Homocystinuria due to cystathionine beta synthase deficiency

Directory of Open Access Journals (Sweden)

Rao T

2008-01-01

Full Text Available A two year-old male child presented with cutis marmorata congenita universalis, brittle hair, mild mental retardation, and finger spasms. Biochemical findings include increased levels of homocysteine in the blood-106.62 µmol/L (normal levels: 5.90-16µmol/L. Biochemical tests such as the silver nitroprusside and nitroprusside tests were positive suggesting homocystinuria. The patient was treated with oral pyridoxine therapy for three months. The child responded well to this therapy and the muscle spasms as well as skin manifestations such as cutis marmorata subsided. The treatment is being continued; the case is reported here because of its rarity. Homocysteinuria arising due to cystathionine beta-synthase (CBS deficiency is an autosomal recessive disorder of methionine metabolism that produces increased levels of urinary homocysteine and methionine It manifests itself in vascular, central nervous system, cutaneous, and connective tissue disturbances and phenotypically resembles Marfan′s syndrome. Skin manifestations include malar flush, thin hair, and cutis reticulata / marmorata.

Role of carglumic acid in the treatment of acute hyperammonemia due to N-acetylglutamate synthase deficiency

Directory of Open Access Journals (Sweden)

Häberle J

2011-08-01

Full Text Available Johannes HäberleKinderspital Zürich, Abteilung Stoffwechsel, Zürich, SwitzerlandAbstract: N-acetylglutamate synthase (NAGS deficiency is a rare inborn error of metabolism affecting ammonia detoxification in the urea cycle. The product of NAGS is N-acetylglutamate which is the absolutely required allosteric activator of the first urea cycle enzyme carbamoylphosphate synthetase 1. In defects of NAGS, the urea cycle function can be severely affected resulting in fatal hyperammonemia in neonatal patients or at any later stage in life. NAGS deficiency can be treated with a structural analog of N-acetylglutamate, N-carbamyl-L-glutamate, which is available for enteral use as a licensed drug. Since NAGS deficiency is an extremely rare disorder, reports on the use of N-carbamyl-L-glutamate are mainly based on single patients. According to these, the drug is very effective in treating acute hyperammonemia by avoiding the need for detoxification during the acute metabolic decompensation. Also during long-term treatment, N-carbamyl-L-glutamate is effective in maintaining normal plasma ammonia levels and avoiding the need for additional drug therapy or protein-restricted diet. Open questions remain which concern the optimal dosage in acute and long-term use of N-carbamyl-L-glutamate and potential additional disorders in which the drug might also be effective in treating acute hyperammonemia. This review focuses on the role of N-carbamyl-L-glutamate for the treatment of acute hyperammonemia due to primary NAGS deficiency but will briefly discuss the current knowledge on the role of N-carbamyl-L-glutamate for treatment of secondary NAGS deficiencies.Keywords: carglumic acid, carbamylglutamate, N-carbamyl-L-glutamate, N-acetylglutamate synthase deficiency, NAGS deficiency, hyperammonemia

Endothelial nitric oxide synthase gene polymorphisms associated ...

African Journals Online (AJOL)

Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...

Altered expression of the caffeine synthase gene in a naturally caffeine-free mutant of Coffea arabica

Directory of Open Access Journals (Sweden)

Mirian Perez Maluf

2009-01-01

Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.

Identification and molecular characterization of the nicotianamine synthase gene family in bread wheat.

Science.gov (United States)

Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T

2016-12-01

Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

The Nicotianamine Synthase Gene Is a Useful Candidate for Improving the Nutritional Qualities and Fe-Deficiency Tolerance of Various Crops

Directory of Open Access Journals (Sweden)

Tomoko Nozoye

2018-03-01

Full Text Available With the global population predicted to grow by at least 25% by the year 2050, the sustainable production of nutritious foods will be necessary for human health and the environment. Iron (Fe is an essential nutrient for both plants and humans. Fe is poorly soluble, especially at high pH levels, at which it is difficult for living organisms to accumulate sufficient Fe. In plants, Fe deficiency leads to low yield and poor nutritional quality, as it significantly affects chlorophyll synthesis. Fe deficiency is a worldwide agricultural problem that is especially serious in soils with a high pH, such as calcareous soils, which comprise approximately 30% of cultivated soils worldwide. Genetic improvements in crops that can tolerate Fe deficiency will be required to meet the demands for crop production and could ultimately contribute to the amelioration of global warming. Nicotianamine (NA is an Fe chelator in plants that is involved in metal translocation in the plant body. In mammals, NA inhibits angiotensin I-converting enzyme, which plays a key role in blood pressure control. It was recently shown that the enhancement of NA production using nicotianamine synthase is useful for increasing not only NA but also Fe and Zn levels in crops such as rice, soybean, and sweet potato. Additionally, these plants showed Fe-deficiency tolerance in calcareous soil. These results suggested that NAS overexpression simultaneously improves food quality and increases plant production. This review summarizes progress in generating crops overexpressing NAS.

Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance

DEFF Research Database (Denmark)

Huang, Laurence; Crothers, Kristina; Atzori, Chiara

2004-01-01

in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...

Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

Science.gov (United States)

Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

2007-07-10

Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

Neuronal nitric oxide synthase-deficient mice have impaired Renin release but normal blood pressure

DEFF Research Database (Denmark)

Sällström, Johan; Carlström, Mattias; Jensen, Boye L

2008-01-01

BackgroundNitric oxide deficiency is involved in the development of hypertension, but the mechanisms are currently unclear. This study was conducted to further elucidate the role of neuronal nitric oxide synthase (nNOS) in blood pressure regulation and renin release in relation to different sodiu......-116; doi:10.1038/ajh.2007.16American Journal of Hypertension (2008) 21 111-116; doi:10.1038/ajh.2007.16....

Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.

Science.gov (United States)

Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako

2009-02-01

Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.

Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

Directory of Open Access Journals (Sweden)

Bechard Matthew E.

2003-01-01

Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli.

Science.gov (United States)

Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

2003-01-01

Tetrahydromethanopterin (H(4)MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H(4)MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H(4)MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H(4)MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H(4)MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP.

Science.gov (United States)

Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica

2017-10-01

Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

Cloning and heterologous expression of a novel subgroup of class IV polyhydroxyalkanoate synthase genes from the genus Bacillus.

Science.gov (United States)

Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T

2017-01-01

Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.

Strengthening Triterpene Saponins Biosynthesis by Over-Expression of Farnesyl Pyrophosphate Synthase Gene and RNA Interference of Cycloartenol Synthase Gene in Panax notoginseng Cells

Directory of Open Access Journals (Sweden)

Yan Yang

2017-04-01

Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.

Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

Science.gov (United States)

Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

2013-12-05

The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

Lysosomal Storage of Subunit c of Mitochondrial ATP Synthase in Brain-Specific Atp13a2-Deficient Mice.

Science.gov (United States)

Sato, Shigeto; Koike, Masato; Funayama, Manabu; Ezaki, Junji; Fukuda, Takahiro; Ueno, Takashi; Uchiyama, Yasuo; Hattori, Nobutaka

2016-12-01

Kufor-Rakeb syndrome (KRS) is an autosomal recessive form of early-onset parkinsonism linked to the PARK9 locus. The causative gene for KRS is Atp13a2, which encodes a lysosomal type 5 P-type ATPase. We recently showed that KRS/PARK9-linked mutations lead to several lysosomal alterations, including reduced proteolytic processing of cathepsin D in vitro. However, it remains unknown how deficiency of Atp13a2 is connected to lysosomal impairments. To address this issue, we analyzed brain tissues of Atp13a2 conditional-knockout mice, which exhibited characteristic features of neuronal ceroid lipofuscinosis, including accumulation of lipofuscin positive for subunit c of mitochondrial ATP synthase, suggesting that a common pathogenic mechanism underlies both neuronal ceroid lipofuscinosis and Parkinson disease. Copyright © 2016 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

Human Mitochondrial HMG-CoA Synthase Deficiency: Role of Enzyme Dimerization Surface and Characterization of Three New Patients

Directory of Open Access Journals (Sweden)

Beatriz Puisac

2018-03-01

Full Text Available Mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase deficiency (mitochondrial HMG-CoA synthase deficiency or mHS deficiency, OMIM #605911 is an inborn error of metabolism that affects ketone body synthesis. Acute episodes include vomiting, lethargy, hepatomegaly, hypoglycemia and dicarboxylic aciduria. The diagnosis is difficult due to the relatively unspecific clinical and biochemical presentation, and fewer than 30 patients have been described. This work describes three new patients with mHS deficiency and two missense mutations c.334C>T (p.R112W and c.430G>T (p.V144L previously not reported. We developed a new method to express and measure the activity of the enzyme and in this work the study is extended to ten new missense variants including those of our patients. Enzymatic assays showed that three of the mutant proteins retained some but seven completely lacked activity. The identification of a patient homozygous for a mutation that retains 70% of enzyme activity opens the door to a new interpretation of the disease by demonstrating that a modest impairment of enzyme function can actually produce symptoms. This is also the first study employing molecular dynamics modelling of the enzyme mutations. We show that the correct maintenance of the dimerization surface is crucial for retaining the structure of the active center and therefore the activity of the enzyme.

Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.

Directory of Open Access Journals (Sweden)

Kattina Zavala

Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.

Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model

Science.gov (United States)

Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

2018-03-01

Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.

Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

Energy Technology Data Exchange (ETDEWEB)

Somerville, Chris R.; Scieble, Wolf

2000-10-11

Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

The polyketide components of waxes and the Cer-cqu gene cluster encoding a novel polyketide synthase, the β-diketone synthase, DKS

DEFF Research Database (Denmark)

von Wettstein, Penny

2017-01-01

The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...

Alkyl-dihydroxyacetonephosphate synthase. Fate in peroxisome biogenesis disorders and identification of the point mutation underlying a single enzyme deficiency

NARCIS (Netherlands)

de Vet, E. C.; IJlst, L.; Oostheim, W.; Wanders, R. J.; van den Bosch, H.

1998-01-01

Peroxisomes play an indispensible role in ether lipid biosynthesis as evidenced by the deficiency of ether phospholipids in fibroblasts and tissues from patients suffering from a number of peroxisomal disorders. Alkyl-dihydroxyacetonephosphate synthase, a peroxisomal enzyme playing a key role in the

Nitric oxide synthase gene G298 allele

International Nuclear Information System (INIS)

Nagib El-Kilany, Galal E.; Nayel, Ehab; Hazzaa, Sahar

2004-01-01

Background: Nitric oxide (NO) has an important effect on blood pressure, arterial wall, and the basal release of endothelial NO in hypertension (HPN) may be reduced. Until now, there is no solid data revealing the potential role of the polymorphism of the nitric oxide synthase gene (NOS) in patients with HPN and microvascular angina. Aim: The aim of the present study is to investigate the gene of endothelial nitric oxide synthase (eNOS), as the polymorphism of this gene may be a putative candidate for HPN and initiate the process of atherosclerosis. Methods: Sixty participants were recruited for this study; 50 were hypertensive patients complaining of chest pain [30 of them have electrocardiogram (EKG) changes of ischemia], 20 had isolated HPN, and 10 healthy volunteers served as control. All patients underwent stress myocardial perfusion imaging (MPI) and coronary angiography. Genotyping of eNOS for all patients and controls was performed. The linkages between HPN, microvascular angina and eNOS gene polymorphism were investigated. Results: MPI and coronary angiography revealed that 15 patients had chest pain with true ischemia and reversible myocardial perfusion defects (multiple and mild) but normal epicardial coronary arteries (microvascular angina), while 15 patients had significant coronary artery disease (CAD), and 20 hypertensive patients showed normal perfusion scan and coronary angiography. The prevalence of the NOS G 298 allele was higher in the hypertensive group with microvascular angina (documented by MPI) than it was among the control participants (P<.005). The eNOS allele was significantly higher in the hypertensive group than in the control participants, but there was no significant difference in homozygote mutants among hypertensive participants, x-syndrome and patients with CAD. Conclusion: eNOS gene polymorphism is proved to be an important etiology in microvascular angina (x-syndrome) among hypertensive patients. In addition, the eNOS mutant

Chromosomal localization of the human and mouse hyaluronan synthase genes

Energy Technology Data Exchange (ETDEWEB)

Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others

1997-05-01

We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

The Eucalyptus terpene synthase gene family.

Science.gov (United States)

Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J

2015-06-11

Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.

The Polyketide Components of Waxes and the Cer-cqu Gene Cluster Encoding a Novel Polyketide Synthase, the β-Diketone Synthase, DKS.

Science.gov (United States)

von Wettstein-Knowles, Penny

2017-07-10

The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c , -q and -u genes forming the 101 kb Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms long, thin crystalline tubes. A pathway branch leads to the formation of esterified alkan-2-ols.

Isolation and expression of the Pneumocystis carinii thymidylate synthase gene

DEFF Research Database (Denmark)

Edman, U; Edman, J C; Lundgren, B

1989-01-01

The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...

Phosphorus starvation induces post-transcriptional CHS gene silencing in Petunia corolla.

Science.gov (United States)

Hosokawa, Munetaka; Yamauchi, Takayoshi; Takahama, Masayoshi; Goto, Mariko; Mikano, Sachiko; Yamaguchi, Yuki; Tanaka, Yoshiyuki; Ohno, Sho; Koeda, Sota; Doi, Motoaki; Yazawa, Susumu

2013-05-01

The corolla of Petunia 'Magic Samba' exhibits unstable anthocyanin expression depending on its phosphorus content. Phosphorus deficiency enhanced post-transcriptional gene silencing of chalcone synthase - A in the corolla. Petunia (Petunia hybrida) 'Magic Samba' has unstable red-white bicolored corollas that respond to nutrient deficiency. We grew this cultivar hydroponically using solutions that lacked one or several nutrients to identify the specific nutrient related to anthocyanin expression in corolla. The white area of the corolla widened under phosphorus (P)-deficient conditions. When the P content of the corolla grown under P-deficient conditions dropped to 40 corollas until the plants died. Other elemental deficiencies had no clear effects on anthocyanin suppression in the corolla. After phosphate was resupplied to the P-deficient plants, anthocyanin was restored in the corollas. The expression of chalcone synthase-A (CHS-A) was suppressed in the white area that widened under P-suppressed conditions, whereas the expression of several other genes related to anthocyanin biosynthesis was enhanced more in the white area than in the red area. Reddish leaves and sepals developed under the P-deficient condition, which is a typical P-deficiency symptom. Two genes related to anthocyanin biosynthesis were enhanced in the reddish organs. Small interfering RNA analysis of CHS-A showed that the suppression resulted from post-transcriptional gene silencing (PTGS). Thus, it was hypothesized that the enhancement of anthocyanin biosynthetic gene expression due to P-deficiency triggered PTGS of CHS-A, which resulted in white corolla development.

UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

Energy Technology Data Exchange (ETDEWEB)

Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)

2014-03-07

Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

International Nuclear Information System (INIS)

Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

2014-01-01

Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes

Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis.

Science.gov (United States)

Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth

2015-09-01

Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. © 2015 American Society of Plant Biologists. All Rights Reserved.

Cobalt-vitamin B12 deficiency and the activity of methylmalonyl CoA mutase and methionine synthase in cattle.

Science.gov (United States)

Kennedy, D G; Young, P B; Kennedy, S; Scott, J M; Molloy, A M; Weir, D G; Price, J

1995-01-01

Cobalt deficiency was induced in cattle by feeding two groups of animals either a basal diet that was very low in Co (12.9-17.6 micrograms Co per kg), or the same diet supplemented with cobalt, for a total of 64 weeks. Vitamin B12 deficiency was induced, as judged by hepatic concentrations of vitamin B12 and plasma concentrations of MMA. However, the activity of holo-methylmalonyl CoA mutase was significantly reduced only in brain. This was reflected in very minor alterations in the tissue concentrations of branched chain- and odd numbered-fatty acids. The activity of holo-methionine synthase was significantly reduced in liver and brain, but there were no consequent alterations in the concentrations of phosphatidyl choline and phosphatidyl ethanolamine. This study confirms that cattle are less susceptible to the effects of cobalt deficiency than sheep, and concludes that prolonged cobalt deficiency had little significant effect on tissue metabolism.

Cloning and characterization of indole synthase (INS) and a putative tryptophan synthase α-subunit (TSA) genes from Polygonum tinctorium.

Science.gov (United States)

Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un

2016-12-01

Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.

Effects of Cerebral Ischemia in Mice Deficient in Neuronal Nitric Oxide Synthase

Science.gov (United States)

Huang, Zhihong; Huang, Paul L.; Panahian, Nariman; Dalkara, Turgay; Fishman, Mark C.; Moskowitz, Michael A.

1994-09-01

The proposal that nitric oxide (NO) or its reactant products mediate toxicity in brain remains controversial in part because of the use of nonselective agents that block NO formation in neuronal, glial, and vascular compartments. In mutant mice deficient in neuronal NO synthase (NOS) activity, infarct volumes decreased significantly 24 and 72 hours after middle cerebral artery occlusion, and the neurological deficits were less than those in normal mice. This result could not be accounted for by differences in blood flow or vascular anatomy. However, infarct size in the mutant became larger after endothelial NOS inhibition by nitro-L-arginine administration. Hence, neuronal NO production appears to exacerbate acute ischemic injury, whereas vascular NO protects after middle cerebral artery occlusion. The data emphasize the importance of developing selective inhibitors of the neuronal isoform.

Novel polyhydroxyalkanoate copolymers produced in Pseudomonas putida by metagenomic polyhydroxyalkanoate synthases.

Science.gov (United States)

Cheng, Jiujun; Charles, Trevor C

2016-09-01

Bacterially produced biodegradable polyhydroxyalkanoates (PHAs) with versatile properties can be achieved using different PHA synthases (PhaCs). This work aims to expand the diversity of known PhaCs via functional metagenomics and demonstrates the use of these novel enzymes in PHA production. Complementation of a PHA synthesis-deficient Pseudomonas putida strain with a soil metagenomic cosmid library retrieved 27 clones expressing either class I, class II, or unclassified PHA synthases, and many did not have close sequence matches to known PhaCs. The composition of PHA produced by these clones was dependent on both the supplied growth substrates and the nature of the PHA synthase, with various combinations of short-chain-length (SCL) and medium-chain-length (MCL) PHA. These data demonstrate the ability to isolate diverse genes for PHA synthesis by functional metagenomics and their use for the production of a variety of PHA polymer and copolymer mixtures.

Early growth and development impairments in patients with ganglioside GM3 synthase deficiency.

Science.gov (United States)

Wang, H; Wang, A; Wang, D; Bright, A; Sency, V; Zhou, A; Xin, B

2016-05-01

Ganglioside GM3 synthase is a key enzyme involved in the biosynthesis of gangliosides. GM3 synthase deficiency (GSD) causes a complete absence of GM3 and all downstream biosynthetic derivatives. The individuals affected by this disorder manifest severe irritability, intractable seizures and profound intellectual disability. However, we have found that most newborns seem symptom-free for a period of time after birth. In order to further understand the onset of the disease, we investigated the early growth and development of patients with this condition through this study. We compared 37 affected individuals with their normal siblings and revealed that all children with GSD had relatively normal intrauterine growth and development, as their weight, length and head circumference were similar to their normal siblings at birth. However, the disease progresses quickly after birth and causes significant constitutional impairments of growth and development by 6 months of age. Neither breastfeeding nor gastrostomy tube placement made significant difference on growth and development as all groups of patients showed the similar pattern. We conclude that GSD causes significant postnatal growth and developmental impairments and the amount of gangliosides in breast milk and general nutritional intervention do not seem to alter these outcomes. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Iron homeostasis in Arabidopsis thaliana: transcriptomic analyses reveal novel FIT-regulated genes, iron deficiency marker genes and functional gene networks.

Science.gov (United States)

Mai, Hans-Jörg; Pateyron, Stéphanie; Bauer, Petra

2016-10-03

FIT (FER-LIKE IRON DEFICIENCY-INDUCED TRANSCRIPTION FACTOR) is the central regulator of iron uptake in Arabidopsis thaliana roots. We performed transcriptome analyses of six day-old seedlings and roots of six week-old plants using wild type, a fit knock-out mutant and a FIT over-expression line grown under iron-sufficient or iron-deficient conditions. We compared genes regulated in a FIT-dependent manner depending on the developmental stage of the plants. We assembled a high likelihood dataset which we used to perform co-expression and functional analysis of the most stably iron deficiency-induced genes. 448 genes were found FIT-regulated. Out of these, 34 genes were robustly FIT-regulated in root and seedling samples and included 13 novel FIT-dependent genes. Three hundred thirty-one genes showed differential regulation in response to the presence and absence of FIT only in the root samples, while this was the case for 83 genes in the seedling samples. We assembled a virtual dataset of iron-regulated genes based on a total of 14 transcriptomic analyses of iron-deficient and iron-sufficient wild-type plants to pinpoint the best marker genes for iron deficiency and analyzed this dataset in depth. Co-expression analysis of this dataset revealed 13 distinct regulons part of which predominantly contained functionally related genes. We could enlarge the list of FIT-dependent genes and discriminate between genes that are robustly FIT-regulated in roots and seedlings or only in one of those. FIT-regulated genes were mostly induced, few of them were repressed by FIT. With the analysis of a virtual dataset we could filter out and pinpoint new candidates among the most reliable marker genes for iron deficiency. Moreover, co-expression and functional analysis of this virtual dataset revealed iron deficiency-induced and functionally distinct regulons.

Plant oxidosqualene metabolism: cycloartenol synthase-dependent sterol biosynthesis in Nicotiana benthamiana.

Science.gov (United States)

Gas-Pascual, Elisabet; Berna, Anne; Bach, Thomas J; Schaller, Hubert

2014-01-01

The plant sterol pathway exhibits a major biosynthetic difference as compared with that of metazoans. The committed sterol precursor is the pentacyclic cycloartenol (9β,19-cyclolanost-24-en-3β-ol) and not lanosterol (lanosta-8,24-dien-3β-ol), as it was shown in the late sixties. However, plant genome mining over the last years revealed the general presence of lanosterol synthases encoding sequences (LAS1) in the oxidosqualene cyclase repertoire, in addition to cycloartenol synthases (CAS1) and to non-steroidal triterpene synthases that contribute to the metabolic diversity of C30H50O compounds on earth. Furthermore, plant LAS1 proteins have been unambiguously identified by peptidic signatures and by their capacity to complement the yeast lanosterol synthase deficiency. A dual pathway for the synthesis of sterols through lanosterol and cycloartenol was reported in the model Arabidopsis thaliana, though the contribution of a lanosterol pathway to the production of 24-alkyl-Δ(5)-sterols was quite marginal (Ohyama et al. (2009) PNAS 106, 725). To investigate further the physiological relevance of CAS1 and LAS1 genes in plants, we have silenced their expression in Nicotiana benthamiana. We used virus induced gene silencing (VIGS) based on gene specific sequences from a Nicotiana tabacum CAS1 or derived from the solgenomics initiative (http://solgenomics.net/) to challenge the respective roles of CAS1 and LAS1. In this report, we show a CAS1-specific functional sterol pathway in engineered yeast, and a strict dependence on CAS1 of tobacco sterol biosynthesis.

Identifying the catalytic components of cellulose synthase and the maize mixed-linkage beta-glucan synthase

Energy Technology Data Exchange (ETDEWEB)

Nicholas C Carpita

2009-04-20

Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.

Virus-induced gene silencing of Withania somnifera squalene synthase negatively regulates sterol and defence-related genes resulting in reduced withanolides and biotic stress tolerance.

Science.gov (United States)

Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A

2015-12-01

Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Cloning and characterization of ATP synthase CF1 α gene from ...

African Journals Online (AJOL)

ATP synthase CF1 α subunit protein is a key enzyme for energy metabolism in plant kingdom, and plays an important role in multiple cell processes. In this study, the complete atpA gene (accession no. JN247444) was cloned from sweet potato (Ipomoea batatas L. Lam) by reverse transcriptasepolymerase chain reaction ...

Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

OpenAIRE

Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

2003-01-01

Tetrahydromethanopterin (H4MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and...

Generation and characterization of P gene-deficient rabies virus

International Nuclear Information System (INIS)

Shoji, Youko; Inoue, Satoshi; Nakamichi, Kazuo; Kurane, Ichiro; Sakai, Takeo; Morimoto, Kinjiro

2004-01-01

Rabies virus (RV) deficient in the P gene was generated by reverse genetics from cDNA of HEP-Flury strain lacking the entire P gene. The defective virus was propagated and amplified by rescue of virus, using a cell line that complemented the functions of the deficient gene. The P gene-deficient (def-P) virus replicated its genome and produced progeny viruses in the cell lines that constitutively expressed the P protein, although it grew at a slightly retarded rate compared to the parental strain. In contrast, no progeny virus was produced in the infected host when the def-P virus-infected cells that did not express the P protein. However, we found that the def-P virus had the ability to perform primary transcription (by the virion-associated polymerase) in the infected host without de novo P protein synthesis. The def-P virus was apathogenic in adult and suckling mice, even when inoculated intracranially. Inoculation of def-P virus in mice induced high levels of virus-neutralizing antibody (VNA) and conferred protective immunity against a lethal rabies infection. These results demonstrate the potential utility of gene-deficient virus as a novel live attenuated rabies vaccine

Low energy costs of F1Fo ATP synthase reversal in colon carcinoma cells deficient in mitochondrial complex IV.

Science.gov (United States)

Zhdanov, Alexander V; Andreev, Dmitry E; Baranov, Pavel V; Papkovsky, Dmitri B

2017-05-01

Mitochondrial polarisation is paramount for a variety of cellular functions. Under ischemia, mitochondrial membrane potential (ΔΨm) and proton gradient (ΔpH) are maintained via a reversal of mitochondrial F1Fo ATP synthase (mATPase), which can rapidly deplete ATP and drive cells into energy crisis. We found that under normal conditions in cells with disassembled cytochrome c oxidase complex (COX-deficient HCT116), mATPase maintains ΔΨm at levels only 15-20% lower than in WT cells, and for this utilises relatively little ATP. For a small energy expenditure, mATPase enables mitochondrial ΔpH, protein import, Ca 2+ turnover, and supports free radical detoxication machinery enlarged to protect the cells from oxidative damage. Whereas in COX-deficient cells the main source of ATP is glycolysis, the ΔΨm is still maintained upon inhibition of the adenine nucleotide translocators with bongkrekic acid and carboxyatractyloside, indicating that the role of ANTs is redundant, and matrix substrate level phosphorylation alone or in cooperation with ATP-Mg/P i carriers can continuously support the mATPase activity. Intriguingly, we found that mitochondrial complex III is active, and it contributes not only to free radical production, but also to ΔΨm maintenance and energy budget of COX-deficient cells. Overall, this study demonstrates that F1Fo ATP synthase can support general mitochondrial and cellular functions, working in extremely efficient 'energy saving' reverse mode and flexibly recruiting free radical detoxication and ATP producing / transporting pathways. Copyright © 2017 Elsevier Inc. All rights reserved.

Functional mitochondrial ATP synthase proteolipid gene produced by recombination of parental genes in a petunia somatic hybrid

International Nuclear Information System (INIS)

Rothenberg, M.; Hanson, M.R.

1988-01-01

A novel ATP synthase subunit 9 gene (atp9) was identified in the mitochondrial genome of a Petunia somatic hybrid line (13-133) which was produced from a fusion between Petunia lines 3688 and 3704. The novel gene was generated by intergenomic recombination between atp9 genes from the two parental plant lines. The entire atp9 coding region is represented on the recombinant gene. Comparison of gene sequences using electrophoresis and autoradiography, indicate that the 5' transcribed region is contributed by an atp9 gene from 3704 and the 3' transcribed region is contributed by an atp9 gene from 3688. The recombinant atp9 gene is transcriptionally active. The location of the 5' and 3' transcript termini are conserved with respect to the parental genes, resulting in the production of hybrid transcripts

A real-time PCR assay for the relative quantification of the tetrahydrocannabinolic acid (THCA) synthase gene in herbal Cannabis samples.

Science.gov (United States)

Cascini, Fidelia; Passerotti, Stella; Martello, Simona

2012-04-10

In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw

Directory of Open Access Journals (Sweden)

Yanjing Su

2012-06-01

Full Text Available Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase and its wild type (WT were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p0.05 was detected in neutral detergent fiber (NDFom and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05. The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05, but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants.

Characterization of three chalcone synthase-like genes from apple (Malus x domestica Borkh.).

Science.gov (United States)

Yahyaa, Mosaab; Ali, Samah; Davidovich-Rikanati, Rachel; Ibdah, Muhammad; Shachtier, Alona; Eyal, Yoram; Lewinsohn, Efraim; Ibdah, Mwafaq

2017-08-01

Apple (Malus x domestica Brokh.) is a widely cultivated deciduous tree species of significant economic importance. Apple leaves accumulate high levels of flavonoids and dihydrochalcones, and their formation is dependent on enzymes of the chalcone synthase family. Three CHS genes were cloned from apple leaves and expressed in Escherichia coli. The encoded recombinant enzymes were purified and functionally characterized. In-vitro activity assays indicated that MdCHS1, MdCHS2 and MdCHS3 code for proteins exhibiting polyketide synthase activity that accepted either p-dihydrocoumaroyl-CoA, p-coumaroyl-CoA, or cinnamoyl-CoA as starter CoA substrates in the presence of malonyl-CoA, leading to production of phloretin, naringenin chalcone, and pinocembrin chalcone. MdCHS3 coded a chalcone-dihydrochalcone synthase enzyme with narrower substrate specificity than the previous ones. The apparent Km values of MdCHS3 for p-dihydrocoumaryl-CoA and p-coumaryl-CoA were both 5.0 μM. Expression analyses of MdCHS genes varied according to tissue type. MdCHS1, MdCHS2 and MdCHS3 expression levels were associated with the levels of phloretin accumulate in the respective tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

OpenAIRE

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-01-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was succe...

Sesquiterpene Synthase-3-Hydroxy-3-Methylglutaryl Coenzyme A Synthase Fusion Protein Responsible for Hirsutene Biosynthesis in Stereum hirsutum.

Science.gov (United States)

Flynn, Christopher M; Schmidt-Dannert, Claudia

2018-06-01

The wood-rotting mushroom Stereum hirsutum is a known producer of a large number of namesake hirsutenoids, many with important bioactivities. Hirsutenoids form a structurally diverse and distinct class of sesquiterpenoids. No genes involved in hirsutenoid biosynthesis have yet been identified or their enzymes characterized. Here, we describe the cloning and functional characterization of a hirsutene synthase as an unexpected fusion protein of a sesquiterpene synthase (STS) with a C-terminal 3-hydroxy-3-methylglutaryl-coenzyme A (3-hydroxy-3-methylglutaryl-CoA) synthase (HMGS) domain. Both the full-length fusion protein and truncated STS domain are highly product-specific 1,11-cyclizing STS enzymes with kinetic properties typical of STSs. Complementation studies in Saccharomyces cerevisiae confirmed that the HMGS domain is also functional in vivo Phylogenetic analysis shows that the hirsutene synthase domain does not form a clade with other previously characterized sesquiterpene synthases from Basidiomycota. Comparative gene structure analysis of this hirsutene synthase with characterized fungal enzymes reveals a significantly higher intron density, suggesting that this enzyme may be acquired by horizontal gene transfer. In contrast, the HMGS domain is clearly related to other fungal homologs. This STS-HMGS fusion protein is part of a biosynthetic gene cluster that includes P450s and oxidases that are expressed and could be cloned from cDNA. Finally, this unusual fusion of a terpene synthase to an HMGS domain, which is not generally recognized as a key regulatory enzyme of the mevalonate isoprenoid precursor pathway, led to the identification of additional HMGS duplications in many fungal genomes, including the localization of HMGSs in other predicted sesquiterpenoid biosynthetic gene clusters. IMPORTANCE Hirsutenoids represent a structurally diverse class of bioactive sesquiterpenoids isolated from fungi. Identification of their biosynthetic pathways will provide

Unchanged gene expression of glycogen synthase in muscle from patients with NIDDM following sulphonylurea-induced improvement of glycaemic control

DEFF Research Database (Denmark)

Vestergaard, H; Lund, S; Bjørbaek, C

1995-01-01

We have previously shown that the mRNA expression of muscle glycogen synthase is decreased in non-insulin-dependent diabetic (NIDDM) patients; the objective of the present protocol was to examine whether the gene expression of muscle glycogen synthase in NIDDM is affected by chronic sulphonylurea...... as enhanced beta-cell responses to an oral glucose load. During euglycaemic, hyperinsulinaemic clamp (2 mU x kg-1 x min-1) in combination with indirect calorimetry, a 35% (p=0.005) increase in whole-body insulin-stimulated glucose disposal rate, predominantly due to an increased non-oxidative glucose....... In conclusion, improved blood glucose control in gliclazide-treated obese NIDDM patients has no impact on the gene expression of muscle glycogen synthase....

Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

Directory of Open Access Journals (Sweden)

Catalina Sanz

Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

Analysis of Human Bradykinin Receptor Gene and Endothelial Nitric Oxide Synthase Gene Polymorphisms in End-Stage Renal Disease Among Malaysians

Directory of Open Access Journals (Sweden)

R. Vasudevan

2014-06-01

Full Text Available The aim of this study was to determine the association of the c.894G>T; p.Glu298Asp polymorphism and the variable number tandem repeat (VNTR polymorphism of the endothelial nitric oxide synthase (eNOS gene and c.181C>T polymorphism of the bradykinin type 2 receptor gene (B2R in Malaysian end-stage renal disease (ESRD subjects.

Expression of an (E-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation

Directory of Open Access Journals (Sweden)

Xiudao Yu

2013-10-01

Full Text Available Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E-β-farnesene (EβF is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piperita, two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint (Mentha asiatica. Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d− 1 g− 1 of fresh tissue. Tritrophic interactions involving peach aphids (Myzus persicae, and predatory lacewing (Chrysopa septempunctata larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.

Disruption of Bcchs4, Bcchs6 or Bcchs7 chitin synthase genes in Botrytis cinerea and the essential role of class VI chitin synthase (Bcchs6).

Science.gov (United States)

Morcx, Serena; Kunz, Caroline; Choquer, Mathias; Assie, Sébastien; Blondet, Eddy; Simond-Côte, Elisabeth; Gajek, Karina; Chapeland-Leclerc, Florence; Expert, Dominique; Soulie, Marie-Christine

2013-03-01

Chitin synthases play critical roles in hyphal development and fungal pathogenicity. Previous studies on Botrytis cinerea, a model organism for necrotrophic pathogens, have shown that disruption of Bcchs1 and more particularly Bcchs3a genes have a drastic impact on virulence (Soulié et al., 2003, 2006). In this work, we investigate the role of other CHS including BcCHS4, BcCHS6 and BcCHS7 during the life cycle of B. cinerea. Single deletions of corresponding genes were carried out. Phenotypic analysis indicates that: (i) BcCHS4 enzyme is not essential for development and pathogenicity of the fungus; (ii) BcCHS7 is required for pathogenicity in a host dependant manner. For Bcchs6 gene disruption, we obtained only heterokaryotic strains. Indeed, sexual or asexual purification assays were unsuccessful. We concluded that class VI chitin synthase could be essential for B. cinerea and therefore BcCHS6 represents a valuable antifungal target. Copyright © 2012 Elsevier Inc. All rights reserved.

[Interspecific polymorphism of the glucosyltransferase domain of the sucrose synthase gene in the genus Malus and related species of Rosaceae].

Science.gov (United States)

Boris, K V; Kochieva, E Z; Kudryavtsev, A M

2014-12-01

The sequences that encode the main functional glucosyltransferase domain of sucrose synthase genes have been identified for the first time in 14 species of the genus Malus and related species of the family Rosaceae, and their polymorphism was investigated. Single nucleotide substitutions leading to amino acid substitutions in the protein sequence, including the conservative transmembrane motif sequence common to all sucrose synthase genes of higher plants, were detected in the studied sequences.

IDENTIFICATION AND CHARACTERIZATION OF THE SUCROSE SYNTHASE 2 GENE (Sus2 IN DURUM WHEAT

Directory of Open Access Journals (Sweden)

Mariateresa eVolpicella

2016-03-01

Full Text Available Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for sucrose synthase in durum wheat (cultivars Ciccio and Svevo is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur and 5-BIL42. The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modelling approaches. The combined results of SUS2 expression and activity levels were then considered in the light of their possible involvement in starch yield.

[Cellulose synthase genes that control the fiber formation of flax (Linum usitatissimum L.)].

Science.gov (United States)

Galinovskiĭ, D V; Anisimova, N V; Raĭskiĭ, A P; Leont'ev, V N; Titok, V V; Hotyleva, L V

2014-01-01

Four cellulose synthase genes were identified by analysis of their class-specific regions (CSRII) in plants of fiber flax during the "rapid growth" stage. These genes were designated as LusCesA1, LusCesA4, LusCesA7 and LusCesA9. LusCesA4, LusCesA7, and LusCesA9 genes were expressed in the stem; LusCesA1 and LusCesA4 genes were expressed in the apex part of plants, and the LusCesA4 gene was expressed in the leaves of fiber flax. The expression of the LusCesA7 and LusCesA9 genes was specific to the stems of fiber flax. These genes may influence the quality of the flax fiber.

Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae

DEFF Research Database (Denmark)

Hove-Jensen, Bjarne

2004-01-01

The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...

Reduced methylation of the thromboxane synthase gene is correlated with its increased vascular expression in preeclampsia.

Science.gov (United States)

Mousa, Ahmad A; Strauss, Jerome F; Walsh, Scott W

2012-06-01

Preeclampsia is characterized by increased thromboxane and decreased prostacyclin levels, which predate symptoms, and can explain some of the clinical manifestations of preeclampsia, including hypertension and thrombosis. In this study, we examined DNA methylation of the promoter region of the thromboxane synthase gene (TBXAS1) and the expression of thromboxane synthase in systemic blood vessels of normal pregnant and preeclamptic women. Thromboxane synthase is responsible for the synthesis of thromboxane A(2), a potent vasoconstrictor and activator of platelets. We also examined the effect of experimentally induced DNA hypomethylation on the expression of thromboxane synthase in a neutrophil-like cell line (HL-60 cells) and in cultured vascular smooth muscle and endothelial cells. We found that DNA methylation of the TBXAS1 promoter was decreased and thromboxane synthase expression was increased in omental arteries of preeclamptic women as compared with normal pregnant women. Increased thromboxane synthase expression was observed in vascular smooth muscles cells, endothelial cells, and infiltrating neutrophils. Experimentally induced DNA hypomethylation only increased expression of thromboxane synthase in the neutrophil-like cell line, whereas tumor necrosis factor-α, a neutrophil product, increased its expression in cultured vascular smooth muscle cells. Our study suggests that epigenetic mechanisms and release of tumor necrosis factor-α by infiltrating neutrophils could contribute to the increased expression of thromboxane synthase in maternal systemic blood vessels, contributing to the hypertension and coagulation abnormalities associated with preeclampsia.

Isolation and characterization of a copalyl diphosphate synthase gene promoter from Salvia miltiorrhiza

Directory of Open Access Journals (Sweden)

Piotr Szymczyk

2016-09-01

Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.

Geranylgeranyl diphosphate synthase in fission yeast is a heteromer of farnesyl diphosphate synthase (FPS), Fps1, and an FPS-like protein, Spo9, essential for sporulation.

Science.gov (United States)

Ye, Yanfang; Fujii, Makoto; Hirata, Aiko; Kawamukai, Makoto; Shimoda, Chikashi; Nakamura, Taro

2007-09-01

Both farnesyl diphosphate synthase (FPS) and geranylgeranyl diphosphate synthase (GGPS) are key enzymes in the synthesis of various isoprenoid-containing compounds and proteins. Here, we describe two novel Schizosaccharomyces pombe genes, fps1(+) and spo9(+), whose products are similar to FPS in primary structure, but whose functions differ from one another. Fps1 is essential for vegetative growth, whereas, a spo9 null mutant exhibits temperature-sensitive growth. Expression of fps1(+), but not spo9(+), suppresses the lethality of a Saccharomyces cerevisiae FPS-deficient mutant and also restores ubiquinone synthesis in an Escherichia coli ispA mutant, which lacks FPS activity, indicating that S. pombe Fps1 in fact functions as an FPS. In contrast to a typical FPS gene, no apparent GGPS homologues have been found in the S. pombe genome. Interestingly, although neither fps1(+) nor spo9(+) expression alone in E. coli confers clear GGPS activity, coexpression of both genes induces such activity. Moreover, the GGPS activity is significantly reduced in the spo9 mutant. In addition, the spo9 mutation perturbs the membrane association of a geranylgeranylated protein, but not that of a farnesylated protein. Yeast two-hybrid and coimmunoprecipitation analyses indicate that Fps1 and Spo9 physically interact. Thus, neither Fps1 nor Spo9 alone functions as a GGPS, but the two proteins together form a complex with GGPS activity. Because spo9 was originally identified as a sporulation-deficient mutant, we show here that expansion of the forespore membrane is severely inhibited in spo9Delta cells. Electron microscopy revealed significant accumulation membrane vesicles in spo9Delta cells. We suggest that lack of GGPS activity in a spo9 mutant results in impaired protein prenylation in certain proteins responsible for secretory function, thereby inhibiting forespore membrane formation.

Functional analysis of the cellulose synthase-like genes CSLD1, CSLD2 and CSLD4 in tip-growing arabidopsis cells

DEFF Research Database (Denmark)

Bernal Giraldo, Adriana Jimena; Yoo, Cheol-Min; Mutwil, Marek

2008-01-01

A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from that pre......A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from...... for insertions in these genes were partially rescued by reduced temperature growth. However, this was not the case for a double mutant homozygous for insertions in both CSLD2 and CSLD3, suggesting that there may be partial redundancy in the functions of these genes. Mutants in CSLD1 and CSLD4 had a defect...

The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes

DEFF Research Database (Denmark)

Schneider, Lizette Marais; Adamski, Nikolai M.; Christensen, Caspar Elo

2016-01-01

identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified...... alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed...... five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase...

First contiguous gene deletion causing biotinidase deficiency: The enzyme deficiency in three Sri Lankan children

Directory of Open Access Journals (Sweden)

Danika Nadeen Senanayake

2015-03-01

Full Text Available We report three symptomatic children with profound biotinidase deficiency from Sri Lanka. All three children presented with typical clinical features of the disorder. The first is homozygous for a missense mutation in the BTD gene (c.98_104 del7insTCC; p.Cys33PhefsX36 that is commonly seen in the western countries, the second is homozygous for a novel missense mutation (p.Ala439Asp, and the third is the first reported instance of a contiguous gene deletion causing the enzyme deficiency. In addition, this latter finding exemplifies the importance of considering a deletion within the BTD gene for reconciling enzymatic activity with genotype, which can occur in asymptomatic children who are identified by newborn screening.

Identification and molecular characterization of nitric oxide synthase (NOS) gene in the intertidal copepod Tigriopus japonicus.

Science.gov (United States)

Jeong, Chang-Bum; Kang, Hye-Min; Seo, Jung Soo; Park, Heum Gi; Rhee, Jae-Sung; Lee, Jae-Seong

2016-02-10

In copepods, no information has been reported on the structure or molecular characterization of the nitric oxide synthase (NOS) gene. In the intertidal copepod Tigriopus japonicus, we identified a NOS gene that is involved in immune responses of vertebrates and invertebrates. In silico analyses revealed that nitric oxide (NO) synthase domains, such as the oxygenase and reductase domains, are highly conserved in the T. japonicus NOS gene. The T. japonicus NOS gene was highly transcribed in the nauplii stages, implying that it plays a role in protecting the host during the early developmental stages. To examine the involvement of the T. japonicus NOS gene in the innate immune response, the copepods were exposed to lipopolysaccharide (LPS) and two Vibrio sp. After exposure to different concentrations of LPS and Vibrio sp., T. japonicus NOS transcription was significantly increased over time in a dose-dependent manner, and the NO/nitrite concentration increased as well. Taken together, our findings suggest that T. japonicus NOS transcription is induced in response to an immune challenge as part of the conserved innate immunity. Copyright © 2015 Elsevier B.V. All rights reserved.

Expression of phytoene synthase1 and carotene desaturase crtI genes result in an increase in the total carotenoids content in transgenic elite wheat (Triticum aestivum L.).

Science.gov (United States)

Cong, Ling; Wang, Cheng; Chen, Ling; Liu, Huijuan; Yang, Guangxiao; He, Guangyuan

2009-09-23

Dietary micronutrient deficiencies, such as the lack of vitamin A, are a major source of morbidity and mortality worldwide. Carotenoids in food can function as provitamin A in humans, while grains of Chinese elite wheat cultivars generally have low carotenoid contents. To increase the carotenoid contents in common wheat endosperm, transgenic wheat has been generated by expressing the maize y1 gene encoding phytoene synthase driven by a endosperm-specific 1Dx5 promoter in the elite wheat (Triticum aestivum L.) variety EM12, together with the bacterial phytoene desaturase crtI gene from Erwinia uredovora under the constitutive CaMV 35S promoter control. A clear increase of the carotenoid content was detected in the endosperms of transgenic wheat that visually showed a light yellow color. The total carotenoids content was increased up to 10.8-fold as compared with the nontransgenic EM12 cultivar. To test whether the variability of total carotenoid content in different transgenic lines was due to differences in the transgene copy number or expression pattern, Southern hybridization and semiquantitative reverse transcriptase polymerase chain reaction analyses were curried out. The results showed that transgene copy numbers and transcript levels did not associate well with carotenoid contents. The expression patterns of endogenous carotenoid genes, such as the phytoene synthases and carotene desaturases, were also investigated in wild-type and transgenic wheat lines. No significant changes in expression levels of these genes were detected in the transgenic endosperms, indicating that the increase in carotenoid transgenic wheat endosperms resulted from the expression of transgenes.

High polyhydroxybutyrate production in Pseudomonas extremaustralis is associated with differential expression of horizontally acquired and core genome polyhydroxyalkanoate synthase genes.

Directory of Open Access Journals (Sweden)

Mariela V Catone

Full Text Available Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB, a short chain length polyhydroxyalkanoate (sclPHA infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA. All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC in comparison with the mclPHA core genome genes (phaC1 and phaC2 indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases.

The expression of inducible nitric oxide synthase (iNOS) in the testis and epididymis of rats with a dihydrotestosterone (DHT) deficiency.

Science.gov (United States)

Kolasa, Agnieszka; Marchlewicz, Mariola; Kurzawa, Rafał; Głabowski, Wojciech; Trybek, Grzegorz; Wenda-Rózewicka, Lidia; Wiszniewska, Barbara

2009-01-01

In our previous studies, we showed that a finasteride-induced DHT deficiency may cause changes in the morphology of the seminiferous epithelium without any morphological alteration of the epididymis. In this study, we demonstrated the constitutive immunoexpression of inducible nitric oxide synthase (iNOS) in the testis and epididymis of Wistar rats treated with finasteride for 28 days (the duration of two cycles of the seminiferous epithelium) and 56 days (the duration of one spermatogenesis). We noted that a 56-day finasteride treatment mainly caused a decrease in the level of circulating DHT, as well as a statistically insignificant decrease in the level of T. The hormone deficiency also led to a change in the iNOS immnoexpression in the testis and epididymis of the finasteride-treated rats. In vitro, DHT did not modify NO production by the epithelial cells of the caput epididymis even when stimulated with LPS and IFNgamma, but it did give rise to an increase in NO production by the epithelial cells of the cauda epididymis without the stimulation. DHT did not have a statistically significant influence on estradiol production by cultured, LPS- and IFNgamma-stimulated epithelial cells from the caput and cauda epididymis. In conclusion, our data clearly indicates that a finasterideinduced DHT deficiency intensifies the constitutive expression of iNOS in most rat testicular and epididymal cells, so it can be expected that the expression of inducible nitric oxide synthase (iNOS) could be regulated by DHT. On the other hand, the profile of the circulating DHT and T levels strongly suggests that the regulation of constitutive iNOS expression is complex and needs more detailed study.

Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species.

Science.gov (United States)

Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing

2016-03-01

Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.

Molecular cloning and expression levels of the monoterpene synthase gene (ZMM1 in Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr.

Directory of Open Access Journals (Sweden)

Bua-In Saowaluck

2014-01-01

Full Text Available Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr. is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant and evaluate the mechanical wounding that may influence the transcription level of the monoterpene synthase gene. To isolate the gene, the selected clones from DNA derived from young leaves were sequenced and analyzed and the monoterpene synthase gene from cassumunar ginger (ZMM1 was identified. The ZMM1 CDS containing 1 773 bp (KF500399 is predicted to encode a protein of 590 amino acids. The deduced amino acid sequence is 40-74% identical with known sequences of other angiosperm monoterpene synthases belonging to the isoprenoid biosynthesis C1 superfamily. A transcript of ZMM1 was detected almost exclusively in the leaves and was related to leaf wounding. The results of this research offer insight into the control of monoterpene synthesis in this plant. This finding can be applied to breeding programs or crop management of cassumunar ginger for better yield and quality of essential oil.

Germacrene A Synthase in Yarrow (Achillea millefolium Is an Enzyme with Mixed Substrate Specificity: Gene Cloning, Functional Characterization and Expression Analysis

Directory of Open Access Journals (Sweden)

Leila ePazouki

2015-03-01

Full Text Available Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5 residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focused on germacrene A synthase (GAS that is a key cytosolic enzyme in the sesquiterpene lactone biosynthesis pathway in the important medicinal plant Achillea millefolium (AmGAS. The full length encoding gene was heterologously expressed in Escherichia coli BL21 (DE3, functionally characterized, and its in vivo expression was analyzed. The recombinant protein catalyzed formation of germacrene A with the C15 substrate farnesyl diphosphate (FDP, while acyclic monoterpenes were formed with the C10 substrate geranyl diphosphate (GDP and cyclic monoterpenes with the C10 substrate neryl diphosphate (NDP. Although monoterpene synthesis has been assumed to be confined exclusively to plastids, AmGAS can potentially synthesize monoterpenes in cytosol when GDP or NDP become available. AmGAS enzyme had high homology with GAS sequences from other Asteraceae species, suggesting that multi-substrate use can be more widespread among germacrene A synthases than previously thought. Expression studies indicated that AmGAS was expressed in both autotrophic and heterotrophic plant compartments with the highest expression levels in leaves and flowers. To our knowledge, this is the first report on the cloning and characterization of germacrene A synthase coding gene in A. millefolium, and multi-substrate use of GAS enzymes.

Expression analysis of cellulose synthase and main cytoskeletal protein genes in flax (Linum usitatissimum L.).

Science.gov (United States)

Galinousky, Dmitry; Padvitski, Tsimafei; Bayer, Galina; Pirko, Yaroslav; Pydiura, Nikolay; Anisimova, Natallia; Nikitinskaya, Tatyana; Khotyleva, Liubov; Yemets, Alla; Kilchevsky, Aleksandr; Blume, Yaroslav

2017-08-09

Fiber flax is an important source of natural fiber and a comprehensive model for the plant fiber biogenesis studies. Cellulose-synthase (CesA) and cytoskeletal genes are known to be important for the cell wall biogenesis in general and for the biogenesis of flax fibers in particular. Currently, knowledge about activity of these genes during the plant growth is limited. In this study, we have investigated flax fiber biogenesis by measuring expression of CesA and cytoskeletal genes at two stages of the flax development (seedlings and stems at the rapid growth stage) in several flax subspecies (elongatum, mediterraneum, crepitans). RT-qPCR has been used to quantify the expression of LusСesA1, LusСesA4, LusСesA7, LusСesA6, Actin, and α-Tubulin genes in plant samples. We report that CesA genes responsible for the secondary cell wall synthesis (LusCesA4, LusCesA7) have different expression pattern compared with CesA genes responsible for the primary cell wall synthesis (LusCesA1, LusCesA6): an average expression of LusCesA4 and LusCesA7 genes is relatively high in seedlings and further increases in stems at the rapid growth stage, whereas an average expression of LusCesA1 and LusCesA6 genes decreases. Interestingly, LusCesA1 is the only studied gene with different expression dynamics between the flax subspecies: its expression decreases by 5.2-10.7 folds in elongatum and mediterraneum but does not change in crepitans subspecies when the rapid growth stage and seedlings are compared. The expression of cytoskeleton genes (coding actin and α-tubulin) is relatively stable and significantly higher than the expression of cellulose-synthase genes in all the studied samples. © 2017 International Federation for Cell Biology.

Transcriptional regulation of the gltA and tlc genes in Rickettsia prowazekii growing in a respiration-deficient host cell

International Nuclear Information System (INIS)

Cai, J.; Winkler, H.H.

1997-01-01

The regulation of the citrate synthase (gltA) and ATP/ADP translocase (tlc) genes of the obligate intracellular bacterium, Rickettsia prowazekii, was analyzed in rickettsia-infected respiration-deficient G14 cells. The level of the gltA mRNAII and the tlc mRNA was much lower in the total RNA isolated from the infected G 14 cells grown in 1 g/1 glucose (low glucose, GL) medium than in that from infected G 14 cells grown in 4.5 g/l glucose (high glucose, GH) medium. However, the level of the gltA mRNAI relative to 16 S rRNA was the same in GL and GH media. An increase in the level of the gltA mRNAII and the tlc mRNA could be observed as early as 2 hrs after shifting from GL to GH medium. We conclude that, under these experimental conditions, the tlc promoter and the gltA promoter P2, but not gltA promoter P1, were transcriptionally regulated. Key words: Rickettsia prowazekii; gltA gene; tlC gene; transcriptional regulation; G 14 cells (authors)

Plasmodium falciparum dolichol phosphate mannose synthase represents a novel clade

International Nuclear Information System (INIS)

Shams-Eldin, Hosam; Santos de Macedo, Cristiana; Niehus, Sebastian; Dorn, Caroline; Kimmel, Juergen; Azzouz, Nahid; Schwarz, Ralph T.

2008-01-01

Dolichol phosphate mannose synthase (DPM) catalyzes the reaction between dolichol phosphate (Dol-P) and guanosine diphosphate mannose (GDP-Man) to form dolichol-phosphate-mannose (Dol-P-Man). This molecule acts as mannose donor for N-glycosylation and glycosylphosphatidylinositol (GPI) biosynthesis. The Plasmodium falciparum DPM1 (Pfdpm1) possesses a single predicted transmembrane region near the N-, but not the C-terminus. Here we show that the cloned Pfdpm1 gene failed to complement a Saccharomyces cerevisiae mutant indicating that the parasite gene does not belong to the baker's yeast group, as was previously assumed. Furthermore, Pfdpm1 was unable to complement a mouse mutant deficient in DPM but efficiently complements the Schizosaccharomyces pombe fission yeast mutant, indicating a difference between fission yeast and mammalian DPM genes. Therefore, we reanalyzed the hydrophobicity scales of all known DPMs and consequently reclassify the DPM clade into six major novel subgroups. Furthermore, we show that Pfdpm1 represents a unique enzyme among these subgroups

Methamphetamine- and 1-methyl-4-phenyl- 1,2,3, 6-tetrahydropyridine-induced dopaminergic neurotoxicity in inducible nitric oxide synthase-deficient mice.

Science.gov (United States)

Itzhak, Y; Martin, J L; Ali, S F

1999-12-15

Previous studies have suggested a role for the retrograde messenger, nitric oxide (NO), in methamphetamine (METH)- and 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)- induced dopaminergic neurotoxicity. Since evidence supported the involvement of the neuronal nitric oxide synthase (nNOS) isoform in the dopaminergic neurotoxicity, the present study was undertaken to investigate whether the inducible nitric oxide synthase (iNOS) isoform is also associated with METH- and MPTP-induced neurotoxicity. The administration of METH (5mg/kg x 3) to iNOS deficient mice [homozygote iNOS(-/-)] and wild type mice (C57BL/6) resulted in significantly smaller depletion of striatal dopaminergic markers in the iNOS(-/-) mice compared with the wild-type mice. METH-induced hyperthermia was also significantly lower in the iNOS(-/-) mice than in wild-type mice. In contrast to the outcome of METH administration, MPTP injections (20 mg/kg x 3) resulted in a similar decrease in striatal dopaminergic markers in iNOS(-/-) and wild-type mice. In the set of behavioral experiments, METH-induced locomotor sensitization was investigated. The acute administration of METH (1.0 mg/kg) resulted in the same intensity of locomotor activity in iNOS(-/-) and wild-type mice. Moreover, 68 to 72 h after the exposure to the high-dose METH regimen (5 mg/kg x 3), a marked sensitized response to a challenge injection of METH (1.0 mg/kg) was observed in both the iNOS(-/-) and wild-type mice. The finding that iNOS(-/-) mice were unprotected from MPTP-induced neurotoxicity suggests that the partial protection against METH-induced neurotoxicity observed was primarily associated with the diminished hyperthermic effect of METH seen in the iNOS(-/-) mice. Moreover, in contrast to nNOS deficiency, iNOS deficiency did not affect METH-induced behavioral sensitization. Copyright 1999 Wiley-Liss, Inc.

