic model for the F O region. Using cryo-electron microscopy, we determined the structure of the dimeric F O complex from Saccharomyces cerevisiae at a resolution of 3.6 angstroms. The structure clarifies how the protons travel through the complex, how the complex dimerizes, and how the dimers bend the membrane to produce cristae. Copyright © 2017, American Association for the Advancement of Science.

  6. Plant diterpene synthases: exploring modularity and metabolic diversity for bioengineering.

    Science.gov (United States)

    Zerbe, Philipp; Bohlmann, Jörg

    2015-07-01

    Plants produce thousands of diterpenoid natural products; some of which are of significant industrial value as biobased pharmaceuticals (taxol), fragrances (sclareol), food additives (steviosides), and commodity chemicals (diterpene resin acids). In nature, diterpene synthase (diTPS) enzymes are essential for generating diverse diterpene hydrocarbon scaffolds. While some diTPSs also form oxygenated compounds, more commonly, oxygenation is achieved by cytochrome P450-dependent mono-oxygenases. Recent genome-, transcriptome-, and metabolome-guided gene discovery and enzyme characterization identified novel diTPS functions that form the core of complex modular pathway systems. Insights into diterpene metabolism may translate into the development of new bioengineered microbial and plant-based production systems. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Two Cycloartenol Synthases for Phytosterol Biosynthesis in Polygala tenuifolia Willd

    Directory of Open Access Journals (Sweden)

    Mei Lan Jin

    2017-11-01

    Full Text Available Oxidosqualene cyclases (OSCs are enzymes that play a key role in control of the biosynthesis of phytosterols and triterpene saponins. In order to uncover OSC genes from Polygala tenuifolia seedlings induced by methyl jasmonate (MeJA, RNA-sequencing analysis was performed using the Illumina sequencing platform. A total of 148,488,632 high-quality reads from two samples (control and the MeJA treated were generated. We screened genes related to phytosterol and triterpene saponin biosynthesis and analyzed the transcriptional changes of differentially expressed unigene (DEUG values calculated by fragments per kilobase million (FPKM. In our datasets, two full-length cDNAs of putative OSC genes, PtCAS1, and PtCAS2, were found, in addition to the PtBS (β-amyrin synthase gene reported in our previous studies and the two cycloartenol synthase genes of P. tenuifolia. All genes were isolated and characterized in yeast cells. The functional expression of the two PtCAS genes in yeast cells showed that the genes all produce a cycloartenol as the sole product. When qRT-PCR analysis from different tissues was performed, the expressions of PtCAS1 and PtCAS2 were highest in flowers and roots, respectively. After MeJA treatment, the transcripts of PtCAS1 and PtCAS2 genes increased by 1.5- and 2-fold, respectively. Given these results, we discuss the potential roles of the two PtCAS genes in relation to triterpenoid biosynthesis.

  8. Glycogen Synthase in Sertoli Cells: More Than Glycogenesis?

    Science.gov (United States)

    Maldonado, Rodrigo; Mancilla, Héctor; Villarroel-Espíndola, Franz; Slebe, Felipe; Slebe, Juan Carlos; Méndez, Raúl; Guinovart, Joan J; Concha, Ilona I

    2016-11-01

    Sertoli cell metabolism actively maintains the nutritional needs of germ cells. It has been described that after glucose incorporation in Sertoli cells, less than 1% is converted to glycogen suggesting low levels of glycogen synthase activity. Phosphorylation of muscle glycogen synthase (MGS) at serine 640 (pS640MGS) decreases its activity, and this form of the enzyme was discovered as a non-ribosomal protein that modulates the translation of a subset of transcripts in HeLa cells. The aim of our study was to functionally characterize MGS in cultured Sertoli cells, as well as to explore this new feature related to RNA molecules. We detected MGS in the cytoplasm of Sertoli cells as well as in the nuclei. The activity rates of the enzyme were extremely low indicating that MGS is expressed but almost inactive. Protein targeting to glycogen (PTG) overexpression was performed to activate MGS by dephosphorylation. PTG induced glycogen synthesis massively, confirming that this enzyme is present but inactive. This finding correlates with high levels of pS640MGS, which were assayed by phosphatase treatment. To explore a putative new function for MGS in Sertoli cells, we performed RNA immunoprecipitation coupled to microarray studies. The results revealed that MGS co-immunoprecipitated with the several mRNAs and also rRNAs. These findings indicate that MGS is expressed Sertoli cells but in an inactive form, and also support a possibly novel feature of this metabolic enzyme associated with RNA-related molecules. J. Cell. Biochem. 117: 2597-2607, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  9. Intestinal nitric oxide synthase activity changes during experimental colon obstruction.

    Science.gov (United States)

    Palásthy, Zsolt; Kaszaki, József; Lázár, György; Nagy, Sándor; Boros, Mihály

    2006-08-01

    The experiments in this study were designed to follow the time course of nitric oxide (NO) synthesis in the large bowel during acute mechanical ileus. Occlusion of the mid-transverse colon was maintained for 420 min in anesthetized dogs. Strain-gauge transducers were used to analyze motility changes on the hepatic and lienal flexures, respectively. Constitutive NO synthase (cNOS) and inducible NOS (iNOS) activities were determined in tissue biopsies, and plasma nitrite/nitrate (NOx) level was measured in the portal blood. Following completion of the baseline studies, the animals were treated with either 7-nitroindazole (7-NI, selective neuronal NOS inhibitor), or N-nitro-L-arginine (NNA, non-selective NOS inhibitor). In the sham-operated group the cNOS activities differed significantly in the oral and aboral tissue samples (oral: 102.9; versus aboral: 62.1 fmol/mg protein/min). The obstruction elicited a significant increase in portal NOx and elevated tissue inducible NO synthase (iNOS) activity. NNA treatment decreased the motility index in both intestinal segments for 60 min, but 120 min later the motility index was significantly elevated (2.5-fold increase in the oral part, and 1.8-fold enhancement in the aboral segment, respectively). Treatment with 7-NI decreased the cNOS activity in the oral and aboral parts by approximately 40% and 70%, respectively, and suppressed the motility increase in the aboral colon segment. The motility of the colon was either significantly increased or decreased, depending on the type and selectivity of the NOS inhibitor compounds applied. NO of neuronal origin is a transmitter that stimulates peristaltic activity; but an increased iNOS/nNOS ratio significantly moderates the obstruction-induced motility increase.

  10. Influence of thymidylate synthase expression on survival in patients with colorectal cancer

    Directory of Open Access Journals (Sweden)

    Kinjal K Gajjar

    2017-01-01

    Full Text Available Background: Thymidylate synthase (TS plays a critical role in nucleotide metabolism and is an important target for 5-fluorouracil (5-FU, the standard chemotherapeutic drug for treatment of colorectal cancer (CRC. Aims and Methods: The present study aimed to evaluate TS variable number tandem repeat sequences (VNTR polymorphism by polymerase chain reaction and TS protein expression by immunohistochemistry and its association with clinicopathological parameters in untreated CRC patients (n = 100. Further, the prognostic and predictive role of TS has been evaluated. Results: For TS VNTR polymorphism, the observed frequencies of 2R/2R, 2R/3R, and 3R/3R genotypes were 22%, 51%, and 27%, respectively. When immunohistochemical localization was studied, cytoplasmic staining for TS was observed in 70% of patients. A significant inverse correlation was noted between TS protein expression and tumor, node, metastasis staging (P = 0.027, Dukes' staging (P = 0.039, and lymph node status (P = 0.012 of CRC patients. However, there was no significant correlation between TS VNTR polymorphism and TS protein expression. On survival analysis, a significantly shorter overall survival (OS was seen in CRC patients with negative protein expression (P = 0.031. Moreover, the subgroup of CRC patients treated only with surgery also showed a trend of poor OS in patients with negative TS protein expression (P = 0.058. However, neither TS polymorphism nor its protein expression was able to predict relapse-free survival. Conclusion: Negative TS protein expression may be related to unfavorable clinical outcome in CRC patients. However, further studies in a larger set of patients are necessary to better assess TS as a prognostic and predictive marker for 5-FU response in CRC patients.

  11. Binding and Inhibition of Spermidine Synthase from Plasmodium falciparum and Implications for In Vitro Inhibitor Testing.

    Directory of Open Access Journals (Sweden)

    Janina Sprenger

    Full Text Available The aminopropyltransferase spermidine synthase (SpdS is a promising drug target in cancer and in protozoan diseases including malaria. Plasmodium falciparum SpdS (PfSpdS transfers the aminopropyl group of decarboxylated S-adenosylmethionine (dcAdoMet to putrescine or to spermidine to form spermidine or spermine, respectively. In an effort to understand why efficient inhibitors of PfSpdS have been elusive, the present study uses enzyme activity assays and isothermal titration calorimetry with verified or predicted inhibitors of PfSpdS to analyze the relationship between binding affinity as assessed by KD and inhibitory activity as assessed by IC50. The results show that some predicted inhibitors bind to the enzyme with high affinity but are poor inhibitors. Binding studies with PfSpdS substrates and products strongly support an ordered sequential mechanism in which the aminopropyl donor (dcAdoMet site must be occupied before the aminopropyl acceptor (putrescine site can be occupied. Analysis of the results also shows that the ordered sequential mechanism adequately accounts for the complex relationship between IC50 and KD and may explain the limited success of previous efforts at structure-based inhibitor design for PfSpdS. Based on PfSpdS active-site occupancy, we suggest a classification of ligands that can help to predict the KD-IC50 relations in future design of new inhibitors. The present findings may be relevant for other drug targets that follow an ordered sequential mechanism.

  12. Characterization of a chalcone synthase (CHS) flower-specific promoter from Lilium orential 'Sorbonne'.

    Science.gov (United States)

    Liu, Yali; Lou, Qian; Xu, Weirong; Xin, Yi; Bassett, Carole; Wang, Yuejin

    2011-12-01

    The first enzyme in the flavonoid pathway, chalcone synthase, is encoded by a gene (CHS) whose expression is normally under developmental control. In our previous studies, an 896-bp promoter region of a flower-specific CHS gene was isolated from Lilium orential 'Sorbonne', and designated as PLoCHS. Here, the PLoCHS promoter was fused to the β-glucuronidase (GUS) gene to characterize its spatial and temporal expression in Petunia hybrida 'Dreams Midnight' using an Agrobacterium-mediated leaf disc transformation method. Our results demonstrated that GUS expression was present in flowers, but reduced or absent in the other tissues (leaf and stem) examined. In petals, GUS activity reached its peak at flower developmental stage 4, and decreased at later stages. Deletion analysis indicated that even a 307-bp fragment of the PLoCHS promoter could still direct flower-specific expression. Further deletion of the region from -261 to -72 bp resulted in weak expression in different organs, including flowers, leaves and stems. This evidence combined with prediction of cis-acting elements in the PLoCHS promoter suggests that the TACPyAT box located in this promoter plays a key role in the regulation of organ-specific expression.

  13. Isolation of 1-aminocyclopropane-1-carboxylate synthase gene from Oncidium Gower Ramsey.

    Science.gov (United States)

    Yang, G H; Liu, J P

    2014-10-20

    A full-length cDNA of a 1-aminocyclopropane-1-carboxylate synthase (ACS) family member from Oncidium, named OnACS1 (GenBank accession No. JQ822087) was cloned and characterized by reverse transcription polymerase chain reaction and rapid amplification of cDNA ends technology. The full-length cDNA was 1586 bp, including a 1308-bp open reading frame, a 105-bp 5' untranslated region (UTR), and 173-bp 3' UTR, encoding 436 amino acids. The deduced amino acid sequence of OnACS1 shares 85, 84, and 83% homology with ACS proteins of Cattleya bicolor, Dendrobium crumenatum, and Phalaenopsis hybrid, respectively. Prokaryotic expression and sodium dodecyl sulfate polyacrylamide gel electrophoresis showed that a specific band was produced and was consistent with the predicted protein size. A tissue-specific manner of OnACS1 expression was observed, and it was predominantly expressed in the gynostemium. The OnACS1 expression in the sepals and gynandria was upregulated by 1% ethephon treatment.

  14. Evolution of the key alkaloid enzyme putrescine N-methyltransferase from spermidine synthase

    Science.gov (United States)

    Junker, Anne; Fischer, Juliane; Sichhart, Yvonne; Brandt, Wolfgang; Dräger, Birgit

    2013-01-01

    Putrescine N-methyltransferases (PMTs) are the first specific enzymes of the biosynthesis of nicotine and tropane alkaloids. PMTs transfer a methyl group onto the diamine putrescine from S-adenosyl-l-methionine (SAM) as coenzyme. PMT proteins have presumably evolved from spermidine synthases (SPDSs), which are ubiquitous enzymes of polyamine metabolism. SPDSs use decarboxylated SAM as coenzyme to transfer an aminopropyl group onto putrescine. In an attempt to identify possible and necessary steps in the evolution of PMT from SPDS, homology based modeling of Datura stramonium SPDS1 and PMT was employed to gain deeper insight in the preferred binding positions and conformations of the substrate and the alternative coenzymes. Based on predictions of amino acids responsible for the change of enzyme specificities, sites of mutagenesis were derived. PMT activity was generated in D. stramonium SPDS1 after few amino acid exchanges. Concordantly, Arabidopsis thaliana SPDS1 was mutated and yielded enzymes with both, PMT and SPDS activities. Kinetic parameters were measured for enzymatic characterization. The switch from aminopropyl to methyl transfer depends on conformational changes of the methionine part of the coenzyme in the binding cavity of the enzyme. The rapid generation of PMT activity in SPDS proteins and the wide-spread occurrence of putative products of N-methylputrescine suggest that PMT activity is present frequently in the plant kingdom. PMID:23908659

  15. Evolution of the key alkaloid enzyme putrescine N-methyltransferase from spermidine synthase.

    Directory of Open Access Journals (Sweden)

    Anne eJunker

    2013-07-01

    Full Text Available Putrescine N-methyltransferases (PMTs are the first specific enzymes of the biosynthesis of nicotine and tropane alkaloids. PMTs transfer a methyl group onto the diamine putrescine from S-adenosyl-L-methionine (SAM as coenzyme. PMT proteins have presumably evolved from spermidine synthases (SPDSs, which are ubiquitous enzymes of polyamine metabolism. SPDS use decarboxylated SAM as coenzyme to transfer an aminopropyl group onto putrescine. In an attempt to identify possible and necessary steps in the evolution of PMT from SPDS, homology based modeling of Datura stramonium SPDS1 and PMT was employed to gain deeper insight in the preferred binding positions and conformations of the substrate and the alternative coenzymes. Based on predictions of amino acids responsible for the change of enzyme specificities, sites of mutagenesis were derived. PMT activity was generated in Datura stramonium SPDS1 after few amino acid exchanges. Concordantly, Arabidopsis thaliana SPDS1 was mutated and yielded enzymes with both, PMT and SPDS activities. Kinetic parameters were measured for enzymatic characterization. The switch from aminopropyl to methyl transfer depends on conformational changes of the methionine part of the coenzyme in the binding cavity of the enzyme. The rapid generation of PMT activity in SPDS proteins and the wide-spread occurrence of putative products of N-methylputrescine suggest that PMT activity is present frequently in the plant kingdom.

  16. A photocrosslinking assay for reporting protein interactions in polyketide and fatty acid synthases.

    Science.gov (United States)

    Ye, Zhixia; Bair, Morgan; Desai, Hemant; Williams, Gavin J

    2011-11-01

    Understanding protein-protein interactions that occur between ACP and KS domains of polyketide synthases and fatty acid synthases is critical to improving the scope and efficiency of combinatorial biosynthesis efforts aimed at producing non-natural polyketides. Here, we report a facile strategy for rapidly reporting such ACP-KS interactions based on the incorporation of an amino acid with photocrosslinking functionality. Crucially, this photocrosslinking strategy can be applied to any polyketide or fatty acid synthase regardless of substrate specificity, and can be adapted to a high-throughput format for directed evolution studies. This journal is © The Royal Society of Chemistry 2011

  17. Microsatellite instability and the association with plasma homocysteine and thymidylate synthase in colorectal cancer

    DEFF Research Database (Denmark)

    Jensen, Lars Henrik; Lindebjerg, Jan; Crüger, Dorthe G.

    2008-01-01

    The possible associations between microsatellite instability, homocysteine and thymidylate synthase were investigated in tumors and plasma from 130 patients with colorectal cancer. Other analyses included thymidylate synthase and 5,10-methylene-tetrahydrofolate reductase gene polymorphisms......, carcinoembryonic antigen, vitamin B12, and folate. Microsatellite instability of tumors was associated with higher levels of plasma homocysteine (p = 0.008) and higher protein expression of thymidylate synthase (p ... factors. CEA was not associated with neither homocysteine nor microsatellite instability. The data suggests that there is a more pronounced methyl unit deficiency in microsatellite instable tumors....

  18. Functional identification of valerena-1,10-diene synthase, a terpene synthase catalyzing a unique chemical cascade in the biosynthesis of biologically active sesquiterpenes in Valeriana officinalis.

    Science.gov (United States)

    Yeo, Yun-Soo; Nybo, S Eric; Chittiboyina, Amar G; Weerasooriya, Aruna D; Wang, Yan-Hong; Góngora-Castillo, Elsa; Vaillancourt, Brieanne; Buell, C Robin; DellaPenna, Dean; Celiz, Mary Dawn; Jones, A Daniel; Wurtele, Eve Syrkin; Ransom, Nick; Dudareva, Natalia; Shaaban, Khaled A; Tibrewal, Nidhi; Chandra, Suman; Smillie, Troy; Khan, Ikhlas A; Coates, Robert M; Watt, David S; Chappell, Joe

    2013-02-01

    Valerian is an herbal preparation from the roots of Valeriana officinalis used as an anxiolytic and sedative and in the treatment of insomnia. The biological activities of valerian are attributed to valerenic acid and its putative biosynthetic precursor valerenadiene, sesquiterpenes, found in V. officinalis roots. These sesquiterpenes retain an isobutenyl side chain whose origin has been long recognized as enigmatic because a chemical rationalization for their biosynthesis has not been obvious. Using recently developed metabolomic and transcriptomic resources, we identified seven V. officinalis terpene synthase genes (VoTPSs), two that were functionally characterized as monoterpene synthases and three that preferred farnesyl diphosphate, the substrate for sesquiterpene synthases. The reaction products for two of the sesquiterpene synthases exhibiting root-specific expression were characterized by a combination of GC-MS and NMR in comparison to the terpenes accumulating in planta. VoTPS7 encodes for a synthase that biosynthesizes predominately germacrene C, whereas VoTPS1 catalyzes the conversion of farnesyl diphosphate to valerena-1,10-diene. Using a yeast expression system, specific labeled [(13)C]acetate, and NMR, we investigated the catalytic mechanism for VoTPS1 and provide evidence for the involvement of a caryophyllenyl carbocation, a cyclobutyl intermediate, in the biosynthesis of valerena-1,10-diene. We suggest a similar mechanism for the biosynthesis of several other biologically related isobutenyl-containing sesquiterpenes.

  19. Functional Identification of Valerena-1,10-diene Synthase, a Terpene Synthase Catalyzing a Unique Chemical Cascade in the Biosynthesis of Biologically Active Sesquiterpenes in Valeriana officinalis*

    Science.gov (United States)

    Yeo, Yun-Soo; Nybo, S. Eric; Chittiboyina, Amar G.; Weerasooriya, Aruna D.; Wang, Yan-Hong; Góngora-Castillo, Elsa; Vaillancourt, Brieanne; Buell, C. Robin; DellaPenna, Dean; Celiz, Mary Dawn; Jones, A. Daniel; Wurtele, Eve Syrkin; Ransom, Nick; Dudareva, Natalia; Shaaban, Khaled A.; Tibrewal, Nidhi; Chandra, Suman; Smillie, Troy; Khan, Ikhlas A.; Coates, Robert M.; Watt, David S.; Chappell, Joe

    2013-01-01

    Valerian is an herbal preparation from the roots of Valeriana officinalis used as an anxiolytic and sedative and in the treatment of insomnia. The biological activities of valerian are attributed to valerenic acid and its putative biosynthetic precursor valerenadiene, sesquiterpenes, found in V. officinalis roots. These sesquiterpenes retain an isobutenyl side chain whose origin has been long recognized as enigmatic because a chemical rationalization for their biosynthesis has not been obvious. Using recently developed metabolomic and transcriptomic resources, we identified seven V. officinalis terpene synthase genes (VoTPSs), two that were functionally characterized as monoterpene synthases and three that preferred farnesyl diphosphate, the substrate for sesquiterpene synthases. The reaction products for two of the sesquiterpene synthases exhibiting root-specific expression were characterized by a combination of GC-MS and NMR in comparison to the terpenes accumulating in planta. VoTPS7 encodes for a synthase that biosynthesizes predominately germacrene C, whereas VoTPS1 catalyzes the conversion of farnesyl diphosphate to valerena-1,10-diene. Using a yeast expression system, specific labeled [13C]acetate, and NMR, we investigated the catalytic mechanism for VoTPS1 and provide evidence for the involvement of a caryophyllenyl carbocation, a cyclobutyl intermediate, in the biosynthesis of valerena-1,10-diene. We suggest a similar mechanism for the biosynthesis of several other biologically related isobutenyl-containing sesquiterpenes. PMID:23243312

  20. Effects of point mutations in Plasmodium falciparum dihydrofolate reductase and dihydropterate synthase genes on clinical outcomes and in vitro susceptibility to sulfadoxine and pyrimethamine.

    Directory of Open Access Journals (Sweden)

    David J Bacon

    2009-08-01

    Full Text Available Sulfadoxine-pyrimethamine was a common first line drug therapy to treat uncomplicated falciparum malaria, but increasing therapeutic failures associated with the development of significant levels of resistance worldwide has prompted change to alternative treatment regimes in many national malaria control programs. METHODOLOGY AND FINDING: We conducted an in vivo therapeutic efficacy trial of sulfadoxine-pyrimethamine at two locations in the Peruvian Amazon enrolling 99 patients of which, 86 patients completed the protocol specified 28 day follow up. Our objective was to correlate the presence of polymorphisms in P. falciparum dihydrofolate reductase and dihydropteroate synthase to in vitro parasite susceptibility to sulfadoxine and pyrimethamine and to in vivo treatment outcomes. Inhibitory concentration 50 values of isolates increased with numbers of mutations (single [108N], sextuplet [BR/51I/108N/164L and 437G/581G] and septuplet (BR/51I/108N/164L and 437G/540E/581G with geometric means of 76 nM (35-166 nM, 582 nM (49-6890- nM and 4909 (3575-6741 nM nM for sulfadoxine and 33 nM (22-51 nM, 81 nM (19-345 nM, and 215 nM (176-262 nM for pyrimethamine. A single mutation present in the isolate obtained at the time of enrollment from either dihydrofolate reductase (164L or dihydropteroate synthase (540E predicted treatment failure as well as any other single gene alone or in combination. Patients with the dihydrofolate reductase 164L mutation were 3.6 times as likely to be treatment failures [failures 85.4% (164L vs 23.7% (I164; relative risk = 3.61; 95% CI: 2.14 - 6.64] while patients with the dihydropteroate synthase 540E were 2.6 times as likely to fail treatment (96.7% (540E vs 37.5% (K540; relative risk = 2.58; 95% CI: 1.88 - 3.73. Patients with both dihydrofolate reductase 164L and dihydropteroate synthase 540E mutations were 4.1 times as likely to be treatment failures [96.7% vs 23.7%; RR = 4.08; 95% CI: 2.45 - 7.46] compared to patients

  1. Thymidylate synthase protein expression levels remain stable during paclitaxel and carboplatin treatment in non-small cell lung cancer

    DEFF Research Database (Denmark)

    Jakobsen, Jan Nyrop; Santoni-Rugiu, Eric; Sørensen, Jens Benn

    2014-01-01

    BACKGROUND: Thymidylate synthase (TS) is a potential predictive marker for efficacy of treatment with pemetrexed. The current study aimed at investigating whether TS expression changes during non-pemetrexed chemotherapy of non-small cell lung cancer (NSCLC), thus making rebiopsy necessary...... for deciding on pemetrexed second-line treatment. MATERIALS AND METHODS: TS immunohistochemístry was performed on biopsies and available resection specimens from 65 NSCLC patients stage T1-3N0-2 treated with preoperative carboplatin and paclitaxel [neoadjuvant chemotherapy (NAC)-group] and from 53 NSCLC...... in primary tumors remained unchanged, and new biopsies for deciding on second-line pemetrexed does not seem warranted based on the current results....

  2. Engineering Isoprene Synthase Expression and Activity in Cyanobacteria.

    Science.gov (United States)

    Chaves, Julie E; Rueda-Romero, Paloma; Kirst, Henning; Melis, Anastasios

    2017-12-15

    Efforts to heterologously produce quantities of isoprene hydrocarbons (C 5 H 8 ) renewably from CO 2 and H 2 O through the photosynthesis of cyanobacteria face barriers, including low levels of recombinant enzyme accumulation compounded by their slow innate catalytic activity. The present work sought to alleviate the "expression level" barrier upon placing the isoprene synthase (IspS) enzyme in different fusion configurations with the cpcB protein, the highly expressed β-subunit of phycocyanin. Different cpcB*IspS fusion constructs were made, distinguished by the absence or presence of linker amino acids between the two proteins. Composition of linker amino acids was variable with lengths of 7, 10, 16, and 65 amino acids designed to test for optimal activity of the IspS through spatial positioning between the cpcB and IspS. Results showed that fusion constructs with the highly expressed cpcB gene, as the leader sequence, improved transgene expression in the range of 61 to 275-fold over what was measured with the unfused IspS control. However, the specific activity of the IspS enzyme was attenuated in all fusion transformants, possibly because of allosteric effects exerted by the leader cpcB fusion protein. This inhibition varied depending on the nature of the linker amino acids between the cpcB and IspS proteins. In terms of isoprene production, the results further showed a trade-off between specific activity and transgenic enzyme accumulation. For example, the cpcB*L7*IspS strain showed only about 10% the isoprene synthase specific-activity of the unfused cpcB-IspS control, but it accumulated 254-fold more IspS enzyme. The latter more than countered the slower specific activity and made the cpcB*L7*IspS transformant the best isoprene producing strain in this work. Isoprene to biomass yield ratios improved from 0.2 mg g -1 in the unfused cpcB-IspS control to 5.4 mg g -1 in the cpcB*L7*IspS strain, a 27-fold improvement.

  3. Functional Genomics Reveals That a Compact Terpene Synthase Gene Family Can Account for Terpene Volatile Production in Apple1[W

    Science.gov (United States)

    Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.

    2013-01-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  4. Molecular cloning and characterization of drimenol synthase from valerian plant (Valeriana officinalis).

    Science.gov (United States)

    Kwon, Moonhyuk; Cochrane, Stephen A; Vederas, John C; Ro, Dae-Kyun

    2014-12-20

    Drimenol, a sesquiterpene alcohol, and its derivatives display diverse bio-activities in nature. However, a drimenol synthase gene has yet to be identified. We identified a new sesquiterpene synthase cDNA (VoTPS3) in valerian plant (Valeriana officinalis). Purification and NMR analyses of the VoTPS3-produced terpene, and characterization of the VoTPS3 enzyme confirmed that VoTPS3 synthesizes (-)-drimenol. In feeding assays, possible reaction intermediates, farnesol and drimenyl diphosphate, could not be converted to drimenol, suggesting that the intermediate remains tightly bound to VoTPS3 during catalysis. A mechanistic consideration of (-)-drimenol synthesis suggests that drimenol synthase is likely to use a protonation-initiated cyclization, which is rare for sesquiterpene synthases. VoTPS3 can be used to produce (-)-drimenol, from which useful drimane-type terpenes can be synthesized. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  5. Eukaryotic beta-alanine synthases are functionally related but have a high degree of structural diversity

    DEFF Research Database (Denmark)

    Gojkovic, Zoran; Sandrini, Michael; Piskur, Jure

    2001-01-01

    beta -Alanine synthase (EC 3.5.1.6), which catalyzes the final step of pyrimidine catabolism, has only been characterized in mammals. A Saccharomyces kluyveri pyd3 mutant that is unable to grow on N-carbamy-beta -alanine as the sole nitrogen source and exhibits diminished beta -alanine synthase...... no pyrimidine catabolic pathway, it enabled growth on N-carbamyl- beta -alanine as the sole nitrogen source. The D. discoideum and D. melanogaster PYD3 gene products are similar to mammalian beta -alanine synthases. In contrast, the S. kluyveri protein is quite different from these and more similar to bacterial...... N- carbamyl amidohydrolases. All three beta -alanine synthases are to some degree related to various aspartate transcarbamylases, which catalyze the second step of the de novo pyrimidine biosynthetic pathway. PYD3 expression in yeast seems to be inducible by dihydrouracil and N...

  6. Identification of amino acid networks governing catalysis in the closed complex of class I terpene synthases.

    Science.gov (United States)

    Schrepfer, Patrick; Buettner, Alexander; Goerner, Christian; Hertel, Michael; van Rijn, Jeaphianne; Wallrapp, Frank; Eisenreich, Wolfgang; Sieber, Volker; Kourist, Robert; Brück, Thomas

    2016-02-23

    Class I terpene synthases generate the structural core of bioactive terpenoids. Deciphering structure-function relationships in the reactive closed complex and targeted engineering is hampered by highly dynamic carbocation rearrangements during catalysis. Available crystal structures, however, represent the open, catalytically inactive form or harbor nonproductive substrate analogs. Here, we present a catalytically relevant, closed conformation of taxadiene synthase (TXS), the model class I terpene synthase, which simulates the initial catalytic time point. In silico modeling of subsequent catalytic steps allowed unprecedented insights into the dynamic reaction cascades and promiscuity mechanisms of class I terpene synthases. This generally applicable methodology enables the active-site localization of carbocations and demonstrates the presence of an active-site base motif and its dominating role during catalysis. It additionally allowed in silico-designed targeted protein engineering that unlocked the path to alternate monocyclic and bicyclic synthons representing the basis of a myriad of bioactive terpenoids.

  7. SCREENING OF 6-PYRUVOYL-TETRAHYDROPTERIN SYNTHASE ACTIVITY DEFICIENCY AMONG HYPERP HENYLALANINEMIC PATIENTS

    Directory of Open Access Journals (Sweden)

    DURDI QUJEQ

    1999-10-01

    Full Text Available A deficiency of the phenylalanine hydroxylase activity or its cofactor tetrahydrobiopterin may"nlead to hyperphenylalamnemia and as a result, loss of IQ, poor school performance, and"nbehavior problems occurs. Deficiency in 6-pyruvoyl-tetrahydropterin synthase activity is the"nmajor cause of tetrahydrobiopterin deficient phenylketonuria. In this study, blood specimens"nfrom 165 healthy volunteers and 127 children with phenylketonuria were used to determine"nthe 6-pyruvoyl-tetrahydropterin synthase activity. It was found that the activity of 6-"npyruvoyl- tetrahydropterin synthase was decreased in comparison with control [23.46 +/-"n2.94, (mean +/- SD, mmol/ ml/h, n=I27 vs. 127.63 +/- 4.52, n=165, p<0.05]. Results of"nthis study indicate that examination of 6-pyruvoyl-tetrahydropterin synthase activity is helpful"nand may lead to the diagnosis cause of hyperphenylalaninemia.

  8. The Structure of Sucrose Synthase-1 from Arabidopsis thaliana and Its Functional Implications

    Energy Technology Data Exchange (ETDEWEB)

    Zheng, Yi; Anderson, Spencer; Zhang, Yanfeng; Garavito, R. Michael (MSU); (NWU)

    2014-10-02

    Sucrose transport is the central system for the allocation of carbon resources in vascular plants. During growth and development, plants control carbon distribution by coordinating sites of sucrose synthesis and cleavage in different plant organs and different cellular locations. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, provides a direct and reversible means to regulate sucrose flux. Depending on the metabolic environment, sucrose synthase alters its cellular location to participate in cellulose, callose, and starch biosynthesis through its interactions with membranes, organelles, and cytoskeletal actin. The x-ray crystal structure of sucrose synthase isoform 1 from Arabidopsis thaliana (AtSus1) has been determined as a complex with UDP-glucose and as a complex with UDP and fructose, at 2.8- and 2.85-{angstrom} resolutions, respectively. The AtSus1 structure provides insights into sucrose catalysis and cleavage, as well as the regulation of sucrose synthase and its interactions with cellular targets.

  9. A close look at a ketosynthase from a trans-acyltransferase modular polyketide synthase.

    Science.gov (United States)

    Gay, Darren C; Gay, Glen; Axelrod, Abram J; Jenner, Matthew; Kohlhaas, Christoph; Kampa, Annette; Oldham, Neil J; Piel, Jörn; Keatinge-Clay, Adrian T

    2014-03-04

    The recently discovered trans-acyltransferase modular polyketide synthases catalyze the biosynthesis of a wide range of bioactive natural products in bacteria. Here we report the structure of the second ketosynthase from the bacillaene trans-acyltransferase polyketide synthase. This 1.95 Å resolution structure provides the highest resolution view available of a modular polyketide synthase ketosynthase and reveals a flanking subdomain that is homologous to an ordered linker in cis-acyltransferase modular polyketide synthases. The structure of the cysteine-to-serine mutant of the ketosynthase acylated by its natural substrate provides high-resolution details of how a native polyketide intermediate is bound and helps explain the basis of ketosynthase substrate specificity. The substrate range of the ketosynthase was further investigated by mass spectrometry. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Use of heterologous expressed polyketide synthase and small molecule foldases to make aromatic and cyclic compounds

    DEFF Research Database (Denmark)

    2016-01-01

    A method for producing individual or libraries of tri- to pentadecaketide-derived aromatic compounds of interest by heterologous expression of polyketide synthase and aromatase/cyclase in a recombinant host cell.......A method for producing individual or libraries of tri- to pentadecaketide-derived aromatic compounds of interest by heterologous expression of polyketide synthase and aromatase/cyclase in a recombinant host cell....

  11. Characterization of a 1-aminocyclopropane-1-carboxylate synthase gene from loblolly pine (Pinus taeda L.).

    Science.gov (United States)

    Barnes, J R; Lorenz, W W; Dean, J F D

    2008-04-30

    1-Aminocyclopropane-1-carboxylate (ACC) synthase catalyzes what is typically the rate-limiting step in the biosynthesis of ethylene, a gaseous plant growth regulator that plays numerous roles in the growth and development of higher plants. Although ACC synthase genes have been characterized from a wide variety of angiosperm plant species, no ACC synthase genes have been described previously for gymnosperms. Evidence suggests that ethylene helps to regulate wood formation in trees, and may also signal for the metabolic shifts that lead to compression wood formation on the undersides of branches and leaning stems in gymnosperm trees. Since compression wood is an inferior feedstock for the manufacturing of most wood products, a better understanding of the factors influencing its formation could lead to substantial economic benefits. This study describes the isolation and characterization of a putative ACC synthase gene, PtaACS1, from loblolly pine (Pinus taeda L.), an important commercial forest tree species. Also described is an apparent splice variant of PtaACS1 (PtaACS1s) that is missing 138 bp from the 5' end of the transcript, including bases that encode a conserved amino acid residue considered critical for ACC synthase activity. The two sequences share interesting homologies with a group of plant aminotransferases, in addition to ACC synthases, but structural models and the conservation of critical catalytic amino acid residues strongly support PtaACS1 as encoding an active ACC synthase. The two transcripts were differentially expressed in various tissues of loblolly pine, as well as in response to perturbations of pine seedling stems. Transcript levels of this ACC synthase gene increased rapidly in response to bending stress but returned to near starting levels within 30 min. It remains unclear to what extent bending-induced expression of this gene product plays a role in compression wood formation.

  12. A domain swapping approach to elucidate differential regiospecific hydroxylation by geraniol and linalool synthases from perilla.

    Science.gov (United States)

    Sato-Masumoto, Naoko; Ito, Michiho

    2014-06-01

    Geraniol and linalool are acyclic monoterpenes found in plant essential oils that have attracted much attention for their commercial use and in pharmaceutical studies. They are synthesized from geranyl diphosphate (GDP) by geraniol and linalool synthases, respectively. Both synthases are very similar at the amino acid level and share the same substrate; however, the position of the GDP to which they introduce hydroxyl groups is different. In this study, the mechanisms underlying the regiospecific hydroxylation of geraniol and linalool synthases were investigated using a domain swapping approach and site-directed mutagenesis in perilla. Sequences of the synthases were divided into ten domains (domains I to IV-4), and each corresponding domain was exchanged between both enzymes. It was shown that different regions were important for the formation of geraniol and linalool, namely, domains IV-1 and -4 for geraniol, and domains III-b, III-d, and IV-4 for linalool. These results suggested that the conformation of carbocation intermediates and their electron localization were seemingly to be different between geraniol and linalool synthases. Further, five amino acids in domain IV-4 were apparently indispensable for the formation of geraniol and linalool. According to three-dimensional structural models of the synthases, these five residues seemed to be responsible for the different spatial arrangement of the amino acid at H524 in the case of geraniol synthase, while N526 is the corresponding residue in linalool synthase. These results suggested that the side-chains of these five amino acids, in combination with several relevant domains, localized the positive charge in the carbocation intermediate to determine the position of the introduced hydroxyl group. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Use of octaketide synthases to produce kermesic acid and flavokermesic acid

    DEFF Research Database (Denmark)

    2016-01-01

    A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....

  14. Improvement in the quality of hematopoietic prostaglandin D synthase crystals in a microgravity environment

    International Nuclear Information System (INIS)

    Tanaka, Hiroaki; Tsurumura, Toshiharu; Aritake, Kosuke; Furubayashi, Naoki; Takahashi, Sachiko; Yamanaka, Mari; Hirota, Erika; Sano, Satoshi; Sato, Masaru; Kobayashi, Tomoyuki; Tanaka, Tetsuo; Inaka, Koji; Urade, Yoshihiro

    2011-01-01

    Crystals of hematopoietic prostaglandin D synthase grown in microgravity show improved quality. Human hematopoietic prostaglandin synthase, one of the better therapeutic target enzymes for allergy and inflammation, was crystallized with 22 inhibitors and in three inhibitor-free conditions in microgravity. Most of the space-grown crystals showed better X-ray diffraction patterns than the terrestrially grown ones, indicating the advantage of a microgravity environment on protein crystallization, especially in the case of this protein

  15. Bio-based production of fuels and industrial chemicals by repurposing antibiotic-producing type I modular polyketide synthases: opportunities and challenges

    Energy Technology Data Exchange (ETDEWEB)

    Yuzawa, Satoshi [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Biological Systems and Engineering Division; Keasling, Jay D. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Biological Systems and Engineering Division; Univ. of California, Berkeley, CA (United States). QB3 Inst.; Joint BioEnergy Inst. (JBEI), Emeryville, CA (United States); Univ. of California, Berkeley, CA (United States). Dept. of Bioengineering; Univ. of California, Berkeley, CA (United States). Dept. of Chemical and Biomolecular Engineering; Technical Univ. of Denmark, Horsholm (Denmark). Novo Nordisk Foundation Center for Biosustainability; Katz, Leonard [Univ. of California, Berkeley, CA (United States). QB3 Inst.

    2016-11-16

    Complex polyketides comprise a large number of natural products that have broad application in medicine and agriculture. They are produced in bacteria and fungi from large enzyme complexes named type I modular polyketide synthases (PKSs) that are composed of multifunctional polypeptides containing discrete enzymatic domains organized into modules. The modular nature of PKSs has enabled a multitude of efforts to engineer the PKS genes to produce novel polyketides of predicted structure. Finally, we have repurposed PKSs to produce a number of short-chain mono- and di-carboxylic acids and ketones that could have applications as fuels or industrial chemicals.

  16. Bio-based production of fuels and industrial chemicals by repurposing antibiotic-producing type I modular polyketide synthases: opportunities and challenges.