Functional genomic analysis supports conservation of function among cellulose synthase-like a gene family members and suggests diverse roles of mannans in plants

DEFF Research Database (Denmark)

Liepman, Aaron H; Nairn, C Joseph; Willats, William G T

2007-01-01

from Arabidopsis (Arabidopsis thaliana), guar (Cyamopsis tetragonolobus), and Populus trichocarpa catalyze beta-1,4-mannan and glucomannan synthase reactions in vitro. Mannan polysaccharides and homologs of CslA genes appear to be present in all lineages of land plants analyzed to date. In many plants......, the CslA genes are members of extended multigene families; however, it is not known whether all CslA proteins are glucomannan synthases. CslA proteins from diverse land plant species, including representatives of the mono- and dicotyledonous angiosperms, gymnosperms, and bryophytes, were produced...... they are prevalent at cell junctions and in buds. Taken together, these results demonstrate that members of the CslA gene family from diverse plant species encode glucomannan synthases and support the hypothesis that mannans function in metabolic networks devoted to other cellular processes in addition to cell wall...

Aldosterone synthase gene is not a major susceptibility gene for progression of chronic kidney disease in patients with autosomal dominant polycystic kidney disease

Directory of Open Access Journals (Sweden)

Gnanasambandan Ramanathan

2017-01-01

Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is the most common heritable kidney disease and is characterized by bilateral renal cysts. Hypertension is a frequent cause of chronic kidney disease (CKD and mortality in patients with ADPKD. The aldosterone synthase gene polymorphisms of the renin-angiotensin-aldosterone system have been extensively studied as hypertension candidate genes. The present study is aimed to investigate the potential modifier effect of CYP11B2 gene on the progression of CKD in ADPKD. One hundred and two ADPKD patients and 106 healthy controls were recruited based on Ravine inclusion and exclusion criteria. The three tag-SNPs within CYP11B2 gene (rs3802230, rs4543, and rs4544 were genotyped using FRET-based KASPar method. Cochran-Armitage trend test was used to assess the potential associations between these polymorphisms and CKD stages. Mantel- Haenszel stratified analysis was used to explore confounding and interaction effects of these polymorphisms. Of the three tag-SNPs genotyped, rs4544 polymorphism was monomorphic and rs3802230 deviated Hardy-Weinberg equilibrium. The CYP11B2 tag-SNPs did not show significant association with ADPKD or CKD. Further, these polymorphisms did not exhibit confounding effect on the relationship between CKD progression and hypertension. Our results suggest that aldosterone synthase gene is not a major susceptibility gene for progression of CKD in South Indian ADPKD patients.

Association of Endothelial Nitric Oxide Synthase Gene Polymorphisms With Acute Rejection in Liver Transplant Recipients.

Science.gov (United States)

Azarpira, Negar; Namazi, Soha; Malahi, Sayan; Kazemi, Kourosh

2016-06-01

Polymorphisms of the endothelial nitric oxide synthase gene have been associated with altered endothelial nitric oxide synthase activity. The purpose of this study was to investigate the relation between endothelial nitric oxide synthase -786T/C and 894G/T polymorphism and their haplotypes on the occurrence of acute rejection episodes in liver transplant recipients. We conducted a case control study in which 100 liver transplant recipients and 100 healthy controls were recruited from Shiraz Transplant Center. The patients used triple therapy including tacrolimus, mycophenolate mofetil, and prednisolone for immunosuppression maintenance. DNA was extracted from peripheral blood and endothelial nitric oxide synthase polymorphisms were determined by polymerase chain reaction and restriction fragment length polymorphism. Patients included 60 men and 40 women (mean age, 32.35 ± 10.2 y). There was a significant association of endothelial nitric oxide synthase 894G/T and acute rejection episode. The GT* gen-otype and acute rejection episodes had a significant association (odds ratio, 2.42; 95% confidence interval, 0.97-6.15; P = .03). The GG and GT* genotype and T* allele frequency were significantly different between patients and control subjects (P = .001). Haplotype TT* was higher in recipients than control subjects (odds ratio, 2.17; 95% confidence interval, 1.12-4.25; P = .01). Haplotype TG was higher in the control group (odds ratio, 0.62; 95% confidence interval, 0.40-0.96; P = .02). Our results suggest a relation between different endothelial nitric oxide synthase geno-types and risk of acute rejection episodes. However, further study is necessary to determine genetic susceptibility for transplant patients.

Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

NARCIS (Netherlands)

van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

1991-01-01

Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

Mice lacking cystathionine beta synthase have lung fibrosis and air space enlargement.

Science.gov (United States)

Hamelet, Julien; Maurin, Nicole; Fulchiron, Romain; Delabar, Jean-Maurice; Janel, Nathalie

2007-10-01

Cystathionine beta synthase (CBS) is a crucial regulator of plasma concentrations of homocysteine. Severe hyperhomocysteinemia due to CBS deficiency confers diverse clinical manifestations, notably pulmonary thrombotic disease. However, the association between hyperhomocysteinemia and chronic obstructive pulmonary disease is not well understood. To investigate the role of hyperhomocysteinemia in lung injury and pulmonary fibrosis, we analyzed the lung of CBS-deficient mice, a murine model of severe hyperhomocysteinemia. The degree of lung injury was assessed by histologic examination. Analysis of profibrogenic factors was performed by real-time quantitative reverse transcription-polymerase chain reaction. CBS-deficient mice develop fibrosis and air space enlargement in the lung, concomitant with an enhanced expression of heme oxygenase-1, pro(alpha)1 collagen type I, transforming growth factor-beta1 and alpha-smooth muscle actin. However, lung fibrosis was found in the absence of increased inflammatory cell infiltrates as determined by histology, without changes in gene expression of proinflammatory cytokines TNFalpha and interleukin 6. The increased expression of alpha-smooth muscle actin and transforming growth factor-beta1 emphasizes the role of myofibroblasts differentiation in case of lung fibrosis due to CBS deficiency in mice.

Characterization and evolutionary analysis of ent-kaurene synthase like genes from the wild rice species Oryza rufipogon.

Science.gov (United States)

Toyomasu, Tomonobu; Miyamoto, Koji; Shenton, Matthew R; Sakai, Arisa; Sugawara, Chizu; Horie, Kiyotaka; Kawaide, Hiroshi; Hasegawa, Morifumi; Chuba, Masaru; Mitsuhashi, Wataru; Yamane, Hisakazu; Kurata, Nori; Okada, Kazunori

2016-11-18

Cultivated rice (Oryza sativa) possesses various labdane-related diterpene synthase genes, homologs of ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS) that are responsible for the biosynthesis of phytohormone gibberellins. The CPS homologs and KS like (KSL) homologs successively converted geranylgeranyl diphosphate to cyclic diterpene hydrocarbons via ent-copalyl diphosphate or syn-copalyl diphosphate in O. sativa. Consequently, a variety of labdane-related diterpenoids, including phytoalexin phytocassanes, momilactones and oryzalexins, have been identified from cultivated rice. Our previous report indicated that the biosynthesis of phytocassanes and momilactones is conserved in Oryza rufipogon, the progenitor of Asian cultivated rice. Moreover, their biosynthetic gene clusters, containing OsCPS2 and OsKSL7 for phytocassane biosynthesis and OsCPS4 and OsKSL4 for momilactone biosynthesis, are also present in the O. rufipogon genome. We herein characterized O. rufipogon homologs of OsKSL5, OsKSL6, OsKSL8 responsible for oryzalexin S biosynthesis, and OsKSL10 responsible for oryzalexins A-F biosynthesis, to obtain more evolutionary insight into diterpenoid biosynthesis in O. sativa. Our phytoalexin analyses showed that no accumulation of oryzalexins was detected in extracts from O. rufipogon leaf blades. In vitro functional analyses indicated that unlike OsKSL10, O. rufipogon KSL10 functions as an ent-miltiradiene synthase, which explains the lack of accumulation of oryzalexins A-F in O. rufipogon. The different functions of KSL5 and KSL8 in O. sativa japonica to those in indica are conserved in each type of O. rufipogon, while KSL6 functions (ent-isokaurene synthases) are well conserved. Our study suggests that O. sativa japonica has evolved distinct specialized diterpenoid metabolism, including the biosynthesis of oryzalexins. Copyright © 2016 Elsevier Inc. All rights reserved.

Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

Science.gov (United States)

Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

2015-09-01

In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

Cloning and Functional Characterization of a Gene for Capsanthin-Capsorubin Synthase from Tiger Lily (Lilium lancifolium Thunb. ‘Splendens’)

OpenAIRE

Jeknić, Zoran; Morré, Jeffrey T.; Jeknić, Stevan; Jevremović, Slađana; Subotić, Angelina; Chen, Tony H.H.

2012-01-01

The orange color of tiger lily (Lolium lancifolium ‘Splendens’) flowers is due, primarily, to the accumulation of two κ-xanthophylls, capsanthin and capsorubin. An enzyme, known as capsanthin-capsorubin synthase (CCS), catalyzes the conversion of antheraxanthin and violaxanthin into capsanthin and capsorubin, respectively. We cloned the gene for capsanthin-capsorubin synthase (Llccs) from flower tepals of L. lancifolium by the rapid amplification of cDNA ends (RACE) with a heterologous non-de...

Alkaline stress and iron deficiency regulate iron uptake and riboflavin synthesis gene expression differently in root and leaf tissue: implications for iron deficiency chlorosis.

Science.gov (United States)

Hsieh, En-Jung; Waters, Brian M

2016-10-01

Iron (Fe) is an essential mineral that has low solubility in alkaline soils, where its deficiency results in chlorosis. Whether low Fe supply and alkaline pH stress are equivalent is unclear, as they have not been treated as separate variables in molecular physiological studies. Additionally, molecular responses to these stresses have not been studied in leaf and root tissues simultaneously. We tested how plants with the Strategy I Fe uptake system respond to Fe deficiency at mildly acidic and alkaline pH by measuring root ferric chelate reductase (FCR) activity and expression of selected Fe uptake genes and riboflavin synthesis genes. Alkaline pH increased cucumber (Cucumis sativus L.) root FCR activity at full Fe supply, but alkaline stress abolished FCR response to low Fe supply. Alkaline pH or low Fe supply resulted in increased expression of Fe uptake genes, but riboflavin synthesis genes responded to Fe deficiency but not alkalinity. Iron deficiency increased expression of some common genes in roots and leaves, but alkaline stress blocked up-regulation of these genes in Fe-deficient leaves. In roots of the melon (Cucumis melo L.) fefe mutant, in which Fe uptake responses are blocked upstream of Fe uptake genes, alkaline stress or Fe deficiency up-regulation of certain Fe uptake and riboflavin synthesis genes was inhibited, indicating a central role for the FeFe protein. These results suggest a model implicating shoot-to-root signaling of Fe status to induce Fe uptake gene expression in roots. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia

DEFF Research Database (Denmark)

Costa, M C; Helweg-Larsen, J; Lundgren, Bettina

2003-01-01

The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...... mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure...

Cloning and Comparative Studies of Seaweed Trehalose-6-Phosphate Synthase Genes

Directory of Open Access Journals (Sweden)

Bin Wang

2010-07-01

Full Text Available The full-length cDNA sequence (3219 base pairs of the trehalose-6-phosphate synthase gene of Porphyra yezoensis (PyTPS was isolated byRACE-PCR and deposited in GenBank (NCBI with the accession number AY729671. PyTPS encodes a protein of 908 amino acids before a stop codon, and has a calculated molecular mass of 101,591 Daltons. The PyTPS protein consists of a TPS domain in the N-terminus and a putative TPP domain at the C-terminus. Homology alignment for PyTPS and the TPS proteins from bacteria, yeast and higher plants indicated that the most closely related sequences to PyTPS were those from higher plants (OsTPS and AtTPS5, whereas the most distant sequence to PyTPS was from bacteria (EcOtsAB. Based on the identified sequence of the PyTPS gene, PCR primers were designed and used to amplify the TPS genes from nine other seaweed species. Sequences of the nine obtained TPS genes were deposited in GenBank (NCBI. All 10 TPS genes encoded peptides of 908 amino acids and the sequences were highly conserved both in nucleotide composition (>94% and in amino acid composition (>96%. Unlike the TPS genes from some other plants, there was no intron in any of the 10 isolated seaweed TPS genes.

The biosynthetic origin of irregular monoterpenes in Lavandula: isolation and biochemical characterization of a novel cis-prenyl diphosphate synthase gene, lavandulyl diphosphate synthase.

Science.gov (United States)

Demissie, Zerihun A; Erland, Lauren A E; Rheault, Mark R; Mahmoud, Soheil S

2013-03-01

Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s(-1), respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering.

Bioinformatics analysis of the phytoene synthase gene in cabbage (Brassica oleracea var. capitata)

Science.gov (United States)

Sun, Bo; Jiang, Min; Xue, Shengling; Zheng, Aihong; Zhang, Fen; Tang, Haoru

2018-04-01

Phytoene Synthase (PSY) is an important enzyme in carotenoid biosynthesis. Here, the Brassica oleracea var. capitata PSY (BocPSY) gene sequences were obtained from Brassica database (BRAD), and preformed for bioinformatics analysis. The BocPSY1, BocPSY2 and BocPSY3 genes mapped to chromosomes 2,3 and 9, and contains an open reading frame of 1,248 bp, 1,266 bp and 1,275 bp that encodes a 415, 421, 424 amino acid protein, respectively. Subcellular localization predicted all BocPSY genes were in the chloroplast. The conserved domain of the BocPSY protein is PLN02632. Homology analysis indicates that the levels of identity among BocPSYs were all more than 85%, and the PSY protein is apparently conserved during plant evolution. The findings of the present study provide a molecular basis for the elucidation of PSY gene function in cabbage.

Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.

Science.gov (United States)

Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey

2015-12-01

Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

Science.gov (United States)

Noar, Roslyn D; Daub, Margaret E

2016-01-01

Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

Directory of Open Access Journals (Sweden)

Roslyn D Noar

Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that

TIMP-1 gene deficiency increases tumour cell sensitivity to chemotherapy-induced apoptosis

DEFF Research Database (Denmark)

Davidsen, Marie Louise; Würts, S.Ø.; Rømer, Maria Unni Koefoed

2006-01-01

deficiency increases the response to chemotherapy considerably, confirming that TIMP-1 protects the cells from apoptosis. This is to our knowledge the first study investigating TIMP-1 and chemotherapy-induced apoptosis employing a powerful model system comprising TIMP-1 gene-deficient cells...... this hypothesis, we have established TIMP-1 gene-deficient and TIMP-1 wild-type fibrosarcoma cells from mouse lung tissue. We have characterised these cells with regard to TIMP-1 genotype, TIMP-1 expression, malignant transformation and sensitivity to chemotherapy-induced apoptosis. We show that TIMP-1 gene...... and their genetically identical wild-type controls. For future studies, this cell system can be used to uncover the mechanisms and signalling pathways involved in the TIMP-1-mediated inhibition of apoptosis as well as to investigate the possibility of using TIMP-1 inhibitors to optimise the effect of conventional...

The rice terpene synthase gene OsTPS19 functions as an (S)-limonene synthase in planta, and its overexpression leads to enhanced resistance to the blast fungus Magnaporthe oryzae.

Science.gov (United States)

Chen, Xujun; Chen, Hao; Yuan, Joshua S; Köllner, Tobias G; Chen, Yuying; Guo, Yufen; Zhuang, Xiaofeng; Chen, Xinlu; Zhang, Yong-Jun; Fu, Jianyu; Nebenführ, Andreas; Guo, Zejian; Chen, Feng

2018-03-06

Rice blast disease, caused by the fungus Magnaporthe oryzae, is the most devastating disease of rice. In our ongoing characterization of the defence mechanisms of rice plants against M. oryzae, a terpene synthase gene OsTPS19 was identified as a candidate defence gene. Here, we report the functional characterization of OsTPS19, which is up-regulated by M. oryzae infection. Overexpression of OsTPS19 in rice plants enhanced resistance against M. oryzae, while OsTPS19 RNAi lines were more susceptible to the pathogen. Metabolic analysis revealed that the production of a monoterpene (S)-limonene was increased and decreased in OsTPS19 overexpression and RNAi lines, respectively, suggesting that OsTPS19 functions as a limonene synthase in planta. This notion was further supported by in vitro enzyme assays with recombinant OsTPS19, in which OsTPS19 had both sesquiterpene activity and monoterpene synthase activity, with limonene as a major product. Furthermore, in a subcellular localization experiment, OsTPS19 was localized in plastids. OsTPS19 has a highly homologous paralog, OsTPS20, which likely resulted from a recent gene duplication event. We found that the variation in OsTPS19 and OsTPS20 enzyme activities was determined by a single amino acid in the active site cavity. The expression of OsTPS20 was not affected by M. oryzae infection. This indicates functional divergence of OsTPS19 and OsTPS20. Lastly, (S)-limonene inhibited the germination of M. oryzae spores in vitro. OsTPS19 was determined to function as an (S)-limonene synthase in rice and plays a role in defence against M. oryzae, at least partly, by inhibiting spore germination. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Human uroporphyrinogen III synthase: Molecular cloning, nucleotide sequence, and expression of a full-length cDNA

International Nuclear Information System (INIS)

Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J.

1988-01-01

Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 x 10 6 recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria

Identification of a Fungal 1,8-Cineole Synthase from Hypoxylon sp. with Specificity Determinants in Common with the Plant Synthases*

Science.gov (United States)

Shaw, Jeffrey J.; Berbasova, Tetyana; Sasaki, Tomoaki; Jefferson-George, Kyra; Spakowicz, Daniel J.; Dunican, Brian F.; Portero, Carolina E.; Narváez-Trujillo, Alexandra; Strobel, Scott A.

2015-01-01

Terpenes are an important and diverse class of secondary metabolites widely produced by fungi. Volatile compound screening of a fungal endophyte collection revealed a number of isolates in the family Xylariaceae, producing a series of terpene molecules, including 1,8-cineole. This compound is a commercially important component of eucalyptus oil used in pharmaceutical applications and has been explored as a potential biofuel additive. The genes that produce terpene molecules, such as 1,8-cineole, have been little explored in fungi, providing an opportunity to explore the biosynthetic origin of these compounds. Through genome sequencing of cineole-producing isolate E7406B, we were able to identify 11 new terpene synthase genes. Expressing a subset of these genes in Escherichia coli allowed identification of the hyp3 gene, responsible for 1,8-cineole biosynthesis, the first monoterpene synthase discovered in fungi. In a striking example of convergent evolution, mutational analysis of this terpene synthase revealed an active site asparagine critical for water capture and specificity during cineole synthesis, the same mechanism used in an unrelated plant homologue. These studies have provided insight into the evolutionary relationship of fungal terpene synthases to those in plants and bacteria and further established fungi as a relatively untapped source of this important and diverse class of compounds. PMID:25648891

Analysis of MaACS2, a stress-inducible ACC Synthase Gene in Musa acuminata AAA Group Cultivar Pisang Ambon

Directory of Open Access Journals (Sweden)

Resnanti Utami Handayani

2014-07-01

Full Text Available Ethylene has an important function in plant growth and development. Ethylene production generally increases in response to pathogen attacks and other environmental stress conditions. The synthesis of this phytohormone is regulated by two enzymes, ACC synthase (ACS and ACC oxidase (ACO. ACC synthase is encoded by a multigene that regulates the production of ACC, after which this precursor is converted into ethylene by ACO. Pisang Ambon (Musa sp. AAA group, a banana cultivar originating from Indonesia, has nine ACS genes (MaACS 1-9 and one ACO gene (MaACO. One of the banana ACS genes, MaACS2, is stress-inducible. In this research, we have investigated the expression profile of MaACS2 in the roots and leaf tissues of infected tissue culture plants. Quantification of gene expression was analyzed using Real-Time PCR (qPCR using Ma18srRNA and MaGAPDH as reference genes. The results showed nine-to ten fold higher MaACS2 expression levels in the infected roots tissues compared to the uninfected roots tissues. However, MaACS2 expression in the leaves was only detected in infected tissue.

Parallel evolution of the glycogen synthase 1 (muscle) gene Gys1 between Old World and New World fruit bats (Order: Chiroptera).

Science.gov (United States)

Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi

2014-10-01

Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.

Microarray analysis of pancreatic gene expression during biotin repletion in biotin-deficient rats.

Science.gov (United States)

Dakshinamurti, Krishnamurti; Bagchi, Rushita A; Abrenica, Bernard; Czubryt, Michael P

2015-12-01

Biotin is a B vitamin involved in multiple metabolic pathways. In humans, biotin deficiency is relatively rare but can cause dermatitis, alopecia, and perosis. Low biotin levels occur in individuals with type-2 diabetes, and supplementation with biotin plus chromium may improve blood sugar control. The acute effect on pancreatic gene expression of biotin repletion following chronic deficiency is unclear, therefore we induced biotin deficiency in adult male rats by feeding them a 20% raw egg white diet for 6 weeks. Animals were then randomized into 2 groups: one group received a single biotin supplement and returned to normal chow lacking egg white, while the second group remained on the depletion diet. After 1 week, pancreata were removed from biotin-deficient (BD) and biotin-repleted (BR) animals and RNA was isolated for microarray analysis. Biotin depletion altered gene expression in a manner indicative of inflammation, fibrosis, and defective pancreatic function. Conversely, biotin repletion activated numerous repair and anti-inflammatory pathways, reduced fibrotic gene expression, and induced multiple genes involved in pancreatic endocrine and exocrine function. A subset of the results was confirmed by quantitative real-time PCR analysis, as well as by treatment of pancreatic AR42J cells with biotin. The results indicate that biotin repletion, even after lengthy deficiency, results in the rapid induction of repair processes in the pancreas.

Differential accumulation of β-carotene and tissue specific expression of phytoene synthase (MaPsy) gene in banana (Musa sp) cultivars.

Science.gov (United States)

Dhandapani, R; Singh, V P; Arora, A; Bhattacharya, R C; Rajendran, Ambika

2017-12-01

An experiment was conducted with twelve major Indian banana cultivars to investigate the molecular relationship between the differential accumulation of β-carotene in peel and pulp of the banana fruit and carotenoid biosynthetic pathway genes. The high performance liquid chromatography showed that all banana cultivars accumulated two-three fold more β-carotene in non-edible portion of the banana fruit. However, Nendran , a famous orange fleshed cultivar of South India, had high β-carotene content (1362 µg/100 g) in edible pulp. The gene encoding Musa accuminata phytoene synthase ( MaPsy ) was successfully amplified using a pair of degenerate primers designed from Oncidium orchid. The deduced amino acid sequences shared a high level of identity to phytoene synthase gene from other plants. Gene expression analysis confirmed the presence of two isoforms ( MaPsy1 and MaPsy2 ) of MaPsy gene in banana fruits. Presence of two isoforms of MaPsy gene in peel and one in pulp confirmed the differential accumulation of β-carotene in banana fruits. However, Nendran accumulated more β-carotene in edible pulp due to presence of both the isoforms of MaPsy gene. Thus, carotenoid accumulation is a tissue specific process strongly dependent on differential expression pattern of two isoforms of MaPsy gene in banana.

Isolation and characterization of an oxidosqualene cyclase gene encoding a β-amyrin synthase involved in Polygala tenuifolia Willd. saponin biosynthesis.

Science.gov (United States)

Jin, Mei Lan; Lee, Dae Young; Um, Yurry; Lee, Jeong Hoon; Park, Chun Geun; Jetter, Reinhard; Kim, Ok Tae

2014-03-01

Expression of PtBS (Polygala tenuifolia β-amyrin synthase) led to the production of β-amyrin as sole product. Polygala tenuifolia Willdenow is a rich source of triterpene saponins, onjisaponins and polygalasaponins, used as herbal medicine to treat phlegms and for detumescence in traditional Asian healing. The Polygala saponins share the oleanane backbone structure and are, therefore, likely synthesized via β-amyrin as a common precursor. We hypothesized that, in analogy to diverse other plant species, this central intermediate should be formed by a β-amyrin synthase catalyzing the complex cyclization of oxidosqualene. This member of the oxidosqualene cyclase (OSC) family of enzymes is thus defining an important branch point between primary and secondary metabolisms, and playing a crucial role in the control of oleanane-type triterpene saponin biosynthesis. From P. tenuifolia roots, we isolated an OSC cDNA containing a reading frame of 2,289 bp nucleotides. The predicted protein of 763 amino acids (molecular weight 87.353 kDa) showed particularly high amino acid sequence identities to known β-amyrin synthases (85-87 %) and was, therefore, named PtBS. Expression of PtBS in the triterpenoid synthase-deficient yeast mutant GIL77 led to the production of β-amyrin as sole product. qRT-PCR analysis of various P. tenuifolia organs showed that PtBS transcript levels were highest in the roots, consistent with onjisaponin accumulation patterns. Therefore, we conclude that PtBS is the β-amyrin synthase enzyme catalyzing the first committed step in the biosynthesis of onjisaponins and polygalasaponins in P. tenuifolia.

Novel cystathionine β-synthase gene mutations in a Filipino patient with classic homocystinuria.

Science.gov (United States)

Silao, Catherine Lynn T; Fabella, Terence Diane F; Rama, Kahlil Izza D; Estrada, Sylvia C

2015-10-01

Classic homocystinuria due to cystathionine β-synthase (CBS) deficiency is an autosomal recessive disorder of sulfur metabolism. Clinical manifestations include mental retardation, dislocation of the optic lens (ectopia lentis), skeletal abnormalities and a tendency to thromboembolic episodes. We present the first mutational analysis of CBS in a Filipino patient with classic homocystinuria. Genomic DNA was extracted from peripheral blood collected from a diagnosed Filipino patient with classic homocystinuria. The entire coding region of CBS (17 exons) was amplified using polymerase chain reaction and bidirectionally sequenced using standard protocols. The patient was found to be compound heterozygous for two novel mutations, g.13995G>A [c.982G>A; p.D328K] and g.15860-15868dupGCAGGAGCT [c.1083-1091dupGCAGGAGCT; p. Q362-L364dupQEL]. Four known single-nucleotide polymorphisms (rs234706, rs1801181, rs706208 and rs706209) were also detected in the present patient's CBS. The patient was heterozygous for all the identified alleles. This is the first mutational analysis of CBS done in a Filipino patient with classic homocystinuria who presented with a novel duplication mutation and a novel missense mutation. Homocystinuria due to CBS deficiency is a heterogeneous disorder at the molecular level. © 2015 Japan Pediatric Society.

Transfer of Chinese hamster DNA repair gene(s) into repair-deficient human cells (Xeroderma pigmentosum)

International Nuclear Information System (INIS)

Karentz, D.; Cleaver, J.E.

1985-01-01

Transfer of repair genes by DNA transfection into repair-deficient Xeroderma pigmentosum (XP) cells has thus far been unsuccessful, presenting an obstacle to cloning XP genes. The authors chose an indirect route to transfer repair genes in chromosome fragments. DNA repair-competent (UV resistant) hybrid cell lines were established by PEG-mediated fusions of DNA repair-deficient (UV sensitive) human fibroblasts (XP12RO) with wild type Chinese hamster (CHO) cells (AA8). CHO cells were exposed to 5 Krad X-rays prior to fusions, predisposing hybrid cells to lose CHO chromosome fragments preferentially. Repair-competent hybrids were selected by periodic exposures to UV light. Secondary and tertiary hybrid cell lines were developed by fusion of X-irradiated hybrids to XP12RO. The hybrid cell lines exhibit resistance to UV that is comparable to that of CHO cells and they are proficient at repair replication after UV exposure. Whole cell DNA-DNA hybridizations indicate that the hybrids have greater homology to CHO DNA than is evident between XP12RO and CHO. These observations indicate that CHO DNA sequences which can function in repair of UV-damaged DNA in human cells have been transferred into the genome of the repair-deficient XP12RO cells

Gene targeted therapeutics for liver disease in alpha-1 antitrypsin deficiency.

LENUS (Irish Health Repository)

McLean, Caitriona

2009-01-01

Alpha-1 antitrypsin (A1AT) is a 52 kDa serine protease inhibitor that is synthesized in and secreted from the liver. Although it is present in all tissues in the body the present consensus is that its main role is to inhibit neutrophil elastase in the lung. A1AT deficiency occurs due to mutations of the A1AT gene that reduce serum A1AT levels to <35% of normal. The most clinically significant form of A1AT deficiency is caused by the Z mutation (Glu342Lys). ZA1AT polymerizes in the endoplasmic reticulum of liver cells and the resulting accumulation of the mutant protein can lead to liver disease, while the reduction in circulating A1AT can result in lung disease including early onset emphysema. There is currently no available treatment for the liver disease other than transplantation and therapies for the lung manifestations of the disease remain limited. Gene therapy is an evolving field which may be of use as a treatment for A1AT deficiency. As the liver disease associated with A1AT deficiency may represent a gain of function possible gene therapies for this condition include the use of ribozymes, peptide nucleic acids (PNAs) and RNA interference (RNAi), which by decreasing the amount of aberrant protein in cells may impact on the pathogenesis of the condition.

Adaptive gene regulation in the Striatum of RGS9-deficient mice.

Directory of Open Access Journals (Sweden)

Kathy Busse

Full Text Available BACKGROUND: RGS9-deficient mice show drug-induced dyskinesia but normal locomotor activity under unchallenged conditions. RESULTS: Genes related to Ca2+ signaling and their functions were regulated in RGS9-deficient mice. CONCLUSION: Changes in Ca2+ signaling that compensate for RGS9 loss-of-function can explain the normal locomotor activity in RGS9-deficient mice under unchallenged conditions. SIGNIFICANCE: Identified signaling components may represent novel targets in antidyskinetic therapy. The long splice variant of the regulator of G-protein signaling 9 (RGS9-2 is enriched in striatal medium spiny neurons and dampens dopamine D2 receptor signaling. Lack of RGS9-2 can promote while its overexpression prevents drug-induced dyskinesia. Other animal models of drug-induced dyskinesia rather pointed towards overactivity of dopamine receptor-mediated signaling. To evaluate changes in signaling pathways mRNA expression levels were determined and compared in wild-type and RGS9-deficient mice. Unexpectedly, expression levels of dopamine receptors were unchanged in RGS9-deficient mice, while several genes related to Ca2+ signaling and long-term depression were differentially expressed when compared to wild type animals. Detailed investigations at the protein level revealed hyperphosphorylation of DARPP32 at Thr34 and of ERK1/2 in striata of RGS9-deficient mice. Whole cell patch clamp recordings showed that spontaneous synaptic events are increased (frequency and size in RGS9-deficient mice while long-term depression is reduced in acute brain slices. These changes are compatible with a Ca2+-induced potentiation of dopamine receptor signaling which may contribute to the drug-induced dyskinesia in RGS9-deficient mice.

Transcriptome mining, functional characterization, and phylogeny of a large terpene synthase gene family in spruce (Picea spp.

Directory of Open Access Journals (Sweden)

Dullat Harpreet K

2011-03-01

Full Text Available Abstract Background In conifers, terpene synthases (TPSs of the gymnosperm-specific TPS-d subfamily form a diverse array of mono-, sesqui-, and diterpenoid compounds, which are components of the oleoresin secretions and volatile emissions. These compounds contribute to defence against herbivores and pathogens and perhaps also protect against abiotic stress. Results The availability of extensive transcriptome resources in the form of expressed sequence tags (ESTs and full-length cDNAs in several spruce (Picea species allowed us to estimate that a conifer genome contains at least 69 unique and transcriptionally active TPS genes. This number is comparable to the number of TPSs found in any of the sequenced and well-annotated angiosperm genomes. We functionally characterized a total of 21 spruce TPSs: 12 from Sitka spruce (P. sitchensis, 5 from white spruce (P. glauca, and 4 from hybrid white spruce (P. glauca × P. engelmannii, which included 15 monoterpene synthases, 4 sesquiterpene synthases, and 2 diterpene synthases. Conclusions The functional diversity of these characterized TPSs parallels the diversity of terpenoids found in the oleoresin and volatile emissions of Sitka spruce and provides a context for understanding this chemical diversity at the molecular and mechanistic levels. The comparative characterization of Sitka spruce and Norway spruce diterpene synthases revealed the natural occurrence of TPS sequence variants between closely related spruce species, confirming a previous prediction from site-directed mutagenesis and modelling.

Gene therapy for adenosine deaminase-deficient severe combined immune deficiency: clinical comparison of retroviral vectors and treatment plans.

Science.gov (United States)

Candotti, Fabio; Shaw, Kit L; Muul, Linda; Carbonaro, Denise; Sokolic, Robert; Choi, Christopher; Schurman, Shepherd H; Garabedian, Elizabeth; Kesserwan, Chimene; Jagadeesh, G Jayashree; Fu, Pei-Yu; Gschweng, Eric; Cooper, Aaron; Tisdale, John F; Weinberg, Kenneth I; Crooks, Gay M; Kapoor, Neena; Shah, Ami; Abdel-Azim, Hisham; Yu, Xiao-Jin; Smogorzewska, Monika; Wayne, Alan S; Rosenblatt, Howard M; Davis, Carla M; Hanson, Celine; Rishi, Radha G; Wang, Xiaoyan; Gjertson, David; Yang, Otto O; Balamurugan, Arumugam; Bauer, Gerhard; Ireland, Joanna A; Engel, Barbara C; Podsakoff, Gregory M; Hershfield, Michael S; Blaese, R Michael; Parkman, Robertson; Kohn, Donald B

2012-11-01

We conducted a gene therapy trial in 10 patients with adenosine deaminase (ADA)-deficient severe combined immunodeficiency using 2 slightly different retroviral vectors for the transduction of patients' bone marrow CD34(+) cells. Four subjects were treated without pretransplantation cytoreduction and remained on ADA enzyme-replacement therapy (ERT) throughout the procedure. Only transient (months), low-level (< 0.01%) gene marking was observed in PBMCs of 2 older subjects (15 and 20 years of age), whereas some gene marking of PBMC has persisted for the past 9 years in 2 younger subjects (4 and 6 years). Six additional subjects were treated using the same gene transfer protocol, but after withdrawal of ERT and administration of low-dose busulfan (65-90 mg/m(2)). Three of these remain well, off ERT (5, 4, and 3 years postprocedure), with gene marking in PBMC of 1%-10%, and ADA enzyme expression in PBMC near or in the normal range. Two subjects were restarted on ERT because of poor gene marking and immune recovery, and one had a subsequent allogeneic hematopoietic stem cell transplantation. These studies directly demonstrate the importance of providing nonmyeloablative pretransplantation conditioning to achieve therapeutic benefits with gene therapy for ADA-deficient severe combined immunodeficiency.

Gene therapy for adenosine deaminase–deficient severe combined immune deficiency: clinical comparison of retroviral vectors and treatment plans

Science.gov (United States)

Candotti, Fabio; Shaw, Kit L.; Muul, Linda; Carbonaro, Denise; Sokolic, Robert; Choi, Christopher; Schurman, Shepherd H.; Garabedian, Elizabeth; Kesserwan, Chimene; Jagadeesh, G. Jayashree; Fu, Pei-Yu; Gschweng, Eric; Cooper, Aaron; Tisdale, John F.; Weinberg, Kenneth I.; Crooks, Gay M.; Kapoor, Neena; Shah, Ami; Abdel-Azim, Hisham; Yu, Xiao-Jin; Smogorzewska, Monika; Wayne, Alan S.; Rosenblatt, Howard M.; Davis, Carla M.; Hanson, Celine; Rishi, Radha G.; Wang, Xiaoyan; Gjertson, David; Yang, Otto O.; Balamurugan, Arumugam; Bauer, Gerhard; Ireland, Joanna A.; Engel, Barbara C.; Podsakoff, Gregory M.; Hershfield, Michael S.; Blaese, R. Michael; Parkman, Robertson

2012-01-01

We conducted a gene therapy trial in 10 patients with adenosine deaminase (ADA)–deficient severe combined immunodeficiency using 2 slightly different retroviral vectors for the transduction of patients' bone marrow CD34+ cells. Four subjects were treated without pretransplantation cytoreduction and remained on ADA enzyme-replacement therapy (ERT) throughout the procedure. Only transient (months), low-level (< 0.01%) gene marking was observed in PBMCs of 2 older subjects (15 and 20 years of age), whereas some gene marking of PBMC has persisted for the past 9 years in 2 younger subjects (4 and 6 years). Six additional subjects were treated using the same gene transfer protocol, but after withdrawal of ERT and administration of low-dose busulfan (65-90 mg/m2). Three of these remain well, off ERT (5, 4, and 3 years postprocedure), with gene marking in PBMC of 1%-10%, and ADA enzyme expression in PBMC near or in the normal range. Two subjects were restarted on ERT because of poor gene marking and immune recovery, and one had a subsequent allogeneic hematopoietic stem cell transplantation. These studies directly demonstrate the importance of providing nonmyeloablative pretransplantation conditioning to achieve therapeutic benefits with gene therapy for ADA-deficient severe combined immunodeficiency. PMID:22968453

Cloning and characterization of novel methylsalicylic acid synthase gene involved in the biosynthesis of isoasperlactone and asperlactone in Aspergillus westerdijkiae

International Nuclear Information System (INIS)

Bacha, N.; Dao, H.P.; Mathieu, F.; Liboz, T.; Lebrihi, A.; Atoui, A.; O'Callaghan, J.; Dobson, A.D.W.; Puel, O.

2008-01-01

Aspergillus westerdijkiae is the main producer of several biologically active polyketide metabolites including isoasperlactone and asperlactone. A 5298 bp polyketide synthase gene ''aomsas'' has been cloned in Aspergillus westerdijkiae by using gene walking approach and RACE-PCR. The predicted amino acid sequence of aomsas shows an identity of 40-56% with different methylsalicylic acid synthase genes found in Byssochlamys nivea, P. patulum, A. terreus and Streptomyces viridochromogenes. Based on the reverse transcription PCR and kinetic secondary metabolites production studies, aomsas expression was found to be associated with the biosynthesis of isoasperlactone and asperlactone. Moreover an aomsas knockout mutant ''aomsas'' of A. westerdijkiae, not only lost the capacity to produce isoasperlactone and asperlactone, but also 6-methylsalicylic acid. The genetically complemented mutant aomsas restored the biosynthesis of all the missing metabolites. Chemical complementation through the addition of 6-methylsalicylic acid, aspyrone and diepoxide to growing culture of aomsas mutant revealed that these compounds play intermediate roles in the biosynthesis of asperlactone and isoasperlactone. (author)

Cloning and characterization of the Yarrowia lipolytica squalene synthase (SQS1) gene and functional complementation of the Saccharomyces cerevisiae erg9 mutation

NARCIS (Netherlands)

Merkulov, S.; Assema, van F.; Springer, J.; Carmen, del A.F.; Mooibroek, H.

2000-01-01

The squalene synthase (SQS) gene encodes a key regulatory enzyme, farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21), in sterol biosynthesis. The SQS1 gene was isolated from a subgenomic library of the industrially important yeast Yarrowia lipolytica, using PCR-generated probes. Probes were

Detection of the enzymatically-active polyhydroxyalkanoate synthase subunit gene, phaC, in cyanobacteria via colony PCR.

Science.gov (United States)

Lane, Courtney E; Benton, Michael G

2015-12-01

A colony PCR-based assay was developed to rapidly determine if a cyanobacterium of interest contains the requisite genetic material, the PHA synthase PhaC subunit, to produce polyhydroxyalkanoates (PHAs). The test is both high throughput and robust, owing to an extensive sequence analysis of cyanobacteria PHA synthases. The assay uses a single detection primer set and a single reaction condition across multiple cyanobacteria strains to produce an easily detectable positive result - amplification via PCR as evidenced by a band in electrophoresis. In order to demonstrate the potential of the presence of phaC as an indicator of a cyanobacteria's PHA accumulation capabilities, the ability to produce PHA was assessed for five cyanobacteria with a traditional in vivo PHA granule staining using an oxazine dye. The confirmed in vivo staining results were then compared to the PCR-based assay results and found to be in agreement. The colony PCR assay was capable of successfully detecting the phaC gene in all six of the diverse cyanobacteria tested which possessed the gene, while exhibiting no undesired product formation across the nine total cyanobacteria strains tested. The colony PCR quick prep provides sufficient usable DNA template such that this assay could be readily expanded to assess multiple genes of interest simultaneously. Copyright © 2015 Elsevier Ltd. All rights reserved.

Homospermidine synthase, the first pathway-specific enzyme of pyrrolizidine alkaloid biosynthesis, evolved from deoxyhypusine synthase

Science.gov (United States)

Ober, Dietrich; Hartmann, Thomas

1999-01-01

Pyrrolizidine alkaloids are preformed plant defense compounds with sporadic phylogenetic distribution. They are thought to have evolved in response to the selective pressure of herbivory. The first pathway-specific intermediate of these alkaloids is the rare polyamine homospermidine, which is synthesized by homospermidine synthase (HSS). The HSS gene from Senecio vernalis was cloned and shown to be derived from the deoxyhypusine synthase (DHS) gene, which is highly conserved among all eukaryotes and archaebacteria. DHS catalyzes the first step in the activation of translation initiation factor 5A (eIF5A), which is essential for eukaryotic cell proliferation and which acts as a cofactor of the HIV-1 Rev regulatory protein. Sequence comparison provides direct evidence for the evolutionary recruitment of an essential gene of primary metabolism (DHS) for the origin of the committing step (HSS) in the biosynthesis of pyrrolizidine alkaloids. PMID:10611289

A Polyketide Synthase Encoded by the Gene An15g07920 Is Involved in the Biosynthesis of Ochratoxin A in Aspergillus niger.

Science.gov (United States)

Zhang, Jian; Zhu, Liuyang; Chen, Haoyu; Li, Min; Zhu, Xiaojuan; Gao, Qiang; Wang, Depei; Zhang, Ying

2016-12-28

The polyketide synthase gene An15g07920 was known in Aspergillus niger CBS 513.88 as putatively involved in the production of ochratoxin A (OTA). Genome resequencing analysis revealed that the gene An15g07920 is also present in the ochratoxin-producing A. niger strain 1062. Disruption of An15g07920 in A. niger 1062 removed its capacity to biosynthesize ochratoxin β (OTβ), ochratoxin α (OTα), and OTA. These results indicate that the polyketide synthase encoded by An15g07920 is a crucial player in the biosynthesis of OTA, in the pathway prior to the phenylalanine ligation step. The gene An15g07920 reached its maximum transcription level before OTA accumulation reached its highest level, confirming that gene transcription precedes OTA production. These findings will not only help explain the mechanism of OTA production in A. niger but also provide necessary information for the development of effective diagnostic, preventive, and control strategies to reduce the risk of OTA contamination in foods.

Amplification and diversity analysis of keto synthase domains of putative polyketide synthase genes in Aspergillus ochraceus and Aspergillus carbonarius producers of ochratoxin A

International Nuclear Information System (INIS)

Atoui, A.; Phong Dao, H.; Mathieu, F.; Lebrihi, A.

2006-01-01

The diversity of polyketide synthase (PKS) genes in Aspergillus ochraceus NRRL 3174 and Aspergil- lus carbonarius 2Mu134 has been investigated using different primer pairs previously developed for the ketosynthase (KS) domain of fungal PKSs. Nine different KS domain sequences in A. ochraceus NRRL 3174 as well as five different KS domain sequences in A. carbonarius 2Mu134 have been identified. The identified KS fragments were distributed in five different clusters on the phylogenetic tree, indicating that they most probably represent PKSs responsible for different functions. (author)

Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger

Energy Technology Data Exchange (ETDEWEB)

Rinker, Torri E.; Baker, Scott E.

2007-01-29

Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.

Synergistic effect of factor VII gene polymorphisms causing mild factor VII deficiency in a case of severe factor X deficiency.

Science.gov (United States)

Deshpande, Rutuja; Ghosh, Kanjaksha; Shetty, Shrimati

2017-01-01

Congenital combined deficiency of coagulation factors VII and X are mainly attributed to large deletions involving both the genes in chromosome 13 or occasionally due to the coincidental occurrence of independently occurring mutations. We report the molecular basis of congenital combined deficiency of factors VII and X in a 6-year-old female child. Direct DNA sequencing of both factor VII (F7) and factor X (F10) genes showed a novel homozygous missense mutation p.Cys90Tyr (c.307G>A) in exon 4 of F10. No mutations were detected in F7; however, the patient was homozygous for three polymorphic alleles known to be associated with reduced factor VII levels. The present case illustrates the synergistic effect of multiple polymorphisms resulting in phenotypic factor VII deficiency in the absence of a pathogenic mutation.

Gene targeted therapeutics for liver disease in alpha-1 antitrypsin deficiency

Directory of Open Access Journals (Sweden)

Caitriona McLean

2009-01-01

Full Text Available Caitriona McLean*, Catherine M Greene*, Noel G McElvaneyRespiratory Research Division, Dept. Medicine, Royal College of Surgeons in Ireland, Education and Research Centre, Beaumont Hospital, Dublin 9, Ireland; *Each of these authors contributed equally to this workAbstract: Alpha-1 antitrypsin (A1AT is a 52 kDa serine protease inhibitor that is synthesized in and secreted from the liver. Although it is present in all tissues in the body the present consensus is that its main role is to inhibit neutrophil elastase in the lung. A1AT deficiency occurs due to mutations of the A1AT gene that reduce serum A1AT levels to <35% of normal. The most clinically significant form of A1AT deficiency is caused by the Z mutation (Glu342Lys. ZA1AT polymerizes in the endoplasmic reticulum of liver cells and the resulting accumulation of the mutant protein can lead to liver disease, while the reduction in circulating A1AT can result in lung disease including early onset emphysema. There is currently no available treatment for the liver disease other than transplantation and therapies for the lung manifestations of the disease remain limited. Gene therapy is an evolving field which may be of use as a treatment for A1AT deficiency. As the liver disease associated with A1AT deficiency may represent a gain of function possible gene therapies for this condition include the use of ribozymes, peptide nucleic acids (PNAs and RNA interference (RNAi, which by decreasing the amount of aberrant protein in cells may impact on the pathogenesis of the condition.Keywords: alpha-1 antitrypsin deficiency, siRNA, peptide nucleic acid, ribozymes

Endothelial nitric oxide synthase gene haplotypes and diabetic nephropathy among Asian Indians

DEFF Research Database (Denmark)

Ahluwalia, Tarun Veer Singh; Ahuja, Monica; Rai, Taranjit Singh

2008-01-01

of the constitutive endothelial nitric oxide synthase gene (eNOS) polymorphisms with type 2 diabetic nephropathy. We genotyped three polymorphisms of eNOS (Two SNPs: -786T > C, 894G > T and one 27-bp repeat polymorphism in Intron 4 (27VNTR)) in type 2 diabetic nephropathy patients (cases: n = 195) and type 2 diabetic...... without nephropathy (controls: n = 255), using validated PCR-RFLP assays. We measured serum NO levels in these subjects and examined its correlation with diabetic nephropathy and eNOS genotypes. The frequency of CC (-786T > C), TT (894G > T) and aa genotypes (27VNTR) were significantly higher in diabetic...

Genome-wide identification, classification and expression profiling of nicotianamine synthase (NAS) gene family in maize

OpenAIRE

Zhou, Xiaojin; Li, Suzhen; Zhao, Qianqian; Liu, Xiaoqing; Zhang, Shaojun; Sun, Cheng; Fan, Yunliu; Zhang, Chunyi; Chen, Rumei

2013-01-01

Background Nicotianamine (NA), a ubiquitous molecule in plants, is an important metal ion chelator and the main precursor for phytosiderophores biosynthesis. Considerable progress has been achieved in cloning and characterizing the functions of nicotianamine synthase (NAS) in plants including barley, Arabidopsis and rice. Maize is not only an important cereal crop, but also a model plant for genetics and evolutionary study. The genome sequencing of maize was completed, and many gene families ...

Overexpression of the homologous lanosterol synthase gene in ganoderic acid biosynthesis in Ganoderma lingzhi.

Science.gov (United States)

Zhang, De-Huai; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei

2017-02-01

Ganoderic acids (GAs) in Ganoderma lingzhi exhibit anticancer and antimetastatic activities. GA yields can be potentially improved by manipulating G. lingzhi through genetic engineering. In this study, a putative lanosterol synthase (LS) gene was cloned and overexpressed in G. lingzhi. Results showed that its overexpression (OE) increased the ganoderic acid (GA) content and the accumulation of lanosterol and ergosterol in a submerged G. lingzhi culture. The maximum contents of GA-O, GA-Mk, GA-T, GA-S, GA-Mf, and GA-Me in transgenic strains were 46.6 ± 4.8, 24.3 ± 3.5, 69.8 ± 8.2, 28.9 ± 1.4, 15.4 ± 1.2, and 26.7 ± 3.1 μg/100 mg dry weight, respectively, these values being 6.1-, 2.2-, 3.2-, 4.8-, 2.0-, and 1.9-times higher than those in wild-type strains. In addition, accumulated amounts of lanosterol and ergosterol in transgenic strains were 2.3 and 1.4-fold higher than those in the control strains, respectively. The transcription level of LS was also increased by more than five times in the presence of the G. lingzhi glyceraldehyde-3-phosphate dehydrogenase gene promoter, whereas transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A enzyme and squalene synthase did not change significantly in transgenic strains. This study demonstrated that OE of the homologous LS gene can enhance lanosterol accumulation. A large precursor supply promotes GA biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.

Down regulation by a low-zinc diet in gene expression of rat prostatic thymidylate synthase and thymidine kinase

Directory of Open Access Journals (Sweden)

Sassa Shuji

2008-05-01

Full Text Available Abstract Background Zinc has a wide spectrum of biological activities and its deficiency is related to various abnormalities of cell metabolism. Methods Wistar male rats, at age of 4 weeks, were fed a low-zinc diet for six weeks. The levels of bromodeoxyuridine incorporated into the prostatic DNA and the mRNA expression levels of prostate thymidylate synthase and thymidine kinase were examined. Result The low-zinc diet caused a marked reduction in the body growth and organ weights, resulted in a low hematopoiesis, hypo-albuminemia and hypocholesterolemia. Although there were few differences in plasma biochemical markers, plasma levels of luteinizing hormone and testosterone were reduced by the low-zinc diet. Bromodeoxyuridine-immunoreactive (S-phase cells and mRNA expression levels of thymidylate synthase and thymidine kinase in the prostate cells were markedly affected by the low-zinc diet. Conclusion A low-zinc diet appears to reduce the body growth and organ weights including prostate, causing low plasma levels of luteinizing hormone and testosterone and reduction in prostate DNA replication in growing-rats.

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.

Science.gov (United States)

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-10-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.

Nitric oxide synthase, calcitonin gene-related peptide and NK-1 receptor mechanisms are involved in GTN-induced neuronal activation

DEFF Research Database (Denmark)

Ramachandran, Roshni; Bhatt, Deepak Kumar; Ploug, Kenneth Beri

2014-01-01

BACKGROUND AND AIM: Infusion of glyceryltrinitrate (GTN), a nitric oxide (NO) donor, in awake, freely moving rats closely mimics a universally accepted human model of migraine and responds to sumatriptan treatment. Here we analyse the effect of nitric oxide synthase (NOS) and calcitonin gene-rela...

Quantification of gene expression in agrostis species subjected to zinc deficiency /

OpenAIRE

Canlı, Özge; Canli, Ozge

2007-01-01

Zinc is an essential micronutrient involved in many cellular mechanisms in biologycal systems and its deficiency causes severe reductions in crop yield and human health.In this study, our goal is to identify and characterize the genes expressed in three Agrostis species; Creeping (Agrostis stolonifera), Colonial (Agrostis capillaris) and Velvet (Agrostis canina) bentgrass upon exposure to zinc deficiency using mRNA differential display method. Differentially expressed fragments were sequenced...

Mitochondrially-Encoded Adenosine Triphosphate Synthase 6 Gene Haplotype Variation among World Population during 2003-2013

OpenAIRE

Steven Steven; Yoni F Syukriani; Julius B Dewanto

2016-01-01

Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...

The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes.

Science.gov (United States)

Schneider, Lizette M; Adamski, Nikolai M; Christensen, Caspar Elo; Stuart, David B; Vautrin, Sonia; Hansson, Mats; Uauy, Cristobal; von Wettstein-Knowles, Penny

2016-03-09

Aliphatic compounds on plant surfaces, called epicuticular waxes, are the first line of defense against pathogens and pests, contribute to reducing water loss and determine other important phenotypes. Aliphatics can form crystals affecting light refraction, resulting in a color change and allowing identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase and Cer-u is a P450 enzyme. All were highly expressed in pertinent leaf sheath tissue of wild type. A physical map revealed the order Cer-c, Cer-u, Cer-q with the flanking genes 101kb apart, confirming they are a gene cluster, Cer-cqu. Homology-based modeling suggests that many of the mutant alleles affect overall protein structure or specific active site residues. The rich diversity of identified mutations will facilitate future studies of three key enzymes involved in synthesis of plant apoplast waxes. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).

Science.gov (United States)

Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes

2012-03-01

Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively). Copyright © 2011 Elsevier GmbH. All rights reserved.

Cloning and sequence analysis of sucrose phosphate synthase gene from varieties of Pennisetum species.

Science.gov (United States)

Li, H C; Lu, H B; Yang, F Y; Liu, S J; Bai, C J; Zhang, Y W

2015-03-31

Sucrose phosphate synthase (SPS) is an enzyme used by higher plants for sucrose synthesis. In this study, three primer sets were designed on the basis of known SPS sequences from maize (GenBank: NM_001112224.1) and sugarcane (GenBank: JN584485.1), and five novel SPS genes were identified by RT-PCR from the genomes of Pennisetum spp (the hybrid P. americanum x P. purpureum, P. purpureum Schum., P. purpureum Schum. cv. Red, P. purpureum Schum. cv. Taiwan, and P. purpureum Schum. cv. Mott). The cloned sequences showed 99.9% identity and 80-88% similarity to the SPS sequences of other plants. The SPS gene of hybrid Pennisetum had one nucleotide and four amino acid polymorphisms compared to the other four germplasms, and cluster analysis was performed to assess genetic diversity in this species. Additional characterization of the SPS gene product can potentially allow Pennisetum to be exploited as a biofuel source.

Loss of stearoyl-CoA desaturase 1 rescues cardiac function in obese leptin-deficient mice.

Science.gov (United States)

Dobrzyn, Pawel; Dobrzyn, Agnieszka; Miyazaki, Makoto; Ntambi, James M

2010-08-01

The heart of leptin-deficient ob/ob mice is characterized by pathologic left ventricular hypertrophy along with elevated triglyceride (TG) content, increased stearoyl-CoA desaturase (SCD) activity, and increased myocyte apoptosis. In the present study, using an ob/ob;SCD1(-/-) mouse model, we tested the hypothesis that lack of SCD1 could improve steatosis and left ventricle (LV) function in leptin deficiency. We show that disruption of the SCD1 gene improves cardiac function in ob/ob mice by correcting systolic and diastolic dysfunction without affecting levels of plasma TG and FFA. The improvement is associated with reduced expression of genes involved in FA transport and lipid synthesis in the heart, as well as reduction in cardiac FFA, diacylglycerol, TG, and ceramide levels. The rate of FA beta-oxidation is also significantly lower in the heart of ob/ob;SCD1(-/-) mice compared with ob/ob controls. Moreover, SCD1 deficiency reduces cardiac apoptosis in ob/ob mice due to increased expression of antiapoptotic factor Bcl-2 and inhibition of inducible nitric oxide synthase and caspase-3 activities. Reduction in myocardial lipid accumulation and inhibition of apoptosis appear to be one of the main mechanisms responsible for improved LV function in ob/ob mice caused by SCD1 deficiency.

Molecular cloning and expression of Chimonanthus praecox farnesyl pyrophosphate synthase gene and its possible involvement in the biosynthesis of floral volatile sesquiterpenoids.

Science.gov (United States)

Xiang, Lin; Zhao, Kaige; Chen, Longqing

2010-01-01

Farnesyl pyrophosphate (FPP) synthase catalyzes the biosynthesis of FPP, which is the precursors of sesquiterpenoids such as floral scent volatiles, from isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). cDNA encoding wintersweet (Chimonanthus praecox L.) FPP synthase was isolated by the RT-PCR and RACE methods. The deduced amino acid sequence showed a high identity to plant FPP synthases. Expression of the gene in Escherichia coli yielded FPPS activity that catalyzed the synthesis of FPP as a main product. Tissue-specific and developmental analyses of the mRNA levels of CpFPPS and volatile sesquiterpenoids levels in C. praecox flowers revealed that the FPPS may play a regulatory role in floral volatile sesquiterpenoids of wintersweet. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

Treatment of Nonclassic 11-Hydroxylase Deficiency with Ashwagandha Root

Directory of Open Access Journals (Sweden)

Daniel Powell

2017-01-01

Full Text Available An elderly woman presented with acne and male pattern alopecia, which upon diagnostic evaluation was found to be due to nonclassic 11-hydroxylase deficiency. We previously reported that Ashwagandha root ameliorates nonclassic 3-β-ol dehydrogenase and aldosterone synthase deficiencies. This is the first report of its use being associated with amelioration of nonclassic 11-hydroxylase deficiency, where its apparent effects appear to be dose-related.