    Science.gov (United States)

    Yuzawa, Satoshi; Keasling, Jay D; Katz, Leonard

    2017-04-01

    Complex polyketides comprise a large number of natural products that have broad application in medicine and agriculture. They are produced in bacteria and fungi from large enzyme complexes named type I modular polyketide synthases (PKSs) that are composed of multifunctional polypeptides containing discrete enzymatic domains organized into modules. The modular nature of PKSs has enabled a multitude of efforts to engineer the PKS genes to produce novel polyketides of predicted structure. We have repurposed PKSs to produce a number of short-chain mono- and di-carboxylic acids and ketones that could have applications as fuels or industrial chemicals.

  17. Bio-based production of fuels and industrial chemicals by repurposing antibiotic-producing type I modular polyketide synthases: opportunities and challenges

    DEFF Research Database (Denmark)

    Yuzawa, Satoshi; Keasling, Jay D.; Katz, Leonard

    2017-01-01

    Complex polyketides comprise a large number of natural products that have broad application in medicine and agriculture. They are produced in bacteria and fungi from large enzyme complexes named type I modular polyketide synthases (PKSs) that are composed of multifunctional polypeptides containing...... discrete enzymatic domains organized into modules. The modular nature of PKSs has enabled a multitude of efforts to engineer the PKS genes to produce novel polyketides of predicted structure. We have repurposed PKSs to produce a number of short-chain mono- and di-carboxylic acids and ketones that could...

  18. Comparative study of Chalcone synthase promoters across plant families

    Directory of Open Access Journals (Sweden)

    Francisco Buitrago

    2009-07-01

    Full Text Available En la era post-genómica, el entendimiento de la regulación génica se ha convertido en un reto y una prioridad de investigación. En este trabajo realizamos un estudio comparativo de las secuencias reguladoras del gen de la chalcón sintetasa de varias familias botánicas. Veintidós secuencias de promotores de Chalcone Synthase fueron comparados teniendo en cuenta tres elementos Cis reguladores: Caja-G, Caja-H y Caja-TATA, que podrían estar actuando como una sola unidad cooperativa. Nuestra comparación muestra que estos elementos puede que se conserven en algunas especies e inclusive que se conserven a nivel de familia. Sin embargo, en algunas especies no todos los elementos Cis fueron encontrados, mostrando que no todas las especies se regulan bajo los mismos parámetros. Adicionalmente, una comparación entre promotores de una misma especie con una familia de multigenes Chs, mostró que los genes duplicados son variables en la composición del elemento Cis, sugiriendo que estos genes pueden estarse expresando de maneras diferentes.

  19. Differential modulation of nitric oxide synthases in aging: therapeutic opportunities

    Directory of Open Access Journals (Sweden)

    Stêfany Bruno De Assis Cau

    2012-06-01

    Full Text Available Vascular aging is the term that describes the structural and functional disturbances of the vasculature with advancing aging. The molecular mechanisms of aging-associated endothelial dysfunction are complex, but reduced nitric oxide (NO bioavailability and altered vascular expression and activity of NO synthase (NOS enzymes have been implicated as major players. Impaired vascular relaxation in aging has been attributed to reduced endothelial NOS (eNOS-derived NO, while increased inducible NOS (iNOS expression seems to account for nitrosative stress and disrupted vascular homeostasis. Although eNOS is considered the main source of NO in the vascular endothelium, neuronal NOS (nNOS also contributes to endothelial cells-derived NO, a mechanism that is reduced in aging. Pharmacological modulation of NO generation and expression/activity of NOS isoforms may represent a therapeutic alternative to prevent the progression of cardiovascular diseases. Accordingly, this review will focus on drugs that modulate NO bioavailability, such as nitrite anions and NO-releasing non-steroidal anti-inflammatory drugs, hormones (dehydroepiandrosterone and estrogen, statins, resveratrol and folic acid, since they may be useful to treat/to prevent aging-associated vascular dysfunction. The impact of these therapies on life quality in elderly and longevity will be discussed.

  20. Two Distinct Cardiolipin Synthases Operate in Agrobacterium tumefaciens.

    Science.gov (United States)

    Czolkoss, Simon; Fritz, Christiane; Hölzl, Georg; Aktas, Meriyem

    2016-01-01

    Cardiolipin (CL) is a universal component of energy generating membranes. In most bacteria, it is synthesized via the condensation of two molecules phosphatidylglycerol (PG) by phospholipase D-type cardiolipin synthases (PLD-type Cls). In the plant pathogen and natural genetic engineer Agrobacterium tumefaciens CL comprises up to 15% of all phospholipids in late stationary growth phase. A. tumefaciens harbors two genes, atu1630 (cls1) and atu2486 (cls2), coding for PLD-type Cls. Heterologous expression of either cls1 or cls2 in Escherichia coli resulted in accumulation of CL supporting involvement of their products in CL synthesis. Expression of cls1 and cls2 in A. tumefaciens is constitutive and irrespective of the growth phase. Membrane lipid profiling of A. tumefaciens mutants suggested that Cls2 is required for CL synthesis at early exponential growth whereas both Cls equally contribute to CL production at later growth stages. Contrary to many bacteria, which suffer from CL depletion, A. tumefaciens tolerates large changes in CL content since the CL-deficient cls1/cls2 double mutant showed no apparent defects in growth, stress tolerance, motility, biofilm formation, UV-stress and tumor formation on plants.

  1. Phylogenomic and functional domain analysis of polyketide synthases in Fusarium

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Daren W.; Butchko, Robert A.; Baker, Scott E.; Proctor, Robert H.

    2012-02-01

    Fusarium species are ubiquitous in nature, cause a range of plant diseases, and produce a variety of chemicals often referred to as secondary metabolites. Although some fungal secondary metabolites affect plant growth or protect plants from other fungi and bacteria, their presence in grain based food and feed is more often associated with a variety of diseases in plants and in animals. Many of these structurally diverse metabolites are derived from a family of related enzymes called polyketide synthases (PKSs). A search of genomic sequence of Fusarium verticillioides, F. graminearum, F. oxysporum and Nectria haematococca (anamorph F. solani) identified a total of 58 PKS genes. To gain insight into how this gene family evolved and to guide future studies, we conducted a phylogenomic and functional domain analysis. The resulting genealogy suggested that Fusarium PKSs represent 34 different groups responsible for synthesis of different core metabolites. The analyses indicate that variation in the Fusarium PKS gene family is due to gene duplication and loss events as well as enzyme gain-of-function due to the acquisition of new domains or of loss-of-function due to nucleotide mutations. Transcriptional analysis indicate that the 16 F. verticillioides PKS genes are expressed under a range of conditions, further evidence that they are functional genes that confer the ability to produce secondary metabolites.

  2. Structural basis for the recruitment of glycogen synthase by glycogenin.

    Science.gov (United States)

    Zeqiraj, Elton; Tang, Xiaojing; Hunter, Roger W; García-Rocha, Mar; Judd, Andrew; Deak, Maria; von Wilamowitz-Moellendorff, Alexander; Kurinov, Igor; Guinovart, Joan J; Tyers, Mike; Sakamoto, Kei; Sicheri, Frank

    2014-07-15

    Glycogen is a primary form of energy storage in eukaryotes that is essential for glucose homeostasis. The glycogen polymer is synthesized from glucose through the cooperative action of glycogen synthase (GS), glycogenin (GN), and glycogen branching enzyme and forms particles that range in size from 10 to 290 nm. GS is regulated by allosteric activation upon glucose-6-phosphate binding and inactivation by phosphorylation on its N- and C-terminal regulatory tails. GS alone is incapable of starting synthesis of a glycogen particle de novo, but instead it extends preexisting chains initiated by glycogenin. The molecular determinants by which GS recognizes self-glucosylated GN, the first step in glycogenesis, are unknown. We describe the crystal structure of Caenorhabditis elegans GS in complex with a minimal GS targeting sequence in GN and show that a 34-residue region of GN binds to a conserved surface on GS that is distinct from previously characterized allosteric and binding surfaces on the enzyme. The interaction identified in the GS-GN costructure is required for GS-GN interaction and for glycogen synthesis in a cell-free system and in intact cells. The interaction of full-length GS-GN proteins is enhanced by an avidity effect imparted by a dimeric state of GN and a tetrameric state of GS. Finally, the structure of the N- and C-terminal regulatory tails of GS provide a basis for understanding phosphoregulation of glycogen synthesis. These results uncover a central molecular mechanism that governs glycogen metabolism.

  3. Substrate specificity of Arabidopsis 3-ketoacyl-CoA synthases

    International Nuclear Information System (INIS)

    Blacklock, Brenda J.; Jaworski, Jan G.

    2006-01-01

    The very long chain fatty acids (VLCFA) incorporated into plant lipids are derived from the iterative addition of C2 units provided by malonyl-CoA to an acyl-CoA by the 3-ketoacyl-CoA synthase (KCS) component of a fatty acid elongase (FAE) complex. Mining of the Arabidopsis genome sequence database revealed 20 genes with homology to seed-specific FAE1 KCS. Eight of the 20 putative KCSs were cloned, expressed in yeast, and isolated as (His) 6 fusion proteins. Five of the eight (At1g71160, At1g19440, At1g07720, At5g04530, and At4g34250) had little or no activity with C16 to C20 substrates while three demonstrated activity with C16, C18, and C20 saturated acyl-CoA substrates. At1g01120 KCS (KCS1) and At2g26640 KCS had broad substrate specificities when assayed with saturated and mono-unsaturated C16 to C24 acyl-CoAs while At4g34510 KCS was specific for saturated fatty acyl-CoA substrates

  4. Evolution of Efficient Modular Polyketide Synthases by Homologous Recombination.

    Science.gov (United States)

    Chemler, Joseph A; Tripathi, Ashootosh; Hansen, Douglas A; O'Neil-Johnson, Mark; Williams, Russell B; Starks, Courtney; Park, Sung Ryeol; Sherman, David H

    2015-08-26

    The structural scaffolds of many complex natural products are produced by multifunctional type I polyketide synthase (PKS) enzymes that operate as biosynthetic assembly lines. The modular nature of these mega-enzymes presents an opportunity to construct custom biocatalysts built in a lego-like fashion by inserting, deleting, or exchanging native or foreign domains to produce targeted variants of natural polyketides. However, previously engineered PKS enzymes are often impaired resulting in limited production compared to native systems. Here, we show a versatile method for generating and identifying functional chimeric PKS enzymes for synthesizing custom macrolactones and macrolides. PKS genes from the pikromycin and erythromycin pathways were hybridized in Saccharomyces cerevisiae to generate hybrid libraries. We used a 96-well plate format for plasmid purification, transformations, sequencing, protein expression, in vitro reactions and analysis of metabolite formation. Active chimeric enzymes were identified with new functionality. Streptomyces venezuelae strains that expressed these PKS chimeras were capable of producing engineered macrolactones. Furthermore, a macrolactone generated from selected PKS chimeras was fully functionalized into a novel macrolide analogue. This method permits the engineering of PKS pathways as modular building blocks for the production of new antibiotic-like molecules.

  5. The Stereochemistry of Complex Polyketide Biosynthesis by Modular Polyketide Synthases

    Directory of Open Access Journals (Sweden)

    David H. Kwan

    2011-07-01

    Full Text Available Polyketides are a diverse class of medically important natural products whose biosynthesis is catalysed by polyketide synthases (PKSs, in a fashion highly analogous to fatty acid biosynthesis. In modular PKSs, the polyketide chain is assembled by the successive condensation of activated carboxylic acid-derived units, where chain extension occurs with the intermediates remaining covalently bound to the enzyme, with the growing polyketide tethered to an acyl carrier domain (ACP. Carboxylated acyl-CoA precursors serve as activated donors that are selected by the acyltransferase domain (AT providing extender units that are added to the growing chain by condensation catalysed by the ketosynthase domain (KS. The action of ketoreductase (KR, dehydratase (DH, and enoylreductase (ER activities can result in unreduced, partially reduced, or fully reduced centres within the polyketide chain depending on which of these enzymes are present and active. The PKS-catalysed assembly process generates stereochemical diversity, because carbon–carbon double bonds may have either cis- or trans- geometry, and because of the chirality of centres bearing hydroxyl groups (where they are retained and branching methyl groups (the latter arising from use of propionate extender units. This review shall cover the studies that have determined the stereochemistry in many of the reactions involved in polyketide biosynthesis by modular PKSs.

  6. Expression, Purification, and Characterisation of Dehydroquinate Synthase from Pyrococcus furiosus

    Directory of Open Access Journals (Sweden)

    Leonardo Negron

    2011-01-01

    Full Text Available Dehydroquinate synthase (DHQS catalyses the second step of the shikimate pathway to aromatic compounds. DHQS from the archaeal hyperthermophile Pyrococcus furiosus was insoluble when expressed in Escherichia coli but was partially solubilised when KCl was included in the cell lysis buffer. A purification procedure was developed, involving lysis by sonication at 30∘C followed by a heat treatment at 70∘C and anion exchange chromatography. Purified recombinant P. furiosus DHQS is a dimer with a subunit Mr of 37,397 (determined by electrospray ionisation mass spectrometry and is active over broad pH and temperature ranges. The kinetic parameters are KM (3-deoxy-D-arabino-heptulosonate 7-phosphate 3.7 μM and kcat 3.0 sec-1 at 60∘C and pH 6.8. EDTA inactivates the enzyme, and enzyme activity is restored by several divalent metal ions including (in order of decreasing effectiveness Cd2+, Co2+, Zn2+, and Mn2+. High activity of a DHQS in the presence of Cd2+ has not been reported for enzymes from other sources, and may be related to the bioavailability of Cd2+ for P. furiosus. This study is the first biochemical characterisation of a DHQS from a thermophilic source. Furthermore, the characterisation of this hyperthermophilic enzyme was carried out at elevated temperatures using an enzyme-coupled assay.

  7. Inducible expression of trehalose synthase in Bacillus licheniformis.

    Science.gov (United States)

    Li, Youran; Gu, Zhenghua; Zhang, Liang; Ding, Zhongyang; Shi, Guiyang

    2017-02-01

    Trehalose synthase (TreS) could transform maltose into trehalose via isomerization. It is a crucial enzyme in the process of trehalose enzymatical transformation. In this study, plasmid-based inducible expression systems were constructed to produce Thermomonospora curvata TreS in B. licheniformis. Xylose operons from B. subtilis, B. licheniformis and B. megaterium were introduced to regulate the expression of the gene encoding TreS. It was functionally expressed, and the BlsTs construct yielded the highest enzyme activity (12.1 U/mL). Furthermore, the effect of different cultural conditions on the inducible expression of BlsTs was investigated, and the optimal condition was as follows: 4% maltodextrin, 0.4% soybean powder, 1% xylose added after 10 h of growth and an induction time of 12 h at 37 °C. As a result, the maximal yield reached 24.7 U/mL. This study contributes to the industrial application of B. licheniformis, a GRAS workhorse for enzyme production. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Conservation and Role of Electrostatics in Thymidylate Synthase.

    Science.gov (United States)

    Garg, Divita; Skouloubris, Stephane; Briffotaux, Julien; Myllykallio, Hannu; Wade, Rebecca C

    2015-11-27

    Conservation of function across families of orthologous enzymes is generally accompanied by conservation of their active site electrostatic potentials. To study the electrostatic conservation in the highly conserved essential enzyme, thymidylate synthase (TS), we conducted a systematic species-based comparison of the electrostatic potential in the vicinity of its active site. Whereas the electrostatics of the active site of TS are generally well conserved, the TSs from minimal organisms do not conform to the overall trend. Since the genomes of minimal organisms have a high thymidine content compared to other organisms, the observation of non-conserved electrostatics was surprising. Analysis of the symbiotic relationship between minimal organisms and their hosts, and the genetic completeness of the thymidine synthesis pathway suggested that TS from the minimal organism Wigglesworthia glossinidia (W.g.b.) must be active. Four residues in the vicinity of the active site of Escherichia coli TS were mutated individually and simultaneously to mimic the electrostatics of W.g.b TS. The measured activities of the E. coli TS mutants imply that conservation of electrostatics in the region of the active site is important for the activity of TS, and suggest that the W.g.b. TS has the minimal activity necessary to support replication of its reduced genome.

  9. Hyperbaric oxygen upregulates cochlear constitutive nitric oxide synthase

    Directory of Open Access Journals (Sweden)

    Kao Ming-Ching

    2011-02-01

    Full Text Available Abstract Background Hyperbaric oxygen therapy (HBOT is a known adjuvant for treating ischemia-related inner ear diseases. Controversies still exist in the role of HBOT in cochlear diseases. Few studies to date have investigated the cellular changes that occur in inner ears after HBOT. Nitric oxide, which is synthesized by nitric oxide synthase (NOS, is an important signaling molecule in cochlear physiology and pathology. Here we investigated the effects of hyperbaric oxygen on eardrum morphology, cochlear function and expression of NOS isoforms in cochlear substructures after repetitive HBOT in guinea pigs. Results Minor changes in the eardrum were observed after repetitive HBOT, which did not result in a significant hearing threshold shift by tone burst auditory brainstem responses. A differential effect of HBOT on the expression of NOS isoforms was identified. Upregulation of constitutive NOS (nNOS and eNOS was found in the substructures of the cochlea after HBOT, but inducible NOS was not found in normal or HBOT animals, as shown by immunohistochemistry. There was no obvious DNA fragmentation present in this HBOT animal model. Conclusions The present evidence indicates that the customary HBOT protocol may increase constitutive NOS expression but such upregulation did not cause cell death in the treated cochlea. The cochlear morphology and auditory function are consequently not changed through the protocol.

  10. Two Distinct Cardiolipin Synthases Operate in Agrobacterium tumefaciens.

    Directory of Open Access Journals (Sweden)

    Simon Czolkoss

    Full Text Available Cardiolipin (CL is a universal component of energy generating membranes. In most bacteria, it is synthesized via the condensation of two molecules phosphatidylglycerol (PG by phospholipase D-type cardiolipin synthases (PLD-type Cls. In the plant pathogen and natural genetic engineer Agrobacterium tumefaciens CL comprises up to 15% of all phospholipids in late stationary growth phase. A. tumefaciens harbors two genes, atu1630 (cls1 and atu2486 (cls2, coding for PLD-type Cls. Heterologous expression of either cls1 or cls2 in Escherichia coli resulted in accumulation of CL supporting involvement of their products in CL synthesis. Expression of cls1 and cls2 in A. tumefaciens is constitutive and irrespective of the growth phase. Membrane lipid profiling of A. tumefaciens mutants suggested that Cls2 is required for CL synthesis at early exponential growth whereas both Cls equally contribute to CL production at later growth stages. Contrary to many bacteria, which suffer from CL depletion, A. tumefaciens tolerates large changes in CL content since the CL-deficient cls1/cls2 double mutant showed no apparent defects in growth, stress tolerance, motility, biofilm formation, UV-stress and tumor formation on plants.

  11. Inhibition of fatty acid synthase prevents preadipocyte differentiation

    International Nuclear Information System (INIS)

    Schmid, Bernhard; Rippmann, Joerg F.; Tadayyon, Moh; Hamilton, Bradford S.

    2005-01-01

    Inhibition of fatty acid synthase (FAS) reduces food intake in rodents. As adipose tissue expresses FAS, we sought to investigate the effect of reduced FAS activity on adipocyte differentiation. FAS activity was suppressed either pharmacologically or by siRNA during differentiation of 3T3-L1 cells. Cerulenin (10 μM), triclosan (50 μM), and C75 (50 μM) reduced dramatically visible lipid droplet accumulation, while incorporation of [1- 14 C]acetate into lipids was reduced by 75%, 70%, and 90%, respectively. Additionally, the substances reduced FAS, CEBPα, and PPARγ mRNA by up to 85% compared to that of control differentiated cells. Transient transfection with FAS siRNA suppressed FAS mRNA and FAS activity, and this was accompanied by reduction of CEBPα and PPARγ mRNA levels, and complete prevention of lipid accumulation. CD36, a late marker of differentiation, was also reduced. Together, these results suggest that FAS generated signals may be essential to support preadipocyte differentiation

  12. CTP limitation increases expression of CTP synthase in Lactococcus lactis

    DEFF Research Database (Denmark)

    Jørgensen, C.M.; Hammer, Karin; Martinussen, Jan

    2003-01-01

    CTP synthase is encoded by the pyrG gene and catalyzes the conversion of UTP to CTP. A Lactococcus lactis pyrG mutant with a cytidine requirement was constructed, in which beta-galactosidase activity in a pyrG-lacLM transcriptional fusion was used to monitor gene expression of pyrG. A 10-fold...... decrease in the CTP pool induced by cytidine limitation was found to immediately increase expression of the L. lactis pyrG gene. The final level of expression of pyrG is 37-fold higher than the uninduced level. CTP limitation has pronounced effects on central cellular metabolism, and both RNA and protein...... for regulation of the pyrG gene. It is possible to fold the pyrG leader in an alternative structure that would prevent the formation of the terminator. We suggest a model for pyrG regulation in L. lactis, and probably in other gram-positive bacteria as well, in which pyrG expression is directly dependent...

  13. Squalene synthase as a target for Chagas disease therapeutics.

    Directory of Open Access Journals (Sweden)

    Na Shang

    2014-05-01

    Full Text Available Trypanosomatid parasites are the causative agents of many neglected tropical diseases and there is currently considerable interest in targeting endogenous sterol biosynthesis in these organisms as a route to the development of novel anti-infective drugs. Here, we report the first x-ray crystallographic structures of the enzyme squalene synthase (SQS from a trypanosomatid parasite, Trypanosoma cruzi, the causative agent of Chagas disease. We obtained five structures of T. cruzi SQS and eight structures of human SQS with four classes of inhibitors: the substrate-analog S-thiolo-farnesyl diphosphate, the quinuclidines E5700 and ER119884, several lipophilic bisphosphonates, and the thiocyanate WC-9, with the structures of the two very potent quinuclidines suggesting strategies for selective inhibitor development. We also show that the lipophilic bisphosphonates have low nM activity against T. cruzi and inhibit endogenous sterol biosynthesis and that E5700 acts synergistically with the azole drug, posaconazole. The determination of the structures of trypanosomatid and human SQS enzymes with a diverse set of inhibitors active in cells provides insights into SQS inhibition, of interest in the context of the development of drugs against Chagas disease.

  14. Brain phenotype of transgenic mice overexpressing cystathionine β-synthase.

    Directory of Open Access Journals (Sweden)

    Vinciane Régnier

    Full Text Available The cystathionine β-synthase (CBS gene, located on human chromosome 21q22.3, is a good candidate for playing a role in the Down Syndrome (DS cognitive profile: it is overexpressed in the brain of individuals with DS, and it encodes a key enzyme of sulfur-containing amino acid (SAA metabolism, a pathway important for several brain physiological processes.Here, we have studied the neural consequences of CBS overexpression in a transgenic mouse line (60.4P102D1 expressing the human CBS gene under the control of its endogenous regulatory regions. These mice displayed a ∼2-fold increase in total CBS proteins in different brain areas and a ∼1.3-fold increase in CBS activity in the cerebellum and the hippocampus. No major disturbance of SAA metabolism was observed, and the transgenic mice showed normal behavior in the rotarod and passive avoidance tests. However, we found that hippocampal synaptic plasticity is facilitated in the 60.4P102D1 line.We demonstrate that CBS overexpression has functional consequences on hippocampal neuronal networks. These results shed new light on the function of the CBS gene, and raise the interesting possibility that CBS overexpression might have an advantageous effect on some cognitive functions in DS.

  15. Phosphorylation Regulates myo-Inositol-3-phosphate Synthase

    Science.gov (United States)

    Deranieh, Rania M.; He, Quan; Caruso, Joseph A.; Greenberg, Miriam L.

    2013-01-01

    myo-Inositol-3-phosphate synthase (MIPS) plays a crucial role in inositol homeostasis. Transcription of the coding gene INO1 is highly regulated. However, regulation of the enzyme is not well defined. We previously showed that MIPS is indirectly inhibited by valproate, suggesting that the enzyme is post-translationally regulated. Using 32Pi labeling and phosphoamino acid analysis, we show that yeast MIPS is a phosphoprotein. Mass spectrometry analysis identified five phosphosites, three of which are conserved in the human MIPS. Analysis of phosphorylation-deficient and phosphomimetic site mutants indicated that the three conserved sites in yeast (Ser-184, Ser-296, and Ser-374) and humans (Ser-177, Ser-279, and Ser-357) affect MIPS activity. Both S296A and S296D yeast mutants and S177A and S177D human mutants exhibited decreased enzymatic activity, suggesting that a serine residue is critical at that location. The phosphomimetic mutations S184D (human S279D) and S374D (human S357D) but not the phosphodeficient mutations decreased activity, suggesting that phosphorylation of these two sites is inhibitory. The double mutation S184A/S374A caused an increase in MIPS activity, conferred a growth advantage, and partially rescued sensitivity to valproate. Our findings identify a novel mechanism of regulation of inositol synthesis by phosphorylation of MIPS. PMID:23902760

  16. Purification and Biochemical Properties of Phytochromobilin Synthase from Etiolated Oat Seedlings1

    Science.gov (United States)

    McDowell, Michael T.; Lagarias, J. Clark

    2001-01-01

    Plant phytochromes are dependent on the covalent attachment of the linear tetrapyrrole chromophore phytochromobilin (PΦB) for photoactivity. In planta, biliverdin IXα (BV) is reduced by the plastid-localized, ferredoxin (Fd)-dependent enzyme PΦB synthase to yield 3Z-PΦB. Here, we describe the >50,000-fold purification of PΦB synthase from etioplasts from dark-grown oat (Avena sativa L. cv Garry) seedlings using traditional column chromatography and preparative electrophoresis. Thus, PΦB synthase is a very low abundance enzyme with a robust turnover rate. We estimate the turnover rate to be >100 s−1, which is similar to that of mammalian NAD(P)H-dependent BV reductase. Oat PΦB synthase is a monomer with a subunit mass of 29 kD. However, two distinct charged forms of the enzymes were identified by native isoelectric focusing. The ability of PΦB synthase to reduce BV is dependent on reduced 2Fe-2S Fds. A Km for spinach (Spinacea oleracea) Fd was determined to be 3 to 4 μm. PΦB synthase has a high affinity for its bilin substrate, with a sub-micromolar Km for BV. PMID:11500553

  17. Purification and biochemical properties of phytochromobilin synthase from etiolated oat seedlings.

    Science.gov (United States)

    McDowell, M T; Lagarias, J C

    2001-08-01

    Plant phytochromes are dependent on the covalent attachment of the linear tetrapyrrole chromophore phytochromobilin (P Phi B) for photoactivity. In planta, biliverdin IX alpha (BV) is reduced by the plastid-localized, ferredoxin (Fd)-dependent enzyme P Phi B synthase to yield 3Z-P Phi B. Here, we describe the >50,000-fold purification of P Phi B synthase from etioplasts from dark-grown oat (Avena sativa L. cv Garry) seedlings using traditional column chromatography and preparative electrophoresis. Thus, P Phi B synthase is a very low abundance enzyme with a robust turnover rate. We estimate the turnover rate to be >100 s(-1), which is similar to that of mammalian NAD(P)H-dependent BV reductase. Oat P Phi B synthase is a monomer with a subunit mass of 29 kD. However, two distinct charged forms of the enzymes were identified by native isoelectric focusing. The ability of P Phi B synthase to reduce BV is dependent on reduced 2Fe-2S Fds. A K(m) for spinach (Spinacea oleracea) Fd was determined to be 3 to 4 microM. P Phi B synthase has a high affinity for its bilin substrate, with a sub-micromolar K(m) for BV.

  18. A high-throughput colorimetric screening assay for terpene synthase activity based on substrate consumption.

    Directory of Open Access Journals (Sweden)

    Maiko Furubayashi

    Full Text Available Terpene synthases catalyze the formation of a variety of terpene chemical structures. Systematic mutagenesis studies have been effective in providing insights into the characteristic and complex mechanisms of C-C bond formations and in exploring the enzymatic potential for inventing new chemical structures. In addition, there is growing demand to increase terpene synthase activity in heterologous hosts, given the maturation of metabolic engineering and host breeding for terpenoid synthesis. We have developed a simple screening method for the cellular activities of terpene synthases by scoring their substrate consumption based on the color loss of the cell harboring carotenoid pathways. We demonstrate that this method can be used to detect activities of various terpene synthase or prenyltransferase genes in a high-throughput manner, irrespective of the product type, enabling the mutation analysis and directed evolution of terpene synthases. We also report the possibility for substrate-specific screening system of terpene synthases by taking advantage of the substrate-size specificity of C30 and C40 carotenoid pathways.

  19. The role of NO synthase isoforms in PDT-induced injury of neurons and glial cells

    Science.gov (United States)

    Kovaleva, V. D.; Berezhnaya, E. V.; Uzdensky, A. B.

    2015-03-01

    Nitric oxide (NO) is an important second messenger, involved in the implementation of various cell functions. It regulates various physiological and pathological processes such as neurotransmission, cell responses to stress, and neurodegeneration. NO synthase is a family of enzymes that synthesize NO from L-arginine. The activity of different NOS isoforms depends both on endogenous and exogenous factors. In particular, it is modulated by oxidative stress, induced by photodynamic therapy (PDT). We have studied the possible role of NOS in the regulation of survival and death of neurons and surrounding glial cells under photo-oxidative stress induced by photodynamic treatment (PDT). The crayfish stretch receptor consisting of a single identified sensory neuron enveloped by glial cells is a simple but informative model object. It was photosensitized with alumophthalocyanine photosens (10 nM) and irradiated with a laser diode (670 nm, 0.4 W/cm2). Antinecrotic and proapoptotic effects of NO on the glial cells were found using inhibitory analysis. We have shown the role of inducible NO synthase in photoinduced apoptosis and involvement of neuronal NO synthase in photoinduced necrosis of glial cells in the isolated crayfish stretch receptor. The activation of NO synthase was evaluated using NADPH-diaphorase histochemistry, a marker of neurons expressing the enzyme. The activation of NO synthase in the isolated crayfish stretch receptor was evaluated as a function of time after PDT. Photodynamic treatment induced transient increase in NO synthase activity and then slowly inhibited this enzyme.

  20. Optimization of ATP synthase function in mitochondria and chloroplasts via the adenylate kinase equilibrium

    Directory of Open Access Journals (Sweden)

    Abir U Igamberdiev

    2015-01-01

    Full Text Available The bulk of ATP synthesis in plants is performed by ATP synthase, the main bioenergetics engine of cells, operating both in mitochondria and in chloroplasts. The reaction mechanism of ATP synthase has been studied in detail for over half a century; however, its optimal performance depends also on the steady delivery of ATP synthase substrates and the removal of its products. For mitochondrial ATP synthase, we analyze here the provision of stable conditions for (i the supply of ADP and Mg2+, supported by adenylate kinase (AK equilibrium in the intermembrane space, (ii the supply of phosphate via membrane transporter in symport with H+, and (iii the conditions of outflow of ATP by adenylate transporter carrying out the exchange of free adenylates. We also show that, in chloroplasts, AK equilibrates adenylates and governs Mg2+ contents in the stroma, optimizing ATP synthase and Calvin cycle operation, and affecting the import of inorganic phosphate in exchange with triose phosphates. It is argued that chemiosmosis is not the sole component of ATP synthase performance, which also depends on AK-mediated equilibrium of adenylates and Mg2+, adenylate transport and phosphate release and supply.

  1. Linalool and linalool nerolidol synthases in roses, several genes for little scent.

    Science.gov (United States)

    Magnard, Jean-Louis; Bony, Aurélie Rius; Bettini, Fabienne; Campanaro, Ausilia; Blerot, Bernard; Baudino, Sylvie; Jullien, Frédéric

    2018-03-11

    Roses are widely appreciated for the appearance of their flowers and for their fragrance. This latter character results from the combination of different odorant molecules among which monoterpenes are often prevalent constituents. In this study, we report the cloning and characterization of three rose monoterpene synthases. In vitro functional characterization of these enzymes showed that one is a (-)-(3R)-linalool synthase whereas the others have a dual (+)-(3S)-linalool nerolidol synthase activity. However, given that the characterized rose cultivars were only able to produce the (-)-(3R)-linalool stereoisomer, the linalool nerolidol synthases are probably not active in planta. Furthermore, these three enzymes were also characterized by a weak expression level as assessed by RT-qPCR and by the low abundance of the corresponding sequences in an EST library. This characteristic is likely to explain why linalool is generally a minor constituent in rose flowers' scents. On this basis, we propose that in roses the monoterpene biosynthesis effort is focused on the production of acyclic monoterpenes derived from geraniol through the recently characterized Nudix biosynthesis pathway, at the expense of conventional monoterpene biosynthesis via terpene synthases such as linalool or linalool nerolidol synthases. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  2. Aspirin inhibits interleukin 1-induced prostaglandin H synthase expression in cultured endothelial cells

    International Nuclear Information System (INIS)

    Wu, K.K.; Sanduja, R.; Tsai, A.L.; Ferhanoglu, B.; Loose-Mitchell, D.S.

    1991-01-01

    Prostaglandin H (PGH) synthase is a key enzyme in the biosynthesis of prostaglandins, thromboxane, and prostacyclin. In cultured human umbilical vein endothelial cells, interleukin 1 (IL-1) is known to induce the synthesis of this enzyme, thereby raising the level of PGH synthase protein severalfold over the basal level. Pretreatment with aspirin at low concentrations inhibited more than 60% of the enzyme mass and also the cyclooxygenase activity in IL-1-induced cells with only minimal effects on the basal level of the synthase enzyme in cells without IL-1. Sodium salicylate exhibited a similar inhibitory action whereas indomethacin had no apparent effect. Similarly low levels of aspirin inhibited the increased L-[ 35 S]methionine incorporation into PGH synthase that was induced by IL0-1 and also suppressed expression of the 2.7-kilobase PGH synthase mRNA. These results suggest that in cultured endothelial cells a potent inhibition of eicosanoid biosynthetic capacity can be effected by aspirin or salicylate at the level of PGH synthase gene expression. The aspirin effect may well be due to degradation of salicylate

  3. Aspirin inhibits interleukin 1-induced prostaglandin H synthase expression in cultured endothelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Wu, K.K.; Sanduja, R.; Tsai, A.L.; Ferhanoglu, B.; Loose-Mitchell, D.S. (Univ. of Texas Medical School, Houston (United States))

    1991-03-15

    Prostaglandin H (PGH) synthase is a key enzyme in the biosynthesis of prostaglandins, thromboxane, and prostacyclin. In cultured human umbilical vein endothelial cells, interleukin 1 (IL-1) is known to induce the synthesis of this enzyme, thereby raising the level of PGH synthase protein severalfold over the basal level. Pretreatment with aspirin at low concentrations inhibited more than 60% of the enzyme mass and also the cyclooxygenase activity in IL-1-induced cells with only minimal effects on the basal level of the synthase enzyme in cells without IL-1. Sodium salicylate exhibited a similar inhibitory action whereas indomethacin had no apparent effect. Similarly low levels of aspirin inhibited the increased L-({sup 35}S)methionine incorporation into PGH synthase that was induced by IL0-1 and also suppressed expression of the 2.7-kilobase PGH synthase mRNA. These results suggest that in cultured endothelial cells a potent inhibition of eicosanoid biosynthetic capacity can be effected by aspirin or salicylate at the level of PGH synthase gene expression. The aspirin effect may well be due to degradation of salicylate.

  4. Valencene synthase from the heartwood of Nootka cypress (Callitropsis nootkatensis) for biotechnological production of valencene.

    Science.gov (United States)

    Beekwilder, Jules; van Houwelingen, Adèle; Cankar, Katarina; van Dijk, Aalt D J; de Jong, René M; Stoopen, Geert; Bouwmeester, Harro; Achkar, Jihane; Sonke, Theo; Bosch, Dirk

    2014-02-01

    Nootkatone is one of the major terpenes in the heartwood of the Nootka cypress Callitropsis nootkatensis. It is an oxidized sesquiterpene, which has been postulated to be derived from valencene. Both valencene and nootkatone are used for flavouring citrus beverages and are considered among the most valuable terpenes used at commercial scale. Functional evaluation of putative terpene synthase genes sourced by large-scale EST sequencing from Nootka cypress wood revealed a valencene synthase gene (CnVS). CnVS expression in different tissues from the tree correlates well with nootkatone content, suggesting that CnVS represents the first dedicated gene in the nootkatone biosynthetic pathway in C. nootkatensis The gene belongs to the gymnosperm-specific TPS-d subfamily of terpenes synthases and its protein sequence has low similarity to known citrus valencene synthases. In vitro, CnVS displays high robustness under different pH and temperature regimes, potentially beneficial properties for application in different host and physiological conditions. Biotechnological production of sesquiterpenes has been shown to be feasible, but productivity of microbial strains expressing valencene synthase from Citrus is low, indicating that optimization of valencene synthase activity is needed. Indeed, expression of CnVS in Saccharomyces cerevisiae indicated potential for higher yields. In an optimized Rhodobacter sphaeroides strain, expression of CnVS increased valencene yields 14-fold to 352 mg/L, bringing production to levels with industrial potential. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  5. Structural basis for substrate activation and regulation by cystathionine beta-synthase (CBS) domains in cystathionine [beta]-synthase

    Energy Technology Data Exchange (ETDEWEB)

    Koutmos, Markos; Kabil, Omer; Smith, Janet L.; Banerjee, Ruma (Michigan-Med)

    2011-08-17

    The catalytic potential for H{sub 2}S biogenesis and homocysteine clearance converge at the active site of cystathionine {beta}-synthase (CBS), a pyridoxal phosphate-dependent enzyme. CBS catalyzes {beta}-replacement reactions of either serine or cysteine by homocysteine to give cystathionine and water or H{sub 2}S, respectively. In this study, high-resolution structures of the full-length enzyme from Drosophila in which a carbanion (1.70 {angstrom}) and an aminoacrylate intermediate (1.55 {angstrom}) have been captured are reported. Electrostatic stabilization of the zwitterionic carbanion intermediate is afforded by the close positioning of an active site lysine residue that is initially used for Schiff base formation in the internal aldimine and later as a general base. Additional stabilizing interactions between active site residues and the catalytic intermediates are observed. Furthermore, the structure of the regulatory 'energy-sensing' CBS domains, named after this protein, suggests a mechanism for allosteric activation by S-adenosylmethionine.

  6. Functional analysis of (4S)-limonene synthase mutants reveals determinants of catalytic outcome in a model monoterpene synthase

    Science.gov (United States)

    Srividya, Narayanan; Davis, Edward M.; Croteau, Rodney B.; Lange, B. Markus

    2015-01-01

    Crystal structural data for (4S)-limonene synthase [(4S)-LS] of spearmint (Mentha spicata L.) were used to infer which amino acid residues are in close proximity to the substrate and carbocation intermediates of the enzymatic reaction. Alanine-scanning mutagenesis of 48 amino acids combined with enzyme fidelity analysis [percentage of (−)-limonene produced] indicated which residues are most likely to constitute the active site. Mutation of residues W324 and H579 caused a significant drop in enzyme activity and formation of products (myrcene, linalool, and terpineol) characteristic of a premature termination of the reaction. A double mutant (W324A/H579A) had no detectable enzyme activity, indicating that either substrate binding or the terminating reaction was impaired. Exchanges to other aromatic residues (W324H, W324F, W324Y, H579F, H579Y, and H579W) resulted in enzyme catalysts with significantly reduced activity. Sequence comparisons across the angiosperm lineage provided evidence that W324 is a conserved residue, whereas the position equivalent to H579 is occupied by aromatic residues (H, F, or Y). These results are consistent with a critical role of W324 and H579 in the stabilization of carbocation intermediates. The potential of these residues to serve as the catalytic base facilitating the terminal deprotonation reaction is discussed. PMID:25733883

  7. Enhanced (S)-linalool production by fusion expression of farnesyl diphosphate synthase and linalool synthase in Saccharomyces cerevisiae.

    Science.gov (United States)

    Deng, Yu; Sun, Mingxue; Xu, Sha; Zhou, Jingwen

    2016-07-01

    In order to improve the availability of geranyl diphosphate (GPP) in the mevalonate pathway for enhancing (S)-linalool production in Saccharomyces cerevisiae. A (S)-linalool synthase (LIS): AaLS1 from Actinidia arguta was coexpressed with FPPS with different peptide linkers to redirect the flux from geranyl diphosphate (GPP) to (S)-linalool production in S. cerevisiae. The strain with the best peptide linker ((GGGGS)3 ), produced 101·55 ± 2·97 μg l(-1) (S)-linalool, a 69·7% increase compared to those with two independent LIS and FPPS expressed. In a 3-l fermenter, the (S)-linalool titre was further improved to 240·64 ± 5·31 μg l(-1) . The results demonstrate that the fusion proteins catalysing consecutive steps in a metabolic pathway significantly improved the (S)-linalool production with GPP as precursor. The fusion protein strategy co-expressing AaLS1 and FPPS, assembled with a long peptide linker made S. cerevisiae produced the highest reported (S)-Linalool titre to date. © 2016 The Society for Applied Microbiology.

  8. Identification of a Fungal 1,8-Cineole Synthase from Hypoxylon sp. with Specificity Determinants in Common with the Plant Synthases*

    Science.gov (United States)

    Shaw, Jeffrey J.; Berbasova, Tetyana; Sasaki, Tomoaki; Jefferson-George, Kyra; Spakowicz, Daniel J.; Dunican, Brian F.; Portero, Carolina E.; Narváez-Trujillo, Alexandra; Strobel, Scott A.

    2015-01-01

    Terpenes are an important and diverse class of secondary metabolites widely produced by fungi. Volatile compound screening of a fungal endophyte collection revealed a number of isolates in the family Xylariaceae, producing a series of terpene molecules, including 1,8-cineole. This compound is a commercially important component of eucalyptus oil used in pharmaceutical applications and has been explored as a potential biofuel additive. The genes that produce terpene molecules, such as 1,8-cineole, have been little explored in fungi, providing an opportunity to explore the biosynthetic origin of these compounds. Through genome sequencing of cineole-producing isolate E7406B, we were able to identify 11 new terpene synthase genes. Expressing a subset of these genes in Escherichia coli allowed identification of the hyp3 gene, responsible for 1,8-cineole biosynthesis, the first monoterpene synthase discovered in fungi. In a striking example of convergent evolution, mutational analysis of this terpene synthase revealed an active site asparagine critical for water capture and specificity during cineole synthesis, the same mechanism used in an unrelated plant homologue. These studies have provided insight into the evolutionary relationship of fungal terpene synthases to those in plants and bacteria and further established fungi as a relatively untapped source of this important and diverse class of compounds. PMID:25648891

  9. Inducible nitric oxide synthase haplotype associated with migraine and aura.

    Science.gov (United States)

    de O S Mansur, Thiago; Gonçalves, Flavia M; Martins-Oliveira, Alisson; Speciali, Jose G; Dach, Fabiola; Lacchini, Riccardo; Tanus-Santos, Jose E

    2012-05-01

    Migraine is a complex neurological disorder with a clear neurogenic inflammatory component apparently including enhanced nitric oxide (NO) formation. Excessive NO amounts possibly contributing to migraine are derived from increased expression and activity of inducible NO synthase (iNOS). We tested the hypothesis that two functional, clinically relevant iNOS genetic polymorphisms (C(-1026)A-rs2779249 and G2087A-rs2297518) are associated with migraine with or without aura. We studied 142 healthy women without migraine (control group) and 200 women with migraine divided into two groups: 148 with migraine without aura (MWA) and 52 with aura (MA). Genotypes were determined by real-time polymerase chain reaction using the Taqman(®) allele discrimination assays. The PHASE 2.1 software was used to estimate the haplotypes. The A allele for the G2087A polymorphism was more commonly found in the MA group than in the MWA group (28 vs. 18%; P 0.05). The haplotype combining both A alleles for the two polymorphisms was more commonly found in the MA group than in the control group or in the MWA group (19 vs. 10 or 8%; P = 0.0245 or 0.0027, respectively). Our findings indicate that the G2087A and the C(-1026)A polymorphism in the iNOS gene affect the susceptibility to migraine with aura when their effects are combined within haplotypes, whereas the G2087A affects the susceptibility to aura in migraine patients. These finding may have therapeutic implications when examining the effects of selective iNOS inhibitors.

  10. Hyaluronan synthase mediates dye translocation across liposomal membranes

    Directory of Open Access Journals (Sweden)

    Medina Andria P

    2012-01-01

    Full Text Available Abstract Background Hyaluronan (HA is made at the plasma membrane and secreted into the extracellular medium or matrix by phospolipid-dependent hyaluronan synthase (HAS, which is active as a monomer. Since the mechanism by which HA is translocated across membranes is still unresolved, we assessed the presence of an intraprotein pore within HAS by adding purified Streptococcus equisimilis HAS (SeHAS to liposomes preloaded with the fluorophore Cascade Blue (CB. Results CB translocation (efflux was not observed with mock-purified material from empty vector control E. coli membranes, but was induced by SeHAS, purified from membranes, in a time- and dose-dependent manner. CB efflux was eliminated or greatly reduced when purified SeHAS was first treated under conditions that inhibit enzyme activity: heating, oxidization or cysteine modification with N-ethylmaleimide. Reduced CB efflux also occurred with SeHAS K48E or K48F mutants, in which alteration of K48 within membrane domain 2 causes decreased activity and HA product size. The above results used liposomes containing bovine cardiolipin (BCL. An earlier study testing many synthetic lipids found that the best activating lipid for SeHAS is tetraoleoyl cardiolipin (TO-CL and that, in contrast, tetramyristoyl cardiolipin (TM-CL is an inactivating lipid (Weigel et al, J. Biol. Chem. 281, 36542, 2006. Consistent with the effects of these CL species on SeHAS activity, CB efflux was more than 2-fold greater in liposomes made with TO-CL compared to TM-CL. Conclusions The results indicate the presence of an intraprotein pore in HAS and support a model in which HA is translocated to the exterior by HAS itself.

  11. Insights into the reactivation of cobalamin-dependent methionine synthase

    Energy Technology Data Exchange (ETDEWEB)

    Koutmos, Markos; Datta, Supratim; Pattridge, Katherine A.; Smith, Janet L.; Matthews, Rowena G.; (Michigan)

    2009-12-10

    Cobalamin-dependent methionine synthase (MetH) is a modular protein that catalyzes the transfer of a methyl group from methyltetrahydrofolate to homocysteine to produce methionine and tetrahydrofolate. The cobalamin cofactor, which serves as both acceptor and donor of the methyl group, is oxidized once every {approx}2,000 catalytic cycles and must be reactivated by the uptake of an electron from reduced flavodoxin and a methyl group from S-adenosyl-L-methionine (AdoMet). Previous structures of a C-terminal fragment of MetH (MetH{sup CT}) revealed a reactivation conformation that juxtaposes the cobalamin- and AdoMet-binding domains. Here we describe 2 structures of a disulfide stabilized MetH{sup CT} ({sub s-s}MetH{sup CT}) that offer further insight into the reactivation of MetH. The structure of {sub s-s}MetH{sup CT} with cob(II)alamin and S-adenosyl-L-homocysteine represents the enzyme in the reactivation step preceding electron transfer from flavodoxin. The structure supports earlier suggestions that the enzyme acts to lower the reduction potential of the Co(II)/Co(I) couple by elongating the bond between the cobalt and its upper axial water ligand, effectively making the cobalt 4-coordinate, and illuminates the role of Tyr-1139 in the stabilization of this 4-coordinate state. The structure of {sub s-s}MetH{sub CT} with aquocobalamin may represent a transient state at the end of reactivation as the newly remethylated 5-coordinate methylcobalamin returns to the 6-coordinate state, triggering the rearrangement to a catalytic conformation.

  12. Platensimycin activity against mycobacterial beta-ketoacyl-ACP synthases.

    Directory of Open Access Journals (Sweden)

    Alistair K Brown

    2009-07-01

    Full Text Available There is an urgent need for the discovery and development of new drugs against Mycobacterium tuberculosis, the causative agent of tuberculosis, especially due to the recent emergence of multi-drug and extensively-drug resistant strains. Herein, we have examined the susceptibility of mycobacteria to the natural product platensimycin.We have demonstrated that platensimycin has bacteriostatic activity against the fast growing Mycobacterium smegmatis (MIC = 14 microg/ml and against Mycobacterium tuberculosis (MIC = 12 microg/ml. Growth in the presence of paltensimycin specifically inhibited the biosynthesis of mycolic acids suggesting that the antibiotic targeted the components of the mycolate biosynthesis complex. Given the inhibitory activity of platensimycin against beta-ketoacyl-ACP synthases from Staphylococcus aureus, M. tuberculosis KasA, KasB or FabH were overexpressed in M. smegmatis to establish whether these mycobacterial KAS enzymes were targets of platensimycin. In M. smegmatis overexpression of kasA or kasB increased the MIC of the strains from 14 microg/ml, to 30 and 124 microg/ml respectively. However, overexpression of fabH on did not affect the MIC. Additionally, consistent with the overexpression data, in vitro assays using purified proteins demonstrated that platensimycin inhibited Mt-KasA and Mt-KasB, but not Mt-FabH.Our results have shown that platensimycin is active against mycobacterial KasA and KasB and is thus an exciting lead compound against M. tuberculosis and the development of new synthetic analogues.

  13. Decoding the substrate supply to human neuronal nitric oxide synthase.

    Directory of Open Access Journals (Sweden)

    Alexandra Simon

    Full Text Available Nitric oxide, produced by the neuronal nitric oxide synthase (nNOS from L-arginine is an important second messenger molecule in the central nervous system: It influences the synthesis and release of neurotransmitters and plays an important role in long-term potentiation, long-term depression and neuroendocrine secretion. However, under certain pathological conditions such as Alzheimer's or Parkinson's disease, stroke and multiple sclerosis, excessive NO production can lead to tissue damage. It is thus desirable to control NO production in these situations. So far, little is known about the substrate supply to human nNOS as a determinant of its activity. Measuring bioactive NO via cGMP formation in reporter cells, we demonstrate here that nNOS in both, human A673 neuroepithelioma and TGW-nu-I neuroblastoma cells can be fast and efficiently nourished by extracellular arginine that enters the cells via membrane transporters (pool I that is freely exchangeable with the extracellular space. When this pool was depleted, NO synthesis was partially sustained by intracellular arginine sources not freely exchangeable with the extracellular space (pool II. Protein breakdown made up by far the largest part of pool II in both cell types. In contrast, citrulline to arginine conversion maintained NO synthesis only in TGW-nu-I neuroblastoma, but not A673 neuroepithelioma cells. Histidine mimicked the effect of protease inhibitors causing an almost complete nNOS inhibition in cells incubated additionally in lysine that depletes the exchangeable arginine pool. Our results identify new ways to modulate nNOS activity by modifying its substrate supply.

  14. Prostaglandin endoperoxide H synthases: peroxidase hydroperoxide specificity and cyclooxygenase activation.

    Science.gov (United States)

    Liu, Jiayan; Seibold, Steve A; Rieke, Caroline J; Song, Inseok; Cukier, Robert I; Smith, William L

    2007-06-22

    The cyclooxygenase (COX) activity of prostaglandin endoperoxide H synthases (PGHSs) converts arachidonic acid and O2 to prostaglandin G2 (PGG2). PGHS peroxidase (POX) activity reduces PGG2 to PGH2. The first step in POX catalysis is formation of an oxyferryl heme radical cation (Compound I), which undergoes intramolecular electron transfer forming Intermediate II having an oxyferryl heme and a Tyr-385 radical required for COX catalysis. PGHS POX catalyzes heterolytic cleavage of primary and secondary hydroperoxides much more readily than H2O2, but the basis for this specificity has been unresolved. Several large amino acids form a hydrophobic "dome" over part of the heme, but when these residues were mutated to alanines there was little effect on Compound I formation from H2O2 or 15-hydroperoxyeicosatetraenoic acid, a surrogate substrate for PGG2. Ab initio calculations of heterolytic bond dissociation energies of the peroxyl groups of small peroxides indicated that they are almost the same. Molecular Dynamics simulations suggest that PGG2 binds the POX site through a peroxyl-iron bond, a hydrogen bond with His-207 and van der Waals interactions involving methylene groups adjoining the carbon bearing the peroxyl group and the protoporphyrin IX. We speculate that these latter interactions, which are not possible with H2O2, are major contributors to PGHS POX specificity. The distal Gln-203 four residues removed from His-207 have been thought to be essential for Compound I formation. However, Q203V PGHS-1 and PGHS-2 mutants catalyzed heterolytic cleavage of peroxides and exhibited native COX activity. PGHSs are homodimers with each monomer having a POX site and COX site. Cross-talk occurs between the COX sites of adjoining monomers. However, no cross-talk between the POX and COX sites of monomers was detected in a PGHS-2 heterodimer comprised of a Q203R monomer having an inactive POX site and a G533A monomer with an inactive COX site.

  15. Human hematopoietic prostaglandin D synthase inhibitor complex structures.

    Science.gov (United States)

    Kado, Yuji; Aritake, Kosuke; Uodome, Nobuko; Okano, Yousuke; Okazaki, Nobuo; Matsumura, Hiroyoshi; Urade, Yoshihiro; Inoue, Tsuyoshi

    2012-04-01

    In mast and Th2 cells, hematopoietic prostaglandin (PG) D synthase (H-PGDS) catalyses the isomerization of PGH(2) in the presence of glutathione (GSH) to produce the allergic and inflammatory mediator PGD(2). We determined the X-ray structures of human H-PGDS inhibitor complexes with 1-amino-4-{4-[4-chloro-6-(2-sulpho-phenylamino)-[1,3,5]triazin-2-ylmethyl]-3-sulpho-phenylamino}-9,10-dioxo-9,10-dihydro-anthracene-2-sulphonic acid (Cibacron Blue) and 1-amino-4-(4-aminosulphonyl) phenyl-anthraquinone-2-sulphonic acid (APAS) at 2.0 Å resolution. When complexed with H-PGDS, Cibacron Blue had an IC(50) value of 40 nM and APAS 2.1 μM. The Cibacron Blue molecule was stabilized by four hydrogen bonds and π-π stacking between the anthraquinone ring and Trp104, the ceiling of the active site H-PGDS pocket. Among the four hydrogen bonds, the Cibacron Blue terminal sulphonic group directly interacted with conserved residues Lys112 and Lys198, which recognize the PGH(2) substrate α-chain. In contrast, the APAS anthraquinone ring was inverted to interact with Trp104, while its benzenesulphonic group penetrated the GSH-bound region at the bottom of the active site. Due to the lack of extended aromatic rings, APAS could not directly hydrogen bond with the two conserved lysine residues, thus decreasing the total number of hydrogen bond from four to one. These factors may contribute to the 50-fold difference in the IC(50) values obtained for the two inhibitors.

  16. Cellulose synthase complex organization and cellulose microfibril structure.

    Science.gov (United States)

    Turner, Simon; Kumar, Manoj

    2018-02-13

    Cellulose consists of linear chains of β-1,4-linked glucose units, which are synthesized by the cellulose synthase complex (CSC). In plants, these chains associate in an ordered manner to form the cellulose microfibrils. Both the CSC and the local environment in which the individual chains coalesce to form the cellulose microfibril determine the structure and the unique physical properties of the microfibril. There are several recent reviews that cover many aspects of cellulose biosynthesis, which include trafficking of the complex to the plasma membrane and the relationship between the movement of the CSC and the underlying cortical microtubules (Bringmann et al. 2012 Trends Plant Sci. 17 , 666-674 (doi:10.1016/j.tplants.2012.06.003); Kumar & Turner 2015 Phytochemistry 112 , 91-99 (doi:10.1016/j.phytochem.2014.07.009); Schneider et al. 2016 Curr. Opin. Plant Biol. 34 , 9-16 (doi:10.1016/j.pbi.2016.07.007)). In this review, we will focus on recent advances in cellulose biosynthesis in plants, with an emphasis on our current understanding of the structure of individual catalytic subunits together with the local membrane environment where cellulose synthesis occurs. We will attempt to relate this information to our current knowledge of the structure of the cellulose microfibril and propose a model in which variations in the structure of the CSC have important implications for the structure of the cellulose microfibril produced.This article is part of a discussion meeting issue 'New horizons for cellulose nanotechnology'. © 2017 The Author(s).

  17. Molecular cloning and characterization of glycogen synthase in Eriocheir sinensis.

    Science.gov (United States)

    Li, Ran; Zhu, Li-Na; Ren, Li-Qi; Weng, Jie-Yang; Sun, Jin-Sheng

    2017-12-01

    Glycogen plays an important role in glucose and energy homeostasis at cellular and organismal levels. In glycogen synthesis, glycogen synthase (GS) is a rate-limiting enzyme catalysing the addition of α-1,4-linked glucose units from (UDP) 3 -glucose to a nascent glycogen chain using glycogenin (GN) as a primer. While studies on mammalian liver GS (GYS2) are numerous, enzymes from crustaceans, which also use glycogen and glucose as their main energy source, have received less attention. In the present study, we amplified full-length GS cDNA from Eriocheir sinensis. Tissue expression profiling revealed the highest expression of GS in the hepatopancreas. During moulting, GS expression and activity declined, and glycogen levels in the hepatopancreas were reduced. Recombinant GS was expressed in Escherichia coli Rosetta (DE3), and induction at 37°C or 16°C yielded EsGS in insoluble inclusion bodies (EsGS-I) or in soluble form (EsGS-S), respectively. Enzyme activity was measured in a cell-free system containing glucose-6-phosphate (G6P), and both forms possessed glycosyltransferase activity, but refolded EsGS-I was more active. Enzyme activity of both GS and EsGS-I in the hepatopancreas was optimum at 25°C, which is coincident with the optimum growth temperature of Chinese mitten crab, and higher (37°C) or lower (16°C) temperatures resulted in lower enzyme activity. Taken together, the results suggest that GS may be important for maintaining normal physiological functions such as growth and reproduction. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Cyclophilin D Promotes Brain Mitochondrial F1FO ATP Synthase Dysfunction in Aging Mice.

    Science.gov (United States)

    Gauba, Esha; Guo, Lan; Du, Heng

    2017-01-01

    Brain aging is the known strongest risk factor for Alzheimer's disease (AD). In recent years, mitochondrial deficits have been proposed to be a common mechanism linking brain aging to AD. Therefore, to elucidate the causative mechanisms of mitochondrial dysfunction in aging brains is of paramount importance for our understanding of the pathogenesis of AD, in particular its sporadic form. Cyclophilin D (CypD) is a specific mitochondrial protein. Recent studies have shown that F1FO ATP synthase oligomycin sensitivity conferring protein (OSCP) is a binding partner of CypD. The interaction of CypD with OSCP modulates F1FO ATP synthase function and mediates mitochondrial permeability transition pore (mPTP) opening. Here, we have found that increased CypD expression, enhanced CypD/OSCP interaction, and selective loss of OSCP are prominent brain mitochondrial changes in aging mice. Along with these changes, brain mitochondria from the aging mice demonstrated decreased F1FO ATP synthase activity and defective F1FO complex coupling. In contrast, CypD deficient mice exhibited substantially mitigated brain mitochondrial F1FO ATP synthase dysfunction with relatively preserved mitochondrial function during aging. Interestingly, the aging-related OSCP loss was also dramatically attenuated by CypD depletion. Therefore, the simplest interpretation of this study is that CypD promotes F1FO ATP synthase dysfunction and the resultant mitochondrial deficits in aging brains. In addition, in view of CypD and F1FO ATP synthase alterations seen in AD brains, the results further suggest that CypD-mediated F1FO ATP synthase deregulation is a shared mechanism linking mitochondrial deficits in brain aging and AD.

  19. Biosynthesis of the microtubule-destabilizing diterpene pseudolaric acid B from golden larch involves an unusual diterpene synthase

    OpenAIRE

    Mafu, Sibongile; Karunanithi, Prema Sambandaswami; Palazzo, Teresa Ann; Harrod, Bronwyn Lee; Rodriguez, Selina Marakana; Mollhoff, Iris Natalie; O’Brien, Terrence Edward; Tong, Shen; Fiehn, Oliver; Tantillo, Dean J.; Bohlmann, Jörg; Zerbe, Philipp

    2017-01-01

    Diterpenes play important roles in plant biology and serve as industrial bioproducts and therapeutics, including the anticancer drug Taxol. Enzymes of the diterpene synthase family produce the many core structural scaffolds that form the foundation of the large diversity of biologically active diterpenes. This paper describes the identification and the mechanism of a distinct diterpene synthase, pseudolaratriene synthase, from the golden larch tree, Pseudolarix amabilis. The enzyme catalyzes ...

  20. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

    Science.gov (United States)

    Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

    2013-12-05

    The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

  1. Fatty acid synthase - Modern tumor cell biology insights into a classical oncology target.

    Science.gov (United States)

    Buckley, Douglas; Duke, Gregory; Heuer, Timothy S; O'Farrell, Marie; Wagman, Allan S; McCulloch, William; Kemble, George

    2017-09-01

    Decades of preclinical and natural history studies have highlighted the potential of fatty acid synthase (FASN) as a bona fide drug target for oncology. This review will highlight the foundational concepts upon which this perspective is built. Published studies have shown that high levels of FASN in patient tumor tissues are present at later stages of disease and this overexpression predicts poor prognosis. Preclinical studies have shown that experimental overexpression of FASN in previously normal cells leads to changes that are critical for establishing a tumor phenotype. Once the tumor phenotype is established, FASN elicits several changes to the tumor cell and becomes intertwined with its survival. The product of FASN, palmitate, changes the biophysical nature of the tumor cell membrane; membrane microdomains enable the efficient assembly of signaling complexes required for continued tumor cell proliferation and survival. Membranes densely packed with phospholipids containing saturated fatty acids become resistant to the action of other chemotherapeutic agents. Inhibiting FASN leads to tumor cell death while sparing normal cells, which do not have the dependence of this enzyme for normal functions, and restores membrane architecture to more normal properties thereby resensitizing tumors to killing by chemotherapies. One compound has recently reached clinical studies in solid tumor patients and highlights the need for continued evaluation of the role of FASN in tumor cell biology. Significant advances have been made and much remains to be done to optimally apply this class of pharmacological agents for the treatment of specific cancers. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  2. Malate synthase: proof of a stepwise Claisen condensation using the double-isotope fractionation test

    International Nuclear Information System (INIS)

    Clark, J.D.; O'Keefe, S.J.; Knowles, J.R.

    1988-01-01

    Although aldolase-catalyzed condensations proceed by stepwise mechanisms via the intermediacy of nucleophilic enol(ate)s or enamines, the mechanisms of those enzymes that catalyze Claisen-type condensations are unclear. The reaction pathway followed by an enzyme from this second group, malate synthase, has been studied by the double-isotope fractionation method to determine whether the reaction is stepwise or concerted. In agreement with earlier work, a deuterium kinetic isotope effect /sup D/(V/K) of 1.3 +/- 0.1 has been found when [ 2 H 3 ]acetyl-CoA is the substrate. The 13 C isotope effect at the aldehydic carbon of glyoxylate has also been measured. For this determination, the malate product was quantitatively transformed into a new sample of malate having the carbon of interest at C-4. This material was decarboxylated by malic enzyme to produce the appropriate CO 2 for isotope ratio mass spectrometric analysis. The 13 C isotope effect with [ 1 H 3 ]acetyl-CoA is 1.0037 +/- 0.0004. By use of the known values of the intermolecular and intramolecular deuterium effects and of 13 (V/K)/sub H/, the value of the 13 C isotope effect when deuteriated [ 2 H 3 ]acetyl-CoA is the substrate can be predicted for three possible mechanisms. The results show clearly that the two salient characteristics of enzymes that catalyze Claisen-like condensations, namely, the absence of enzyme-catalyzed proton exchange with solvent and the inversion of the configuration at the nucleophilic center, which had been suggestive of a concerted pathway, are not mechanistically diagnostic

  3. Cloning and functional characterization of a gene for capsanthin-capsorubin synthase from tiger lily (Lilium lancifolium Thunb. 'Splendens').

    Science.gov (United States)

    Jeknić, Zoran; Morré, Jeffrey T; Jeknić, Stevan; Jevremović, Sladana; Subotić, Angelina; Chen, Tony H H

    2012-11-01

    The orange color of tiger lily (Lolium lancifolium 'Splendens') flowers is due, primarily, to the accumulation of two κ-xanthophylls, capsanthin and capsorubin. An enzyme, known as capsanthin-capsorubin synthase (CCS), catalyzes the conversion of antheraxanthin and violaxanthin into capsanthin and capsorubin, respectively. We cloned the gene for capsanthin-capsorubin synthase (Llccs) from flower tepals of L. lancifolium by the rapid amplification of cDNA ends (RACE) with a heterologous non-degenerate primer that was based on the sequence of a gene for lycopene β-cyclase (lcyB). The full-length cDNA of Llccs was 1,785 bp long and contained an open reading frame of 1,425 bp that encoded a polypeptide of 474 amino acids with a predicted N-terminal plastid-targeting sequence. Analysis by reverse transcription-PCR (RT-PCR) revealed that expression of Llccs was spatially and temporally regulated, with expression in flower buds and flowers of L. lancifolium but not in vegetative tissues. Stable overexpression of the Llccs gene in callus tissue of Iris germanica, which accumulates several xanthophylls including violaxanthin, the precursor of capsorubin, resulted in transgenic callus whose color had changed from its normal yellow to red-orange. This novel red-orange coloration was due to the accumulation of two non-native κ-xanthophylls, capsanthin and capsorubin, as confirmed by HPLC and ultraperformance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS) analysis with authentic standards. Cloning of the Llccs gene should advance our understanding of the molecular and genetic mechanisms of the biosynthesis of κ-carotenoids in general and in the genus Lilium in particular, and will facilitate transgenic alterations of the colors of flowers and fruits of many plant species.

  4. Three-dimensional structures of Plasmodium falciparum spermidine synthase with bound inhibitors suggest new strategies for drug design

    Energy Technology Data Exchange (ETDEWEB)

    Sprenger, Janina [Lund University, SE-221 00 Lund (Sweden); Lund University, SE-221 84 Lund (Sweden); Svensson, Bo [Lund University, SE-221 00 Lund (Sweden); SARomics Biostructures AB, Box 724, SE-220 07 Lund (Sweden); Hålander, Jenny [Lund University, SE-221 00 Lund (Sweden); Carey, Jannette [Princeton University, Princeton, New Jersey (United States); Persson, Lo [Lund University, SE-221 84 Lund (Sweden); Al-Karadaghi, Salam, E-mail: salam.al-karadaghi@biochemistry.lu.se [Lund University, SE-221 00 Lund (Sweden)

    2015-03-01

    In this work, X-ray crystallography was used to examine ligand complexes of spermidine synthase from the malaria parasite Plasmodium falciparum (PfSpdS). The enzymes of the polyamine-biosynthesis pathway have been proposed to be promising drug targets in the treatment of malaria. Spermidine synthase (SpdS; putrescine aminopropyltransferase) catalyzes the transfer of the aminopropyl moiety from decarboxylated S-adenosylmethionine to putrescine, leading to the formation of spermidine and 5′-methylthioadenosine (MTA). In this work, X-ray crystallography was used to examine ligand complexes of SpdS from the malaria parasite Plasmodium falciparum (PfSpdS). Five crystal structures were determined of PfSpdS in complex with MTA and the substrate putrescine, with MTA and spermidine, which was obtained as a result of the enzymatic reaction taking place within the crystals, with dcAdoMet and the inhibitor 4-methylaniline, with MTA and 4-aminomethylaniline, and with a compound predicted in earlier in silico screening to bind to the active site of the enzyme, benzimidazol-(2-yl)pentan-1-amine (BIPA). In contrast to the other inhibitors tested, the complex with BIPA was obtained without any ligand bound to the dcAdoMet-binding site of the enzyme. The complexes with the aniline compounds and BIPA revealed a new mode of ligand binding to PfSpdS. The observed binding mode of the ligands, and the interplay between the two substrate-binding sites and the flexible gatekeeper loop, can be used in the design of new approaches in the search for new inhibitors of SpdS.

  5. Glycogen synthase isoforms in Synechocystis sp. PCC6803: identification of different roles to produce glycogen by targeted mutagenesis.

    Directory of Open Access Journals (Sweden)

    Sang-Ho Yoo

    Full Text Available Synechocystis sp. PCC6803 belongs to cyanobacteria which carry out photosynthesis and has recently become of interest due to the evolutionary link between bacteria and plant species. Similar to other bacteria, the primary carbohydrate storage source of Synechocystis sp. PCC6803 is glycogen. While most bacteria are not known to have any isoforms of glycogen synthase, analysis of the genomic DNA sequence of Synechocystis sp. PCC6803 predicts that this strain encodes two isoforms of glycogen synthase (GS for synthesizing glycogen structure. To examine the functions of the putative GS genes, each gene (sll1393 or sll0945 was disrupted by double cross-over homologous recombination. Zymogram analysis of the two GS disruption mutants allowed the identification of a protein band corresponding to each GS isoform. Results showed that two GS isoforms (GSI and GSII are present in Synechocystis sp. PCC6803, and both are involved in glycogen biosynthesis with different elongation properties: GSI is processive and GSII is distributive. Total GS activities in the mutant strains were not affected and were compensated by the remaining isoform. Analysis of the branch-structure of glycogen revealed that the sll1393- mutant (GSI- produced glycogen containing more intermediate-length chains (DP 8-18 at the expense of shorter and longer chains compared with the wild-type strain. The sll0945- mutant (GSII- produced glycogen similar to the wild-type, with only a slightly higher proportion of short chains (DP 4-11. The current study suggests that GS isoforms in Synechocystis sp. PCC6803 have different elongation specificities in the biosynthesis of glycogen, combined with ADP-glucose pyrophosphorylase and glycogen branching enzyme.

  6. Role of Polymorphisms of Inducible Nitric Oxide Synthase and Endothelial Nitric Oxide Synthase in Idiopathic Environmental Intolerances

    Directory of Open Access Journals (Sweden)

    Chiara De Luca

    2015-01-01

    Full Text Available Oxidative stress and inflammation play a pathogenetic role in idiopathic environmental intolerances (IEI, namely, multiple chemical sensitivity (MCS, fibromyalgia (FM, and chronic fatigue syndrome (CFS. Given the reported association of nitric oxide synthase (NOS gene polymorphisms with inflammatory disorders, we aimed to investigate the distribution of NOS2A −2.5 kb (CCTTTn as well as Ser608Leu and NOS3 −786T>C variants and their correlation with nitrite/nitrate levels, in a study cohort including 170 MCS, 108 suspected MCS (SMCS, 89 FM/CFS, and 196 healthy subjects. Patients and controls had similar distributions of NOS2A Ser608Leu and NOS3 −786T>C polymorphisms. Interestingly, the NOS3 −786TT genotype was associated with increased nitrite/nitrate levels only in IEI patients. We also found that the NOS2A −2.5 kb (CCTTT11 allele represents a genetic determinant for FM/CFS, and the (CCTTT16 allele discriminates MCS from SMCS patients. Instead, the (CCTTT8 allele reduces by three-, six-, and tenfold, respectively, the risk for MCS, SMCS, and FM/CFS. Moreover, a short number of (CCTTT repeats is associated with higher concentrations of nitrites/nitrates. Here, we first demonstrate that NOS3 −786T>C variant affects nitrite/nitrate levels in IEI patients and that screening for NOS2A −2.5 kb (CCTTTn polymorphism may be useful for differential diagnosis of various IEI.

  7. CELLULOSE SYNTHASE-LIKE A2, a glucomannan synthase, is involved in maintaining adherent mucilage structure in Arabidopsis seed.

    Science.gov (United States)

    Yu, Li; Shi, Dachuan; Li, Junling; Kong, Yingzhen; Yu, Yanchong; Chai, Guohua; Hu, Ruibo; Wang, Juan; Hahn, Michael G; Zhou, Gongke

    2014-04-01

    Mannans are hemicellulosic polysaccharides that are considered to have both structural and storage functions in the plant cell wall. However, it is not yet known how mannans function in Arabidopsis (Arabidopsis thaliana) seed mucilage. In this study, CELLULOSE SYNTHASE-LIKE A2 (CSLA2; At5g22740) expression was observed in several seed tissues, including the epidermal cells of developing seed coats. Disruption of CSLA2 resulted in thinner adherent mucilage halos, although the total amount of the adherent mucilage did not change compared with the wild type. This suggested that the adherent mucilage in the mutant was more compact compared with that of the wild type. In accordance with the role of CSLA2 in glucomannan synthesis, csla2-1 mucilage contained 30% less mannosyl and glucosyl content than did the wild type. No appreciable changes in the composition, structure, or macromolecular properties were observed for nonmannan polysaccharides in mutant mucilage. Biochemical analysis revealed that cellulose crystallinity was substantially reduced in csla2-1 mucilage; this was supported by the removal of most mucilage cellulose through treatment of csla2-1 seeds with endo-β-glucanase. Mutation in CSLA2 also resulted in altered spatial distribution of cellulose and an absence of birefringent cellulose microfibrils within the adherent mucilage. As with the observed changes in crystalline cellulose, the spatial distribution of pectin was also modified in csla2-1 mucilage. Taken together, our results demonstrate that glucomannans synthesized by CSLA2 are involved in modulating the structure of adherent mucilage, potentially through altering cellulose organization and crystallization.

  8. Mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase: a control enzyme in ketogenesis.

    Science.gov (United States)

    Hegardt, F G

    1999-03-15

    Cytosolic and mitochondrial 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) synthases were first recognized as different chemical entities in 1975, when they were purified and characterized by Lane's group. Since then, the two enzymes have been studied extensively, one as a control site of the cholesterol biosynthetic pathway and the other as an important control site of ketogenesis. This review describes some key developments over the last 25 years that have led to our current understanding of the physiology of mitochondrial HMG-CoA synthase in the HMG-CoA pathway and in ketogenesis in the liver and small intestine of suckling animals. The enzyme is regulated by two systems: succinylation and desuccinylation in the short term, and transcriptional regulation in the long term. Both control mechanisms are influenced by nutritional and hormonal factors, which explains the incidence of ketogenesis in diabetes and starvation, during intense lipolysis, and in the foetal-neonatal and suckling-weaning transitions. The DNA-binding properties of the peroxisome-proliferator-activated receptor and other transcription factors on the nuclear-receptor-responsive element of the mitochondrial HMG-CoA synthase promoter have revealed how ketogenesis can be regulated by fatty acids. Finally, the expression of mitochondrial HMG-CoA synthase in the gonads and the correction of auxotrophy for mevalonate in cells deficient in cytosolic HMG-CoA synthase suggest that the mitochondrial enzyme may play a role in cholesterogenesis in gonadal and other tissues.

  9. Isolation, characterization, and mechanistic studies of (-)-alpha-gurjunene synthase from Solidago canadensis.

    Science.gov (United States)

    Schmidt, C O; Bouwmeester, H J; Bülow, N; König, W A

    1999-04-15

    The leaves of the composite Solidago canadensis (goldenrod) were shown to contain (-)-alpha-gurjunene synthase activity. This sesquiterpene is likely to be the precursor for cyclocolorenone, a sesquiterpene ketone present in high amounts in S. canadensis leaves. (-)-alpha-Gurjunene synthase was purified to apparent homogeneity (741-fold) by anion-exchange chromatography (on several matrices), dye ligand chromatography, hydroxylapatite chromatography, and gel filtration. Chromatography on a gel filtration matrix indicated a native molecular mass of 48 kDa, and SDS-PAGE showed the enzyme to be composed of one subunit with a denatured mass of 60 kDa. Its maximum activity was observed at pH 7.8 in the presence of 10 mM Mg2+ and the KM value for the substrate farnesyl diphosphate was 5.5 microM. Over a range of purification steps (-)-alpha-gurjunene and (+)-gamma-gurjunene synthase activities copurified. In addition, the product ratio of the enzyme activity under several different assay conditions was always 91% (-)-alpha-gurjunene and 9% (+)-gamma-gurjunene. This suggests that the formation of these two structurally related products is catalyzed by one enzyme. For further confirmation, we carried out a number of mechanistic studies with (-)-alpha-gurjunene synthase, in which an enzyme preparation was incubated with deuterated substrate analogues. Based on mass spectrometry analysis of the products formed, a cyclization mechanism was postulated which makes it plausible that the synthase catalyzes the formation of both sesquiterpenes. Copyright 1999 Academic Press.

  10. High order quaternary arrangement confers increased structural stability to Brucella Spp. lumazine synthase

    Energy Technology Data Exchange (ETDEWEB)

    Zylberman, V.; Craig, P.O.; Klinke, S.; Cauerhff, A.; Goldbaum, F.A. [Instituto Leloir, Buenos Aires (Argentina); Braden, B.C. [Bowie State Univ., Maryland (United States)

    2004-07-01

    The penultimate step in the pathway of riboflavin biosynthesis is catalyzed by the enzyme lumazine synthase (LS). One of the most distinctive characteristics of this enzyme is the structural quaternary divergence found in different species. The protein exists as pentameric and icosahedral forms, built from practically the same structural monomeric unit. The pentameric structure is formed by five 18 kDa monomers, each extensively contacting neighboring monomers. The icosahedral structure consists of 60 LS monomers arranged as twelve pentamers giving rise to a capsid exhibiting icosahedral 532 symmetry. In all lumazine synthases studied, the topologically equivalent active sites are located at the interfaces between adjacent subunits in the pentameric modules. The Brucella spp. lumazine synthase (BLS) sequence clearly diverges from pentameric and icosahedral enzymes. This unusual divergence prompted to further investigate on its quaternary arrangement. In the present work, we demonstrate by means of solution Light Scattering and X-ray structural analyses that BLS assembles as a very stable dimer of pentamers representing a third category of quaternary assembly for lumazine synthases. We also describe by spectroscopic studies the thermodynamic stability of this oligomeric protein, and postulate a mechanism for dissociation/unfolding of this macromolecular assembly. The higher molecular order of BLS increases its stability 20 deg C compared to pentameric lumazine synthases. The decameric arrangement described in this work highlights the importance of quaternary interactions in the stabilization of proteins. (author)

  11. Biotechnical production of trehalose through the trehalose synthase pathway: current status and future prospects.

    Science.gov (United States)

    Cai, Xue; Seitl, Ines; Mu, Wanmeng; Zhang, Tao; Stressler, Timo; Fischer, Lutz; Jiang, Bo

    2018-04-01

    Trehalose (α-D-glucopyranosyl-(1 → 1)-α-D-glucopyranoside) is a non-reducing disaccharide composed of two glucose molecules linked by an α,α-1,1-glycosidic bond. It possesses physicochemical properties, which account for its biological roles in a variety of prokaryotic and eukaryotic organisms and invertebrates. Intensive studies of trehalose gradually uncovered its functions, and its applications in foods, cosmetics, and pharmaceuticals have increased every year. Currently, trehalose is industrially produced by the two-enzyme method, which was first developed in 1995 using maltooligosyltrehalose synthase (EC 5.4.99.15) and subsequently using maltooligosyltrehalose trehalohydrolase (EC 3.2.1.141), with starch as the substrate. This biotechnical method has lowered the price of trehalose and expanded its applications. However, when trehalose synthase (EC 5.4.99.16) was later discovered, this method for trehalose production using maltose as the substrate soon became a popular topic because of its simplicity and potential in industrial production. Since then, many trehalose synthases have been studied. This review summarizes the sources and characteristics of reported trehalose synthases, and the most recent advances on structural analysis of trehalose synthase, catalytic mechanism, molecular modification, and usage in industrial production processes.