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

Science.gov (United States)

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-01-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043

The polyketide synthase gene pks4 is essential for sexual development and regulates fruiting body morphology in Sordaria macrospora.

Science.gov (United States)

Schindler, Daniel; Nowrousian, Minou

2014-07-01

Filamentous ascomycetes have long been known as producers of a variety of secondary metabolites, many of which have toxic effects on other organisms. However, the role of these metabolites in the biology of the fungi that produce them remains in most cases enigmatic. A major group of fungal secondary metabolites are polyketides. They are chemically diverse, but have in common that their chemical scaffolds are synthesized by polyketide synthases (PKSs). In a previous study, we analyzed development-dependent expression of pks genes in the filamentous ascomycete Sordaria macrospora. Here, we show that a deletion mutant of the pks4 gene is sterile, producing only protoperithecia but no mature perithecia, whereas overexpression of pks4 leads to enlarged, malformed fruiting bodies. Thus, correct expression levels of pks4 are essential for wild type-like perithecia formation. The predicted PKS4 protein has a domain structure that is similar to homologs in other fungi, but conserved residues of a methyl transferase domain present in other fungi are mutated in PKS4. Expression of several developmental genes is misregulated in the pks4 mutant. Surprisingly, the development-associated app gene is not downregulated in the mutant, in contrast to all other previously studied mutants with a block at the protoperithecial stage. Our data show that the polyketide synthase gene pks4 is essential for sexual development and plays a role in regulating fruiting body morphology. Copyright © 2014 Elsevier Inc. All rights reserved.

Cyclooxygenase 2 and neuronal nitric oxide synthase expression in the renal cortex are not interdependent in states of salt deficiency

DEFF Research Database (Denmark)

Castrop, H; Kammerl, M; Mann, Birgitte

2000-01-01

Neuronal nitric oxide synthase (nNOS) and cyclooxygenase-2 (COX-2) expression in the kidney are localized to the cortical thick ascending limb of the loop of Henle (cTALH), including the macula region, and increase after salt restriction. Because of the similar localization and regulation of n...... excretion. These findings suggest that under these conditions the control of nNOS and COX-2 gene expression in the macula densa regions of the kidney cortex are not dependent on each other....

Compensatory upregulation of respiratory chain complexes III and IV in isolated deficiency of ATP synthase due to TMEM70 mutation

Czech Academy of Sciences Publication Activity Database

Karbanová-Havlíčková, Vendula; Vrbacká-Čížková, Alena; Hejzlarová, Kateřina; Nůsková, Hana; Stránecký, V.; Potocká, Andrea; Kmoch, S.; Houštěk, Josef

2012-01-01

Roč. 1817, č. 7 (2012), s. 1037-1043 ISSN 0005-2728 R&D Projects: GA MZd(CZ) NS9759; GA ČR(CZ) GAP303/11/0970; GA ČR(CZ) GD303/03/H065; GA MŠk(CZ) 1M0520 Grant - others:Univerzita Karlova(CZ) 370411 Institutional research plan: CEZ:AV0Z50110509 Keywords : ATP synthase * TMEM70 * disease * gene expression profiling * oxidative phosphorylation * mitochondrial biogenesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.624, year: 2012

Expression analysis of cell wall assembly and remodelling-related genes in Arabidopsis roots subjected to boron stress and brassinosteroid at different developmental stages

Directory of Open Access Journals (Sweden)

Rabia İşkil

2018-04-01

Full Text Available ABSTRACT Plant cell walls are affected by many biotic and abiotic stress conditions. The aim of this study is to determine the effects of 24-Epibrassinolide (EBL on some cell wall-related genes in root tissue of five- and ten-week-old Arabidopsis thaliana plants exposed to boron (B deficiency (0 µM or toxicity (3000 µM at the transcriptional level. Expressions of the genes that encode cellulose synthase (CESA1, CESA4, CESA6 and CESA8, cellulose synthase-like (CSLB5, expansin (EXPA5, EXPA8 and EXPA14 and cell wall protein (SEB1 decreased under conditions of B deficiency and toxicity. EBL treatments, in general, led the expressions of these genes to reduce significantly. Expressions of xyloglucan endotransglucosylase/hydrolase genes (XTH21 and XTH23 changed only under conditions of B toxicity. Boron stress and/or EBL treatments caused different responses in expression of pectin methylesterase (PME2 and PME41 genes. As a result of B stress, the expression levels of investigated genes changed more in roots of five-week-old plants than in roots of ten-week-old plants. Results of the present study include new findings that support the ability of BRs to increase molecular aspects of tolerance to stress in plants.

Extracellular vesicles from human liver stem cells restore argininosuccinate synthase deficiency.

Science.gov (United States)

Herrera Sanchez, Maria Beatriz; Previdi, Sara; Bruno, Stefania; Fonsato, Valentina; Deregibus, Maria Chiara; Kholia, Sharad; Petrillo, Sara; Tolosano, Emanuela; Critelli, Rossana; Spada, Marco; Romagnoli, Renato; Salizzoni, Mauro; Tetta, Ciro; Camussi, Giovanni

2017-07-27

Argininosuccinate synthase (ASS)1 is a urea cycle enzyme that catalyzes the conversion of citrulline and aspartate to argininosuccinate. Mutations in the ASS1 gene cause citrullinemia type I, a rare autosomal recessive disorder characterized by neonatal hyperammonemia, elevated citrulline levels, and early neonatal death. Treatment for this disease is currently restricted to liver transplantation; however, due to limited organ availability, substitute therapies are required. Recently, extracellular vesicles (EVs) have been reported to act as intercellular transporters carrying genetic information responsible for cell reprogramming. In previous studies, we isolated a population of stem cell-like cells known as human liver stem cells (HLSCs) from healthy liver tissue. Moreover, EVs derived from HLSCs were reported to exhibit regenerative effects on the liver parenchyma in models of acute liver injury. The aim of this study was to evaluate whether EVs derived from normal HLSCs restored ASS1 enzymatic activity and urea production in hepatocytes differentiated from HLSCs derived from a patient with type I citrullinemia. HLSCs were isolated from the liver of a patient with type I citrullinemia (ASS1-HLSCs) and characterized by fluorescence-activated cell sorting (FACS), immunofluorescence, and DNA sequencing analysis. Furthermore, their differentiation capabilities in vitro were also assessed. Hepatocytes differentiated from ASS1-HLSCs were evaluated by the production of urea and ASS enzymatic activity. EVs derived from normal HLSCs were purified by differential ultracentrifugation followed by floating density gradient. The EV content was analyzed to identify the presence of ASS1 protein, mRNA, and ASS1 gene. In order to obtain ASS1-depleted EVs, a knockdown of the ASS1 gene in HLSCs was performed followed by EV isolation from these cells. Treating ASS1-HLSCs with EVs from HLSCs restored both ASS1 activity and urea production mainly through the transfer of ASS1 enzyme

Identification, functional characterization and developmental regulation of sesquiterpene synthases from sunflower capitate glandular trichomes

Directory of Open Access Journals (Sweden)

Ro Dae-Kyun

2009-07-01

Full Text Available Abstract Background Sesquiterpene lactones are characteristic metabolites of Asteraceae (or Compositae which often display potent bioactivities and are sequestered in specialized organs such as laticifers, resin ducts, and trichomes. For characterization of sunflower sesquiterpene synthases we employed a simple method to isolate pure trichomes from anther appendages which facilitated the identification of these genes and investigation of their enzymatic functions and expression patterns during trichome development. Results Glandular trichomes of sunflower (Helianthus annuus L. were isolated, and their RNA was extracted to investigate the initial steps of sesquiterpene lactone biosynthesis. Reverse transcription-PCR experiments led to the identification of three sesquiterpene synthases. By combination of in vitro and in vivo characterization of sesquiterpene synthase gene products in Escherichia coli and Saccharomyces cerevisiae, respectively, two enzymes were identified as germacrene A synthases, the key enzymes of sesquiterpene lactone biosynthesis. Due to the very low in vitro activity, the third enzyme was expressed in vivo in yeast as a thioredoxin-fusion protein for functional characterization. In in vivo assays, it was identified as a multiproduct enzyme with the volatile sesquiterpene hydrocarbon δ-cadinene as one of the two main products with α-muuorlene, β-caryophyllene, α-humulene and α-copaene as minor products. The second main compound remained unidentified. For expression studies, glandular trichomes from the anther appendages of sunflower florets were isolated in particular developmental stages from the pre- to the post-secretory phase. All three sesquiterpene synthases were solely upregulated during the biosynthetically active stages of the trichomes. Expression in different aerial plant parts coincided with occurrence and maturity of trichomes. Young roots with root hairs showed expression of the sesquiterpene synthase genes

The effect of boron deficiency on gene expression and boron compartmentalization in sugarbeet

Science.gov (United States)

NIP5, BOR1, NIP6, and WRKY6 genes were investigated for their role in boron deficiency in sugar beet, each with a proposed role in boron use in model plant species. All genes showed evidence of polymorphism in fragment size and gene expression in the target genomic DNA and cDNA libraries, with no co...

Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean

OpenAIRE

Good, Laura Lee

2001-01-01

The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. 5.5.1.4) from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...

An (E,E)-a-farnesene synthase gene of soybean has a role in defense against nematodes and is involved in synthesizing insect-induced volatiles

Science.gov (United States)

Plant terpene synthase genes (TPSs) have roles in diverse biological processes. Here we report the functional characterization of one member of the soybean TP S gene family, which was designated GmAFS. Recombinant GmAFS produced in E.coli catalyzed the formation of a sesquiterpene (E,E)-a-farnesene....

Effects of mutations in Pneumocystis carinii dihydropteroate synthase gene on outcome of AIDS-associated P. carinii pneumonia

DEFF Research Database (Denmark)

Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, J

1999-01-01

Sulpha drugs are widely used for the treatment and long-term prophylaxis of Pneumocystis carinii pneumonia (PCP) in HIV-1-infected individuals. Sulpha resistance in many microorganisms is caused by point mutations in dihydropteroate synthase (DHPS), an enzyme that is essential for folate biosynth...... biosynthesis. We assessed whether mutations in the DHPS gene of P. carinii were associated with exposure to sulpha drugs and influenced outcome from PCP....

Genes involved in meso-diaminopimelate synthesis in Bacillus subtilis: identification of the gene encoding aspartokinase I.

Science.gov (United States)

Roten, C A; Brandt, C; Karamata, D

1991-04-01

Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.

Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

International Nuclear Information System (INIS)

Franchi, Nicola; Piccinni, Ester; Ferro, Diana; Basso, Giuseppe; Spolaore, Barbara; Santovito, Gianfranco; Ballarin, Loriano

2014-01-01

Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal

Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

Energy Technology Data Exchange (ETDEWEB)

Franchi, Nicola [Department of Biology, University of Padova, Padova (Italy); Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Piccinni, Ester [Department of Biology, University of Padova, Padova (Italy); Ferro, Diana [Department of Biology, University of Padova, Padova (Italy); Institute for Evolution and Biodiversity, Westfälische Wilhelms-Universität, Münster (Germany); Basso, Giuseppe [Department of Woman and Child Health, University of Padova, Padova (Italy); Spolaore, Barbara [CRIBI Biotechnology Centre, University of Padova, Padova (Italy); Department of Pharmaceutical and Pharmacological Sciences, University of Padova, Padova (Italy); Santovito, Gianfranco, E-mail: gianfranco.santovito@unipd.it [Department of Biology, University of Padova, Padova (Italy); Ballarin, Loriano [Department of Biology, University of Padova, Padova (Italy)

2014-07-01

Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal.

Highly divergent mitochondrial ATP synthase complexes in Tetrahymena thermophila.

Directory of Open Access Journals (Sweden)

Praveen Balabaskaran Nina

2010-07-01

Full Text Available The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1 sector catalyzes ATP synthesis, whereas the F(o sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1 and F(o sectors are highly conserved across prokaryotes and eukaryotes. Therefore, it was a surprise that genes encoding the a and b subunits as well as other components of the F(o sector were undetectable in the sequenced genomes of a variety of apicomplexan parasites. While the parasitic existence of these organisms could explain the apparent incomplete nature of ATP synthase in Apicomplexa, genes for these essential components were absent even in Tetrahymena thermophila, a free-living ciliate belonging to a sister clade of Apicomplexa, which demonstrates robust oxidative phosphorylation. This observation raises the possibility that the entire clade of Alveolata may have invented novel means to operate ATP synthase complexes. To assess this remarkable possibility, we have carried out an investigation of the ATP synthase from T. thermophila. Blue native polyacrylamide gel electrophoresis (BN-PAGE revealed the ATP synthase to be present as a large complex. Structural study based on single particle electron microscopy analysis suggested the complex to be a dimer with several unique structures including an unusually large domain on the intermembrane side of the ATP synthase and novel domains flanking the c subunit rings. The two monomers were in a parallel configuration rather than the angled configuration previously observed in other organisms. Proteomic analyses of well-resolved ATP synthase complexes from 2-D BN/BN-PAGE identified orthologs of seven canonical ATP synthase subunits, and at least 13 novel proteins that constitute subunits apparently limited to the ciliate lineage. A mitochondrially encoded protein, Ymf66, with predicted eight transmembrane domains could be a

Alpha-tryptophan synthase of Isatis tinctoria: gene cloning and expression.

Science.gov (United States)

Salvini, M; Boccardi, T M; Sani, E; Bernardi, R; Tozzi, S; Pugliesi, C; Durante, M

2008-07-01

Indole producing reaction is a crux in the regulation of metabolite flow through the pathways and the coordination of primary and secondary product biosynthesis in plants. Indole is yielded transiently from indole-3-glycerol phosphate and immediately condensed with serine to give tryptophan, by the enzyme tryptophan synthase (TS). There is evidence that plant TS, like the bacterial complex, functions as an alpha beta heteromer. In few species, e.g. maize, are known enzymes, related with the TS alpha-subunit (TSA), able to catalyse reaction producing indole, which is free to enter the secondary metabolite pathways. In this contest, we searched for TSA and TSA related genes in Isatis tinctoria, a species producing the natural blue dye indigo. The It-TSA cDNA and the full-length exons/introns genomic region were isolated. The phylogenetic analysis indicates that It-TSA is more closely related to Arabidopsis thaliana At-T14E10.210 TSA (95.7% identity at the amino acid level) with respect to A. thaliana At-T10P11.11 TSA1-like (63%), Zea mays indole-3-glycerol phosphate lyase (54%), Z. mays TSA (53%), and Z. mays indole synthase (50%). The It-TSA cDNA was also able to complement an Escherichia coli trpA mutant. To examine the involvement of It-TSA in the biosynthesis of secondary metabolism compounds, It-TSA expression was tested in seedling grown under different light conditions. Semi-quantitative RT-PCR showed an increase in the steady-state level of It-TSA mRNA, paralleled by an increase of indigo and its precursor isatan B. Our results appear to indicate an involvement for It-TSA in indigo precursor synthesis and/or tryptophan biosynthesis.

Wounding stimulates ALLENE OXIDE SYNTHASE gene and increases the level of jasmonic acid in Ipomoea nil cotyledons

Directory of Open Access Journals (Sweden)

Emilia Wilmowicz

2016-03-01

Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.

Glycogen Metabolic Genes Are Involved in Trehalose-6-Phosphate Synthase-Mediated Regulation of Pathogenicity by the Rice Blast Fungus Magnaporthe oryzae

Science.gov (United States)

Wilson, Richard A.; Wang, Zheng-Yi; Kershaw, Michael J.; Talbot, Nicholas J.

2013-01-01

The filamentous fungus Magnaporthe oryzae is the causal agent of rice blast disease. Here we show that glycogen metabolic genes play an important role in plant infection by M. oryzae. Targeted deletion of AGL1 and GPH1, which encode amyloglucosidase and glycogen phosphorylase, respectively, prevented mobilisation of glycogen stores during appressorium development and caused a significant reduction in the ability of M. oryzae to cause rice blast disease. By contrast, targeted mutation of GSN1, which encodes glycogen synthase, significantly reduced the synthesis of intracellular glycogen, but had no effect on fungal pathogenicity. We found that loss of AGL1 and GPH1 led to a reduction in expression of TPS1 and TPS3, which encode components of the trehalose-6-phosphate synthase complex, that acts as a genetic switch in M. oryzae. Tps1 responds to glucose-6-phosphate levels and the balance of NADP/NADPH to regulate virulence-associated gene expression, in association with Nmr transcriptional inhibitors. We show that deletion of the NMR3 transcriptional inhibitor gene partially restores virulence to a Δagl1Δgph1 mutant, suggesting that glycogen metabolic genes are necessary for operation of the NADPH-dependent genetic switch in M. oryzae. PMID:24098112

Folate deficiency enhances arsenic effects on expression of genes involved in epidermal differentiation in transgenic K6/ODC mouse skin

International Nuclear Information System (INIS)

Nelson, Gail M.; Ahlborn, Gene J.; Delker, Don A.; Kitchin, Kirk T.; O'Brien, Thomas G.; Chen Yan; Kohan, Michael J.; Roop, Barbara C.; Ward, William O.; Allen, James W.

2007-01-01

Chronic arsenic exposure in humans is associated with cancers of the skin, lung, bladder and other tissues. There is evidence that folate deficiency may increase susceptibility to arsenic effects, including skin lesions. K6/ODC mice develop skin tumors when exposed to 10 ppm sodium arsenite for 5 months. In the current study, K6/ODC mice maintained on either a folate deficient or folate sufficient diet were exposed to 0, 1, or 10 ppm sodium arsenite in the drinking water for 30 days. Total RNA was isolated from skin samples and gene expression analyzed using Affymetrix Mouse 430 2.0 GeneChips. Data from 24 samples, with 4 mice in each of the 6 treatment groups, were RMA normalized and analyzed by two-way ANOVA using GeneSpring TM . Top gene ontology (GO) categories for genes responding significantly to both arsenic treatment and folate deficiency include nucleotide metabolism and cell organization and biogenesis. For many of these genes, folate deficiency magnifies the response to arsenic treatment. In particular, expression of markers of epidermal differentiation, e.g., loricrin, small proline rich proteins and involucrin, was significantly reduced by arsenic in the folate sufficient animals, and reduced further or at a lower arsenic dose in the folate deficient animals. In addition, expression of a number of epidermal cell growth/proliferation genes and cellular movement genes was altered. These results indicate that arsenic disrupts the normal balance of cell proliferation and differentiation, and that folate deficiency exacerbates these effects, consistent with the view that folate deficiency is a nutritional susceptibility factor for arsenic-induced skin tumorigenesis

Genetické a funkční příčiny mitochondriálních chorob vyvolaných defekty ATP syntázy

OpenAIRE

Tauchmannová, Kateřina

2015-01-01

Disorders of ATP synthase, the key enzyme of mitochondrial energy provision belong to the most severe metabolic diseases presenting mostly as early-onset mitochondrial encephalo-cardio-myopathies. Mutations in four nuclear genes can result in isolated deficiency of ATP synthase, all sharing a similar biochemical phenotype - pronounced decrease in the content of fully assembled and functional ATP synthase complex. The thesis summarises studies on two distinct causes of ATP synthase deficiency....

Inducible nitric-oxide synthase plays a minimal role in lymphocytic choriomeningitis virus-induced, T cell-mediated protective immunity and immunopathology

DEFF Research Database (Denmark)

Bartholdy, C; Nansen, A; Christensen, Jeanette Erbo

1999-01-01

-mediated immune response was found to be unaltered in iNOS-deficient mice compared with wild-type C57BL/6 mice, and LCMV- induced general immunosuppression was equally pronounced in both strains. In vivo analysis revealed identical kinetics of virus clearance, as well as unaltered clinical severity of systemic......By using mice with a targetted disruption in the gene encoding inducible nitric-oxide synthase (iNOS), we have studied the role of nitric oxide (NO) in lymphocytic choriomeningitis virus (LCMV)-induced, T cell-mediated protective immunity and immunopathology. The afferent phase of the T cell...... LCMV infection in both strains. Concerning the outcome of intracerebral infection, no significant differences were found between iNOS-deficient and wild-type mice in the number or composition of mononuclear cells found in the cerebrospinal fluid on day 6 post-infection. Likewise, NO did not influence...

SNP in Chalcone Synthase gene is associated with variation of 6-gingerol content in contrasting landraces of Zingiber officinale.Roscoe.

Science.gov (United States)

Ghosh, Subhabrata; Mandi, Swati Sen

2015-07-25

Zingiber officinale, medicinally the most important species within Zingiber genus, contains 6-gingerol as the active principle. This compound obtained from rhizomes of Z.officinale, has immense medicinal importance and is used in various herbal drug formulations. Our record of variation in content of this active principle, viz. 6-gingerol, in land races of this drug plant collected from different locations correlated with our Gene expression studies exhibiting high Chalcone Synthase gene (Chalcone Synthase is the rate limiting enzyme of 6-gingerol biosynthesis pathway) expression in high 6-gingerol containing landraces than in the low 6-gingerol containing landraces. Sequencing of Chalcone Synthase cDNA and subsequent multiple sequence alignment revealed seven SNPs between these contrasting genotypes. Converting this nucleotide sequence to amino acid sequence, alteration of two amino acids becomes evident; one amino acid change (asparagine to serine at position 336) is associated with base change (A→G) and another change (serine to leucine at position 142) is associated with the base change (C→T). Since asparagine at position 336 is one of the critical amino acids of the catalytic triad of Chalcone Synthase enzyme, responsible for substrate binding, our study suggests that landraces with a specific amino acid change viz. Asparagine (found in high 6-gingerol containing landraces) to serine causes low 6-gingerol content. This is probably due to a weak enzyme substrate association caused by the absence of asparagine in the catalytic triad. Detailed study of this finding could also help to understand molecular mechanism associated with variation in 6-gingerol content in Z.officinale genotypes and thereby strategies for developing elite genotypes containing high 6-gingerol content. Copyright © 2015 Elsevier B.V. All rights reserved.

TREX1 deficiency triggers cell-autonomous immunity in a cGAS-dependent manner.

Science.gov (United States)

Ablasser, Andrea; Hemmerling, Inga; Schmid-Burgk, Jonathan L; Behrendt, Rayk; Roers, Axel; Hornung, Veit

2014-06-15

Cytosolic detection of DNA is crucial for the initiation of antiviral immunity but can also cause autoimmunity in the context of endogenous nucleic acids being sensed. Mutations in the human 3' repair exonuclease 1 (TREX1) have been linked to the type I IFN-associated autoimmune disease Aicardi-Goutières syndrome. The exact mechanisms driving unabated type I IFN responses in the absence of TREX1 are only partly understood, but it appears likely that accumulation of endogenous DNA species triggers a cell-autonomous immune response by activating a cytosolic DNA receptor. In this article, we demonstrate that knocking out the DNA sensor cyclic GMP-AMP synthase completely abrogates spontaneous induction of IFN-stimulated genes in TREX1-deficient cells. These findings indicate a key role of cyclic GMP-AMP synthase for the initiation of self-DNA-induced autoimmune disorders, thus providing important implications for novel therapeutic approaches. Copyright © 2014 by The American Association of Immunologists, Inc.

An aureobasidin A resistance gene isolated from Aspergillus is a homolog of yeast AUR1, a gene responsible for inositol phosphorylceramide (IPC) synthase activity.

Science.gov (United States)

Kuroda, M; Hashida-Okado, T; Yasumoto, R; Gomi, K; Kato, I; Takesako, K

1999-03-01

The AUR1 gene of Saccharomyces cerevisiae, mutations in which confer resistance to the antibiotic aureobasidin A, is necessary for inositol phosphorylceramide (IPC) synthase activity. We report the molecular cloning and characterization of the Aspergillus nidulans aurA gene, which is homologous to AUR1. A single point mutation in the aurA gene of A. nidulans confers a high level of resistance to aureobasidin A. The A. nidulans aurA gene was used to identify its homologs in other Aspergillus species, including A. fumigatus, A. niger, and A. oryzae. The deduced amino acid sequence of an aurA homolog from the pathogenic fungus A. fumigatus showed 87% identity to that of A. nidulans. The AurA proteins of A. nidulans and A. fumigatus shared common characteristics in primary structure, including sequence, hydropathy profile, and N-glycosylation sites, with their S. cerevisiae, Schizosaccharomyces pombe, and Candida albicans counterparts. These results suggest that the aureobasidin resistance gene is conserved evolutionarily in various fungi.

Cloning and expression analysis of two dehydrodolichyl diphosphate synthase genes from Tripterygium wilfordii

Directory of Open Access Journals (Sweden)

Lin-Hui Gao

2018-01-01

Full Text Available Objective: To clone and investigate two dehydrodolichyl diphosphate synthase genes of Tripterygium wilfordii by bioinformatics and tissue expression analysis. Materials and Methods: According to the T. wifordii transcriptome database, specific primers were designed to clone the TwDHDDS1 and TwDHDDS2 genes via PCR. Based on the cloned sequences, protein structure prediction, multiple sequence alignment and phylogenetic tree construction were performed. The expression levels of the genes in different tissues of T. wilfordii were measured by real-time quantitative PCR. Results: The TwDHDDS1 gene encompassed a 873 bp open reading frame (ORF and encoded a protein of 290 amino acids. The calculated molecular weight of the translated protein was about 33.46 kDa, and the theoretical isoelectric point (pI was 8.67. The TwDHDDS2 encompassed a 768 bp ORF, encoding a protein of 255 amino acids with a calculated molecular weight of about 21.19 kDa, and a theoretical isoelectric point (pI of 7.72. Plant tissue expression analysis indicated that TwDHDDS1 and TwDHDDS2 both have relatively ubiquitous expression in all sampled organ tissues, but showed the highest transcription levels in the stems. Conclusions: The results of this study provide a basis for further functional studies of TwDHDDS1 and TwDHDDS2. Most importantly, these genes are promising genetic targets for the regulation of the biosynthetic pathways of important bioactive terpenoids such as triptolide.

Clinical efficacy of gene-modified stem cells in adenosine deaminase-deficient immunodeficiency.

Science.gov (United States)

Shaw, Kit L; Garabedian, Elizabeth; Mishra, Suparna; Barman, Provaboti; Davila, Alejandra; Carbonaro, Denise; Shupien, Sally; Silvin, Christopher; Geiger, Sabine; Nowicki, Barbara; Smogorzewska, E Monika; Brown, Berkley; Wang, Xiaoyan; de Oliveira, Satiro; Choi, Yeong; Ikeda, Alan; Terrazas, Dayna; Fu, Pei-Yu; Yu, Allen; Fernandez, Beatriz Campo; Cooper, Aaron R; Engel, Barbara; Podsakoff, Greg; Balamurugan, Arumugam; Anderson, Stacie; Muul, Linda; Jagadeesh, G Jayashree; Kapoor, Neena; Tse, John; Moore, Theodore B; Purdy, Ken; Rishi, Radha; Mohan, Kathey; Skoda-Smith, Suzanne; Buchbinder, David; Abraham, Roshini S; Scharenberg, Andrew; Yang, Otto O; Cornetta, Kenneth; Gjertson, David; Hershfield, Michael; Sokolic, Rob; Candotti, Fabio; Kohn, Donald B

2017-05-01

Autologous hematopoietic stem cell transplantation (HSCT) of gene-modified cells is an alternative to enzyme replacement therapy (ERT) and allogeneic HSCT that has shown clinical benefit for adenosine deaminase-deficient (ADA-deficient) SCID when combined with reduced intensity conditioning (RIC) and ERT cessation. Clinical safety and therapeutic efficacy were evaluated in a phase II study. Ten subjects with confirmed ADA-deficient SCID and no available matched sibling or family donor were enrolled between 2009 and 2012 and received transplantation with autologous hematopoietic CD34+ cells that were modified with the human ADA cDNA (MND-ADA) γ-retroviral vector after conditioning with busulfan (90 mg/m2) and ERT cessation. Subjects were followed from 33 to 84 months at the time of data analysis. Safety of the procedure was assessed by recording the number of adverse events. Efficacy was assessed by measuring engraftment of gene-modified hematopoietic stem/progenitor cells, ADA gene expression, and immune reconstitution. With the exception of the oldest subject (15 years old at enrollment), all subjects remained off ERT with normalized peripheral blood mononuclear cell (PBMC) ADA activity, improved lymphocyte numbers, and normal proliferative responses to mitogens. Three of nine subjects were able to discontinue intravenous immunoglobulin replacement therapy. The MND-ADA vector was persistently detected in PBMCs (vector copy number [VCN] = 0.1-2.6) and granulocytes (VCN = 0.01-0.3) through the most recent visits at the time of this writing. No patient has developed a leukoproliferative disorder or other vector-related clinical complication since transplant. These results demonstrate clinical therapeutic efficacy from gene therapy for ADA-deficient SCID, with an excellent clinical safety profile. ClinicalTrials.gov NCT00794508. Food and Drug Administration Office of Orphan Product Development award, RO1 FD003005; NHLBI awards, PO1 HL73104 and Z01 HG000122; UCLA

Clinical efficacy of gene-modified stem cells in adenosine deaminase–deficient immunodeficiency

Science.gov (United States)

Shaw, Kit L.; Garabedian, Elizabeth; Mishra, Suparna; Barman, Provaboti; Davila, Alejandra; Carbonaro, Denise; Shupien, Sally; Silvin, Christopher; Geiger, Sabine; Nowicki, Barbara; Smogorzewska, E. Monika; Brown, Berkley; Wang, Xiaoyan; de Oliveira, Satiro; Choi, Yeong; Ikeda, Alan; Terrazas, Dayna; Fu, Pei-Yu; Yu, Allen; Fernandez, Beatriz Campo; Cooper, Aaron R.; Engel, Barbara; Podsakoff, Greg; Balamurugan, Arumugam; Anderson, Stacie; Muul, Linda; Jagadeesh, G. Jayashree; Kapoor, Neena; Tse, John; Moore, Theodore B.; Purdy, Ken; Rishi, Radha; Mohan, Kathey; Skoda-Smith, Suzanne; Buchbinder, David; Abraham, Roshini S.; Scharenberg, Andrew; Yang, Otto O.; Cornetta, Kenneth; Gjertson, David; Hershfield, Michael; Sokolic, Rob; Candotti, Fabio

2017-01-01

BACKGROUND. Autologous hematopoietic stem cell transplantation (HSCT) of gene-modified cells is an alternative to enzyme replacement therapy (ERT) and allogeneic HSCT that has shown clinical benefit for adenosine deaminase–deficient (ADA-deficient) SCID when combined with reduced intensity conditioning (RIC) and ERT cessation. Clinical safety and therapeutic efficacy were evaluated in a phase II study. METHODS. Ten subjects with confirmed ADA-deficient SCID and no available matched sibling or family donor were enrolled between 2009 and 2012 and received transplantation with autologous hematopoietic CD34+ cells that were modified with the human ADA cDNA (MND-ADA) γ-retroviral vector after conditioning with busulfan (90 mg/m2) and ERT cessation. Subjects were followed from 33 to 84 months at the time of data analysis. Safety of the procedure was assessed by recording the number of adverse events. Efficacy was assessed by measuring engraftment of gene-modified hematopoietic stem/progenitor cells, ADA gene expression, and immune reconstitution. RESULTS. With the exception of the oldest subject (15 years old at enrollment), all subjects remained off ERT with normalized peripheral blood mononuclear cell (PBMC) ADA activity, improved lymphocyte numbers, and normal proliferative responses to mitogens. Three of nine subjects were able to discontinue intravenous immunoglobulin replacement therapy. The MND-ADA vector was persistently detected in PBMCs (vector copy number [VCN] = 0.1–2.6) and granulocytes (VCN = 0.01–0.3) through the most recent visits at the time of this writing. No patient has developed a leukoproliferative disorder or other vector-related clinical complication since transplant. CONCLUSION. These results demonstrate clinical therapeutic efficacy from gene therapy for ADA-deficient SCID, with an excellent clinical safety profile. TRIAL REGISTRATION. ClinicalTrials.gov NCT00794508. FUNDING. Food and Drug Administration Office of Orphan Product

RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

Directory of Open Access Journals (Sweden)

Smrati Mishra

Full Text Available Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.

Endothelial Nitric Oxide Synthase Gene Polymorphism (G894T and Diabetes Mellitus (Type II among South Indians

Directory of Open Access Journals (Sweden)

T. Angeline

2011-01-01

Full Text Available The objective of the study is to find out whether the endothelial nitric oxide synthase (eNOS G894T single-nucleotide polymorphism is associated with type 2 diabetes mellitus in South Indian (Tamil population. A total number of 260 subjects comprising 100 type 2 diabetic mellitus patients and 160 healthy individuals with no documented history of diabetes were included for the study. DNA was isolated, and eNOS G894T genotyping was performed using the polymerase chain reaction followed by restriction enzyme analysis using Ban II. The genotype distribution in patients and controls were compatible with the Hardy-Weinberg expectations (P>0.05. Odds ratio indicates that the occurrence of mutant genotype (GT/TT was 7.2 times (95% CI = 4.09–12.71 more frequent in the cases than in controls. Thus, the present study demonstrates that there is an association of endothelial nitric oxide synthase gene (G894T polymorphism with diabetes mellitus among South Indians.

Isolation and expression of two polyketide synthase genes from Trichoderma harzianum 88 during mycoparasitism.

Science.gov (United States)

Yao, Lin; Tan, Chong; Song, Jinzhu; Yang, Qian; Yu, Lijie; Li, Xinling

2016-01-01

Metabolites of mycoparasitic fungal species such as Trichoderma harzianum 88 have important biological roles. In this study, two new ketoacyl synthase (KS) fragments were isolated from cultured Trichoderma harzianum 88 mycelia using degenerate primers and analysed using a phylogenetic tree. The gene fragments were determined to be present as single copies in Trichoderma harzianum 88 through southern blot analysis using digoxigenin-labelled KS gene fragments as probes. The complete sequence analysis in formation of pksT-1 (5669bp) and pksT-2 (7901bp) suggests that pksT-1 exhibited features of a non-reducing type I fungal PKS, whereas pksT-2 exhibited features of a highly reducing type I fungal PKS. Reverse transcription polymerase chain reaction indicated that the isolated genes are differentially regulated in Trichoderma harzianum 88 during challenge with three fungal plant pathogens, which suggests that they participate in the response of Trichoderma harzianum 88 to fungal plant pathogens. Furthermore, disruption of the pksT-2 encoding ketosynthase-acyltransferase domains through Agrobacterium-mediated gene transformation indicated that pksT-2 is a key factor for conidial pigmentation in Trichoderma harzianum 88. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Temporal gene expression profiling reveals CEBPD as a candidate regulator of brain disease in prosaposin deficient mice

Directory of Open Access Journals (Sweden)

Ran Huimin

2008-08-01

Full Text Available Abstract Background Prosaposin encodes, in tandem, four small acidic activator proteins (saposins with specificities for glycosphingolipid (GSL hydrolases in lysosomes. Extensive GSL storage occurs in various central nervous system regions in mammalian prosaposin deficiencies. Results Our hypomorphic prosaposin deficient mouse, PS-NA, exhibited 45% WT levels of brain saposins and showed neuropathology that included neuronal GSL storage and Purkinje cell loss. Impairment of neuronal function was observed as early as 6 wks as demonstrated by the narrow bridges tests. Temporal transcriptome microarray analyses of brain tissues were conducted with mRNA from three prosaposin deficient mouse models: PS-NA, prosaposin null (PS-/- and a V394L/V394L glucocerebrosidase mutation combined with PS-NA (4L/PS-NA. Gene expression alterations in cerebrum and cerebellum were detectable at birth preceding the neuronal deficits. Differentially expressed genes encompassed a broad spectrum of cellular functions. The number of down-regulated genes was constant, but up-regulated gene numbers increased with age. CCAAT/enhancer-binding protein delta (CEBPD was the only up-regulated transcription factor in these two brain regions of all three models. Network analyses revealed that CEBPD has functional relationships with genes in transcription, pro-inflammation, cell death, binding, myelin and transport. Conclusion These results show that: 1 Regionally specific gene expression abnormalities precede the brain histological and neuronal function changes, 2 Temporal gene expression profiles provide insights into the molecular mechanism during the GSL storage disease course, and 3 CEBPD is a candidate regulator of brain disease in prosaposin deficiency to participate in modulating disease acceleration or progression.

Cloning and sequence analysis of putative type II fatty acid synthase ...

Indian Academy of Sciences (India)

Prakash

Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. ... acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP .... Helix II plays a dominant role in the interaction ... main distinguishing features of plant ACPs in plastids and ..... synthase component; J. Biol.

Impact of neonatal iron deficiency on hippocampal DNA methylation and gene transcription in a porcine biomedical model of cognitive development.

Science.gov (United States)

Schachtschneider, Kyle M; Liu, Yingkai; Rund, Laurie A; Madsen, Ole; Johnson, Rodney W; Groenen, Martien A M; Schook, Lawrence B

2016-11-03

Iron deficiency is a common childhood micronutrient deficiency that results in altered hippocampal function and cognitive disorders. However, little is known about the mechanisms through which neonatal iron deficiency results in long lasting alterations in hippocampal gene expression and function. DNA methylation is an epigenetic mark involved in gene regulation and altered by environmental factors. In this study, hippocampal DNA methylation and gene expression were assessed via reduced representation bisulfite sequencing and RNA-seq on samples from a previous study reporting reduced hippocampal-based learning and memory in a porcine biomedical model of neonatal iron deficiency. In total 192 differentially expressed genes (DEGs) were identified between the iron deficient and control groups. GO term and pathway enrichment analysis identified DEGs associated with hypoxia, angiogenesis, increased blood brain barrier (BBB) permeability, and altered neurodevelopment and function. Of particular interest are genes previously implicated in cognitive deficits and behavioral disorders in humans and mice, including HTR2A, HTR2C, PAK3, PRSS12, and NETO1. Altered genome-wide DNA methylation was observed across 0.5 million CpG and 2.4 million non-CpG sites. In total 853 differentially methylated (DM) CpG and 99 DM non-CpG sites were identified between groups. Samples clustered by group when comparing DM non-CpG sites, suggesting high conservation of non-CpG methylation in response to neonatal environment. In total 12 DM sites were associated with 9 DEGs, including genes involved in angiogenesis, neurodevelopment, and neuronal function. Neonatal iron deficiency leads to altered hippocampal DNA methylation and gene regulation involved in hypoxia, angiogenesis, increased BBB permeability, and altered neurodevelopment and function. Together, these results provide new insights into the mechanisms through which neonatal iron deficiency results in long lasting reductions in cognitive

First discovery of two polyketide synthase genes for mitorubrinic acid and mitorubrinol yellow pigment biosynthesis and implications in virulence of Penicillium marneffei.

Directory of Open Access Journals (Sweden)

Patrick C Y Woo

Full Text Available BACKGROUND: The genome of P. marneffei, the most important thermal dimorphic fungus causing respiratory, skin and systemic mycosis in China and Southeast Asia, possesses 23 polyketide synthase (PKS genes and 2 polyketide synthase nonribosomal peptide synthase hybrid (PKS-NRPS genes, which is of high diversity compared to other thermal dimorphic pathogenic fungi. We hypothesized that the yellow pigment in the mold form of P. marneffei could also be synthesized by one or more PKS genes. METHODOLOGY/PRINCIPAL FINDINGS: All 23 PKS and 2 PKS-NRPS genes of P. marneffei were systematically knocked down. A loss of the yellow pigment was observed in the mold form of the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants. Sequence analysis showed that PKS11 and PKS12 are fungal non-reducing PKSs. Ultra high performance liquid chromatography-photodiode array detector/electrospray ionization-quadruple time of flight-mass spectrometry (MS and MS/MS analysis of the culture filtrates of wild type P. marneffei and the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants showed that the yellow pigment is composed of mitorubrinic acid and mitorubrinol. The survival of mice challenged with the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants was significantly better than those challenged with wild type P. marneffei (P<0.05. There was also statistically significant decrease in survival of pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants compared to wild type P. marneffei in both J774 and THP1 macrophages (P<0.05. CONCLUSIONS/SIGNIFICANCE: The yellow pigment of the mold form of P. marneffei is composed of mitorubrinol and mitorubrinic acid. This represents the first discovery of PKS genes responsible for mitorubrinol and mitorubrinic acid biosynthesis. pks12 and pks11 are probably responsible for sequential use in the biosynthesis of mitorubrinol and mitorubrinic acid

Geranylfarnesyl diphosphate synthase from Methanosarcina mazei: Different role, different evolution

International Nuclear Information System (INIS)

Ogawa, Takuya; Yoshimura, Tohru; Hemmi, Hisashi

2010-01-01

The gene of (all-E) geranylfarnesyl diphosphate synthase that is responsible for the biosynthesis of methanophenazine, an electron carrier utilized for methanogenesis, was cloned from a methanogenic archaeon Methanosarcina mazei Goe1. The properties of the recombinant enzyme and the results of phylogenetic analysis suggest that the enzyme is closely related to (all-E) prenyl diphosphate synthases that are responsible for the biosynthesis of respiratory quinones, rather than to the enzymes involved in the biosynthesis of archaeal membrane lipids, including (all-E) geranylfarnesyl diphosphate synthase from a thermophilic archaeon.

An update on gene therapy for the treatment of lipoprotein lipase deficiency

Directory of Open Access Journals (Sweden)

Libby AE

2014-05-01

Full Text Available Andrew E Libby, Hong Wang Division of Endocrinology, Metabolism, and Diabetes, School of Medicine, University of Colorado at Denver, Aurora, CO, USA Abstract: Lipoprotein lipase (LPL is responsible for clearance of triglyceride-rich lipoproteins from the blood. Deficiency or defects in this enzyme result in profound hypertriglyceridemia and susceptibility to chronic, life-threatening pancreatitis. Management of LPL deficiency has traditionally been restricted to palliative care and strategies to reduce the risk of pancreatitis, including severe dietary restrictions of fat. Recently, the European Commission approved the first gene therapy treatment in the West to treat this rare disease. Alipogene tiparvovec (Glybera® was granted marketing authorization in November 2012 to treat LPL deficiency in a subset of patients that are at increased risk for pancreatitis. Designed as a one-time treatment, the drug uses adeno-associated virus (AAV1 delivery of transgenic LPL to muscle in patients lacking functional enzyme. Although statistically significant reduction of serum triglycerides was initially observed in trial subjects, this effect was found to be transient, with triglyceride levels eventually rebounding to basal levels by 26 weeks in all participants. Nevertheless, despite the return of triglycerides to pretreatment levels, alipogene tiparvovec was found to have a long-term impact on postprandial chylomicron metabolism by lowering the fraction of triglyceride found in this subset of lipoproteins. Furthermore, the drug led to a clinically significant reduction in the incidence of pancreatitis in LPL-deficient patients. The regulatory approval of alipogene tiparvovec was a historic process and serves as an example of the challenges that future orphan drugs will face. Keywords: lipoprotein lipase deficiency, gene therapy, AAV, chylomicron, pancreatitis

Valencene synthase from the heartwood of Nootka cypress (Callitropsis nootkatensis) for biotechnological production of valencene.

Science.gov (United States)

Beekwilder, Jules; van Houwelingen, Adèle; Cankar, Katarina; van Dijk, Aalt D J; de Jong, René M; Stoopen, Geert; Bouwmeester, Harro; Achkar, Jihane; Sonke, Theo; Bosch, Dirk

2014-02-01

Nootkatone is one of the major terpenes in the heartwood of the Nootka cypress Callitropsis nootkatensis. It is an oxidized sesquiterpene, which has been postulated to be derived from valencene. Both valencene and nootkatone are used for flavouring citrus beverages and are considered among the most valuable terpenes used at commercial scale. Functional evaluation of putative terpene synthase genes sourced by large-scale EST sequencing from Nootka cypress wood revealed a valencene synthase gene (CnVS). CnVS expression in different tissues from the tree correlates well with nootkatone content, suggesting that CnVS represents the first dedicated gene in the nootkatone biosynthetic pathway in C. nootkatensis The gene belongs to the gymnosperm-specific TPS-d subfamily of terpenes synthases and its protein sequence has low similarity to known citrus valencene synthases. In vitro, CnVS displays high robustness under different pH and temperature regimes, potentially beneficial properties for application in different host and physiological conditions. Biotechnological production of sesquiterpenes has been shown to be feasible, but productivity of microbial strains expressing valencene synthase from Citrus is low, indicating that optimization of valencene synthase activity is needed. Indeed, expression of CnVS in Saccharomyces cerevisiae indicated potential for higher yields. In an optimized Rhodobacter sphaeroides strain, expression of CnVS increased valencene yields 14-fold to 352 mg/L, bringing production to levels with industrial potential. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Identification, Functional Characterization, and Evolution of Terpene Synthases from a Basal Dicot1[OPEN

Science.gov (United States)

Yahyaa, Mosaab; Matsuba, Yuki; Brandt, Wolfgang; Doron-Faigenboim, Adi; Bar, Einat; McClain, Alan; Davidovich-Rikanati, Rachel; Lewinsohn, Efraim; Pichersky, Eran; Ibdah, Mwafaq

2015-01-01

Bay laurel (Laurus nobilis) is an agriculturally and economically important dioecious tree in the basal dicot family Lauraceae used in food and drugs and in the cosmetics industry. Bay leaves, with their abundant monoterpenes and sesquiterpenes, are used to impart flavor and aroma to food, and have also drawn attention in recent years because of their potential pharmaceutical applications. To identify terpene synthases (TPSs) involved in the production of these volatile terpenes, we performed RNA sequencing to profile the transcriptome of L. nobilis leaves. Bioinformatic analysis led to the identification of eight TPS complementary DNAs. We characterized the enzymes encoded by three of these complementary DNAs: a monoterpene synthase that belongs to the TPS-b clade catalyzes the formation of mostly 1,8-cineole; a sesquiterpene synthase belonging to the TPS-a clade catalyzes the formation of mainly cadinenes; and a diterpene synthase of the TPS-e/f clade catalyzes the formation of geranyllinalool. Comparison of the sequences of these three TPSs indicated that the TPS-a and TPS-b clades of the TPS gene family evolved early in the evolution of the angiosperm lineage, and that geranyllinalool synthase activity is the likely ancestral function in angiosperms of genes belonging to an ancient TPS-e/f subclade that diverged from the kaurene synthase gene lineages before the split of angiosperms and gymnosperms. PMID:26157114

Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

Directory of Open Access Journals (Sweden)

Hongxia Miao

Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

Science.gov (United States)

Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

2014-01-01

Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

Functional Characterization of Sesquiterpene Synthase from Polygonum minus

Directory of Open Access Journals (Sweden)

Su-Fang Ee

2014-01-01

Full Text Available Polygonum minus is an aromatic plant, which contains high abundance of terpenoids, especially the sesquiterpenes C15H24. Sesquiterpenes were believed to contribute to the many useful biological properties in plants. This study aimed to functionally characterize a full length sesquiterpene synthase gene from P. minus. P. minus sesquiterpene synthase (PmSTS has a complete open reading frame (ORF of 1689 base pairs encoding a 562 amino acid protein. Similar to other sesquiterpene synthases, PmSTS has two large domains: the N-terminal domain and the C-terminal metal-binding domain. It also consists of three conserved motifs: the DDXXD, NSE/DTE, and RXR. A three-dimensional protein model for PmSTS built clearly distinguished the two main domains, where conserved motifs were highlighted. We also constructed a phylogenetic tree, which showed that PmSTS belongs to the angiosperm sesquiterpene synthase subfamily Tps-a. To examine the function of PmSTS, we expressed this gene in Arabidopsis thaliana. Two transgenic lines, designated as OE3 and OE7, were further characterized, both molecularly and functionally. The transgenic plants demonstrated smaller basal rosette leaves, shorter and fewer flowering stems, and fewer seeds compared to wild type plants. Gas chromatography-mass spectrometry analysis of the transgenic plants showed that PmSTS was responsible for the production of β-sesquiphellandrene.

Determination of cystathionine beta-synthase activity in human plasma by LC-MS/MS: potential use in diagnosis of CBS deficiency.

LENUS (Irish Health Repository)

Krijt, Jakub

2011-02-01

Cystathionine β-synthase (CBS) deficiency is usually confirmed by assaying the enzyme activity in cultured skin fibroblasts. We investigated whether CBS is present in human plasma and whether determination of its activity in plasma could be used for diagnostic purposes. We developed an assay to measure CBS activity in 20 μL of plasma using a stable isotope substrate - 2,3,3-(2)H serine. The activity was determined by measurement of the product of enzyme reaction, 3,3-(2)H-cystathionine, using LC-MS\\/MS. The median enzyme activity in control plasma samples was 404 nmol\\/h\\/L (range 66-1,066; n = 57). In pyridoxine nonresponsive CBS deficient patients, the median plasma activity was 0 nmol\\/ho\\/L (range 0-9; n = 26), while in pyridoxine responsive patients the median activity was 16 nmol\\/hour\\/L (range 0-358; n = 28); this overlapped with the enzyme activity from control subject. The presence of CBS in human plasma was confirmed by an in silico search of the proteome database, and was further evidenced by the activation of CBS by S-adenosyl-L-methionine and pyridoxal 5\\'-phosphate, and by configuration of the detected reaction product, 3,3-(2)H-cystathionine, which was in agreement with the previously observed CBS reaction mechanism. We hypothesize that the CBS enzyme in plasma originates from liver cells, as the plasma CBS activities in patients with elevated liver aminotransferase activities were more than 30-fold increased. In this study, we have demonstrated that CBS is present in human plasma and that its catalytic activity is detectable by LC-MS\\/MS. CBS assay in human plasma brings new possibilities in the diagnosis of pyridoxine nonresponsive CBS deficiency.

Cloning and expression of pineapple sucrose- phosphate synthase ...

African Journals Online (AJOL)

hope&shola

2010-12-06

Dec 6, 2010 ... phosphate; EDTA, ethylene diamine tetraacetic acid; Ivr, invertase; SS .... phenolics, tannins and artifacts due to differences of tissue composition ..... Banana sucrose-phosphate synthase gene expression during fruit ripening.

Molecular cloning and expression of a novel trehalose synthase gene from Enterobacter hormaechei

Directory of Open Access Journals (Sweden)

Yue Ming

2009-06-01

Full Text Available Abstract Background Trehalose synthase (TreS which converts maltose to trehalose is considered to be a potential biocatalyst for trehalose production. This enzymatic process has the advantage of simple reaction and employs an inexpensive substrate. Therefore, new TreS producing bacteria with suitable enzyme properties are expected to be isolated from extreme environment. Results Six TreS producing strains were isolated from a specimen obtained from soil of the Tibetan Plateau using degenerate PCR. A novel treS gene from Enterobacter hormaechei was amplified using thermal asymmetric interlaced PCR. The gene contained a 1626 bp open reading frame encoding 541 amino acids. The gene was expressed in Escherichia coli, and the recombinant TreS was purified and characterized. The purified TreS had a molecular mass of 65 kDa and an activity of 18.5 U/mg. The optimum temperature and pH for the converting reaction were 37°C and 6, respectively. Hg2+, Zn2+, Cu2+and SDS inhibited the enzyme activity at different levels whereas Mn2+ showed an enhancing effect by 10%. Conclusion In this study, several TreS producing strains were screened from a source of soil bacteria. The characterization of the recombinant TreS of Enterobacter hormaechei suggested its potential application. Consequently, a strategy for isolation of TreS producing strains and cloning of novel treS genes from natural sources was demonstrated.

Cost-benefit analysis of hyperphenylalaninemia due to 6-pyruvoyl-tetrahydropterin synthase (PTPS) deficiency: for consideration of expanded newborn screening in Hong Kong.

Science.gov (United States)

Lee, Hencher Han-Chih; Mak, Chloe Miu; Poon, Grace Wing-Kit; Wong, Kar-Yin; Lam, Ching-Wan

2014-06-01

To evaluate the cost-benefit of implementing an expanded newborn screening programme for hyperphenylalaninemias due to 6-pyruvoyl-tetrahydropterin synthase (PTPS) deficiency in Hong Kong. Regional public hospitals in Hong Kong providing care for cases of inborn errors of metabolism. Implementational and operational costs of a new expanded mass spectrometry-based newborn screening programme were estimated. Data on various medical expenditures for the mild and severe phenotypic subtypes were gathered from a case cohort diagnosed with PTPS deficiency from 2001 to 2009. Local incidence from a previously published study was used. Implementation and operational costs of an expanded newborn screening programme in Hong Kong were estimated at HKD 10,473,848 (USD 1,342,801) annually. Assuming a birthrate of 50,000 per year and an incidence of 1 in 29,542 live births, the medical costs and adjusted loss of workforce per year would be HKD 20,773,207 (USD 2,663,232). Overall the annual savings from implementing the programme would be HKD 9,632,750 (USD 1,234,968). Our estimates show that implementation of an expanded newborn screening programme in Hong Kong is cost-effective, with a significant annual saving for public expenditure. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

[Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

Science.gov (United States)

Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

2010-01-01

Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

Air pollution alters brain and pituitary endothelin-1 and inducible nitric oxide synthase gene expression.

Science.gov (United States)

Thomson, Errol M; Kumarathasan, Prem; Calderón-Garcidueñas, Lilian; Vincent, Renaud

2007-10-01

Recent work suggests that air pollution is a risk factor for cerebrovascular and neurodegenerative disease. Effects of inhaled pollutants on the production of vasoactive factors such as endothelin (ET) and nitric oxide (NO) in the brain may be relevant to disease pathogenesis. Inhaled pollutants increase circulating levels of ET-1 and ET-3, and the pituitary is a potential source of plasma ET, but the effects of pollutants on the expression of ET and NO synthase genes in the brain and pituitary are not known. In the present study, Fischer-344 rats were exposed by nose-only inhalation to particles (0, 5, 50mg/m3 EHC-93), ozone (0, 0.4, 0.8 ppm), or combinations of particles and ozone for 4 h. Real-time reverse transcription polymerase chain reaction was used to measure mRNA levels in the cerebral hemisphere and pituitary 0 and 24 h post-exposure. Ozone inhalation significantly increased preproET-1 but decreased preproET-3 mRNAs in the cerebral hemisphere, while increasing mRNA levels of preproET-1, preproET-3, and the ET-converting enzyme (ECE)-1 in the pituitary. Inducible NO synthase (iNOS) was initially decreased in the cerebral hemisphere after ozone inhalation, but increased 24 h post-exposure. Particles decreased tumour necrosis factor (TNF)-alpha mRNA in the cerebral hemisphere, and both particles and ozone decreased TNF-alpha mRNA in the pituitary. Our results show that ozone and particulate matter rapidly modulate the expression of genes involved in key vasoregulatory pathways in the brain and pituitary, substantiating the notion that inhaled pollutants induce cerebrovascular effects.

Functional Genomics Reveals That a Compact Terpene Synthase Gene Family Can Account for Terpene Volatile Production in Apple1[W

Science.gov (United States)

Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.

2013-01-01

Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

Relationship between single nucleotide polymorphism of glycogen synthase gene of Pacific oyster Crassostrea gigas and its glycogen content

Science.gov (United States)

Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng

2017-02-01

Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P glycogen content ( P glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.

Gene Transfer of Brain-derived Neurotrophic Factor (BDNF) Prevents Neurodegeneration Triggered by FXN Deficiency.

Science.gov (United States)

Katsu-Jiménez, Yurika; Loría, Frida; Corona, Juan Carlos; Díaz-Nido, Javier

2016-05-01

Friedreich's ataxia is a predominantly neurodegenerative disease caused by recessive mutations that produce a deficiency of frataxin (FXN). Here, we have used a herpesviral amplicon vector carrying a gene encoding for brain-derived neurotrophic factor (BDNF) to drive its overexpression in neuronal cells and test for its effect on FXN-deficient neurons both in culture and in the mouse cerebellum in vivo. Gene transfer of BDNF to primary cultures of mouse neurons prevents the apoptosis which is triggered by the knockdown of FXN gene expression. This neuroprotective effect of BDNF is also observed in vivo in a viral vector-based knockdown mouse cerebellar model. The injection of a lentiviral vector carrying a minigene encoding for a FXN-specific short hairpin ribonucleic acid (shRNA) into the mouse cerebellar cortex triggers a FXN deficit which is accompanied by significant apoptosis of granule neurons as well as loss of calbindin in Purkinje cells. These pathological changes are accompanied by a loss of motor coordination of mice as assayed by the rota-rod test. Coinjection of a herpesviral vector encoding for BDNF efficiently prevents both the development of cerebellar neuropathology and the ataxic phenotype. These data demonstrate the potential therapeutic usefulness of neurotrophins like BDNF to protect FXN-deficient neurons from degeneration.