  12. Pivotal role of glycogen synthase kinase-3: A therapeutic target for Alzheimer's disease.

    Science.gov (United States)

    Maqbool, Mudasir; Mobashir, Mohammad; Hoda, Nasimul

    2016-01-01

    Neurodegenerative diseases are among the most challenging diseases with poorly known mechanism of cause and paucity of complete cure. Out of all the neurodegenerative diseases, Alzheimer's disease is the most devastating and loosening of thinking and judging ability disease that occurs in the old age people. Many hypotheses came forth in order to explain its causes. In this review, we have enlightened Glycogen Synthase Kinase-3 which has been considered as a concrete cause for Alzheimer's disease. Plaques and Tangles (abnormal structures) are the basic suspects in damaging and killing of nerve cells wherein Glycogen Synthase Kinase-3 has a key role in the formation of these fatal accumulations. Various Glycogen Synthase Kinase-3 inhibitors have been reported to reduce the amount of amyloid-beta as well as the tau hyperphosphorylation in both neuronal and nonneuronal cells. Additionally, Glycogen Synthase Kinase-3 inhibitors have been reported to enhance the adult hippocampal neurogenesis in vivo as well as in vitro. Keeping the chemotype of the reported Glycogen Synthase Kinase-3 inhibitors in consideration, they may be grouped into natural inhibitors, inorganic metal ions, organo-synthetic, and peptide like inhibitors. On the basis of their mode of binding to the constituent enzyme, they may also be grouped as ATP, nonATP, and allosteric binding sites competitive inhibitors. ATP competitive inhibitors were known earlier inhibitors but they lack efficient selectivity. This led to find the new ways for the enzyme inhibition. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  13. Association of a Soybean Raffinose Synthase Gene with Low Raffinose and Stachyose Seed Phenotype

    Directory of Open Access Journals (Sweden)

    Emily C. Dierking

    2008-11-01

    Full Text Available Oligosaccharides are an important component of soybean [ (L. Merr.] meal in terms of metabolizable energy for monogastric animals. Sucrose, raffinose, and stachyose are the three main oligosaccharides present in soybean meal. Of the three, only sucrose is nutritionally useful. When raffinose and stachyose are fermented by microbes present in the gut, the results are flatulence and discomfort, which ultimately lead to poor weight gain. The long term objective of this research is ultimately to increase the nutritional value of soybean meal by elevating the metabolizable energy at the expense of raffinose and stachyose through the manipulation of soybean raffinose synthase, the key enzyme for raffinose and stachyose biosynthesis. The objectives of this work were to develop molecular genetic information about soybean raffinose synthases and to evaluate the candidate raffinose synthase genes in a soybean germplasm accession (PI 200508 that contains low levels of raffinose and stachyose. Our results indicate the soybean genome contains at least two expressed genes similar to other characterized raffinose synthases. A novel allele of one of these putative soybean raffinose synthase genes was discovered from the PI 200508 that completely associates with the low raffinose and stachyose phenotype. Molecular marker assays specific for the PI 200508 allele were developed to allow direct selection for the low raffinose and low stachyose phenotype.

  14. Mitochondrial ATP synthases cluster as discrete domains that reorganize with the cellular demand for oxidative phosphorylation.

    Science.gov (United States)

    Jimenez, Laure; Laporte, Damien; Duvezin-Caubet, Stephane; Courtout, Fabien; Sagot, Isabelle

    2014-02-15

    Mitochondria are double membrane-bounded organelles that form a dynamic tubular network. Mitochondria energetic functions depend on a complex internal architecture. Cristae, inner membrane invaginations that fold into the matrix space, are proposed to be the site of oxidative phosphorylation, reactions by which ATP synthase produces ATP. ATP synthase is also thought to have a role in crista morphogenesis. To date, the exploration of the processes regulating mitochondrial internal compartmentalization have been mostly limited to electron microscopy. Here, we describe ATP synthase localization in living yeast cells and show that it clusters as discrete inner membrane domains. These domains are dynamic within the mitochondrial network. They are impaired in mutants defective in crista morphology and partially overlap with the crista-associated MICOS-MINOS-MITOS complex. Finally, ATP synthase occupancy increases with the cellular demand for OXPHOS. Overall our data suggest that domains in which ATP synthases are clustered correspond to mitochondrial cristae. Being able to follow mitochondrial sub-compartments in living yeast cells opens new avenues to explore the mechanisms involved in inner membrane remodeling, an architectural feature crucial for mitochondrial activities.

  15. Heterologous expression of dammarenediol synthase gene in an engineered Saccharomyces cerevisiae.

    Science.gov (United States)

    Liang, Y-L; Zhao, S-J; Xu, L-X; Zhang, X-Y

    2012-11-01

    Dammarenediol production by an engineered yeast Saccharomyces cerevisiae was investigated. A dammarenediol-producing engineered yeast was constructed by heterologous expression of the dammarenediol synthase gene from Panax ginseng hairy roots through RT-PCR. Fermentation was carried out in a 5-L GRJY-bioreactor with an inoculum size of 1% v/v at 30°C. Dammarenediol detection was performed with silica gel chromatography and HPLC. Determination of dammarenediol synthase activity subcellular distribution was carried out by surveying the enzyme activity in microsomes, lipid particles and total yeast homogenate. When cultured under aerobic conditions, the engineered yeast could produce dammarenediol up to 250μgl(-1). However, when an anaerobic shift strategy was employed, dammarenediol accumulated at a level as twice as that under aerobic condition. The dammarenediol synthase and dammarenediol were mainly localized in lipid particles. Dammarenediol could be heterologously produced in engineered yeast. The heterologously expressed dammarenediol synthase is mainly localized in lipid particles. Anaerobic shift strategy could enhance the dammarenediol level in the engineered yeast. This study showed that the high-value plant product dammarenediol could be produced by heterologous expression of the according gene in yeast. Furthermore, the anaerobic shift strategy could be potentially applied in oxidosqualene-derived compounds production in yeast. Here, the information about subcellular distribution of heterologously expressed dammarenediol synthase in the engineered yeast was also provided. © 2012 The Authors. Letters in Applied Microbiology © 2012 The Society for Applied Microbiology.

  16. Dihydropteroate Synthase of Mycobacterium leprae and Dapsone Resistance

    Science.gov (United States)

    Williams, Diana L.; Spring, Laynette; Harris, Eugene; Roche, Paul; Gillis, Thomas P.

    2000-01-01

    Two Mycobacterium leprae genes, folP1 and folP2, encoding putative dihydropteroate synthases (DHPS), were studied for enzymatic activity and for the presence of mutations associated with dapsone resistance. Each gene was cloned and expressed in a folP knockout mutant of Escherichia coli (C600ΔfolP::Kmr). Expression of M. leprae folP1 in C600ΔfolP::Kmr conferred growth on a folate-deficient medium, and bacterial lysates exhibited DHPS activity. This recombinant displayed a 256-fold-greater sensitivity to dapsone (measured by the MIC) than wild-type E. coli C600, and 50-fold less dapsone was required to block (expressed as the 50% inhibitory concentration [IC50]) the DHPS activity of this recombinant. When the folP1 genes of several dapsone-resistant M. leprae clinical isolates were sequenced, two missense mutations were identified. One mutation occurred at codon 53, substituting an isoleucine for a threonine residue (T53I) in the DHPS-1, and a second mutation occurred in codon 55, substituting an arginine for a proline residue (P55R). Transformation of the C600ΔfolP::Kmr knockout with plasmids carrying either the T53I or the P55R mutant allele did not substantially alter the DHPS activity compared to levels produced by recombinants containing wild-type M. leprae folP1. However, both mutations increased dapsone resistance, with P55R having the greatest affect on dapsone resistance by increasing the MIC 64-fold and the IC50 68-fold. These results prove that the folP1 of M. leprae encodes a functional DHPS and that mutations within this gene are associated with the development of dapsone resistance in clinical isolates of M. leprae. Transformants created with M. leprae folP2 did not confer growth on the C600ΔfolP::Kmr knockout strain, and DNA sequences of folP2 from dapsone-susceptible and -resistant M. leprae strains were identical, indicating that this gene does not encode a functional DHPS and is not involved in dapsone resistance in M. leprae. PMID:10817704

  17. ENSO Prediction and Predictability

    Science.gov (United States)

    Cane, M. A.

    2016-12-01

    In 1986 there was one dynamical forecasting model for ENSO and a small handful of statistical and hybrid schemes. Now there are more than 40 models in the IRI-CPC forecast plume, many of them coupled GCMs. Why hasn't forecasting improved more in 30 years? In a 1982 landmark paper, Rasmussen and Carpenter created the canonical El Niño, transforming the inchoate view of the time. Now much research is focuses on ENSO diversity. Is our understanding deeper for this? Has this work properly incorporated the ENSO life cycle of the canonical event? Some eras are more predictable than others. Why? Is it random, or is there a systematic difference in background state? Do we have any idea how predictable ENSO is? Why is the ENSO band 2-7 years? What will become of ENSO in the next century?

  18. Crystallization and preliminary crystallographic analysis of an octaketide-producing plant type III polyketide synthase

    Energy Technology Data Exchange (ETDEWEB)

    Morita, Hiroyuki [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan); Kondo, Shin; Kato, Ryohei [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Wanibuchi, Kiyofumi; Noguchi, Hiroshi [School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka 422-8526 (Japan); Sugio, Shigetoshi, E-mail: sugio.shigetoshi@mw.m-kagaku.co.jp [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Abe, Ikuro, E-mail: sugio.shigetoshi@mw.m-kagaku.co.jp [School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka 422-8526 (Japan); PRESTO, Japan Science and Technology Agency, Kawaguchi, Saitama 332-0012 (Japan); Kohno, Toshiyuki, E-mail: sugio.shigetoshi@mw.m-kagaku.co.jp [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan)

    2007-11-01

    Octaketide synthase from A. arborescens has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.6 Å. Octaketide synthase (OKS) from Aloe arborescens is a plant-specific type III polyketide synthase that produces SEK4 and SEK4b from eight molecules of malonyl-CoA. Recombinant OKS expressed in Escherichia coli was crystallized by the hanging-drop vapour-diffusion method. The crystals belonged to space group I422, with unit-cell parameters a = b = 110.2, c = 281.4 Å, α = β = γ = 90.0°. Diffraction data were collected to 2.6 Å resolution using synchrotron radiation at BL24XU of SPring-8.

  19. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    Science.gov (United States)

    Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  20. Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.

    Science.gov (United States)

    Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako

    2009-02-01

    Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.

  1. Progress challenges and opportunities for the re-engineering of trans-AT polyketide synthases.

    Science.gov (United States)

    Till, M; Race, P R

    2014-05-01

    Polyketides are a structurally and functionally diverse family of bioactive natural products that are used extensively as pharmaceuticals and agrochemicals. In bacteria these molecules are biosynthesized by giant, multi-functional enzymatic complexes, termed modular polyketide synthases (PKSs), that function in assembly-line like fashion to fuse and tailor simple carboxylic acid monomers into a vast array of elaborate chemical scaffolds. Modifying PKSs through targeted synthase re-engineering is a promising approach for accessing functionally-optimized polyketides. Due to their highly mosaic architectures the recently identified trans-AT family of modular synthases appear inherently more amenable to re-engineering than their well studied cis-AT counterparts. Here, we review recent progress in the re-engineering of trans-AT PKSs, summarize opportunities for harnessing the biosynthetic potential of these systems, and highlight challenges that such re-engineering approaches present.

  2. Human METTL12 is a mitochondrial methyltransferase that modifies citrate synthase.

    Science.gov (United States)

    Rhein, Virginie F; Carroll, Joe; Ding, Shujing; Fearnley, Ian M; Walker, John E

    2017-06-01

    The protein methylome in mammalian mitochondria has been little studied until recently. Here, we describe that lysine-368 of human citrate synthase is methylated and that the modifying enzyme, localized in the mitochondrial matrix, is methyltransferase-like protein 12 (METTL12), a member of the family of 7β-strand methyltransferases. Lysine-368 is near the active site of citrate synthase, but removal of methylation has no effect on its activity. In mitochondria, it is possible that some or all of the enzymes of the citric acid cycle, including citrate synthase, are organized in metabolons to facilitate the channelling of substrates between participating enzymes. Thus, possible roles for the methylation of Lys-368 are in controlling substrate channelling itself, or in influencing protein-protein interactions in the metabolon. © 2017 The Authors FEBS Letters published by John Wiley & Sons Ltd on behalf of Federation of European Biochemical Societies.

  3. Proposed mechanism for diterpene synthases in the formation of phomactatriene and taxadiene.

    Science.gov (United States)

    Tokiwano, Tetsuo; Endo, Taeko; Tsukagoshi, Tae; Goto, Hitoshi; Fukushi, Eri; Oikawa, Hideaki

    2005-08-07

    To obtain insight into how the cyclization pathway is controlled, the mechanism of diterpene synthase reactions (the putative phomactatriene synthase and taxadiene synthases) involving the same intermediate was investigated in detail. The mechanism of the initial transformation of GGDP to verticillen-12-yl cation (A+) was proposed based on the labelling pattern of phomactatriene (9a) obtained in the feeding experiments with 13C-labelled acetates. To obtain information on the reaction pathway of A+ to 9a and taxadiene, reactions of verticillol with various acids were conducted. Structural determination of products allowed us to propose a reaction pathway via cations A+, D+, E+, F+ and G+. Identification of hydrocarbons in mycelial extracts of phomactin-producing fungus supported the proposed reaction mechanism. Based on the results of ab initio calculations for highly flexible cation intermediates, a mechanism is proposed.

  4. Novel polyhydroxyalkanoate copolymers produced in Pseudomonas putida by metagenomic polyhydroxyalkanoate synthases.

    Science.gov (United States)

    Cheng, Jiujun; Charles, Trevor C

    2016-09-01

    Bacterially produced biodegradable polyhydroxyalkanoates (PHAs) with versatile properties can be achieved using different PHA synthases (PhaCs). This work aims to expand the diversity of known PhaCs via functional metagenomics and demonstrates the use of these novel enzymes in PHA production. Complementation of a PHA synthesis-deficient Pseudomonas putida strain with a soil metagenomic cosmid library retrieved 27 clones expressing either class I, class II, or unclassified PHA synthases, and many did not have close sequence matches to known PhaCs. The composition of PHA produced by these clones was dependent on both the supplied growth substrates and the nature of the PHA synthase, with various combinations of short-chain-length (SCL) and medium-chain-length (MCL) PHA. These data demonstrate the ability to isolate diverse genes for PHA synthesis by functional metagenomics and their use for the production of a variety of PHA polymer and copolymer mixtures.

  5. Broad Substrate Specificity of the Loading Didomain of the Lipomycin Polyketide Synthase

    Energy Technology Data Exchange (ETDEWEB)

    Yuzawa, S; Eng, CH; Katz, L; Keasling, JD

    2013-06-04

    LipPks1, a polyketide synthase subunit of the lipomycin synthase, is believed to catalyze the polyketide chain initiation reaction using isobutyryl-CoA as a substrate, followed by an elongation reaction with methylmalonyl-CoA to start the biosynthesis of antibiotic alpha-lipomycin in Streptomyces aureofaciens Tu117. Recombinant LipPks1, containing the thioesterase domain from the 6-deoxyerythronolide B synthase, was produced in Escherichia coli, and its substrate specificity was investigated in vitro. Surprisingly, several different acyl-CoAs, including isobutyryl-CoA, were accepted as the starter substrates, while no product was observed with acetyl-CoA. These results demonstrate the broad substrate specificity of LipPks1 and may be applied to producing new antibiotics.

  6. WALS Prediction

    NARCIS (Netherlands)

    Magnus, J.R.; Wang, W.; Zhang, Xinyu

    2012-01-01

    Abstract: Prediction under model uncertainty is an important and difficult issue. Traditional prediction methods (such as pretesting) are based on model selection followed by prediction in the selected model, but the reported prediction and the reported prediction variance ignore the uncertainty

  7. Functional Characterization of Nine Norway Spruce TPS Genes and Evolution of Gymnosperm Terpene Synthases of the TPS-d Subfamily1[w

    Science.gov (United States)

    Martin, Diane M.; Fäldt, Jenny; Bohlmann, Jörg

    2004-01-01

    Constitutive and induced terpenoids are important defense compounds for many plants against potential herbivores and pathogens. In Norway spruce (Picea abies L. Karst), treatment with methyl jasmonate induces complex chemical and biochemical terpenoid defense responses associated with traumatic resin duct development in stems and volatile terpenoid emissions in needles. The cloning of (+)-3-carene synthase was the first step in characterizing this system at the molecular genetic level. Here we report the isolation and functional characterization of nine additional terpene synthase (TPS) cDNAs from Norway spruce. These cDNAs encode four monoterpene synthases, myrcene synthase, (−)-limonene synthase, (−)-α/β-pinene synthase, and (−)-linalool synthase; three sesquiterpene synthases, longifolene synthase, E,E-α-farnesene synthase, and E-α-bisabolene synthase; and two diterpene synthases, isopimara-7,15-diene synthase and levopimaradiene/abietadiene synthase, each with a unique product profile. To our knowledge, genes encoding isopimara-7,15-diene synthase and longifolene synthase have not been previously described, and this linalool synthase is the first described from a gymnosperm. These functionally diverse TPS account for much of the structural diversity of constitutive and methyl jasmonate-induced terpenoids in foliage, xylem, bark, and volatile emissions from needles of Norway spruce. Phylogenetic analyses based on the inclusion of these TPS into the TPS-d subfamily revealed that functional specialization of conifer TPS occurred before speciation of Pinaceae. Furthermore, based on TPS enclaves created by distinct branching patterns, the TPS-d subfamily is divided into three groups according to sequence similarities and functional assessment. Similarities of TPS evolution in angiosperms and modeling of TPS protein structures are discussed. PMID:15310829

  8. Association of Endothelial Nitric Oxide Synthase Gene Polymorphisms With Acute Rejection in Liver Transplant Recipients.

    Science.gov (United States)

    Azarpira, Negar; Namazi, Soha; Malahi, Sayan; Kazemi, Kourosh

    2016-06-01

    Polymorphisms of the endothelial nitric oxide synthase gene have been associated with altered endothelial nitric oxide synthase activity. The purpose of this study was to investigate the relation between endothelial nitric oxide synthase -786T/C and 894G/T polymorphism and their haplotypes on the occurrence of acute rejection episodes in liver transplant recipients. We conducted a case control study in which 100 liver transplant recipients and 100 healthy controls were recruited from Shiraz Transplant Center. The patients used triple therapy including tacrolimus, mycophenolate mofetil, and prednisolone for immunosuppression maintenance. DNA was extracted from peripheral blood and endothelial nitric oxide synthase polymorphisms were determined by polymerase chain reaction and restriction fragment length polymorphism. Patients included 60 men and 40 women (mean age, 32.35 ± 10.2 y). There was a significant association of endothelial nitric oxide synthase 894G/T and acute rejection episode. The GT* gen-otype and acute rejection episodes had a significant association (odds ratio, 2.42; 95% confidence interval, 0.97-6.15; P = .03). The GG and GT* genotype and T* allele frequency were significantly different between patients and control subjects (P = .001). Haplotype TT* was higher in recipients than control subjects (odds ratio, 2.17; 95% confidence interval, 1.12-4.25; P = .01). Haplotype TG was higher in the control group (odds ratio, 0.62; 95% confidence interval, 0.40-0.96; P = .02). Our results suggest a relation between different endothelial nitric oxide synthase geno-types and risk of acute rejection episodes. However, further study is necessary to determine genetic susceptibility for transplant patients.

  9. Crystal Structure of Albaflavenone Monooxygenase Containing a Moonlighting Terpene Synthase Active Site

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Bin; Lei, Li; Vassylyev, Dmitry G.; Lin, Xin; Cane, David E.; Kelly, Steven L.; Yuan, Hang; Lamb, David C.; Waterman, Michael R.; (Vanderbilt); (UAB); (Brown); (Swansea)

    2010-01-08

    Albaflavenone synthase (CYP170A1) is a monooxygenase catalyzing the final two steps in the biosynthesis of this antibiotic in the soil bacterium, Streptomyces coelicolor A3(2). Interestingly, CYP170A1 shows no stereo selection forming equal amounts of two albaflavenol epimers, each of which is oxidized in turn to albaflavenone. To explore the structural basis of the reaction mechanism, we have studied the crystal structures of both ligand-free CYP170A1 (2.6 {angstrom}) and complex of endogenous substrate (epi-isozizaene) with CYP170A1 (3.3 {angstrom}). The structure of the complex suggests that the proximal epi-isozizaene molecules may bind to the heme iron in two orientations. In addition, much to our surprise, we have found that albaflavenone synthase also has a second, completely distinct catalytic activity corresponding to the synthesis of farnesene isomers from farnesyl diphosphate. Within the cytochrome P450 {alpha}-helical domain both the primary sequence and x-ray structure indicate the presence of a novel terpene synthase active site that is moonlighting on the P450 structure. This includes signature sequences for divalent cation binding and an {alpha}-helical barrel. This barrel is unusual because it consists of only four helices rather than six found in all other terpene synthases. Mutagenesis establishes that this barrel is essential for the terpene synthase activity of CYP170A1 but not for the monooxygenase activity. This is the first bifunctional P450 discovered to have another active site moonlighting on it and the first time a terpene synthase active site is found moonlighting on another protein.

  10. Transcriptional regulation of mitochondrial HMG-CoA synthase in the control of ketogenesis.

    Science.gov (United States)

    Hegardt, F G

    1998-10-01

    Mitochondrial and cytosolic HMG-CoA synthases are encoded by two different genes. Control of ketogenesis is exerted by transcriptional regulation of mitochondrial HMG-CoA synthase. Fasting, cAMP, and fatty acids increase its transcriptional rate, while refeeding and insulin repress it. Fatty acids increase transcription through peroxisomal proliferator regulatory element (PPRE), to which peroxisome proliferator activated receptor (PPAR) can bind. Other transcription factors such as chicken ovalbumin upstream promoter transcription factor (COUP-TF) and hepatocyte nuclear factor 4 (HNF-4) compete for the PPRE site, modulating the response of PPAR.

  11. Identification, functional characterization and developmental regulation of sesquiterpene synthases from sunflower capitate glandular trichomes

    Directory of Open Access Journals (Sweden)

    Ro Dae-Kyun

    2009-07-01

    Full Text Available Abstract Background Sesquiterpene lactones are characteristic metabolites of Asteraceae (or Compositae which often display potent bioactivities and are sequestered in specialized organs such as laticifers, resin ducts, and trichomes. For characterization of sunflower sesquiterpene synthases we employed a simple method to isolate pure trichomes from anther appendages which facilitated the identification of these genes and investigation of their enzymatic functions and expression patterns during trichome development. Results Glandular trichomes of sunflower (Helianthus annuus L. were isolated, and their RNA was extracted to investigate the initial steps of sesquiterpene lactone biosynthesis. Reverse transcription-PCR experiments led to the identification of three sesquiterpene synthases. By combination of in vitro and in vivo characterization of sesquiterpene synthase gene products in Escherichia coli and Saccharomyces cerevisiae, respectively, two enzymes were identified as germacrene A synthases, the key enzymes of sesquiterpene lactone biosynthesis. Due to the very low in vitro activity, the third enzyme was expressed in vivo in yeast as a thioredoxin-fusion protein for functional characterization. In in vivo assays, it was identified as a multiproduct enzyme with the volatile sesquiterpene hydrocarbon δ-cadinene as one of the two main products with α-muuorlene, β-caryophyllene, α-humulene and α-copaene as minor products. The second main compound remained unidentified. For expression studies, glandular trichomes from the anther appendages of sunflower florets were isolated in particular developmental stages from the pre- to the post-secretory phase. All three sesquiterpene synthases were solely upregulated during the biosynthetically active stages of the trichomes. Expression in different aerial plant parts coincided with occurrence and maturity of trichomes. Young roots with root hairs showed expression of the sesquiterpene synthase genes

  12. Studies on the chalcone synthase gene of two higher plants: petroselinum hortense and matthiola incana

    Energy Technology Data Exchange (ETDEWEB)

    Hemleben, V.; Frey, M.; Rall, S.; Koch, M.; Kittel, M.; Kreuzaler, F.; Ragg, H.; Fautz, E.; Hahlbrock, K.

    1982-01-01

    Two higher plant systems are presented which allow to study coordinated gene expression of the light-induced metabolic pathway of flavonoid biosynthesis: tissue culture cells of Petroselinum hortense (Apiaceae) and different developmental stages of various genotypes of Matthiola incana (Brassicaceae). The gene structure of the chalcone synthase is mainly studied. A cDNA clone (pLF56) of parsley has been constructed and characterized conferring the chalcone synthase gene sequence. Strong cross hybridization between the parsley cDNA and Matthiola DNA allowed to identify a HindIII fragment (6000 bp) identical in size for parsley and different Matthiola wild type lines and a mutant line.

  13. Studies on the chalcone synthase gene of two higher plants: petroselinum hortense and matthiola incana.

    Science.gov (United States)

    Hemleben, V; Frey, M; Rall, S; Koch, M; Kittel, M; Kreuzaler, F; Ragg, H; Fautz, E; Hahlbrock, K

    1982-01-01

    Two higher plant systems are presented which allow to study coordinated gene expression of the light-induced metabolic pathway of flavonoid biosynthesis: tissue culture cells of Petroselinum hortense (Apiaceae) and different developmental stages of various genotypes of Matthiola incana (Brassicaceae). The gene structure of the chalcone synthase is mainly studied. A cDNA clone (pLF56) of parsley has been constructed and characterized conferring the chalcone synthase gene sequence. Strong cross hybridization between the parsley cDNA and Matthiola DNA allowed to identify a HindIII fragment (6000 bp) identical in size for parsley and different Matthiola wild type lines and a mutant line.

  14. Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species.

    Science.gov (United States)

    Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing

    2016-03-01

    Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. The primary diterpene synthase products of Picea abies levopimaradiene/abietadiene synthase (PaLAS) are epimers of a thermally unstable diterpenol.

    Science.gov (United States)

    Keeling, Christopher I; Madilao, Lina L; Zerbe, Philipp; Dullat, Harpreet K; Bohlmann, Jörg

    2011-06-17

    The levopimaradiene/abietadiene synthase from Norway spruce (Picea abies; PaLAS) has previously been reported to produce a mixture of four diterpene hydrocarbons when incubated with geranylgeranyl diphosphate as the substrate: levopimaradiene, abietadiene, neoabietadiene, and palustradiene. However, variability in the assay products observed by GC-MS of this and orthologous conifer diterpene synthases over the past 15 years suggested that these diterpenes may not be the initial enzyme assay products but are rather the products of dehydration of an unstable alcohol. We have identified epimers of the thermally unstable allylic tertiary alcohol 13-hydroxy-8(14)-abietene as the products of PaLAS. The identification of these compounds, not previously described in conifers, as the initial products of PaLAS has considerable implications for our understanding of the complexity of the biosynthetic pathway of the structurally diverse diterpene resin acids of conifer defense.

  16. Predictive Testing

    Science.gov (United States)

    ... you want to learn. Search form Search Predictive testing You are here Home Testing & Services Testing for ... you make the decision. What Is Predictive Genetic Testing Predictive genetic testing searches for genetic changes, or ...

  17. Cloning and sequencing of cDNAs specifying a novel class of phosphoribosyl diphosphate synthase in Arabidopsis thaliana

    DEFF Research Database (Denmark)

    Krath, Britta N.; Eriksen, Tina A.; Poulsen, Tim S.

    1999-01-01

    cDNAs specifying four active phosphoribosyl diphosphate synthase isozymes were isolated from an Arabidopsis thaliana cDNA library. In contrast to other phosphoribosyl diphosphate synthases the activity of two of the A. thaliana isozymes are independent of Pi. Amino acid sequence comparison...

  18. Biallelic variants in WARS2 encoding mitochondrial tryptophanyl-tRNA synthase in six individuals with mitochondrial encephalopathy

    NARCIS (Netherlands)

    Wortmann, Saskia B.; Timal, Sharita; Venselaar, Hanka; Wintjes, Liesbeth T.; Kopajtich, Robert; Feichtinger, Rene G.; Onnekink, Carla; Muhlmeister, Mareike; Brandt, Ulrich; Smeitink, Jan A.; Veltman, Joris A.; Sperl, Wolfgang; Lefeber, Dirk; Pruijn, Ger; Stojanovic, Vesna; Freisinger, Peter; von Spronsen, Francjan; Derks, Terry G. J.; Veenstra-Knol, Hermine E.; Mayr, Johannes A.; Rotig, Agnes; Tarnopolsky, Mark; Prokisch, Holger; Rodenburg, Richard J.

    2017-01-01

    Mitochondrial protein synthesis involves an intricate interplay between mitochondrial DNA encoded RNAs and nuclear DNA encoded proteins, such as ribosomal proteins and aminoacyl-tRNA synthases. Eukaryotic cells contain 17 mitochondria-specific aminoacyl-tRNA synthases. WARS2 encodes mitochondrial

  19. Friedelin Synthase from Maytenus ilicifolia: Leucine 482 Plays an Essential Role in the Production of the Most Rearranged Pentacyclic Triterpene

    Science.gov (United States)

    Souza-Moreira, Tatiana M.; Alves, Thaís B.; Pinheiro, Karina A.; Felippe, Lidiane G.; de Lima, Gustavo M. A.; Watanabe, Tatiana F.; Barbosa, Cristina C.; Santos, Vânia A. F. F. M.; Lopes, Norberto P.; Valentini, Sandro R.; Guido, Rafael V. C.; Furlan, Maysa; Zanelli, Cleslei F.

    2016-11-01

    Among the biologically active triterpenes, friedelin has the most-rearranged structure produced by the oxidosqualene cyclases and is the only one containing a cetonic group. In this study, we cloned and functionally characterized friedelin synthase and one cycloartenol synthase from Maytenus ilicifolia (Celastraceae). The complete coding sequences of these 2 genes were cloned from leaf mRNA, and their functions were characterized by heterologous expression in yeast. The cycloartenol synthase sequence is very similar to other known OSCs of this type (approximately 80% identity), although the M. ilicifolia friedelin synthase amino acid sequence is more related to β-amyrin synthases (65-74% identity), which is similar to the friedelin synthase cloned from Kalanchoe daigremontiana. Multiple sequence alignments demonstrated the presence of a leucine residue two positions upstream of the friedelin synthase Asp-Cys-Thr-Ala-Glu (DCTAE) active site motif, while the vast majority of OSCs identified so far have a valine or isoleucine residue at the same position. The substitution of the leucine residue with valine, threonine or isoleucine in M. ilicifolia friedelin synthase interfered with substrate recognition and lead to the production of different pentacyclic triterpenes. Hence, our data indicate a key role for the leucine residue in the structure and function of this oxidosqualene cyclase.

  20. A highly prevalent equine glycogen storage disease is explained by constitutive activation of a mutant glycogen synthase

    DEFF Research Database (Denmark)

    Maile, C A; Hingst, Janne Rasmuss; Mahalingan, K K

    2017-01-01

    BACKGROUND: Equine type 1 polysaccharide storage myopathy (PSSM1) is associated with a missense mutation (R309H) in the glycogen synthase (GYS1) gene, enhanced glycogen synthase (GS) activity and excessive glycogen and amylopectate inclusions in muscle. METHODS: Equine muscle biochemical and reco...

  1. Evidence that the "waxy" protein of pea (Pisum sativum L.) is not the major starch-granule-bound starch synthase.

    Science.gov (United States)

    Smith, A M

    1990-11-01

    The aim of this work was to identify the starch-granule-bound starch synthase of developing pea embryos. When starch-granule-bound proteins were solubilised by digestion of granules with α-amylase and fractionated on a Mono Q anion-exchange column, activity of starch synthase eluted as three peaks. The distribution of activity in fractions from the column coincided with that of a 77-kDa protein. An antibody to this protein inhibited starch-synthase activity both in solubilised, starch-granule-bound protein and on intact starch granules. Recoveries of activity through extraction, solubilisation and chromatography indicate that this protein is the major, if not the only, form of starch synthase on the starch granule. The major, 59-kDa protein of the pea starch granule is antigenically related to the product of thewaxy locus of potato, which has previously been identified as the starch-granule-bound starch synthase of the tuber. However, the distribution of the 59-kDa protein did not coincide with that of starch-synthase activity in fractions from the Mono Q column. An antibody to the 59-kDa protein did not inhibit starch-synthase activity. The results raise questions about the relationship between "waxy" proteins and starch-granule-bound starch synthases generally.

  2. Cloning and verification of the Lactococcus lactis pyrG gene and characterization of the gene product, CTP synthase

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lyders Lerche; Willemoës, M.; Martinussen, Jan

    2001-01-01

    of a functional cdd gene encoding cytidine deaminase. A characterization of the enzyme revealed similar properties as found for CTP synthases from other organisms. However, unlike the majority of CTP synthases the lactococcal enzyme can convert dUTP to dCTP, although a half saturation concentration of 0.6 m...

  3. Physcomitrella PpORS, basal to plant type III polyketide synthases in phylogenetic trees, is a very long chain 2'-oxoalkylresorcinol synthase.

    Science.gov (United States)

    Kim, Sun Young; Colpitts, Che C; Wiedemann, Gertrud; Jepson, Christina; Rahimi, Mehrieh; Rothwell, Jordan R; McInnes, Adam D; Hasebe, Mitsuyasu; Reski, Ralf; Sterenberg, Brian T; Suh, Dae-Yeon

    2013-01-25

    The plant type III polyketide synthases (PKSs), which produce diverse secondary metabolites with different biological activities, have successfully co-evolved with land plants. To gain insight into the roles that ancestral type III PKSs played during the early evolution of land plants, we cloned and characterized PpORS from the moss Physcomitrella. PpORS has been proposed to closely resemble the most recent common ancestor of the plant type III PKSs. PpORS condenses a very long chain fatty acyl-CoA with four molecules of malonyl-CoA and catalyzes decarboxylative aldol cyclization to yield the pentaketide 2'-oxoalkylresorcinol. Therefore, PpORS is a 2'-oxoalkylresorcinol synthase. Structure modeling and sequence alignments identified a unique set of amino acid residues (Gln(218), Val(277), and Ala(286)) at the putative PpORS active site. Substitution of the Ala(286) to Phe apparently constricted the active site cavity, and the A286F mutant instead produced triketide alkylpyrones from fatty acyl-CoA substrates with shorter chain lengths. Phylogenetic analysis and comparison of the active sites of PpORS and alkylresorcinol synthases from sorghum and rice suggested that the gramineous enzymes evolved independently from PpORS to have similar functions but with distinct active site architecture. Microarray analysis revealed that PpORS is exclusively expressed in nonprotonemal moss cells. The in planta function of PpORS, therefore, is probably related to a nonprotonemal structure, such as the cuticle.

  4. The C-terminal peptide of Aquifex aeolicus riboflavin synthase directs encapsulation of native and foreign guests by a cage-forming lumazine synthase.

    Science.gov (United States)

    Azuma, Yusuke; Zschoche, Reinhard; Hilvert, Donald

    2017-06-23

    Encapsulation of specific enzymes in self-assembling protein cages is a hallmark of bacterial compartments that function as counterparts to eukaryotic organelles. The cage-forming enzyme lumazine synthase (LS) from Bacillus subtilis (BsLS), for example, encapsulates riboflavin synthase (BsRS), enabling channeling of lumazine from the site of its generation to the site of its conversion to vitamin B 2 Elucidating the molecular mechanisms underlying the assembly of these supramolecular complexes could help inform new approaches for metabolic engineering, nanotechnology, and drug delivery. To that end, we investigated a thermostable LS from Aquifex aeolicus (AaLS) and found that it also forms cage complexes with the cognate riboflavin synthase (AaRS) when both proteins are co-produced in the cytosol of Escherichia coli A 12-amino acid-long peptide at the C terminus of AaRS serves as a specific localization sequence responsible for targeting the guest to the protein compartment. Sequence comparisons suggested that analogous peptide segments likely direct RS complexation by LS cages in other bacterial species. Covalent fusion of this peptide tag to heterologous guest molecules led to their internalization into AaLS assemblies both in vivo and in vitro , providing a firm foundation for creating tailored biomimetic nanocompartments for medical and biotechnological applications. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Differentially expressed galactinol synthase(s) in chickpea are implicated in seed vigor and longevity by limiting the age induced ROS accumulation

    Science.gov (United States)

    Salvi, Prafull; Saxena, Saurabh Chandra; Petla, Bhanu Prakash; Kamble, Nitin Uttam; Kaur, Harmeet; Verma, Pooja; Rao, Venkateswara; Ghosh, Shraboni; Majee, Manoj

    2016-01-01

    Galactinol synthase (GolS) catalyzes the first and rate limiting step of Raffinose Family Oligosaccharide (RFO) biosynthetic pathway, which is a highly specialized metabolic event in plants. Increased accumulation of galactinol and RFOs in seeds have been reported in few plant species, however their precise role in seed vigor and longevity remain elusive. In present study, we have shown that galactinol synthase activity as well as galactinol and raffinose content progressively increase as seed development proceeds and become highly abundant in pod and mature dry seeds, which gradually decline as seed germination progresses in chickpea (Cicer arietinum). Furthermore, artificial aging also stimulates galactinol synthase activity and consequent galactinol and raffinose accumulation in seed. Molecular analysis revealed that GolS in chickpea are encoded by two divergent genes (CaGolS1 and CaGolS2) which potentially encode five CaGolS isoforms through alternative splicing. Biochemical analysis showed that only two isoforms (CaGolS1 and CaGolS2) are biochemically active with similar yet distinct biochemical properties. CaGolS1 and CaGolS2 are differentially regulated in different organs, during seed development and germination however exhibit similar subcellular localization. Furthermore, seed-specific overexpression of CaGolS1 and CaGolS2 in Arabidopsis results improved seed vigor and longevity through limiting the age induced excess ROS and consequent lipid peroxidation. PMID:27725707

  6. Novel class III phosphoribosyl diphosphate synthase: structure and properties of the tetrameric, phosphate-activated, non-allosterically inhibited enzyme from Methanocaldococcus jannaschii

    DEFF Research Database (Denmark)

    Kadziola, Anders; Jepsen, Clemens H; Johansson, Eva

    2005-01-01

    The prs gene encoding phosphoribosyl diphosphate (PRPP) synthase of the hyperthermophilic autotrophic methanogenic archaeon Methanocaldococcus jannaschii has been cloned and expressed in Escherichia coli. Subsequently, M.jannaschii PRPP synthase has been purified, characterised, crystallised, and...

  7. Radiolabeling of a wound-inducible pyridoxal phosphate utilizing protein from tomato: evidence for its identification as ACC synthase

    International Nuclear Information System (INIS)

    Privalle, L.S.; Graham, J.S.; Caughey, P.A.

    1986-01-01

    Aminocyclopropane 1-carboxylic acid (ACC) synthase, a pyridoxal phosphate utilizing enzyme, catalyzes the conversion of S-adenosylmethionine to ACC, the rate limiting step in the biosynthesis of the plant hormone, ethylene. Ethylene, besides being involved in normal plant growth processes, is also produced in response to stress, e.g. wounding, pathogen infection, etc. The authors report the partial purification (400 fold) of ACC synthase from wounded pink tomato pericarp by classical techniques including ammonium sulfate precipitation, ion exchange and phenyl sepharose chromatography. Further purification results in a decrease in specific activity apparently due to the instability of the enzyme and the low levels present in plant tissue. Radiolabeling of a pyridoxal phosphate-utilizing protein in the ACC synthase enriched fraction was achieved. Evidence that this radiolabeled protein is ACC synthase will be presented. Amino acid sequence determination of putative ACC synthase-derived peptides is underway

  8. Altered expression of the caffeine synthase gene in a naturally caffeine-free mutant of Coffea arabica

    Directory of Open Access Journals (Sweden)

    Mirian Perez Maluf

    2009-01-01

    Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.

  9. Anticonvulsion effect of acupuncture might be related to the decrease of neuronal and inducible nitric oxide synthases.

    Science.gov (United States)

    Yang, R; Huang, Z N; Cheng, J S

    1999-01-01

    To measure the levels of hippocampal nitric oxide synthase isoforms in penicillin induced epilepsy and to test the effect of electroacupuncture (EA) on changes of these levels during epilepsy, we injected penicillin into rat hippocampus to make an epilepsy model and performed electroacupuncture treatment on "Feng Fu" (DU 16) and "Jin Suo" (DU 8) points in Wistar rats. Nitric oxide synthase (NOS) mRNA levels of rat hippocampus were determined by reverse transcription-polymerase chain reaction (RT-PCR). The neuronal nitric oxide synthase (nNOS) mRNA markedly increased (pepilepsy, whereas no significant change in epithelial nitric oxide synthase (eNOS) mRNA was observed. EA inhibited the epilepsy and decreased nNOS (pepilepsy caused an increase in nNOS and iNOS, and the EA anticonvulsant effect might be related to the decrease of these nitric oxide synthases.

  10. Genome-wide analysis of the grapevine stilbene synthase multigenic family: genomic organization and expression profiles upon biotic and abiotic stresses

    Directory of Open Access Journals (Sweden)

    Vannozzi Alessandro

    2012-08-01

    Full Text Available Abstract Background Plant stilbenes are a small group of phenylpropanoids, which have been detected in at least 72 unrelated plant species and accumulate in response to biotic and abiotic stresses such as infection, wounding, UV-C exposure and treatment with chemicals. Stilbenes are formed via the phenylalanine/polymalonate-route, the last step of which is catalyzed by the enzyme stilbene synthase (STS, a type III polyketide synthase (PKS. Stilbene synthases are closely related to chalcone synthases (CHS, the key enzymes of the flavonoid pathway, as illustrated by the fact that both enzymes share the same substrates. To date, STSs have been cloned from peanut, pine, sorghum and grapevine, the only stilbene-producing fruiting-plant for which the entire genome has been sequenced. Apart from sorghum, STS genes appear to exist as a family of closely related genes in these other plant species. Results In this study a complete characterization of the STS multigenic family in grapevine has been performed, commencing with the identification, annotation and phylogenetic analysis of all members and integration of this information with a comprehensive set of gene expression analyses including healthy tissues at differential developmental stages and in leaves exposed to both biotic (downy mildew infection and abiotic (wounding and UV-C exposure stresses. At least thirty-three full length sequences encoding VvSTS genes were identified, which, based on predicted amino acid sequences, cluster in 3 principal groups designated A, B and C. The majority of VvSTS genes cluster in groups B and C and are located on chr16 whereas the few gene family members in group A are found on chr10. Microarray and mRNA-seq expression analyses revealed different patterns of transcript accumulation between the different groups of VvSTS family members and between VvSTSs and VvCHSs. Indeed, under certain conditions the transcriptional response of VvSTS and VvCHS genes appears to be

  11. Erratum Aldosterone synthase C-344T, angiotensin II type 1 receptor ...

    Indian Academy of Sciences (India)

    Aldosterone synthase C-344T, angiotensin II type 1 receptor A1166C and 11-β hydroxysteroid dehydrogenase G534A gene polymorphisms and essential hypertension in the population of Odisha, India. Manisha Patnaik, Pallabi Pati, Surendra N. Swain, Manoj K. Mohapatra, Bhagirathi Dwibedi, Shantanu K. Kar.

  12. Growth, sucrose synthase, and invertase activities of developing Phaseolus vulgaris L. fruits

    Science.gov (United States)

    Shi-Jean S. Sung; W.J. Sheih; D.R. Geiger; C.C. Black

    1994-01-01

    Activities of sucrose-cleaving enzymes, acid and neutral invertase and sucrose synthase, were measured in pods and seeds of developing snap bean (Phaseolus vulgaris L.) fruits, and compared with 14C-import, elongation and dry weight accumulation. The data supports the association of specific sucrose-cleaving enzymes with the specific processes that occur in the...

  13. Differential effects of nitric oxide synthase inhibitors on endotoxin-induced liver damage in rats

    NARCIS (Netherlands)

    Vos, TA; Gouw, ASH; Klok, PA; Havinga, R; vanGoor, H; Roelofsen, H; Kuipers, F; Jansen, PLM; Moshage, H

    1997-01-01

    Background & Aims: During endotoxemia, expression of inducible nitric oxide synthase (iNOS) and nitric oxide production in the liver is increased, NO has been suggested to have a hepatoprotective function. The aim of this study was to investigate the distribution of iNOS and the effect of different

  14. Isolated deficiency of mitochondrial ATP synthase caused by nuclear genetic defects

    Czech Academy of Sciences Publication Activity Database

    Ješina, Pavel; Sperl, W.; Zeman, J.; Mayr, J. A.; DeMeirleir, L.; Van Coster, R.; Pícková, Andrea; Hansíková, H.; Houšťková, H.; Krejčík, Z.; Koch, J.; Holme, E.; Houštěk, Josef

    2006-01-01

    Roč. 61, č. 5 (2006), s. 281-281 ISSN 0069-2328. [Český pediatrický kongres s mezinárodní účastí /7./. 08.06.2006-11.06.2006, Praha] R&D Projects: GA MZd NR7790 Keywords : ATP synthase * mitochondrial disorder Subject RIV: CE - Biochemistry

  15. Structure of Salmonella typhimurium OMP Synthase in a Complete Substrate Complex

    DEFF Research Database (Denmark)

    Grubmeyer, Charles; Hansen, Michael Riis; Fedorov, Alexander A.

    2012-01-01

    Dimeric Salmonella typhimurium orotate phosphoribosyltransferase (OMP synthase, EC 2.4.2.10), a key enzyme in de novo pyrimidine nucleotide synthesis, has been cocrystallized in a complete substrate E·MgPRPP·orotate complex and the structure determined to 2.2 Å resolution. This structure resem...

  16. In situ localization of chalcone synthase mRNA in pea root nodule development.

    NARCIS (Netherlands)

    Yang, W.C.; Canter Cremers, H.C.J.; Hogendijk, P.; Katinakis, P.; Wijffelman, C.A.; Franssen, H.J.; Kammen, van A.; Bisseling, T.

    1992-01-01

    In this paper studies on the role of flavonoids in pea root nodule development are reported. Flavonoid synthesis was followed by localizing chalcone synthase (CHS) mRNA in infected pea roots and in root nodules. In a nodule primordium, CHS mRNA is present in all cells of the primordium. Therefore it

  17. Metabolite profiling of Arabidopsis thaliana (L.) plants transformed with an antisense chalcone synthase gene

    DEFF Research Database (Denmark)

    Le Gall, G.; Metzdorff, Stine Broeng; Pedersen, Jan W.

    2005-01-01

    A metabolite profiling study has been carried out on Arabidopsis thaliana (L.) Heynh. ecotype Wassilewskija and a series of transgenic lines of the ecotype transformed with a CHS (chalcone synthase) antisense construct. Compound identifications by LC/MS and H-1 NMR are discussed. The glucosinolate...

  18. Molecular characterization of a stable antisense chalcone synthase phenotype in strawberry (Fragaria ananassa)

    NARCIS (Netherlands)

    Lunkenbein, S.; Coiner, H.; Vos, de C.H.; Schaart, J.G.; Boone, M.J.; Krens, F.A.; Schwab, W.; Salentijn, E.M.J.

    2006-01-01

    An octaploid (Fragaria × ananassa cv. Calypso) genotype of strawberry was transformed with an antisense chalcone synthase (CHS) gene construct using a ripening related CHS cDNA from Fragaria × ananassa cv. Elsanta under the control of the constitutive CaMV 35S promoter via Agrobacterium tumefaciens.

  19. Crystallization of Δ1-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa

    International Nuclear Information System (INIS)

    Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi; Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota; Shoyama, Yukihiro; Morimoto, Satoshi

    2005-01-01

    Δ 1 -Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ 1 -Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å 3 Da −1 assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively

  20. Crystallization of Δ{sup 1}-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa

    Energy Technology Data Exchange (ETDEWEB)

    Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi [Faculty of Pharmaceutical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota [Neutron Science Research Center, Japan Atomic Energy Research Institute, 2-4 Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Shoyama, Yukihiro; Morimoto, Satoshi, E-mail: morimoto@phar.kyushu-u.ac.jp [Faculty of Pharmaceutical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan)

    2005-08-01

    Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å{sup 3} Da{sup −1} assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively.

  1. The α-terpineol to 1,8-cineole cyclization reaction of tobacco terpene synthases

    NARCIS (Netherlands)

    Piechulla, Birgit; Bartelt, Richard; Brosemann, Anne; Effmert, Uta; Bouwmeester, Harro; Hippauf, Frank; Brandt, Wolfgang

    2016-01-01

    Flowers of Nicotiana species emit a characteristic blend including the cineole cassette monoterpenes. This set of terpenes is synthesized by multiproduct enzymes, with either 1,8-cineole or α-terpineol contributing most to the volatile spectrum, thus referring to cineole or terpineol synthase,

  2. Effect of a selective thromboxane synthase inhibitor on arterial graft patency and platelet deposition in dogs

    International Nuclear Information System (INIS)

    McDaniel, M.D.; Huntsman, W.T.; Miett, T.O.; Cronenwett, J.L.

    1987-01-01

    This study examined the effect of selective thromboxane synthase inhibition and nonselective cyclooxygenase inhibition on vascular graft patency and indium 111-labeled platelet deposition in 35 mongrel dogs undergoing carotid artery replacement with 4 mm X 4 cm polytetrafluoroethylene (PTFE) (one side) and Dacron (opposite side) end-to-end grafts. Aspirin-dipyridamole therapy improved one-week graft patency, from 46% in untreated dogs to 93% in treated dogs. Thromboxane synthase inhibition (U-63557A) improved graft patency in these dogs to 81%. Both drug treatments reduced platelet deposition on Dacron and PTFE grafts by 48% to 68% compared with control dogs. Dacron grafts accumulated significantly more platelets than PTFE grafts but had comparable patency rates. Low-dose aspirin therapy had no significant effect on either graft patency or platelet deposition. All treatment groups showed a 60% to 76% reduction in serum thromboxane B2, but only thromboxane synthase inhibitor treatment increased plasma 6-keto-prostaglandin F1 alpha by 100%. Selective thromboxane synthase inhibition improved small-caliber prosthetic graft patency to the same extent as did conventional cyclooxygenase inhibition in this preliminary study

  3. Glycogen synthase kinase-3β in patients with bipolar I disorder

    DEFF Research Database (Denmark)

    Jacoby, Anne S; Munkholm, Klaus; Vinberg, Maj

    2016-01-01

    OBJECTIVES: The enzyme glycogen synthase kinase-3β (GSK3β) is involved in the mechanisms of action of lithium and may play a role in relation to affective states in bipolar disorder. The objectives of the present study were to compare the activity of GSK-3β (measured as levels of phosphorylated GSK...

  4. A specific and potent inhibitor of glucosylceramide synthase for substrate inhibition therapy of Gaucher disease

    NARCIS (Netherlands)

    McEachern, Kerry Anne; Fung, John; Komarnitsky, Svetlana; Siegel, Craig S.; Chuang, Wei-Lien; Hutto, Elizabeth; Shayman, James A.; Grabowski, Gregory A.; Aerts, Johannes M. F. G.; Cheng, Seng H.; Copeland, Diane P.; Marshall, John

    2007-01-01

    An approach to treating Gaucher disease is substrate inhibition therapy which seeks to abate the aberrant lysosomal accumulation of glucosylceramide. We have identified a novel inhibitor of glucosylceramide synthase (Genz-112638) and assessed its activity in a murine model of Gaucher disease

  5. Expanding the product portfolio of fungal type I fatty acid synthases

    DEFF Research Database (Denmark)

    Zhu, Zhiwei; Zhou, Yongjin J.; Krivoruchko, Anastasia

    2017-01-01

    Fungal type I fatty acid synthases (FASs) are mega-enzymes with two separated, identical compartments, in which the acyl carrier protein (ACP) domains shuttle substrates to catalytically active sites embedded in the chamber wall. We devised synthetic FASs by integrating heterologous enzymes...

  6. Identification of the conserved coding sequences of three chitin synthase genes in Fonsecaea pedrosoi.

    Science.gov (United States)

    Karuppayil, S M; Peng, M; Mendoza, L; Levins, T A; Szaniszlo, P J

    1996-01-01

    Primers having designs based on highly conserved stretches in the deduced amino acid sequences of chitin synthase (CHS) genes were used in PCR reactions to amplify 600 bp and 366 bp products from the genomic DNA of three major causal agents of chromoblastomycosis. Cloning and sequencing of the PCR products of one of these fungi, Fonsecaea pedrosoi, identified three CHS sequences designated as FpCHS1, FpCHS2 and FpCHS3. FpCHS1 and FpCHS2 were homologous to regions of CHS1 and CHS2 of Saccharomyces cerevisiae, and their derived amino acid sequences fell into chitin synthase classes I and II, respectively. FpCHS3 was homologous to a region of the CAL1/CSD2 gene of S. cerevisiae, which codes for the chitin synthase three (Chs3) enzyme in that fungus. Phylogenetic trees constructed using the deduced amino acid sequences of PCR-amplified CHS products from many fungi clustered F. pedrosoi with other dematiaceous fungi, providing new molecular evidence for the genetic relatedness of these organisms. The identification of these CHS genes in F. pedrosoi will facilitate future studies of the functional roles of chitin synthases in the unique in vivo dimorphism exhibited by chromoblastomycotic fungi.

  7. Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia

    DEFF Research Database (Denmark)

    Costa, M C; Helweg-Larsen, J; Lundgren, Bettina

    2003-01-01

    The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene mutat...

  8. Binding and inhibition of human spermidine synthase by decarboxylated S-adenosylhomocysteine

    Energy Technology Data Exchange (ETDEWEB)

    Še; #269; kut; #279; , Jolita; McCloskey, Diane E.; Thomas, H. Jeanette; Secrist III, John A.; Pegg, Anthony E.; Ealick, Steven E. (Cornell); (Southern Research); (UPENN-MED)

    2011-11-17

    Aminopropyltransferases are essential enzymes that form polyamines in eukaryotic and most prokaryotic cells. Spermidine synthase (SpdS) is one of the most well-studied enzymes in this biosynthetic pathway. The enzyme uses decarboxylated S-adenosylmethionine and a short-chain polyamine (putrescine) to make a medium-chain polyamine (spermidine) and 5'-deoxy-5'-methylthioadenosine as a byproduct. Here, we report a new spermidine synthase inhibitor, decarboxylated S-adenosylhomocysteine (dcSAH). The inhibitor was synthesized, and dose-dependent inhibition of human, Thermatoga maritima, and Plasmodium falciparum spermidine synthases, as well as functionally homologous human spermine synthase, was determined. The human SpdS/dcSAH complex structure was determined by X-ray crystallography at 2.0 {angstrom} resolution and showed consistent active site positioning and coordination with previously known structures. Isothermal calorimetry binding assays confirmed inhibitor binding to human SpdS with K{sub d} of 1.1 {+-} 0.3 {mu}M in the absence of putrescine and 3.2 {+-} 0.1 {mu}M in the presence of putrescine. These results indicate a potential for further inhibitor development based on the dcSAH scaffold.

  9. Insights into natural products biosynthesis from analysis of 490 polyketide synthases from Fusarium

    Science.gov (United States)

    Species of the fungus Fusarium collectively cause disease on almost all crop plants and produce numerous natural products (NPs), including some of the mycotoxins of greatest concern to agriculture. Many Fusarium NPs are derived from polyketide synthases, large multi-domain enzymes that catalyze sequ...

  10. Nitric Oxide Synthases Reveal a Role for Calmodulin in Controlling Electron Transfer

    Science.gov (United States)

    Abu-Soud, Husam M.; Stuehr, Dennis J.

    1993-11-01

    Nitric oxide (NO) is synthesized within the immune, vascular, and nervous systems, where it acts as a wide-ranging mediator of mammalian physiology. The NO synthases (EC 1.14.13.39) isolated from neurons or endothelium are calmodulin dependent. Calmodulin binds reversibly to neuronal NO synthase in response to elevated Ca2+, triggering its NO production by an unknown mechanism. Here we show that calmodulin binding allows NADPH-derived electrons to pass onto the heme group of neuronal NO synthase. Calmodulin-triggered electron transfer to heme was independent of substrate binding, caused rapid enzymatic oxidation of NADPH in the presence of O_2, and was required for NO synthesis. An NO synthase isolated from cytokine-induced macrophages that contains tightly bound calmodulin catalyzed spontaneous electron transfer to its heme, consistent with bound calmodulin also enabling electron transfer within this isoform. Together, these results provide a basis for how calmodulin may regulate NO synthesis. The ability of calmodulin to trigger electron transfer within an enzyme is unexpected and represents an additional function for calcium-binding proteins in biology.

  11. Cloning and sequence analysis of putative type II fatty acid synthase ...

    Indian Academy of Sciences (India)

    Prakash

    pathway for improving oil quality and increasing oil content of peanut through biotechnology-based approaches. Fatty acid biosynthesis is catalysed by two types of fatty acid synthase (FAS). Type I FAS, as found in vertebrates, yeast and some bacteria, contains all the active sites on one or two multidomain polypeptides.

  12. of endothelial nitric oxide synthase gene and serum level of vascular ...

    African Journals Online (AJOL)

    uwerhiavwe

    Davignon and Ganz, 2004). NO is synthe- sized via a reaction that includes the conversion of L- arginine to L-citruline catalyzed by endothelial nitric oxide synthase (eNOS), which is one of the three isoforms of the enzyme (Mayer and Hemmens, 1997) ...

  13. Expression of inducible nitric oxide synthase in trigeminal ganglion cells during culture

    DEFF Research Database (Denmark)

    Jansen-Olesen, Inger; Zhou, MingFang; Zinck, Tina Jovanovic

    2005-01-01

    Nitric oxide (NO) is an important signalling molecule that has been suggested to be a key molecule for induction and maintenance of migraine attacks based on clinical studies, animal experimental studies and the expression of nitric oxide synthase (NOS) immunoreactivity within the trigeminovascular...

  14. Purification and characterization of CDP-diacylglycerol synthase from Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Kelley, M.J.; Carman, G.M.

    1987-01-01

    The membrane-associated phospholipid biosynthetic enzyme CDP-diacylglycerol synthase (CTP:phosphatidate cytidylyltransferase was purified 2300-fold from Saccharomyces cerevisiae. The purification procedure included Triton X-100 solubilization of mitochondrial membranes, CDP-diacylglycerol-Sepharose affinity chromatography, and hydroxylapatite chromatography. The procedure resulted in a nearly homogeneous enzyme preparation as determined by native and sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Radiation inactivation of mitochondrial associated and purified CDP-diacylglycerol synthase suggested that the molecular weight of the native enzyme was 114,000. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of the purified enzyme preparation yielded two subunits with molecular weights of 56,000 and 54,000. Antibodies prepared against the purified enzyme immunoprecipitated CDP-diacylglycerol synthase activity and subunits. CDP-diacylglycerol synthase activity was dependent on magnesium ions and Triton X-100 at pH 6.5. Thio-reactive agents inhibited activity. The activation energy for the reaction was 9 kcal/mol, and the enzyme was thermally labile above 30 degrees C. The Km values for CTP and phosphatidate were 1 and 0.5 mM, respectively, and the Vmax was 4700 nmol/min/mg. Results of kinetic and isotopic exchange reactions suggested that the enzyme catalyzes a sequential Bi Bi reaction mechanism

  15. Cloning and characterization of ATP synthase CF1 α gene from ...

    African Journals Online (AJOL)

    ATP synthase CF1 α subunit protein is a key enzyme for energy metabolism in plant kingdom, and plays an important role in multiple cell processes. In this study, the complete atpA gene (accession no. JN247444) was cloned from sweet potato (Ipomoea batatas L. Lam) by reverse transcriptasepolymerase chain reaction ...

  16. Identification and characterization of the iridoid synthase involved in oleuropein biosynthesis in olive (Olea europaea) fruits

    DEFF Research Database (Denmark)

    Alagna, Fiammetta; Geu-Flores, Fernando; Kries, Hajo

    2016-01-01

    these candidates, we have functionally characterized the olive homologue of iridoid synthase (OeISY), an unusual terpene cyclase that couples an NAD (P)H-dependent 1,4-reduction step with a subsequent cyclization, and we provide evidence that OeISY likely generates the monoterpene scaffold of oleuropein in olive...

  17. Nitric oxide synthase expression and apoptotic cell death in brains of AIDS and AIDS dementia patients

    NARCIS (Netherlands)

    Vincent, V. A.; de Groot, C. J.; Lucassen, P. J.; Portegies, P.; Troost, D.; Tilders, F. J.; van Dam, A. M.

    1999-01-01

    To determine the occurrence and cellular localization of inducible nitric oxide synthase (iNOS), NOS activity and its association with cell death in brains of AIDS and AIDS dementia complex (ADC) patients. Post-mortem cerebral cortex tissue of eight AIDS patients, eight ADC patients and eight

  18. Atypical composition and structure of the mitochondrial dimeric ATP synthase from Euglena gracilis

    NARCIS (Netherlands)

    Yadav, K.N. Satish; Miranda-Astudillo, Héctor V; Colina-Tenorio, Lilia; Bouillenne, Fabrice; Degand, Hervé; Morsomme, Pierre; González-Halphen, Diego; Boekema, Egbert J; Cardol, Pierre

    Mitochondrial respiratory-chain complexes from Euglenozoa comprise classical subunits described in other eukaryotes (i.e. mammals and fungi) and subunits that are restricted to Euglenozoa (e.g. Euglena gracilis and Trypanosoma brucei). Here we studied the mitochondrial F1FO-ATP synthase (or Complex

  19. THYMIDYLATE SYNTHASE LEVELS IN TUMOR-BIOPSIES FROM PATIENTS WITH COLORECTAL-CANCER

    NARCIS (Netherlands)

    MULDER, NH; TIMMERBOSSCHA, H; MEERSMA, GJ; VERSCHUEREN, RCJ

    1994-01-01

    Catalytic activity and FdUMP binding characteristics of thymidylate synthase (TS) were determined in 22 rumor biopsies of patients to be treated (15) or just treated (7) for colorectal cancer with 5-fluorouracil and leucovorin. In 19 samples both parameters could be determined and were found to

  20. A single arabidopsis gene encodes two differentially targeted geranylgeranyl diphosphate synthase isoforms

    NARCIS (Netherlands)

    Águila Ruiz-Sola, M.; Barja, M.V.; Manzano, David; Llorente, Briardo; Schipper, Bert; Beekwilder, Jules; Rodriguez-Concepcion, Manuel

    2016-01-01

    A wide diversity of isoprenoids is produced in different plant compartments. Most groups of isoprenoids synthesized in plastids, and some produced elsewhere in the plant cell derive from geranylgeranyl diphosphate (GGPP) synthesized by GGPP synthase (GGPPS) enzymes. In Arabidopsis (Arabidopsis

  1. Triterpenoid modulates the salt tolerance of lanosterol synthase deficient Saccharomyces cerevisiae, GIL77

    Directory of Open Access Journals (Sweden)

    Masashi Inafuku

    2018-01-01

    Full Text Available This study examined the effect of triterpenoid on the salt tolerance of lanosterol synthase deficient yeast mutant GIL77. The expression of the triterpenoid synthase gene under GAL1 promoter in GIL77 increased the triterpenoid concentration of both whole cell and plasma membrane fractions. Without the induction of the genes, the growth curve of BgbAS or RsM1 transformant depicted patterns similar to control cells in both the presence and absence of salt with growth inhibition at 500 mM NaCl. The induction of BgbAS and RsM1 gene expression slightly repressed growth compared with control cells in the absence of NaCl. The growth of GIL77 was significantly suppressed by the expression of BgbAS or RsM1 under salinity conditions. Of the triterpenoid synthase genes, BgbAS rather than RsM1 was found to strongly inhibit the growth of GIL77 cells under salt stressed conditions. The expression of the triterpenoid synthase gene in GIL77 also influenced their tolerance to other abiotic stresses. In contrast to the endogenous synthesis, the exogenous supply of triterpenoid in the culture medium appeared to occur in the plasma membrane fraction and enhanced the salt tolerance of GIL77. This study thus discussed the physiological significance of triterpenoid in relation to its possible role in modulating salt tolerance.

  2. Lack of endothelial nitric oxide synthase aggravates murine accelerated anti-glomerular basement membrane glomerulonephritis

    NARCIS (Netherlands)

    Heeringa, P; van Goor, H; Itoh-Lindstrom, Y; Maeda, N; Falk, RJ; Assmann, KJM; Kallenberg, CGM; Jennette, JC

    Nitric oxide (NO) radicals generated by endothelial nitric oxide synthase (eNOS) are involved in the regulation of vascular tone. In addition, NO radicals derived from eNOS inhibit platelet aggregation and leukocyte adhesion to the endothelium and, thus, may have anti-inflammatory effects. To study

  3. Effect of deletion of chitin synthase genes on mycelial morphology and culture viscosity in Aspergillus oryzae

    DEFF Research Database (Denmark)

    Müller, Christian; Hansen, K.; Szabo, Peter

    2003-01-01

    The objective of this study was to quantify the effect of disrupting two chitin synthases, chsB and csmA, on the morphology and rheology during batch cultivation of Aspergillus oryzae. The rheological properties were characterized in batch cultivations at different biomass concentrations (from 3....

  4. Chemical analysis of a genome wide polyketide synthase gene deletion library in Aspergillus nidulans

    DEFF Research Database (Denmark)

    Larsen, Thomas Ostenfeld; Klejnstrup, Marie Louise; Nielsen, Jakob Blæsbjerg

    to encode polyketide synthases have been individually been deleted. This presentation will highlight our recent linking of secondary metabolites in A. nidulans to genes, and in particular describe some recent work on characterization of ANID_6448 and associated genes responsible for biosynthesis of 3-methyl...

  5. Astrocytes and microglia express inducible nitric oxide synthase in mice with experimental allergic encephalomyelitis

    DEFF Research Database (Denmark)

    Tran, E H; Hardin-Pouzet, H; Verge, G

    1997-01-01

    Nitric oxide (NO), produced by inducible NO synthase (iNOS), may play a role in inflammatory demyelinating diseases of the central nervous system (CNS). We show upregulation of iNOS mRNA in CNS of SJL/J mice with experimental allergic encephalomyelitis (EAE). Using antibodies against mouse i...

  6. cDNA sequence of the long mRNA for human glutamine synthase

    NARCIS (Netherlands)

    van den Hoff, M. J.; Geerts, W. J.; Das, A. T.; Moorman, A. F.; Lamers, W. H.

    1991-01-01

    Screening a human liver cDNA library in lambda ZAP revealed several clones for the mRNA of glutamine synthase. The longest clone was completely sequenced and consists of a 109 bp 5' untranslated region, a 1119 bp protein coding region, a 1498 bp 3' untranslated region and a poly(A) tract of 12 bp

  7. Modulation of Escherichia coli serine acetyltransferase catalytic activity in the cysteine synthase complex

    Czech Academy of Sciences Publication Activity Database

    Benoni, Roberto; De Bei, O.; Paredi, G.; Hayes, C. S.; Franko, N.; Mozzarelli, A.; Bettati, S.; Campanini, B.

    2017-01-01

    Roč. 591, č. 9 (2017), s. 1212-1224 ISSN 0014-5793 Institutional support: RVO:61388963 Keywords : cysteine synthase * protein-protein interaction * serine acetyltransferase Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 3.623, year: 2016

  8. The absence of functional glucosylceramide synthase does not sensitize melanoma cells for anticancer drugs

    NARCIS (Netherlands)

    Veldman, RJ; Mita, A; Cuvillier, O; Garcia, [No Value; Klappe, K; Medin, JA; Campbell, JD; Carpentier, S; Kok, JW; Levade, T

    Conversion of ceramide, a putative mediator of anticancer drug-induced apoptosis, into glucosylceramide, by the action of glucosylceramide synthase (GCS), has been implicated in drug resistance. Herein, we compared GM95 mouse melanoma cells deficient in GCS activity, with cells stably transfected

  9. Isolation of an ATP synthase cDNA from Sinonovacula constricta ...

    African Journals Online (AJOL)

    Yomi

    2012-01-24

    Jan 24, 2012 ... Complete cDNA sequence of ScATPase and its deduced amino acid sequence. Nucleotides were numbered from the first base at the 5'end. The canonical polyadenylation signal-sequence was italic and underlined. The asterisk indicated the stop codon. The domain for ATP synthase C was underlined.

  10. Mechanistic Insight with HBCH2CoA as a Probe to Polyhydroxybutyrate (PHB) Synthases

    Science.gov (United States)

    2015-01-01

    Polyhydroxybutyrate (PHB) synthases catalyze the polymerization of 3-(R)-hydroxybutyrate coenzyme A (HBCoA) to produce polyoxoesters of 1–2 MDa. A substrate analogue HBCH2CoA, in which the S in HBCoA is replaced with a CH2 group, was synthesized in 13 steps using a chemoenzymatic approach in a 7.5% overall yield. Kinetic studies reveal it is a competitive inhibitor of a class I and a class III PHB synthases, with Kis of 40 and 14 μM, respectively. To probe the elongation steps of the polymerization, HBCH2CoA was incubated with a synthase acylated with a [3H]-saturated trimer-CoA ([3H]-sTCoA). The products of the reaction were shown to be the methylene analogue of [3H]-sTCoA ([3H]-sT-CH2-CoA), saturated dimer-([3H]-sD-CO2H), and trimer-acid ([3H]-sT-CO2H), distinct from the expected methylene analogue of [3H]-saturated tetramer-CoA ([3H]-sTet-CH2-CoA). Detection of [3H]-sT-CH2-CoA and its slow rate of formation suggest that HBCH2CoA may be reporting on the termination and repriming process of the synthases, rather than elongation. PMID:24896226

  11. Nitric oxide regulates the heart by spatial confinement of nitric oxide synthase isoforms.

    Science.gov (United States)

    Barouch, Lili A; Harrison, Robert W; Skaf, Michel W; Rosas, Gisele O; Cappola, Thomas P; Kobeissi, Zoulficar A; Hobai, Ion A; Lemmon, Christopher A; Burnett, Arthur L; O'Rourke, Brian; Rodriguez, E Rene; Huang, Paul L; Lima, João A C; Berkowitz, Dan E; Hare, Joshua M

    2002-03-21

    Subcellular localization of nitric oxide (NO) synthases with effector molecules is an important regulatory mechanism for NO signalling. In the heart, NO inhibits L-type Ca2+ channels but stimulates sarcoplasmic reticulum (SR) Ca2+ release, leading to variable effects on myocardial contractility. Here we show that spatial confinement of specific NO synthase isoforms regulates this process. Endothelial NO synthase (NOS3) localizes to caveolae, where compartmentalization with beta-adrenergic receptors and L-type Ca2+ channels allows NO to inhibit beta-adrenergic-induced inotropy. Neuronal NO synthase (NOS1), however, is targeted to cardiac SR. NO stimulation of SR Ca2+ release via the ryanodine receptor (RyR) in vitro, suggests that NOS1 has an opposite, facilitative effect on contractility. We demonstrate that NOS1-deficient mice have suppressed inotropic response, whereas NOS3-deficient mice have enhanced contractility, owing to corresponding changes in SR Ca2+ release. Both NOS1-/- and NOS3-/- mice develop age-related hypertrophy, although only NOS3-/- mice are hypertensive. NOS1/3-/- double knockout mice have suppressed beta-adrenergic responses and an additive phenotype of marked ventricular remodelling. Thus, NOS1 and NOS3 mediate independent, and in some cases opposite, effects on cardiac structure and function.

  12. Unique synteny and alternate splicing of the chitin synthases in closely related heliothine moths

    Science.gov (United States)

    Two chitin synthase genes were characterized in the genomes of two heliothine moths: the corn earworm/cotton bollworm, Helicoverpa zea (Boddie) (Lepidoptera: Noctuidae) and the cotton bollworm, Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae). In both moths, the coding sequences for the two ge...

  13. Structure of dimeric, recombinant Sulfolobus solfataricus phosphoribosyl diphosphate synthase

    DEFF Research Database (Denmark)

    Andersen, Rune W.; Lo Leggio, Leila; Hove-Jensen, Bjarne

    2015-01-01

    ion were observed. Sulphate ion, reminiscent of the ammonium sulphate precipitation step of the purification, seems to bind tightly and, therefore, presumably occupies and blocks the ribose 5-phosphate binding site. The activity of S. solfataricus PRPP synthase is independent of phosphate ion....

  14. Methionine synthase A2756G and reduced folate carrier1 A80G ...

    African Journals Online (AJOL)

    Aim of the study: To analyze the effect of methionine synthase (MTR) A2756G, and reduced folate carrier (RFC1) A80G gene polymorphisms on the maternal risk for DS. Patients: This study was conducted in the Medical Genetics Center, Ain-Shams University hospitals, on a total of 170 mothers of children, diagnosed with ...

  15. Expression of inducible nitric oxide synthase in trigeminal ganglion cells during culture

    DEFF Research Database (Denmark)

    Jansen-Olesen, Inger; Zhou, MingFang; Zinck, Tina Jovanovic

    2005-01-01

    Nitric oxide (NO) is an important signalling molecule that has been suggested to be a key molecule for induction and maintenance of migraine attacks based on clinical studies, animal experimental studies and the expression of nitric oxide synthase (NOS) immunoreactivity within the trigeminovascul...

  16. Switching head group selectivity in mammalian sphingolipid biosynthesis by active-site-engineering of sphingomyelin synthases

    NARCIS (Netherlands)

    Kol, Matthijs|info:eu-repo/dai/nl/25059434X; Panatala Narendranath, Radhakrishnan|info:eu-repo/dai/nl/315032162; Nordmann, Mirjana; Swart, Leoni; Van Suijlekom, Leonie; Cabukusta, Birol; Hilderink, Angelika; Grabietz, Tanja; Mina, John G M; Somerharju, Pentti; Korneev, Sergei; Tafesse, Fikadu G; Holthuis, Joost C.M.|info:eu-repo/dai/nl/153674520

    2017-01-01

    SM is a fundamental component of mammalian cell membranes that contributes to mechanical stability, signaling, and sorting. Its production involves the transfer of phosphocholine from phosphatidylcholine onto ceramide, a reaction catalyzed by SM synthase (SMS)1 in the Golgi and SMS2 at the plasma

  17. Random mutagenesis of 1-aminocyclopropane-1-carboxylate synthase: a key enzyme in ethylene biosynthesis.

    Science.gov (United States)

    Tarun, A S; Lee, J S; Theologis, A

    1998-08-18

    1-Aminocyclopropane-1-carboxylate synthase (ACC synthase, EC 4.4.1. 14) catalyzes the rate-limiting step in the ethylene biosynthetic pathway in plants. To determine the amino acid residues critical for the structure and function of this enzyme, the tomato Le-ACS2 isoenzyme has been subjected to both site-directed and PCR random mutagenesis. Mutant ACC synthases with reduced enzyme activity have been selected by using a genetic screen based on the functional complementation of an Escherichia coli Ile auxotroph that has been engineered to express ACC deaminase from Pseudomonas sp. The DNA sequence of almost 1,000 clones has been determined, and 334 single missense mutations have been selected for analysis. We have identified three classes of mutants based on their activity and expression in E. coli. Class I and II mutants have the same level of protein expression as the wild type, but their enzyme activity is reduced to 0-5% and 5-50%, respectively. Class III mutants have neither activity nor detectable protein expression. The inactive mutations are clustered in regions that are highly conserved among various ACC synthases. This library of mutants will facilitate the elucidation of structure-function relationships of this regulatory enzyme.

  18. Increased and altered fragrance of tobacco plants after metabolic engineering using three monoterpene synthases from lemon

    NARCIS (Netherlands)

    Lücker, J.; Schwab, W.; Hautum, van B.; Blaas, J.; Plas, van der L.H.W.; Bouwmeester, H.J.; Verhoeven, H.A.

    2004-01-01

    Wild-type tobacco (Nicotiana tabacum) plants emit low levels of terpenoids, particularly from the flowers. By genetic modification of tobacco cv Petit Havana SR1 using three different monoterpene synthases from lemon (Citrus limon L. Burm. f.) and the subsequent combination of these three into one

  19. Aldosterone-Synthase Gene Polymorphism is Associated with Blood Pressure Levels and Left Ventricle Mass Index

    Czech Academy of Sciences Publication Activity Database

    Horký, K.; Jáchymová, M.; Heller, S.; Linhart, A.; Hlubocká, Z.; Umnerová, V.; Peleška, Jan; Pavlíková, Markéta; Jindra, A.

    2004-01-01

    Roč. 204, 1 suppl. (2004), s. 35 ISSN 0014-2565. [World Congress of Internal Medicine /27./. 26.09.2004-01.10.2004, Granada] R&D Projects: GA MŠk LN00B107 Keywords : aldosterone synthase (CYP11B) * genetic polymorphism * arterial hypertension * left ventricular hypertrophy Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  20. Chronic nitric oxide synthase inhibition exacerbates renal dysfunction in cirrhotic rats

    DEFF Research Database (Denmark)

    Graebe, Martin; Brond, Lone; Christensen, Sten

    2004-01-01

    The present study investigated sodium balance and renal tubular function in cirrhotic rats with chronic blockade of the nitric oxide (NO) system. Rats were treated with the nonselective NO synthase inhibitor NG-nitro-l-arginine methyl ester (l-NAME) starting on the day of common bile duct ligation...

  1. Antisense repression of sucrose phosphate synthase in transgenic muskmelon alters plant growth and fruit development

    International Nuclear Information System (INIS)

    Tian, Hongmei; Ma, Leyuan; Zhao, Cong; Hao, Hui; Gong, Biao; Yu, Xiyan; Wang, Xiufeng

    2010-01-01

    To unravel the roles of sucrose phosphate synthase (SPS) in muskmelon (Cucumis melo L.), we reduced its activity in transgenic muskmelon plants by an antisense approach. For this purpose, an 830 bp cDNA fragment of muskmelon sucrose phosphate synthase was expressed in antisense orientation behind the 35S promoter of the cauliflower mosaic virus. The phenotype of the antisense plants clearly differed from that of control plants. The transgenic plant leaves were markedly smaller, and the plant height and stem diameter were obviously shorter and thinner. Transmission electron microscope observation revealed that the membrane degradation of chloroplast happened in transgenic leaves and the numbers of grana and grana lamella in the chloroplast were significantly less, suggesting that the slow growth and weaker phenotype of transgenic plants may be due to the damage of the chloroplast ultrastructure, which in turn results in the decrease of the net photosynthetic rate. The sucrose concentration and levels of sucrose phosphate synthase decreased in transgenic mature fruit, and the fruit size was smaller than the control fruit. Together, our results suggest that sucrose phosphate synthase may play an important role in regulating the muskmelon plant growth and fruit development.

  2. Methionine synthase A2756G and reduced folate carrier1 A80G ...

    African Journals Online (AJOL)

    Background: Polymorphisms of genes encoding enzymes involved in folate metabolism have long been hypothesized to be maternal risk factors for Down syndrome, however, results are conflicting and inconclusive. Aim of the study: To analyze the effect of methionine synthase (MTR) A2756G, and reduced folate carrier ...

  3. Cloning, expression, purification and characterization of recombinant (+)-germacrene D synthase from Zingiber officinale.