Analysis of genetic variation of inducible nitric oxide synthase and ...

African Journals Online (AJOL)

The genetic diversity of 100 Malaysian native chickens was investigated using polymerase chain reaction-restriction fragment polymorphism (PCR-RFLP) for two candidate genes: inducible nitric oxide synthase (INOS) and natural resistance-associated macrophage protein 1 (NRAMP1). The two genes were selected ...

Analysis of acetohydroxyacid synthase1 gene in chickpea conferring resistance to imazamox herbicide.

Science.gov (United States)

Jain, Parul; Tar'an, Bunyamin

2014-11-01

Chickpea (Cicer arietinum L.) production in the Canadian prairies is challenging due to a lack of effective weed management mainly because of poor competition ability of the crop and limited registered herbicide options. Chickpea genotype with resistance to imidazolinone (IMI) herbicides has been identified. A point mutation in the acetohydroxyacid synthase1 (AHAS1) gene at C581 to T581, resulting in an amino acid substitution from Ala194 to Val194 (position 205, standardized to arabidopsis), confers the resistance to imazamox in chickpea. However, the molecular mechanism leading to the resistance is not fully understood. In many plant species, contrasting transcription levels of AHAS gene has been implicated in the resistant and susceptible genotypes in response to IMI. The objectives of this research were to compare the AHAS gene expression and AHAS enzyme activity in resistant and susceptible chickpea cultivars in response to imazamox herbicide treatment. Results from RT-qPCR indicated that there is no significant change in the transcript levels of AHAS1 between the susceptible and the resistant genotypes in response to imazamox treatment. Protein hydrophobic cluster analysis, protein-ligand docking analysis, and AHAS enzyme activity assay all indicated that the resistance to imazamox in chickpea is due to the alteration of interaction of the AHAS1 enzyme with the imazamox herbicide.

Cloning and Expression of the PHA Synthase Gene From a Locally Isolated Chromobacterium sp. USM2

Directory of Open Access Journals (Sweden)

Bhubalan, K.

2010-01-01

Full Text Available Chromobacterium sp. USM2, a locally isolated bacterium was found to synthesize poly(3-hydroxybutyrate-co-3-hydroxyvalerate, P(3HB-co-3HV copolymer with high 3HV monomer composition. The PHA synthase gene was cloned and expressed in Cupriavidus necator PHB¯4 to investigate the possibilities of incorporating other monomer. The recombinant successfully incorporated 3-hydroxyhexanoate (3HHx monomer when fed with crude palm kernel oil (CPKO as the sole carbon source. Approximately 63 ± 2 wt% of P(3HB-co-3HHx copolymer with 4 mol% of 3HHx was synthesized from 5 g/L of oil after 48 h of cultivation. In addition, P(3HB-co-3HV-co-3HHx terpolymer with 9 mol% 3HV and 4 mol% 3HHx could be synthesized with a mixture of CPKO and sodium valerate. The presence of 3HV and 3HHx monomers in the copolymer and terpolymer was further confirmed with +H-NMR analysis. This locally isolated PHA synthase has demonstrated its ability to synthesize P(3HB-co-3HHx copolymer from a readily available and renewable carbon source; CPKO, without the addition of 3HHx precursors.

Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer.

Science.gov (United States)

Zhang, Dale; Qi, Jinfeng; Yue, Jipei; Huang, Jinling; Sun, Ting; Li, Suoping; Wen, Jian-Fan; Hettenhausen, Christian; Wu, Jinsong; Wang, Lei; Zhuang, Huifu; Wu, Jianqiang; Sun, Guiling

2014-01-13

Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts.

Acute intermittent porphyria: A single-base deletion and a nonsense mutation in the human hydroxymethylbilane synthase gene, predicting truncations of the enzyme polypeptide

Energy Technology Data Exchange (ETDEWEB)

Lee, G.L.; Astrin, K.H.; Desnick, R.J. [Mount Sinai School of Medicine, New York, NY (United States)

1995-08-28

Acute intermittent porphyria (AIP) is an autosomal-dominant inborn error of metabolism that results from the half-normal activity of the third enzyme in the heme biosynthetic pathway, hydroxymethylbilane synthase (HMB-synthase). AIP is an ecogenetic condition, since the life-threatening acute attacks are precipitated by various factors, including drugs, alcohol, fasting, and certain hormones. Biochemical diagnosis is problematic, and the identification of mutations in the HMB-synthase gene provides accurate detection of presymptomatic heterozygotes, permitting avoidance of the acute precipitating factors. By direct solid-phase sequencing, two mutations causing AIP were identified, an adenine deletion at position 629 in exon 11(629delA), which alters the reading frame and predicts premature truncation of the enzyme protein after amino acid 255, and a nonsense mutation in exon 12 (R225X). These mutations were confirmed by either restriction enzyme analysis or family studies of symptomatic patients, permitting accurate presymptomatic diagnosis of affected relatives. 29 refs., 2 figs.

Methylglyoxal synthase regulates cell elongation via alterations of cellular methylglyoxal and spermidine content in Bacillus subtilis.

Science.gov (United States)

Shin, Sang-Min; Song, Sung-Hyun; Lee, Jin-Woo; Kwak, Min-Kyu; Kang, Sa-Ouk

2017-10-01

Methylglyoxal regulates cell division and differentiation through its interaction with polyamines. Loss of their biosynthesizing enzyme causes physiological impairment and cell elongation in eukaryotes. However, the reciprocal effects of methylglyoxal and polyamine production and its regulatory metabolic switches on morphological changes in prokaryotes have not been addressed. Here, Bacillus subtilis methylglyoxal synthase (mgsA) and polyamine biosynthesizing genes encoding arginine decarboxylase (SpeA), agmatinase (SpeB), and spermidine synthase (SpeE), were disrupted or overexpressed. Treatment of 0.2mM methylglyoxal and 1mM spermidine led to the elongation and shortening of B. subtilis wild-type cells to 12.38±3.21μm (P<0.05) and 3.24±0.73μm (P<0.01), respectively, compared to untreated cells (5.72±0.68μm). mgsA-deficient (mgsA - ) and -overexpressing (mgsA OE ) mutants also demonstrated cell shortening and elongation, similar to speB- and speE-deficient (speB - and speE - ) and -overexpressing (speB OE and speE OE ) mutants. Importantly, both mgsA-depleted speB OE and speE OE mutants (speB OE /mgsA - and speE OE /mgsA - ) were drastically shortened to 24.5% and 23.8% of parental speB OE and speE OE mutants, respectively. These phenotypes were associated with reciprocal alterations of mgsA and polyamine transcripts governed by the contents of methylglyoxal and spermidine, which are involved in enzymatic or genetic metabolite-control mechanisms. Additionally, biophysically detected methylglyoxal-spermidine Schiff bases did not affect morphogenesis. Taken together, the findings indicate that methylglyoxal triggers cell elongation. Furthermore, cells with methylglyoxal accumulation commonly exhibit an elongated rod-shaped morphology through upregulation of mgsA, polyamine genes, and the global regulator spx, as well as repression of the cell division and shape regulator, FtsZ. Copyright © 2017 Elsevier Ltd. All rights reserved.

Isolation of developing secondary xylem specific cellulose synthase ...

Indian Academy of Sciences (India)

The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from .... the First strand cDNA synthesis kit (Fermentas, Pittsburgh,. USA). .... ing height of the rooted cutting, girth of the stem, leaf area.

Identification, isolation and evaluation of a constitutive sucrose phosphate synthase gene promoter from tomato

International Nuclear Information System (INIS)

Naqvi, R.Z.; Mubeen, H.; Maqsood, A.; Khatoon, A.

2017-01-01

Sucrose phosphate synthase (SPS) is one of the abundantly expressed genes in plants. The promoters of SPS gene was identified, analyzed and retrieved from high throughput genomic sequence (HTGS) database. The cis-acting regulatory elements and transcription start sites of promoter were identified through different bioinformatics tools. The SPS promoter was isolated from Solanum lycopersicum and was initially cloned in TA vector (pTZ57R/T). Later on this promoter was transferred to a plant expression binary vector, pGR1 (pGRSPS) that was used for the transient GUS expression studies in various tissues of Nicotiana tabacum. SPS promoter was also cloned in plant stable expression vector pGA482 (pGASPS) and was transformed in Nicotiana tabacum through Agrobacterium-mediated transformation method. The histochemical GUS expression analysis of both transient and stable transgenic plants for this promoter indicated its functional importance in regulating gene expression in a constitutive manner. It was concluded that SPS promoter is constitutively expressed with a strength equivalent to CaMV 2X35S promoter. The promoter isolated through these studies may be effectively substituted in plant genetic engineering with other constitutive promoter for transgene expression in economically important agricultural crops. (author)

Changes in the proteomic and metabolic profiles of Beta vulgaris root tips in response to iron deficiency and resupply

Directory of Open Access Journals (Sweden)

Álvarez-Fernández Ana

2010-06-01

Full Text Available Abstract Background Plants grown under iron deficiency show different morphological, biochemical and physiological changes. These changes include, among others, the elicitation of different strategies to improve the acquisition of Fe from the rhizosphere, the adjustment of Fe homeostasis processes and a reorganization of carbohydrate metabolism. The application of modern techniques that allow the simultaneous and untargeted analysis of multiple proteins and metabolites can provide insight into multiple processes taking place in plants under Fe deficiency. The objective of this study was to characterize the changes induced in the root tip proteome and metabolome of sugar beet plants in response to Fe deficiency and resupply. Results Root tip extract proteome maps were obtained by 2-D isoelectric focusing polyacrylamide gel electrophoresis, and approximately 140 spots were detected. Iron deficiency resulted in changes in the relative amounts of 61 polypeptides, and 22 of them were identified by mass spectrometry (MS. Metabolites in root tip extracts were analyzed by gas chromatography-MS, and more than 300 metabolites were resolved. Out of 77 identified metabolites, 26 changed significantly with Fe deficiency. Iron deficiency induced increases in the relative amounts of proteins and metabolites associated to glycolysis, tri-carboxylic acid cycle and anaerobic respiration, confirming previous studies. Furthermore, a protein not present in Fe-sufficient roots, dimethyl-8-ribityllumazine (DMRL synthase, was present in high amounts in root tips from Fe-deficient sugar beet plants and gene transcript levels were higher in Fe-deficient root tips. Also, a marked increase in the relative amounts of the raffinose family of oligosaccharides (RFOs was observed in Fe-deficient plants, and a further increase in these compounds occurred upon short term Fe resupply. Conclusions The increases in DMRL synthase and in RFO sugars were the major changes induced by Fe

Glycogen synthase kinase 3β promotes liver innate immune activation by restraining AMP-activated protein kinase activation.

Science.gov (United States)

Zhou, Haoming; Wang, Han; Ni, Ming; Yue, Shi; Xia, Yongxiang; Busuttil, Ronald W; Kupiec-Weglinski, Jerzy W; Lu, Ling; Wang, Xuehao; Zhai, Yuan

2018-02-13

Glycogen synthase kinase 3β (Gsk3β [Gsk3b]) is a ubiquitously expressed kinase with distinctive functions in different types of cells. Although its roles in regulating innate immune activation and ischaemia and reperfusion injuries (IRIs) have been well documented, the underlying mechanisms remain ambiguous, in part because of the lack of cell-specific tools in vivo. We created a myeloid-specific Gsk3b knockout (KO) strain to study the function of Gsk3β in macrophages in a murine liver partial warm ischaemia model. Compared with controls, myeloid Gsk3b KO mice were protected from IRI, with diminished proinflammatory but enhanced anti-inflammatory immune responses in livers. In bone marrow-derived macrophages, Gsk3β deficiency resulted in an early reduction of Tnf gene transcription but sustained increase of Il10 gene transcription on Toll-like receptor 4 stimulation in vitro. These effects were associated with enhanced AMP-activated protein kinase (AMPK) activation, which led to an accelerated and higher level of induction of the novel innate immune negative regulator small heterodimer partner (SHP [Nr0b2]). The regulatory function of Gsk3β on AMPK activation and SHP induction was confirmed in wild-type bone marrow-derived macrophages with a Gsk3 inhibitor. Furthermore, we found that this immune regulatory mechanism was independent of Gsk3β Ser9 phosphorylation and the phosphoinositide 3-kinase-Akt signalling pathway. In vivo, myeloid Gsk3β deficiency facilitated SHP upregulation by ischaemia-reperfusion in liver macrophages. Treatment of Gsk3b KO mice with either AMPK inhibitor or SHP small interfering RNA before the onset of liver ischaemia restored liver proinflammatory immune activation and IRI in these otherwise protected hosts. Additionally, pharmacological activation of AMPK protected wild-type mice from liver IRI, with reduced proinflammatory immune activation. Inhibition of the AMPK-SHP pathway by liver ischaemia was demonstrated in tumour resection

Invertebrate Trehalose-6-Phosphate Synthase Gene: Genetic Architecture, Biochemistry, Physiological Function, and Potential Applications

Directory of Open Access Journals (Sweden)

Bin Tang

2018-01-01

Full Text Available The non-reducing disaccharide trehalose is widely distributed among various organisms. It plays a crucial role as an instant source of energy, being the major blood sugar in insects. In addition, it helps countering abiotic stresses. Trehalose synthesis in insects and other invertebrates is thought to occur via the trehalose-6-phosphate synthase (TPS and trehalose-6-phosphate phosphatase (TPP pathways. In many insects, the TPP gene has not been identified, whereas multiple TPS genes that encode proteins harboring TPS/OtsA and TPP/OtsB conserved domains have been found and cloned in the same species. The function of the TPS gene in insects and other invertebrates has not been reviewed in depth, and the available information is quite fragmented. The present review discusses the current understanding of the trehalose synthesis pathway, TPS genetic architecture, biochemistry, physiological function, and potential sensitivity to insecticides. We note the variability in the number of TPS genes in different invertebrate species, consider whether trehalose synthesis may rely only on the TPS gene, and discuss the results of in vitro TPS overexpression experiment. Tissue expression profile and developmental characteristics of the TPS gene indicate that it is important in energy production, growth and development, metamorphosis, stress recovery, chitin synthesis, insect flight, and other biological processes. We highlight the molecular and biochemical properties of insect TPS that make it a suitable target of potential pest control inhibitors. The application of trehalose synthesis inhibitors is a promising direction in insect pest control because vertebrates do not synthesize trehalose; therefore, TPS inhibitors would be relatively safe for humans and higher animals, making them ideal insecticidal agents without off-target effects.

Isolation and identification of a thermophilic strain producing trehalose synthase from geothermal water in China.

Science.gov (United States)

Zhu, Yueming; Zhang, Jun; Wei, Dongsheng; Wang, Yufan; Chen, Xiaoyun; Xing, Laijun; Li, Mingchun

2008-08-01

A slightly thermophilic strain, CBS-01, producing trehalose synthase (TreS), was isolated from geothermal water in this study. According to the phenotypic characteristics and phylogenetic analysis of the 16s rRNA gene sequence, it was identified as Meiothermus ruber. The trehalose synthase gene of Meiothermus ruber CBS-01 was cloned by polymerase chain reaction and sequenced. The TreS gene consisted of 2,895 nucleotides, which specified a 964-amino-acid protein. This novel TreS catalyzed reversible interconversion of maltose and trehalose.

Impact of neonatal iron deficiency on hippocampal DNA methylation and gene transcription in a porcine biomedical model of cognitive development

NARCIS (Netherlands)

Schachtschneider, Kyle M.; Liu, Yingkai; Rund, Laurie A.; Madsen, Ole; Johnson, Rodney W.; Groenen, Martien A.M.; Schook, Lawrence B.

2016-01-01

Background

Iron deficiency is a common childhood micronutrient deficiency that results in altered hippocampal function and cognitive disorders. However, little is known about the mechanisms through which neonatal iron deficiency results in long lasting alterations in hippocampal gene

Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome.

Science.gov (United States)

Müller, Christina A; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C A; Wellington, Elizabeth M H; Berg, Gabriele

2015-08-01

Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Likelihood analysis of the chalcone synthase genes suggests the role of positive selection in morning glories (Ipomoea).

Science.gov (United States)

Yang, Ji; Gu, Hongya; Yang, Ziheng

2004-01-01

Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoides, which are important for the pigmentation of flowers and act as attractants to pollinators. Genes encoding CHS constitute a multigene family in which the copy number varies among plant species and functional divergence appears to have occurred repeatedly. In morning glories (Ipomoea), five functional CHS genes (A-E) have been described. Phylogenetic analysis of the Ipomoea CHS gene family revealed that CHS A, B, and C experienced accelerated rates of amino acid substitution relative to CHS D and E. To examine whether the CHS genes of the morning glories underwent adaptive evolution, maximum-likelihood models of codon substitution were used to analyze the functional sequences in the Ipomoea CHS gene family. These models used the nonsynonymous/synonymous rate ratio (omega = d(N)/ d(S)) as an indicator of selective pressure and allowed the ratio to vary among lineages or sites. Likelihood ratio test suggested significant variation in selection pressure among amino acid sites, with a small proportion of them detected to be under positive selection along the branches ancestral to CHS A, B, and C. Positive Darwinian selection appears to have promoted the divergence of subfamily ABC and subfamily DE and is at least partially responsible for a rate increase following gene duplication.

Prevalence of alpha-1 antitrypsin deficiency and hereditary hemochromatosis gene mutations in Algarve, Portugal

OpenAIRE

Barreto da Silva, Marta; Gaio, Vânia; Fernandes, Aida; Mendonça, Francisco; Horta Correia, Filomena; Beleza, Álvaro; Gil, Ana Paula; Bourbon, Mafalda; Vicente, A.M.; Dias, Carlos Matias

2012-01-01

Alpha-1 antitrypsin (AAT) deficiency and hereditary hemochromatosis (HH) are two of the most fatal genetic disorders in adult life, affecting million individuals worldwide. They are often under-diagnosed conditions and diagnosis is only made when the patient is already in the advanced stages of damage. AAT deficiency results from mutations in one highly pleiomorphic gene located on chromosome 14, SERPINA 1, being Z and S mutations the most relevant clinically. These mutations will lead to an ...

Genomic Analysis of Terpene Synthase Family and Functional Characterization of Seven Sesquiterpene Synthases from Citrus sinensis

Directory of Open Access Journals (Sweden)

Berta Alquézar

2017-08-01

Full Text Available Citrus aroma and flavor, chief traits of fruit quality, are derived from their high content in essential oils of most plant tissues, including leaves, stems, flowers, and fruits. Accumulated in secretory cavities, most components of these oils are volatile terpenes. They contribute to defense against herbivores and pathogens, and perhaps also protect tissues against abiotic stress. In spite of their importance, our understanding of the physiological, biochemical, and genetic regulation of citrus terpene volatiles is still limited. The availability of the sweet orange (Citrus sinensis L. Osbeck genome sequence allowed us to characterize for the first time the terpene synthase (TPS family in a citrus type. CsTPS is one of the largest angiosperm TPS families characterized so far, formed by 95 loci from which just 55 encode for putative functional TPSs. All TPS angiosperm families, TPS-a, TPS-b, TPS-c, TPS-e/f, and TPS-g were represented in the sweet orange genome, with 28, 18, 2, 2, and 5 putative full length genes each. Additionally, sweet orange β-farnesene synthase, (Z-β-cubebene/α-copaene synthase, two β-caryophyllene synthases, and three multiproduct enzymes yielding β-cadinene/α-copaene, β-elemene, and β-cadinene/ledene/allo-aromandendrene as major products were identified, and functionally characterized via in vivo recombinant Escherichia coli assays.

Characterization of two trpE genes encoding anthranilate synthase α-subunit in Azospirillum brasilense

International Nuclear Information System (INIS)

Ge Shimei; Xie Baoen; Chen Sanfeng

2006-01-01

The previous report from our laboratory has recently identified a new trpE gene (termed trpE 2 ) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE 1 (G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE 1 (G) while these sequence features did not exist in front of trpE 2 . The β-galactosidase activity of an A. brasilense strain carrying a trpE 2 -lacZ fusion remained constant at different tryptophan concentrations, but the β-galactosidase activity of the same strain carrying a trpE 1 (G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE 1 (G) is regulated at the transcriptional level by attenuation while trpE 2 is constantly expressed. The anthranilate synthase assays with trpE 1 (G) - and trpE 2 - mutants demonstrated that TrpE 1 (G) fusion protein is feedback inhibited by tryptophan while TrpE 2 protein is not. We also found that both trpE 1 (G) and trpE 2 gene products were involved in IAA synthesis

Genome-wide identification of galactinol synthase (GolS) genes in Solanum lycopersicum and Brachypodium distachyon.

Science.gov (United States)

Filiz, Ertugrul; Ozyigit, Ibrahim Ilker; Vatansever, Recep

2015-10-01

GolS genes stand as potential candidate genes for molecular breeding and/or engineering programs in order for improving abiotic stress tolerance in plant species. In this study, a total of six galactinol synthase (GolS) genes/proteins were retrieved for Solanum lycopersicum and Brachypodium distachyon. GolS protein sequences were identified to include glyco_transf_8 (PF01501) domain structure, and to have a close molecular weight (36.40-39.59kDa) and amino acid length (318-347 aa) with a slightly acidic pI (5.35-6.40). The sub-cellular location was mainly predicted as cytoplasmic. S. lycopersicum genes located on chr 1 and 2, and included one segmental duplication while genes of B. distachyon were only on chr 1 with one tandem duplication. GolS sequences were found to have well conserved motif structures. Cis-acting analysis was performed for three abiotic stress responsive elements, including ABA responsive element (ABRE), dehydration and cold responsive elements (DRE/CRT) and low-temperature responsive element (LTRE). ABRE elements were found in all GolS genes, except for SlGolS4; DRE/CRT was not detected in any GolS genes and LTRE element found in SlGolS1 and BdGolS1 genes. AU analysis in UTR and ORF regions indicated that SlGolS and BdGolS mRNAs may have a short half-life. SlGolS3 and SlGolS4 genes may generate more stable transcripts since they included AATTAAA motif for polyadenylation signal POLASIG2. Seconder structures of SlGolS proteins were well conserved than that of BdGolS. Some structural divergences were detected in 3D structures and predicted binding sites exhibited various patterns in GolS proteins. Copyright © 2015 Elsevier Ltd. All rights reserved.

Transplantation of Gene-Edited Hepatocyte-like Cells Modestly Improves Survival of Arginase-1-Deficient Mice

Directory of Open Access Journals (Sweden)

Yuan Yan Sin

2018-03-01

Full Text Available Progress in gene editing research has been accelerated by utilizing engineered nucleases in combination with induced pluripotent stem cell (iPSC technology. Here, we report transcription activator-like effector nuclease (TALEN-mediated reincorporation of Arg1 exons 7 and 8 in iPSCs derived from arginase-1-deficient mice possessing Arg1Δ alleles lacking these terminal exons. The edited cells could be induced to differentiate into hepatocyte-like cells (iHLCs in vitro and were subsequently used for transplantation into our previously described (Sin et al., PLoS ONE 2013 tamoxifen-inducible Arg1-Cre arginase-1-deficient mouse model. While successful gene-targeted repair was achieved in iPSCs containing Arg1Δ alleles, only minimal restoration of urea cycle function could be observed in the iHLC-transplanted mice compared to control mice, and survival in this lethal model was extended by up to a week in some mice. The partially rescued phenotype may be due to inadequate regenerative capacity of arginase-1-expressing cells in the correct metabolic zones. Technical hurdles exist and will need to be overcome for gene-edited iPSC to iHLC rescue of arginase-1 deficiency, a rare urea cycle disorder.

Gene expression profiles of inducible nitric oxide synthase and cytokines in Leishmania major-infected macrophage-like RAW 264.7 cells treated with gallic acid

NARCIS (Netherlands)

Radtke, O.A.; Kiderlen, A.F.; Kayser, Oliver; Kolodziej, H

2004-01-01

The effects of gallic acid on the gene expressions of inducible nitric oxide synthase (iNOS) and the cytokines interleukin (IL)-1, IL-10, IL-12, IL-18, TNF-alpha, and interferon (IFN)-gamma were investigated by reverse-transcription polymerase chain reaction (RT-PCR). The experiments were performed

A Possible Trifunctional β-Carotene Synthase Gene Identified in the Draft Genome of Aurantiochytrium sp. Strain KH105

Directory of Open Access Journals (Sweden)

Hiroaki Iwasaka

2018-04-01

Full Text Available Labyrinthulomycetes have been regarded as a promising industrial source of xanthophylls, including astaxanthin and canthaxanthin, polyunsaturated fatty acids such as docosahexaenoic acid and docosapentaenoic acid, ω-3 oils, and terpenic hydrocarbons, such as sterols and squalene. A Thraustochytrid, Aurantiochytrium sp. KH105 produces carotenoids, including astaxanthin, with strong antioxidant activity. To gain genomic insights into this capacity, we decoded its 97-Mbp genome and characterized genes for enzymes involved in carotenoid biosynthesis. Interestingly, all carotenogenic genes, as well as other eukaryotic genes, appeared duplicated, suggesting that this strain is diploid. In addition, among the five genes involved in the pathway from geranylgeranyl pyrophosphate to astaxanthin, geranylgeranyl phytoene synthase (crtB, phytoene desaturase (crtI and lycopene cyclase (crtY were fused into single gene (crtIBY with no internal stop codons. Functionality of the trifunctional enzyme, CrtIBY, to catalyze the reaction from geranylgeranyl diphosphate to β-carotene was confirmed using a yeast assay system and mass spectrometry. Furthermore, analyses of differential gene expression showed characteristic up-regulation of carotenoid biosynthetic genes during stationary and starvation phases under these culture conditions. This suggests genetic engineering events to promote more efficient production of carotenoids. We also showed an occurrence of crtIBY in other Thraustochytrid species.

Early transcriptomic changes induced by magnesium deficiency in Arabidopsis thaliana reveal the alteration of circadian clock gene expression in roots and the triggering of abscisic acid-responsive genes.

Science.gov (United States)

Hermans, Christian; Vuylsteke, Marnik; Coppens, Frederik; Craciun, Adrian; Inzé, Dirk; Verbruggen, Nathalie

2010-07-01

*Plant growth and development ultimately depend on environmental variables such as the availability of essential minerals. Unravelling how nutrients affect gene expression will help to understand how they regulate plant growth. *This study reports the early transcriptomic response to magnesium (Mg) deprivation in Arabidopsis. Whole-genome transcriptome was studied in the roots and young mature leaves 4, 8 and 28 h after the removal of Mg from the nutrient solution. *The highest number of regulated genes was first observed in the roots. Contrary to other mineral deficiencies, Mg depletion did not induce a higher expression of annotated genes in Mg uptake. Remarkable responses include the perturbation of the central oscillator of the circadian clock in roots and the triggering of abscisic acid (ABA) signalling, with half of the up-regulated Mg genes in leaves being ABA-responsive. However, no change in ABA content was observed. *The specificity of the response of some Mg-regulated genes was challenged by studying their expression after other mineral deficiencies and environmental stresses. The possibility to develop markers for Mg incipient deficiency is discussed here.

Construction of a mouse model of factor VIII deficiency by gene targeting

Energy Technology Data Exchange (ETDEWEB)

Bi, L.; Lawler, A.; Gearhart, J. [Univ. of Pennsylvania School of Medicine, Philadelphia, PA (United States)] [and others

1994-09-01

To develop a small animal model of hemophilia A for gene therapy experiments, we set out to construct a mouse model for factor VIII deficiency by gene targeting. First, we screened a mouse liver cDNA library using a human FVIII cDNA probe. We cloned a 2.6 Kb partial mouse factor VIII cDNA which extends from 800 base pairs of the 3{prime} end of exon 14 to the 5{prime} end of exon 26. A mouse genomic library made from strain 129 was then screened to obtain genomic fragments covering the exons desired for homologous recombination. Two genomic clones were obtained, and one covering exon 15 through 22 was used for gene targeting. To make gene targeting constructs, a 5.8 Kb genomic DNA fragment covering exons 15 to 19 of the mouse FVIII gene was subcloned, and the neo expression cassette was inserted into exons 16 and 17 separately by different strategies. These two constructs were named MFVIIIC-16 and MFVIIIC-17. The constructs were linearized and transfected into strain 129 mouse ES cells by electroporation. Factor VIII gene-knockout ES cell lines were selected by G-418 and screened by genomic Southern blots. Eight exon 16 targeted cell lines and five exon 17 targeted cell lines were obtained. Three cell lines from each construct were injected into blastocysts and surgically transferred into foster mothers. Multiple chimeric mice with 70-90% hair color derived from the ES-cell genotype were seen with both constructs. Germ line transmission of the ES-cell genotype has been obtained for the MFVIIIC-16 construct, and multiple hemophilia A carrier females have been identified. Factor VIII-deficient males will be conceived soon.

Polyhydroxyalkanoate production by a novel bacterium Massilia sp. UMI-21 isolated from seaweed, and molecular cloning of its polyhydroxyalkanoate synthase gene.

Science.gov (United States)

Han, Xuerong; Satoh, Yasuharu; Kuriki, Yumi; Seino, Teruyuki; Fujita, Shinji; Suda, Takanori; Kobayashi, Takanori; Tajima, Kenji

2014-11-01

We successfully isolated one microorganism (UMI-21) from Ulva, a green algae that contains starch. The strain UMI-21 can produce polyhydroxyalkanoate (PHA) from starch, maltotriose, or maltose as a sole carbon source. Taxonomic studies and 16S rDNA sequence analysis revealed that strain UMI-21 was phylogenetically related to species of the genus Massilia. The PHA content under the cultivation condition using a 10-L jar fermentor was 45.5% (w/w). This value was higher than that obtained after cultivation in a flask, suggesting the possibility of large-scale PHA production by UMI-21 from starch. A major issue for the industrial production of microbial PHAs is the very high production cost. Starch is a relatively inexpensive substrate that is also found in abundant seaweeds such as Ulva. Therefore, the strain isolated in this study may be very useful for producing PHA from seaweeds containing polysaccharides such as starch. In addition, a 3.7-kbp DNA fragment containing the whole PHA synthase gene (phaC) was obtained from the strain UMI-21. The results of open reading frame (ORF) analysis suggested that the DNA fragment contained two ORFs, which were composed of 1740 (phaC) and 564 bp (phaR). The deduced amino acid sequence of PhaC from strain UMI-21 shared high similarity with PhaC from Ralstonia eutropha, which is a representative PHA-producing bacterium with a class I PHA synthase. This is the first report for the cloning of the PHA synthase gene from Massilia species. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Identification and characterization of two bisabolene synthases from linear glandular trichomes of sunflower (Helianthus annuus L., Asteraceae).

Science.gov (United States)

Aschenbrenner, Anna-Katharina; Kwon, Moonhyuk; Conrad, Jürgen; Ro, Dae-Kyun; Spring, Otmar

2016-04-01

Sunflower is known to produce a variety of bisabolene-type sesquiterpenes and accumulates these substances in trichomes of leaves, stems and flowering parts. A bioinformatics approach was used to identify the enzyme responsible for the initial step in the biosynthesis of these compounds from its precursor farnesyl pyrophosphate. Based on sequence similarity with a known bisabolene synthases from Arabidopsis thaliana AtTPS12, candidate genes of Helianthus were searched in EST-database and used to design specific primers. PCR experiments identified two candidates in the RNA pool of linear glandular trichomes of sunflower. Their sequences contained the typical motifs of sesquiterpene synthases and their expression in yeast functionally characterized them as bisabolene synthases. Spectroscopic analysis identified the stereochemistry of the product of both enzymes as (Z)-γ-bisabolene. The origin of the two sunflower bisabolene synthase genes from the transcripts of linear trichomes indicates that they may be involved in the synthesis of sesquiterpenes produced in these trichomes. Comparison of the amino acid sequences of the sunflower bisabolene synthases showed high similarity with sesquiterpene synthases from other Asteracean species and indicated putative evolutionary origin from a β-farnesene synthase. Copyright © 2016 Elsevier Ltd. All rights reserved.

Natural disease course and genotype-phenotype correlations in Complex I deficiency caused by nuclear gene defects

DEFF Research Database (Denmark)

Koene, S; Rodenburg, R J; van der Knaap, M S

2012-01-01

cases and 126 from literature) with mutations in nuclear genes encoding structural complex I proteins or those involved in its assembly. Complex I deficiency caused by a nuclear gene defect is usually a non-dysmorphic syndrome, characterized by severe multi-system organ involvement and a poor prognosis...

2-Methyl-3-buten-2-ol (MBO) synthase expression in Nostoc punctiforme leads to over production of phytols.

Science.gov (United States)

Gupta, Dinesh; Ip, Tina; Summers, Michael L; Basu, Chhandak

2015-01-01

Phytol is a diterpene alcohol of medicinal importance and it also has potential to be used as biofuel. We found over production of phytol in Nostoc punctiforme by expressing a 2-Methyl-3-buten-2-ol (MBO) synthase gene. MBO synthase catalyzes the conversion of dimethylallyl pyrophosphate (DMAPP) into MBO, a volatile hemiterpene alcohol, in Pinus sabiniana. The result of enhanced phytol production in N. punctiforme, instead of MBO, could be explained by one of the 2 models: either the presence of a native prenyltransferase enzyme with a broad substrate specificity, or appropriation of a MBO synthase metabolic intermediate by a native geranyl diphosphate (GDP) synthase. In this work, an expression vector with an indigenous petE promoter for gene expression in the cyanobacterium N. punctiforme was constructed and MBO synthase gene expression was successfully shown using reverse transcriptase (RT)-PCR and SDS-PAGE. Gas chromatography--mass spectrophotometry (GC-MS) was performed to confirm phytol production from the transgenic N. punctiforme strains. We conclude that the expression of MBO synthase in N. punctiforme leads to overproduction of an economically important compound, phytol. This study provides insights about metabolic channeling of isoprenoids in cyanobacteria and also illustrates the challenges of bioengineering non-native hosts to produce economically important compounds.

Structure of the human beta-ketoacyl [ACP] synthase from the mitochondrial type II fatty acid synthase

DEFF Research Database (Denmark)

Christensen, Caspar Elo; Kragelund, Birthe B; von Wettstein-Knowles, Penny

2007-01-01

Two distinct ways of organizing fatty acid biosynthesis exist: the multifunctional type I fatty acid synthase (FAS) of mammals, fungi, and lower eukaryotes with activities residing on one or two polypeptides; and the dissociated type II FAS of prokaryotes, plastids, and mitochondria with individual...... activities encoded by discrete genes. The beta-ketoacyl [ACP] synthase (KAS) moiety of the mitochondrial FAS (mtKAS) is targeted by the antibiotic cerulenin and possibly by the other antibiotics inhibiting prokaryotic KASes: thiolactomycin, platensimycin, and the alpha-methylene butyrolactone, C75. The high...... degree of structural similarity between mitochondrial and prokaryotic KASes complicates development of novel antibiotics targeting prokaryotic KAS without affecting KAS domains of cytoplasmic FAS. KASes catalyze the C(2) fatty acid elongation reaction using either a Cys-His-His or Cys-His-Asn catalytic...

Gene therapy/bone marrow transplantation in ADA-deficient mice: roles of enzyme-replacement therapy and cytoreduction.

Science.gov (United States)

Carbonaro, Denise A; Jin, Xiangyang; Wang, Xingchao; Yu, Xiao-Jin; Rozengurt, Nora; Kaufman, Michael L; Wang, Xiaoyan; Gjertson, David; Zhou, Yang; Blackburn, Michael R; Kohn, Donald B

2012-11-01

Gene therapy (GT) for adenosine deaminase-deficient severe combined immune deficiency (ADA-SCID) can provide significant long-term benefit when patients are given nonmyeloablative conditioning and ADA enzyme-replacement therapy (ERT) is withheld before autologous transplantation of γ-retroviral vector-transduced BM CD34+ cells. To determine the contributions of conditioning and discontinuation of ERT to the therapeutic effects, we analyzed these factors in Ada gene knockout mice (Ada(-/-)). Mice were transplanted with ADA-deficient marrow transduced with an ADA-expressing γ-retroviral vector without preconditioning or after 200 cGy or 900 cGy total-body irradiation and evaluated after 4 months. In all tissues analyzed, vector copy numbers (VCNs) were 100- to 1000-fold greater in mice receiving 900 cGy compared with 200 cGy (P < .05). In mice receiving 200 cGy, VCN was similar whether ERT was stopped or given for 1 or 4 months after GT. In unconditioned mice, there was decreased survival with and without ERT, and VCN was very low to undetectable. When recipients were conditioned with 200 cGy and received transduced lineage-depleted marrow, only recipients receiving ERT (1 or 4 months) had detectable vector sequences in thymocytes. In conclusion, cytoreduction is important for the engraftment of gene-transduced HSC, and short-term ERT after GT did not diminish the capacity of gene-corrected cells to engraft and persist.

Defect in IgV gene somatic hypermutation in common variable immuno-deficiency syndrome.

Science.gov (United States)

Levy, Y; Gupta, N; Le Deist, F; Garcia, C; Fischer, A; Weill, J C; Reynaud, C A

1998-10-27

Common Variable Immuno-Deficiency (CVID) is the most common symptomatic primary antibody-deficiency syndrome, but the basic immunologic defects underlying this syndrome are not well defined. We report here that among eight patients studied (six CVID and two hypogammaglobulinemic patients with recurrent infections), there is in two CVID patients a dramatic reduction in Ig V gene somatic hypermutation with 40-75% of IgG transcripts totally devoid of mutations in the circulating memory B cell compartment. Functional assays of the T cell compartment point to an intrinsic B cell defect in the process of antibody affinity maturation in these two cases.

Isolation and characterization of terpene synthases in cotton (Gossypium hirsutum).

Science.gov (United States)

Yang, Chang-Qing; Wu, Xiu-Ming; Ruan, Ju-Xin; Hu, Wen-Li; Mao, Yin-Bo; Chen, Xiao-Ya; Wang, Ling-Jian

2013-12-01

Cotton plants accumulate gossypol and related sesquiterpene aldehydes, which function as phytoalexins against pathogens and feeding deterrents to herbivorous insects. However, to date little is known about the biosynthesis of volatile terpenes in this crop. Herein is reported that 5 monoterpenes and 11 sesquiterpenes from extracts of a glanded cotton cultivar, Gossypium hirsutum cv. CCRI12, were detected by gas chromatography-mass spectrometry (GC-MS). By EST data mining combined with Rapid Amplification of cDNA Ends (RACE), full-length cDNAs of three terpene synthases (TPSs), GhTPS1, GhTPS2 and GhTPS3 were isolated. By in vitro assays of the recombinant proteins, it was found that GhTPS1 and GhTPS2 are sesquiterpene synthases: the former converted farnesyl pyrophosphate (FPP) into β-caryophyllene and α-humulene in a ratio of 2:1, whereas the latter produced several sesquiterpenes with guaia-1(10),11-diene as the major product. By contrast, GhTPS3 is a monoterpene synthase, which produced α-pinene, β-pinene, β-phellandrene and trace amounts of other monoterpenes from geranyl pyrophosphate (GPP). The TPS activities were also supported by Virus Induced Gene Silencing (VIGS) in the cotton plant. GhTPS1 and GhTPS3 were highly expressed in the cotton plant overall, whereas GhTPS2 was expressed only in leaves. When stimulated by mechanical wounding, Verticillium dahliae (Vde) elicitor or methyl jasmonate (MeJA), production of terpenes and expression of the corresponding synthase genes were induced. These data demonstrate that the three genes account for the biosynthesis of volatile terpenes of cotton, at least of this Upland cotton. Copyright © 2013 Elsevier Ltd. All rights reserved.

Genome-Wide Identification, Evolutionary and Expression Analyses of the GALACTINOL SYNTHASE Gene Family in Rapeseed and Tobacco

Directory of Open Access Journals (Sweden)

Yonghai Fan

2017-12-01

Full Text Available Galactinol synthase (GolS is a key enzyme in raffinose family oligosaccharide (RFO biosynthesis. The finding that GolS accumulates in plants exposed to abiotic stresses indicates RFOs function in environmental adaptation. However, the evolutionary relationships and biological functions of GolS family in rapeseed (Brassica napus and tobacco (Nicotiana tabacum remain unclear. In this study, we identified 20 BnGolS and 9 NtGolS genes. Subcellular localization predictions showed that most of the proteins are localized to the cytoplasm. Phylogenetic analysis identified a lost event of an ancient GolS copy in the Solanaceae and an ancient duplication event leading to evolution of GolS4/7 in the Brassicaceae. The three-dimensional structures of two GolS proteins were conserved, with an important DxD motif for binding to UDP-galactose (uridine diphosphate-galactose and inositol. Expression profile analysis indicated that BnGolS and NtGolS genes were expressed in most tissues and highly expressed in one or two specific tissues. Hormone treatments strongly induced the expression of most BnGolS genes and homologous genes in the same subfamilies exhibited divergent-induced expression. Our study provides a comprehensive evolutionary analysis of GolS genes among the Brassicaceae and Solanaceae as well as an insight into the biological function of GolS genes in hormone response in plants.

Virus-induced gene silencing of the two squalene synthase isoforms of apple tree (Malus × domestica L.) negatively impacts phytosterol biosynthesis, plastid pigmentation and leaf growth.

Science.gov (United States)

Navarro Gallón, Sandra M; Elejalde-Palmett, Carolina; Daudu, Dimitri; Liesecke, Franziska; Jullien, Frédéric; Papon, Nicolas; Dugé de Bernonville, Thomas; Courdavault, Vincent; Lanoue, Arnaud; Oudin, Audrey; Glévarec, Gaëlle; Pichon, Olivier; Clastre, Marc; St-Pierre, Benoit; Atehortùa, Lucia; Yoshikawa, Nobuyuki; Giglioli-Guivarc'h, Nathalie; Besseau, Sébastien

2017-07-01

The use of a VIGS approach to silence the newly characterized apple tree SQS isoforms points out the biological function of phytosterols in plastid pigmentation and leaf development. Triterpenoids are beneficial health compounds highly accumulated in apple; however, their metabolic regulation is poorly understood. Squalene synthase (SQS) is a key branch point enzyme involved in both phytosterol and triterpene biosynthesis. In this study, two SQS isoforms were identified in apple tree genome. Both isoforms are located at the endoplasmic reticulum surface and were demonstrated to be functional SQS enzymes using an in vitro activity assay. MdSQS1 and MdSQS2 display specificities in their expression profiles with respect to plant organs and environmental constraints. This indicates a possible preferential involvement of each isoform in phytosterol and/or triterpene metabolic pathways as further argued using RNAseq meta-transcriptomic analyses. Finally, a virus-induced gene silencing (VIGS) approach was used to silence MdSQS1 and MdSQS2. The concomitant down-regulation of both MdSQS isoforms strongly affected phytosterol synthesis without alteration in triterpene accumulation, since triterpene-specific oxidosqualene synthases were found to be up-regulated to compensate metabolic flux reduction. Phytosterol deficiencies in silenced plants clearly disturbed chloroplast pigmentation and led to abnormal development impacting leaf division rather than elongation or differentiation. In conclusion, beyond the characterization of two SQS isoforms in apple tree, this work brings clues for a specific involvement of each isoform in phytosterol and triterpene pathways and emphasizes the biological function of phytosterols in development and chloroplast integrity. Our report also opens the door to metabolism studies in Malus domestica using the apple latent spherical virus-based VIGS method.

Cyclic GMP-AMP Synthase Is an Innate Immune DNA Sensor for Mycobacterium tuberculosis.

Science.gov (United States)

Collins, Angela C; Cai, Haocheng; Li, Tuo; Franco, Luis H; Li, Xiao-Dong; Nair, Vidhya R; Scharn, Caitlyn R; Stamm, Chelsea E; Levine, Beth; Chen, Zhijian J; Shiloh, Michael U

2015-06-10

Activation of the DNA-dependent cytosolic surveillance pathway in response to Mycobacterium tuberculosis infection stimulates ubiquitin-dependent autophagy and inflammatory cytokine production, and plays an important role in host defense against M. tuberculosis. However, the identity of the host sensor for M. tuberculosis DNA is unknown. Here we show that M. tuberculosis activated cyclic guanosine monophosphate-adenosine monophosphate (cGAMP) synthase (cGAS) in macrophages to produce cGAMP, a second messenger that activates the adaptor protein stimulator of interferon genes (STING) to induce type I interferons and other cytokines. cGAS localized with M. tuberculosis in mouse and human cells and in human tuberculosis lesions. Knockdown or knockout of cGAS in human or mouse macrophages blocked cytokine production and induction of autophagy. Mice deficient in cGAS were more susceptible to lethality caused by infection with M. tuberculosis. These results demonstrate that cGAS is a vital innate immune sensor of M. tuberculosis infection. Copyright © 2015 Elsevier Inc. All rights reserved.

Cloning and Characterization of Farnesyl Diphosphate Synthase Gene Involved in Triterpenoids Biosynthesis from Poria cocos

Directory of Open Access Journals (Sweden)

Jianrong Wang

2014-12-01

Full Text Available Poria cocos (P. cocos has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%. The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP from geranyl diphosphate (GPP and isopentenyl diphosphate (IPP. Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos.

Characterization of microbial community and the alkylscccinate synthase genes in petroleum reservoir fluids of China

Energy Technology Data Exchange (ETDEWEB)

Zhou, Lei; Mu, Bo-Zhong [University of Science and Technology (China)], email: bzmu@ecust.edu.cn; Gu, Ji-Dong [The University of Hong Kong (China)], email: jdgu@hkucc.hku.hk

2011-07-01

Petroleum reservoirs represent a special ecosystem consisting of specific temperature, pressure, salt concentration, oil, gas, water, microorganisms and, enzymes among others. This paper presents the characterization of microbial community and the alkyl succinate synthase genes in petroleum reservoir fluids in China. A few samples were analyzed and the physical and chemical characteristics are given in a tabular form. A flow chart shows the methods and procedures for microbial activities. Six petroleum reservoirs were studied using an archaeal 16S rRNA gene-based approach to establish the presence of archaea and the results are given. The correlation of archaeal and bacterial communities with reservoir conditions and diversity of the arachaeal community in water-flooding petroleum reservoirs at different temperatures is also shown. From the study, it can be summarized that, among methane producers, CO2-reducing methanogens are mostly found in oil reservoir ecosystems and as more assA sequences are revealed, more comprehensive molecular probes can be designed to track the activity of anaerobic alkane-degrading organisms in the environment.

Analysis of tandem repeat units of the promoter of capsanthin/capsorubin synthase (Ccs) gene in pepper fruit.

Science.gov (United States)

Tian, Shi-Lin; Li, Zheng; Li, Li; Shah, S N M; Gong, Zhen-Hui

2017-07-01

Capsanthin/capsorubin synthase ( Ccs ) gene is a key gene that regulates the synthesis of capsanthin and the development of red coloration in pepper fruits. There are three tandem repeat units in the promoter region of Ccs , but the potential effects of the number of repetitive units on the transcriptional regulation of Ccs has been unclear. In the present study, expression vectors carrying different numbers of repeat units of the Ccs promoter were constructed, and the transient expression of the β-glucuronidase ( GUS ) gene was used to detect differences in expression levels associated with the promoter fragments. These repeat fragments and the plant expression vector PBI121 containing the 35s CaMV promoter were ligated to form recombinant vectors that were transfected into Agrobacterium tumefaciens GV3101. A fluorescence spectrophotometer was used to analyze the expression associated with the various repeat units. It was concluded that the constructs containing at least one repeat were associated with GUS expression, though they did not differ from one another. This repeating unit likely plays a role in transcription and regulation of Ccs expression.

Genetic variants in promoters and coding regions of the muscle glycogen synthase and the insulin-responsive GLUT4 genes in NIDDM

DEFF Research Database (Denmark)

Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P

1994-01-01

To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...

Use of octaketide synthases to produce kermesic acid and flavokermesic acid

DEFF Research Database (Denmark)

2017-01-01

A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....

Use of octaketide synthases to produce kermesic acid and flavokermesic acid

DEFF Research Database (Denmark)

2016-01-01

A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....

Effects and mechanism of acid rain on plant chloroplast ATP synthase.

Science.gov (United States)

Sun, Jingwen; Hu, Huiqing; Li, Yueli; Wang, Lihong; Zhou, Qing; Huang, Xiaohua

2016-09-01

Acid rain can directly or indirectly affect plant physiological functions, especially photosynthesis. The enzyme ATP synthase is the key in photosynthetic energy conversion, and thus, it affects plant photosynthesis. To clarify the mechanism by which acid rain affects photosynthesis, we studied the effects of acid rain on plant growth, photosynthesis, chloroplast ATP synthase activity and gene expression, chloroplast ultrastructure, intracellular H(+) level, and water content of rice seedlings. Acid rain at pH 4.5 remained the chloroplast structure unchanged but increased the expression of six chloroplast ATP synthase subunits, promoted chloroplast ATP synthase activity, and increased photosynthesis and plant growth. Acid rain at pH 4.0 or less decreased leaf water content, destroyed chloroplast structure, inhibited the expression of six chloroplast ATP synthase subunits, decreased chloroplast ATP synthase activity, and reduced photosynthesis and plant growth. In conclusion, acid rain affected the chloroplast ultrastructure, chloroplast ATPase transcription and activity, and P n by changing the acidity in the cells, and thus influencing the plant growth and development. Finally, the effects of simulated acid rain on the test indices were found to be dose-dependent.

Gene expression of endoplasmic reticulum resident selenoproteins correlates with apoptosis in various muscles of se-deficient chicks.

Science.gov (United States)

Yao, Hai-Dong; Wu, Qiong; Zhang, Zi-Wei; Zhang, Jiu-Li; Li, Shu; Huang, Jia-Qiang; Ren, Fa-Zheng; Xu, Shi-Wen; Wang, Xiao-Long; Lei, Xin Gen

2013-05-01

Dietary selenium (Se) deficiency causes muscular dystrophy in various species, but the molecular mechanism remains unclear. Our objectives were to investigate: 1) if dietary Se deficiency induced different amounts of oxidative stress, lipid peroxidation, and cell apoptosis in 3 skeletal muscles; and 2) if the distribution and expression of 4 endoplasmic reticulum (ER) resident selenoprotein genes (Sepn1, Selk, Sels, and Selt) were related to oxidative damages in these muscles. Two groups of day-old layer chicks (n = 60/group) were fed a corn-soy basal diet (33 μg Se/kg; produced in the Se-deficient area of Heilongjiang, China) or the diet supplemented with Se (as sodium selenite) at 0.15 mg/kg for 55 d. Dietary Se deficiency resulted in accelerated (P muscles. All these responses were stronger in the pectoral muscle than in the thigh and wing muscles (P muscles. Expression of Sepn1, Sels, and Selt in these muscles was correlated with (r > 0.72; P muscle demonstrated unique expression patterns of the ER resident selenoprotein genes and GPx activity, along with elevated susceptibility to oxidative cell death, compared with the other skeletal muscles. These features might help explain why it is a primary target of Se deficiency diseases in chicks.

Impaired glycogen synthase activity and mitochondrial dysfunction in skeletal muscle

DEFF Research Database (Denmark)

Højlund, Kurt; Beck-Nielsen, Henning

2006-01-01

Insulin resistance in skeletal muscle is a major hallmark of type 2 diabetes and an early detectable abnormality in the development of this disease. The cellular mechanisms of insulin resistance include impaired insulin-mediated muscle glycogen synthesis and increased intramyocellular lipid content......, whereas impaired insulin activation of muscle glycogen synthase represents a consistent, molecular defect found in both type 2 diabetic and high-risk individuals. Despite several studies of the insulin signaling pathway believed to mediate dephosphorylation and hence activation of glycogen synthase......, the molecular mechanisms responsible for this defect remain unknown. Recently, the use of phospho-specific antibodies in human diabetic muscle has revealed hyperphosphorylation of glycogen synthase at sites not regulated by the classical insulin signaling pathway. In addition, novel approaches such as gene...

Bacterial Production, Characterization and Protein Modeling of a Novel Monofuctional Isoform of FAD Synthase in Humans: An Emergency Protein?

Directory of Open Access Journals (Sweden)

Piero Leone

2018-01-01

Full Text Available FAD synthase (FADS, EC 2.7.7.2 is the last essential enzyme involved in the pathway of biosynthesis of Flavin cofactors starting from Riboflavin (Rf. Alternative splicing of the human FLAD1 gene generates different isoforms of the enzyme FAD synthase. Besides the well characterized isoform 1 and 2, other FADS isoforms with different catalytic domains have been detected, which are splice variants. We report the characterization of one of these novel isoforms, a 320 amino acid protein, consisting of the sole C-terminal 3′-phosphoadenosine 5′-phosphosulfate (PAPS reductase domain (named FADS6. This isoform has been previously detected in Riboflavin-Responsive (RR-MADD and Non-responsive Multiple Acyl-CoA Dehydrogenase Deficiency (MADD patients with frameshift mutations of FLAD1 gene. To functionally characterize the hFADS6, it has been over-expressed in Escherichia coli and purified with a yield of 25 mg·L−1 of cell culture. The protein has a monomeric form, it binds FAD and is able to catalyze FAD synthesis (kcat about 2.8 min−1, as well as FAD pyrophosphorolysis in a strictly Mg2+-dependent manner. The synthesis of FAD is inhibited by HgCl2. The enzyme lacks the ability to hydrolyze FAD. It behaves similarly to PAPS. Combining threading and ab-initio strategy a 3D structural model for such isoform has been built. The relevance to human physio-pathology of this FADS isoform is discussed.

Mcm2 deficiency results in short deletions allowing high resolution identification of genes contributing to lymphoblastic lymphoma

Science.gov (United States)

Rusiniak, Michael E.; Kunnev, Dimiter; Freeland, Amy; Cady, Gillian K.; Pruitt, Steven C.

2011-01-01

Mini-chromosome maintenance (Mcm) proteins are part of the replication licensing complex that is loaded onto chromatin during the G1-phase of the cell cycle and required for initiation of DNA replication in the subsequent S-phase. Mcm proteins are typically loaded in excess of the number of locations that are utilized during S-phase. Nonetheless, partial depletion of Mcm proteins leads to cancers and stem cell deficiencies. Mcm2 deficient mice, on a 129Sv genetic background, display a high rate of thymic lymphoblastic lymphoma. Here array comparative genomic hybridization (aCGH) is utilized to characterize the genetic damage accruing in these tumors. The predominant events are deletions averaging less than 0.5 Mb, considerably shorter than observed in prior studies using alternative mouse lymphoma models or human tumors. Such deletions facilitate identification of specific genes and pathways responsible for the tumors. Mutations in many genes that have been implicated in human lymphomas are recapitulated in this mouse model. These features, and the fact that the mutation underlying the accelerated genetic damage does not target a specific gene or pathway a priori, are valuable features of this mouse model for identification of tumor suppressor genes. Genes affected in all tumors include Pten, Tcfe2a, Mbd3 and Setd1b. Notch1 and additional genes are affected in subsets of tumors. The high frequency of relatively short deletions is consistent with elevated recombination between nearby stalled replication forks in Mcm2 deficient mice. PMID:22158038

Biosynthesis of Akaeolide and Lorneic Acids and Annotation of Type I Polyketide Synthase Gene Clusters in the Genome of Streptomyces sp. NPS554

Directory of Open Access Journals (Sweden)

Tao Zhou

2015-01-01

Full Text Available The incorporation pattern of biosynthetic precursors into two structurally unique polyketides, akaeolide and lorneic acid A, was elucidated by feeding experiments with 13C-labeled precursors. In addition, the draft genome sequence of the producer, Streptomyces sp. NPS554, was performed and the biosynthetic gene clusters for these polyketides were identified. The putative gene clusters contain all the polyketide synthase (PKS domains necessary for assembly of the carbon skeletons. Combined with the 13C-labeling results, gene function prediction enabled us to propose biosynthetic pathways involving unusual carbon-carbon bond formation reactions. Genome analysis also indicated the presence of at least ten orphan type I PKS gene clusters that might be responsible for the production of new polyketides.

Altering the expression of two chitin synthase genes differentially affects the growth and morphology of Aspergillus oryzae

DEFF Research Database (Denmark)

Müller, Christian; Hjort, C.M.; Hansen, K.

2002-01-01

In Aspergillus oryzae, one full-length chitin synthase (chsB) and fragments of two other chitin synthases (csmA and chsC) were identified. The deduced amino acid sequence of chsB was similar (87% identity) to chsB from Aspergillus nidulans, which encodes a class III chitin synthase. The sequence...

Regulation of RNA-dependent RNA polymerase 1 and isochorismate synthase gene expression in Arabidopsis.

Directory of Open Access Journals (Sweden)

Lydia J R Hunter

Full Text Available RNA-dependent RNA polymerases (RDRs function in anti-viral silencing in Arabidopsis thaliana and other plants. Salicylic acid (SA, an important defensive signal, increases RDR1 gene expression, suggesting that RDR1 contributes to SA-induced virus resistance. In Nicotiana attenuata RDR1 also regulates plant-insect interactions and is induced by another important signal, jasmonic acid (JA. Despite its importance in defense RDR1 regulation has not been investigated in detail.In Arabidopsis, SA-induced RDR1 expression was dependent on 'NON-EXPRESSER OF PATHOGENESIS-RELATED GENES 1', indicating regulation involves the same mechanism controlling many other SA- defense-related genes, including pathogenesis-related 1 (PR1. Isochorismate synthase 1 (ICS1 is required for SA biosynthesis. In defensive signal transduction RDR1 lies downstream of ICS1. However, supplying exogenous SA to ics1-mutant plants did not induce RDR1 or PR1 expression to the same extent as seen in wild type plants. Analysing ICS1 gene expression using transgenic plants expressing ICS1 promoter:reporter gene (β-glucuronidase constructs and by measuring steady-state ICS1 transcript levels showed that SA positively regulates ICS1. In contrast, ICS2, which is expressed at lower levels than ICS1, is unaffected by SA. The wound-response hormone JA affects expression of Arabidopsis RDR1 but jasmonate-induced expression is independent of CORONATINE-INSENSITIVE 1, which conditions expression of many other JA-responsive genes. Transiently increased RDR1 expression following tobacco mosaic virus inoculation was due to wounding and was not a direct effect of infection. RDR1 gene expression was induced by ethylene and by abscisic acid (an important regulator of drought resistance. However, rdr1-mutant plants showed normal responses to drought.RDR1 is regulated by a much broader range of phytohormones than previously thought, indicating that it plays roles beyond those already suggested in virus

Effects of Biotin Deficiency on Biotinylated Proteins and Biotin-Related Genes in the Rat Brain.

Science.gov (United States)

Yuasa, Masahiro; Aoyama, Yuki; Shimada, Ryoko; Sawamura, Hiromi; Ebara, Shuhei; Negoro, Munetaka; Fukui, Toru; Watanabe, Toshiaki

2016-01-01

Biotin is a water-soluble vitamin that functions as a cofactor for biotin-dependent carboxylases. The biochemical and physiological roles of biotin in brain regions have not yet been investigated sufficiently in vivo. Thus, in order to clarify the function of biotin in the brain, we herein examined biotin contents, biotinylated protein expression (e.g. holocarboxylases), and biotin-related gene expression in the brain of biotin-deficient rats. Three-week-old male Wistar rats were divided into a control group, biotin-deficient group, and pair-fed group. Rats were fed experimental diets from 3 wk old for 8 wk, and the cortex, hippocampus, striatum, hypothalamus, and cerebellum were then collected. In the biotin-deficient group, the maintenance of total biotin and holocarboxylases, increases in the bound form of biotin and biotinidase activity, and the expression of an unknown biotinylated protein were observed in the cortex. In other regions, total and free biotin contents decreased, holocarboxylase expression was maintained, and bound biotin and biotinidase activity remained unchanged. Biotin-related gene (pyruvate carboxylase, sodium-dependent multivitamin transporter, holocarboxylase synthetase, and biotinidase) expression in the cortex and hippocampus also remained unchanged among the dietary groups. These results suggest that biotin may be related to cortex functions by binding protein, and the effects of a biotin deficiency and the importance of biotin differ among the different brain regions.

Molecular cloning and expression levels of the monoterpene synthase gene (ZMM1) in Cassumunar ginger (Zingiber montanum (Koenig) Link ex Dietr.)

OpenAIRE

Bua-In Saowaluck; Paisooksantivatana Yingyong; Weimer Bart C.; Chowpongpang Srimek

2014-01-01

Cassumunar ginger (Zingiber montanum (Koenig) Link ex Dietr.) is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant an...

Gene therapy/bone marrow transplantation in ADA-deficient mice: roles of enzyme-replacement therapy and cytoreduction

Science.gov (United States)

Jin, Xiangyang; Wang, Xingchao; Yu, Xiao-Jin; Rozengurt, Nora; Kaufman, Michael L.; Wang, Xiaoyan; Gjertson, David; Zhou, Yang; Blackburn, Michael R.; Kohn, Donald B.

2012-01-01

Gene therapy (GT) for adenosine deaminase–deficient severe combined immune deficiency (ADA-SCID) can provide significant long-term benefit when patients are given nonmyeloablative conditioning and ADA enzyme-replacement therapy (ERT) is withheld before autologous transplantation of γ-retroviral vector-transduced BM CD34+ cells. To determine the contributions of conditioning and discontinuation of ERT to the therapeutic effects, we analyzed these factors in Ada gene knockout mice (Ada−/−). Mice were transplanted with ADA-deficient marrow transduced with an ADA-expressing γ-retroviral vector without preconditioning or after 200 cGy or 900 cGy total-body irradiation and evaluated after 4 months. In all tissues analyzed, vector copy numbers (VCNs) were 100- to 1000-fold greater in mice receiving 900 cGy compared with 200 cGy (P < .05). In mice receiving 200 cGy, VCN was similar whether ERT was stopped or given for 1 or 4 months after GT. In unconditioned mice, there was decreased survival with and without ERT, and VCN was very low to undetectable. When recipients were conditioned with 200 cGy and received transduced lineage-depleted marrow, only recipients receiving ERT (1 or 4 months) had detectable vector sequences in thymocytes. In conclusion, cytoreduction is important for the engraftment of gene-transduced HSC, and short-term ERT after GT did not diminish the capacity of gene-corrected cells to engraft and persist. PMID:22833548

Characterization of D-myo-inositol 3-phosphate synthase gene expression in two soybean low phytate mutants

International Nuclear Information System (INIS)

Yuan Fengjie; Dong Dekun; Li Baiquan; Yu Xiaomin; Fu Xujun; Zhu Danhua; Zhu Shenlong; Yang Qinghua

2013-01-01

1D-myo-inositol 3-phosphate synthase (MIPS) gene plays a significant role in phytic acid biosynthesis. In this study, we used two low phytic acid mutants Gm-lpa-TW-1, Gm-lpa-ZC-2 and their respective wild type parents Taiwan75 and Zhechun No.3 to analyze the expression pattern and characterization of MIPS1 gene. The results showed that there was a common expression pattern of MIPS1 in soybean developing seeds. Expression was weak as detected by RT-PCR in initial stage, increased in the following stages, and the peak expression was appeared in 22 day after flowering (DAF). The expression of MIPS1 gene of non-seed tissues in mutant Gm-lpa-TW-1 and its wildtype Taiwan75 was very weak. In the developing seeds, the MIPS1 expression by qRT-PCR revealed a significant reduction in 22 DAF in mutant Gm-lpa-TW-1 as compared with the wildtype. Similarly, the expression of MIPS1 gene in non-seed tissue of Zhenchun No.3 and Gm-lpa-ZC-2 was very weak. However, stronger expression in developing seeds of the mutant Gm-lpa-ZC-2 than Zhechun No.3 was found. We concluded that the MIPS1 gene expression in the developing seed exhibited an up-regulation pattern in mutant Gm-lpa-ZC-2, but a down-regulation pattern in the mutant Gm-lpa-TW-1. (authors)

Two Cycloartenol Synthases for Phytosterol Biosynthesis in Polygala tenuifolia Willd.

Science.gov (United States)

Jin, Mei Lan; Lee, Woo Moon; Kim, Ok Tae

2017-11-15

Oxidosqualene cyclases (OSCs) are enzymes that play a key role in control of the biosynthesis of phytosterols and triterpene saponins. In order to uncover OSC genes from Polygala tenuifolia seedlings induced by methyl jasmonate (MeJA), RNA-sequencing analysis was performed using the Illumina sequencing platform. A total of 148,488,632 high-quality reads from two samples (control and the MeJA treated) were generated. We screened genes related to phytosterol and triterpene saponin biosynthesis and analyzed the transcriptional changes of differentially expressed unigene (DEUG) values calculated by fragments per kilobase million (FPKM). In our datasets, two full-length cDNAs of putative OSC genes, PtCAS1 , and PtCAS2 , were found, in addition to the PtBS (β-amyrin synthase) gene reported in our previous studies and the two cycloartenol synthase genes of P. tenuifolia . All genes were isolated and characterized in yeast cells. The functional expression of the two PtCAS genes in yeast cells showed that the genes all produce a cycloartenol as the sole product. When qRT-PCR analysis from different tissues was performed, the expressions of PtCAS1 and PtCAS2 were highest in flowers and roots, respectively. After MeJA treatment, the transcripts of PtCAS1 and PtCAS2 genes increased by 1.5- and 2-fold, respectively. Given these results, we discuss the potential roles of the two PtCAS genes in relation to triterpenoid biosynthesis.

Two Cycloartenol Synthases for Phytosterol Biosynthesis in Polygala tenuifolia Willd

Directory of Open Access Journals (Sweden)

Mei Lan Jin

2017-11-01

Full Text Available Oxidosqualene cyclases (OSCs are enzymes that play a key role in control of the biosynthesis of phytosterols and triterpene saponins. In order to uncover OSC genes from Polygala tenuifolia seedlings induced by methyl jasmonate (MeJA, RNA-sequencing analysis was performed using the Illumina sequencing platform. A total of 148,488,632 high-quality reads from two samples (control and the MeJA treated were generated. We screened genes related to phytosterol and triterpene saponin biosynthesis and analyzed the transcriptional changes of differentially expressed unigene (DEUG values calculated by fragments per kilobase million (FPKM. In our datasets, two full-length cDNAs of putative OSC genes, PtCAS1, and PtCAS2, were found, in addition to the PtBS (β-amyrin synthase gene reported in our previous studies and the two cycloartenol synthase genes of P. tenuifolia. All genes were isolated and characterized in yeast cells. The functional expression of the two PtCAS genes in yeast cells showed that the genes all produce a cycloartenol as the sole product. When qRT-PCR analysis from different tissues was performed, the expressions of PtCAS1 and PtCAS2 were highest in flowers and roots, respectively. After MeJA treatment, the transcripts of PtCAS1 and PtCAS2 genes increased by 1.5- and 2-fold, respectively. Given these results, we discuss the potential roles of the two PtCAS genes in relation to triterpenoid biosynthesis.

Molecular characterization of two alkylresorcylic acid synthases from Sordariomycetes fungi

DEFF Research Database (Denmark)

Ramakrishnan, Dhivya; Tiwari, Manish Kumar; Manoharan, Gomathi

2018-01-01

Two putative type III polyketide synthase genes (PKS) were identified from Sordariomycetes fungi. These two type III PKS genes from Sordaria macrospora (SmPKS) and Chaetomium thermophilum (CtPKS), shared 59.8% sequence identity. Both, full-length and truncated versions of type III PKSs were...

Microsatellite instability and the association with plasma homocysteine and thymidylate synthase in colorectal cancer

DEFF Research Database (Denmark)

Jensen, Lars Henrik; Lindebjerg, Jan; Crüger, Dorthe G.

2008-01-01

, carcinoembryonic antigen, vitamin B12, and folate. Microsatellite instability of tumors was associated with higher levels of plasma homocysteine (p = 0.008) and higher protein expression of thymidylate synthase (p ... factors. CEA was not associated with neither homocysteine nor microsatellite instability. The data suggests that there is a more pronounced methyl unit deficiency in microsatellite instable tumors....

Pathogenic classification of LPL gene variants reported to be associated with LPL deficiency

DEFF Research Database (Denmark)

Rodrigues, Rute; Artieda, Marta; Tejedor, Diego

2016-01-01

into the deleterious effect of the mutations is clinically essential. METHODS: We used gene sequencing followed by in-vivo/in-vitro and in-silico tools for classification. We classified 125 rare LPL mutations in 33 subjects thought to have LPL deficiency and in 314 subjects selected for very SHTG. RESULTS: Of the 33...

Molecular cloning and functional expression of geranylgeranyl pyrophosphate synthase from Coleus forskohlii Briq

Directory of Open Access Journals (Sweden)

Kawamukai Makoto

2004-11-01

Full Text Available Abstract Background Isopentenyl diphosphate (IPP, a common biosynthetic precursor to the labdane diterpene forskolin, has been biosynthesised via a non-mevalonate pathway. Geranylgeranyl diphosphate (GGPP synthase is an important branch point enzyme in terpenoid biosynthesis. Therefore, GGPP synthase is thought to be a key enzyme in biosynthesis of forskolin. Herein we report the first confirmation of the GGPP synthase gene in Coleus forskohlii Briq. Results The open reading frame for full-length GGPP synthase encodes a protein of 359 amino acids, in which 1,077 nucleotides long with calculated molecular mass of 39.3 kDa. Alignments of C. forskohlii GGPP synthase amino acid sequences revealed high homologies with other plant GGPP synthases. Several highly conserved regions, including two aspartate-rich motifs were identified. Transient expression of the N-terminal region of C. forskohlii GGPP synthase-GFP fusion protein in tobacco cells demonstrated subcellular localization in the chloroplast. Carotenoid production was observed in Escherichia coli harboring pACCAR25ΔcrtE from Erwinia uredovora and plasmid carrying C. forskohlii GGPP synthase. These results suggested that cDNA encoded functional GGPP synthase. Furthermore, C. forskohlii GGPP synthase expression was strong in leaves, decreased in stems and very little expression was observed in roots. Conclusion This investigation proposed that forskolin was synthesised via a non-mevalonate pathway. GGPP synthase is thought to be involved in the biosynthesis of forskolin, which is primarily synthesised in the leaves and subsequently accumulates in the stems and roots.

Genetics Home Reference: tetrahydrobiopterin deficiency

Science.gov (United States)

... 1-16. Review. Citation on PubMed or Free article on PubMed Central Thöny B, Blau N. Mutations in the BH4-metabolizing genes GTP cyclohydrolase I, 6-pyruvoyl-tetrahydropterin synthase, sepiapterin ...

Interleukin-18 gene-deficient mice show enhanced defense and reduced inflammation during pneumococcal meningitis

NARCIS (Netherlands)

Zwijnenburg, Petra J. G.; van der Poll, Tom; Florquin, Sandrine; Akira, Shizuo; Takeda, Kiyoshi; Roord, John J.; van Furth, A. Marceline

2003-01-01

To determine the role of endogenous interleukin-18 (IL-18) in pneumococcal meningitis, meningitis was induced in IL-18 gene-deficient (IL-18(-/-)) and wild-type (WT) mice by intranasal inoculation of Streptococcus pneumoniae with hyaluronidase. Induction of meningitis resulted in an upregulation of

Interleukin-18 gene-deficient mice show enhanced defense and reduced inflammation during pneumococcal meningitis.

NARCIS (Netherlands)

Zwijnenburg, P.J.G.; Poll, van der T.; Florquin, S; Akira, S; Takeda, K; Roord, J.J.; Furth, van A.M.

2003-01-01

To determine the role of endogenous interleukin-18 (IL-18) in pneumococcal meningitis, meningitis was induced in IL-18 gene-deficient (IL-18(-/-)) and wild-type (WT) mice by intranasal inoculation of Streptococcus pneumoniae with hyaluronidase. Induction of meningitis resulted in an upregulation of

Structural Basis of Catalysis in the Bacterial Monoterpene Synthases Linalool Synthase and 1,8-Cineole Synthase

OpenAIRE

Karuppiah, Vijaykumar; Ranaghan, Kara E.; Leferink, Nicole G. H.; Johannissen, Linus O.; Shanmugam, Muralidharan; Ní Cheallaigh, Aisling; Bennett, Nathan J.; Kearsey, Lewis J.; Takano, Eriko; Gardiner, John M.; van der Kamp, Marc W.; Hay, Sam; Mulholland, Adrian J.; Leys, David; Scrutton, Nigel S.

2017-01-01

Terpenoids form the largest and stereochemically most diverse class of natural products, and there is considerable interest in producing these by biocatalysis with whole cells or purified enzymes, and by metabolic engineering. The monoterpenes are an important class of terpenes and are industrially important as flavors and fragrances. We report here structures for the recently discovered Streptomyces clavuligerus monoterpene synthases linalool synthase (bLinS) and 1,8-cineole synthase (bCinS)...

Tyrosinase inhibition due to interaction of homocyst(e)ine with copper: the mechanism for reversible hypopigmentation in homocystinuria due to cystathionine beta-synthase deficiency.

Science.gov (United States)

Reish, O; Townsend, D; Berry, S A; Tsai, M Y; King, R A

1995-01-01

Deficiency of cystathionine beta-synthase (CBS) is a genetic disorder of transsulfuration resulting in elevated plasma homocyst(e)ine and methionine and decreased cysteine. Affected patients have multisystem involvement, which may include light skin and hair. Reversible hypopigmentation in treated homocystinuric patients has been infrequently reported, and the mechanism is undefined. Two CBS-deficient homocystinuric patients manifested darkening of their hypopigmented hair following treatment that decreased plasma homocyst(e)ine. We hypothesized that homocyst(e)ine inhibits tyrosinase, the major pigment enzyme. The activity of tyrosinase extracted from pigmented human melanoma cells (MNT-1) that were grown in the presence of homocysteine was reduced in comparison to that extracted from cells grown without homocysteine. Copper sulfate restored homocyst(e)ine-inhibited tyrosinase activity when added to the culture cell media at a proportion of 1.25 mol of copper sulfate per 1 mol of DL-homocysteine. Holo-tyrosinase activity was inhibited by adding DL-homocysteine to the assay reaction mixture, and the addition of copper sulfate to the reaction mixture prevented this inhibition. Other tested compounds, L-cystine and betaine did not affect tyrosinase activity. Our data suggest that reversible hypopigmentation in homocystinuria is the result of tyrosinase inhibition by homocyst(e)ine and that the probable mechanism of this inhibition is the interaction of homocyst(e)ine with copper at the active site of tyrosinase. Images Figure 1 PMID:7611281

CD48-deficient T-lymphocytes from DMBA-treated rats have de novo mutations in the endogenous Pig-a gene.

Science.gov (United States)

Dobrovolsky, Vasily N; Revollo, Javier; Pearce, Mason G; Pacheco-Martinez, M Monserrat; Lin, Haixia

2015-10-01

A major question concerning the scientific and regulatory acceptance of the rodent red blood cell-based Pig-a gene mutation assay is the extent to which mutants identified by their phenotype in the assay are caused by mutations in the Pig-a gene. In this study, we identified T-lymphocytes deficient for the glycosylphosphatidylinositol-anchored surface marker, CD48, in control and 7,12-dimethylbenz[a]anthracene (DMBA)-treated rats using a flow cytometric assay and determined the spectra of mutations in the endogenous Pig-a gene in these cells. CD48-deficient T-cells were seeded by sorting at one cell per well into 96-well plates, expanded into clones, and exons of their genomic Pig-a were sequenced. The majority (78%) of CD48-deficient T-cell clones from DMBA-treated rats had mutations in the Pig-a gene. The spectrum of DMBA-induced Pig-a mutations was dominated by mutations at A:T, with the mutated A being on the nontranscribed strand and A → T transversion being the most frequent change. The spectrum of Pig-a mutations in DMBA-treated rats was different from the spectrum of Pig-a mutations in N-ethyl-N-nitrosourea (ENU)-treated rats, but similar to the spectrum of DMBA mutations for another endogenous X-linked gene, Hprt. Only 15% of CD48-deficient mutants from control animals contained Pig-a mutations; T-cell biology may be responsible for a relatively large fraction of false Pig-a mutant lymphocytes in control animals. Among the verified mutants from control rats, the most common were frameshifts and deletions. The differences in the spectra of spontaneous, DMBA-, and ENU-induced Pig-a mutations suggest that the flow cytometric Pig-a assay detects de novo mutation in the endogenous Pig-a gene. © 2015 Wiley Periodicals, Inc.

HAEM SYNTHASE AND COBALT PORPHYRIN SYNTHASE IN VARIOUS MICRO-ORGANISMS.

Science.gov (United States)

PORRA, R J; ROSS, B D

1965-03-01

1. The preparation of a crude extract of Clostridium tetanomorphum containing cobalt porphyrin synthase but little haem-synthase activity is described. 2. The properties of cobalt porphyrin synthase in the clostridial extracts is compared with the properties of a haem synthase present in crude extracts of the yeast Torulopsis utilis. 3. Cobalt porphyrin synthase in extracts of C. tetanomorphum inserts Co(2+) ions into the following dicarboxylic porphyrins in descending order of rate of insertion: meso-, deutero- and proto-porphyrins. Esterification renders meso- and deutero-porphyrins inactive as substrates. Neither the tetracarboxylic (coproporphyrin III) nor the octacarboxylic (uroporphyrin III) compounds are converted into cobalt porphyrins by the extract, but the non-enzymic incorporation of Co(2+) ions into these two porphyrins is rapid. These extracts are unable to insert Mn(2+), Zn(2+), Mg(2+) or Cu(2+) ions into mesoporphyrin. 4. Crude extracts of T. utilis readily insert both Co(2+) and Fe(2+) ions into deutero-, meso, and proto-porphyrins. Unlike the extracts of C. tetanomorphum, these preparations catalyse the insertion of Co(2+) ions into deuteroporphyrin more rapidly than into mesoporphyrin. This parallels the formation of haems by the T. utilis extract. 5. Cobalt porphyrin synthase is present in the particulate fraction of the extracts of C. tetanomorphum but requires a heat-stable factor present in the soluble fraction. This soluble factor can be replaced by GSH. 6. Cobalt porphyrin synthase in the clostridial extract is inhibited by iodoacetamide and to a smaller extent by p-chloromercuribenzoate and N-ethylmaleimide. The haem synthases of T. utilis and Micrococcus denitrificans are also inhibited by various thiol reagents.

Citric acid production and citrate synthase genes in distinct strains of ...

African Journals Online (AJOL)

SAM

2014-05-28

May 28, 2014 ... synthase in lactic acid production by A. niger and with the ... A number of microorganisms, including both bacteria and fungi, possess the capacity ..... citric acid production by solid-state fermentation from cassava bagasse and ...

Genome-wide identification, functional and evolutionary analysis of terpene synthases in pineapple.

Science.gov (United States)

Chen, Xiaoe; Yang, Wei; Zhang, Liqin; Wu, Xianmiao; Cheng, Tian; Li, Guanglin

2017-10-01

Terpene synthases (TPSs) are vital for the biosynthesis of active terpenoids, which have important physiological, ecological and medicinal value. Although terpenoids have been reported in pineapple (Ananas comosus), genome-wide investigations of the TPS genes responsible for pineapple terpenoid synthesis are still lacking. By integrating pineapple genome and proteome data, twenty-one putative terpene synthase genes were found in pineapple and divided into five subfamilies. Tandem duplication is the cause of TPS gene family duplication. Furthermore, functional differentiation between each TPS subfamily may have occurred for several reasons. Sixty-two key amino acid sites were identified as being type-II functionally divergence between TPS-a and TPS-c subfamily. Finally, coevolution analysis indicated that multiple amino acid residues are involved in coevolutionary processes. In addition, the enzyme activity of two TPSs were tested. This genome-wide identification, functional and evolutionary analysis of pineapple TPS genes provide a new insight into understanding the roles of TPS family and lay the basis for further characterizing the function and evolution of TPS gene family. Copyright © 2017 Elsevier Ltd. All rights reserved.

Vitamin D3 deficiency increases DNA damage and modify the expression of genes associated with hypertension in normotensive and hypertensive rats

Directory of Open Access Journals (Sweden)

Carla Silva Machado

2015-05-01

Full Text Available Vitamin D3 is a lipophilic micronutrient obtained from the diet (salmon, sardines, mackerel and cod liver oil or by the conversion of 7-dehydrocholesterol on skin after exposure to UVB radiation. This vitamin participates in several cellular processes, contributes to the maintenance of calcium concentrations, acts on phosphorus absorption, and is also related to the development and progression of chronic diseases. In hypertension, it is known that vitamin D3 act on renin-angiotensin-aldosterone system, regulates the gene expression and can induce or attenuate oxidative DNA damage. Vitamin D3 deficiency is present in 30-50% of human population (Pilz et al., 2009, and has been associated with increase of chromosomal instability and DNA damage (Nair-Shalliker; Armstrong; Fenech, 2012. Since experimental and clinical studies have suggested a relationship between vitamin D3 and blood pressure, the aim of this study was to evaluate whether vitamin D3 deficiency or supplementation lead to an increase or decrease in DNA damage, regulates the expression of genes associated with hypertension and changes the systolic blood pressure. Spontaneously hypertensive rats (SHR, used as a model of human essential hypertension, and their normotensive controls (Wistar Kyoto – WKY were fed a control diet (vitamin D3 at 1.000 UI/kg, a deficient diet (vitamin D3 at 0 UI/kg or a supplemented diet (vitamin D3 at 10.000 UI/kg for 12 weeks. DNA damage was assessed by comet assay in cardiac muscle tissue and blood tissue, following the methodology proposed by Singh et al. (1988 and Tice et al. (2000; gene expression of 84 genes was assessed by RT2ProfilerTM PCR Array in cardiac muscle tissue; and systolic blood pressure was measured weekly by a noninvasive method using tail plethysmography. In SHR and WKY rats, vitamin D3 deficiency increased DNA damage in the blood tissue and did not change the DNA damage in cardiac muscle tissue; vitamin D3 supplementation maintained the

Association of a neuronal nitric oxide synthase gene polymorphism with levodopa-induced dyskinesia in Parkinson's disease.

Science.gov (United States)

Santos-Lobato, Bruno Lopes; Borges, Vanderci; Ferraz, Henrique Ballalai; Mata, Ignacio Fernandez; Zabetian, Cyrus P; Tumas, Vitor

2018-04-01

Levodopa-induced dyskinesia (LID) is a common complication of advanced Parkinson's disease (PD). PD physiopathology is associated with dopaminergic and non-dopaminergic pathways, including the nitric oxide system. The present study aims to examine the association of a neuronal nitric oxide synthase gene (NOS1) single nucleotide polymorphism (rs2682826) with LID in PD patients. We studied 186 PD patients using levodopa. The presence of LID was defined as a MDS-UPDRS Part IV score ≥1 on item 4.1. We tested for association between NOS1 rs2682826 and the presence, daily frequency, and functional impact of LID using regression models, adjusting for important covariates. There was no significant association between genotype and any of the LID-related variables examined. Our results suggest that this NOS1 polymorphism does not contribute to LID susceptibility or severity. However, additional studies that include a comprehensive set of NOS1 variants will be needed to fully define the role of this gene in LID. Copyright © 2017 Elsevier Inc. All rights reserved.

Aspirin inhibits interleukin 1-induced prostaglandin H synthase expression in cultured endothelial cells

International Nuclear Information System (INIS)

Wu, K.K.; Sanduja, R.; Tsai, A.L.; Ferhanoglu, B.; Loose-Mitchell, D.S.

1991-01-01

Prostaglandin H (PGH) synthase is a key enzyme in the biosynthesis of prostaglandins, thromboxane, and prostacyclin. In cultured human umbilical vein endothelial cells, interleukin 1 (IL-1) is known to induce the synthesis of this enzyme, thereby raising the level of PGH synthase protein severalfold over the basal level. Pretreatment with aspirin at low concentrations inhibited more than 60% of the enzyme mass and also the cyclooxygenase activity in IL-1-induced cells with only minimal effects on the basal level of the synthase enzyme in cells without IL-1. Sodium salicylate exhibited a similar inhibitory action whereas indomethacin had no apparent effect. Similarly low levels of aspirin inhibited the increased L-[ 35 S]methionine incorporation into PGH synthase that was induced by IL0-1 and also suppressed expression of the 2.7-kilobase PGH synthase mRNA. These results suggest that in cultured endothelial cells a potent inhibition of eicosanoid biosynthetic capacity can be effected by aspirin or salicylate at the level of PGH synthase gene expression. The aspirin effect may well be due to degradation of salicylate

The phosphatidylinositol synthase gene (GhPIS) contributes to longer, stronger, and finer fibers in cotton.

Science.gov (United States)

Long, Qin; Yue, Fang; Liu, Ruochen; Song, Shuiqing; Li, Xianbi; Ding, Bo; Yan, Xingying; Pei, Yan

2018-05-11

Cotton fibers are the most important natural raw material used in textile industries world-wide. Fiber length, strength, and fineness are the three major traits which determine the quality and economic value of cotton. It is known that exogenous application of phosphatidylinositols (PtdIns), important structural phospholipids, can promote cotton fiber elongation. Here, we sought to increase the in planta production of PtdIns to improve fiber traits. Transgenic cotton plants were generated in which the expression of a cotton phosphatidylinositol synthase gene (i.e., GhPIS) was controlled by the fiber-specific SCFP promoter element, resulting in the specific up-regulation of GhPIS during cotton fiber development. We demonstrate that PtdIns content was significantly enhanced in transgenic cotton fibers and the elevated level of PtdIns stimulated the expression of genes involved in PtdIns phosphorylation as well as promoting lignin/lignin-like phenolic biosynthesis. Fiber length, strength and fineness were also improved in the transgenic plants as compared to the wild-type cotton, with no loss in overall fiber yield. Our data indicate that fiber-specific up-regulation of PtdIns synthesis is a promising strategy for cotton fiber quality improvement.

Sunflower (Helianthus annuus) fatty acid synthase complex: enoyl-[acyl carrier protein]-reductase genes.

Science.gov (United States)

González-Thuillier, Irene; Venegas-Calerón, Mónica; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique

2015-01-01

Enoyl-[acyl carrier protein]-reductases from sunflower. A major factor contributing to the amount of fatty acids in plant oils are the first steps of their synthesis. The intraplastidic fatty acid biosynthetic pathway in plants is catalysed by type II fatty acid synthase (FAS). The last step in each elongation cycle is carried out by the enoyl-[ACP]-reductase, which reduces the dehydrated product of β-hydroxyacyl-[ACP] dehydrase using NADPH or NADH. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus) seeds, two enoyl-[ACP]-reductase genes have been identified and cloned from developing seeds with 75 % identity: HaENR1 (GenBank HM021137) and HaENR2 (HM021138). The two genes belong to the ENRA and ENRB families in dicotyledons, respectively. The genetic duplication most likely originated after the separation of di- and monocotyledons. RT-qPCR revealed distinct tissue-specific expression patterns. Highest expression of HaENR1 was in roots, stems and developing cotyledons whereas that of H a ENR2 was in leaves and early stages of seed development. Genomic DNA gel blot analyses suggest that both are single-copy genes. In vivo activity of the ENR enzymes was tested by complementation experiments with the JP1111 fabI(ts) E. coli strain. Both enzymes were functional demonstrating that they interacted with the bacterial FAS components. That different fatty acid profiles resulted infers that the two Helianthus proteins have different structures, substrate specificities and/or reaction rates. The latter possibility was confirmed by in vitro analysis with affinity-purified heterologous-expressed enzymes that reduced the crotonyl-CoA substrate using NADH with different V max.

SEQUENCE OF THE STRUCTURAL GENE FOR GRANULE-BOUND STARCH SYNTHASE OF POTATO (SOLANUM-TUBEROSUM L) AND EVIDENCE FOR A SINGLE POINT DELETION IN THE AMF ALLELE

NARCIS (Netherlands)

van der Leij, Feike R.; VISSER, RGF; Ponstein, Anne S.; Jacobsen, Evert; Feenstra, Willem

The genomic sequence of the potato gene for starch granule-bound starch synthase (GBSS; "waxy protein") has been determined for the wild-type allele of a monoploid genotype from which an amylose-free (amf) mutant was derived, and for the mutant part of the amf allele. Comparison of the wild-type

Genome-wide analysis of the cellulose synthase-like (Csl) gene family in bread wheat (Triticum aestivum L.).

Science.gov (United States)

Kaur, Simerjeet; Dhugga, Kanwarpal S; Beech, Robin; Singh, Jaswinder

2017-11-03

Hemicelluloses are a diverse group of complex, non-cellulosic polysaccharides, which constitute approximately one-third of the plant cell wall and find use as dietary fibres, food additives and raw materials for biofuels. Genes involved in hemicellulose synthesis have not been extensively studied in small grain cereals. In efforts to isolate the sequences for the cellulose synthase-like (Csl) gene family from wheat, we identified 108 genes (hereafter referred to as TaCsl). Each gene was represented by two to three homeoalleles, which are named as TaCslXY_ZA, TaCslXY_ZB, or TaCslXY_ZD, where X denotes the Csl subfamily, Y the gene number and Z the wheat chromosome where it is located. A quarter of these genes were predicted to have 2 to 3 splice variants, resulting in a total of 137 putative translated products. Approximately 45% of TaCsl genes were located on chromosomes 2 and 3. Sequences from the subfamilies C and D were interspersed between the dicots and grasses but those from subfamily A clustered within each group of plants. Proximity of the dicot-specific subfamilies B and G, to the grass-specific subfamilies H and J, respectively, points to their common origin. In silico expression analysis in different tissues revealed that most of the genes were expressed ubiquitously and some were tissue-specific. More than half of the genes had introns in phase 0, one-third in phase 2, and a few in phase 1. Detailed characterization of the wheat Csl genes has enhanced the understanding of their structural, functional, and evolutionary features. This information will be helpful in designing experiments for genetic manipulation of hemicellulose synthesis with the goal of developing improved cultivars for biofuel production and increased tolerance against various stresses.

Alternative splicing of the porcine glycogen synthase kinase 3β (GSK-3β gene with differential expression patterns and regulatory functions.

Directory of Open Access Journals (Sweden)

Linjie Wang

Full Text Available Glycogen synthase kinase 3 (GSK3α and GSK3β are serine/threonine kinases involved in numerous cellular processes and diverse diseases including mood disorders, Alzheimer's disease, diabetes, and cancer. However, in pigs, the information on GSK3 is very limited. Identification and characterization of pig GSK3 are not only important for pig genetic improvement, but also contribute to the understanding and development of porcine models for human disease prevention and treatment.Five different isoforms of GSK3β were identified in porcine different tissues, in which three isoforms are novel. These isoforms had differential expression patterns in the fetal and adult of the porcine different tissues. The mRNA expression level of GSK3β isoforms was differentially regulated during the course of the insulin treatment, suggesting that different GSK3β isoforms may have different roles in insulin signaling pathway. Moreover, GSK3β5 had a different role on regulating the glycogen synthase activity, phosphorylation and the expression of porcine GYS1 and GYS2 gene compared to other GSK3β isoforms.We are the first to report five different isoforms of GSK3β identified from the porcine different tissues. Splice variants of GSK3β exhibit differential activity towards glycogen synthase. These results provide new insight into roles of the GSK3β on regulating glycogen metabolism.

Enhanced growth and improved vascular function in offspring from successive pregnancies in endothelial nitric oxide synthase knockout mice

NARCIS (Netherlands)

Longo, M; Jain, [No Value; Langenveld, J; Vedernikov, YP; Garfield, RE; Hankins, GDV; Anderson, GD; Saade, GR

2004-01-01

Objective: Transgenic mice that lack endothelial nitric oxide synthase have offspring with growth deficiency and abnormal vascular reactivity in later life. Our objective was to evaluate the role of parity in the modulation of the fetal programming of growth and vascular responses in these

Cyclophilin D Promotes Brain Mitochondrial F1FO ATP Synthase Dysfunction in Aging Mice.

Science.gov (United States)

Gauba, Esha; Guo, Lan; Du, Heng

2017-01-01

Brain aging is the known strongest risk factor for Alzheimer's disease (AD). In recent years, mitochondrial deficits have been proposed to be a common mechanism linking brain aging to AD. Therefore, to elucidate the causative mechanisms of mitochondrial dysfunction in aging brains is of paramount importance for our understanding of the pathogenesis of AD, in particular its sporadic form. Cyclophilin D (CypD) is a specific mitochondrial protein. Recent studies have shown that F1FO ATP synthase oligomycin sensitivity conferring protein (OSCP) is a binding partner of CypD. The interaction of CypD with OSCP modulates F1FO ATP synthase function and mediates mitochondrial permeability transition pore (mPTP) opening. Here, we have found that increased CypD expression, enhanced CypD/OSCP interaction, and selective loss of OSCP are prominent brain mitochondrial changes in aging mice. Along with these changes, brain mitochondria from the aging mice demonstrated decreased F1FO ATP synthase activity and defective F1FO complex coupling. In contrast, CypD deficient mice exhibited substantially mitigated brain mitochondrial F1FO ATP synthase dysfunction with relatively preserved mitochondrial function during aging. Interestingly, the aging-related OSCP loss was also dramatically attenuated by CypD depletion. Therefore, the simplest interpretation of this study is that CypD promotes F1FO ATP synthase dysfunction and the resultant mitochondrial deficits in aging brains. In addition, in view of CypD and F1FO ATP synthase alterations seen in AD brains, the results further suggest that CypD-mediated F1FO ATP synthase deregulation is a shared mechanism linking mitochondrial deficits in brain aging and AD.

SIRT3 deacetylates ATP synthase F1 complex proteins in response to nutrient- and exercise-induced stress.

Science.gov (United States)

Vassilopoulos, Athanassios; Pennington, J Daniel; Andresson, Thorkell; Rees, David M; Bosley, Allen D; Fearnley, Ian M; Ham, Amy; Flynn, Charles Robb; Hill, Salisha; Rose, Kristie Lindsey; Kim, Hyun-Seok; Deng, Chu-Xia; Walker, John E; Gius, David

2014-08-01

Adenosine triphosphate (ATP) synthase uses chemiosmotic energy across the inner mitochondrial membrane to convert adenosine diphosphate and orthophosphate into ATP, whereas genetic deletion of Sirt3 decreases mitochondrial ATP levels. Here, we investigate the mechanistic connection between SIRT3 and energy homeostasis. By using both in vitro and in vivo experiments, we demonstrate that ATP synthase F1 proteins alpha, beta, gamma, and Oligomycin sensitivity-conferring protein (OSCP) contain SIRT3-specific reversible acetyl-lysines that are evolutionarily conserved and bind to SIRT3. OSCP was further investigated and lysine 139 is a nutrient-sensitive SIRT3-dependent deacetylation target. Site directed mutants demonstrate that OSCP(K139) directs, at least in part, mitochondrial ATP production and mice lacking Sirt3 exhibit decreased ATP muscle levels, increased ATP synthase protein acetylation, and an exercise-induced stress-deficient phenotype. This work connects the aging and nutrient response, via SIRT3 direction of the mitochondrial acetylome, to the regulation of mitochondrial energy homeostasis under nutrient-stress conditions by deacetylating ATP synthase proteins. Our data suggest that acetylome signaling contributes to mitochondrial energy homeostasis by SIRT3-mediated deacetylation of ATP synthase proteins.

Suppressing Farnesyl Diphosphate Synthase Alters Chloroplast Development and Triggers Sterol-Dependent Induction of Jasmonate- and Fe-Related Responses1[OPEN

Science.gov (United States)

Andrade, Paola; Caudepón, Daniel; Arró, Montserrat

2016-01-01

Farnesyl diphosphate synthase (FPS) catalyzes the synthesis of farnesyl diphosphate from isopentenyl diphosphate and dimethylallyl diphosphate. Arabidopsis (Arabidopsis thaliana) contains two genes (FPS1 and FPS2) encoding FPS. Single fps1 and fps2 knockout mutants are phenotypically indistinguishable from wild-type plants, while fps1/fps2 double mutants are embryo lethal. To assess the effect of FPS down-regulation at postembryonic developmental stages, we generated Arabidopsis conditional knockdown mutants expressing artificial microRNAs devised to simultaneously silence both FPS genes. Induction of silencing from germination rapidly caused chlorosis and a strong developmental phenotype that led to seedling lethality. However, silencing of FPS after seed germination resulted in a slight developmental delay only, although leaves and cotyledons continued to show chlorosis and altered chloroplasts. Metabolomic analyses also revealed drastic changes in the profile of sterols, ubiquinones, and plastidial isoprenoids. RNA sequencing and reverse transcription-quantitative polymerase chain reaction transcriptomic analysis showed that a reduction in FPS activity levels triggers the misregulation of genes involved in biotic and abiotic stress responses, the most prominent one being the rapid induction of a set of genes related to the jasmonic acid pathway. Down-regulation of FPS also triggered an iron-deficiency transcriptional response that is consistent with the iron-deficient phenotype observed in FPS-silenced plants. The specific inhibition of the sterol biosynthesis pathway by chemical and genetic blockage mimicked these transcriptional responses, indicating that sterol depletion is the primary cause of the observed alterations. Our results highlight the importance of sterol homeostasis for normal chloroplast development and function and reveal important clues about how isoprenoid and sterol metabolism is integrated within plant physiology and development. PMID

The subcellular localization of yeast glycogen synthase is dependent upon glycogen content

OpenAIRE

Wilson, Wayne A.; Boyer, Michael P.; Davis, Keri D.; Burke, Michael; Roach, Peter J.

2010-01-01

The budding yeast, Saccharomyces cerevisiae, accumulates the storage polysaccharide glycogen in response to nutrient limitation. Glycogen synthase, the major form of which is encoded by the GSY2 gene, catalyzes the key regulated step in glycogen storage. Here, we utilize Gsy2p fusions to green fluorescent protein (GFP) to determine where glycogen synthase is located within cells. We demonstrate that the localization pattern of Gsy2-GFP depends upon the glycogen content of the cell. When glyco...

Suppressing Farnesyl Diphosphate Synthase Alters Chloroplast Development and Triggers Sterol-Dependent Induction of Jasmonate- and Fe-Related Responses.

Science.gov (United States)

Manzano, David; Andrade, Paola; Caudepón, Daniel; Altabella, Teresa; Arró, Montserrat; Ferrer, Albert

2016-09-01

Farnesyl diphosphate synthase (FPS) catalyzes the synthesis of farnesyl diphosphate from isopentenyl diphosphate and dimethylallyl diphosphate. Arabidopsis (Arabidopsis thaliana) contains two genes (FPS1 and FPS2) encoding FPS. Single fps1 and fps2 knockout mutants are phenotypically indistinguishable from wild-type plants, while fps1/fps2 double mutants are embryo lethal. To assess the effect of FPS down-regulation at postembryonic developmental stages, we generated Arabidopsis conditional knockdown mutants expressing artificial microRNAs devised to simultaneously silence both FPS genes. Induction of silencing from germination rapidly caused chlorosis and a strong developmental phenotype that led to seedling lethality. However, silencing of FPS after seed germination resulted in a slight developmental delay only, although leaves and cotyledons continued to show chlorosis and altered chloroplasts. Metabolomic analyses also revealed drastic changes in the profile of sterols, ubiquinones, and plastidial isoprenoids. RNA sequencing and reverse transcription-quantitative polymerase chain reaction transcriptomic analysis showed that a reduction in FPS activity levels triggers the misregulation of genes involved in biotic and abiotic stress responses, the most prominent one being the rapid induction of a set of genes related to the jasmonic acid pathway. Down-regulation of FPS also triggered an iron-deficiency transcriptional response that is consistent with the iron-deficient phenotype observed in FPS-silenced plants. The specific inhibition of the sterol biosynthesis pathway by chemical and genetic blockage mimicked these transcriptional responses, indicating that sterol depletion is the primary cause of the observed alterations. Our results highlight the importance of sterol homeostasis for normal chloroplast development and function and reveal important clues about how isoprenoid and sterol metabolism is integrated within plant physiology and development. © 2016

Leaf Volatile Compounds and Associated Gene Expression during Short-Term Nitrogen Deficient Treatments in Cucumis Seedlings

Directory of Open Access Journals (Sweden)

Jie Deng

2016-11-01

Full Text Available Nitrogen (N is an important macronutrient for plant growth and development, but the regulatory mechanism of volatile compounds in response to N deficiency is not well understood, especially in cucumber, which consumes excessive N during growth. In this study, the major volatile compounds from cucumber leaves subjected to N deficiency were analyzed by GC-MS. A total of 24 volatile components were identified including 15 aldehydes, two ketones, two alkenes, and five other volatile compounds in 9930 leaves. Principal component analysis using volatile compounds from cucumber leaves provided good separation between N-sufficient and N-deficient treatments. The main volatiles in cucumber leaves were found to be C6 and C9 aldehydes, especially (E-2-hexanal and (E,Z-2,6-nonadienal. (E-2-hexanal belonged to the C6 aldehyde and was the most abundant compound, whereas (E,Z-2,6-nonadienal was the chief component of C9 aldehydes. During N-deficient treatment, short-chain volatile content was significantly improved at 5 day, other volatiles displayed significant reduction or no significantly changes in all sampling points. Improvement of short-chain volatiles was confirmed in the six other inbred lines at 5 day after N-deficient treatments. The expression analysis of 12 cucumber LOX genes and two HPL genes revealed that CsLOX19, CsLOX20, and CsLOX22 had common up-regulated expression patterns in response to N-deficient stress in most inbred lines; meanwhile, most sample points of CsHPL1 also had significant up-regulated expression patterns. This research focused on the relationship between volatiles in cucumber and different nitrogen environments to provide valuable insight into the effect of cultivation and management of the quality of cucumber and contributes to further research on volatile metabolism in cucumber.

Deficiency of the Erc/mesothelin gene ameliorates renal carcinogenesis in Tsc2 knockout mice.

Science.gov (United States)

Zhang, Danqing; Kobayashi, Toshiyuki; Kojima, Tetsuo; Kanenishi, Kenji; Hagiwara, Yoshiaki; Abe, Masaaki; Okura, Hidehiro; Hamano, Yoshitomo; Sun, Guodong; Maeda, Masahiro; Jishage, Kou-ichi; Noda, Tetsuo; Hino, Okio

2011-04-01

Genetic crossing experiments were performed between tuberous sclerosis-2 (Tsc2) KO and expressed in renal carcinoma (Erc) KO mice to analyze the function of the Erc/mesothelin gene in renal carcinogenesis. We found the number and size of renal tumors were significantly less in Tsc2+/-;Erc-/- mice than in Tsc2+/-;Erc+/+ and Tsc2+/-;Erc+/- mice. Tumors from Tsc2+/-;Erc-/- mice exhibited reduced cell proliferation and increased apoptosis, as determined by proliferating cell nuclear antigen (Ki67) and TUNEL analysis, respectively. Adhesion to collagen-coated plates in vitro was enhanced in Erc-restored cells and decreased in Erc-suppressed cells with siRNA. Tumor formation by Tsc2-deficient cells in nude mice was remarkably suppressed by stable knockdown of Erc with shRNA. Western blot analysis showed that the phosphorylation of focal adhesion kinase, Akt and signal transducer and activator of transcription protein 3 were weaker in Erc-deficient/suppressed cells compared with Erc-expressed cells. These results indicate that deficiency of the Erc/mesothelin gene ameliorates renal carcinogenesis in Tsc2 KO mice and inhibits the phosphorylation of several kinases of cell adhesion mechanism. This suggests that Erc/mesothelin may have an important role in the promotion and/or maintenance of carcinogenesis by influencing cell-substrate adhesion via the integrin-related signal pathway. © 2011 Japanese Cancer Association.

Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase

International Nuclear Information System (INIS)

Dotson, G.D.; Woodard, R.W.

1994-01-01

The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3 2 H)PEP, (2- 13 C)PEP, and (2- 13 C, 18 O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our 1 H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3- 2 H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3- 2 H)PEP gave predominantly (3S)-(3 2 H)KDO 8-P and (E)-(3- 2 H)PEP gave predominantly (3R)-(3 2 H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2- 13 C, 18 O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both 13 C- and 31 P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the 18 O

Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase

Energy Technology Data Exchange (ETDEWEB)

Dotson, G.D.; Woodard, R.W. [Univ. of Michigan, Ann Arbor, MI (United States)

1994-12-01

The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3{sup 2}H)PEP, (2-{sup 13}C)PEP, and (2-{sup 13}C,{sup 18}O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our {sup 1}H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3-{sup 2}H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3-{sup 2}H)PEP gave predominantly (3S)-(3{sup 2}H)KDO 8-P and (E)-(3-{sup 2}H)PEP gave predominantly (3R)-(3{sup 2}H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2-{sup 13}C, {sup 18}O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both {sup 13}C- and {sup 31}P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the {sup 18}O.

Role of heteroplasmic mutations in the mitochondrial genome and the ID4 gene promoter methylation region in the pathogenesis of chronic aplastic anemia in patients suffering from Kidney yin deficiency.

Science.gov (United States)

Cui, Xing; Wang, Jing-Yi; Liu, Kui; Cui, Si-Yuan; Zhang, Jie; Luo, Ya-Qin; Wang, Xin

2016-06-01

To analyze changes in gene amplification in the mitochondrial genome and in the ID4 gene promoter methylation region in patients with chronic aplastic anemia (CAA) suffering from Kidney (Shen) yin deficiency or Kidney yang deficiency. Bone marrow and oral epithelium samples were collected from CAA patients with Kidney yin deficiency or Kidney yang deficiency (20 cases). Bone marrow samples were collected from 20 healthy volunteers. The mitochondrial genome was amplified by polymerase chain reaction (PCR), and PCR products were used for sequencing and analysis. Higher mutational rates were observed in the ND1-2, ND4-6, and CYTB genes in CAA patients suffering from Kidney yin deficiency. Moreover, the ID4 gene was unmethylated in bone marrow samples from healthy individuals, but was methylated in some CAA patients suffering from Kidney yin deficiency (positive rate, 60%) and Kidney yang deficiency (positive rate, 55%). These data supported that gene mutations can alter the expression of respiratory chain enzyme complexes in CAA patients, resulting in energy metabolism impairment and promoting the physiological and pathological processes of hematopoietic failure. Functional impairment of the mitochondrial respiration chain induced by gene mutation may be an important reason for hematopoietic failure in patients with CAA. This change is closely related to maternal inheritance and Kidney yin deficiency. Finally, these data supported the assertion that it is easy to treat disease in patients suffering from yang deficiency and difficult to treat disease in patients suffering from yin deficiency.

Glycine N-methyltransferase deficiency: a novel inborn error causing persistent isolated hypermethioninaemia.

NARCIS (Netherlands)

Mudd, S.H.; Cerone, R.; Schiaffino, M.C.; Fantasia, A.R.; Minniti, G.; Caruso, U.; Lorini, R.; Watkins, D.; Matiaszuk, N.; Rosenblatt, D.S.; Schwahn, B.; Rozen, R.; Gros, L. Le; Kotb, M.; Capdevila, A.; Luka, Z.; Finkelstein, J.; Tangerman, A.; Stabler, S.P.; Allen, R.; Wagner, C.

2001-01-01

This paper reports clinical and metabolic studies of two Italian siblings with a novel form of persistent isolated hypermethioninaemia, i.e. abnormally elevated plasma methionine that lasted beyond the first months of life and is not due to cystathionine beta-synthase deficiency, tyrosinaemia I or

Silybin content and overexpression of chalcone synthase genes in Silybum marianum L. plants under abiotic elicitation.

Science.gov (United States)

El-Garhy, Hoda A S; Khattab, Salah; Moustafa, Mahmoud M A; Abou Ali, Rania; Abdel Azeiz, Ahmed Z; Elhalwagi, Abeer; El Sherif, Fadia

2016-11-01

Silymarin, a Silybum marianum seed extract containing a mixture of flavonolignans including silybin, is being used as an antihepatotoxic therapy for liver diseases. In this study, the enhancing effect of gamma irradiation on plant growth parameters of S. marianum under salt stress was investigated. The effect of gamma irradiation, either as a single elicitor or coupled with salinity, on chalcone synthase (CHS) gene expression and silybin A + B yield was also evaluated. The silybin A + B content in S. marianum fruits was estimated by liquid chromatography-mass spectrometry (LC-MS/MS). An increase in silybin content was accompanied by up-regulation of the CHS1, CHS2 and CHS3 genes, which are involved in the silybin biosynthetic pathway. The highest silybin A + B production (0.77 g/100 g plant DW) and transcript levels of the three studied genes (100.2-, 91.9-, and 24.3-fold increase, respectively) were obtained with 100GY gamma irradiation and 4000 ppm salty water. The CHS2 and CHS3 genes were partially sequenced and submitted to the NCBI database under the accession numbers KT252908.1 and KT252909.1, respectively. Developing new approaches to stimulate silybin biosynthetic pathways could be a useful tool to potentiate the use of plants as renewable resources of medicinal compounds. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Chalcone Synthase (CHS) Gene Suppression in Flax Leads to Changes in Wall Synthesis and Sensing Genes, Cell Wall Chemistry and Stem Morphology Parameters

Science.gov (United States)

Zuk, Magdalena; Działo, Magdalena; Richter, Dorota; Dymińska, Lucyna; Matuła, Jan; Kotecki, Andrzej; Hanuza, Jerzy; Szopa, Jan

2016-01-01

The chalcone synthase (CHS) gene controls the first step in the flavonoid biosynthesis. In flax, CHS down-regulation resulted in tannin accumulation and reduction in lignin synthesis, but plant growth was not affected. This suggests that lignin content and thus cell wall characteristics might be modulated through CHS activity. This study investigated the possibility that CHS affects cell wall sensing as well as polymer content and arrangement. CHS-suppressed and thus lignin-reduced plants showed significant changes in expression of genes involved in both synthesis of components and cell wall sensing. This was accompanied by increased levels of cellulose and hemicellulose. CHS-reduced flax also showed significant changes in morphology and arrangement of the cell wall. The stem tissue layers were enlarged averagely twofold compared to the control, and the number of fiber cells more than doubled. The stem morphology changes were accompanied by reduction of the crystallinity index of the cell wall. CHS silencing induces a signal transduction cascade that leads to modification of plant metabolism in a wide range and thus cell wall structure. PMID:27446124

Prolonged pancytopenia in a gene therapy patient with ADA-deficient SCID and trisomy 8 mosaicism: a case report.

Science.gov (United States)

Engel, Barbara C; Podsakoff, Greg M; Ireland, Joanna L; Smogorzewska, E Monika; Carbonaro, Denise A; Wilson, Kathy; Shah, Ami; Kapoor, Neena; Sweeney, Mirna; Borchert, Mark; Crooks, Gay M; Weinberg, Kenneth I; Parkman, Robertson; Rosenblatt, Howard M; Wu, Shi-Qi; Hershfield, Michael S; Candotti, Fabio; Kohn, Donald B

2007-01-15

A patient with adenosine deaminase-deficient severe combined immune deficiency (ADA-SCID) was enrolled in a study of retroviral-mediated ADA gene transfer to bone marrow hematopoietic stem cells. After the discontinuation of ADA enzyme replacement, busulfan (75 mg/m2) was administered for bone marrow cytoreduction, followed by infusion of autologous, gene-modified CD34+ cells. The expected myelosuppression developed after busulfan but then persisted, necessitating the administration of untransduced autologous bone marrow back-up at day 40. Because of sustained pancytopenia and negligible gene marking, diagnostic bone marrow biopsy and aspirate were performed at day 88. Analyses revealed hypocellular marrow and, unexpectedly, evidence of trisomy 8 in 21.6% of cells. Trisomy 8 mosaicism (T8M) was subsequently diagnosed by retrospective analysis of a pretreatment marrow sample that might have caused the lack of hematopoietic reconstitution. The confounding effects of this preexisting marrow cytogenetic abnormality on the response to gene transfer highlights another challenge of gene therapy with the use of autologous hematopoietic stem cells.

Genetics Home Reference: N-acetylglutamate synthase deficiency

Science.gov (United States)

... belongs to a class of genetic diseases called urea cycle disorders. The urea cycle is a sequence of reactions ... Other Diagnosis and Management Resources (3 links) GeneReview: Urea Cycle Disorders Overview MedlinePlus Encyclopedia: Hereditary Urea Cycle Abnormality National ...

of endothelial nitric oxide synthase gene and serum level of vascular ...

African Journals Online (AJOL)

uwerhiavwe

Davignon and Ganz, 2004). NO is synthe- sized via a reaction that includes the conversion of L- arginine to L-citruline catalyzed by endothelial nitric oxide synthase (eNOS), which is one of the three isoforms of the enzyme (Mayer and Hemmens, 1997) ...

Factors influencing gene silencing of granule-bound starch synthase in potato

NARCIS (Netherlands)

Heilersig, H.J.B.

2005-01-01

In the past, antisense RNA technology was used to modify the composition of potato tuber starch. Potato starch comprises amylose and amylopectin, polymers of glucose. Amylose production in potato is completely dependent on the presence of granule-bound starch synthase I (GBSSI). Inhibition of GBSSI

Defective bone formation and anabolic response to exogenous estrogen in mice with targeted disruption of endothelial nitric oxide synthase.