    Science.gov (United States)

    Picaud, Sarah; Olsson, Mikael E; Brodelius, Maria; Brodelius, Peter E

    2006-08-01

    A cDNA clone encoding a sesquiterpene synthase, (+)-germacrene D synthase, has been isolated from ginger (Zingiber officinale). The full-length cDNA (AY860846) contains a 1650-bp open reading frame coding for 550 amino acids (63.8kDa) with a theoretical pI=5.59. The deduced amino acid sequence is 30-46% identical with sequences of other sesquiterpene synthases from angiosperms. The recombinant enzyme, produced in Escherichia coli, catalyzed the formation of a major product, (+)-germacrene D (50.2% of total sesquiterpenoids produced) and a co-product, germacrene B (17.1%) and a number of minor by-products. The optimal pH for the recombinant enzyme is around 7.5. Substantial (+)-germacrene D synthase activity is observed in the presence of Mg2+, Mn2+, Ni2+ or Co2+, while the enzyme is inactive when Cu2+ or Zn2+ is used. The Km- and kcat-values are 0.88 microM and 3.34 x 10(-3) s(-1), respectively. A reaction mechanism involving a double 1,2-hydride shift has been established using deuterium labeled substrates in combination with GC-MS analysis.

  4. Constitutive expression of inducible nitric oxide synthase in the normal human colonic epithelium

    DEFF Research Database (Denmark)

    Perner, A; Andresen, Lars; Normark, M

    2002-01-01

    Inducible nitric oxide synthase (iNOS) in the human colon is considered expressed only in inflammatory states such as ulcerative or collagenous colitis. As subtle iNOS labelling was previously observed in some colonic mucosal biopsies from a heterogeneous group of controls with non-inflamed bowel...

  5. Heterologous expression of pentalenene synthase (PSS) from Streptomyces UC5319 in Xanthophyllomyces dendrorhous

    NARCIS (Netherlands)

    Melillo, Elena; Muntendam, Remco; Quax, Wim J.; Kayser, Oliver

    2012-01-01

    For the first time, the pentalenene synthase (PSS) gene from Streptomyces UC5319 was expressed in Xanthophyllomyces dendrorhous, a native producer of astaxanthin. For the expression of the gene and the concurrent knock out of the native crtE or crtYB genes, two new vectors were engineered and used

  6. Interactions between membrane-bound cellulose synthases involved in the synthesis of the secondary cell wall

    NARCIS (Netherlands)

    Timmers, J.F.P.; Vernhettes, S.; Desprez, T.; Vincken, J.P.; Visser, R.G.F.; Trindade, L.M.

    2009-01-01

    It has not yet been reported how the secondary CESA (cellulose synthase) proteins are organized in the rosette structure. A membrane-based yeast two-hybrid (MbYTH) approach was used to analyze the interactions between the CESA proteins involved in secondary cell wall synthesis of Arabidopsis and the

  7. Cortisol regulates nitric oxide synthase in freshwater and seawater acclimated rainbow trout, Oncorhynchus mykiss

    DEFF Research Database (Denmark)

    Gerber, Lucie; Madsen, Steffen S; Jensen, Frank B

    2017-01-01

    in osmoregulatory tissues by regulating NO synthase (NOS) expression. We evaluated the influence of cortisol treatment on mRNA expression of Nos1 and Nos2 in gill, kidney and middle intestine of both freshwater (FW) and seawater (SW) acclimated rainbow trout and found both tissue- and salinity-dependent effects...

  8. Lipocalin-type prostaglandin D synthase is not a biomarker of atherosclerotic manifestations

    DEFF Research Database (Denmark)

    Hosbond, Susanne E; Diederichsen, Axel C P; Pedersen, Lise

    2014-01-01

    OBJECTIVE: Over the last decades Lipocalin-type prostaglandin D synthase (L-PGDS), Osteoprotegerin (OPG), Osteopontin (OPN) and Pregnancy associated plasma protein A (PAPP-A) have been reported to be associated with coronary artery disease, and L-PGDS has been proposed as a potential new diagnost...

  9. Molecular Cloning, Characterization and mRNA Expression of a Chitin Synthase 2 Gene from the Oriental Fruit Fly, Bactrocera dorsalis (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Kang-Kang Xu

    2013-08-01

    Full Text Available Chitin synthase (CHS, a potential target for eco-friendly insecticides, plays an essential role in chitin formation in insects. In this study, a full-length cDNA encoding chitin synthase 2 (BdCHS2 was cloned and characterized in the oriental fruit fly, Bactrocera dorsalis. The BdCHS2 cDNA had 4417 nucleotides, containing an open reading frame of 4122 nucleotides, which encoded 1373 amino acid residues with a predicted molecular weight of 158.5 kDa. Phylogenetic analysis with other insect CHSs suggested that BdCHS2 belongs to insect CHS2. The BdCHS2 transcript was predominately found in midgut but was detected at low levels in fat body, Malpighian tubules, integument, and trachea. Moreover, BdCHS2 was expressed in all developmental stages, and highly expressed in the feeding stages. There was a positive relationship between BdCHS2 expression and total chitin content during development. Furthermore, both the gene expression and chitin content in midgut decreased when the insect was fed for 24 h, then starved for 24 h, while they increased dramatically and rapidly under the condition of starvation for 24 h then feeding for 24 h. These results suggest that BdCHS2 may play an important role in regulating chitin content of the midgut, and subsequently affect the growth and development of B. dorsalis.

  10. Identification and characterization of the polyketide synthase involved in ochratoxin A biosynthesis in Aspergillus carbonarius

    Energy Technology Data Exchange (ETDEWEB)

    Gallo, Antonia; Knox, Benjamin P.; Bruno, Kenneth S.; Solfrizzo, Michele; Baker, Scott E.; Perrone, Giancarlo

    2014-06-02

    Ochratoxin A (OTA) is a potent mycotoxin produced by Aspergillus and Penicillium species and is a common contaminant of a wide variety of food commodities, with Aspergillus carbonarius being the main producer of OTA contamination in grapes and wine. The molecular structure of OTA is composed of a dihydroisocoumarin ring linked to phenylalanine and, as shown in different producing fungal species, a polyketide synthase (PKS) is a component of the OTA biosynthetic pathway. Similar to observations in other filamentous ascomycetes, the genome sequence of A. carbonarius contains a large number of genes predicted to encode PKSs. In this work a pks gene identified within the putative OTA cluster of A. carbonarius, designated as AcOTApks, was inactivated and the resulting mutant strain was unable to produce OTA, confirming the role of AcOTApks in this biosynthetic pathway. AcOTApks protein is characteristic of the highly reduced (HR)-PKS family, and also contains a putative methyltransferase domain likely responsible for the addition of the methyl group to the OTA polyketide structure. AcOTApks is different from the ACpks protein that we previously described which showed an expression profile compatible with OTA production. We performed phylogenetic analyses of the β-ketosynthase and acyl-transferase domains of the OTA PKSs which had been identified and characterized in different OTA producing fungal species. The phylogenetic results were similar for both the two domains analyzed and showed that OTA PKS of A. carbonarius, Aspergillus niger, and Aspergillus ochraceus clustered in a monophyletic group with 100% bootstrap support suggesting a common origin, while the other OTA PKSs analyzed were phylogenetically distant. A qRT-PCR assay monitored AcOTApks expression during fungal growth and concomitant production of OTA by A. carbonarius in synthetic grape medium. A clear correlation between the expression profile of AcOTApks and kinetics of OTA production was observed with

  11. Engineered biosynthesis of regioselectively modified aromatic polyketides using bimodular polyketide synthases.

    Science.gov (United States)

    Tang, Yi; Lee, Taek Soon; Khosla, Chaitan

    2004-02-01

    Bacterial aromatic polyketides such as tetracycline and doxorubicin are a medicinally important class of natural products produced as secondary metabolites by actinomyces bacteria. Their backbones are derived from malonyl-CoA units by polyketide synthases (PKSs). The nascent polyketide chain is synthesized by the minimal PKS, a module consisting of four dissociated enzymes. Although the biosynthesis of most aromatic polyketide backbones is initiated through decarboxylation of a malonyl building block (which results in an acetate group), some polyketides, such as the estrogen receptor antagonist R1128, are derived from nonacetate primers. Understanding the mechanism of nonacetate priming can lead to biosynthesis of novel polyketides that have improved pharmacological properties. Recent biochemical analysis has shown that nonacetate priming is the result of stepwise activity of two dissociated PKS modules with orthogonal molecular recognition features. In these PKSs, an initiation module that synthesizes a starter unit is present in addition to the minimal PKS module. Here we describe a general method for the engineered biosynthesis of regioselectively modified aromatic polyketides. When coexpressed with the R1128 initiation module, the actinorhodin minimal PKS produced novel hexaketides with propionyl and isobutyryl primer units. Analogous octaketides could be synthesized by combining the tetracenomycin minimal PKS with the R1128 initiation module. Tailoring enzymes such as ketoreductases and cyclases were able to process the unnatural polyketides efficiently. Based upon these findings, hybrid PKSs were engineered to synthesize new anthraquinone antibiotics with predictable functional group modifications. Our results demonstrate that (i) bimodular aromatic PKSs present a general mechanism for priming aromatic polyketide backbones with nonacetate precursors; (ii) the minimal PKS controls polyketide chain length by counting the number of atoms incorporated into the

  12. Engineered biosynthesis of regioselectively modified aromatic polyketides using bimodular polyketide synthases.

    Directory of Open Access Journals (Sweden)

    Yi Tang

    2004-02-01

    Full Text Available Bacterial aromatic polyketides such as tetracycline and doxorubicin are a medicinally important class of natural products produced as secondary metabolites by actinomyces bacteria. Their backbones are derived from malonyl-CoA units by polyketide synthases (PKSs. The nascent polyketide chain is synthesized by the minimal PKS, a module consisting of four dissociated enzymes. Although the biosynthesis of most aromatic polyketide backbones is initiated through decarboxylation of a malonyl building block (which results in an acetate group, some polyketides, such as the estrogen receptor antagonist R1128, are derived from nonacetate primers. Understanding the mechanism of nonacetate priming can lead to biosynthesis of novel polyketides that have improved pharmacological properties. Recent biochemical analysis has shown that nonacetate priming is the result of stepwise activity of two dissociated PKS modules with orthogonal molecular recognition features. In these PKSs, an initiation module that synthesizes a starter unit is present in addition to the minimal PKS module. Here we describe a general method for the engineered biosynthesis of regioselectively modified aromatic polyketides. When coexpressed with the R1128 initiation module, the actinorhodin minimal PKS produced novel hexaketides with propionyl and isobutyryl primer units. Analogous octaketides could be synthesized by combining the tetracenomycin minimal PKS with the R1128 initiation module. Tailoring enzymes such as ketoreductases and cyclases were able to process the unnatural polyketides efficiently. Based upon these findings, hybrid PKSs were engineered to synthesize new anthraquinone antibiotics with predictable functional group modifications. Our results demonstrate that (i bimodular aromatic PKSs present a general mechanism for priming aromatic polyketide backbones with nonacetate precursors; (ii the minimal PKS controls polyketide chain length by counting the number of atoms

  13. Conservation and divergence of Starch Synthase III genes of monocots and dicots.

    Directory of Open Access Journals (Sweden)

    Bhavya Priyadarshini Mishra

    Full Text Available Starch Synthase (SS plays an important role in extending the α-1,4 glucan chains during starch biosynthesis by catalyzing the transfer of the glucosyl moiety from ADP-glucose to the non-reducing end of a pre-existing glucan chain. SS has five distinct isoforms of which SSIII is involved in the formation of longer glucan chain length. Here we report identification and detailed characterization of 'true' orthologs of the well-characterized maize SSIII (ZmSSIII, among six monocots and two dicot species. ZmSSIII orthologs have nucleotide sequence similarity ranging from 56-81%. Variation in gene size among various orthologs ranged from 5.49 kb in Arabidopsis to 11.62 kb in Brachypodium and the variation was mainly due to intron size and indels present in the exons 1 and 3. Number of exons and introns were highly conserved among all orthologs however. While the intron number was conserved, intron phase showed variation at group, genera and species level except for intron 1 and 5. Several species, genera, and class specific cis-acting regulatory elements were identified in the promoter region. The predicted protein size of the SSIII orthologs ranged from 1094 amino acid (aa in Arabidopsis to 1688 aa in Brachypodium with sequence identity ranging from 60%-89%. The N-terminal region of the protein was highly variable whereas the C-terminal region containing the Glycosyltransferase domain was conserved with >80% sequence similarity among the orthologs. In addition to confirming the known motifs, eleven novel motifs possibly providing species, genera and group specific functions, were identified in the three carbohydrate binding domains. Despite of significant sequence variation among orthologs, most of the motifs and their relative distances are highly conserved among the orthologs. The 3-D structure of catalytic region of SSIII orthologs superimposed with higher confidence confirming the presence of similar binding sites with five unidentified

  14. Climate prediction and predictability

    Science.gov (United States)

    Allen, Myles

    2010-05-01

    Climate prediction is generally accepted to be one of the grand challenges of the Geophysical Sciences. What is less widely acknowledged is that fundamental issues have yet to be resolved concerning the nature of the challenge, even after decades of research in this area. How do we verify or falsify a probabilistic forecast of a singular event such as anthropogenic warming over the 21st century? How do we determine the information content of a climate forecast? What does it mean for a modelling system to be "good enough" to forecast a particular variable? How will we know when models and forecasting systems are "good enough" to provide detailed forecasts of weather at specific locations or, for example, the risks associated with global geo-engineering schemes. This talk will provide an overview of these questions in the light of recent developments in multi-decade climate forecasting, drawing on concepts from information theory, machine learning and statistics. I will draw extensively but not exclusively from the experience of the climateprediction.net project, running multiple versions of climate models on personal computers.

  15. Identification and characterization of two bisabolene synthases from linear glandular trichomes of sunflower (Helianthus annuus L., Asteraceae).

    Science.gov (United States)

    Aschenbrenner, Anna-Katharina; Kwon, Moonhyuk; Conrad, Jürgen; Ro, Dae-Kyun; Spring, Otmar

    2016-04-01

    Sunflower is known to produce a variety of bisabolene-type sesquiterpenes and accumulates these substances in trichomes of leaves, stems and flowering parts. A bioinformatics approach was used to identify the enzyme responsible for the initial step in the biosynthesis of these compounds from its precursor farnesyl pyrophosphate. Based on sequence similarity with a known bisabolene synthases from Arabidopsis thaliana AtTPS12, candidate genes of Helianthus were searched in EST-database and used to design specific primers. PCR experiments identified two candidates in the RNA pool of linear glandular trichomes of sunflower. Their sequences contained the typical motifs of sesquiterpene synthases and their expression in yeast functionally characterized them as bisabolene synthases. Spectroscopic analysis identified the stereochemistry of the product of both enzymes as (Z)-γ-bisabolene. The origin of the two sunflower bisabolene synthase genes from the transcripts of linear trichomes indicates that they may be involved in the synthesis of sesquiterpenes produced in these trichomes. Comparison of the amino acid sequences of the sunflower bisabolene synthases showed high similarity with sesquiterpene synthases from other Asteracean species and indicated putative evolutionary origin from a β-farnesene synthase. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. A transcriptomic analysis for identifying the unintended effects of introducing a heterologous glyphosate-tolerant EPSP synthase into Escherichia coli.

    Science.gov (United States)

    Li, Liang; Zhou, Zhengfu; Jin, Wujun; Wan, Yusong; Lu, Wei

    2015-03-01

    Glyphosate is one of the most commonly used broad-spectrum herbicides with little to no hazard to animals, human beings, or the environment. Some microbial 5-enolpyruvylshikimate-3-phosphate (EPSP) synthase variants are not inhibited by glyphosate, and they provide a powerful tool to engineer glyphosate-tolerant plants. However, the unintended effects of EPSP synthase expression patterns on microbes are not yet clear. Here, we use an Affymetrix GeneChip analysis to study how introduction of a heterologous glyphosate-tolerant EPSP synthase into a model microorganism Escherichia coli (E. coli) affects the global gene expression profile. The profile showed that 161 of 4071 genes were differentially expressed after the introduction of the synthase: 19 (0.47%) were up-regulated and 143 (3.49%) were down-regulated. The microarray results, in combination with BiOLOG substrate utilization and amino acid composition assays, suggested that heterologous EPSP synthase expression had very minor effects on E. coli. Although a small number of genes and metabolites were affected by EPSP synthase expression, no functional correlations were identified among the dataset. This study may shed light on the effect of EPSP synthase expression on microbes, which should help in the assessment of environmental safety.

  17. Impact of drought stress on specialised metabolism: Biosynthesis and the expression of monoterpene synthases in sage (Salvia officinalis).

    Science.gov (United States)

    Radwan, Alzahraa; Kleinwächter, Maik; Selmar, Dirk

    2017-09-01

    In previous experiments, we demonstrated that the amount of monoterpenes in sage is increased massively by drought stress. Our current study is aimed to elucidate whether this increase is due, at least in part, to elevated activity of the monoterpene synthases responsible for the biosynthesis of essential oils in sage. Accordingly, the transcription rates of the monoterpene synthases were analyzed. Salvia officinalis plants were cultivated under moderate drought stress. The concentrations of monoterpenes as well as the expression of the monoterpene synthases were analyzed. The amount of monoterpenes massively increased in response to drought stress; it doubled after just two days of drought stress. The observed changes in monoterpene content mostly match with the patterns of monoterpene synthase expressions. The expression of bornyl diphosphate synthase was strongly up-regulated; its maximum level was reached after two days. Sabinene synthase increased gradually and reached a maximum after two weeks. In contrast, the transcript level of cineole synthase continuously declined. This study revealed that the stress related increase of biosynthesis is not only due to a "passive" shift caused by the stress related over-reduced status, but also is due - at least in part-to an "active" up-regulation of the enzymes involved. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Trehalose-6-phosphate synthase and stabilization of yeast glycolysis

    DEFF Research Database (Denmark)

    Fraenkel, Dan; Nielsen, Jens

    2016-01-01

    ‘Lost in transition: Startup of glycolysis yields subpopulations of nongrowing cells…’ (‘LIT’, van Heerden et al. 2014) is a massive paper from groups in Amsterdam and Delft, which deals with broad issues in metabolism and cell heterogeneity, as addressed for the predominant metabolic pathway......, glycolysis, in the context of a long studied but incompletely understood yeast mutant which is impaired in use of glucose without evident direct defects in the pathway. The primary approach is the quite original one of predicting, for the mutant, the dynamics of metabolism upon glucose addition, based...

  19. Genome-Wide Identification, Evolutionary and Expression Analyses of the GALACTINOL SYNTHASE Gene Family in Rapeseed and Tobacco

    Directory of Open Access Journals (Sweden)

    Yonghai Fan

    2017-12-01

    Full Text Available Galactinol synthase (GolS is a key enzyme in raffinose family oligosaccharide (RFO biosynthesis. The finding that GolS accumulates in plants exposed to abiotic stresses indicates RFOs function in environmental adaptation. However, the evolutionary relationships and biological functions of GolS family in rapeseed (Brassica napus and tobacco (Nicotiana tabacum remain unclear. In this study, we identified 20 BnGolS and 9 NtGolS genes. Subcellular localization predictions showed that most of the proteins are localized to the cytoplasm. Phylogenetic analysis identified a lost event of an ancient GolS copy in the Solanaceae and an ancient duplication event leading to evolution of GolS4/7 in the Brassicaceae. The three-dimensional structures of two GolS proteins were conserved, with an important DxD motif for binding to UDP-galactose (uridine diphosphate-galactose and inositol. Expression profile analysis indicated that BnGolS and NtGolS genes were expressed in most tissues and highly expressed in one or two specific tissues. Hormone treatments strongly induced the expression of most BnGolS genes and homologous genes in the same subfamilies exhibited divergent-induced expression. Our study provides a comprehensive evolutionary analysis of GolS genes among the Brassicaceae and Solanaceae as well as an insight into the biological function of GolS genes in hormone response in plants.

  20. Solid-State NMR, Crystallographic, and Computational Investigation of Bisphosphonates and Farnesyl Diphosphate Synthase-Bisphosphonate Complexes

    Energy Technology Data Exchange (ETDEWEB)

    Mao,J.; Mukherjee, S.; Zhang, Y.; Cao, R.; Sanders, J.; Song, Y.; Zhang, Y.; Meints, G.; Gao, Y.; et al.

    2006-01-01

    Bisphosphonates are a class of molecules in widespread use in treating bone resorption diseases and are also of interest as immunomodulators and anti-infectives. They function by inhibiting the enzyme farnesyl diphosphate synthase (FPPS), but the details of how these molecules bind are not fully understood. Here, we report the results of a solid-state {sup 13}C, {sup 15}N, and {sup 31}P magic-angle sample spinning (MAS) NMR and quantum chemical investigation of several bisphosphonates, both as pure compounds and when bound to FPPS, to provide information about side-chain and phosphonate backbone protonation states when bound to the enzyme. We then used computational docking methods (with the charges assigned by NMR) to predict how several bisphosphonates bind to FPPS. Finally, we used X-ray crystallography to determine the structures of two potent bisphosphonate inhibitors, finding good agreement with the computational results, opening up the possibility of using the combination of NMR, quantum chemistry and molecular docking to facilitate the design of other, novel prenytransferase inhibitors.

  1. Rice Cellulose SynthaseA8 Plant-Conserved Region Is a Coiled-Coil at the Catalytic Core Entrance

    Energy Technology Data Exchange (ETDEWEB)

    Rushton, Phillip S.; Olek, Anna T.; Makowski, Lee; Badger, John; Steussy, C. Nicklaus; Carpita, Nicholas C.; Stauffacher, Cynthia V. (NEU); (Purdue)

    2016-11-22

    The crystallographic structure of a rice (Oryza sativa) cellulose synthase, OsCesA8, plant-conserved region (P-CR), one of two unique domains in the catalytic domain of plant CesAs, was solved to 2.4 Å resolution. Two antiparallel α-helices form a coiled-coil domain linked by a large extended connector loop containing a conserved trio of aromatic residues. The P-CR structure was fit into a molecular envelope for the P-CR domain derived from small-angle X-ray scattering data. The P-CR structure and molecular envelope, combined with a homology-based chain trace of the CesA8 catalytic core, were modeled into a previously determined CesA8 small-angle X-ray scattering molecular envelope to produce a detailed topological model of the CesA8 catalytic domain. The predicted position for the P-CR domain from the molecular docking models places the P-CR connector loop into a hydrophobic pocket of the catalytic core, with the coiled-coil aligned near the entrance of the substrate UDP-glucose into the active site. In this configuration, the P-CR coiled-coil alone is unlikely to regulate substrate access to the active site, but it could interact with other domains of CesA, accessory proteins, or other CesA catalytic domains to control substrate delivery.

  2. Aberrant prostaglandin synthase 2 expression defines an antigen-presenting cell defect for insulin-dependent diabetes mellitus

    Science.gov (United States)

    Litherland, S.A.; Xie, X.T.; Hutson, A.D.; Wasserfall, C.; Whittaker, D.S.; She, J.-X.; Hofig, A.; Dennis, M.A.; Fuller, K.; Cook, R.; Schatz, D.; Moldawer, L.L.; Clare-Salzler, M.J.

    1999-01-01

    Prostaglandins (PGs) are lipid molecules that profoundly affect cellular processes including inflammation and immune response. Pathways contributing to PG output are highly regulated in antigen-presenting cells such as macrophages and monocytes, which produce large quantities of these molecules upon activation. In this report, we demonstrate aberrant constitutive expression of the normally inducible cyclooxygenase PG synthase 2 (PGS2/ COX-2) in nonactivated monocytes of humans with insulin-dependent diabetes mellitus (IDDM) and those with islet autoantibodies at increased risk of developing this disease. Constitutive PGS2 appears to characterize a high risk for diabetes as it correlates with and predicts a low first-phase insulin response in autoantibody-positive subjects. Abnormal PGS2 expression in at-risk subjects affected immune response in vitro, as the presence of a specific PGS2 inhibitor, NS398, significantly increased IL-2 receptor α-chain (CD25) expression on phytohemagglutinin-stimulated T cells. The effect of PGS2 on CD25 expression was most profound in subjects expressing both DR04 and DQβ0302 high-risk alleles, suggesting that this cyclooxygenase interacts with diabetes-associated MHC class II antigens to limit T-cell activation. These results indicate that constitutive PGS2 expression in monocytes defines an antigen-presenting cell defect affecting immune response, and that this expression is a novel cell-associated risk marker for IDDM. J. Clin. Invest. 104:515-523 (1999). PMID:10449443

  3. REVIEW: Epistasis and dominance in the emergence of catalytic function as exemplified by the evolution of plant terpene synthases.

    Science.gov (United States)

    Cheema, Jitender; Faraldos, Juan A; O'Maille, Paul E

    2017-02-01

    Epistasis, the interaction between mutations and the genetic background, is a pervasive force in evolution that is difficult to predict yet derives from a simple principle - biological systems are interconnected. Therefore, one effect may be intimately linked to another, hence interdependent. Untangling epistatic interactions between and within genes is a vibrant area of research. Deriving a mechanistic understanding of epistasis is a major challenge. Particularly, elucidating how epistasis can attenuate the effects of otherwise dominant mutations that control phenotypes. Using the emergence of terpene cyclization in specialized metabolism as an excellent example, this review describes the process of discovery and interpretation of dominance and epistasis in relation to current efforts. Specifically, we outline experimental approaches to isolating epistatic networks of mutations in protein structure, formally quantifying epistatic interactions, then building biochemical models with chemical mechanisms in efforts to achieve an understanding of the physical basis for epistasis. From these models we describe informed conjectures about past evolutionary events that underlie the emergence, divergence and specialization of terpene synthases to illustrate key principles of the constraining forces of epistasis in enzyme function. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  4. Studies on the expression of linalool synthase using a promoter-β-glucuronidase fusion in transgenic Artemisia annua.

    Science.gov (United States)

    Wang, Hongzhen; Kanagarajan, Selvaraju; Han, Junli; Hao, Mengshu; Yang, Yiyi; Lundgren, Anneli; Brodelius, Peter E

    2014-01-15

    Artemisinin, an antimalarial endoperoxide sesquiterpene, is synthesized in glandular trichomes of Artemisia annua L. A number of other enzymes of terpene metabolism utilize intermediates of artemisinin biosynthesis, such as isopentenyl and farnesyl diphosphate, and may thereby influence the yield of artemisinin. In order to study the expression of such enzymes, we have cloned the promoter regions of some enzymes and fused them to β-glucuronidase (GUS). In this study, we have investigated the expression of the monoterpene synthase linalool synthase (LIS) using transgenic A. annua carrying the GUS gene under the control of the LIS promoter. The 652bp promoter region was cloned by the genome walker method. A number of putative cis-acting elements were predicted indicating that the LIS is driven by a complex regulation mechanism. Transgenic plants carrying the promoter-GUS fusion showed specific expression of GUS in T-shaped trichomes (TSTs) but not in glandular secretory trichomes, which is the site for artemisinin biosynthesis. GUS expression was observed at late stage of flower development in styles of florets and in TSTs and guard cells of basal bracts. GUS expression after wounding showed that LIS is involved in plant responsiveness to wounding. Furthermore, the LIS promoter responded to methyl jasmonate (MeJA). These results indicate that the promoter carries a number of cis-acting regulatory elements involved in the tissue-specific expression of LIS and in the response of the plant to wounding and MeJA treatment. Southern blot analysis indicated that the GUS gene was integrated in the A. annua genome as single or multi copies in different transgenic lines. Promoter activity analysis by qPCR showed that both the wild-type and the recombinant promoter are active in the aerial parts of the plant while only the recombinant promoter was active in roots. Due to the expression in TSTs but not in glandular trichomes, it may be concluded that LIS expression will most

  5. Amplification and diversity analysis of keto synthase domains of putative polyketide synthase genes in Aspergillus ochraceus and Aspergillus carbonarius producers of ochratoxin A

    International Nuclear Information System (INIS)

    Atoui, A.; Phong Dao, H.; Mathieu, F.; Lebrihi, A.

    2006-01-01

    The diversity of polyketide synthase (PKS) genes in Aspergillus ochraceus NRRL 3174 and Aspergil- lus carbonarius 2Mu134 has been investigated using different primer pairs previously developed for the ketosynthase (KS) domain of fungal PKSs. Nine different KS domain sequences in A. ochraceus NRRL 3174 as well as five different KS domain sequences in A. carbonarius 2Mu134 have been identified. The identified KS fragments were distributed in five different clusters on the phylogenetic tree, indicating that they most probably represent PKSs responsible for different functions. (author)

  6. Cloning of a cDNA that encodes farnesyl diphosphate synthase and the blue-light-induced expression of the corresponding gene in the leaves of rice plants.

    Science.gov (United States)

    Sanmiya, K; Iwasaki, T; Matsuoka, M; Miyao, M; Yamamoto, N

    1997-02-28

    A cDNA encoding farnesyl diphosphate synthase (FPPS), a key enzyme in isoprenoid biosynthesis, was isolated from a cDNA library constructed from mRNA that had been prepared from etiolated rice (Oriza sativa L. variety Nipponbare) seedlings after three hours of illumination by a subtraction method. The putative polypeptide deduced from the 1289 bp nucleotide sequence consisted of 353 amino acids and had a molecular mass of 40 676 Da. The predicted amino acid sequence exhibited high homology to those of FPPS from Arabidopsis (73% to type 1, 72% to type 2) and white lupin (74%). Southern blot analysis showed that the rice genome might contain only one gene for FPPS. The highest level of expression of the gene was demonstrated in leaves by RNA blot analysis. Moreover, light, in particular blue light, effectively enhanced expression of the gene.

  7. The Phytoene synthase gene family of apple (Malus x domestica) and its role in controlling fruit carotenoid content.

    Science.gov (United States)

    Ampomah-Dwamena, Charles; Driedonks, Nicky; Lewis, David; Shumskaya, Maria; Chen, Xiuyin; Wurtzel, Eleanore T; Espley, Richard V; Allan, Andrew C

    2015-07-28

    Carotenoid compounds play essential roles in plants such as protecting the photosynthetic apparatus and in hormone signalling. Coloured carotenoids provide yellow, orange and red colour to plant tissues, as well as offering nutritional benefit to humans and animals. The enzyme phytoene synthase (PSY) catalyses the first committed step of the carotenoid biosynthetic pathway and has been associated with control of pathway flux. We characterised four PSY genes found in the apple genome to further understand their involvement in fruit carotenoid accumulation. The apple PSY gene family, containing six members, was predicted to have three functional members, PSY1, PSY2, and PSY4, based on translation of the predicted gene sequences and/or corresponding cDNAs. However, only PSY1 and PSY2 showed activity in a complementation assay. Protein localisation experiments revealed differential localization of the PSY proteins in chloroplasts; PSY1 and PSY2 localized to the thylakoid membranes, while PSY4 localized to plastoglobuli. Transcript levels in 'Granny Smith' and 'Royal Gala' apple cultivars showed PSY2 was most highly expressed in fruit and other vegetative tissues. We tested the transient activation of the apple PSY1 and PSY2 promoters and identified potential and differential regulation by AP2/ERF transcription factors, which suggested that the PSY genes are controlled by different transcriptional mechanisms. The first committed carotenoid pathway step in apple is controlled by MdPSY1 and MdPSY2, while MdPSY4 play little or no role in this respect. This has implications for apple breeding programmes where carotenoid enhancement is a target and would allow co-segregation with phenotypes to be tested during the development of new cultivars.

  8. Promiscuity of Exiguobacterium sp. AT1b o-succinylbenzoate synthase illustrates evolutionary transitions in the OSBS family.

    Science.gov (United States)

    Brizendine, Ashley M; Odokonyero, Denis; McMillan, Andrew W; Zhu, Mingzhao; Hull, Ken; Romo, Daniel; Glasner, Margaret E

    2014-07-18

    Catalytic promiscuity, which is the ability to catalyze more than one reaction in the same active site, is thought to facilitate the evolution of new protein functions. Although many enzymes are catalytically promiscuous, there is little direct evidence to show how promiscuous activities evolved into biological functions. We are seeking evidence for this model by studying the o-succinylbenzoate synthase (OSBS) family. Most enzymes within this family only catalyze OSBS, which is a step in menaquinone synthesis. However, several characterized enzymes in one branch of the family (called the NSAR/OSBS subfamily) efficiently catalyze both OSBS and N-succinylamino acid racemization (NSAR). Based on genome context, NSAR appears to be the only biological function of some characterized NSAR/OSBS enzymes, while both activities are biologically relevant in others. The promiscuity model predicts that these enzymes evolved from an ancestral OSBS which promiscuously catalyzed NSAR as a side reaction that was not biologically relevant. If so, the model predicts that some extant OSBS enzymes would have low levels of promiscuous NSAR activity. This manuscript describes such an enzyme from Exiguobacterium sp. AT1b (ExiOSBS). We show that ExiOSBS efficiently catalyzes OSBS (kcat/KM=2.6×10(6) M(-1) s(-1)), but its efficiency for the NSAR reaction is only 41 M(-1) s(-1). Moreover, genome context indicates that OSBS is the only biologically relevant activity. ExiOSBS diverged from the NSAR/OSBS subfamily before NSAR emerged as a biologically relevant activity. These results provide evidence that NSAR activity originated as a promiscuous activity in an ancestor of the NSAR/OSBS subfamily. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. (+)-(10R)-Germacrene A synthase from goldenrod, Solidago canadensis; cDNA isolation, bacterial expression and functional analysis.

    Science.gov (United States)

    Prosser, Ian; Phillips, Andy L; Gittings, Simon; Lewis, Mervyn J; Hooper, Antony M; Pickett, John A; Beale, Michael H

    2002-08-01

    Profiling of sesquiterpene hydrocarbons in extracts of goldenrod, Solidago canadensis, by GC-MS revealed the presence of both enantiomers of germacrene D and lesser amounts of germacrene A, alpha-humulene, and beta-caryophyllene. A similarity-based cloning strategy using degenerate oligonucleotide primers, based on conserved amino acid sequences in known plant sesquiterpene synthases and RT-PCR, resulted in the isolation of a full length sesquiterpene synthase cDNA. Functional expression of the cDNA in E. coli, as an N-terminal thioredoxin fusion protein using the pET32b vector yielded an enzyme that was readily purified by nickel-chelate affinity chromatography. Chiral GC-MS analysis of products from of (3)H- and (2)H-labelled farnesyl diphosphate identified the enzyme as (+)-(10R)-germacrene A synthase. Sequence analysis and molecular modelling was used to compare this enzyme with the mechanistically related epi-aristolochene synthase from tobacco.

  10. The FoF1-ATP synthase complex contains novel subunits and is essential for procyclic Trypanosoma brucei

    Czech Academy of Sciences Publication Activity Database

    Zíková, Alena; Schnaufer, A.; Dalley, A. R.; Panigrahi, A. K.; Stuart, K. D.

    2009-01-01

    Roč. 5, č. 5 (2009), s. 1-15 E-ISSN 1932-6203 Keywords : mitochondrion * respiratory chain * / ATP synthase * TAP-tag * RNAi Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.351, year: 2009

  11. The Dictyostelium discoideum cellulose synthase: Structure/function analysis and identification of interacting proteins

    Energy Technology Data Exchange (ETDEWEB)

    Richard L. Blanton

    2004-02-19

    OAK-B135 The major accomplishments of this project were: (1) the initial characterization of dcsA, the gene for the putative catalytic subunit of cellulose synthase in the cellular slime mold Dictyostelium discoideum; (2) the detection of a developmentally regulated event (unidentified, but perhaps a protein modification or association with a protein partner) that is required for cellulose synthase activity (i.e., the dcsA product is necessary, but not sufficient for cellulose synthesis); (3) the continued exploration of the developmental context of cellulose synthesis and DcsA; (4) the isolation of a GFP-DcsA-expressing strain (work in progress); and (5) the identification of Dictyostelium homologues for plant genes whose products play roles in cellulose biosynthesis. Although our progress was slow and many of our results negative, we did develop a number of promising avenues of investigation that can serve as the foundation for future projects.

  12. Bacterial Cell Growth Inhibitors Targeting Undecaprenyl Diphosphate Synthase and Undecaprenyl Diphosphate Phosphatase.

    Science.gov (United States)

    Wang, Yang; Desai, Janish; Zhang, Yonghui; Malwal, Satish R; Shin, Christopher J; Feng, Xinxin; Sun, Hong; Liu, Guizhi; Guo, Rey-Ting; Oldfield, Eric

    2016-10-19

    We synthesized a series of benzoic acids and phenylphosphonic acids and investigated their effects on the growth of Staphylococcus aureus and Bacillus subtilis. One of the most active compounds, 5-fluoro-2-(3-(octyloxy)benzamido)benzoic acid (7, ED 50 ∼0.15 μg mL -1 ) acted synergistically with seven antibiotics known to target bacterial cell-wall biosynthesis (a fractional inhibitory concentration index (FICI) of ∼0.35, on average) but had indifferent effects in combinations with six non-cell-wall biosynthesis inhibitors (average FICI∼1.45). The most active compounds were found to inhibit two enzymes involved in isoprenoid/bacterial cell-wall biosynthesis: undecaprenyl diphosphate synthase (UPPS) and undecaprenyl diphosphate phosphatase (UPPP), but not farnesyl diphosphate synthase, and there were good correlations between bacterial cell growth inhibition, UPPS inhibition, and UPPP inhibition. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Microsatellite instability in colorectal cancer and association with thymidylate synthase and dihydropyrimidine dehydrogenase expression

    DEFF Research Database (Denmark)

    Jensen, Søren A; Vainer, Ben; Kruhøffer, Mogens

    2009-01-01

    BACKGROUND: Microsatellite instability (MSI) refers to mutations in short motifs of tandemly repeated nucleotides resulting from replication errors and deficient mismatch repair (MMR). Colorectal cancer with MSI has characteristic biology and chemosensitivity, however the molecular basis remains...... unclarified. The association of MSI and MMR status with outcome and with thymidylate synthase (TS) and dihydropyrimidine dehydrogenase (DPD) expression in colorectal cancer were evaluated. METHODS: MSI in five reference loci, MMR enzymes (hMSH2, hMSH6, hMLH1 and hPMS2), thymidylate synthase (TS......) and dihydropyrimidine dehydrogenase (DPD) expression were assessed in paraffin embedded tumor specimens, and associated with outcome in 340 consecutive patients completely resected for colorectal cancer stages II-IV and subsequently receiving adjuvant 5-fluorouracil therapy. RESULTS: MSI was found in 43 (13.8%) tumors...

  14. Glycogen synthase kinase 3α regulates urine concentrating mechanism in mice

    DEFF Research Database (Denmark)

    Nørregaard, Rikke; Tao, Shixin; Nilsson, Line

    2015-01-01

    In mammals, glycogen synthase kinase (GSK)3 comprises GSK3α and GSK3β isoforms. GSK3β has been shown to play a role in the ability of kidneys to concentrate urine by regulating vasopressin-mediated water permeability of collecting ducts, whereas the role of GSK3α has yet to be discerned. To inves......In mammals, glycogen synthase kinase (GSK)3 comprises GSK3α and GSK3β isoforms. GSK3β has been shown to play a role in the ability of kidneys to concentrate urine by regulating vasopressin-mediated water permeability of collecting ducts, whereas the role of GSK3α has yet to be discerned...

  15. Alkyldihydropyrones, new polyketides synthesized by a type III polyketide synthase from Streptomyces reveromyceticus.

    Science.gov (United States)

    Aizawa, Teruki; Kim, Seung-Young; Takahashi, Shunji; Koshita, Masahiko; Tani, Mioka; Futamura, Yushi; Osada, Hiroyuki; Funa, Nobutaka

    2014-12-01

    Genome sequencing allows a rapid and efficient identification of novel catalysts that produce novel secondary metabolites. Here we describe the catalytic properties of dihydropyrone synthase A (DpyA), a novel type III polyketide synthase encoded in a linear plasmid of Streptomyces reveromyceticus. Heterologous expression of dpyA led to the accumulation of alkyldihydropyrones A (1), B (2), C (3) and D (4), which are novel dihydropyran compounds that exhibit weak cytotoxicity against the leukemia cell line HL-60. DpyA catalyzes the condensation of β-hydroxyl acid thioester and methylmalonyl-CoA to yield a triketide intermediate that then undergoes lactonization of a secondary alcohol and a thioester to give alkyldihydropyrone.