Science.gov (United States)

Armour, K E; Armour, K J; Gallagher, M E; Gödecke, A; Helfrich, M H; Reid, D M; Ralston, S H

2001-02-01

Nitric oxide (NO) is a pleiotropic signaling molecule that is produced by bone cells constitutively and in response to diverse stimuli such as proinflammatory cytokines, mechanical strain, and sex hormones. Endothelial nitric oxide synthase (eNOS) is the predominant NOS isoform expressed in bone, but its physiological role in regulating bone metabolism remains unclear. Here we studied various aspects of bone metabolism in female mice with targeted disruption of the eNOS gene. Mice with eNOS deficiency (eNOS KO) had reduced bone mineral density, and cortical thinning when compared with WT controls and histomorphometric analysis of bone revealed profound abnormalities of bone formation, with reduced osteoblast numbers, surfaces and mineral apposition rate. Studies in vitro showed that osteoblasts derived from eNOS KO mice had reduced rates of growth when compared with WT and were less well differentiated as reflected by lower levels of alkaline phosphatase activity. Mice with eNOS deficiency lost bone normally following ovariectomy but exhibited a significantly blunted anabolic response to high dose exogenous estrogen. We conclude that the eNOS pathway plays an essential role in regulating bone mass and bone turnover by modulating osteoblast function.

Iron Refractory Iron Deficiency Anaemia: A Rare Cause of Iron Deficiency Anaemia

LENUS (Irish Health Repository)

McGrath, T

2018-01-01

We describe the case of a 17-month-old boy with a hypochromic microcytic anaemia, refractory to oral iron treatment. After exclusion of dietary and gastrointestinal causes of iron deficiency, a genetic cause for iron deficiency was confirmed by finding two mutations in the TMPRSS6 gene, consistent with a diagnosis of iron-refractory iron deficiency anaemia (IRIDA).

A high-throughput colorimetric screening assay for terpene synthase activity based on substrate consumption.

Directory of Open Access Journals (Sweden)

Maiko Furubayashi

Full Text Available Terpene synthases catalyze the formation of a variety of terpene chemical structures. Systematic mutagenesis studies have been effective in providing insights into the characteristic and complex mechanisms of C-C bond formations and in exploring the enzymatic potential for inventing new chemical structures. In addition, there is growing demand to increase terpene synthase activity in heterologous hosts, given the maturation of metabolic engineering and host breeding for terpenoid synthesis. We have developed a simple screening method for the cellular activities of terpene synthases by scoring their substrate consumption based on the color loss of the cell harboring carotenoid pathways. We demonstrate that this method can be used to detect activities of various terpene synthase or prenyltransferase genes in a high-throughput manner, irrespective of the product type, enabling the mutation analysis and directed evolution of terpene synthases. We also report the possibility for substrate-specific screening system of terpene synthases by taking advantage of the substrate-size specificity of C30 and C40 carotenoid pathways.

Sunflower (Helianthus annuus) fatty acid synthase complex: β-hydroxyacyl-[acyl carrier protein] dehydratase genes.

Science.gov (United States)

González-Thuillier, Irene; Venegas-Calerón, Mónica; Sánchez, Rosario; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique

2016-02-01

Two sunflower hydroxyacyl-[acyl carrier protein] dehydratases evolved into two different isoenzymes showing distinctive expression levels and kinetics' efficiencies. β-Hydroxyacyl-[acyl carrier protein (ACP)]-dehydratase (HAD) is a component of the type II fatty acid synthase complex involved in 'de novo' fatty acid biosynthesis in plants. This complex, formed by four intraplastidial proteins, is responsible for the sequential condensation of two-carbon units, leading to 16- and 18-C acyl-ACP. HAD dehydrates 3-hydroxyacyl-ACP generating trans-2-enoyl-ACP. With the aim of a further understanding of fatty acid biosynthesis in sunflower (Helianthus annuus) seeds, two β-hydroxyacyl-[ACP] dehydratase genes have been cloned from developing seeds, HaHAD1 (GenBank HM044767) and HaHAD2 (GenBank GU595454). Genomic DNA gel blot analyses suggest that both are single copy genes. Differences in their expression patterns across plant tissues were detected. Higher levels of HaHAD2 in the initial stages of seed development inferred its key role in seed storage fatty acid synthesis. That HaHAD1 expression levels remained constant across most tissues suggest a housekeeping function. Heterologous expression of these genes in E. coli confirmed both proteins were functional and able to interact with the bacterial complex 'in vivo'. The large increase of saturated fatty acids in cells expressing HaHAD1 and HaHAD2 supports the idea that these HAD genes are closely related to the E. coli FabZ gene. The proposed three-dimensional models of HaHAD1 and HaHAD2 revealed differences at the entrance to the catalytic tunnel attributable to Phe166/Val1159, respectively. HaHAD1 F166V was generated to study the function of this residue. The 'in vitro' enzymatic characterization of the three HAD proteins demonstrated all were active, with the mutant having intermediate K m and V max values to the wild-type proteins.

Citrate synthase gene sequence: a new tool for phylogenetic analysis and identification of Ehrlichia.

Science.gov (United States)

Inokuma, H; Brouqui, P; Drancourt, M; Raoult, D

2001-09-01

The sequence of the citrate synthase gene (gltA) of 13 ehrlichial species (Ehrlichia chaffeensis, Ehrlichia canis, Ehrlichia muris, an Ehrlichia species recently detected from Ixodes ovatus, Cowdria ruminantium, Ehrlichia phagocytophila, Ehrlichia equi, the human granulocytic ehrlichiosis [HGE] agent, Anaplasma marginale, Anaplasma centrale, Ehrlichia sennetsu, Ehrlichia risticii, and Neorickettsia helminthoeca) have been determined by degenerate PCR and the Genome Walker method. The ehrlichial gltA genes are 1,197 bp (E. sennetsu and E. risticii) to 1,254 bp (A. marginale and A. centrale) long, and GC contents of the gene vary from 30.5% (Ehrlichia sp. detected from I. ovatus) to 51.0% (A. centrale). The percent identities of the gltA nucleotide sequences among ehrlichial species were 49.7% (E. risticii versus A. centrale) to 99.8% (HGE agent versus E. equi). The percent identities of deduced amino acid sequences were 44.4% (E. sennetsu versus E. muris) to 99.5% (HGE agent versus E. equi), whereas the homology range of 16S rRNA genes was 83.5% (E. risticii versus the Ehrlichia sp. detected from I. ovatus) to 99.9% (HGE agent, E. equi, and E. phagocytophila). The architecture of the phylogenetic trees constructed by gltA nucleotide sequences or amino acid sequences was similar to that derived from the 16S rRNA gene sequences but showed more-significant bootstrap values. Based upon the alignment analysis of the ehrlichial gltA sequences, two sets of primers were designed to amplify tick-borne Ehrlichia and Neorickettsia genogroup Ehrlichia (N. helminthoeca, E. sennetsu, and E. risticii), respectively. Tick-borne Ehrlichia species were specifically identified by restriction fragment length polymorphism (RFLP) patterns of AcsI and XhoI with the exception of E. muris and the very closely related ehrlichia derived from I. ovatus for which sequence analysis of the PCR product is needed. Similarly, Neorickettsia genogroup Ehrlichia species were specifically identified by

Evolution of hepatic glucose metabolism: liver-specific glucokinase deficiency explained by parallel loss of the gene for glucokinase regulatory protein (GCKR.

Directory of Open Access Journals (Sweden)

Zhao Yang Wang

Full Text Available Glucokinase (GCK plays an important role in the regulation of carbohydrate metabolism. In the liver, phosphorylation of glucose to glucose-6-phosphate by GCK is the first step for both glycolysis and glycogen synthesis. However, some vertebrate species are deficient in GCK activity in the liver, despite containing GCK genes that appear to be compatible with function in their genomes. Glucokinase regulatory protein (GCKR is the most important post-transcriptional regulator of GCK in the liver; it participates in the modulation of GCK activity and location depending upon changes in glucose levels. In experimental models, loss of GCKR has been shown to associate with reduced hepatic GCK protein levels and activity.GCKR genes and GCKR-like sequences were identified in the genomes of all vertebrate species with available genome sequences. The coding sequences of GCKR and GCKR-like genes were identified and aligned; base changes likely to disrupt coding potential or splicing were also identified.GCKR genes could not be found in the genomes of 9 vertebrate species, including all birds. In addition, in multiple mammalian genomes, whereas GCKR-like gene sequences could be identified, these genes could not predict a functional protein. Vertebrate species that were previously reported to be deficient in hepatic GCK activity were found to have deleted (birds and lizard or mutated (mammals GCKR genes. Our results suggest that mutation of the GCKR gene leads to hepatic GCK deficiency due to the loss of the stabilizing effect of GCKR.

Crystallization and preliminary crystallographic analysis of mannosyl-3-phosphoglycerate synthase from Rubrobacter xylanophilus

International Nuclear Information System (INIS)

Sá-Moura, Bebiana; Albuquerque, Luciana; Empadinhas, Nuno; Costa, Milton S. da; Pereira, Pedro José Barbosa; Macedo-Ribeiro, Sandra

2008-01-01

The enzyme mannosyl-3-phosphoglycerate synthase from R. xylanophilus has been expressed, purified and crystallized. The crystals belong to the hexagonal space group P6 5 22 and diffract to 2.2 Å resolution. Rubrobacter xylanophilus is the only Gram-positive bacterium known to synthesize the compatible solute mannosylglycerate (MG), which is commonly found in hyperthermophilic archaea and some thermophilic bacteria. Unlike the salt-dependent pattern of accumulation observed in (hyper)thermophiles, in R. xylanophilus MG accumulates constitutively. The synthesis of MG in R. xylanophilus was tracked from GDP-mannose and 3-phosphoglycerate, but the genome sequence of the organism failed to reveal any of the genes known to be involved in this pathway. The native enzyme was purified and its N-terminal sequence was used to identify the corresponding gene (mpgS) in the genome of R. xylanophilus. The gene encodes a highly divergent mannosyl-3-phosphoglycerate synthase (MpgS) without relevant sequence homology to known mannosylphosphoglycerate synthases. In order to understand the specificity and enzymatic mechanism of this novel enzyme, it was expressed in Escherichia coli, purified and crystallized. The crystals thus obtained belonged to the hexagonal space group P6 5 22 and contained two protein molecules per asymmetric unit. The structure was solved by SIRAS using a mercury derivative

HPRT deficiency coordinately dysregulates canonical Wnt and presenilin-1 signaling: a neuro-developmental regulatory role for a housekeeping gene?

Directory of Open Access Journals (Sweden)

Tae Hyuk Kang

2011-01-01

Full Text Available We have used microarray-based methods of global gene expression together with quantitative PCR and Western blot analysis to identify dysregulation of genes and aberrant cellular processes in human fibroblasts and in SH-SY5Y neuroblastoma cells made HPRT-deficient by transduction with a retrovirus stably expressing an shRNA targeted against HPRT. Analysis of the microarray expression data by Gene ontology (GO and Gene Set Enrichment Analysis (GSEA as well as significant pathway analysis by GeneSpring GX10 and Panther Classification System reveal that HPRT deficiency is accompanied by aberrations in a variety of pathways known to regulate neurogenesis or to be implicated in neurodegenerative disease, including the canonical Wnt/β-catenin and the Alzheimer's disease/presenilin signaling pathways. Dysregulation of the Wnt/β-catenin pathway is confirmed by Western blot demonstration of cytosolic sequestration of β-catenin during in vitro differentiation of the SH-SY5Y cells toward the neuronal phenotype. We also demonstrate that two key transcription factor genes known to be regulated by Wnt signaling and to be vital for the generation and function of dopaminergic neurons; i.e., Lmx1a and Engrailed 1, are down-regulated in the HPRT knockdown SH-SY5Y cells. In addition to the Wnt signaling aberration, we found that expression of presenilin-1 shows severely aberrant expression in HPRT-deficient SH-SY5Y cells, reflected by marked deficiency of the 23 kDa C-terminal fragment of presenilin-1 in knockdown cells. Western blot analysis of primary fibroblast cultures from two LND patients also shows dysregulated presenilin-1 expression, including aberrant proteolytic processing of presenilin-1. These demonstrations of dysregulated Wnt signaling and presenilin-1 expression together with impaired expression of dopaminergic transcription factors reveal broad pleitropic neuro-regulatory defects played by HPRT expression and suggest new directions for

Avaliação de plantas transgênicas de Petunia x hybrida contendo o gene Psag12 - ipt cultivadas sob deficiência nutricional.

Directory of Open Access Journals (Sweden)

Francine Lorena Cuquel

2001-05-01

Full Text Available Deficiência nutricional em plantas pode causar clorose, necrose, desfolha, redução do crescimento e da produtividade e senescência prematura. Aplicações xógenas de citocinina podem aliviar tais sintomas. Este estudo foi efetuado para avaliar os efeitos da produção auto-regulada de citocinina na tolerância de plantas de petúnia (Petunia x hybrida à deficiência nutricional. Um gene quimérico contendo o promotor SAG12 unido ao gene ipt, o qual codifica a produção de isopentenyl transferase, uma enzima da rota metabólica da biossíntese de citocinina, foi introduzido em petúnia através de transformação mediada por Agrobacterium. Duas plantas contendo o gene ipt foram selecionadas e autopolinizadas para obtenção das linhas a serem submetidas à deficiência nutricional. Ambas as linhas PSAG12–ipt avaliadas foram mais tolerantes à deficiência nutricional que as plantas do tipo selvagem. Os resultados indicam que a produção endógena de citocinina pode aumentar a tolerância das plantas à deficiência nutricional.

Molecular characterization of FXI deficiency.

Science.gov (United States)

Berber, Ergul

2011-02-01

Factor XI (FXI) deficiency is a rare autosomal bleeding disease associated with genetic defects in the FXI gene. It is a heterogeneous disorder with variable tendency in bleeding and variable causative FXI gene mutations. It is characterized as a cross-reacting material-negative (CRM-) FXI deficiency due to decreased FXI levels or cross-reacting material-positive (CRM+) FXI deficiency due to impaired FXI function. Increasing number of mutations has been reported in FXI mutation database, and most of the mutations are affecting serine protease (SP) domain of the protein. Functional characterization for the mutations helps to better understand the molecular basis of FXI deficiency. Prevalence of the disease is higher in certain populations such as Ashkenazi Jews. The purpose of this review is to give an overview of the molecular basis of congenital FXI deficiency.

Molecular cloning of a seed specific multifunctional RFO synthase/ galactosylhydrolase in Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

Roman eGangl

2015-09-01

Full Text Available Stachyose is among the raffinose family oligosaccharides one of the major water-soluble carbohydrates next to sucrose in seeds of a number of plant species. Especially in leguminous seeds, e.g. chickpea, stachyose is reported as the major component. In contrast to their ambiguous potential as essential source of carbon for germination, raffinose family oligosaccharides are indigestible for humans and can contribute to diverse abdominal disorders.In the genome of Arabidopsis thaliana, six putative raffinose synthase genes are reported, whereas little is known about these putative raffinose synthases and their biochemical characteristics or their contribution to the raffinose family oligosaccharide physiology in A. thaliana.In this paper, we report on the molecular cloning, functional expression in Escherichia coli and purification of recombinant AtRS4 from A. thaliana and the biochemical characterisation of the putative stachyose synthase (AtSTS, At4g01970 as a raffinose and high affinity stachyose synthase (Km for raffinose 259.2 ± 21.15 µM as well as stachyose and galactinol specific galactosylhydrolase. A T-DNA insertional mutant in the AtRS4 gene was isolated. Only sqPCR from WT siliques showed a specific transcriptional AtRS4 PCR product. Metabolite measurements in seeds of ΔAtRS4 mutant plants revealed a total loss of stachyose in ΔAtRS4 mutant seeds. We conclude that AtRS4 is the only stachyose synthase in the genome of A. thaliana that AtRS4 represents a key regulation mechanism in the raffinose family oligosaccharide physiology of A. thaliana due to its multifunctional enzyme activity and that AtRS4 is possibly the second seed specific raffinose synthase beside AtRS5, which is responsible for Raf-accumulation under abiotic stress.

Monoterpene synthases from common sage (Salvia officinalis)

Energy Technology Data Exchange (ETDEWEB)

Croteau, Rodney Bruce (Pullman, WA); Wise, Mitchell Lynn (Pullman, WA); Katahira, Eva Joy (Pullman, WA); Savage, Thomas Jonathan (Christchurch 5, NZ)

1999-01-01

cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.

Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

Directory of Open Access Journals (Sweden)

Marquez Rodolfo

2004-09-01

Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

Co-expression of peppermint geranyl diphosphate synthase small subunit enhances monoterpene production in transgenic tobacco plants.

Science.gov (United States)

Yin, Jun-Lin; Wong, Woon-Seng; Jang, In-Cheol; Chua, Nam-Hai

2017-02-01

Monoterpenes are important for plant survival and useful to humans. In addition to their function in plant defense, monoterpenes are also used as flavors, fragrances and medicines. Several metabolic engineering strategies have been explored to produce monoterpene in tobacco but only trace amounts of monoterpenes have been detected. We investigated the effects of Solanum lycopersicum 1-deoxy-d-xylulose-5-phosphate synthase (SlDXS), Arabidopsis thaliana geranyl diphosphate synthase 1 (AtGPS) and Mentha × piperita geranyl diphosphate synthase small subunit (MpGPS.SSU) on production of monoterpene and geranylgeranyl diphosphate (GGPP) diversities, and plant morphology by transient expression in Nicotiana benthamiana and overexpression in transgenic Nicotiana tabacum. We showed that MpGPS.SSU could enhance the production of various monoterpenes such as (-)-limonene, (-)-linalool, (-)-α-pinene/β-pinene or myrcene, in transgenic tobacco by elevating geranyl diphosphate synthase (GPS) activity. In addition, overexpression of MpGPS.SSU in tobacco caused early flowering phenotype and increased shoot branching by elevating contents of GA 3 and cytokinins due to upregulated transcript levels of several plastidic 2-C-methyl-d-erythritol-4-phosphate (MEP) pathway genes, geranylgeranyl diphosphate synthases 3 (GGPPS3) and GGPPS4. Our method would allow the identification of new monoterpene synthase genes using transient expression in N. benthamiana and the improvement of monoterpene production in transgenic tobacco plants. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

Frameshift mutational target gene analysis identifies similarities and differences in constitutional mismatch repair-deficiency and Lynch syndrome.

Science.gov (United States)

Maletzki, Claudia; Huehns, Maja; Bauer, Ingrid; Ripperger, Tim; Mork, Maureen M; Vilar, Eduardo; Klöcking, Sabine; Zettl, Heike; Prall, Friedrich; Linnebacher, Michael

2017-07-01

Mismatch-repair deficient (MMR-D) malignancies include Lynch Syndrome (LS), which is secondary to germline mutations in one of the MMR genes, and the rare childhood-form of constitutional mismatch repair-deficiency (CMMR-D); caused by bi-allelic MMR gene mutations. A hallmark of LS-associated cancers is microsatellite instability (MSI), characterized by coding frameshift mutations (cFSM) in target genes. By contrast, tumors arising in CMMR-D patients are thought to display a somatic mutation pattern differing from LS. This study has the main goal to identify cFSM in MSI target genes relevant in CMMR-D and to compare the spectrum of common somatic mutations, including alterations in DNA polymerases POLE and D1 between LS and CMMR-D. CMMR-D-associated tumors harbored more somatic mutations compared to LS cases, especially in the TP53 gene and in POLE and POLD1, where novel mutations were additionally identified. Strikingly, MSI in classical mononucleotide markers BAT40 and CAT25 was frequent in CMMR-D cases. MSI-target gene analysis revealed mutations in CMMR-D-associated tumors, some of them known to be frequently hit in LS, such as RNaseT2, HT001, and TGFβR2. Our results imply a general role for these cFSM as potential new drivers of MMR-D tumorigenesis. © 2017 Wiley Periodicals, Inc.

Targeting CPS1 in the treatment of Carbamoyl phosphate synthetase 1 (CPS1) deficiency, a urea cycle disorder.

Science.gov (United States)

Diez-Fernandez, Carmen; Häberle, Johannes

2017-04-01

Carbamoyl phosphate synthetase 1 (CPS1) deficiency (CPS1D) is a rare autosomal recessive urea cycle disorder (UCD), which can lead to life-threatening hyperammonemia. Unless promptly treated, it can result in encephalopathy, coma and death, or intellectual disability in surviving patients. Over recent decades, therapies for CPS1D have barely improved leaving the management of these patients largely unchanged. Additionally, in many cases, current management (protein-restriction and supplementation with citrulline and/or arginine and ammonia scavengers) is insufficient for achieving metabolic stability, highlighting the importance of developing alternative therapeutic approaches. Areas covered: After describing UCDs and CPS1D, we give an overview of the structure- function of CPS1. We then describe current management and potential novel treatments including N-carbamoyl-L-glutamate (NCG), pharmacological chaperones, and gene therapy to treat hyperammonemia. Expert opinion: Probably, the first novel CPS1D therapies to reach the clinics will be the already commercial substance NCG, which is the standard treatment for N-acetylglutamate synthase deficiency and has been proven to rescue specific CPS1D mutations. Pharmacological chaperones and gene therapy are under development too, but these two technologies still have key challenges to be overcome. In addition, current experimental therapies will hopefully add further treatment options.

Cloning expression and analysis of phytochelatin synthase (pcs) gene from Anabaena sp. PCC 7120 offering multiple stress tolerance in Escherichia coli

International Nuclear Information System (INIS)

Chaurasia, Neha; Mishra, Yogesh; Rai, Lal Chand

2008-01-01

Phytochelatin synthase (PCS) is involved in the synthesis of phytochelatins (PCs), plays role in heavy metal detoxification. The present study describes for first time the functional expression and characterization of pcs gene of Anabaena sp. PCC 7120 in Escherichia coli in terms of offering protection against heat, salt, carbofuron (pesticide), cadmium, copper, and UV-B stress. The involvement of pcs gene in tolerance to above abiotic stresses was investigated by cloning of pcs gene in expression vector pGEX-5X-2 and its transformation in E. coli BL21 (DE3). The E. coli cells transformed with pGEX-5X-pcs showed better growth than control cells (pGEX-5X-2) under temperature (47 deg. C), NaCl (6% w/v), carbofuron (0.025 mg ml -1 ), CdCl 2 (4 mM), CuCl 2 (1 mM), and UV-B (10 min) exposure. The enhanced expression of pcs gene revealed by RT-PCR analysis under above stresses at different time intervals further advocates its role in tolerance against above abiotic stresses

Homocysteine threshold value based on cystathionine beta synthase and paraoxonase 1 activities in mice.

Science.gov (United States)

Hamelet, J; Aït-Yahya-Graison, E; Matulewicz, E; Noll, C; Badel-Chagnon, A; Camproux, A-C; Demuth, K; Paul, J-L; Delabar, J M; Janel, N

2007-12-01

Hyperhomocysteinaemia is a metabolic disorder associated with the development of premature atherosclerosis. Among the determinants which predispose to premature thromboembolic and atherothrombotic events, serum activity of paraoxonase 1, mainly synthesized in the liver, has been shown to be a predictor of cardiovascular disease and to be negatively correlated with serum homocysteine levels in human. Even though treatments of hyperhomocysteinaemic patients ongoing cardiovascular complications are commonly used, it still remains unclear above which homocysteine level a preventive therapy should be started. In order to establish a threshold of plasma homocysteine concentration we have analyzed the hepatic cystathionine beta synthase and paraoxonase 1 activities in a moderate to intermediate murine model of hyperhomocysteinaemia. Using wild type and heterozygous cystathionine beta synthase deficient mice fed a methionine enriched diet or a control diet, we first studied the link between cystathionine beta synthase and paraoxonase 1 activities and plasma homocysteine concentration. Among the animals used in this study, we observed a negative correlation between plasma homocysteine level and cystathionine beta synthase activity (rho=-0.52, P=0.0008) or paraoxonase 1 activity (rho=-0.49, P=0.002). Starting from these results, a homocysteine cut-off value of 15 microm has been found for both cystathionine beta synthase (P=0.0003) and paraoxonase 1 (P=0.0007) activities. Our results suggest that both cystathionine beta synthase and paraoxonase 1 activities are significantly decreased in mice with a plasma homocysteine value greater than 15 microm. In an attempt to set up preventive treatment for cardiovascular disease our results indicate that treatments should be started from 15 microm of plasma homocysteine.

v-src induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element.

OpenAIRE

Xie, W; Fletcher, B S; Andersen, R D; Herschman, H R

1994-01-01

We recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factors and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5' of the TIS10/PGS2 transcription start site that mediates pp60v-src induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E...

Novel class III phosphoribosyl diphosphate synthase: structure and properties of the tetrameric, phosphate-activated, non-allosterically inhibited enzyme from Methanocaldococcus jannaschii

DEFF Research Database (Denmark)

Kadziola, Anders; Jepsen, Clemens H; Johansson, Eva

2005-01-01

The prs gene encoding phosphoribosyl diphosphate (PRPP) synthase of the hyperthermophilic autotrophic methanogenic archaeon Methanocaldococcus jannaschii has been cloned and expressed in Escherichia coli. Subsequently, M.jannaschii PRPP synthase has been purified, characterised, crystallised, and...

DNA-Mediated Cyclic GMP-AMP Synthase-Dependent and -Independent Regulation of Innate Immune Responses.

Science.gov (United States)

Motani, Kou; Ito, Shinji; Nagata, Shigekazu

2015-05-15

Cytoplasmic DNA activates cyclic GMP-AMP synthase (cGAS) to produce cyclic 2'-5'3'-5'GMP-AMP dinucleotide (2'5 'cGAMP). The binding of 2'5'cGAMP to an adaptor protein, stimulator of IFN genes (STING), activates a transcription factor, IFN regulatory factor 3, leading to the induction of IFN and chemokine gene expression. In this study, we found that the 2'5'cGAMP-dependent STING activation induced highly upregulated CXCL10 gene expression. Formation of a distinct STING dimer, which was detected by native PAGE, was induced by 2'5'cGAMP, but not 3'-5'3'-5'cGAMP. Analysis of DNase II(-/-) mice, which constitutively produce IFN-β and CXCL10, showed the accumulation of 2'5'cGAMP in their fetal livers and spleens, suggesting that the undigested DNA accumulating in DNase II(-/-) cells may have leaked from the lysosomes into the cytoplasm. The DNase II(-/-) mouse embryonic fibroblasts produced 2'5'cGAMP in a cGAS-dependent manner during apoptotic cell engulfment. However, cGAS deficiency did not impair the STING-dependent upregulation of CXCL10 in DNase II(-/-) mouse embryonic fibroblasts that was induced by apoptotic cell engulfment or DNA lipofection. These results suggest the involvement of a cGAS-independent additional DNA sensor(s) that induces the STING-dependent activation of innate immunity. Copyright © 2015 by The American Association of Immunologists, Inc.

A multilevel prediction of physiological response to challenge: Interactions among child maltreatment, neighborhood crime, endothelial nitric oxide synthase gene (eNOS), and GABA(A) receptor subunit alpha-6 gene (GABRA6).

Science.gov (United States)

Lynch, Michael; Manly, Jody Todd; Cicchetti, Dante

2015-11-01

Physiological response to stress has been linked to a variety of healthy and pathological conditions. The current study conducted a multilevel examination of interactions among environmental toxins (i.e., neighborhood crime and child maltreatment) and specific genetic polymorphisms of the endothelial nitric oxide synthase gene (eNOS) and GABA(A) receptor subunit alpha-6 gene (GABRA6). One hundred eighty-six children were recruited at age 4. The presence or absence of child maltreatment as well as the amount of crime that occurred in their neighborhood during the previous year were determined at that time. At age 9, the children were brought to the lab, where their physiological response to a cognitive challenge (i.e., change in the amplitude of the respiratory sinus arrhythmia) was assessed and DNA samples were collected for subsequent genotyping. The results confirmed that complex Gene × Gene, Environment × Environment, and Gene × Environment interactions were associated with different patterns of respiratory sinus arrhythmia reactivity. The implications for future research and evidence-based intervention are discussed.

The L locus, one of complementary genes required for anthocyanin production in onions (Allium cepa), encodes anthocyanidin synthase.

Science.gov (United States)

Kim, Sunggil; Jones, Rick; Yoo, Kil-Sun; Pike, Leonard M

2005-06-01

Bulb color in onions (Allium cepa) is an important trait, but its complex, unclear mechanism of inheritance has been a limiting factor in onion cultivar improvement. The identity of the L locus, which is involved in the color difference between Brazilian yellow and red onions, is revealed in this study. A cross was made between a US-type yellow breeding line and a Brazilian yellow cultivar. The segregation ratio of nine red to seven yellow onions in the F(2) population supports the involvement of two complementary genes in anthocyanin production in the F(1) hybrids. The high-performance liquid chromatography (HPLC) and reverse-transcriptase (RT)-PCR analysis of the Brazilian yellow onions indicated that the genes are involved late in the anthocyanin synthesis pathway. The genomic sequence of the anthocyanidin synthase (ANS) gene in Brazilian yellow onions showed a point mutation, which results in an amino acid change of a glycine to an arginine at residue 229. Because this residue is located adjacent to a highly conserved iron-binding active site, this mutation is likely responsible for the inactivation of the ANS gene in Brazilian yellow onions. Following the isolation of the promoter sequence of the mutant allele, a PCR-based marker for allelic selection of the ANS gene was designed. This assay is based on an insertion (larger than 3 kb) mutation. The marker perfectly co-segregated with the color phenotypes in the F(2) populations, thereby indicating that the L locus encodes ANS.

Influence of gibberellin and daminozide on the expression of terpene synthases and on monoterpenes in common sage (Salvia officinalis).

Science.gov (United States)

Schmiderer, Corinna; Grausgruber-Gröger, Sabine; Grassi, Paolo; Steinborn, Ralf; Novak, Johannes

2010-07-01

Common sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants, with antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, composed mainly of the monoterpenes 1,8-cineole, alpha-thujone, beta-thujone and camphor, is responsible for some of these effects. Gibberellins regulate diverse physiological processes in plants, such as seed germination, shoot elongation and cell division. In this study, we analyzed the effect of exogenously applied plant growth regulators, namely gibberellic acid (GA(3)) and daminozide, on leaf morphology and essential oil formation of two leaf stages during the period of leaf expansion. Essential oil content increased with increasing levels of gibberellins and decreased when gibberellin biosynthesis was blocked with daminozide. With increasing levels of gibberellins, 1,8-cineole and camphor contents increased. Daminozide blocked the accumulation of alpha- and beta-thujone. GA(3) at the highest level applied also led to a significant decrease of alpha- and beta-thujone. Monoterpene synthases are a class of enzymes responsible for the first step in monoterpene biosynthesis, competing for the same substrate geranylpyrophosphate. The levels of gene expression of the three most important monoterpene synthases in sage were investigated, 1,8-cineole synthase leading directly to 1,8-cineole, (+)-sabinene synthase responsible for the first step in the formation of alpha- and beta-thujone, and (+)-bornyl diphosphate synthase, the first step in camphor biosynthesis. The foliar application of GA(3) increased, while daminozide significantly decreased gene expression of the monoterpene synthases. The amounts of two of the end products, 1,8-cineole and camphor, were directly correlated with the levels of gene expression of the respective monoterpene synthases, indicating transcriptional control, while the formation of alpha- and beta

Contribution of granule bound starch synthase in kernel modification ...

African Journals Online (AJOL)

The role of gbssI and gbssII genes, encoding granule bound starch synthase enzyme I and II, respectively, in quality protein maize (QPM) were studied at different days after pollination (DAP). Total RNA was used for first strand cDNA synthesis using the ImpromIISriptTM reverse transcriptase. No detectable levels of gbssI ...

Methanogenic Paraffin Biodegradation: Alkylsuccinate Synthase Gene Quantification and Dicarboxylic Acid Production.

Science.gov (United States)

Oberding, Lisa K; Gieg, Lisa M

2018-01-01

Paraffinic n -alkanes (>C 17 ) that are solid at ambient temperature comprise a large fraction of many crude oils. The comparatively low water solubility and reactivity of these long-chain alkanes can lead to their persistence in the environment following fuel spills and pose serious problems for crude oil recovery operations by clogging oil production wells. However, the degradation of waxy paraffins under the anoxic conditions characterizing contaminated groundwater environments and deep subsurface energy reservoirs is poorly understood. Here, we assessed the ability of a methanogenic culture enriched from freshwater fuel-contaminated aquifer sediments to biodegrade the model paraffin n -octacosane (C 28 H 58 ). Compared with that in controls, the consumption of n -octacosane was coupled to methane production, demonstrating its biodegradation under these conditions. Smithella was postulated to be an important C 28 H 58 degrader in the culture on the basis of its high relative abundance as determined by 16S rRNA gene sequencing. An identified assA gene (known to encode the α subunit of alkylsuccinate synthase) aligned most closely with those from other Smithella organisms. Quantitative PCR (qPCR) and reverse transcription qPCR assays for assA demonstrated significant increases in the abundance and expression of this gene in C 28 H 58 -degrading cultures compared with that in controls, suggesting n -octacosane activation by fumarate addition. A metabolite analysis revealed the presence of several long-chain α,ω-dicarboxylic acids only in the C 28 H 58 -degrading cultures, a novel observation providing clues as to how methanogenic consortia access waxy hydrocarbons. The results of this study broaden our understanding of how waxy paraffins can be biodegraded in anoxic environments with an application toward bioremediation and improved oil recovery. IMPORTANCE Understanding the methanogenic biodegradation of different classes of hydrocarbons has important

Polyketide synthases from poison hemlock (Conium maculatum L.).

Science.gov (United States)

Hotti, Hannu; Seppänen-Laakso, Tuulikki; Arvas, Mikko; Teeri, Teemu H; Rischer, Heiko

2015-11-01

Coniine is a toxic alkaloid, the biosynthesis of which is not well understood. A possible route, supported by evidence from labelling experiments, involves a polyketide formed by the condensation of one acetyl-CoA and three malonyl-CoAs catalysed by a polyketide synthase (PKS). We isolated PKS genes or their fragments from poison hemlock (Conium maculatum L.) by using random amplification of cDNA ends (RACE) and transcriptome analysis, and characterized three full-length enzymes by feeding different starter-CoAs in vitro. On the basis of our in vitro experiments, two of the three characterized PKS genes in poison hemlock encode chalcone synthases (CPKS1 and CPKS2), and one encodes a novel type of PKS (CPKS5). We show that CPKS5 kinetically favours butyryl-CoA as a starter-CoA in vitro. Our results suggest that CPKS5 is responsible for the initiation of coniine biosynthesis by catalysing the synthesis of the carbon backbone from one butyryl-CoA and two malonyl-CoAs. © 2015 FEBS.

THE POLYMORPHISM OF THE SUS4 SUCROSE SYNTHASE DOMAIN SEQUENCES IN RUSSIAN, BELORUSSIAN AND KAZAKH POTATO CULTIVARS

Directory of Open Access Journals (Sweden)

M. A. Slugina

2016-01-01

Full Text Available The potato is one of the main strategic crops in the Russian Federation, Belarus and Kazakhstan. Currently, we have achieved significant advances in the understanding of metabolic mechanism of carbohydrate and interconversion «sucrose – starch» in potato tubers. Sucrose synthase (Sus is a key enzyme in the breakdown of sucrose. Sucrose synthase (Sus is catalyzing a reversible reaction of conversion sucrose and UDP into fructose and UDP-glucose. The identification and subsequent characterization of the genes encoding plant sucrose synthase is the first step towards understanding their physiological roles and metabolic mechanism involved in carbohydrate accumulation in potato tubers. In the present work the nucleotide and amino acid polymorphism of the Sus4 gene fragments containing sequences of the sucrose synthase domain were analyzed. Sus4 gene fragments (intron III – exon VI in 9 potato cultivars of Russian, Kazakh and Belarusian breeding were analyzed. The polymorphism of the Sus4 sucrose synthase domain sequences was first examined. The length of analyzed fragment varied from 977 b.p. (cultivars Favorit, Karasaiskii, Miras to 1013 b.p. (cultivars Zorochka, Manifest, Elisaveta, Bashkirskii. It was demonstrated that the examined sequences contained point mutations, as well as insertions and deletions. The common polymorphism level was 5.82%. It was shown that the examined sequences contained 58 SNPs and 4 indels. The most variable were introns IV (12.4% and V (9.18%. The most variable was exon IV. 7 allelic variants were detected. 6 different amino acid sequences specific to different varieties were also identified.

The variability of sesquiterpenes emitted from two Zea mays cultivars is controlled by allelic variation of two terpene synthase genes encoding stereoselective multiple product enzymes.

Science.gov (United States)

Köllner, Tobias G; Schnee, Christiane; Gershenzon, Jonathan; Degenhardt, Jörg

2004-05-01

The mature leaves and husks of Zea mays release a complex blend of terpene volatiles after anthesis consisting predominantly of bisabolane-, sesquithujane-, and bergamotane-type sesquiterpenes. The varieties B73 and Delprim release the same volatile constituents but in significantly different proportions. To study the molecular genetic and biochemical mechanisms controlling terpene diversity and distribution in these varieties, we isolated the closely related terpene synthase genes terpene synthase4 (tps4) and tps5 from both varieties. The encoded enzymes, TPS4 and TPS5, each formed the same complex mixture of sesquiterpenes from the precursor farnesyl diphosphate but with different proportions of products. These mixtures correspond to the sesquiterpene blends observed in the varieties B73 and Delprim, respectively. The differences in the stereoselectivity of TPS4 and TPS5 are determined by four amino acid substitutions with the most important being a Gly instead of an Ala residue at position 409 at the catalytic site of the enzyme. Although both varieties contain tps4 and tps5 alleles, their differences in terpene composition result from the fact that B73 has only a single functional allele of tps4 and no functional alleles of tps5, whereas Delprim has only a functional allele of tps5 and no functional alleles of tps4. Lack of functionality was shown to be attributable to frame-shift mutations or amino acid substitutions that greatly reduce the activity of their encoded proteins. Therefore, the diversity of sesquiterpenes in these two maize cultivars is strongly influenced by single nucleotide changes in the alleles of two terpene synthase genes.

Coordinated responses of phytochelatin synthase and metallothionein genes in black mangrove, Avicennia germinans, exposed to cadmium and copper

Energy Technology Data Exchange (ETDEWEB)

Gonzalez-Mendoza, Daniel [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico); Moreno, Adriana Quiroz [Unidad de biotecnologia, CICY, Merida, Yucatan (Mexico); Zapata-Perez, Omar [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico)]. E-mail: ozapata@mda.cinvestav.mx

2007-08-01

To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd{sup 2+} and Cu{sup 2+} concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4 h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd{sup 2+} and Cu{sup 2+} detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu{sup 2+}) in A. germinans leaves.

Characterization of capsaicin synthase and identification of its gene (csy1) for pungency factor capsaicin in pepper (Capsicum sp.)

Science.gov (United States)

Prasad, B. C. Narasimha; Kumar, Vinod; Gururaj, H. B.; Parimalan, R.; Giridhar, P.; Ravishankar, G. A.

2006-01-01

Capsaicin is a unique alkaloid of the plant kingdom restricted to the genus Capsicum. Capsaicin is the pungency factor, a bioactive molecule of food and of medicinal importance. Capsaicin is useful as a counterirritant, antiarthritic, analgesic, antioxidant, and anticancer agent. Capsaicin biosynthesis involves condensation of vanillylamine and 8-methyl nonenoic acid, brought about by capsaicin synthase (CS). We found that CS activity correlated with genotype-specific capsaicin levels. We purified and characterized CS (≈35 kDa). Immunolocalization studies confirmed that CS is specifically localized to the placental tissues of Capsicum fruits. Western blot analysis revealed concomitant enhancement of CS levels and capsaicin accumulation during fruit development. We determined the N-terminal amino acid sequence of purified CS, cloned the CS gene (csy1) and sequenced full-length cDNA (981 bp). The deduced amino acid sequence of CS from full-length cDNA was 38 kDa. Functionality of csy1 through heterologous expression in recombinant Escherichia coli was also demonstrated. Here we report the gene responsible for capsaicin biosynthesis, which is unique to Capsicum spp. With this information on the CS gene, speculation on the gene for pungency is unequivocally resolved. Our findings have implications in the regulation of capsaicin levels in Capsicum genotypes. PMID:16938870

Changes in membrane lipid composition in ethanol- and acid-adapted Oenococcus oeni cells: characterization of the cfa gene by heterologous complementation.

Science.gov (United States)

Grandvalet, Cosette; Assad-García, Juan Simón; Chu-Ky, Son; Tollot, Marie; Guzzo, Jean; Gresti, Joseph; Tourdot-Maréchal, Raphaëlle

2008-09-01

Cyclopropane fatty acid (CFA) synthesis was investigated in Oenococcus oeni. The data obtained demonstrated that acid-grown cells or cells harvested in the stationary growth phase showed changes in fatty acid composition similar to those of ethanol-grown cells. An increase of the CFA content and a decrease of the oleic acid content were observed. The biosynthesis of CFAs from unsaturated fatty acid phospholipids is catalysed by CFA synthases. Quantitative real-time-PCR experiments were performed on the cfa gene of O. oeni, which encodes a putative CFA synthase. The level of cfa transcripts increased when cells were harvested in stationary phase and when cells were grown in the presence of ethanol or at low pH, suggesting transcriptional regulation of the cfa gene under different stress conditions. In contrast to Escherichia coli, only one functional promoter was identified upstream of the cfa gene of O. oeni. The function of the cfa gene was confirmed by complementation of a cfa-deficient E. coli strain. Nevertheless, the complementation remained partial because the conversion percentage of unsaturated fatty acids into CFA of the complemented strain was much lower than that of the wild-type strain. Moreover, a prevalence of cycC19 : 0 was observed in the membrane of the complemented strain. This could be due to a specific affinity of the CFA synthase from O. oeni. In spite of this partial complementation, the complemented strain of E. coli totally recovered its viability after ethanol shock (10 %, v/v) whereas its viability was only partly recovered after an acid shock at pH 3.0.

Novel deletion alleles carrying CYP21A1P/A2 chimeric genes in Brazilian patients with 21-hydroxylase deficiency

Directory of Open Access Journals (Sweden)

Guerra-Júnior Gil

2010-06-01

Full Text Available Abstract Background Congenital adrenal hyperplasia due to 21-hydroxylase deficiency is caused by deletions, large gene conversions or mutations in CYP21A2 gene. The human gene is located at 6p21.3 within a locus containing the genes for putative serine/threonine Kinase RP, complement C4, steroid 21-hydroxylase CYP21 tenascin TNX, normally, in a duplicated cluster known as RCCX module. The CYP21 extra copy is a pseudogene (CYP21A1P. In Brazil, 30-kb deletion forming monomodular alleles that carry chimeric CYP21A1P/A2 genes corresponds to ~9% of disease-causing alleles. Such alleles are considered to result from unequal crossovers within the bimodular C4/CYP21 locus. Depending on the localization of recombination breakpoint, different alleles can be generated conferring the locus high degree of allelic variability. The purpose of the study was to investigate the variability of deleted alleles in patients with 21-hydroxylase deficiency. Methods We used different techniques to investigate the variability of 30-kb deletion alleles in patients with 21-hydroxylase deficiency. Alleles were first selected after Southern blotting. The composition of CYP21A1P/A2 chimeric genes was investigated by ASO-PCR and MLPA analyses followed by sequencing to refine the location of recombination breakpoints. Twenty patients carrying at least one allele with C4/CYP21 30-kb deletion were included in the study. Results An allele carrying a CYP21A1P/A2 chimeric gene was found unusually associated to a C4B/C4A Taq I 6.4-kb fragment, generally associated to C4B and CYP21A1P deletions. A novel haplotype bearing both p.P34L and p.H62L, novel and rare mutations, respectively, was identified in exon 1, however p.P30L, the most frequent pseudogene-derived mutation in this exon, was absent. Four unrelated patients showed this haplotype. Absence of p.P34L in CYP21A1P of normal controls indicated that it is not derived from pseudogene. In addition, the combination of different

Development of gene therapy: potential in severe combined immunodeficiency due to adenosine deaminase deficiency

Directory of Open Access Journals (Sweden)

Claudia A Montiel-Equihua

2009-12-01

Full Text Available Claudia A Montiel-Equihua, Adrian J Thrasher, H Bobby GasparCentre for Immunodeficiency, Molecular Immunology Unit, UCL Institute of Child Health, London, UKAbstract: The history of stem cell gene therapy is strongly linked to the development of gene therapy for severe combined immunodeficiencies (SCID and especially adenosine deaminase (ADA-deficient SCID. Here we discuss the developments achieved in over two decades of clinical and laboratory research that led to the establishment of a protocol for the autologous transplant of retroviral vector-mediated gene-modified hematopoietic stem cells, which has proved to be both successful and, to date, safe. Patients in trials in three different countries have shown long-term immunological and metabolic correction. Nevertheless, improvements to the safety profile of viral vectors are underway and will undoubtedly reinforce the position of stem cell gene therapy as a treatment option for ADA-SCID.Keywords: adenosine deaminase, severe combined immunodeficiency, gene therapy, hematopoietic stem cell, retrovirus, clinical trial

Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer

International Nuclear Information System (INIS)

Hirst, D.G.; Worthington, J.; Adams, C.; Robson, T.; Scott, S.D.

2003-01-01

Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement

Aldosterone synthase gene polymorphism in alimentary obesity, metabolic syndrome components, some secondary forms of arterial hypertension, pathology of the adrenals glands core (literature review)

OpenAIRE

Koval, S.N.; Miloslavsky, D.K.; Snegurskaya, I.A.; Mysnichenko, O.V.; Penkova, M.Yu.

2017-01-01

Hormonal factors of adrenal origin belong to the pathophysiological mechanisms of the formation and progression of arterial hypertension (AH) and should be consi­dered while developing differentiated approaches to the treatment and prevention of hypertensive states, their primary, secondary and resistant forms. The first thing we should point up is aldosterone (AL), enzyme aldosterone synthase (AS), which takes a direct part in the formation of this hormone, as well as gene polymorphisms of A...

Identification of Cannabis sativa L. using the 1-kbTHCA synthase-fluorescence in situ hybridization probe.

Science.gov (United States)

Jeangkhwoa, Pattraporn; Bandhaya, Achirapa; Umpunjun, Puangpaka; Chuenboonngarm, Ngarmnij; Panvisavas, Nathinee

2017-03-01

This study reports a successful application of fluorescence in situ hybridization (FISH) technique in the identification of Cannabis sativa L. cells recovered from fresh and dried powdered plant materials. Two biotin-16-dUTP-labeled FISH probes were designed from the Cannabis-specific tetrahydrocannabinolic acid synthase (THCAS) gene and the ITS region of the 45S rRNA gene. Specificity of probe-target hybridization was tested against the target and 4 non-target plant species, i.e., Humulus lupulus, Mitragyna speciosa, Papaver sp., and Nicotiana tabacum. The 1-kb THCA synthase hybridization probe gave Cannabis-specific hybridization signals, unlike the 700-bp Cannabis-ITS hybridization probe. Probe-target hybridization was also confirmed against 20 individual Cannabis plant samples. The 1-kb THCA synthase and 700-bp Cannabis-ITS hybridization probes clearly showed 2 hybridization signals per cell with reproducibility. The 1-kb THCA synthase probe did not give any FISH signal when tested against H. lupulus, its closely related member of the Canabaceae family. It was also showed that 1-kb THCA synthase FISH probe can be applied to identify small amount of dried powdered Cannabis material with an addition of rehydration step prior to the experimental process. This study provided an alternative identification method for Cannabis trace. Copyright © 2016. Published by Elsevier B.V.

Selectable tolerance to herbicides by mutated acetolactate synthase genes integrated into the chloroplast genome of tobacco.

Science.gov (United States)

Shimizu, Masanori; Goto, Maki; Hanai, Moeko; Shimizu, Tsutomu; Izawa, Norihiko; Kanamoto, Hirosuke; Tomizawa, Ken-Ichi; Yokota, Akiho; Kobayashi, Hirokazu

2008-08-01

Strategies employed for the production of genetically modified (GM) crops are premised on (1) the avoidance of gene transfer in the field; (2) the use of genes derived from edible organisms such as plants; (3) preventing the appearance of herbicide-resistant weeds; and (4) maintaining transgenes without obstructing plant cell propagation. To this end, we developed a novel vector system for chloroplast transformation with acetolactate synthase (ALS). ALS catalyzes the first step in the biosynthesis of the branched amino acids, and its enzymatic activity is inhibited by certain classes of herbicides. We generated a series of Arabidopsis (Arabidopsis thaliana) mutated ALS (mALS) genes and introduced constructs with mALS and the aminoglycoside 3'-adenyltransferase gene (aadA) into the tobacco (Nicotiana tabacum) chloroplast genome by particle bombardment. Transplastomic plants were selected using their resistance to spectinomycin. The effects of herbicides on transplastomic mALS activity were examined by a colorimetric assay using the leaves of transplastomic plants. We found that transplastomic G121A, A122V, and P197S plants were specifically tolerant to pyrimidinylcarboxylate, imidazolinon, and sulfonylurea/pyrimidinylcarboxylate herbicides, respectively. Transplastomic plants possessing mALSs were able to grow in the presence of various herbicides, thus affirming the relationship between mALSs and the associated resistance to herbicides. Our results show that mALS genes integrated into the chloroplast genome are useful sustainable markers that function to exclude plants other than those that are GM while maintaining transplastomic crops. This investigation suggests that the resistance management of weeds in the field amid growing GM crops is possible using (1) a series of mALSs that confer specific resistance to herbicides and (2) a strategy that employs herbicide rotation.

Melatonin Therapy Prevents Programmed Hypertension and Nitric Oxide Deficiency in Offspring Exposed to Maternal Caloric Restriction

Directory of Open Access Journals (Sweden)

You-Lin Tain

2014-01-01

Full Text Available Nitric oxide (NO deficiency is involved in the development of hypertension, a condition that can originate early in life. We examined whether NO deficiency contributed to programmed hypertension in offspring from mothers with calorie-restricted diets and whether melatonin therapy prevented this process. We examined 3-month-old male rat offspring from four maternal groups: untreated controls, 50% calorie-restricted (CR rats, controls treated with melatonin (0.01% in drinking water, and CR rats treated with melatonin (CR + M. The effect of melatonin on nephrogenesis was analyzed using next-generation sequencing. The CR group developed hypertension associated with elevated plasma asymmetric dimethylarginine (ADMA, a nitric oxide synthase inhibitor, decreased L-arginine, decreased L-arginine-to-ADMA ratio (AAR, and decreased renal NO production. Maternal melatonin treatment prevented these effects. Melatonin prevented CR-induced renin and prorenin receptor expression. Renal angiotensin-converting enzyme 2 protein levels in the M and CR + M groups were also significantly increased by melatonin therapy. Maternal melatonin therapy had long-term epigenetic effects on global gene expression in the kidneys of offspring. Conclusively, we attributed these protective effects of melatonin on CR-induced programmed hypertension to the reduction of plasma ADMA, restoration of plasma AAR, increase of renal NO level, alteration of renin-angiotensin system, and epigenetic changes in numerous genes.

Neonatal pyruvate dehydrogenase deficiency due to a R302H mutation in the PDHA1 gene: MRI findings

International Nuclear Information System (INIS)

Soares-Fernandes, Joao P.; Ribeiro, Manuel; Magalhaes, Zita; Rocha, Jaime F.; Teixeira-Gomes, Roseli; Cruz, Romeu; Leijser, Lara M.

2008-01-01

Pyruvate dehydrogenase (PDH) deficiency is one of the most common causes of congenital lactic acidosis. Correlations between the genetic defect and neuroimaging findings are lacking. We present conventional and diffusion-weighted MRI findings in a 7-day-old male neonate with PDH deficiency due to a mosaicism for the R302H mutation in the PDHA1 gene. Corpus callosum dysgenesis, widespread increased diffusion in the white matter, and bilateral subependymal cysts were the main features. Although confirmation of PDH deficiency depends on specialized biochemical analyses, neonatal MRI plays a role in evaluating the pattern and extent of brain damage, and potentially in early diagnosis and clinical decision making. (orig.)

Malonyl CoA decarboxylase deficiency: C to T transition in intron 2 of the MCD gene.

Science.gov (United States)

Surendran, S; Sacksteder, K A; Gould, S J; Coldwell, J G; Rady, P L; Tyring, S K; Matalon, R

2001-09-15

Malonyl CoA decarboxylase (MCD) is an enzyme involved in the metabolism of fatty acids synthesis. Based on reports of MCD deficiency, this enzyme is particular important in muscle and brain metabolism. Mutations in the MCD gene result in a deficiency of MCD activity, that lead to psychomotor retardation, cardiomyopathy and neonatal death. To date however, only a few patients have been reported with defects in MCD. We report here studies of a patient with MCD deficiency, who presented with hypotonia, cardiomyopathy and psychomotor retardation. DNA sequencing of MCD revealed a homozygous intronic mutation, specifically a -5 C to T transition near the acceptor site for exon 3. RT-PCR amplification of exons 2 and 3 revealed that although mRNA from a normal control sample yielded one major DNA band, the mutant mRNA sample resulted in two distinct DNA fragments. Sequencing of the patient's two RT-PCR products revealed that the larger molecular weight fragments contained exons 2 and 3 as well as the intervening intronic sequence. The smaller size band from the patient contained the properly spliced exons, similar to the normal control. Western blotting analysis of the expressed protein showed only a faint band in the patient sample in contrast to a robust band in the control. In addition, the enzyme activity of the mutant protein was lower than that of the control protein. The data indicate that homozygous mutation in intron 2 disrupt normal splicing of the gene, leading to lower expression of the MCD protein and MCD deficiency. Copyright 2001 Wiley-Liss, Inc.

Effects of Vector Backbone and Pseudotype on Lentiviral Vector-mediated Gene Transfer: Studies in Infant ADA-Deficient Mice and Rhesus Monkeys

Science.gov (United States)

Carbonaro Sarracino, Denise; Tarantal, Alice F; Lee, C Chang I.; Martinez, Michele; Jin, Xiangyang; Wang, Xiaoyan; Hardee, Cinnamon L; Geiger, Sabine; Kahl, Christoph A; Kohn, Donald B

2014-01-01

Systemic delivery of a lentiviral vector carrying a therapeutic gene represents a new treatment for monogenic disease. Previously, we have shown that transfer of the adenosine deaminase (ADA) cDNA in vivo rescues the lethal phenotype and reconstitutes immune function in ADA-deficient mice. In order to translate this approach to ADA-deficient severe combined immune deficiency patients, neonatal ADA-deficient mice and newborn rhesus monkeys were treated with species-matched and mismatched vectors and pseudotypes. We compared gene delivery by the HIV-1-based vector to murine γ-retroviral vectors pseudotyped with vesicular stomatitis virus-glycoprotein or murine retroviral envelopes in ADA-deficient mice. The vesicular stomatitis virus-glycoprotein pseudotyped lentiviral vectors had the highest titer and resulted in the highest vector copy number in multiple tissues, particularly liver and lung. In monkeys, HIV-1 or simian immunodeficiency virus vectors resulted in similar biodistribution in most tissues including bone marrow, spleen, liver, and lung. Simian immunodeficiency virus pseudotyped with the gibbon ape leukemia virus envelope produced 10- to 30-fold lower titers than the vesicular stomatitis virus-glycoprotein pseudotype, but had a similar tissue biodistribution and similar copy number in blood cells. The relative copy numbers achieved in mice and monkeys were similar when adjusted to the administered dose per kg. These results suggest that this approach can be scaled-up to clinical levels for treatment of ADA-deficient severe combined immune deficiency subjects with suboptimal hematopoietic stem cell transplantation options. PMID:24925206

Effects of vector backbone and pseudotype on lentiviral vector-mediated gene transfer: studies in infant ADA-deficient mice and rhesus monkeys.

Science.gov (United States)

Carbonaro Sarracino, Denise; Tarantal, Alice F; Lee, C Chang I; Martinez, Michele; Jin, Xiangyang; Wang, Xiaoyan; Hardee, Cinnamon L; Geiger, Sabine; Kahl, Christoph A; Kohn, Donald B

2014-10-01

Systemic delivery of a lentiviral vector carrying a therapeutic gene represents a new treatment for monogenic disease. Previously, we have shown that transfer of the adenosine deaminase (ADA) cDNA in vivo rescues the lethal phenotype and reconstitutes immune function in ADA-deficient mice. In order to translate this approach to ADA-deficient severe combined immune deficiency patients, neonatal ADA-deficient mice and newborn rhesus monkeys were treated with species-matched and mismatched vectors and pseudotypes. We compared gene delivery by the HIV-1-based vector to murine γ-retroviral vectors pseudotyped with vesicular stomatitis virus-glycoprotein or murine retroviral envelopes in ADA-deficient mice. The vesicular stomatitis virus-glycoprotein pseudotyped lentiviral vectors had the highest titer and resulted in the highest vector copy number in multiple tissues, particularly liver and lung. In monkeys, HIV-1 or simian immunodeficiency virus vectors resulted in similar biodistribution in most tissues including bone marrow, spleen, liver, and lung. Simian immunodeficiency virus pseudotyped with the gibbon ape leukemia virus envelope produced 10- to 30-fold lower titers than the vesicular stomatitis virus-glycoprotein pseudotype, but had a similar tissue biodistribution and similar copy number in blood cells. The relative copy numbers achieved in mice and monkeys were similar when adjusted to the administered dose per kg. These results suggest that this approach can be scaled-up to clinical levels for treatment of ADA-deficient severe combined immune deficiency subjects with suboptimal hematopoietic stem cell transplantation options.