  16. Strategies in megasynthase engineering - fatty acid synthases (FAS) as model proteins.

    Science.gov (United States)

    Fischer, Manuel; Grininger, Martin

    2017-01-01

    Megasynthases are large multienzyme proteins that produce a plethora of important natural compounds by catalyzing the successive condensation and modification of precursor units. Within the class of megasynthases, polyketide synthases (PKS) are responsible for the production of a large spectrum of bioactive polyketides (PK), which have frequently found their way into therapeutic applications. Rational engineering approaches have been performed during the last 25 years that seek to employ the "assembly-line synthetic concept" of megasynthases in order to deliver new bioactive compounds. Here, we highlight PKS engineering strategies in the light of the newly emerging structural information on megasynthases, and argue that fatty acid synthases (FAS) are and will be valuable objects for further developing this field.

  17. Structure of the ATP Synthase Catalytic Complex (F1) from Escherichia coli in an Autoinhibited conformation

    Energy Technology Data Exchange (ETDEWEB)

    G Cingolani; T Duncan

    2011-12-31

    ATP synthase is a membrane-bound rotary motor enzyme that is critical for cellular energy metabolism in all kingdoms of life. Despite conservation of its basic structure and function, autoinhibition by one of its rotary stalk subunits occurs in bacteria and chloroplasts but not in mitochondria. The crystal structure of the ATP synthase catalytic complex (F{sub 1}) from Escherichia coli described here reveals the structural basis for this inhibition. The C-terminal domain of subunit {var_epsilon} adopts a heretofore unknown, highly extended conformation that inserts deeply into the central cavity of the enzyme and engages both rotor and stator subunits in extensive contacts that are incompatible with functional rotation. As a result, the three catalytic subunits are stabilized in a set of conformations and rotational positions distinct from previous F{sub 1} structures.

  18. IDENTIFICATION AND CHARACTERIZATION OF THE SUCROSE SYNTHASE 2 GENE (Sus2 IN DURUM WHEAT

    Directory of Open Access Journals (Sweden)

    Mariateresa eVolpicella

    2016-03-01

    Full Text Available Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for sucrose synthase in durum wheat (cultivars Ciccio and Svevo is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur and 5-BIL42. The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modelling approaches. The combined results of SUS2 expression and activity levels were then considered in the light of their possible involvement in starch yield.

  19. Enhancing production of bio-isoprene using hybrid MVA pathway and isoprene synthase in E. coli.

    Directory of Open Access Journals (Sweden)

    Jianming Yang

    Full Text Available The depleting petroleum reserve, increasingly severe energy crisis, and global climate change are reigniting enthusiasm for seeking sustainable technologies to replace petroleum as a source of fuel and chemicals. In this paper, the efficiency of the MVA pathway on isoprene production has been improved as follows: firstly, in order to increase MVA production, the source of the "upper pathway" which contains HMG-CoA synthase, acetyl-CoA acetyltransferase and HMG-CoA reductase to covert acetyl-CoA into MVA has been changed from Saccharomyces cerevisiae to Enterococcus faecalis; secondly, to further enhance the production of MVA and isoprene, a alanine 110 of the mvaS gene has been mutated to a glycine. The final genetic strain YJM25 containing the optimized MVA pathway and isoprene synthase from Populus alba can accumulate isoprene up to 6.3 g/L after 40 h of fed-batch cultivation.

  20. Stochastic thermodynamics of a chemical nanomachine: The channeling enzyme tryptophan synthase.

    Science.gov (United States)

    Loutchko, Dimitri; Eisbach, Maximilian; Mikhailov, Alexander S

    2017-01-14

    The enzyme tryptophan synthase is characterized by a complex pattern of allosteric interactions that regulate the catalytic activity of its two subunits and opening or closing of their ligand gates. As a single macromolecule, it implements 13 different reaction steps, with an intermediate product directly channeled from one subunit to another. Based on experimental data, a stochastic model for the operation of tryptophan synthase has been earlier constructed [D. Loutchko, D. Gonze, and A. S. Mikhailov, J. Phys. Chem. B 120, 2179 (2016)]. Here, this model is used to consider stochastic thermodynamics of such a chemical nanomachine. The Gibbs energy landscape of the internal molecular states is determined, the production of entropy and its flow within the enzyme are analyzed, and the information exchange between the subunits resulting from allosteric cross-regulations and channeling is discussed.

  1. Strategies in megasynthase engineering – fatty acid synthases (FAS as model proteins

    Directory of Open Access Journals (Sweden)

    Manuel Fischer

    2017-06-01

    Full Text Available Megasynthases are large multienzyme proteins that produce a plethora of important natural compounds by catalyzing the successive condensation and modification of precursor units. Within the class of megasynthases, polyketide synthases (PKS are responsible for the production of a large spectrum of bioactive polyketides (PK, which have frequently found their way into therapeutic applications. Rational engineering approaches have been performed during the last 25 years that seek to employ the “assembly-line synthetic concept” of megasynthases in order to deliver new bioactive compounds. Here, we highlight PKS engineering strategies in the light of the newly emerging structural information on megasynthases, and argue that fatty acid synthases (FAS are and will be valuable objects for further developing this field.

  2. Promiscuity of a modular polyketide synthase towards natural and non-natural extender units.

    Science.gov (United States)

    Koryakina, Irina; McArthur, John B; Draelos, Matthew M; Williams, Gavin J

    2013-07-21

    Combinatorial biosynthesis approaches that involve modular type I polyketide synthases (PKSs) are proven strategies for the synthesis of polyketides. In general however, such strategies are usually limited in scope and utility due to the restricted substrate specificity of polyketide biosynthetic machinery. Herein, a panel of chemo-enzymatically synthesized acyl-CoA's was used to probe the promiscuity of a polyketide synthase. Promiscuity determinants were dissected, revealing that the KS is remarkably tolerant to a diverse array of extender units, while the AT likely discriminates between extender units that are native to the producing organism. Our data provides a clear blueprint for future enzyme engineering efforts, and sets the stage for harnessing extender unit promiscuity by employing various in vivo polyketide diversification strategies.

  3. Production of taxadiene from cultured ginseng roots transformed with taxadiene synthase gene

    Directory of Open Access Journals (Sweden)

    Mijeong Cha1, Sang Hee Shim1, Sung Hong Kim2, Ok Tae Kim3, Se-Weon Lee4, Suk-Yoon Kwon5 & Kwang-Hyun Baek1,*

    2012-10-01

    Full Text Available Paclitaxel is produced by various species of yew trees and hasbeen extensively used to treat tumors. In our research, ataxadiene synthase (TS gene from Taxus brevifolia was used totransform the roots of cultured ginseng (Panax ginseng C.A.Meyer to produce taxadiene, the unique skeletal precursor totaxol. The TS gene was successfully introduced into theginseng genome, and the de novo formation of taxadiene wasidentified by mass spectroscopy profiling. Without any changein phenotypes or growth difference in a TS-transgenic ginsengline, the transgenic TSS3-2 line accumulated 9.1 μg taxadieneper gram of dry weight. In response to the treatment of methyljasmonate for 3 or 6 days, the accumulation was 14.6 and15.9 μg per g of dry weight, respectively. This is the first reportof the production of taxadiene by engineering ginseng rootswith a taxadiene synthase gene.

  4. Involvement of Glycogen Synthase Kinase-3 in the Mechanisms of Conditioned Food Aversion Memory Reconsolidation.

    Science.gov (United States)

    Nikitin, V P; Solntseva, S V; Kozyrev, S A

    2017-02-01

    Experiments were performed on the snails trained in conditioned food aversion for 3 days. Injection of TDZD-8 (glycogen synthase kinase-3 inhibitor, 2 mg/kg) in combination with reminder (presentation of a conditioned food stimulus) led to memory impairment developing 3 days after inhibitor/reminder exposure and followed by spontaneous recovery in 10 days. Injections of TDZD-8 in a dose of 4 or 20 mg/kg before reminder were shown to cause amnesia that persisted for more than 10 days. Memory recovery during repeated training was observed at the earlier period than after initial training. The impairment of memory reconsolidation by TDZD-8 after training of snails for 1 day was less pronounced than under standard training conditions (3 days). The effect of a glycogen synthase kinase-3 inhibitor during memory reconsolidation is probably followed by impairment of memory retrieval and/or partial loss, which can be compensated spontaneously or after repeated training.

  5. Characterization and expression of glucosamine-6-phosphate synthase from Saccharomyces cerevisiae in Pichia pastoris.

    Science.gov (United States)

    Wang, Sheng; Li, Piwu; Su, Jing; Wu, Xiangkun; Liang, Rongrong

    2014-10-01

    Glucosamine-6-phosphate (GlcN-6-P) synthase from Saccharomyces cerevisiae was expressed in Pichia pastoris SMD1168 GIVING maximum activity of 96 U ml(-1) for the enzyme in the culture medium. By SDS-PAGE, the enzyme, a glycosylated protein, had an apparent molecular mass of 90 kDa. The enzyme was purified by gel exclusion chromatography to near homogeneity, with a 90 % yield and its properties were characterized. Optimal activities were at pH 5.5 and 55 °C, respectively, at which the highest specific activity was 6.8 U mg protein (-1). The enzyme was stable from pH 4.5 to 5.5 and from 45 to 60 °C. The Km and Vmax of the GlcN-6-P synthase towards D-fructose 6-phosphate were 2.8 mM and 6.9 μmol min(-1) mg(-1), respectively.

  6. Strengthening Triterpene Saponins Biosynthesis by Over-Expression of Farnesyl Pyrophosphate Synthase Gene and RNA Interference of Cycloartenol Synthase Gene in Panax notoginseng Cells

    Directory of Open Access Journals (Sweden)

    Yan Yang

    2017-04-01

    Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.

  7. Identification and characterization of (E)-β-caryophyllene synthase and α/β-pinene synthase potentially involved in constitutive and herbivore-induced terpene formation in cotton.

    Science.gov (United States)

    Huang, Xinzheng; Xiao, Yutao; Köllner, Tobias G; Zhang, Wanna; Wu, Junxiang; Wu, Juan; Guo, Yuyuan; Zhang, Yongjun

    2013-12-01

    Cotton (Gossypium hirsutum L.) plants damaged by insects emit a blend of volatiles, including monoterpenes and sesquiterpenes, which can directly repel herbivores and/or indirectly protect the plant by attracting natural enemies of the herbivores. To understand the molecular basis of terpene biosynthesis and regulation in cotton, two terpene synthase genes, GhTPS1 and GhTPS2, were heterologously expressed and characterized. Recombinant GhTPS1 accepted farnesyl pyrophosphate as substrate and produced (E)-β-caryophyllene and α-humulene. GhTPS2 was characterized as a monoterpene synthase which formed α-pinene and β-pinene using geranyl pyrophosphate as substrate. Quantitative real-time PCR analysis revealed that GhTPS1 and GhTPS2 gene expression was elevated after methyl jasmonate (MeJA) treatment in cotton leaves. Moreover, feeding of the green plant bug Apolygus lucorum, a major cotton pest in northern China, resulted in increased GhTPS2 expression in young leaves, suggesting that GhTPS2 might be involved in plant defense in cotton. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  8. Disruption of Bcchs4, Bcchs6 or Bcchs7 chitin synthase genes in Botrytis cinerea and the essential role of class VI chitin synthase (Bcchs6).

    Science.gov (United States)

    Morcx, Serena; Kunz, Caroline; Choquer, Mathias; Assie, Sébastien; Blondet, Eddy; Simond-Côte, Elisabeth; Gajek, Karina; Chapeland-Leclerc, Florence; Expert, Dominique; Soulie, Marie-Christine

    2013-03-01

    Chitin synthases play critical roles in hyphal development and fungal pathogenicity. Previous studies on Botrytis cinerea, a model organism for necrotrophic pathogens, have shown that disruption of Bcchs1 and more particularly Bcchs3a genes have a drastic impact on virulence (Soulié et al., 2003, 2006). In this work, we investigate the role of other CHS including BcCHS4, BcCHS6 and BcCHS7 during the life cycle of B. cinerea. Single deletions of corresponding genes were carried out. Phenotypic analysis indicates that: (i) BcCHS4 enzyme is not essential for development and pathogenicity of the fungus; (ii) BcCHS7 is required for pathogenicity in a host dependant manner. For Bcchs6 gene disruption, we obtained only heterokaryotic strains. Indeed, sexual or asexual purification assays were unsuccessful. We concluded that class VI chitin synthase could be essential for B. cinerea and therefore BcCHS6 represents a valuable antifungal target. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. Cell-Specific Expression of Homospermidine Synthase, the Entry Enzyme of the Pyrrolizidine Alkaloid Pathway in Senecio vernalis, in Comparison with Its Ancestor, Deoxyhypusine Synthase1

    Science.gov (United States)

    Moll, Stefanie; Anke, Sven; Kahmann, Uwe; Hänsch, Robert; Hartmann, Thomas; Ober, Dietrich

    2002-01-01

    Pyrrolizidine alkaloids (PAs) are constitutive plant defense compounds with a sporadic taxonomic occurrence. The first committed step in PA biosynthesis is catalyzed by homospermidine synthase (HSS). Recent evidence confirmed that HSS evolved by gene duplication from deoxyhypusine synthase (DHS), an enzyme involved in the posttranslational activation of the eukaryotic translation initiation factor 5A. To better understand the evolutionary relationship between these two enzymes, which are involved in completely different biological processes, we studied their tissue-specific expression. RNA-blot analysis, reverse transcriptase-PCR, and immunolocalization techniques demonstrated that DHS is constitutively expressed in shoots and roots of Senecio vernalis (Asteraceae), whereas HSS expression is root specific and restricted to distinct groups of endodermis and neighboring cortex cells located opposite to the phloem. All efforts to detect DHS by immunolocalization failed, but studies with promoter-β-glucuronidase fusions confirmed a general expression pattern, at least in young seedlings of tobacco (Nicotiana tabacum). The expression pattern for HSS differs completely from its ancestor DHS due to the adaptation of HSS to the specific requirements of PA biosynthesis. PMID:12226485

  10. Middle T antigen-transformed endothelial cells exhibit an increased activity of nitric oxide synthase

    OpenAIRE

    1995-01-01

    Endothelioma cell lines transformed by polyoma virus middle T antigen (mTa) cause cavernous hemangiomas in syngeneic mice by recruitment of host cells. The production of nitric oxide (NO), as measured by nitrite and citrulline production, was significantly higher in mTa-transformed endothelial cells in comparison with nontransformed control cells. The maximal activity of NO synthase (NOS) was about 200-fold higher in cell lysates from the tEnd.1 endothelioma cell line than in lysates from non...

  11. Fatty Acid Synthase Inhibitors Engage the Cell Death Program Through the Endoplasmic Reticulum

    Science.gov (United States)

    2007-12-01

    Saccharomyces cerevisiae , J Biol Chem 268 (1993) 27269-27276. Epstein, J. I., Carmichael, M. and Partin, A. W., OA-519 (fatty acid synthase) as an independent...547cholesterol lowering drugs is bile acid sequestrants , which 548prevent reabsorption of bile acids by the intestine and result 549in excretion through the...and measured for protein content using a standard copper reduction/bicinchoninic acid assay (BCA; Pierce Biotech- nology), with bovine serum albumin as

  12. Endothelial nitric oxide synthase gene polymorphisms (G894T) in diabetes mellitus in Egypt

    OpenAIRE

    El-baz1 ; Farouk2; Tag Eldin2; Ezat2

    2010-01-01

    Objective: Diabetic nephropathy (DN) is one of the major microvascular complications of diabetes. Genetic predisposition has been implicated in DN. The eNOS protein synthesizes nitric oxide constitutively via a reaction including the conversion of L-arginine to L-citrulline, which involves the transfer of five electrons provided by nicotinamide adenine dinucleotide phosphate The aim of this study is to evaluate the association of G894T polymorphisms of endothelial nitric oxide synthase(eNOS) ...

  13. Spermine Synthase Deficiency Leads to Deafness and a Profound Sensitivity to α-Difluoromethylornithine*♦

    Science.gov (United States)

    Wang, Xiaojing; Levic, Snezana; Gratton, Michael Anne; Doyle, Karen Jo; Yamoah, Ebenezer N.; Pegg, Anthony E.

    2009-01-01

    Male gyro (Gy) mice, which have an X chromosomal deletion inactivating the SpmS and Phex genes, were found to be profoundly hearing impaired. This defect was due to alteration in polyamine content due to the absence of spermine synthase, the product of the SpmS gene. It was reversed by breeding the Gy strain with CAG/SpmS mice, a transgenic line that ubiquitously expresses spermine synthase under the control of a composite cytomegalovirus-IE enhancer/chicken β-actin promoter. There was an almost complete loss of the endocochlear potential in the Gy mice, which parallels the hearing deficiency, and this was also reversed by the production of spermine from the spermine synthase transgene. Gy mice showed a striking toxic response to treatment with the ornithine decarboxylase inhibitor α-difluoromethylornithine (DFMO). Within 2–3 days of exposure to DFMO in the drinking water, the Gy mice suffered a catastrophic loss of motor function resulting in death within 5 days. This effect was due to an inability to maintain normal balance and was also prevented by the transgenic expression of spermine synthase. DFMO treatment of control mice or Gy-CAG/SpmS had no effect on balance. The loss of balance in Gy mice treated with DFMO was due to inhibition of polyamine synthesis because it was prevented by administration of putrescine. Our results are consistent with a critical role for polyamines in regulation of Kir channels that maintain the endocochlear potential and emphasize the importance of normal spermidine:spermine ratio in the hearing and balance functions of the inner ear. PMID:19001365

  14. Post-irradiation inactivation, protection, and repair of the sulfhydryl enzyme malate synthase

    International Nuclear Information System (INIS)

    Durchschlag, H.; Zipper, P.

    1985-01-01

    Malate synthase from baker's yeast, a trimeric sulfhydryl enzyme with one essential sulfhydryl group per subunit, was inactivated by 2 kGy X-irradiation in air-saturated aqueous solution (enzyme concentration: 0.5 mg/ml). The radiation induced changes of enzymic activity were registered at about 0,30,60 h after irradiation. To elucidate the role of OH - , O 2 , and H 2 O 2 in the X-ray inactivation of the enzyme, experiments were performed in the absence of presence of different concentrations of specific additives (formate, superoxide dismutase, catalase). These additives were added to malate synthase solutions before or after X-irradiation. Moreover, repairs of inactivated malate synthase were initiated at about 0 or 30 h after irradiation by means of the sulfhydryl agent dithiothreitol. Experiments yielded the following results: 1. Irradiation of malate synthase in the absence of additives inactivated the enzyme immediately to a residual activity Asub(r)=3% (corresponding to a D 37 =0.6 kGy), and led to further slow inactivation in the post-irradiation phase. Repairs, initiated at different times after irradiation, restored enzymic activity considerably. The repair initiated at t=0 led to Asub(r)=21%; repairs started later on resulted in somewhat lower activities. The decay of reparability, however, was found to progress more slowly than post-irradiation inactivation itself. After completion of repair the activities of repaired samples did not decrease significantly. 2. The presence of specific additives during irradiation caused significant protective effects against primary inactivation. The protection by formate was very pronounced (e.g., Asub(r)=72% and D 37 =6 kGy for 100 mM formate). The presence of catalytic amounts of superoxide dismutase and/or catalase exhibited only minor effects, depending on the presence and concentration of formate. (orig.)

  15. Identification of Sporothrix schenckii based on sequences of the chitin synthase 1 gene.

    Science.gov (United States)

    Kano, R; Nakamura, Y; Watanabe, S; Tsujimoto, H; Hasegawa, A

    2001-01-01

    Sporothrix schenckii is pathogenic to human and animals. To detect S. schenckii in the tissue, we designed specific oligonucleotide primers based on the chitin synthase gene. Amplification products were selectively obtained from S. schenckii DNA. Polymerase chain reaction analysis with the primer pair S2-R2 was able to detect 10 pg genomic DNA of S. schenckii with ethidium bromide staining. This detection system will be useful as a microbiological tool for the diagnosis of human and animal sporotrichosis.

  16. Improved pestalotiollide B production by deleting competing polyketide synthase genes in Pestalotiopsis microspora.

    Science.gov (United States)

    Chen, Longfei; Li, Yingying; Zhang, Qian; Wang, Dan; Akhberdi, Oren; Wei, Dongsheng; Pan, Jiao; Zhu, Xudong

    2017-02-01

    Pestalotiollide B, an analog of dibenzodioxocinones which are inhibitors of cholesterol ester transfer proteins, is produced by Pestalotiopsis microspora NK17. To increase the production of pestalotiollide B, we attempted to eliminate competing polyketide products by deleting the genes responsible for their biosynthesis. We successfully deleted 41 out of 48 putative polyketide synthases (PKSs) in the genome of NK17. Nine of the 41 PKS deleted strains had significant increased production of pestalotiollide B (P polyketides.

  17. The first prokaryotic trehalose synthase complex identified in the hyperthermophilic crenarchaeon Thermoproteus tenax.

    Directory of Open Access Journals (Sweden)

    Melanie Zaparty

    Full Text Available The role of the disaccharide trehalose, its biosynthesis pathways and their regulation in Archaea are still ambiguous. In Thermoproteus tenax a fused trehalose-6-phosphate synthase/phosphatase (TPSP, consisting of an N-terminal trehalose-6-phosphate synthase (TPS and a C-terminal trehalose-6-phosphate phosphatase (TPP domain, was identified. The tpsp gene is organized in an operon with a putative glycosyltransferase (GT and a putative mechanosensitive channel (MSC. The T. tenax TPSP exhibits high phosphatase activity, but requires activation by the co-expressed GT for bifunctional synthase-phosphatase activity. The GT mediated activation of TPS activity relies on the fusion of both, TPS and TPP domain, in the TPSP enzyme. Activation is mediated by complex-formation in vivo as indicated by yeast two-hybrid and crude extract analysis. In combination with first evidence for MSC activity the results suggest a sophisticated stress response involving TPSP, GT and MSC in T. tenax and probably in other Thermoproteales species. The monophyletic prokaryotic TPSP proteins likely originated via a single fusion event in the Bacteroidetes with subsequent horizontal gene transfers to other Bacteria and Archaea. Furthermore, evidence for the origin of eukaryotic TPSP fusions via HGT from prokaryotes and therefore a monophyletic origin of eukaryotic and prokaryotic fused TPSPs is presented. This is the first report of a prokaryotic, archaeal trehalose synthase complex exhibiting a much more simple composition than the eukaryotic complex described in yeast. Thus, complex formation and a complex-associated regulatory potential might represent a more general feature of trehalose synthesizing proteins.

  18. Optimization of expression and properties of the recombinant acetohydroxyacid synthase of Thermotoga maritima

    Directory of Open Access Journals (Sweden)

    Mohammad S. Eram

    2015-12-01

    Full Text Available The data provide additional support of the characterization of the biophysical and biochemical properties of the enzyme acetohydroxyacid synthase from the hyperthermophilic bacterium Thermotoga maritima (Eram et al., 2015 [1]. The genes encoding the enzyme subunits have been cloned and expressed in the mesophilic host Escherichia coli. Detailed data include information about the optimization of the expression conditions, biophysical properties of the enzyme and reconstitution of the holoenzyme from individually expressed and purified subunits.

  19. Respiratory Muscle Training Improves Diaphragm Citrate Synthase Activity and Hemodynamic Function in Rats with Heart Failure.

    Science.gov (United States)

    Jaenisch, Rodrigo Boemo; Bertagnolli, Mariane; Borghi-Silva, Audrey; Arena, Ross; Lago, Pedro Dal

    2017-01-01

    Enhanced respiratory muscle strength in patients with heart failure positively alters the clinical trajectory of heart failure. In an experimental model, respiratory muscle training in rats with heart failure has been shown to improve cardiopulmonary function through mechanisms yet to be entirely elucidated. The present report aimed to evaluate the respiratory muscle training effects in diaphragm citrate synthase activity and hemodynamic function in rats with heart failure. Wistar rats were divided into four experimental groups: sedentary sham (Sed-Sham, n=8), trained sham (RMT-Sham, n=8), sedentary heart failure (Sed-HF, n=7) and trained heart failure (RMT-HF, n=7). The animals were submitted to a RMT protocol performed 30 minutes a day, 5 days/week, for 6 weeks. In rats with heart failure, respiratory muscle training decreased pulmonary congestion and right ventricular hypertrophy. Deleterious alterations in left ventricular pressures, as well as left ventricular contractility and relaxation, were assuaged by respiratory muscle training in heart failure rats. Citrate synthase activity, which was significantly reduced in heart failure rats, was preserved by respiratory muscle training. Additionally, a negative correlation was found between citrate synthase and left ventricular end diastolic pressure and positive correlation was found between citrate synthase and left ventricular systolic pressure. Respiratory muscle training produces beneficial adaptations in the diaphragmatic musculature, which is linked to improvements in left ventricular hemodynamics and blood pressure in heart failure rats. The RMT-induced improvements in cardiac architecture and the oxidative capacity of the diaphragm may improve the clinical trajectory of patients with heart failure.

  20. Neuronal nitric oxide synthase is involved in the induction of NGF induced neck muscle nociception

    OpenAIRE

    Isaak, Andreas

    2011-01-01

    BACKGROUND: Neck muscle nociception mediated by nitric oxide may play a role in the pathophysiology of tension-type headache.OBJECTIVE: The present study addresses the involvement of neuronal nitric oxide synthase (nNOS) in the facilitation of neck muscle nociception after local application of nerve growth factor (NGF).METHODS: After administration of NGF into semispinal neck muscles, the impact of neck muscle noxious input on brainstem processing was monitored by the jaw-opening reflex in an...

  1. Enantioselective synthesis of the novel chiral sulfoxide derivative as a glycogen synthase kinase 3beta inhibitor.

    Science.gov (United States)

    Saitoh, Morihisa; Kunitomo, Jun; Kimura, Eiji; Yamano, Toru; Itoh, Fumio; Kori, Masakuni

    2010-09-01

    Glycogen synthase kinase 3beta (GSK-3beta) inhibitors are expected to be attractive therapeutic agents for the treatment of Alzheimer's disease (AD). Recently we discovered sulfoxides (S)-1 as a novel GSK-3beta inhibitor having in vivo efficacy. We investigated practical asymmetric preparation methods for the scale-up synthesis of (S)-1. The highly enantioselective synthesis of (S)-1 (94% ee) was achieved by titanium-mediated oxidation with D-(-)-diethyl tartrate on gram scale.

  2. Pre- and posttranslational upregulation of muscle-specific glycogen synthase in athletes

    DEFF Research Database (Denmark)

    Vestergaard, H; Andersen, P H; Lund, S

    1994-01-01

    Expression of muscle-specific glycogen synthase (GS) and phosphofructokinase (PFK) was analyzed in seven athletes and eight control subjects who were characterized using the euglycemic, hyperinsulinemic (2 mU.kg-1.min-1) clamp technique in combination with indirect calorimetry and biopsy sampling...... regulation of the GS protein activity is important for the increased glycogen synthesis rate of muscle in endurance-trained individuals....

  3. Molecular Cloning and Functional Analysis of Squalene Synthase 2(SQS2) in Salvia miltiorrhiza Bunge

    OpenAIRE

    Qixian Rong; Dan Jiang; Dan Jiang; Yijun Chen; Yijun Chen; Ye Shen; Qingjun Yuan; Huixin Lin; Liangping Zha; Yan Zhang; Luqi Huang

    2016-01-01

    Salvia miltiorrhiza Bunge,which is also known as a traditional Chinese herbal medicine,is widely studied for its ability to accumulate the diterpene quinone Tanshinones. In addition to producing a variety of diterpene quinone, S. miltiorrhiza Bunge also accumulates sterol, brassinosteroid and triterpenoids. During their biosynthesis, squalene synthase (SQS, EC 2.5.1.21) converts two molecules of the hydrophilic substrate farnesyl diphosphate into a hydrophobic product, squalene. In the presen...

  4. Molecular Cloning and Functional Analysis of Squalene Synthase 2(SQS2) in Salvia miltiorrhiza Bunge

    OpenAIRE

    Rong, Qixian; Jiang, Dan; Chen, Yijun; Shen, Ye; Yuan, Qingjun; Lin, Huixin; Zha, Liangping; Zhang, Yan; Huang, Luqi

    2016-01-01

    Salvia miltiorrhiza Bunge, which is also known as a traditional Chinese herbal medicine, is widely studied for its ability to accumulate the diterpene quinone Tanshinones. In addition to producing a variety of diterpene quinone, S. miltiorrhiza Bunge also accumulates sterol, brassinosteroid and triterpenoids. During their biosynthesis, squalene synthase (SQS, EC 2.5.1.21) converts two molecules of the hydrophilic substrate farnesyl diphosphate (FPP) into a hydrophobic product, squalene. In th...

  5. Endothelial nitric oxide synthase: a potential therapeutic target for cerebrovascular diseases.

    Science.gov (United States)

    Zhu, Jinqiang; Song, Wanshan; Li, Lin; Fan, Xiang

    2016-03-22

    Endothelial nitric oxide (NO) is a significant signaling molecule that regulates cerebral blood flow (CBF), playing a pivotal role in the prevention and treatment of cerebrovascular diseases. However, achieving the expected therapeutic efficacy is difficult using direct administration of NO donors. Therefore, endothelial nitric oxide synthase (eNOS) becomes a potential therapeutic target for cerebrovascular diseases. This review summarizes the current evidence supporting the importance of CBF to cerebrovascular function, and the roles of NO and eNOS in CBF regulation.

  6. Isolation and Characterization of Two Germacrene A Synthase cDNA Clones from Chicory1

    Science.gov (United States)

    Bouwmeester, Harro J.; Kodde, Jan; Verstappen, Francel W.A.; Altug, Iris G.; de Kraker, Jan-Willem; Wallaart, T. Eelco

    2002-01-01

    Chicory (Cichorium intybus) sesquiterpene lactones were recently shown to be derived from a common sesquiterpene intermediate, (+)-germacrene A. Germacrene A is of interest because of its key role in sesquiterpene lactone biosynthesis and because it is an enzyme-bound intermediate in the biosynthesis of a number of phytoalexins. Using polymerase chain reaction with degenerate primers, we have isolated two sesquiterpene synthases from chicory that exhibited 72% amino acid identity. Heterologous expression of the genes in Escherichia coli has shown that they both catalyze exclusively the formation of (+)-germacrene A, making this the first report, to our knowledge, on the isolation of (+)-germacrene A synthase (GAS)-encoding genes. Northern analysis demonstrated that both genes were expressed in all chicory tissues tested albeit at varying levels. Protein isolation and partial purification from chicory heads demonstrated the presence of two GAS proteins. On MonoQ, these proteins co-eluted with the two heterologously produced proteins. The Km value, pH optimum, and MonoQ elution volume of one of the proteins produced in E. coli were similar to the values reported for the GAS protein that was recently purified from chicory roots. Finally, the two deduced amino acid sequences were modeled, and the resulting protein models were compared with the crystal structure of tobacco (Nicotiana tabacum) 5-epi-aristolochene synthase, which forms germacrene A as an enzyme-bound intermediate en route to 5-epi-aristolochene. The possible involvement of a number of amino acids in sesquiterpene synthase product specificity is discussed. PMID:12011345

  7. Synthesis of N-(Methoxycarbonylthienylmethylthioureas and Evaluation of Their Interaction with Inducible and Neuronal Nitric Oxide Synthase

    Directory of Open Access Journals (Sweden)

    Michael D. Threadgill

    2010-04-01

    Full Text Available Two isomeric N-(methoxycarbonylthienylmethylthioureas were synthesised by a sequence of radical bromination of methylthiophenecarboxylic esters, substitution with trifluoroacetamide anion, deprotection, formation of the corresponding isothiocyanates and addition of ammonia. The interaction of these new thiophene-based thioureas with inducible and neuronal nitric oxide synthase was evaluauted. These novel thienylmethylthioureas stimulated the activity of inducible Nitric Oxide Synthase (iNOS.

  8. Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP.

    Science.gov (United States)

    Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica

    2017-10-01

    Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  9. In silico design of PHA synthase and its validation by PHAs producing bacterial isolates

    Directory of Open Access Journals (Sweden)

    Susrita Sahoo

    2017-10-01

    Full Text Available Biopolymers are important alternatives to the petroleum-based plastics due to environment friendly manufacturing processes, biodegradability and biocompatibility. Therefore use of novel biopolymers such as polylactide, polysaccharides, aliphatic polyesters and polyhydroxyalkonoates (PHAs is of interest. PHAs are biodegradable polyesters of hydroxyalkanoates (HA produced from renewable resources by using microorganisms as intracellular carbon and energy storage compounds.  Even though PHAs are promising candidate for biodegradable polymers, however, the production cost limits their application on an industrial scale. Therefore an attempt was made to model different PHAs synthases which are the key enzyme in the biosynthesis of Polyhydroxyalkanoates as the structural information of this enzyme is in dark veil.Then molecular docking  of class I  PHA  Synthase from Ralstonia Eutrophia was done to study the PHA synthase activity. As there are lots of strain which needs to explore for the production of PHA. This investigation leads to find out the most industrial applicable microbes. Few bacterial isolates from soil sample were screened for production of PHA followed by the validation of the enzymatic activity and its product characterization to understand its structural properties.

  10. Gibberellin overproduction promotes sucrose synthase expression and secondary cell wall deposition in cotton fibers.

    Directory of Open Access Journals (Sweden)

    Wen-Qin Bai

    Full Text Available Bioactive gibberellins (GAs comprise an important class of natural plant growth regulators and play essential roles in cotton fiber development. To date, the molecular base of GAs' functions in fiber development is largely unclear. To address this question, the endogenous bioactive GA levels in cotton developing fibers were elevated by specifically up-regulating GA 20-oxidase and suppressing GA 2-oxidase via transgenic methods. Higher GA levels in transgenic cotton fibers significantly increased micronaire values, 1000-fiber weight, cell wall thickness and cellulose contents of mature fibers. Quantitative RT-PCR and biochemical analysis revealed that the transcription of sucrose synthase gene GhSusA1 and sucrose synthase activities were significantly enhanced in GA overproducing transgenic fibers, compared to the wild-type cotton. In addition, exogenous application of bioactive GA could promote GhSusA1 expression in cultured fibers, as well as in cotton hypocotyls. Our results suggested that bioactive GAs promoted secondary cell wall deposition in cotton fibers by enhancing sucrose synthase expression.

  11. Crystallization and preliminary crystallographic analysis of mannosyl-3-phosphoglycerate synthase from Rubrobacter xylanophilus

    International Nuclear Information System (INIS)

    Sá-Moura, Bebiana; Albuquerque, Luciana; Empadinhas, Nuno; Costa, Milton S. da; Pereira, Pedro José Barbosa; Macedo-Ribeiro, Sandra

    2008-01-01

    The enzyme mannosyl-3-phosphoglycerate synthase from R. xylanophilus has been expressed, purified and crystallized. The crystals belong to the hexagonal space group P6 5 22 and diffract to 2.2 Å resolution. Rubrobacter xylanophilus is the only Gram-positive bacterium known to synthesize the compatible solute mannosylglycerate (MG), which is commonly found in hyperthermophilic archaea and some thermophilic bacteria. Unlike the salt-dependent pattern of accumulation observed in (hyper)thermophiles, in R. xylanophilus MG accumulates constitutively. The synthesis of MG in R. xylanophilus was tracked from GDP-mannose and 3-phosphoglycerate, but the genome sequence of the organism failed to reveal any of the genes known to be involved in this pathway. The native enzyme was purified and its N-terminal sequence was used to identify the corresponding gene (mpgS) in the genome of R. xylanophilus. The gene encodes a highly divergent mannosyl-3-phosphoglycerate synthase (MpgS) without relevant sequence homology to known mannosylphosphoglycerate synthases. In order to understand the specificity and enzymatic mechanism of this novel enzyme, it was expressed in Escherichia coli, purified and crystallized. The crystals thus obtained belonged to the hexagonal space group P6 5 22 and contained two protein molecules per asymmetric unit. The structure was solved by SIRAS using a mercury derivative

  12. Structural study and thermodynamic characterization of inhibitor binding to lumazine synthase from Bacillus anthracis

    Energy Technology Data Exchange (ETDEWEB)

    Morgunova, Ekaterina [Karolinska Institutet NOVUM, Center of Structural Biochemistry, Hälsovägen 7-9, 141 57 Huddinge (Sweden); Illarionov, Boris; Saller, Sabine [Institut für Lebensmittelchemie, Universität Hamburg, Grindelallee 117, 20146 Hamburg (Germany); Popov, Aleksander [European Synchrotron Radiation Facility, BP 220, F-38043 Grenoble CEDEX 09 (France); Sambaiah, Thota [Department of Medicinal Chemistry and Molecular Pharmacology, Purdue University (United States); Bacher, Adelbert [Chemistry Department, Technical University of Munich, 85747 Garching (Germany); Cushman, Mark [Department of Medicinal Chemistry and Molecular Pharmacology, Purdue University (United States); Fischer, Markus [Institut für Lebensmittelchemie, Universität Hamburg, Grindelallee 117, 20146 Hamburg (Germany); Ladenstein, Rudolf, E-mail: rudolf.ladenstein@ki.se [Karolinska Institutet NOVUM, Center of Structural Biochemistry, Hälsovägen 7-9, 141 57 Huddinge (Sweden)

    2010-09-01

    Crystallographic studies of lumazine synthase, the penultimate enzyme of the riboflavin-biosynthetic pathway in B. anthracis, provide a structural framework for the design of antibiotic inhibitors, together with calorimetric and kinetic investigations of inhibitor binding. The crystal structure of lumazine synthase from Bacillus anthracis was solved by molecular replacement and refined to R{sub cryst} = 23.7% (R{sub free} = 28.4%) at a resolution of 3.5 Å. The structure reveals the icosahedral symmetry of the enzyme and specific features of the active site that are unique in comparison with previously determined orthologues. The application of isothermal titration calorimetry in combination with enzyme kinetics showed that three designed pyrimidine derivatives bind to lumazine synthase with micromolar dissociation constants and competitively inhibit the catalytic reaction. Structure-based modelling suggested the binding modes of the inhibitors in the active site and allowed an estimation of the possible contacts formed upon binding. The results provide a structural framework for the design of antibiotics active against B. anthracis.

  13. Characterization of three chalcone synthase-like genes from apple (Malus x domestica Borkh.).

    Science.gov (United States)

    Yahyaa, Mosaab; Ali, Samah; Davidovich-Rikanati, Rachel; Ibdah, Muhammad; Shachtier, Alona; Eyal, Yoram; Lewinsohn, Efraim; Ibdah, Mwafaq

    2017-08-01

    Apple (Malus x domestica Brokh.) is a widely cultivated deciduous tree species of significant economic importance. Apple leaves accumulate high levels of flavonoids and dihydrochalcones, and their formation is dependent on enzymes of the chalcone synthase family. Three CHS genes were cloned from apple leaves and expressed in Escherichia coli. The encoded recombinant enzymes were purified and functionally characterized. In-vitro activity assays indicated that MdCHS1, MdCHS2 and MdCHS3 code for proteins exhibiting polyketide synthase activity that accepted either p-dihydrocoumaroyl-CoA, p-coumaroyl-CoA, or cinnamoyl-CoA as starter CoA substrates in the presence of malonyl-CoA, leading to production of phloretin, naringenin chalcone, and pinocembrin chalcone. MdCHS3 coded a chalcone-dihydrochalcone synthase enzyme with narrower substrate specificity than the previous ones. The apparent Km values of MdCHS3 for p-dihydrocoumaryl-CoA and p-coumaryl-CoA were both 5.0 μM. Expression analyses of MdCHS genes varied according to tissue type. MdCHS1, MdCHS2 and MdCHS3 expression levels were associated with the levels of phloretin accumulate in the respective tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Expanding the chemical space of polyketides through structure-guided mutagenesis of Vitis vinifera stilbene synthase.