Role of Endothelial Nitric Oxide Synthase Gene Polymorphisms in Predicting Aneurysmal Subarachnoid Hemorrhage in South Indian Patients

Directory of Open Access Journals (Sweden)

Linda Koshy

2008-01-01

Full Text Available Endothelial nitric oxide synthase (eNOS gene polymorphisms have been implicated as predisposing genetic factors that can predict aneurysmal subarachnoid hemorrhage (aSAH, but with controversial results from different populations. Using a case-control study design, we tested the hypothesis whether variants in eNOS gene can increase risk of aSAH among South Indian patients, either independently, or by interacting with other risk factors of the disease. We enrolled 122 patients, along with 224 ethnically matched controls. We screened the intron-4 27-bp VNTR, the promoter T-786C and the exon-7 G894T SNPs in the eNOS gene. We found marked interethnic differences in the genotype distribution of eNOS variants when comparing the South Indian population with the reported frequencies from Caucasian and Japanese populations. Genotype distributions in control and patient populations were found to be in Hardy-Weinberg equilibrium. In patients, the allele, genotype and estimated haplotype frequencies did not differ significantly from the controls. Multiple logistic regression indicated hypertension and smoking as risk factors for the disease, however the risk alleles did not have any interaction with these risk factors. Although the eNOS polymorphisms were not found to be a likely risk factor for aSAH, the role of factors such as ethnicity, gender, smoking and hypertension should be evaluated cautiously to understand the genotype to phenotype conversion.

Molecular cloning and characterization of two β-ketoacyl-acyl carrier protein synthase I genes from Jatropha curcas L.

Science.gov (United States)

Xiong, Wangdan; Wei, Qian; Wu, Pingzhi; Zhang, Sheng; Li, Jun; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

2017-07-01

The β-ketoacyl-acyl carrier protein synthase I (KASI) is involved in de novo fatty acid biosynthesis in many organisms. Two putative KASI genes, JcKASI-1 and JcKASI-2, were isolated from Jatropha curcas. The deduced amino acid sequences of JcKASI-1 and JcKASI-2 exhibit around 83.8% and 72.5% sequence identities with AtKASI, respectively, and both contain conserved Cys-His-Lys-His-Phe catalytic active sites. Phylogenetic analysis indicated that JcKASI-2 belongs to a clade with several KASI proteins from dicotyledonous plants. Both JcKASI genes were expressed in multiple tissues, most strongly in filling stage seeds of J. curcas. Additionally, the JcKASI-1 and JcKASI-2 proteins were both localized to the plastids. Expressing JcKASI-1 in the Arabidopsis kasI mutant rescued the mutant's phenotype and restored the fatty acid composition and oil content in seeds to wild-type, but expressing JcKASI-2 in the Arabidopsis kasI mutant resulted in only partial rescue. This implies that JcKASI-1 and JcKASI-2 exhibit partial functional redundancy and KASI genes play a universal role in regulating fatty acid biosynthesis, growth, and development in plants. Copyright © 2017 Elsevier GmbH. All rights reserved.

Nitric oxide synthase during early embryonic development in silkworm Bombyx mori: Gene expression, enzyme activity, and tissue distribution.

Science.gov (United States)

Kitta, Ryo; Kuwamoto, Marina; Yamahama, Yumi; Mase, Keisuke; Sawada, Hiroshi

2016-12-01

To elucidate the mechanism for embryonic diapause or the breakdown of diapause in Bombyx mori, we biochemically analyzed nitric oxide synthase (NOS) during the embryogenesis of B. mori. The gene expression and enzyme activity of B. mori NOS (BmNOS) were examined in diapause, non-diapause, and HCl-treated diapause eggs. In the case of HCl-treated diapause eggs, the gene expression and enzyme activity of BmNOS were induced by HCl treatment. However, in the case of diapause and non-diapause eggs during embryogenesis, changes in the BmNOS activity and gene expressions did not coincide except 48-60 h after oviposition in diapause eggs. The results imply that changes in BmNOS activity during the embryogenesis of diapause and non-diapause eggs are regulated not only at the level of transcription but also post-transcription. The distribution and localization of BmNOS were also investigated with an immunohistochemical technique using antibodies against the universal NOS; the localization of BmNOS was observed mainly in the cytoplasm of yolk cells in diapause eggs and HCl-treated diapause eggs. These data suggest that BmNOS has an important role in the early embryonic development of the B. mori. © 2016 Japanese Society of Developmental Biologists.

A novel haplotype of low-frequency variants in the aldosterone synthase gene among northern Han Chinese with essential hypertension.

Science.gov (United States)

Zhang, Hao; Li, Xueyan; Zhou, Li; Zhang, Keyong; Zhang, Qi; Li, Jingping; Wang, Ningning; Jin, Ming; Wu, Nan; Cong, Mingyu; Qiu, Changchun

2017-09-01

Low-frequency variants showed that there is more power to detect risk variants than to detect protective variants in complex diseases. Aldosterone plays an important role in the renin-angiotensin-aldosterone system, and aldosterone synthase catalyzes the speed-controlled steps of aldosterone biosynthesis. Polymorphisms of the aldosterone synthase gene (CYP11B2) have been reported to be associated with essential hypertension (EH). CYP11B2 polymorphisms such as -344T/C, have been extensively reported, but others are less well known. This study aimed to assess the association between human CYP11B2 and EH using a haplotype-based case-control study. A total of 1024 EH patients and 956 normotensive controls, which consist of north Han population peasants, were enrolled. Seven single nucleotide polymorphisms (SNPs) (rs28659182, rs10087214, rs73715282, rs542092383, rs4543, rs28491316, and rs7463212) covering the entire human CYP11B2 gene were genotyped as markers using the MassARRAY system. The major allele G frequency of rs542092383 was found to be risk against hypertension [odds ratio (OR) 3.478, 95% confidence interval (95% CI) 1.407-8.597, P = .004]. The AG genotype frequency of SNP rs542092383 was significantly associated with an increased risk of hypertension (OR 4.513, 95% CI 1.426-14.287, P = .010). In the haplotype-based case-control analysis, the frequency of the T-G-T haplotype was higher for EH patients than for controls (OR 5.729, 95% CI 1.889-17.371, P = .000495). All |D'| values of the seven SNPs were >0.9, and r values for rs28659182- rs10087214-rs28491316-rs7463212 SNPs were >0.8 and showed strong linkage intensity. Haplotype T-G-T may therefore be a useful genetic marker for EH.

Effects of starch synthase IIa gene dosage on grain, protein and starch in endosperm of wheat.

Science.gov (United States)

Konik-Rose, Christine; Thistleton, Jenny; Chanvrier, Helene; Tan, Ihwa; Halley, Peter; Gidley, Michael; Kosar-Hashemi, Behjat; Wang, Hong; Larroque, Oscar; Ikea, Joseph; McMaugh, Steve; Regina, Ahmed; Rahman, Sadequr; Morell, Matthew; Li, Zhongyi

2007-11-01

Starch synthases (SS) are responsible for elongating the alpha-1,4 glucan chains of starch. A doubled haploid population was generated by crossing a line of wheat, which lacks functional ssIIa genes on each genome (abd), and an Australian wheat cultivar, Sunco, with wild type ssIIa alleles on each genome (ABD). Evidence has been presented previously indicating that the SGP-1 (starch granule protein-1) proteins present in the starch granule in wheat are products of the ssIIa genes. Analysis of 100 progeny lines demonstrated co-segregation of the ssIIa alleles from the three genomes with the SGP-1 proteins, providing further evidence that the SGP-1 proteins are the products of the ssIIa genes. From the progeny lines, 40 doubled haploid lines representing the eight possible genotypes for SSIIa (ABD, aBD, AbD, ABd, abD, aBd, Abd, abd) were characterized for their grain weight, protein content, total starch content and starch properties. For some properties (chain length distribution, pasting properties, swelling power, and gelatinization properties), a progressive change was observed across the four classes of genotypes (wild type, single nulls, double nulls and triple nulls). However, for other grain properties (seed weight and protein content) and starch properties (total starch content, granule morphology and crystallinity, granule size distribution, amylose content, amylose-lipid dissociation properties), a statistically significant change only occurred for the triple nulls, indicating that all three genes had to be missing or inactive for a change to occur. These results illustrate the importance of SSIIa in controlling grain and starch properties and the importance of amylopectin fine structure in controlling starch granule properties in wheat.

POLYMORPHISMS OF ENDOTHELIAL NITRIC OXIDE SYNTHASE GENE AS PREDICTORS OF WOLFF-PARKINSON-WHITE SYNDROME

Directory of Open Access Journals (Sweden)

G. V. Matyushin

2017-01-01

Full Text Available Background. The discovery of new genetic predictors of cardiovascular diseases can be used in predicting and diagnosing latent forms of the disease. Wolff-Parkinson-White syndrome (WPW occurs in all age groups  and detected in 1-30 people per 10000, it manifests mainly in young age (on average 20 years, and the risk of sudden cardiac death is higher than in general population.Aim. To study the relationship of WPW syndrome with the polymorphism of endothelial nitric synthase gene (NOS3, and to identify genetic predictors of this syndrome.Material and methods. The study included 51 people with ECG proven WPW syndrome and 153 people with no cardiovascular disease. The patients were divided into subgroups according to sex: 21 women, 30 men. All patients underwent a standard cardiac examination (anamnesis, electrocardiography, echocardiography, bicycle ergometry, transesophageal electrical stimulation of the atria, Holter monitoring and blood was taken for molecular genetic testing of DNA.Results. The results showed a statistically significant prevalence of rare genotype 4b\\4b NOS3 gene in the control group of women (16.3%; р<0.05 compared with women from the main group, who did not have this genotype, while there was significant prevalence of genotype 4a\\4a in the main group of women (81.0%; р<0.05 compared with women from the control group.  In men this prevalence was not found.Conclusion. The presence of genotype 4b\\4b NOS3 gene reduces the likelihood of WPW syndrome and its symptoms in females. In men,  this prevalence is not found, presumably, in connection with some mechanisms of hormonal regulation. The results can be used in the genetic prediction of the course of the disease.

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

Science.gov (United States)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Adiponectin, a downstream target gene of peroxisome proliferator-activated receptor γ, controls hepatitis B virus replication

International Nuclear Information System (INIS)

Yoon, Sarah; Jung, Jaesung; Kim, Taeyeung; Park, Sun; Chwae, Yong-Joon; Shin, Ho-Joon; Kim, Kyongmin

2011-01-01

In this study, HepG2-hepatitis B virus (HBV)-stable cells that did not overexpress HBx and HBx-deficient mutant-transfected cells were analyzed for their expression of HBV-induced, upregulated adipogenic and lipogenic genes. The mRNAs of CCAAT enhancer binding protein α (C/EBPα), peroxisome proliferator-activated receptor γ (PPARγ), adiponectin, liver X receptor α (LXRα), sterol regulatory element binding protein 1c (SREBP1c), and fatty acid synthase (FAS) were expressed at higher levels in HepG2-HBV and lamivudine-treated stable cells and HBx-deficient mutant-transfected cells than in the HepG2 cells. Lamivudine treatment reduced the mRNA levels of PPARγ and C/EBPα. Conversely, HBV replication was upregulated by adiponectin and PPARγ agonist rosiglitazone treatments and was downregulated by adiponectin siRNAs. Collectively, our results demonstrate that HBV replication and/or protein expression, even in the absence of HBx, upregulated adipogenic or lipogenic genes, and that the control of adiponectin might prove useful as a therapeutic modality for the treatment of chronic hepatitis B.

Long-term boron-deficiency-responsive genes revealed by cDNA-AFLP differ between Citrus sinensis roots and leaves

Science.gov (United States)

Lu, Yi-Bin; Qi, Yi-Ping; Yang, Lin-Tong; Lee, Jinwook; Guo, Peng; Ye, Xin; Jia, Meng-Yang; Li, Mei-Li; Chen, Li-Song

2015-01-01

Seedlings of Citrus sinensis (L.) Osbeck were supplied with boron (B)-deficient (without H3BO3) or -sufficient (10 μM H3BO3) nutrient solution for 15 weeks. We identified 54 (38) and 38 (45) up (down)-regulated cDNA-AFLP bands (transcript-derived fragments, TDFs) from B-deficient leaves and roots, respectively. These TDFs were mainly involved in protein and amino acid metabolism, carbohydrate and energy metabolism, nucleic acid metabolism, cell transport, signal transduction, and stress response and defense. The majority of the differentially expressed TDFs were isolated only from B-deficient roots or leaves, only seven TDFs with the same GenBank ID were isolated from the both. In addition, ATP biosynthesis-related TDFs were induced in B-deficient roots, but unaffected in B-deficient leaves. Most of the differentially expressed TDFs associated with signal transduction and stress defense were down-regulated in roots, but up-regulated in leaves. TDFs related to protein ubiquitination and proteolysis were induced in B-deficient leaves except for one TDF, while only two down-regulated TDFs associated with ubiquitination were detected in B-deficient roots. Thus, many differences existed in long-term B-deficiency-responsive genes between roots and leaves. In conclusion, our findings provided a global picture of the differential responses occurring in B-deficient roots and leaves and revealed new insight into the different adaptive mechanisms of C. sinensis roots and leaves to B-deficiency at the transcriptional level. PMID:26284101

A Genome-Wide Association Study for Culm Cellulose Content in Barley Reveals Candidate Genes Co-Expressed with Members of the CELLULOSE SYNTHASE A Gene Family

Science.gov (United States)

Houston, Kelly; Burton, Rachel A.; Sznajder, Beata; Rafalski, Antoni J.; Dhugga, Kanwarpal S.; Mather, Diane E.; Taylor, Jillian; Steffenson, Brian J.; Waugh, Robbie; Fincher, Geoffrey B.

2015-01-01

Cellulose is a fundamentally important component of cell walls of higher plants. It provides a scaffold that allows the development and growth of the plant to occur in an ordered fashion. Cellulose also provides mechanical strength, which is crucial for both normal development and to enable the plant to withstand both abiotic and biotic stresses. We quantified the cellulose concentration in the culm of 288 two – rowed and 288 six – rowed spring type barley accessions that were part of the USDA funded barley Coordinated Agricultural Project (CAP) program in the USA. When the population structure of these accessions was analysed we identified six distinct populations, four of which we considered to be comprised of a sufficient number of accessions to be suitable for genome-wide association studies (GWAS). These lines had been genotyped with 3072 SNPs so we combined the trait and genetic data to carry out GWAS. The analysis allowed us to identify regions of the genome containing significant associations between molecular markers and cellulose concentration data, including one region cross-validated in multiple populations. To identify candidate genes we assembled the gene content of these regions and used these to query a comprehensive RNA-seq based gene expression atlas. This provided us with gene annotations and associated expression data across multiple tissues, which allowed us to formulate a supported list of candidate genes that regulate cellulose biosynthesis. Several regions identified by our analysis contain genes that are co-expressed with CELLULOSE SYNTHASE A (HvCesA) across a range of tissues and developmental stages. These genes are involved in both primary and secondary cell wall development. In addition, genes that have been previously linked with cellulose synthesis by biochemical methods, such as HvCOBRA, a gene of unknown function, were also associated with cellulose levels in the association panel. Our analyses provide new insights into the

Late-Onset N-Acetylglutamate Synthase Deficiency: Report of a Paradigmatic Adult Case Presenting with Headaches and Review of the Literature

Science.gov (United States)

Cavicchi, Catia; Chilleri, Chiara; Fioravanti, Antonella; Ferri, Lorenzo; Ripandelli, Francesco; Costa, Cinzia; Calabresi, Paolo; Prontera, Paolo; Pochiero, Francesca; Pasquini, Elisabetta; Funghini, Silvia; la Marca, Giancarlo; Donati, Maria Alice

2018-01-01

N-acetylglutamate synthase deficiency (NAGSD) is an extremely rare urea cycle disorder (UCD) with few adult cases so far described. Diagnosis of late-onset presentations is difficult and delayed treatment may increase the risk of severe hyperammonemia. We describe a 52-year-old woman with recurrent headaches who experienced an acute onset of NAGSD. As very few papers focus on headaches in UCDs, we also report a literature review of types and pathophysiologic mechanisms of UCD-related headaches. In our case, headaches had been present since puberty (3–4 days a week) and were often accompanied by nausea, vomiting, or behavioural changes. Despite three previous episodes of altered consciousness, ammonia was measured for the first time at 52 years and levels were increased. Identification of the new homozygous c.344C>T (p.Ala115Val) NAGS variant allowed the definite diagnosis of NAGSD. Bioinformatic analysis suggested that an order/disorder alteration of the mutated form could affect the arginine-binding site, resulting in poor enzyme activation and late-onset presentation. After optimized treatment for NAGSD, ammonia and amino acid levels were constantly normal and prevented other headache bouts. The manuscript underlies that headache may be the presenting symptom of UCDs and provides clues for the rapid diagnosis and treatment of late-onset NAGSD. PMID:29364180

Late-Onset N-Acetylglutamate Synthase Deficiency: Report of a Paradigmatic Adult Case Presenting with Headaches and Review of the Literature

Directory of Open Access Journals (Sweden)

Catia Cavicchi

2018-01-01

Full Text Available N-acetylglutamate synthase deficiency (NAGSD is an extremely rare urea cycle disorder (UCD with few adult cases so far described. Diagnosis of late-onset presentations is difficult and delayed treatment may increase the risk of severe hyperammonemia. We describe a 52-year-old woman with recurrent headaches who experienced an acute onset of NAGSD. As very few papers focus on headaches in UCDs, we also report a literature review of types and pathophysiologic mechanisms of UCD-related headaches. In our case, headaches had been present since puberty (3–4 days a week and were often accompanied by nausea, vomiting, or behavioural changes. Despite three previous episodes of altered consciousness, ammonia was measured for the first time at 52 years and levels were increased. Identification of the new homozygous c.344C>T (p.Ala115Val NAGS variant allowed the definite diagnosis of NAGSD. Bioinformatic analysis suggested that an order/disorder alteration of the mutated form could affect the arginine-binding site, resulting in poor enzyme activation and late-onset presentation. After optimized treatment for NAGSD, ammonia and amino acid levels were constantly normal and prevented other headache bouts. The manuscript underlies that headache may be the presenting symptom of UCDs and provides clues for the rapid diagnosis and treatment of late-onset NAGSD.

Association between Polymorphism of Endothelial Nitric Oxide Synthase Gene (Glu298Asp) and Chronic Heart Failure in Patients with Ischemic Heart Disease and Obesity

OpenAIRE

O.I. Kadykova; P.P. Kravchun

2016-01-01

The article reviewed the links between polymorphism of endothelial nitric oxide synthase gene (Glu298Asp) and the development and progression of chronic heart failure in patients with ischemic heart disease and obesity. There has been a comprehensive survey of 222 patients with ischemic heart disease. Comparison group consisted of 115 patients with ischemic heart disease with normal body weight. The control group included 35 healthy individuals. G allele and genotype G/G polymorphism of the g...

Erratum Aldosterone synthase C-344T, angiotensin II type 1 receptor ...

Indian Academy of Sciences (India)

Aldosterone synthase C-344T, angiotensin II type 1 receptor A1166C and 11-β hydroxysteroid dehydrogenase G534A gene polymorphisms and essential hypertension in the population of Odisha, India. Manisha Patnaik, Pallabi Pati, Surendra N. Swain, Manoj K. Mohapatra, Bhagirathi Dwibedi, Shantanu K. Kar.

Eukaryotic beta-alanine synthases are functionally related but have a high degree of structural diversity

DEFF Research Database (Denmark)

Gojkovic, Zoran; Sandrini, Michael; Piskur, Jure

2001-01-01

no pyrimidine catabolic pathway, it enabled growth on N-carbamyl- beta -alanine as the sole nitrogen source. The D. discoideum and D. melanogaster PYD3 gene products are similar to mammalian beta -alanine synthases. In contrast, the S. kluyveri protein is quite different from these and more similar to bacterial......beta -Alanine synthase (EC 3.5.1.6), which catalyzes the final step of pyrimidine catabolism, has only been characterized in mammals. A Saccharomyces kluyveri pyd3 mutant that is unable to grow on N-carbamy-beta -alanine as the sole nitrogen source and exhibits diminished beta -alanine synthase...... N- carbamyl amidohydrolases. All three beta -alanine synthases are to some degree related to various aspartate transcarbamylases, which catalyze the second step of the de novo pyrimidine biosynthetic pathway. PYD3 expression in yeast seems to be inducible by dihydrouracil and N...

Geranylgeranyl diphosphate synthase from Scoparia dulcis and Croton sublyratus. Plastid localization and conversion to a farnesyl diphosphate synthase by mutagenesis.

Science.gov (United States)

Sitthithaworn, W; Kojima, N; Viroonchatapan, E; Suh, D Y; Iwanami, N; Hayashi, T; Noji, M; Saito, K; Niwa, Y; Sankawa, U

2001-02-01

cDNAs encoding geranylgeranyl diphosphate synthase (GGPPS) of two diterpene-producing plants, Scoparia dulcis and Croton sublyratus, have been isolated using the homology-based polymerase chain reaction (PCR) method. Both clones contained highly conserved aspartate-rich motifs (DDXX(XX)D) and their N-terminal residues exhibited the characteristics of chloroplast targeting sequence. When expressed in Escherichia coli, both the full-length and truncated proteins in which the putative targeting sequence was deleted catalyzed the condensation of farnesyl diphosphate and isopentenyl diphosphate to produce geranylgeranyl diphosphate (GGPP). The structural factors determining the product length in plant GGPPSs were investigated by constructing S. dulcis GGPPS mutants on the basis of sequence comparison with the first aspartate-rich motif (FARM) of plant farnesyl diphosphate synthase. The result indicated that in plant GGPPSs small amino acids, Met and Ser, at the fourth and fifth positions before FARM and Pro and Cys insertion in FARM play essential roles in determination of product length. Further, when a chimeric gene comprised of the putative transit peptide of the S. dulcis GGPPS gene and a green fluorescent protein was introduced into Arabidopsis leaves by particle gun bombardment, the chimeric protein was localized in chloroplasts, indicating that the cloned S. dulcis GGPPS is a chloroplast protein.

2-Methylbutyryl-coenzyme A dehydrogenase deficiency

DEFF Research Database (Denmark)

Sass, Jörn Oliver; Ensenauer, Regina; Röschinger, Wulf

2008-01-01

2-Methylbutyryl-CoA dehydrogenase (MBD; coded by the ACADSB gene) catalyzes the step in isoleucine metabolism that corresponds to the isovaleryl-CoA dehydrogenase reaction in the degradation of leucine. Deficiencies of both enzymes may be detected by expanded neonatal screening with tandem...... individuals showed clinical symptoms attributable to MBD deficiency although the defect in isoleucine catabolism was demonstrated both in vivo and in vitro. Several mutations in the ACADSB gene were identified, including a novel one. MBD deficiency may be a harmless metabolic variant although significant...

Biochemical Assessment of Coenzyme Q10 Deficiency

Directory of Open Access Journals (Sweden)

Juan Carlos Rodríguez-Aguilera

2017-03-01

Full Text Available Coenzyme Q10 (CoQ10 deficiency syndrome includes clinically heterogeneous mitochondrial diseases that show a variety of severe and debilitating symptoms. A multiprotein complex encoded by nuclear genes carries out CoQ10 biosynthesis. Mutations in any of these genes are responsible for the primary CoQ10 deficiency, but there are also different conditions that induce secondary CoQ10 deficiency including mitochondrial DNA (mtDNA depletion and mutations in genes involved in the fatty acid β-oxidation pathway. The diagnosis of CoQ10 deficiencies is determined by the decrease of its content in skeletal muscle and/or dermal skin fibroblasts. Dietary CoQ10 supplementation is the only available treatment for these deficiencies that require a rapid and distinct diagnosis. Here we review methods for determining CoQ10 content by HPLC separation and identification using alternative approaches including electrochemical detection and mass spectrometry. Also, we review procedures to determine the CoQ10 biosynthesis rate using labeled precursors.

Study of the serotonin transporter (SLC6A4 and BDNF genes in French patients with non syndromic mental deficiency

Directory of Open Access Journals (Sweden)

Mignon Laurence

2010-02-01

Full Text Available Abstract Background Mental deficiency has been linked to abnormalities in cortical neuronal network connectivity and plasticity. These mechanisms are in part under the control of two interacting signalling pathways, the serotonergic and the brain-derived neurotrophic (BDNF pathways. The aim of the current paper is to determine whether particular alleles or genotypes of two crucial genes of these systems, the serotonin transporter gene (SLC6A4 and the brain-derived neurotrophic factor gene (BDNF, are associated with mental deficiency (MD. Methods We analyzed four functional polymorphisms (rs25531, 5-HTTLPR, VNTR, rs3813034 of the SLC6A4 gene and one functional polymorphism (Val66 Met of the BDNF gene in 98 patients with non-syndromic mental deficiency (NS-MD and in an ethnically matched control population of 251 individuals. Results We found no significant differences in allele and genotype frequencies in the five polymorphisms studied in the SLC6A4 and BDNF genes of NS-MD patients versus control patients. While the comparison of the patterns of linkage disequilibrium (D' in the control and NS-MD populations revealed a degree of variability it did not, however, reach significance. No significant differences in frequencies of haplotypes and genotypes for VNTR/rs3813034 and rs25531/5-HTTLPR were observed. Conclusion Altogether, results from the present study do not support a role for any of the five functional polymorphisms of SLC6A4 and BDNF genes in the aetiology of NS-RM. Moreover, they suggest no epistatic interaction in NS-MD between polymorphisms in BDNF and SLC6A4. However, we suggest that further studies on these two pathways in NS-MD remain necessary.

Polyketide synthases of Diaporthe helianthi and involvement of DhPKS1 in virulence on sunflower.

Science.gov (United States)

Ruocco, Michelina; Baroncelli, Riccardo; Cacciola, Santa Olga; Pane, Catello; Monti, Maurilia Maria; Firrao, Giuseppe; Vergara, Mariarosaria; Magnano di San Lio, Gaetano; Vannacci, Giovanni; Scala, Felice

2018-01-06

The early phases of Diaporthe helianthi pathogenesis on sunflower are characterized by the production of phytotoxins that may play a role in host colonisation. In previous studies, phytotoxins of a polyketidic nature were isolated and purified from culture filtrates of virulent strains of D. helianthi isolated from sunflower. A highly aggressive isolate (7/96) from France contained a gene fragment of a putative nonaketide synthase (lovB) which was conserved in a virulent D. helianthi population. In order to investigate the role of polyketide synthases in D. helianthi 7/96, a draft genome of this isolate was examined. We were able to find and phylogenetically analyse 40 genes putatively coding for polyketide synthases (PKSs). Analysis of their domains revealed that most PKS genes of D. helianthi are reducing PKSs, whereas only eight lacked reducing domains. Most of the identified PKSs have orthologs shown to be virulence factors or genetic determinants for toxin production in other pathogenic fungi. One of the genes (DhPKS1) corresponded to the previously cloned D. helianthi lovB gene fragment and clustered with a nonribosomal peptide synthetase (NRPS) -PKS hybrid/lovastatin nonaketide like A. nidulans LovB. We used DhPKS1 as a case study and carried out its disruption through Agrobacterium-mediated transformation in the isolate 7/96. D. helianthi DhPKS1 deleted mutants were less virulent to sunflower compared to the wild type, indicating a role for this gene in the pathogenesis of the fungus. The PKS sequences analysed and reported here constitute a new genomic resource that will be useful for further research on the biology, ecology and evolution of D. helianthi and generally of fungal plant pathogens.

Ascorbic acid deficiency increases endotoxin influx to portal blood and liver inflammatory gene expressions in ODS rats.

Science.gov (United States)

Tokuda, Yuki; Miura, Natsuko; Kobayashi, Misato; Hoshinaga, Yukiko; Murai, Atsushi; Aoyama, Hiroaki; Ito, Hiroyuki; Morita, Tatsuya; Horio, Fumihiko

2015-02-01

The aim of this study was to determine whether ascorbic acid (AsA) deficiency-induced endotoxin influx into portal blood from the gastrointestinal tract contributes to the inflammatory changes in the liver. The mechanisms by which AsA deficiency provokes inflammatory changes in the liver were investigated in Osteogenic Disorder Shionogi (ODS) rats (which are unable to synthesize AsA). Male ODS rats (6-wk-old) were fed a diet containing sufficient (300 mg/kg) AsA (control group) or a diet without AsA (AsA-deficient group) for 14 or 18 d. On day 14, the hepatic mRNA levels of acute-phase proteins and inflammation-related genes were significantly higher in the AsA-deficient group than the control group, and these elevations by AsA deficiency were exacerbated on day 18. The serum concentrations of interleukin (IL)-1β and IL-6, which induce acute-phase proteins in the liver, were also significantly elevated on day 14 in the AsA-deficient group compared with the respective values in the control group. IL-1β mRNA levels in the liver, spleen, and lung were increased by AsA deficiency. Moreover, on both days 14 and 18, the portal blood endotoxin concentration was significantly higher in the AsA-deficient group than in the control group, and a significant correlation between serum IL-1β concentrations and portal endotoxin concentrations was found in AsA-deficient rats. In the histologic analysis of the ileum tissues, the number of goblet cells per villi was increased by AsA deficiency. These results suggest that AsA deficiency-induced endotoxin influx into portal blood from the gastrointestinal tract contributes to the inflammatory changes in the liver. Copyright © 2015 Elsevier Inc. All rights reserved.

Major histocompatibility complex class III genes and susceptibility to immunoglobulin A deficiency and common variable immunodeficiency.

OpenAIRE

Volanakis, J E; Zhu, Z B; Schaffer, F M; Macon, K J; Palermos, J; Barger, B O; Go, R; Campbell, R D; Schroeder, H W; Cooper, M D

1992-01-01

We have proposed that significant subsets of individuals with IgA deficiency (IgA-D) and common variable immunodeficiency (CVID) may represent polar ends of a clinical spectrum reflecting a single underlying genetic defect. This proposal was supported by our finding that individuals with these immunodeficiencies have in common a high incidence of C4A gene deletions and C2 rare gene alleles. Here we present our analysis of the MHC haplotypes of 12 IgA-D and 19 CVID individuals from 21 families...

Gene expression changes in the colon epithelium are similar to those of intact colon during late inflammation in interleukin-10 gene deficient mice.

Directory of Open Access Journals (Sweden)

Anna E Russ

Full Text Available In addition to their role in absorption and secretion, epithelial cells play an important role in the protection of the colon mucosa from the resident microbiota and are important for the maintenance of homeostasis. Microarray analysis of intact colon samples is widely used to gain an overview of the cellular pathways and processes that are active in the colon during inflammation. Laser microdissection of colon epithelial cells allows a more targeted analysis of molecular pathways in the mucosa, preceding and during inflammation, with potentially increased sensitivity to changes in specific cell populations. The aim of this study was to investigate the molecular changes that occur in early and late inflammation stages in colon epithelium of a mouse model of inflammatory bowel diseases. Microarray analysis of intact colon samples and microdissected colon epithelial cell samples from interleukin-10 gene deficient and control mice at 6 and 12 weeks of age was undertaken. Results of gene set enrichment analysis showed that more immune-related pathways were identified between interleukin-10 gene deficient and control mice at 6 weeks of age in epithelial cells than intact colon. This suggests that targeting epithelial cells could increase sensitivity for detecting immune changes that occur early in the inflammatory process. However, in the later stages of inflammation, microarray analyses of intact colon and epithelium both provide a similar overview of gene expression changes in the colon mucosa at the pathway level.

Adenosine Deaminase (ADA)-Deficient Severe Combined Immune Deficiency (SCID): Molecular Pathogenesis and Clinical Manifestations.

Science.gov (United States)

Bradford, Kathryn L; Moretti, Federico A; Carbonaro-Sarracino, Denise A; Gaspar, Hubert B; Kohn, Donald B

2017-10-01

Deficiency of adenosine deaminase (ADA, EC3.5.4.4), a housekeeping enzyme of purine metabolism encoded by the Ada gene, is a cause of human severe combined immune deficiency (SCID). Numerous deleterious mutations occurring in the ADA gene have been found in patients with profound lymphopenia (T - B - NK - ), thus underscoring the importance of functional purine metabolism for the development of the immune defense. While untreated ADA SCID is a fatal disorder, there are multiple life-saving therapeutic modalities to restore ADA activity and reconstitute protective immunity, including enzyme replacement therapy (ERT), allogeneic hematopoietic stem cell transplantation (HSCT) and gene therapy (GT) with autologous gene-corrected hematopoietic stem cells (HSC). We review the pathogenic mechanisms and clinical manifestations of ADA SCID.

Purification, crystallization and preliminary crystallographic analysis of human cystathionine β-synthase

International Nuclear Information System (INIS)

Oyenarte, Iker; Majtan, Tomas; Ereño, June; Corral-Rodríguez, María Angeles; Kraus, Jan P.; Martínez-Cruz, Luis Alfonso

2012-01-01

This article describes the crystallization and preliminary crystallographic analysis of a protein construct (hCBS 516–525 ) that contains the full-length cystathionine β-synthase from Homo sapiens (hCBS) and just lacks amino-acid residues 516–525. Human cystathionine β-synthase (CBS) is a pyridoxal-5′-phosphate-dependent hemeprotein, whose catalytic activity is regulated by S-adenosylmethionine. CBS catalyzes the β-replacement reaction of homocysteine (Hcy) with serine to yield cystathionine. CBS is a key regulator of plasma levels of the thrombogenic Hcy and deficiency in CBS is the single most common cause of homocystinuria, an inherited metabolic disorder of sulfur amino acids. The properties of CBS enzymes, such as domain organization, oligomerization degree or regulatory mechanisms, are not conserved across the eukaryotes. The current body of knowledge is insufficient to understand these differences and their impact on CBS function and physiology. To overcome this deficiency, we have addressed the crystallization and preliminary crystallographic analysis of a protein construct (hCBS 516–525 ) that contains the full-length CBS from Homo sapiens (hCBS) and just lacks amino-acid residues 516–525, which are located in a disordered loop. The human enzyme yielded crystals belonging to space group I222, with unit-cell parameters a = 124.98, b = 136.33, c = 169.83 Å and diffracting X-rays to a resolution of 3.0 Å. The crystal structure appears to contain two molecules in the asymmetric unit which presumably correspond to a dimeric form of the enzyme

Análise molecular dos genes PROP1 e HESX1 em pacientes com displasia septo-ótica e/ou deficiência hormonal hipofisária

OpenAIRE

Cruz, Juliana B. [UNESP; Nunes, Vânia dos Santos [UNESP; Clara, Sueli A. [UNESP; Perone, Denise [UNESP; Kopp, Peter; Nogueira, Célia Regina [UNESP

2010-01-01

Objective: The present study aimed at evaluating the PROP1 and HESX1 genes in a group of patients with septo-optic dysplasia (SOD) and pituitary hormone deficiency (combined – CPHD; isolated GH deficiency – GHD). Eleven patients with a clinical and biochemical presentation consistent with CPHD, GHD or SOD were evaluated. Subjects and methods: In all patients, the HESX1 gene was analyzed by direct sequence analysis and in cases of CPHD the PROP1 gene was also sequenced. Results: A polymorphism...

Requirement of the inducible nitric oxide synthase pathway for IL-1-induced osteoclastic bone resorption.

Science.gov (United States)

van't Hof, R J; Armour, K J; Smith, L M; Armour, K E; Wei, X Q; Liew, F Y; Ralston, S H

2000-07-05

Nitric oxide has been suggested to be involved in the regulation of bone turnover, especially in pathological conditions characterized by release of bone-resorbing cytokines. The cytokine IL-1 is thought to act as a mediator of periarticular bone loss and tissue damage in inflammatory diseases such as rheumatoid arthritis. IL-1 is a potent stimulator of both osteoclastic bone resorption and expression of inducible nitric oxide synthase (iNOS) in bone cells and other cell types. In this study, we investigated the role that the iNOS pathway plays in mediating the bone-resorbing effects of IL-1 by studying mice with targeted disruption of the iNOS gene. Studies in vitro and in vivo showed that iNOS-deficient mice exhibited profound defects of IL-1-induced osteoclastic bone resorption but responded normally to calciotropic hormones such as 1,25 dihydroxyvitamin D3 and parathyroid hormone. Immunohistochemical studies and electrophoretic mobility shift assays performed on bone marrow cocultures from iNOS-deficient mice showed abnormalities in IL-1-induced nuclear translocation of the p65 component of NFkappaB and in NFkappaB-DNA binding, which were reversed by treatment with the NO donor S-nitroso-acetyl penicillamine. These results show that the iNOS pathway is essential for IL-1-induced bone resorption and suggest that the effects of NO may be mediated by modulating IL-1-induced nuclear activation of NFkappaB in osteoclast precursors.

Requirement of the inducible nitric oxide synthase pathway for IL-1-induced osteoclastic bone resorption

Science.gov (United States)

van't Hof, R. J.; Armour, K. J.; Smith, L. M.; Armour, K. E.; Wei, X. Q.; Liew, F. Y.; Ralston, S. H.

2000-01-01

Nitric oxide has been suggested to be involved in the regulation of bone turnover, especially in pathological conditions characterized by release of bone-resorbing cytokines. The cytokine IL-1 is thought to act as a mediator of periarticular bone loss and tissue damage in inflammatory diseases such as rheumatoid arthritis. IL-1 is a potent stimulator of both osteoclastic bone resorption and expression of inducible nitric oxide synthase (iNOS) in bone cells and other cell types. In this study, we investigated the role that the iNOS pathway plays in mediating the bone-resorbing effects of IL-1 by studying mice with targeted disruption of the iNOS gene. Studies in vitro and in vivo showed that iNOS-deficient mice exhibited profound defects of IL-1-induced osteoclastic bone resorption but responded normally to calciotropic hormones such as 1,25 dihydroxyvitamin D3 and parathyroid hormone. Immunohistochemical studies and electrophoretic mobility shift assays performed on bone marrow cocultures from iNOS-deficient mice showed abnormalities in IL-1-induced nuclear translocation of the p65 component of NFκB and in NFκB-DNA binding, which were reversed by treatment with the NO donor S-nitroso-acetyl penicillamine. These results show that the iNOS pathway is essential for IL-1-induced bone resorption and suggest that the effects of NO may be mediated by modulating IL-1-induced nuclear activation of NFκB in osteoclast precursors. PMID:10869429

Digital gene expression analysis of corky split vein caused by boron deficiency in 'Newhall' Navel Orange (Citrus sinensis Osbeck for selecting differentially expressed genes related to vascular hypertrophy.

Directory of Open Access Journals (Sweden)

Cheng-Quan Yang

Full Text Available Corky split vein caused by boron (B deficiency in 'Newhall' Navel Orange was studied in the present research. The boron-deficient citrus exhibited a symptom of corky split vein in mature leaves. Morphologic and anatomical surveys at four representative phases of corky split veins showed that the symptom was the result of vascular hypertrophy. Digital gene expression (DGE analysis was performed based on the Illumina HiSeq™ 2000 platform, which was applied to analyze the gene expression profilings of corky split veins at four morphologic phases. Over 5.3 million clean reads per library were successfully mapped to the reference database and more than 22897 mapped genes per library were simultaneously obtained. Analysis of the differentially expressed genes (DEGs revealed that the expressions of genes associated with cytokinin signal transduction, cell division, vascular development, lignin biosynthesis and photosynthesis in corky split veins were all affected. The expressions of WOL and ARR12 involved in the cytokinin signal transduction pathway were up-regulated at 1(st phase of corky split vein development. Furthermore, the expressions of some cell cycle genes, CYCs and CDKB, and vascular development genes, WOX4 and VND7, were up-regulated at the following 2(nd and 3(rd phases. These findings indicated that the cytokinin signal transduction pathway may play a role in initiating symptom observed in our study.

Tomatidine Is a Lead Antibiotic Molecule That Targets Staphylococcus aureus ATP Synthase Subunit C.

Science.gov (United States)

Lamontagne Boulet, Maxime; Isabelle, Charles; Guay, Isabelle; Brouillette, Eric; Langlois, Jean-Philippe; Jacques, Pierre-Étienne; Rodrigue, Sébastien; Brzezinski, Ryszard; Beauregard, Pascale B; Bouarab, Kamal; Boyapelly, Kumaraswamy; Boudreault, Pierre-Luc; Marsault, Éric; Malouin, François

2018-06-01

Methicillin-resistant Staphylococcus aureus (MRSA) is a leading cause of deadly hospital-acquired infections. The discovery of anti- Staphylococcus antibiotics and new classes of drugs not susceptible to the mechanisms of resistance shared among bacteria is imperative. We recently showed that tomatidine (TO), a steroidal alkaloid from solanaceous plants, possesses potent antibacterial activity against S. aureus small-colony variants (SCVs), the notoriously persistent form of this bacterium that has been associated with recurrence of infections. Here, using genomic analysis of in vitro -generated TO-resistant S. aureus strains to identify mutations in genes involved in resistance, we identified the bacterial ATP synthase as the cellular target. Sequence alignments were performed to highlight the modified sequences, and the structural consequences of the mutations were evaluated in structural models. Overexpression of the atpE gene in S. aureus SCVs or introducing the mutation found in the atpE gene of one of the high-level TO-resistant S. aureus mutants into the Bacillus subtilis atpE gene provided resistance to TO and further validated the identity of the cellular target. FC04-100, a TO derivative which also possesses activity against non-SCV strains, prevents high-level resistance development in prototypic strains and limits the level of resistance observed in SCVs. An ATP synthesis assay allowed the observation of a correlation between antibiotic potency and ATP synthase inhibition. The selectivity index (inhibition of ATP production by mitochondria versus that of bacterial ATP synthase) is estimated to be >10 5 -fold for FC04-100. Copyright © 2018 American Society for Microbiology.

Ancient horizontal gene transfer from bacteria enhances biosynthetic capabilities of fungi.

Directory of Open Access Journals (Sweden)

Imke Schmitt

Full Text Available Polyketides are natural products with a wide range of biological functions and pharmaceutical applications. Discovery and utilization of polyketides can be facilitated by understanding the evolutionary processes that gave rise to the biosynthetic machinery and the natural product potential of extant organisms. Gene duplication and subfunctionalization, as well as horizontal gene transfer are proposed mechanisms in the evolution of biosynthetic gene clusters. To explain the amount of homology in some polyketide synthases in unrelated organisms such as bacteria and fungi, interkingdom horizontal gene transfer has been evoked as the most likely evolutionary scenario. However, the origin of the genes and the direction of the transfer remained elusive.We used comparative phylogenetics to infer the ancestor of a group of polyketide synthase genes involved in antibiotic and mycotoxin production. We aligned keto synthase domain sequences of all available fungal 6-methylsalicylic acid (6-MSA-type PKSs and their closest bacterial relatives. To assess the role of symbiotic fungi in the evolution of this gene we generated 24 6-MSA synthase sequence tags from lichen-forming fungi. Our results support an ancient horizontal gene transfer event from an actinobacterial source into ascomycete fungi, followed by gene duplication.Given that actinobacteria are unrivaled producers of biologically active compounds, such as antibiotics, it appears particularly promising to study biosynthetic genes of actinobacterial origin in fungi. The large number of 6-MSA-type PKS sequences found in lichen-forming fungi leads us hypothesize that the evolution of typical lichen compounds, such as orsellinic acid derivatives, was facilitated by the gain of this bacterial polyketide synthase.

Multi-substrate terpene synthases: their occurrence and physiological significance

Directory of Open Access Journals (Sweden)

Leila Pazouki

2016-07-01

Full Text Available Terpene synthases are responsible for synthesis of a large number of terpenes in plants using substrates provided by two distinct metabolic pathways, the mevalonate-dependent pathway that is located in cytosol and has been suggested to be responsible for synthesis of sesquiterpenes (C15, and 2-C-methyl-D-erythritol-4-phosphate pathway located in plastids and suggested to be responsible for the synthesis of hemi- (C5, mono- (C10 and diterpenes (C20. Recent advances in characterization of genes and enzymes responsible for substrate and end product biosynthesis as well as efforts in metabolic engineering have demonstrated existence of a number of multi-substrate terpene synthases. This review summarizes the progress in the characterization of such multi-substrate terpene synthases and suggests that the presence of multi-substrate use might have been significantly underestimated. Multi-substrate use could lead to important changes in terpene product profiles upon substrate profile changes under perturbation of metabolism in stressed plants as well as under certain developmental stages. We therefore argue that multi-substrate use can be significant under physiological conditions and can result in complicate modifications in terpene profiles.

Transcriptome resources and functional characterization of monoterpene synthases for two host species of the mountain pine beetle, lodgepole pine (Pinus contorta) and jack pine (Pinus banksiana)

Science.gov (United States)

2013-01-01

Background The mountain pine beetle (MPB, Dendroctonus ponderosae) epidemic has affected lodgepole pine (Pinus contorta) across an area of more than 18 million hectares of pine forests in western Canada, and is a threat to the boreal jack pine (Pinus banksiana) forest. Defence of pines against MPB and associated fungal pathogens, as well as other pests, involves oleoresin monoterpenes, which are biosynthesized by families of terpene synthases (TPSs). Volatile monoterpenes also serve as host recognition cues for MPB and as precursors for MPB pheromones. The genes responsible for terpene biosynthesis in jack pine and lodgepole pine were previously unknown. Results We report the generation and quality assessment of assembled transcriptome resources for lodgepole pine and jack pine using Sanger, Roche 454, and Illumina sequencing technologies. Assemblies revealed transcripts for approximately 20,000 - 30,000 genes from each species and assembly analyses led to the identification of candidate full-length prenyl transferase, TPS, and P450 genes of oleoresin biosynthesis. We cloned and functionally characterized, via expression of recombinant proteins in E. coli, nine different jack pine and eight different lodgepole pine mono-TPSs. The newly identified lodgepole pine and jack pine mono-TPSs include (+)-α-pinene synthases, (-)-α-pinene synthases, (-)-β-pinene synthases, (+)-3-carene synthases, and (-)-β-phellandrene synthases from each of the two species. Conclusion In the absence of genome sequences, transcriptome assemblies are important for defence gene discovery in lodgepole pine and jack pine, as demonstrated here for the terpenoid pathway genes. The product profiles of the functionally annotated mono-TPSs described here can account for the major monoterpene metabolites identified in lodgepole pine and jack pine. PMID:23679205

Transcriptome resources and functional characterization of monoterpene synthases for two host species of the mountain pine beetle, lodgepole pine (Pinus contorta) and jack pine (Pinus banksiana).

Science.gov (United States)

Hall, Dawn E; Yuen, Macaire M S; Jancsik, Sharon; Quesada, Alfonso Lara; Dullat, Harpreet K; Li, Maria; Henderson, Hannah; Arango-Velez, Adriana; Liao, Nancy Y; Docking, Roderick T; Chan, Simon K; Cooke, Janice Ek; Breuil, Colette; Jones, Steven Jm; Keeling, Christopher I; Bohlmann, Jörg

2013-05-16

The mountain pine beetle (MPB, Dendroctonus ponderosae) epidemic has affected lodgepole pine (Pinus contorta) across an area of more than 18 million hectares of pine forests in western Canada, and is a threat to the boreal jack pine (Pinus banksiana) forest. Defence of pines against MPB and associated fungal pathogens, as well as other pests, involves oleoresin monoterpenes, which are biosynthesized by families of terpene synthases (TPSs). Volatile monoterpenes also serve as host recognition cues for MPB and as precursors for MPB pheromones. The genes responsible for terpene biosynthesis in jack pine and lodgepole pine were previously unknown. We report the generation and quality assessment of assembled transcriptome resources for lodgepole pine and jack pine using Sanger, Roche 454, and Illumina sequencing technologies. Assemblies revealed transcripts for approximately 20,000 - 30,000 genes from each species and assembly analyses led to the identification of candidate full-length prenyl transferase, TPS, and P450 genes of oleoresin biosynthesis. We cloned and functionally characterized, via expression of recombinant proteins in E. coli, nine different jack pine and eight different lodgepole pine mono-TPSs. The newly identified lodgepole pine and jack pine mono-TPSs include (+)-α-pinene synthases, (-)-α-pinene synthases, (-)-β-pinene synthases, (+)-3-carene synthases, and (-)-β-phellandrene synthases from each of the two species. In the absence of genome sequences, transcriptome assemblies are important for defence gene discovery in lodgepole pine and jack pine, as demonstrated here for the terpenoid pathway genes. The product profiles of the functionally annotated mono-TPSs described here can account for the major monoterpene metabolites identified in lodgepole pine and jack pine.

International collaborative study of the endogenous reference gene, sucrose phosphate synthase (SPS), used for qualitative and quantitative analysis of genetically modified rice.

Science.gov (United States)

Jiang, Lingxi; Yang, Litao; Zhang, Haibo; Guo, Jinchao; Mazzara, Marco; Van den Eede, Guy; Zhang, Dabing

2009-05-13

One rice ( Oryza sativa ) gene, sucrose phosphate synthase (SPS), has been proven to be a suitable endogenous reference gene for genetically modified (GM) rice detection in a previous study. Herein are the reported results of an international collaborative ring trial for validation of the SPS gene as an endogenous reference gene and its optimized qualitative and quantitative polymerase chain reaction (PCR) systems. A total of 12 genetically modified organism (GMO) detection laboratories from seven countries participated in the ring trial and returned their results. The validated results confirmed the species specificity of the method through testing 10 plant genomic DNAs, low heterogeneity, and a stable single-copy number of the rice SPS gene among 7 indica varieties and 5 japonica varieties. The SPS qualitative PCR assay was validated with a limit of detection (LOD) of 0.1%, which corresponded to about 230 copies of haploid rice genomic DNA, while the limit of quantification (LOQ) for the quantitative PCR system was about 23 copies of haploid rice genomic DNA, with acceptable PCR efficiency and linearity. Furthermore, the bias between the test and true values of eight blind samples ranged from 5.22 to 26.53%. Thus, we believe that the SPS gene is suitable for use as an endogenous reference gene for the identification and quantification of GM rice and its derivates.

Mutations in Arabidopsis thaliana genes involved in the tryptophan biosynthesis pathway affect root waving on tilted agar surfaces

Science.gov (United States)

Rutherford, R.; Gallois, P.; Masson, P. H.

1998-01-01

Arabidopsis thaliana roots grow in a wavy pattern upon a slanted surface. A novel mutation in the anthranilate synthase alpha 1 (ASA1) gene, named trp5-2wvc1, and mutations in the tryptophan synthase alpha and beta 1 genes (trp3-1 and trp2-1, respectively) confer a compressed root wave phenotype on tilted agar surfaces. When trp5-2wvc1 seedlings are grown on media supplemented with anthranilate metabolites, their roots wave like wild type. Genetic and pharmacological experiments argue that the compressed root wave phenotypes of trp5-2wvc1, trp2-1 and trp3-1 seedlings are not due to reduced IAA biosynthetic potential, but rather to a deficiency in L-tryptophan (L-Trp), or in a L-Trp derivative. Although the roots of 7-day-old seedlings possess higher concentrations of free L-Trp than the shoot as a whole, trp5-2wvc1 mutants show no detectable alteration in L-Trp levels in either tissue type, suggesting that a very localized shortage of L-Trp, or of a L-Trp-derived compound, is responsible for the observed phenotype.

Isolation and Characterization of Three New Monoterpene Synthases from Artemisia annua

Science.gov (United States)

Ruan, Ju-Xin; Li, Jian-Xu; Fang, Xin; Wang, Ling-Jian; Hu, Wen-Li; Chen, Xiao-Ya; Yang, Chang-Qing

2016-01-01

Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5, and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography–mass spectrometry detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate, salicylic acid, and gibberellin, suggesting a role of these monoterpene synthases in plant–environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant. PMID:27242840

Isolation and characterization of three new monoterpene synthases from Artemisia annua

Directory of Open Access Journals (Sweden)

Ju-Xin eRuan

2016-05-01

Full Text Available Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5 and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography-mass spectrometry (GC-MS detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate (MeJA, salicylic acid (SA and gibberellin (GA, suggesting a role of these monoterpene synthases in plant-environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant.

Transcriptome profiling of the Australian arid-land plant Eremophila serrulata (A.DC.) Druce (Scrophulariaceae) for the identification of monoterpene synthases.

Science.gov (United States)

Kracht, Octavia Natascha; Ammann, Ann-Christin; Stockmann, Julia; Wibberg, Daniel; Kalinowski, Jörn; Piotrowski, Markus; Kerr, Russell; Brück, Thomas; Kourist, Robert

2017-04-01

Plant terpenoids are a large and highly diverse class of metabolites with an important role in the immune defense. They find wide industrial application as active pharmaceutical ingredients, aroma and fragrance compounds. Several Eremophila sp. derived terpenoids have been documented. To elucidate the terpenoid metabolism, the transcriptome of juvenile and mature Eremophila serrulata (A.DC.) Druce (Scrophulariaceae) leaves was sequenced and a transcript library was generated. We report on the first transcriptomic dataset of an Eremophila plant. IlluminaMiSeq sequencing (2 × 300 bp) revealed 7,093,266 paired reads, which could be assembled to 34,505 isogroups. To enable detection of terpene biosynthetic genes, leaves were separately treated with methyl jasmonate, a well-documented inducer of plant secondary metabolites. In total, 21 putative terpene synthase genes were detected in the transcriptome data. Two terpene synthase isoenzymatic genes, termed ES01 and ES02, were successfully expressed in E. coli. The resulting proteins catalyzed the conversion of geranyl pyrophosphate, the universal substrate of monoterpene synthases to myrcene and Z-(b)-ocimene, respectively. The transcriptomic data and the discovery of the first terpene synthases from Eremophila serrulata are the initial step for the understanding of the terpene metabolism in this medicinally important plant genus. Copyright © 2017 Elsevier Ltd. All rights reserved.

Glutamylation of the DNA sensor cGAS regulates its binding and synthase activity in antiviral immunity.

Science.gov (United States)

Xia, Pengyan; Ye, Buqing; Wang, Shuo; Zhu, Xiaoxiao; Du, Ying; Xiong, Zhen; Tian, Yong; Fan, Zusen

2016-04-01

Cyclic GMP-AMP synthase (cGAS) senses cytosolic DNA during viral infection and catalyzes synthesis of the dinucleotide cGAMP, which activates the adaptor STING to initiate antiviral responses. Here we found that deficiency in the carboxypeptidase CCP5 or CCP6 led to susceptibility to DNA viruses. CCP5 and CCP6 were required for activation of the transcription factor IRF3 and interferons. Polyglutamylation of cGAS by the enzyme TTLL6 impeded its DNA-binding ability, whereas TTLL4-mediated monoglutamylation of cGAS blocked its synthase activity. Conversely, CCP6 removed the polyglutamylation of cGAS, whereas CCP5 hydrolyzed the monoglutamylation of cGAS, which together led to the activation of cGAS. Therefore, glutamylation and deglutamylation of cGAS tightly modulate immune responses to infection with DNA viruses.

The Role of ?786T/C Polymorphism in the Endothelial Nitric Oxide Synthase Gene in Males with Clinical and Biochemical Features of the Metabolic Syndrome

OpenAIRE

Misiak, Blazej; Krolik, Marta; Kukowka, Anna; Lewera, Anna; Leszczynski, Przemyslaw; Stankiewicz-Olczyk, Joanna; Slezak, Ryszard

2011-01-01

Background. Extensive evidence, arising from models of endothelial nitric oxide synthase gene (NOS3)-knockout mice supports the role of endothelial malfunction in the pathogenesis of the metabolic syndrome (MS). Aims. The aim of this study was to evaluate the role of −786T/C polymorphism in the etiology of MS and assess previously reported interaction with cigarette smoking. Methods. Based on International Diabetes Federation 2005 criteria, we recruited randomly 152 subjects with MS and 75 su...

Proto-oncogene FBI-1 (Pokemon) and SREBP-1 Synergistically Activate Transcription of Fatty-acid Synthase Gene (FASN)*S⃞

Science.gov (United States)

Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F.; Hur, Man-Wook

2008-01-01

FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402

Dynamic 1-aminocyclopropane-1-carboxylate-synthase and -oxidase transcript accumulation patterns during pollen tube growth in tobacco styles.