    Science.gov (United States)

    Bhan, Namita; Cress, Brady F; Linhardt, Robert J; Koffas, Mattheos

    2015-08-01

    Several natural polyketides (PKs) have been associated with important pharmaceutical properties. Type III polyketide synthases (PKS) that generate aromatic PK polyketides have been studied extensively for their substrate promiscuity and product diversity. Stilbene synthase-like (STS) enzymes are unique in the type III PKS class as they possess a hydrogen bonding network, furnishing them with thioesterase-like properties, resulting in aldol condensation of the polyketide intermediates formed. Chalcone synthases (CHS) in contrast, lack this hydrogen-bonding network, resulting primarily in the Claisen condensation of the polyketide intermediates formed. We have attempted to expand the chemical space of this interesting class of compounds generated by creating structure-guided mutants of Vitis vinifera STS. Further, we have utilized a previously established workflow to quickly compare the wild-type reaction products to those generated by the mutants and identify novel PKs formed by using XCMS analysis of LC-MS and LC-MS/MS data. Based on this approach, we were able to generate 15 previously unreported PK molecules by exploring the substrate promiscuity of the wild-type enzyme and all mutants using unnatural substrates. These structures were specific to STSs and cannot be formed by their closely related CHS-like counterparts. Copyright © 2015 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  15. Expression, purification and characterization of recombinant (E)-beta-farnesene synthase from Artemisia annua.

    Science.gov (United States)

    Picaud, Sarah; Brodelius, Maria; Brodelius, Peter E

    2005-05-01

    A cDNA clone (GenBank Accession No. AY835398) encoding a sesquiterpene synthase, (E)-beta-farnesene synthase, has been isolated from Artemisia annua L. It contains a 1746-bp open reading frame coding for 574 amino acids (66.9 kDa) with a calculated pI=5.03. The deduced amino acid sequence is 30-50% identical with sequences of other sesquiterpene synthases from angiosperms. The recombinant enzyme, produced in Escherichia coli, catalyzed the formation of a single product, beta-farnesene, from farnesyl diphosphate. The pH optimum for the recombinant enzyme is around 6.5 and the K(m)- and k(cat)-values for farnesyl diphosphate, is 2.1 microM and 9.5 x 10(-3) s(-1), respectively resulting in the efficiency 4.5 x 10(-3) M(-1)s(-1). The enzyme exhibits substantial activity in the presence of Mg(2+), Mn(2+) or Co(2+) but essentially no activity when Zn(2+), Ni(2+) or Cu(2+) is used as cofactor. The concentration required for maximum activity are estimated to 5 mM, 0.5 mM and <10 microM for Mg(2+), Co(2+) or Mn(2+), respectively. Geranyl diphosphate is not a substrate for the recombinant enzyme.

  16. Crystallization and preliminary crystallographic analysis of mannosyl-3-phosphoglycerate synthase from Rubrobacter xylanophilus

    Energy Technology Data Exchange (ETDEWEB)

    Sá-Moura, Bebiana [IBMC - Instituto de Biologia Molecular e Celular, Universidade do Porto, Porto (Portugal); Albuquerque, Luciana; Empadinhas, Nuno [Centro de Neurociências e Biologia Celular, Departamento de Zoologia, Universidade de Coimbra, Coimbra (Portugal); Costa, Milton S. da [Departamento de Bioquímica, Universidade de Coimbra, Coimbra (Portugal); Pereira, Pedro José Barbosa; Macedo-Ribeiro, Sandra, E-mail: sribeiro@ibmc.up.pt [IBMC - Instituto de Biologia Molecular e Celular, Universidade do Porto, Porto (Portugal)

    2008-08-01

    The enzyme mannosyl-3-phosphoglycerate synthase from R. xylanophilus has been expressed, purified and crystallized. The crystals belong to the hexagonal space group P6{sub 5}22 and diffract to 2.2 Å resolution. Rubrobacter xylanophilus is the only Gram-positive bacterium known to synthesize the compatible solute mannosylglycerate (MG), which is commonly found in hyperthermophilic archaea and some thermophilic bacteria. Unlike the salt-dependent pattern of accumulation observed in (hyper)thermophiles, in R. xylanophilus MG accumulates constitutively. The synthesis of MG in R. xylanophilus was tracked from GDP-mannose and 3-phosphoglycerate, but the genome sequence of the organism failed to reveal any of the genes known to be involved in this pathway. The native enzyme was purified and its N-terminal sequence was used to identify the corresponding gene (mpgS) in the genome of R. xylanophilus. The gene encodes a highly divergent mannosyl-3-phosphoglycerate synthase (MpgS) without relevant sequence homology to known mannosylphosphoglycerate synthases. In order to understand the specificity and enzymatic mechanism of this novel enzyme, it was expressed in Escherichia coli, purified and crystallized. The crystals thus obtained belonged to the hexagonal space group P6{sub 5}22 and contained two protein molecules per asymmetric unit. The structure was solved by SIRAS using a mercury derivative.

  17. Evidence for an iterative module in chain elongation on the azalomycin polyketide synthase

    Directory of Open Access Journals (Sweden)

    Hui Hong

    2016-10-01

    Full Text Available The assembly-line synthases that produce bacterial polyketide natural products follow a modular paradigm in which each round of chain extension is catalysed by a different set or module of enzymes. Examples of deviation from this paradigm, in which a module catalyses either multiple extensions or none are of interest from both a mechanistic and an evolutionary viewpoint. We present evidence that in the biosynthesis of the 36-membered macrocyclic aminopolyol lactones (marginolactones azalomycin and kanchanamycin, isolated respectively from Streptomyces malaysiensis DSM4137 and Streptomyces olivaceus Tü4018, the first extension module catalyses both the first and second cycles of polyketide chain extension. To confirm the integrity of the azl gene cluster, it was cloned intact on a bacterial artificial chromosome and transplanted into the heterologous host strain Streptomyces lividans, which does not possess the genes for marginolactone production. When furnished with 4-guanidinobutyramide, a specific precursor of the azalomycin starter unit, the recombinant S. lividans produced azalomycin, showing that the polyketide synthase genes in the sequenced cluster are sufficient to accomplish formation of the full-length polyketide chain. This provides strong support for module iteration in the azalomycin and kanchanamycin biosynthetic pathways. In contrast, re-sequencing of the gene cluster for biosynthesis of the polyketide β-lactone ebelactone in Streptomyces aburaviensis has shown that, contrary to a recently-published proposal, the ebelactone polyketide synthase faithfully follows the colinear modular paradigm.

  18. Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw

    Directory of Open Access Journals (Sweden)

    Yanjing Su

    2012-06-01

    Full Text Available Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase and its wild type (WT were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p0.05 was detected in neutral detergent fiber (NDFom and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05. The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05, but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants.

  19. Atypical composition and structure of the mitochondrial dimeric ATP synthase from Euglena gracilis.

    Science.gov (United States)

    Yadav, K N Sathish; Miranda-Astudillo, Héctor V; Colina-Tenorio, Lilia; Bouillenne, Fabrice; Degand, Hervé; Morsomme, Pierre; González-Halphen, Diego; Boekema, Egbert J; Cardol, Pierre

    2017-04-01

    Mitochondrial respiratory-chain complexes from Euglenozoa comprise classical subunits described in other eukaryotes (i.e. mammals and fungi) and subunits that are restricted to Euglenozoa (e.g. Euglena gracilis and Trypanosoma brucei). Here we studied the mitochondrial F 1 F O -ATP synthase (or Complex V) from the photosynthetic eukaryote E. gracilis in detail. The enzyme was purified by a two-step chromatographic procedure and its subunit composition was resolved by a three-dimensional gel electrophoresis (BN/SDS/SDS). Twenty-two different subunits were identified by mass-spectrometry analyses among which the canonical α, β, γ, δ, ε, and OSCP subunits, and at least seven subunits previously found in Trypanosoma. The ADP/ATP carrier was also associated to the ATP synthase into a dimeric ATP synthasome. Single-particle analysis by transmission electron microscopy of the dimeric ATP synthase indicated that the structures of both the catalytic and central rotor parts are conserved while other structural features are original. These new features include a large membrane-spanning region joining the monomers, an external peripheral stalk and a structure that goes through the membrane and reaches the inter membrane space below the c-ring, the latter having not been reported for any mitochondrial F-ATPase. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    Energy Technology Data Exchange (ETDEWEB)

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  1. Structural and Functional Trends in Dehydrating Bimodules from trans -Acyltransferase Polyketide Synthases

    Energy Technology Data Exchange (ETDEWEB)

    Wagner, Drew T.; Zeng, Jia; Bailey, Constance B.; Gay, Darren C.; Yuan, Fang; Manion, Hannah R.; Keatinge-Clay, Adrian T. (Texas)

    2017-07-01

    In an effort to uncover the structural motifs and biosynthetic logic of the relatively uncharacterized trans-acyltransferase polyketide synthases, we have begun the dissection of the enigmatic dehydrating bimodules common in these enzymatic assembly lines. We report the 1.98 Å resolution structure of a ketoreductase (KR) from the first half of a type A dehydrating bimodule and the 2.22 Å resolution structure of a dehydratase (DH) from the second half of a type B dehydrating bimodule. The KR, from the third module of the bacillaene synthase, and the DH, from the tenth module of the difficidin synthase, possess features not observed in structurally characterized homologs. The DH architecture provides clues for how it catalyzes a unique double dehydration. Correlations between the chemistries proposed for dehydrating bimodules and bioinformatic analysis indicate that type A dehydrating bimodules generally produce an α/β-cis alkene moiety, while type B dehydrating bimodules generally produce an α/β-trans, γ/δ-cis diene moiety.

  2. The α-Terpineol to 1,8-Cineole Cyclization Reaction of Tobacco Terpene Synthases1

    Science.gov (United States)

    Piechulla, Birgit; Bartelt, Richard; Brosemann, Anne; Bouwmeester, Harro; Hippauf, Frank

    2016-01-01

    Flowers of Nicotiana species emit a characteristic blend including the cineole cassette monoterpenes. This set of terpenes is synthesized by multiproduct enzymes, with either 1,8-cineole or α-terpineol contributing most to the volatile spectrum, thus referring to cineole or terpineol synthase, respectively. To understand the molecular and structural requirements of the enzymes that favor the biochemical formation of α-terpineol and 1,8-cineole, site-directed mutagenesis, in silico modeling, and semiempiric calculations were performed. Our results indicate the formation of α-terpineol by a nucleophilic attack of water. During this attack, the α-terpinyl cation is stabilized by π-stacking with a tryptophan side chain (tryptophan-253). The hypothesized catalytic mechanism of α-terpineol-to-1,8-cineole conversion is initiated by a catalytic dyad (histidine-502 and glutamate-249), acting as a base, and a threonine (threonine-278) providing the subsequent rearrangement from terpineol to cineol by catalyzing the autoprotonation of (S)-(−)-α-terpineol, which is the favored enantiomer product of the recombinant enzymes. Furthermore, by site-directed mutagenesis, we were able to identify amino acids at positions 147, 148, and 266 that determine the different terpineol-cineole ratios in Nicotiana suaveolens cineole synthase and Nicotiana langsdorffii terpineol synthase. Since amino acid 266 is more than 10 Å away from the active site, an indirect effect of this amino acid exchange on the catalysis is discussed. PMID:27729471

  3. The α-Terpineol to 1,8-Cineole Cyclization Reaction of Tobacco Terpene Synthases.

    Science.gov (United States)

    Piechulla, Birgit; Bartelt, Richard; Brosemann, Anne; Effmert, Uta; Bouwmeester, Harro; Hippauf, Frank; Brandt, Wolfgang

    2016-12-01

    Flowers of Nicotiana species emit a characteristic blend including the cineole cassette monoterpenes. This set of terpenes is synthesized by multiproduct enzymes, with either 1,8-cineole or α-terpineol contributing most to the volatile spectrum, thus referring to cineole or terpineol synthase, respectively. To understand the molecular and structural requirements of the enzymes that favor the biochemical formation of α-terpineol and 1,8-cineole, site-directed mutagenesis, in silico modeling, and semiempiric calculations were performed. Our results indicate the formation of α-terpineol by a nucleophilic attack of water. During this attack, the α-terpinyl cation is stabilized by π-stacking with a tryptophan side chain (tryptophan-253). The hypothesized catalytic mechanism of α-terpineol-to-1,8-cineole conversion is initiated by a catalytic dyad (histidine-502 and glutamate-249), acting as a base, and a threonine (threonine-278) providing the subsequent rearrangement from terpineol to cineol by catalyzing the autoprotonation of (S)-(-)-α-terpineol, which is the favored enantiomer product of the recombinant enzymes. Furthermore, by site-directed mutagenesis, we were able to identify amino acids at positions 147, 148, and 266 that determine the different terpineol-cineole ratios in Nicotiana suaveolens cineole synthase and Nicotiana langsdorffii terpineol synthase. Since amino acid 266 is more than 10 Å away from the active site, an indirect effect of this amino acid exchange on the catalysis is discussed. © 2016 American Society of Plant Biologists. All Rights Reserved.

  4. Quantitative proteomic analysis of human lung tumor xenografts treated with the ectopic ATP synthase inhibitor citreoviridin.

    Directory of Open Access Journals (Sweden)

    Yi-Hsuan Wu

    Full Text Available ATP synthase is present on the plasma membrane of several types of cancer cells. Citreoviridin, an ATP synthase inhibitor, selectively suppresses the proliferation and growth of lung cancer without affecting normal cells. However, the global effects of targeting ectopic ATP synthase in vivo have not been well defined. In this study, we performed quantitative proteomic analysis using isobaric tags for relative and absolute quantitation (iTRAQ and provided a comprehensive insight into the complicated regulation by citreoviridin in a lung cancer xenograft model. With high reproducibility of the quantitation, we obtained quantitative proteomic profiling with 2,659 proteins identified. Bioinformatics analysis of the 141 differentially expressed proteins selected by their relative abundance revealed that citreoviridin induces alterations in the expression of glucose metabolism-related enzymes in lung cancer. The up-regulation of enzymes involved in gluconeogenesis and storage of glucose indicated that citreoviridin may reduce the glycolytic intermediates for macromolecule synthesis and inhibit cell proliferation. Using comprehensive proteomics, the results identify metabolic aspects that help explain the antitumorigenic effect of citreoviridin in lung cancer, which may lead to a better understanding of the links between metabolism and tumorigenesis in cancer therapy.

  5. ATP synthase in slow- and fast-growing mycobacteria is active in ATP synthesis and blocked in ATP hydrolysis direction.

    Science.gov (United States)

    Haagsma, Anna C; Driessen, Nicole N; Hahn, Marc-Manuel; Lill, Holger; Bald, Dirk

    2010-12-01

    ATP synthase is a validated drug target for the treatment of tuberculosis, and ATP synthase inhibitors are promising candidate drugs for the treatment of infections caused by other slow-growing mycobacteria, such as Mycobacterium leprae and Mycobacterium ulcerans. ATP synthase is an essential enzyme in the energy metabolism of Mycobacterium tuberculosis; however, no biochemical data are available to characterize the role of ATP synthase in slow-growing mycobacterial strains. Here, we show that inverted membrane vesicles from the slow-growing model strain Mycobacterium bovis BCG are active in ATP synthesis, but ATP synthase displays no detectable ATP hydrolysis activity and does not set up a proton-motive force (PMF) using ATP as a substrate. Treatment with methanol as well as PMF activation unmasked the ATP hydrolysis activity, indicating that the intrinsic subunit ɛ and inhibitory ADP are responsible for the suppression of hydrolytic activity. These results suggest that the enzyme is needed for the synthesis of ATP, not for the maintenance of the PMF. For the development of new antimycobacterial drugs acting on ATP synthase, screening for ATP synthesis inhibitors, but not for ATP hydrolysis blockers, can be regarded as a promising strategy. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  6. Bifunctional cis-Abienol Synthase from Abies balsamea Discovered by Transcriptome Sequencing and Its Implications for Diterpenoid Fragrance Production*

    Science.gov (United States)

    Zerbe, Philipp; Chiang, Angela; Yuen, Macaire; Hamberger, Björn; Hamberger, Britta; Draper, Jason A.; Britton, Robert; Bohlmann, Jörg

    2012-01-01

    The labdanoid diterpene alcohol cis-abienol is a major component of the aromatic oleoresin of balsam fir (Abies balsamea) and serves as a valuable bioproduct material for the fragrance industry. Using high-throughput 454 transcriptome sequencing and metabolite profiling of balsam fir bark tissue, we identified candidate diterpene synthase sequences for full-length cDNA cloning and functional characterization. We discovered a bifunctional class I/II cis-abienol synthase (AbCAS), along with the paralogous levopimaradiene/abietadiene synthase and isopimaradiene synthase, all of which are members of the gymnosperm-specific TPS-d subfamily. The AbCAS-catalyzed formation of cis-abienol proceeds via cyclization and hydroxylation at carbon C-8 of a postulated carbocation intermediate in the class II active site, followed by cleavage of the diphosphate group and termination of the reaction sequence without further cyclization in the class I active site. This reaction mechanism is distinct from that of synthases of the isopimaradiene- or levopimaradiene/abietadiene synthase type, which employ deprotonation reactions in the class II active site and secondary cyclizations in the class I active site, leading to tricyclic diterpenes. Comparative homology modeling suggested the active site residues Asp-348, Leu-617, Phe-696, and Gly-723 as potentially important for the specificity of AbCAS. As a class I/II bifunctional enzyme, AbCAS is a promising target for metabolic engineering of cis-abienol production. PMID:22337889

  7. LAP6/POLYKETIDE SYNTHASE A and LAP5/POLYKETIDE SYNTHASE B Encode Hydroxyalkyl α-Pyrone Synthases Required for Pollen Development and Sporopollenin Biosynthesis in Arabidopsis thaliana[C][W][OA

    Science.gov (United States)

    Kim, Sung Soo; Grienenberger, Etienne; Lallemand, Benjamin; Colpitts, Che C.; Kim, Sun Young; Souza, Clarice de Azevedo; Geoffroy, Pierrette; Heintz, Dimitri; Krahn, Daniel; Kaiser, Markus; Kombrink, Erich; Heitz, Thierry; Suh, Dae-Yeon; Legrand, Michel; Douglas, Carl J.

    2010-01-01

    Plant type III polyketide synthases (PKSs) catalyze the condensation of malonyl-CoA units with various CoA ester starter molecules to generate a diverse array of natural products. The fatty acyl-CoA esters synthesized by Arabidopsis thaliana ACYL-COA SYNTHETASE5 (ACOS5) are key intermediates in the biosynthesis of sporopollenin, the major constituent of exine in the outer pollen wall. By coexpression analysis, we identified two Arabidopsis PKS genes, POLYKETIDE SYNTHASE A (PKSA) and PKSB (also known as LAP6 and LAP5, respectively) that are tightly coexpressed with ACOS5. Recombinant PKSA and PKSB proteins generated tri-and tetraketide α-pyrone compounds in vitro from a broad range of potential ACOS5-generated fatty acyl-CoA starter substrates by condensation with malonyl-CoA. Furthermore, substrate preference profile and kinetic analyses strongly suggested that in planta substrates for both enzymes are midchain- and ω-hydroxylated fatty acyl-CoAs (e.g., 12-hydroxyoctadecanoyl-CoA and 16-hydroxyhexadecanoyl-CoA), which are the products of sequential actions of anther-specific fatty acid hydroxylases and acyl-CoA synthetase. PKSA and PKSB are specifically and transiently expressed in tapetal cells during microspore development in Arabidopsis anthers. Mutants compromised in expression of the PKS genes displayed pollen exine layer defects, and a double pksa pksb mutant was completely male sterile, with no apparent exine. These results show that hydroxylated α-pyrone polyketide compounds generated by the sequential action of ACOS5 and PKSA/B are potential and previously unknown sporopollenin precursors. PMID:21193570

  8. Earthquake prediction

    International Nuclear Information System (INIS)

    Ward, P.L.

    1978-01-01

    The state of the art of earthquake prediction is summarized, the possible responses to such prediction are examined, and some needs in the present prediction program and in research related to use of this new technology are reviewed. Three basic aspects of earthquake prediction are discussed: location of the areas where large earthquakes are most likely to occur, observation within these areas of measurable changes (earthquake precursors) and determination of the area and time over which the earthquake will occur, and development of models of the earthquake source in order to interpret the precursors reliably. 6 figures

  9. Riboflavin synthase of Schizosaccharomyces pombe. Protein dynamics revealed by 19F NMR protein perturbation experiments

    Directory of Open Access Journals (Sweden)

    Cushman Mark

    2003-12-01

    Full Text Available Abstract Background Riboflavin synthase catalyzes the transformation of 6,7-dimethyl-8-ribityllumazine into riboflavin in the last step of the riboflavin biosynthetic pathway. Gram-negative bacteria and certain yeasts are unable to incorporate riboflavin from the environment and are therefore absolutely dependent on endogenous synthesis of the vitamin. Riboflavin synthase is therefore a potential target for the development of antiinfective drugs. Results A cDNA sequence from Schizosaccharomyces pombe comprising a hypothetical open reading frame with similarity to riboflavin synthase of Escherichia coli was expressed in a recombinant E. coli strain. The recombinant protein is a homotrimer of 23 kDa subunits as shown by sedimentation equilibrium centrifugation. The protein sediments at an apparent velocity of 4.1 S at 20°C. The amino acid sequence is characterized by internal sequence similarity indicating two similar folding domains per subunit. The enzyme catalyzes the formation of riboflavin from 6,7-dimethyl-8-ribityllumazine at a rate of 158 nmol mg-1 min-1 with an apparent KM of 5.7 microM. 19F NMR protein perturbation experiments using fluorine-substituted intermediate analogs show multiple signals indicating that a given ligand can be bound in at least 4 different states. 19F NMR signals of enzyme-bound intermediate analogs were assigned to ligands bound by the N-terminal respectively C-terminal folding domain on basis of NMR studies with mutant proteins. Conclusion Riboflavin synthase of Schizosaccharomyces pombe is a trimer of identical 23-kDa subunits. The primary structure is characterized by considerable similarity of the C-terminal and N-terminal parts. Riboflavin synthase catalyzes a mechanistically complex dismutation of 6,7-dimethyl-8-ribityllumazine affording riboflavin and 5-amino-6-ribitylamino-2,4(1H,3H-pyrimidinedione. The 19F NMR data suggest large scale dynamic mobility in the trimeric protein which may play an important

  10. Inducible and neuronal nitric oxide synthases exert contrasting effects during rat intestinal recovery following fasting.

    Science.gov (United States)

    Ito, Junta; Uchida, Hiroyuki; Machida, Naomi; Ohtake, Kazuo; Saito, Yuki; Kobayashi, Jun

    2017-04-01

    We investigated the effects of endogenous inducible (iNOS) and neuronal nitric oxide synthase on recovery from intestinal mucosal atrophy caused by fasting-induced apoptosis and decreased cell proliferation during refeeding in rats. Rats were divided into five groups, one of which was fed ad libitum, and four of which underwent 72 h of fasting, followed by refeeding for 0, 6, 24, and 48 h, respectively. iNOS and neuronal nitric oxide synthase mRNA and protein levels in jejunal tissues were measured, and mucosal height was histologically evaluated. Apoptotic indices, interferon-γ (IFN-γ) transcription levels, nitrite levels (as a measure of nitric oxide [NO] production),8-hydroxydeoxyguanosine formation (indicating reactive oxygen species [ROS] levels), crypt cell proliferation, and the motility indices (MI) were also estimated. Associations between mucosal height and NOS protein levels were determined using Spearman's rank correlation test. Notably, we observed significant increases in mucosal height and in neuronal nitric oxide synthase mRNA and protein expression as refeeding time increased. Indeed, there was a significant positive correlation between neuronal nitric oxide synthase protein level and mucosal height during the 48-h refeeding period ( r = 0.725, P fasting. Our finding suggests that refeeding likely repairs fasting-induced jejunal atrophy by suppressing iNOS expression and subsequently inhibiting NO, ROS, and IFN-γ as apoptosis mediators, and by promoting neuronal nitric oxide synthase production and inducing crypt cell proliferation via mechanical stimulation. Impact statement Besides providing new data confirming the involvement of iNOS and nNOS in intestinal mucosal atrophy caused by fasting, this study details their expression and function during recovery from this condition following refeeding. We demonstrate a significant negative correlation between iNOS and nNOS levels during refeeding, and associate this with cell proliferation

  11. Predictive medicine

    NARCIS (Netherlands)

    Boenink, Marianne; ten Have, Henk

    2015-01-01

    In the last part of the twentieth century, predictive medicine has gained currency as an important ideal in biomedical research and health care. Research in the genetic and molecular basis of disease suggested that the insights gained might be used to develop tests that predict the future health

  12. Evolution of Conifer Diterpene Synthases: Diterpene Resin Acid Biosynthesis in Lodgepole Pine and Jack Pine Involves Monofunctional and Bifunctional Diterpene Synthases1[W][OA

    Science.gov (United States)

    Hall, Dawn E.; Zerbe, Philipp; Jancsik, Sharon; Quesada, Alfonso Lara; Dullat, Harpreet; Madilao, Lina L.; Yuen, Macaire; Bohlmann, Jörg

    2013-01-01

    Diterpene resin acids (DRAs) are major components of pine (Pinus spp.) oleoresin. They play critical roles in conifer defense against insects and pathogens and as a renewable resource for industrial bioproducts. The core structures of DRAs are formed in secondary (i.e. specialized) metabolism via cycloisomerization of geranylgeranyl diphosphate (GGPP) by diterpene synthases (diTPSs). Previously described gymnosperm diTPSs of DRA biosynthesis are bifunctional enzymes that catalyze the initial bicyclization of GGPP followed by rearrangement of a (+)-copalyl diphosphate intermediate at two discrete class II and class I active sites. In contrast, similar diterpenes of gibberellin primary (i.e. general) metabolism are produced by the consecutive activity of two monofunctional class II and class I diTPSs. Using high-throughput transcriptome sequencing, we discovered 11 diTPS from jack pine (Pinus banksiana) and lodgepole pine (Pinus contorta). Three of these were orthologous to known conifer bifunctional levopimaradiene/abietadiene synthases. Surprisingly, two sets of orthologous PbdiTPSs and PcdiTPSs were monofunctional class I enzymes that lacked functional class II active sites and converted (+)-copalyl diphosphate, but not GGPP, into isopimaradiene and pimaradiene as major products. Diterpene profiles and transcriptome sequences of lodgepole pine and jack pine are consistent with roles for these diTPSs in DRA biosynthesis. The monofunctional class I diTPSs of DRA biosynthesis form a new clade within the gymnosperm-specific TPS-d3 subfamily that evolved from bifunctional diTPS rather than monofunctional enzymes (TPS-c and TPS-e) of gibberellin metabolism. Homology modeling suggested alterations in the class I active site that may have contributed to their functional specialization relative to other conifer diTPSs. PMID:23370714

  13. Evolution of conifer diterpene synthases: diterpene resin acid biosynthesis in lodgepole pine and jack pine involves monofunctional and bifunctional diterpene synthases.

    Science.gov (United States)

    Hall, Dawn E; Zerbe, Philipp; Jancsik, Sharon; Quesada, Alfonso Lara; Dullat, Harpreet; Madilao, Lina L; Yuen, Macaire; Bohlmann, Jörg

    2013-02-01

    Diterpene resin acids (DRAs) are major components of pine (Pinus spp.) oleoresin. They play critical roles in conifer defense against insects and pathogens and as a renewable resource for industrial bioproducts. The core structures of DRAs are formed in secondary (i.e. specialized) metabolism via cycloisomerization of geranylgeranyl diphosphate (GGPP) by diterpene synthases (diTPSs). Previously described gymnosperm diTPSs of DRA biosynthesis are bifunctional enzymes that catalyze the initial bicyclization of GGPP followed by rearrangement of a (+)-copalyl diphosphate intermediate at two discrete class II and class I active sites. In contrast, similar diterpenes of gibberellin primary (i.e. general) metabolism are produced by the consecutive activity of two monofunctional class II and class I diTPSs. Using high-throughput transcriptome sequencing, we discovered 11 diTPS from jack pine (Pinus banksiana) and lodgepole pine (Pinus contorta). Three of these were orthologous to known conifer bifunctional levopimaradiene/abietadiene synthases. Surprisingly, two sets of orthologous PbdiTPSs and PcdiTPSs were monofunctional class I enzymes that lacked functional class II active sites and converted (+)-copalyl diphosphate, but not GGPP, into isopimaradiene and pimaradiene as major products. Diterpene profiles and transcriptome sequences of lodgepole pine and jack pine are consistent with roles for these diTPSs in DRA biosynthesis. The monofunctional class I diTPSs of DRA biosynthesis form a new clade within the gymnosperm-specific TPS-d3 subfamily that evolved from bifunctional diTPS rather than monofunctional enzymes (TPS-c and TPS-e) of gibberellin metabolism. Homology modeling suggested alterations in the class I active site that may have contributed to their functional specialization relative to other conifer diTPSs.

  14. Regulation of acetate metabolism in Corynebacterium glutamicum: transcriptional control of the isocitrate lyase and malate synthase genes.

    Science.gov (United States)

    Wendisch, V F; Spies, M; Reinscheid, D J; Schnicke, S; Sahm, H; Eikmanns, B J

    1997-10-01

    In the amino-acid-producing microorganism Corynebacterium glutamicum, the specific activities of the acetate-activating enzymes acetate kinase and phosphotransacetylase and those of the glyoxylate cycle enzymes isocitrate lyase and malate synthase were found to be high when the cells were grown on acetate (0.8, 2.9, 2.1, and 1.8 U/mg protein, respectively). When the cells were grown on glucose or on other carbon sources such as lactate, succinate, or glutamate, the specific activities were two- to fourfold (acetate kinase and phosphotransacetylase) and 45- to 100-fold (isocitrate lyase and malate synthase) lower, indicating that the synthesis of the four enzymes is regulated by acetate in the growth medium. A comparative Northern (RNA) analysis of the C. glutamicum isocitrate lyase and malate synthase genes (aceA and aceB) and transcriptional cat fusion experiments revealed that aceA and aceB are transcribed as 1.6- and 2.7-kb monocistronic messages, respectively, and that the regulation of isocitrate lyase and malate synthase synthesis is exerted at the level of transcription from the respective promoters. Surprisingly, C. glutamicum mutants defective in either acetate kinase or phosphotransacetylase showed low specific activities of the other three enzymes (phosphotransacetylase, isocitrate lyase, and malate synthase or acetate kinase, isocitrate lyase, and malate synthase, respectively) irrespective of the presence or absence of acetate in the medium. This result and a correlation of a high intracellular acetyl coenzyme A concentration with high specific activities of isocitrate lyase, malate synthase, acetate kinase, and phosphotransacetylase suggest that acetyl coenzyme A or a derivative thereof may be a physiological trigger for the genetic regulation of enzymes involved in acetate metabolism of C. glutamicum.

  15. Defective ceramide synthases in mice cause reduced amplitudes in electroretinograms and altered sphingolipid composition in retina and cornea.

    Science.gov (United States)

    Brüggen, Bianca; Kremser, Christiane; Bickert, Andreas; Ebel, Philipp; Vom Dorp, Katharina; Schultz, Konrad; Dörmann, Peter; Willecke, Klaus; Dedek, Karin

    2016-07-01

    Complex sphingolipids are strongly expressed in neuronal tissue and contain ceramides in their backbone. Ceramides are synthesized by six ceramide synthases (CerS1-6). Although it is known that each tissue has a unique profile of ceramide synthase expression and ceramide synthases are implicated in several neurodegenerative disorders, the expression of ceramide synthase isoforms has not been investigated in the retina. Here we demonstrate CerS1, CerS2 and CerS4 expression in mouse retina and cornea, with CerS4 ubiquitously expressed in all retinal neurons and Müller cells. To test whether ceramide synthase deficiency affects retinal function, we compared electroretinograms and retina morphology between wild-type and CerS1-, CerS2- and CerS4-deficient mice. Electroretinograms were strongly reduced in amplitude in ceramide synthase-deficient mice, suggesting that signalling in the outer retina is affected. However, the number of photoreceptors and cone outer segment length were unaltered and no changes in retinal layer thickness or synaptic structures were found. Mass spectrometric analyses of ceramides, hexosyl-ceramides and sphingomyelins showed that C20 to C24 acyl-containing species were decreased whereas C16-containing species were increased in the retina of ceramide synthase-deficient mice. Similar but smaller changes were also found in the cornea. Thus, we hypothesize that the replacement of very long-chain fatty acyl residues by shorter C16 residues may affect the electrical properties of retina and cornea, and alter receptor-mediated signal transduction, vesicle-mediated synaptic transmission or corneal light transmission. Future studies need to identify the molecular targets of ceramides or derived sphingolipids in light signal transduction and transmission in the eye. © 2016 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  16. Challenges and Hallmarks of Establishing Alkylacetylphosphonates as Probes of Bacterial 1-Deoxy-d-xylulose 5-Phosphate Synthase.

    Science.gov (United States)

    Sanders, Sara; Vierling, Ryan J; Bartee, David; DeColli, Alicia A; Harrison, Mackenzie J; Aklinski, Joseph L; Koppisch, Andrew T; Freel Meyers, Caren L

    2017-07-14

    1-Deoxy-d-xylulose 5-phosphate (DXP) synthase catalyzes the thiamin diphosphate (ThDP)-dependent formation of DXP from pyruvate and d-glyceraldehyde 3-phosphate. DXP is at a metabolic branch point in bacteria, feeding into the methylerythritol phosphate pathway to indispensable isoprenoids and acting as a precursor for biosynthesis of essential cofactors in central metabolism, pyridoxal phosphate and ThDP, the latter of which is also required for DXP synthase catalysis. DXP synthase follows a unique random sequential mechanism and possesses an unusually large active site. These features have guided the design of sterically demanding alkylacetylphosphonates (alkylAPs) toward the development of selective DXP synthase inhibitors. alkylAPs studied here display selective, low μM inhibitory activity against DXP synthase. They are weak inhibitors of bacterial growth in standard nutrient rich conditions. However, bacteria are significantly sensitized to most alkylAPs in defined minimal growth medium, with minimal inhibitory concentrations (MICs) ranging from low μM to low mM and influenced by alkyl-chain length. The longest analog (C 8 ) displays the weakest antimicrobial activity and is a substrate for efflux via AcrAB-TolC. The dependence of inhibitor potency on growth environment emphasizes the need for antimicrobial screening conditions that are relevant to the in vivo microbial microenvironment during infection. DXP synthase expression and thiamin supplementation studies offer support for DXP synthase as an intracellular target for some alkylAPs and reveal both the challenges and intriguing aspects of these approaches to study target engagement.

  17. Germacrene A synthase in yarrow (Achillea millefolium) is an enzyme with mixed substrate specificity: gene cloning, functional characterization and expression analysis

    OpenAIRE

    Pazouki, Leila; Memari, Hamid R.; Kännaste, Astrid; Bichele, Rudolf; Niinemets, Ülo

    2015-01-01

    Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5) residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focuse...

  18. In Silico Screening of Nonsteroidal Anti-Inflammatory Drugs and Their Combined Action on Prostaglandin H Synthase-1

    Directory of Open Access Journals (Sweden)

    Alexey Goltsov

    2010-07-01

    Full Text Available The detailed kinetic model of Prostaglandin H Synthase-1 (PGHS-1 was applied to in silico screening of dose-dependencies for the different types of nonsteroidal anti-inflammatory drugs (NSAIDs, such as: reversible/irreversible, nonselective/selective to PGHS-1/PGHS-2 and time dependent/independent inhibitors (aspirin, ibuprofen, celecoxib, etc. The computational screening has shown a significant variability in the IC50s of the same drug, depending on different in vitro and in vivo experimental conditions. To study this high heterogeneity in the inhibitory effects of NSAIDs, we have developed an in silico approach to evaluate NSAID action on targets under different PGHS-1 microenvironmental conditions, such as arachidonic acid, reducing cofactor, and peroxide concentrations. The designed technique permits translating the drug IC50, obtained in one experimental setting to another, and predicts in vivo inhibitory effects based on the relevant in vitro data. For the aspirin case, we elucidated the mechanism underlying the enhancement and reduction (aspirin resistance of its efficacy, depending on PGHS-1 microenvironment in in vitro/in vivo experimental settings. We also present the results of the in silico screening of the combined action of sets of two NSAIDs (aspirin with ibuprofen, aspirin with celecoxib, and study the mechanism of the experimentally observed effect of the suppression of aspirin-mediated PGHS-1 inhibition by selective and nonselective NSAIDs. Furthermore, we discuss the applications of the obtained results to the problems of standardization of NSAID test assay, dependence of the NSAID efficacy on cellular environment of PGHS-1, drug resistance, and NSAID combination therapy.

  19. Caveolin-1-mediated post-transcriptional regulation of inducible nitric oxide synthase in human colon carcinoma cells

    Directory of Open Access Journals (Sweden)

    EMANUELA FELLEY-BOSCO

    2002-01-01

    Full Text Available Reactive oxygen species are now widely recognized as important players contributing both to cell homeostasis and the development of disease. In this respect nitric oxide (NO is no exception. The discussion here will center on regulation of the inducible form of nitric oxide synthase (iNOS for two reasons. First, only iNOS produces micromolar NO concentrations, amounts that are high by comparison with the picomolar to nanomolar concentrations resulting from Ca2+-controlled NO production by endothelial eNOS or neuronal nNOS. Second, iNOS is not constitutively expressed in cells and regulation of this isoenzyme, in contrast to endothelial eNOS or neuronal nNOS, is widely considered to occur at the transcriptional level only. In particular, we were interested in the possibility that caveolin-1, a protein that functions as a tumor suppressor in colon carcinoma cells (Bender et al., 2002; this issue, might regulate iNOS activity. Our results provide evidence for the existence of a post-transcriptional mechanism controlling iNOS protein levels that involves caveolin-1-dependent sequestration of iNOS within a detergent-insoluble compartment. Interestingly, despite the high degree of conservation of the caveolin-1 scaffolding domain binding motif within all NOS enzymes, the interaction detected between caveolin-1 and iNOS in vitro is crucially dependent on presence of a caveolin-1 sequence element immediately adjacent to the scaffolding domain. A model is presented summarizing the salient aspects of these results. These observations are important in the context of tumor biology, since down-regulation of caveolin-1 is predicted to promote uncontrolled iNOS activity, genotoxic damage and thereby facilitate tumor development in humans

  20. Expression Profiles of the Trehalose-6-Phosphate Synthase Gene Associated With Thermal Stress in Ostrinia furnacalis (Lepidoptera: Crambidae)

    Science.gov (United States)

    Jin, Tingting; Gao, Yulin; He, Kanglai

    2018-01-01

    Abstract Trehalose is the major blood sugar in insects. Physiological significance of this compound has been extensively reported. Trehalose-6-phosphate synthase (TPS) is an important enzyme in the trehalose biosynthesis pathway. Full-length cDNAs of TPS (Of tps) and its alternative splicing isoform (Of tps_isoformI) were cloned from the Asian corn borer (ACB), Ostrinia furnacalis (Guenée; Lepidoptera: Crambidae) larvae. The Of tps and Of tps_isoformI transcripts were 2913 and 1689 bp long, contained 2529 and 1293 bp open reading frames encoding proteins of 842 and 430 amino acids with a molecular mass of 94.4 and 48.6 kDa, respectively. Transcriptional profiling and response to thermal stress of Of tps gene were determined by quantitative real-time PCR showing that the Of tps was predominantly expressed in the larval fat body, significantly enhanced during molting and transformation; and thermal stress also induced Of tps expression. Gene structure analysis is indicating that one TPS domain and one trehalose-6-phosphate phosphatase (TPP) domain were located at the N- and C-termini of Of        TPS, respectively, while only the TPS domain was detected in OfTPS_isoformI. Three-dimensional modeling and heterologous expression were developed to predict the putative functions of OfTPS and Of   TPS_isoformI. We infer that the expression of Of tps gene is thermally induced and might be crucial for larvae survival.