Science.gov (United States)

Weterings, Koen; Pezzotti, Mario; Cornelissen, Marc; Mariani, Celestina

2002-11-01

In flowering plants, pollination of the stigma sets off a cascade of responses in the distal flower organs. Ethylene and its biosynthetic precursor 1-aminocyclopropane-1-carboxylate (ACC) play an important role in regulating these responses. Because exogenous application of ethylene or ACC does not invoke the full postpollination syndrome, the pollination signal probably consists of a more complex set of stimuli. We set out to study how and when the pollination signal moves through the style of tobacco (Nicotiana tabacum) by analyzing the expression patterns of pistil-expressed ACC-synthase and -oxidase genes. Results from this analysis showed that pollination induces high ACC-oxidase transcript levels in all cells of the transmitting tissue. ACC-synthase mRNA accumulated only in a subset of transmitting tract cells and to lower levels as compared with ACC-oxidase. More significantly, we found that although ACC-oxidase transcripts accumulate to uniform high levels, the ACC-synthase transcripts accumulate in a wave-like pattern in which the peak coincides with the front of the ingrowing pollen tube tips. This wave of ACC-synthase expression can also be induced by incongruous pollination and (partially) by wounding. This indicates that wounding-like features of pollen tube invasion might be part of the stimuli evoking the postpollination response and that these stimuli are interpreted differently by the regulatory mechanisms of the ACC-synthase and -oxidase genes.

Deficiencies in both starch synthase IIIa and branching enzyme IIb lead to a significant increase in amylose in SSIIa-inactive japonica rice seeds.

Science.gov (United States)

Asai, Hiroki; Abe, Natsuko; Matsushima, Ryo; Crofts, Naoko; Oitome, Naoko F; Nakamura, Yasunori; Fujita, Naoko

2014-10-01

Starch synthase (SS) IIIa has the second highest activity of the total soluble SS activity in developing rice endosperm. Branching enzyme (BE) IIb is the major BE isozyme, and is strongly expressed in developing rice endosperm. A mutant (ss3a/be2b) was generated from wild-type japonica rice which lacks SSIIa activity. The seed weight of ss3a/be2b was 74-94% of that of the wild type, whereas the be2b seed weight was 59-73% of that of the wild type. There were significantly fewer amylopectin short chains [degree of polymerization (DP) ≤13] in ss3a/be2b compared with the wild type. In contrast, the amount of long chains (DP ≥25) connecting clusters of amylopectin in ss3a/be2b was higher than in the wild type and lower than in be2b. The apparent amylose content of ss3a/be2b was 45%, which was >1.5 times greater than that of either ss3a or be2b. Both SSIIIa and BEIIb deficiencies led to higher activity of ADP-glucose pyrophosphorylase (AGPase) and granule-bound starch synthase I (GBSSI), which partly explains the high amylose content in the ss3a/be2b endosperm. The percentage apparent amylose content of ss3a and ss3a/be2b at 10 days after flowering (DAF) was higher than that of the wild type and be2b. At 20 DAF, amylopectin biosynthesis in be2b and ss3a/be2b was not observed, whereas amylose biosynthesis in these lines was accelerated at 30 DAF. These data suggest that the high amylose content in the ss3a/be2b mutant results from higher amylose biosynthesis at two stages, up to 20 DAF and from 30 DAF to maturity. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Rearrangement of Rag-1 recombinase gene in DNA-repair deficient/immunodeficient ``wasted`` mice

Energy Technology Data Exchange (ETDEWEB)

Woloschak, G.E.; Weaver, P.; Churchill, M.; Chang-Liu, C-M. [Argonne National Lab., IL (United States); Libertin, C.R. [Loyola Univ., Maywood, IL (United States)

1992-11-01

Mice recessive for the autosomal gene ``wasted`` (wst) display a disease pattern which includes increased sensitivity to the killing effects of ionizing radiation, immunodeficiency, and neurologic dysfunction. The recent cloning and characterization of recombinase genes (Rag-l/Rag-2) expressed in lymphoid and possibly central nervous system tissues prompted us to examine expression of these genes in DNA repair-deficient/immunodeficient wasted mice. Our results revealed that in thymus tissue, a small Rag-I transcript (1.0 kb) was detected in wst/wst mice that was not evident in thymus from control mice. In wst/{sm_bullet} mice, a two-fold increase in Rag-1 mRNA was evident in thymus tissue. Rag-2 mRNA could only be detected in thymus tissue from wst/{sm_bullet} and not from wst/wst or parental control BCF, mice. Southern blots revealed a rearrangement or deletion within the Rag-1 gene of affected wasted mice that was not evident in known strain-specific parental or littermate controls. These results support the idea that the Rag-1 gene may map at or near the locus for the wasted mutation. In addition, they suggest the importance of recombinase function in normal immune and central nervous system development as well as the potential contribution of this gene family to the normal repair of radiation-induced DNA damage.

Benzalacetone Synthase

Directory of Open Access Journals (Sweden)

Ikuro eAbe

2012-03-01

Full Text Available Benzalacetone synthase, from the medicinal plant Rheum palmatum (Polygonaceae (RpBAS, is a plant-specific chalcone synthase (CHS superfamily of type III polyketide synthase (PKS. RpBAS catalyzes the one-step, decarboxylative condensation of 4-coumaroyl-CoA with malonyl-CoA to produce the C6-C4 benzalacetone scaffold. The X-ray crystal structures of RpBAS confirmed that the diketide-forming activity is attributable to the characteristic substitution of the conserved active-site "gatekeeper" Phe with Leu. Furthermore, the crystal structures suggested that RpBAS employs novel catalytic machinery for the thioester bond cleavage of the enzyme-bound diketide intermediate and the final decarboxylation reaction to produce benzalacetone. Finally, by exploiting the remarkable substrate tolerance and catalytic versatility of RpBAS, precursor-directed biosynthesis efficiently generated chemically and structurally divergent, unnatural novel polyketide scaffolds. These findings provided a structural basis for the functional diversity of the type III PKS enzymes.

Both AtrbohD and AtrbohF are essential for mediating responses to oxygen deficiency in Arabidopsis.

Science.gov (United States)

Liu, Bo; Sun, Lirong; Ma, Liya; Hao, Fu-Shun

2017-06-01

Both AtrbohD and AtrbohF promote the increases in activities of ADH, PDC, LDH, and Ca 2+ levels, and induce the expression of multiple hypoxia response genes, thus improving Arabidopsis adaptation to oxygen deficiency. NADPH oxidase AtrbohD and AtrbohF cooperatively play key roles in regulation of growth and stress signaling in Arabidopsis. However, reports on AtrbohD and AtrbohF functioning together in hypoxia signaling are scarce, and the underlying mechanisms remain elusive. Here, we show that the double null mutant atrbohD/F is more sensitive to oxygen deprivation compared with wild type (WT) and the single mutant atrbohD and atrbohF. Under oxygen deficiency, enhancements of the transcripts of alcohol dehydrogenase 1 (ADH1) and pyruvate decarboxylase 1 (PDC1) and the activities of ADH, PDC and lactate dehydrogenase in WT are clearly reduced in the single mutants, and more strongly reduced in the double mutant. Moreover, increases in the production of ATP, H 2 O 2 and Ca 2+ in WT are significantly arrested in atrbohD, atrbohF, and especially in atrbohD/F. Hypoxia-promoted rise in the expression of some hypoxic responsive genes is also inhibited in atrbohD/F relative to WT, atrbohD and atrbohF. These genes include ethylene response factor 73, lactate dehydrogenase, MYB transcription factor 2, sucrose synthase 1 (SUS1), SUS4, heat stress transcription factor A2 and heat-shock protein 18.2. These results suggest that both AtrbohD and AtrbohF are essential for mediating hypoxia signaling. H 2 O 2 derived from AtrbohD and AtrbohF triggers the Ca 2+ increase and induces the expression of multiple hypoxia response genes, thus improving Arabidopsis tolerance to low-oxygen stress. These findings provide new insights into the mechanisms of AtrbohF in regulating the responses to oxygen deprivation in Arabidopsis.

Endothelial nitric oxide synthase deficiency influences normal cell cycle progression and apoptosis in trabecular meshwork cells

Directory of Open Access Journals (Sweden)

Qiong Liao

2016-06-01

Full Text Available AIM: To clarify how the endothelial nitric oxide synthase (eNOS, NOS3 make effect on outflow facility through the trabecular meshwork (TM. METHODS: Inhibition of NOS3 gene expression in human TM cells were conducted by three siRNAs. Then the mRNA and protein levels of NOS3 in siRNA-treated and negative control (NC cells were determined, still were the collagen, type IV, alpha 1 (COL4A1 and fibronectin 1 by real-time PCR and Western blot analysis. In addition, NOS3 concentrations in culture supernatant fluids of TM cells were measured. Cell cycle and cell apoptosis analysis were performed using flow cytometry. RESULTS: The mRNA level of NOS3 was decreased by three different siRNA interference, similar results were obtained not only of the relative levels of NOS3 protein, but also the expression levels of COL4A1 and fibronectin 1. The number of cells in S phase was decreased, while contrary result was obtained in G2 phase. The number of apoptotic cells in siRNA-treated groups were significant increased compared to the NC samples. CONCLUSION: Abnormal NOS3 expression can make effects on the proteins levels of extracellular matrix component (e.g. fibronectin 1 and COL4A1. Reduced NOS3 restrains the TM cell cycle progression at the G2/M-phase transition and induced cell apoptosis.

Gene expression deregulation in postnatal skeletal muscle of TK2 deficient mice reveals a lower pool of proliferating myogenic progenitor cells.

Directory of Open Access Journals (Sweden)

João A Paredes

Full Text Available Loss of thymidine kinase 2 (TK2 causes a heterogeneous myopathic form of mitochondrial DNA (mtDNA depletion syndrome (MDS in humans that predominantly affects skeletal muscle tissue. In mice, TK2 deficiency also affects several tissues in addition to skeletal muscle, including brain, heart, adipose tissue, kidneys and causes death about 3 weeks after birth. We analysed skeletal muscle and heart muscle tissues of Tk2 knockout mice at postnatal development phase and observed that TK2 deficient pups grew slower and their skeletal muscles appeared significantly underdeveloped, whereas heart was close to normal in size. Both tissues showed mtDNA depletion and mitochondria with altered ultrastructure, as revealed by transmission electron microscopy. Gene expression microarray analysis showed a strong down-regulation of genes involved in cell cycle and cell proliferation in both tissues, suggesting a lower pool of undifferentiated proliferating cells. Analysis of isolated primary myoblasts from Tk2 knockout mice showed slow proliferation, less ability to differentiate and signs of premature senescence, even in absence of mtDNA depletion. Our data demonstrate that TK2 deficiency disturbs myogenic progenitor cells function in postnatal skeletal muscle and we propose this as one of the causes of underdeveloped phenotype and myopathic characteristic of the TK2 deficient mice, in addition to the progressive mtDNA depletion, mitochondrial damage and respiratory chain deficiency in post-mitotic differentiated tissue.

Gene expression deregulation in postnatal skeletal muscle of TK2 deficient mice reveals a lower pool of proliferating myogenic progenitor cells.

Science.gov (United States)

Paredes, João A; Zhou, Xiaoshan; Höglund, Stefan; Karlsson, Anna

2013-01-01

Loss of thymidine kinase 2 (TK2) causes a heterogeneous myopathic form of mitochondrial DNA (mtDNA) depletion syndrome (MDS) in humans that predominantly affects skeletal muscle tissue. In mice, TK2 deficiency also affects several tissues in addition to skeletal muscle, including brain, heart, adipose tissue, kidneys and causes death about 3 weeks after birth. We analysed skeletal muscle and heart muscle tissues of Tk2 knockout mice at postnatal development phase and observed that TK2 deficient pups grew slower and their skeletal muscles appeared significantly underdeveloped, whereas heart was close to normal in size. Both tissues showed mtDNA depletion and mitochondria with altered ultrastructure, as revealed by transmission electron microscopy. Gene expression microarray analysis showed a strong down-regulation of genes involved in cell cycle and cell proliferation in both tissues, suggesting a lower pool of undifferentiated proliferating cells. Analysis of isolated primary myoblasts from Tk2 knockout mice showed slow proliferation, less ability to differentiate and signs of premature senescence, even in absence of mtDNA depletion. Our data demonstrate that TK2 deficiency disturbs myogenic progenitor cells function in postnatal skeletal muscle and we propose this as one of the causes of underdeveloped phenotype and myopathic characteristic of the TK2 deficient mice, in addition to the progressive mtDNA depletion, mitochondrial damage and respiratory chain deficiency in post-mitotic differentiated tissue.

Rearrangement of RAG-1 recombinase gene in DNA-repair deficient ``wasted`` mice

Energy Technology Data Exchange (ETDEWEB)

Woloschak, G.E.; Libertin, C.R.; Weaver, P. [Loyola Univ., Chicago, IL (United States); Churchill, M.; Chang-Liu, C.M. [Argonne National Lab., IL (United States)

1993-11-01

Mice recessive for the autosomal gene ``wasted`` wst display a disease pattern which includes increased sensitivity to the killing effects of ionizing radiation, immunodeficiency, and neurologic dysfunction. The recent cloning and characterization of recombinase genes (RAG-l/RAG-2) expressed in lymphoid and possibly central nervous system tissues prompted us to examine expression of these genes in DNA repair-deficient/immunodeficient wasted mice. Our results revealed expression of RAG-1 mRNA in spinal cord (but not brain) of control mice; no expression of RAG-1 mRNA was detected in spinal cord or brain from wst/wst mice or their normal littermates (wst/{center_dot}mice). In thymus tissue, a small RAG-1 transcript (1.0 kb) was detected in wst/wst mice that was not evident in thymus from control mice. In wst/{center_dot}mice, a two-fold increase in RAG-1 mRNA was evident in thymus tissue. RAG-2 mRNA could only be detected in thymus tissue from wst/{center_dot} and not from wst/wst or parental control BCF{sub 1} mice. Southern blots revealed a rearrangement/deletion within the RAG-1 gene of affected wasted mice, not evident in known strain-specific parental or littermate controls. These results support the idea that the RAG-1 gene may map at or near the locus for the wasted mutation. In addition, they suggest the importance of recombinase function in normal immune and central nervous system development as well as the potential contribution of this gene family to the normal repair of radiation-induced DNA damage.

2C-Methyl- D- erythritol 2,4-cyclodiphosphate synthase from Stevia rebaudiana Bertoni is a functional gene.

Science.gov (United States)

Kumar, Hitesh; Singh, Kashmir; Kumar, Sanjay

2012-12-01

Stevia [Stevia rebaudiana (Bertoni)] is a perennial herb which accumulates sweet diterpenoid steviol glycosides (SGs) in its leaf tissue. SGs are synthesized by 2C-methyl-D-erythritol 4-phosphate (MEP) pathway. Of the various enzymes of the MEP pathway, 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (MDS) (encoded by MDS) catalyzes the cyclization of 4-(cytidine 5' diphospho)-2C-methyl-D-erythritol 2-phosphate into 2C-methyl-D-erythritol 2,4-cyclodiphosphate. Complementation of the MDS knockout mutant strain of Escherichia coli, EB370 with putative MDS of stevia (SrMDS) rescued the lethal mutant, suggesting SrMDS to be a functional gene. Experiments conducted in plant growth chamber and in the field suggested SrMDS to be a light regulated gene. Indole 3-acetic acid (IAA; 50, 100 μM) down-regulated the expression of SrMDS at 4 h of the treatment, whereas, abscisic acid did not modulate its expression. A high expression of SrMDS was observed during the light hours of the day as compared to the dark hours. The present work established functionality of SrMDS and showed the role of light and IAA in regulating expression of SrMDS.

Bioengineering of the Plant Culture of Capsicum frutescens with Vanillin Synthase Gene for the Production of Vanillin.

Science.gov (United States)

Chee, Marcus Jenn Yang; Lycett, Grantley W; Khoo, Teng-Jin; Chin, Chiew Foan

2017-01-01

Production of vanillin by bioengineering has gained popularity due to consumer demand toward vanillin produced by biological systems. Natural vanillin from vanilla beans is very expensive to produce compared to its synthetic counterpart. Current bioengineering works mainly involve microbial biotechnology. Therefore, alternative means to the current approaches are constantly being explored. This work describes the use of vanillin synthase (VpVAN), to bioconvert ferulic acid to vanillin in a plant system. The VpVAN enzyme had been shown to directly convert ferulic acid and its glucoside into vanillin and its glucoside, respectively. As the ferulic acid precursor and vanillin were found to be the intermediates in the phenylpropanoid biosynthetic pathway of Capsicum species, this work serves as a proof-of-concept for vanillin production using Capsicum frutescens (C. frutescens or hot chili pepper). The cells of C. frutescens were genetically transformed with a codon optimized VpVAN gene via biolistics. Transformed explants were selected and regenerated into callus. Successful integration of the gene cassette into the plant genome was confirmed by polymerase chain reaction. High-performance liquid chromatography was used to quantify the phenolic compounds detected in the callus tissues. The vanillin content of transformed calli was 0.057% compared to 0.0003% in untransformed calli.

The Dictyostelium discoideum cellulose synthase: Structure/function analysis and identification of interacting proteins

Energy Technology Data Exchange (ETDEWEB)

Richard L. Blanton

2004-02-19

OAK-B135 The major accomplishments of this project were: (1) the initial characterization of dcsA, the gene for the putative catalytic subunit of cellulose synthase in the cellular slime mold Dictyostelium discoideum; (2) the detection of a developmentally regulated event (unidentified, but perhaps a protein modification or association with a protein partner) that is required for cellulose synthase activity (i.e., the dcsA product is necessary, but not sufficient for cellulose synthesis); (3) the continued exploration of the developmental context of cellulose synthesis and DcsA; (4) the isolation of a GFP-DcsA-expressing strain (work in progress); and (5) the identification of Dictyostelium homologues for plant genes whose products play roles in cellulose biosynthesis. Although our progress was slow and many of our results negative, we did develop a number of promising avenues of investigation that can serve as the foundation for future projects.

Enhanced Toxic Metal Accumulation in Engineered Bacterial Cells Expressing Arabidopsis thaliana Phytochelatin Synthase

Science.gov (United States)

Sauge-Merle, Sandrine; Cuiné, Stéphan; Carrier, Patrick; Lecomte-Pradines, Catherine; Luu, Doan-Trung; Peltier, Gilles

2003-01-01

Phytochelatins (PCs) are metal-binding cysteine-rich peptides, enzymatically synthesized in plants and yeasts from glutathione in response to heavy metal stress by PC synthase (EC 2.3.2.15). In an attempt to increase the ability of bacterial cells to accumulate heavy metals, the Arabidopsis thaliana gene encoding PC synthase (AtPCS) was expressed in Escherichia coli. A marked accumulation of PCs was observed in vivo together with a decrease in the glutathione cellular content. When bacterial cells expressing AtPCS were placed in the presence of heavy metals such as cadmium or the metalloid arsenic, cellular metal contents were increased 20- and 50-fold, respectively. We discuss the possibility of using genes of the PC biosynthetic pathway to design bacterial strains or higher plants with increased abilities to accumulate toxic metals, and also arsenic, for use in bioremediation and/or phytoremediation processes. PMID:12514032

Organellar and cytosolic localization of four phosphoribosyl diphosphate synthase isozymes in spinach

DEFF Research Database (Denmark)

Krath, Britta N.; Hove-Jensen, Bjarne

1999-01-01

Four cDNAs encoding phosphoribosyl diphosphate (PRPP) synthase were isolated from a spinach (Spinacia oleracea) cDNA library by complementation of an Escherichia coli Δprs mutation. The four gene products produced PRPP in vitro from ATP and ribose-5-phosphate. Two of the enzymes (isozymes 1 and 2...

Pharmacogenetic Study in Rectal Cancer Patients Treated With Preoperative Chemoradiotherapy: Polymorphisms in Thymidylate Synthase, Epidermal Growth Factor Receptor, GSTP1, and DNA Repair Genes

International Nuclear Information System (INIS)

Páez, David; Salazar, Juliana; Paré, Laia; Pertriz, Lourdes; Targarona, Eduardo; Rio, Elisabeth del; Barnadas, Agusti; Marcuello, Eugenio; Baiget, Montserrat

2011-01-01

Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5′UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The ∗3/∗3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in ∗3/∗3 vs. 35% in ∗2/∗2 and ∗2/∗3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the ∗3/∗3 patients and 84 months for the ∗2/∗2 and ∗2/∗3 patients (p = .039). For XRCC1 Arg399Gln SNP, the median progression-free survival was 101 months for the G/G, 78 months for the G/A, and 31 months for the A/A patients (p = .048). Conclusions: The thymidylate

Pharmacogenetic Study in Rectal Cancer Patients Treated With Preoperative Chemoradiotherapy: Polymorphisms in Thymidylate Synthase, Epidermal Growth Factor Receptor, GSTP1, and DNA Repair Genes

Energy Technology Data Exchange (ETDEWEB)

Paez, David, E-mail: dpaez@santpau.cat [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Salazar, Juliana; Pare, Laia [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Pertriz, Lourdes [Department of Radiotherapy, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Targarona, Eduardo [Department of Surgery, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Rio, Elisabeth del [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Barnadas, Agusti; Marcuello, Eugenio [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Baiget, Montserrat [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain)

2011-12-01

Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5 Prime UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The Asterisk-Operator 3/ Asterisk-Operator 3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in Asterisk-Operator 3/ Asterisk-Operator 3 vs. 35% in Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk-Operator 3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the Asterisk-Operator 3/ Asterisk-Operator 3 patients and 84 months for the Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk

JAZ repressors: Possible Involvement in Nutrients Deficiency Response in Rice and Chickpea

Directory of Open Access Journals (Sweden)

Ajit P. Singh

2015-11-01

Full Text Available Jasmonates (JA are well-known phytohormones which play important roles in plant development and defence against pathogens. Jasmonate ZIM domain (JAZ proteins are plant-specific proteins and act as transcriptional repressors of JA-responsive genes. JA regulates both biotic and abiotic stress responses in plants; however, its role in nutrient deficiency responses is very elusive. Although, JA is well-known for root growth inhibition, little is known about behaviour of JAZ genes in response to nutrient deficiencies, under which root architectural alteration is an important adaptation. Using protein sequence homology and a conserved-domains approach, here we identify ten novel JAZ genes from the recently sequenced Chickpea genome, which is one of the most nutrient efficient crops. Both rice and chickpea JAZ genes express in tissue- and stimuli-specific manners. Many of which are preferentially expressed in root. Our analysis further showed differential expression of JAZ genes under macro (NPK and micronutrients (Zn, Fe deficiency in rice and chickpea roots. While both rice and chickpea JAZ genes showed a certain level of specificity towards type of nutrient deficiency, generally majority of them showed induction under K deficiency. Generally, JAZ genes showed an induction at early stages of stress and expression declined at later stages of macro-nutrient deficiency. Our results suggest that JAZ genes might play a role in early nutrient deficiency response both in monocot and dicot roots, and information generated here can be further used for understanding the possible roles of JA in root architectural alterations for nutrient deficiency adaptations

Polymorphisms in nitric oxide synthase and endothelin genes among children with obstructive sleep apnea.

Science.gov (United States)

Chatsuriyawong, Siriporn; Gozal, David; Kheirandish-Gozal, Leila; Bhattacharjee, Rakesh; Khalyfa, Ahamed A; Wang, Yang; Sukhumsirichart, Wasana; Khalyfa, Abdelnaby

2013-09-06

Obstructive sleep apnea (OSA) is associated with adverse and interdependent cognitive and cardiovascular consequences. Increasing evidence suggests that nitric oxide synthase (NOS) and endothelin family (EDN) genes underlie mechanistic aspects of OSA-associated morbidities. We aimed to identify single nucleotide polymorphisms (SNPs) in the NOS family (3 isoforms), and EDN family (3 isoforms) to identify potential associations of these SNPs in children with OSA. A pediatric community cohort (ages 5-10 years) enriched for snoring underwent overnight polysomnographic (NPSG) and a fasting morning blood draw. The diagnostic criteria for OSA were an obstructive apnea-hypopnea Index (AHI) >2/h total sleep time (TST), snoring during the night, and a nadir oxyhemoglobin saturation DNA from peripheral blood was extracted and allelic frequencies were assessed for, NOS1 (209 SNPs), NOS2 (122 SNPs), NOS3 (50 SNPs), EDN1 (43 SNPs), EDN2 (48 SNPs), EDN3 (14 SNPs), endothelin receptor A, EDNRA, (27 SNPs), and endothelin receptor B, EDNRB (23 SNPs) using a custom SNPs array. The relative frequencies of NOS-1,-2, and -3, and EDN-1,-2,-3,-EDNRA, and-EDNRB genotypes were evaluated in 608 subjects [128 with OSA, and 480 without OSA (NOSA)]. Furthermore, subjects with OSA were divided into 2 subgroups: OSA with normal endothelial function (OSA-NEF), and OSA with endothelial dysfunction (OSA-ED). Linkage disequilibrium was analyzed using Haploview version 4.2 software. For NOSA vs. OSA groups, 15 differentially distributed SNPs for NOS1 gene, and 1 SNP for NOS3 emerged, while 4 SNPs for EDN1 and 1 SNP for both EDN2 and EDN3 were identified. However, in the smaller sub-group for whom endothelial function was available, none of the significant SNPs was retained due to lack of statistical power. Differences in the distribution of polymorphisms among NOS and EDN gene families suggest that these SNPs could play a contributory role in the pathophysiology and risk of OSA-induced cardiovascular

An In Planta-Expressed Polyketide Synthase Produces (R)-Mellein in the Wheat Pathogen Parastagonospora nodorum

Science.gov (United States)

Krill, Christian; Barrow, Russell A.; Chen, Shasha; Trengove, Robert; Oliver, Richard P.; Solomon, Peter S.

2014-01-01

Parastagonospora nodorum is a pathogen of wheat that affects yields globally. Previous transcriptional analysis identified a partially reducing polyketide synthase (PR-PKS) gene, SNOG_00477 (SN477), in P. nodorum that is highly upregulated during infection of wheat leaves. Disruption of the corresponding SN477 gene resulted in the loss of production of two compounds, which we identified as (R)-mellein and (R)-O-methylmellein. Using a Saccharomyces cerevisiae yeast heterologous expression system, we successfully demonstrated that SN477 is the only enzyme required for the production of (R)-mellein. This is the first identification of a fungal PKS that is responsible for the synthesis of (R)-mellein. The P. nodorum ΔSN477 mutant did not show any significant difference from the wild-type strain in its virulence against wheat. However, (R)-mellein at 200 μg/ml inhibited the germination of wheat (Triticum aestivum) and barrel medic (Medicago truncatula) seeds. Comparative sequence analysis identified the presence of mellein synthase (MLNS) homologues in several Dothideomycetes and two sodariomycete genera. Phylogenetic analysis suggests that the MLNSs in fungi and bacteria evolved convergently from fungal and bacterial 6-methylsalicylic acid synthases. PMID:25326302

Therapeutics: Gene Therapy for Alpha-1 Antitrypsin Deficiency.

Science.gov (United States)

Gruntman, Alisha M; Flotte, Terence R

2017-01-01

This review seeks to give an overview of alpha-1 antitrypsin deficiency, including the different disease phenotypes that it encompasses. We then describe the different therapeutic endeavors that have been undertaken to address these different phenotypes. Lastly we discuss future potential therapeutics, such as genome editing, and how they may play a role in treating alpha-1 antitrypsin deficiency.

Irradiation promotes Akt-targeting therapeutic gene delivery to the tumor vasculature

International Nuclear Information System (INIS)

Sonveaux, Pierre; Frerart, Francoise; Bouzin, Caroline; Brouet, Agnes; Wever, Julie de; Jordan, Benedicte F.; Gallez, Bernard; Feron, Olivier

2007-01-01

Purpose: To determine whether radiation-induced increases in nitric oxide (NO) production can influence tumor blood flow and improve delivery of Akt-targeting therapeutic DNA lipocomplexes to the tumor. Methods and Materials: The contribution of NO to the endothelial response to radiation was identified using NO synthase (NOS) inhibitors and endothelial NOS (eNOS)-deficient mice. Reporter-encoding plasmids complexed with cationic lipids were used to document the tumor vascular specificity and the efficacy of in vivo lipofection after irradiation. A dominant-negative Akt gene construct was used to evaluate the facilitating effects of radiotherapy on the therapeutic transgene delivery. Results: The abundance of eNOS protein was increased in both irradiated tumor microvessels and endothelial cells, leading to a stimulation of NO release and an associated increase in tumor blood flow. Transgene expression was subsequently improved in the irradiated vs. nonirradiated tumor vasculature. This effect was not apparent in eNOS-deficient mice and could not be reproduced in irradiated cultured endothelial cells. Finally, we combined low-dose radiotherapy with a dominant-negative Akt gene construct and documented synergistic antitumor effects. Conclusions: This study offers a new rationale to combine radiotherapy with gene therapy, by directly exploiting the stimulatory effects of radiation on NO production by tumor endothelial cells. The preferential expression of the transgene in the tumor microvasculature underscores the potential of such an adjuvant strategy to limit the angiogenic response of irradiated tumors

Post-transcriptional gene expression control by NANOS is up-regulated and functionally important in pRb-deficient cells.

Science.gov (United States)

Miles, Wayne O; Korenjak, Michael; Griffiths, Lyra M; Dyer, Michael A; Provero, Paolo; Dyson, Nicholas J

2014-10-01

Inactivation of the retinoblastoma tumor suppressor (pRb) is a common oncogenic event that alters the expression of genes important for cell cycle progression, senescence, and apoptosis. However, in many contexts, the properties of pRb-deficient cells are similar to wild-type cells suggesting there may be processes that counterbalance the transcriptional changes associated with pRb inactivation. Therefore, we have looked for sets of evolutionary conserved, functionally related genes that are direct targets of pRb/E2F proteins. We show that the expression of NANOS, a key facilitator of the Pumilio (PUM) post-transcriptional repressor complex, is directly repressed by pRb/E2F in flies and humans. In both species, NANOS expression increases following inactivation of pRb/RBF1 and becomes important for tissue homeostasis. By analyzing datasets from normal retinal tissue and pRb-null retinoblastomas, we find a strong enrichment for putative PUM substrates among genes de-regulated in tumors. These include pro-apoptotic genes that are transcriptionally down-regulated upon pRb loss, and we characterize two such candidates, MAP2K3 and MAP3K1, as direct PUM substrates. Our data suggest that NANOS increases in importance in pRb-deficient cells and helps to maintain homeostasis by repressing the translation of transcripts containing PUM Regulatory Elements (PRE). © 2014 The Authors.

Effects of betaine supplementation and choline deficiency on folate deficiency-induced hyperhomocysteinemia in rats.

Science.gov (United States)

Liu, Ying; Liu, Yi-qun; Morita, Tatsuya; Sugiyama, Kimio

2012-01-01

The effect of betaine status on folate deficiency-induced hyperhomocysteinemia was investigated to determine whether folate deficiency impairs homocysteine removal not only by the methionine synthase (MS) pathway but also by the betaine-homocysteine S-methyltransferase (BHMT) pathway. For this purpose, we investigated the effect of dietary supplementation with betaine at a high level (1%) in rats fed a folate-deprived 10% casein diet (10C) and 20% casein diet (20C). We also investigated the effect of choline deprivation on folate deficiency-induced hyperhomocysteinemia in rats fed 20C. Supplementation of folate-deprived 10C and 20C with 1% betaine significantly suppressed folate deprivation-induced hyperhomocysteinemia, but the extent of suppression was partial or limited, especially in rats fed 10C, the suppression of plasma homocysteine increment being 48.5% in rats fed 10C and 69.7% in rats fed 20C. Although betaine supplementation greatly increased hepatic betaine concentration and BHMT activity, these increases did not fully explain why the effect of betaine supplementation was partial or limited. Folate deprivation markedly increased the hepatic concentration of N,N-dimethylglycine (DMG), a known inhibitor of BHMT, and there was a significant positive correlation between hepatic DMG concentration and plasma homocysteine concentration, suggesting that folate deficiency increases hepatic DMG concentration and thereby depresses BHMT reaction, leading to interference with the effect of betaine supplementation. Choline deprivation did not increase plasma homocysteine concentration in rats fed 20C, but it markedly enhanced plasma homocysteine concentration when rats were fed folate-deprived 20C. This indicates that choline deprivation reinforced folate deprivation-induced hyperhomocysteinemia. Increased hepatic DMG concentration was also associated with such an effect. These results support the concept that folate deficiency impairs homocysteine metabolism not only

Evolution and functional insights of different ancestral orthologous clades of chitin synthase genes in the fungal tree of life

Directory of Open Access Journals (Sweden)

Mu eLi

2016-02-01

Full Text Available Chitin synthases (CHSs are key enzymes in the biosynthesis of chitin, an important structural component of fungal cell walls that can trigger innate immune responses in host plants and animals. Members of CHS gene family perform various functions in fungal cellular processes. Previous studies focused primarily on classifying diverse CHSs into different classes, regardless of their functional diversification, or on characterizing their functions in individual fungal species. A complete and systematic comparative analysis of CHS genes based on their orthologous relationships will be valuable for elucidating the evolution and functions of different CHS genes in fungi. Here, we identified and compared members of the CHS gene family across the fungal tree of life, including 18 divergent fungal lineages. Phylogenetic analysis revealed that the fungal CHS gene family is comprised of at least 10 ancestral orthologous clades, which have undergone multiple independent duplications and losses in different fungal lineages during evolution. Interestingly, one of these CHS clades (class III was expanded in plant or animal pathogenic fungi belonging to different fungal lineages. Two clades (classes VIb and VIc identified for the first time in this study occurred mainly in plant pathogenic fungi from Sordariomycetes and Dothideomycetes. Moreover, members of classes III and VIb were specifically up-regulated during plant infection, suggesting important roles in pathogenesis. In addition, CHS-associated networks conserved among plant pathogenic fungi are involved in various biological processes, including sexual reproduction and plant infection. We also identified specificity-determining sites, many of which are located at or adjacent to important structural and functional sites that are potentially responsible for functional divergence of different CHS classes. Overall, our results provide new insights into the evolution and function of members of CHS gene

Molecular characterization of a stable antisense chalcone synthase phenotype in strawberry (Fragaria ananassa)

NARCIS (Netherlands)

Lunkenbein, S.; Coiner, H.; Vos, de C.H.; Schaart, J.G.; Boone, M.J.; Krens, F.A.; Schwab, W.; Salentijn, E.M.J.

2006-01-01

An octaploid (Fragaria × ananassa cv. Calypso) genotype of strawberry was transformed with an antisense chalcone synthase (CHS) gene construct using a ripening related CHS cDNA from Fragaria × ananassa cv. Elsanta under the control of the constitutive CaMV 35S promoter via Agrobacterium tumefaciens.

Short communication: Effect of inhibition of fatty acid synthase on triglyceride accumulation and effect on lipid metabolism genes in goat mammary epithelial cells.

Science.gov (United States)

Zhu, J J; Luo, J; Sun, Y T; Shi, H B; Li, J; Wu, M; Yu, K; Haile, A B; Loor, J J

2015-05-01

The role of fatty acid synthase (FASN) on de novo fatty acid synthesis has been well established. In monogastrics, unlike acetyl-coenzyme A carboxylase, FASN is primarily controlled at the transcriptional level. However, no data exist on ruminant mammary cells evaluating effects of FASN knockdown on mRNA expression of lipogenic genes. Inhibition of FASN in mammary cells by C75-mediated interference, a synthetic inhibitor of FASN activity, and short hairpin RNA-mediated interference markedly reduced cellular triglyceride content at least in part by decreasing the expression of genes related to triglyceride synthesis (GPAT, AGPAT6, and DGAT2) and enhancing the expression of lipolysis-related genes (ATGL and HSL). Consistent with the markedly lower expression of genes related to lipid droplet formation and secretion (TIP47, ADFP, BTN1A1, and XDH), cellular lipid droplets also were reduced sharply after incubation with C75 or adenovirus-short-hairpin-RNA. The results underscored the essential role of FASN in the overall process of milk-fat formation in goat mammary epithelial cells. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Partial IGF-1 deficiency is sufficient to reduce heart contractibility, angiotensin II sensibility, and alter gene expression of structural and functional cardiac proteins.

Science.gov (United States)

González-Guerra, José Luis; Castilla-Cortazar, Inma; Aguirre, Gabriel A; Muñoz, Úrsula; Martín-Estal, Irene; Ávila-Gallego, Elena; Granado, Miriam; Puche, Juan E; García-Villalón, Ángel Luis

2017-01-01

Circulating levels of IGF-1 may decrease under several circumstances like ageing, metabolic syndrome, and advanced cirrhosis. This reduction is associated with insulin resistance, dyslipidemia, progression to type 2 diabetes, and increased risk for cardiovascular diseases. However, underlying mechanisms between IGF-1 deficiency and cardiovascular disease remain elusive. The specific aim of the present work was to study whether the partial IGF-1 deficiency influences heart and/or coronary circulation, comparing vasoactive factors before and after of ischemia-reperfusion (I/R). In addition, histology of the heart was performed together with cardiac gene expression for proteins involved in structure and function (extracellular matrix, contractile proteins, active peptides); carried out using microarrays, followed by RT-qPCR confirmation of the three experimental groups. IGF-1 partial deficiency is associated to a reduction in contractility and angiotensin II sensitivity, interstitial fibrosis as well as altered expression pattern of genes involved in extracellular matrix proteins, calcium dynamics, and cardiac structure and function. Although this work is descriptive, it provides a clear insight of the impact that partial IGF-1 deficiency on the heart and establishes this experimental model as suitable for studying cardiac disease mechanisms and exploring therapeutic options for patients under IGF-1 deficiency conditions.

Partial IGF-1 deficiency is sufficient to reduce heart contractibility, angiotensin II sensibility, and alter gene expression of structural and functional cardiac proteins.

Directory of Open Access Journals (Sweden)

José Luis González-Guerra

Full Text Available Circulating levels of IGF-1 may decrease under several circumstances like ageing, metabolic syndrome, and advanced cirrhosis. This reduction is associated with insulin resistance, dyslipidemia, progression to type 2 diabetes, and increased risk for cardiovascular diseases. However, underlying mechanisms between IGF-1 deficiency and cardiovascular disease remain elusive. The specific aim of the present work was to study whether the partial IGF-1 deficiency influences heart and/or coronary circulation, comparing vasoactive factors before and after of ischemia-reperfusion (I/R. In addition, histology of the heart was performed together with cardiac gene expression for proteins involved in structure and function (extracellular matrix, contractile proteins, active peptides; carried out using microarrays, followed by RT-qPCR confirmation of the three experimental groups. IGF-1 partial deficiency is associated to a reduction in contractility and angiotensin II sensitivity, interstitial fibrosis as well as altered expression pattern of genes involved in extracellular matrix proteins, calcium dynamics, and cardiac structure and function. Although this work is descriptive, it provides a clear insight of the impact that partial IGF-1 deficiency on the heart and establishes this experimental model as suitable for studying cardiac disease mechanisms and exploring therapeutic options for patients under IGF-1 deficiency conditions.

Association of endothelial nitric oxide synthase gene polymorphism with the risk of Henoch-Schönlein purpura/Henoch-Schönlein purpura nephritis.

Science.gov (United States)

Zhong, Weiqiang; Zhou, Tian-Biao; Jiang, Zongpei

2015-04-01

Association between endothelial nitric oxide synthase (eNOS) gene polymorphism and Henoch-Schönlein purpura (HSP)/Henoch-Schönlein purpura nephritis (HSPN) risk is still controversial. A meta-analysis was performed to evaluate the association between eNOS gene polymorphism and HSP/HSPN susceptibility. A predefined literature search and selection of eligible relevant studies were performed to collect data from electronic database. Three articles were identified for the analysis of association between eNOS gene polymorphism and HSPN/HSP risk. eNOS G894T gene polymorphism was not associated with HSPN susceptibility and the risk of patients with HSP developing into HSPN. Interestingly, eNOS G894T T allele and GG genotype were associated with HSP susceptibility, but not the TT genotype. eNOS T786C TT genotype was associated with HSPN susceptibility, but not C allele and CC genotype. Furthermore, eNOS T786C gene polymorphism was not associated with HSP risk and the risk of patients with HSP developing into HSPN. In conclusion, eNOS T786C TT genotype was associated with and eNOS G894T T allele and GG genotype were associated with HSP susceptibility. However, more studies should be performed in the future.

Molecular Analysis of Activation-Induced Cytidine Deaminase Gene in Immunoglobulin-E Deficient Patients

Directory of Open Access Journals (Sweden)

Sergio Roa

2008-01-01

Full Text Available Understanding how class switch recombination (CSR is regulated to produce immunoglobulin E (IgE has become fundamental because of the dramatic increase in the prevalence of IgE-mediated hypersensitivity reactions. CSR requires the induction of the enzyme AICDA in B cells. Mutations in AICDA have been linked to Hyper-IgM syndrome (HIGM2, which shows absence of switching to IgE as well as to IgG and IgA. Although isolated IgE deficiency is a rare entity, here we show some individuals with normal serum IgM, IgG, and IgA levels that had undetectable total serum IgE levels. We have analyzed the AICDA gene in these individuals to determine if there are mutations in AICDA that could lead to selective IgE deficiency. Conformational sensitive gel electrophoresis (CSGE and sequencing analysis of AICDA coding sequences demonstrated sequence heterogeneity due to 5923A/G and 7888C/T polymorphisms, but did not reveal any novel mutation that might explain the selective IgE deficit.

A Malus crabapple chalcone synthase gene, McCHS, regulates red petal color and flavonoid biosynthesis.

Directory of Open Access Journals (Sweden)

Deqiang Tai

Full Text Available Chalcone synthase is a key and often rate-limiting enzyme in the biosynthesis of anthocyanin pigments that accumulate in plant organs such as flowers and fruits, but the relationship between CHS expression and the petal coloration level in different cultivars is still unclear. In this study, three typical crabapple cultivars were chosen based on different petal colors and coloration patterns. The two extreme color cultivars, 'Royalty' and 'Flame', have dark red and white petals respectively, while the intermediate cultivar 'Radiant' has pink petals. We detected the flavoniods accumulation and the expression levels of McCHS during petals expansion process in different cultivars. The results showed McCHS have their special expression patterns in each tested cultivars, and is responsible for the red coloration and color variation in crabapple petals, especially for color fade process in 'Radiant'. Furthermore, tobacco plants constitutively expressing McCHS displayed a higher anthocyanins accumulation and a deeper red petal color compared with control untransformed lines. Moreover, the expression levels of several anthocyanin biosynthetic genes were higher in the transgenic McCHS overexpressing tobacco lines than in the control plants. A close relationship was observed between the expression of McCHS and the transcription factors McMYB4 and McMYB5 during petals development in different crabapple cultivars, suggesting that the expression of McCHS was regulated by these transcription factors. We conclude that the endogenous McCHS gene is a critical factor in the regulation of anthocyanin biosynthesis during petal coloration in Malus crabapple.

Association of Nitric Oxide Synthase2 gene polymorphisms with leprosy reactions in northern Indian population.

Science.gov (United States)

Dubey, Amit; Biswas, Sanjay Kumar; Sinha, Ekata; Chakma, Joy Kumar; Kamal, Raj; Arora, Mamta; Sagar, Harish; Natarajan, Mohan; Bhagyawant, Sameer S; Mohanty, Keshar Kunja

2017-07-01

The pathogen Mycobacterium leprae causes leprosy that affects mainly skin and nerves. Polymorphisms of certain genes are substantiated to be associated with the susceptibility/resistance to leprosy. The present investigation addressed the association of Nitric Oxide Synthase2 gene polymorphisms and leprosy in a population from northern part of India. A total of 323 leprosy cases and 288 healthy controls were genotyped for four NOS2 promoter variants (rs1800482, rs2779249, rs8078340 and rs2301369) using FRET technology in Real Time PCR. None of these SNPs in promoter sites was associated with susceptibility/resistance to leprosy. NOS2 rs1800482 was found to be monomorphic with GG genotype. However, NOS2-1026T allele was observed to be in higher frequency with leprosy cases (BL and LL) who were not suffering from any reactional episodes compared to cases with ENL reaction {OR=0.30, 95% CI (0.10-0.86), p=0.024}. NOS2-1026GT genotype was more prevalent in cases without reaction (BT, BB and BL) compared to RR reactional patients {OR=0.38, 95% CI (0.17-0.86), p=0.02}. Although haplotype analysis revealed that no haplotype was associated with leprosy susceptibility/resistance with statistical significance, GTG haplotype was noted to be more frequent in healthy controls. These SNPs are observed to be in linkage disequilibrium. Although, these SNPs are not likely to influence leprosy vulnerability, -1026G>T SNP was indicated to have noteworthy role in leprosy reactions. Copyright © 2017 Elsevier B.V. All rights reserved.

Sterol regulatory element-binding protein-1 participates in the regulation of fatty acid synthase expression in colorectal neoplasia.

Science.gov (United States)

Li, J N; Mahmoud, M A; Han, W F; Ripple, M; Pizer, E S

2000-11-25

Endogenous fatty acid synthesis has been observed in certain rapidly proliferating normal and neoplastic tissues. Sterol regulatory element-binding proteins (SREBPs) are transcription factors that regulate the expression of lipogenic genes including fatty acid synthase (FAS), the major biosynthetic enzyme for fatty acid synthesis. We have previously shown that SREBP-1, FAS, and Ki-67, a proliferation marker, colocalized in the crypts of the fetal gastrointestinal tract epithelium. This study sought to determine whether SREBP-1 participates in the regulation of proliferation-associated fatty acid synthesis in colorectal neoplasia. An immunohistochemical analysis of SREBP-1, FAS, and Ki-67 expression in 25 primary human colorectal carcinoma specimens showed colocalization in 22 of these. To elucidate a functional linkage between SREBP-1 activation and proliferation-associated FA synthesis, SREBP-1 and FAS content were assayed during the adaptive response of cultured HCT116 colon carcinoma cells to pharmacological inhibition of FA synthesis. Cerulenin and TOFA each inhibited the endogenous synthesis of fatty acids in a dose-dependent manner and each induced increases in both precursor and mature forms of SREBP-1. Subsequently, both the transcriptional activity of the FAS promoter in a luciferase reporter gene construct and the FAS expression increased. These results demonstrate that tumor cells recognize and respond to a deficiency in endogenous fatty acid synthesis by upregulating both SREBP-1 and FAS expression and support the model that SREBP-1 participates in the transcriptional regulation of lipogenic genes in colorectal neoplasia. Copyright 2000 Academic Press.

The Phytoene synthase gene family of apple (Malus x domestica) and its role in controlling fruit carotenoid content.

Science.gov (United States)

Ampomah-Dwamena, Charles; Driedonks, Nicky; Lewis, David; Shumskaya, Maria; Chen, Xiuyin; Wurtzel, Eleanore T; Espley, Richard V; Allan, Andrew C

2015-07-28

Carotenoid compounds play essential roles in plants such as protecting the photosynthetic apparatus and in hormone signalling. Coloured carotenoids provide yellow, orange and red colour to plant tissues, as well as offering nutritional benefit to humans and animals. The enzyme phytoene synthase (PSY) catalyses the first committed step of the carotenoid biosynthetic pathway and has been associated with control of pathway flux. We characterised four PSY genes found in the apple genome to further understand their involvement in fruit carotenoid accumulation. The apple PSY gene family, containing six members, was predicted to have three functional members, PSY1, PSY2, and PSY4, based on translation of the predicted gene sequences and/or corresponding cDNAs. However, only PSY1 and PSY2 showed activity in a complementation assay. Protein localisation experiments revealed differential localization of the PSY proteins in chloroplasts; PSY1 and PSY2 localized to the thylakoid membranes, while PSY4 localized to plastoglobuli. Transcript levels in 'Granny Smith' and 'Royal Gala' apple cultivars showed PSY2 was most highly expressed in fruit and other vegetative tissues. We tested the transient activation of the apple PSY1 and PSY2 promoters and identified potential and differential regulation by AP2/ERF transcription factors, which suggested that the PSY genes are controlled by different transcriptional mechanisms. The first committed carotenoid pathway step in apple is controlled by MdPSY1 and MdPSY2, while MdPSY4 play little or no role in this respect. This has implications for apple breeding programmes where carotenoid enhancement is a target and would allow co-segregation with phenotypes to be tested during the development of new cultivars.

Telomerase Reverse Transcriptase Deficiency Prevents Neointima Formation Through Chromatin Silencing of E2F1 Target Genes.

Science.gov (United States)

Endorf, Elizabeth B; Qing, Hua; Aono, Jun; Terami, Naoto; Doyon, Geneviève; Hyzny, Eric; Jones, Karrie L; Findeisen, Hannes M; Bruemmer, Dennis

2017-02-01

Aberrant proliferation of smooth muscle cells (SMC) in response to injury induces pathological vascular remodeling during atherosclerosis and neointima formation. Telomerase is rate limiting for tissue renewal and cell replication; however, the physiological role of telomerase in vascular diseases remains to be determined. The goal of the present study was to determine whether telomerase reverse transcriptase (TERT) affects proliferative vascular remodeling and to define the molecular mechanism by which TERT supports SMC proliferation. We first demonstrate high levels of TERT expression in replicating SMC of atherosclerotic and neointimal lesions. Using a model of guidewire-induced arterial injury, we demonstrate decreased neointima formation in TERT-deficient mice. Studies in SMC isolated from TERT-deficient and TERT overexpressing mice with normal telomere length established that TERT is necessary and sufficient for cell proliferation. TERT deficiency did not induce a senescent phenotype but resulted in G1 arrest albeit hyperphosphorylation of the retinoblastoma protein. This proliferative arrest was associated with stable silencing of the E2F1-dependent S-phase gene expression program and not reversed by ectopic overexpression of E2F1. Finally, chromatin immunoprecipitation and accessibility assays revealed that TERT is recruited to E2F1 target sites and promotes chromatin accessibility for E2F1 by facilitating the acquisition of permissive histone modifications. These data indicate a previously unrecognized role for TERT in neointima formation through epigenetic regulation of proliferative gene expression in SMC. © 2016 American Heart Association, Inc.

Distinct UV-B and UV-A/blue light signal transduction pathways induce chalcone synthase gene expression in Arabidopsis cells

International Nuclear Information System (INIS)

Christie, J.M.; Jenkins, G.I.

1996-01-01

UV and blue light control the expression of flavonoid biosynthesis genes in a range of higher plants. To investigate the signal transduction processes involved in the induction of chalcone synthase (CHS) gene expression by UV-B and UV-A/blue light, we examined the, effects of specific agonists and inhibitors of known signaling components in mammalian systems in a photomixotrophic Arabidopsis cell suspension culture. CHS expression is induced specifically by these wavelengths in the cell culture, in a manner similar to that in mature Arabidopsis leaf tissue. Both the UV-B and UV-A/blue phototransduction processes involve calcium, although the elevation of cytosolic calcium is insufficient on its own to stimulate CHS expression. The UV-A/blue light induction of CHS expression does not appear to involve calmodulin, whereas the UV-B response does; this difference indicates that the signal transduction pathways are, at least in part, distinct. We provide evidence that both pathways involve reversible protein phosphorylation and require protein synthesis. The UV-B and UV-A/blue light signaling pathways are therefore different from the phytochrome signal transduction pathway regulating CHS expression in other species

G6PD Deficiency (Glucose-6-Phosphate Dehydrogenase) (For Parents)

Science.gov (United States)

... genes from one or both parents to a child. The gene responsible for this deficiency is on the X chromosome. G6PD deficiency is most common in males of African heritage. Many females of African heritage are carriers ...

Genome mining of the sordarin biosynthetic gene cluster from Sordaria araneosa Cain ATCC 36386: characterization of cycloaraneosene synthase and GDP-6-deoxyaltrose transferase.

Science.gov (United States)

Kudo, Fumitaka; Matsuura, Yasunori; Hayashi, Takaaki; Fukushima, Masayuki; Eguchi, Tadashi

2016-07-01

Sordarin is a glycoside antibiotic with a unique tetracyclic diterpene aglycone structure called sordaricin. To understand its intriguing biosynthetic pathway that may include a Diels-Alder-type [4+2]cycloaddition, genome mining of the gene cluster from the draft genome sequence of the producer strain, Sordaria araneosa Cain ATCC 36386, was carried out. A contiguous 67 kb gene cluster consisting of 20 open reading frames encoding a putative diterpene cyclase, a glycosyltransferase, a type I polyketide synthase, and six cytochrome P450 monooxygenases were identified. In vitro enzymatic analysis of the putative diterpene cyclase SdnA showed that it catalyzes the transformation of geranylgeranyl diphosphate to cycloaraneosene, a known biosynthetic intermediate of sordarin. Furthermore, a putative glycosyltransferase SdnJ was found to catalyze the glycosylation of sordaricin in the presence of GDP-6-deoxy-d-altrose to give 4'-O-demethylsordarin. These results suggest that the identified sdn gene cluster is responsible for the biosynthesis of sordarin. Based on the isolated potential biosynthetic intermediates and bioinformatics analysis, a plausible biosynthetic pathway for sordarin is proposed.

Genetics Home Reference: arginase deficiency

Science.gov (United States)

... belongs to a class of genetic diseases called urea cycle disorders. The urea cycle is a sequence of reactions ... links) Baby's First Test GeneReview: Arginase Deficiency GeneReview: Urea Cycle Disorders Overview MedlinePlus Encyclopedia: Hereditary urea cycle abnormality National ...

Nuclear receptor 5A (NR5A) family regulates 5-aminolevulinic acid synthase 1 (ALAS1) gene expression in steroidogenic cells.

Science.gov (United States)

Ju, Yunfeng; Mizutani, Tetsuya; Imamichi, Yoshitaka; Yazawa, Takashi; Matsumura, Takehiro; Kawabe, Shinya; Kanno, Masafumi; Umezawa, Akihiro; Kangawa, Kenji; Miyamoto, Kaoru

2012-11-01

5-Aminolevulinic acid synthase 1 (ALAS1) is a rate-limiting enzyme for heme biosynthesis in mammals. Heme is essential for the catalytic activities of P450 enzymes including steroid metabolic enzymes. Nuclear receptor 5A (NR5A) family proteins, steroidogenic factor-1 (SF-1), and liver receptor homolog-1 (LRH-1) play pivotal roles in regulation of steroidogenic enzymes. Recently, we showed that expression of SF-1/LRH-1 induces differentiation of mesenchymal stem cells into steroidogenic cells. In this study, genome-wide analysis revealed that ALAS1 was a novel SF-1-target gene in differentiated mesenchymal stem cells. Chromatin immunoprecipitation and reporter assays revealed that SF-1/LRH-1 up-regulated ALAS1 gene transcription in steroidogenic cells via binding to a 3.5-kb upstream region of ALAS1. The ALAS1 gene was up-regulated by overexpression of SF-1/LRH-1 in steroidogenic cells and down-regulated by knockdown of SF-1 in these cells. Peroxisome proliferator-activated receptor-γ coactivator-1α, a coactivator of nuclear receptors, also strongly coactivated expression of NR5A-target genes. Reporter analysis revealed that peroxisome proliferator-activated receptor-γ coactivator-1α strongly augmented ALAS1 gene transcription caused by SF-1 binding to the 3.5-kb upstream region. Finally knockdown of ALAS1 resulted in reduced progesterone production by steroidogenic cells. These results indicate that ALAS1 is a novel NR5A-target gene and participates in steroid hormone production.

Effect of Lowering Asymmetric Dimethylarginine (ADMA on Vascular Pathology in Atherosclerotic ApoE-Deficient Mice with Reduced Renal Mass

Directory of Open Access Journals (Sweden)

Johannes Jacobi

2014-03-01

Full Text Available The purpose of the work was to study the impact of the endogenous nitric oxide synthase (NOS inhibitor asymmetric dimethylarginine (ADMA and its degrading enzyme, dimethylarginine dimethylaminohydrolase (DDAH1, on atherosclerosis in subtotally nephrectomized (SNX ApoE-deficient mice. Male DDAH1 transgenic mice (TG, n = 39 and C57Bl/6J wild-type littermates (WT, n = 27 with or without the deletion of the ApoE gene underwent SNX at the age of eight weeks. Animals were sacrificed at 12 months of age, and blood chemistry, as well as the extent of atherosclerosis within the entire aorta were analyzed. Sham treated (no renal mass reduction ApoE-competent DDAH1 transgenic and wild-type littermates (n = 11 served as a control group. Overexpression of DDAH1 was associated with significantly lower ADMA levels in all treatment groups. Surprisingly, SNX mice did not exhibit higher ADMA levels compared to sham treated control mice. Furthermore, the degree of atherosclerosis in ApoE-deficient mice with SNX was similar in mice with or without overexpression of DDAH1. Overexpression of the ADMA degrading enzyme, DDAH1, did not ameliorate atherosclerosis in ApoE-deficient SNX mice. Furthermore, SNX in mice had no impact on ADMA levels, suggesting a minor role of this molecule in chronic kidney disease (CKD in this mouse model.