WorldWideScience

Sample records for symptomless virus coat

  1. Genome characterization and genetic diversity of sweet potato symptomless virus 1: a mastrevirus with an unusual nonanucleotide

    Science.gov (United States)

    Complete genomic sequences of nine isolates of sweet potato symptomless virus 1 (SPSMV-1), a virus of genus Mastrevirus in the family Geminiviridae, was determined to be 2,559-2,602 nucleotides from sweet potato accessions from different countries. These isolates shared genomic sequence identities o...

  2. Variability in management of symptomless microhaematuria in schoolchildren

    NARCIS (Netherlands)

    Benbassat, J.; Gergawi, M.; Offringa, M.; Bearman, J. E.; Drukker, A.

    1998-01-01

    The evaluation of incidentally detected symptomless microhaematuria in schoolchildren is controversial. Some authors advocate varying numbers of immediate tests, while others recommend investigations only in cases who develop systemic symptoms or signs, or a decline in renal function. The objective

  3. PRODUCTION OF POLYCLONAL ANTIBODY TO THE COAT PROTEIN OF CITRUS TRISTEZA VIRUS IN CHICKEN EGGS

    Directory of Open Access Journals (Sweden)

    Nurhadi Nurhadi

    2016-10-01

    Full Text Available Citrus tristeza virus (CTV is one of the most destructive diseases in many citrus growing areas of Indonesia. Effective strategies for controlling CTV depend on diagnostic procedure namely enzyme-linked immunosorbent assay (ELISA. Study aimed to purify the CTV antigen and produced its polyclonal antibody. Virion of the severe CTV isolate designated UPM/ T-002 was concentrated by polyethylene glycol (PEG precipitation combined with low speed centrifugation. Semipurified antigen was further purified by sodium dodecyl sulphatepolyacrylamide gel electrophoresis (SDS-PAGE. The specific coat protein (CP band of CTV with molecular weight of 25 kD was excised and eluted using elution buffer containing 0.25 M Tris-HCl pH 6.8 + 0.1% SDS, then used as antigen for injection into 6-month-old female of White Leghorn chicken. Results, showed than the specific polyclonal antibody raised against the 25-kDa CP had a titer of approximately 104, gave low background reaction with healthy plant sap and reacted specifically with CTV isolates. The reaction was equally strong for a severe, a moderate, a mild, and a symptomless isolate, suggesting a broad reaction range of this antibody toward different CTV isolates. Optimal virus titer can be obtained since virus loss during purification could be minimized and the highly purified antigen as an immunogen could be obtained by cutting out the CP band from SDS-PAGE gels. Large amount of highly titer of CTV antibody can be produced in chicken egg. The simplicity of the procedure makes it economically acceptable and technically adoptable because the antibody can be produced in basic laboratory.

  4. Isolation and Identification of Burkholderia glumae from Symptomless Rice Seeds

    Directory of Open Access Journals (Sweden)

    Bo Zhu

    2008-06-01

    Full Text Available A survey on isolation and detection of the casual organism of bacterial grain rot of rice was conducted during 1997–2006. In 2006, six pathogenic bacterial strains were isolated from two symptomless seed samples of rice (Oryza sativa L. originally produced in Hainan Province and then planted in Zhejiang Province, China. They were identified as Burkholderia glumae which is the causal organism of bacterial grain rot of rice by physiological characteristics, colony morphology, pathogenicity test, Biolog, fatty acid methyl ester (FAME analysis and RAPD-PCR compared with the four standard reference strains. It is confirmed that there is the infection of B. glumae in so-called ‘health looking seeds’.

  5. Coated microneedle arrays for transcutaneous delivery of live virus vaccines.

    Science.gov (United States)

    Vrdoljak, Anto; McGrath, Marie G; Carey, John B; Draper, Simon J; Hill, Adrian V S; O'Mahony, Conor; Crean, Abina M; Moore, Anne C

    2012-04-10

    Vaccines are sensitive biologics that require continuous refrigerated storage to maintain their viability. The vast majority of vaccines are also administered using needles and syringes. The need for cold chain storage and the significant logistics surrounding needle-and-syringe vaccination is constraining the success of immunization programs. Recombinant live viral vectors are a promising platform for the development of vaccines against a number of infectious diseases, however these viruses must retain infectivity to be effective. Microneedles offer an effective and painless method for delivery of vaccines directly into skin that in the future could provide solutions to current vaccination issues. Here we investigated methods of coating live recombinant adenovirus and modified vaccinia virus Ankara (MVA) vectors onto solid microneedle arrays. An effective spray-coating method, using conventional pharmaceutical processes, was developed, in tandem with suitable sugar-based formulations, which produces arrays with a unique coating of viable virus in a dry form around the shaft of each microneedle on the array. Administration of live virus-coated microneedle arrays successfully resulted in virus delivery, transcutaneous infection and induced an antibody or CD8(+) T cell response in mice that was comparable to that obtained by needle-and-syringe intradermal immunization. To our knowledge, this is the first report of successful vaccination with recombinant live viral vectored vaccines coated on microneedle delivery devices. Copyright © 2011 Elsevier B.V. All rights reserved.

  6. Coated microneedle arrays for transcutaneous delivery of live virus vaccines

    Science.gov (United States)

    Vrdoljak, Anto; McGrath, Marie G.; Carey, John B.; Draper, Simon J.; Hill, Adrian V.S.; O’Mahony, Conor; Crean, Abina M.; Moore, Anne C.

    2016-01-01

    Vaccines are sensitive biologics that require continuous refrigerated storage to maintain their viability. The vast majority of vaccines are also administered using needles and syringes. The need for cold chain storage and the significant logistics surrounding needle-and-syringe vaccination is constraining the success of immunization programs. Recombinant live viral vectors are a promising platform for the development of vaccines against a number of infectious diseases, however these viruses must retain infectivity to be effective. Microneedles offer an effective and painless method for delivery of vaccines directly into skin that in the future could provide solutions to current vaccination issues. Here we investigated methods of coating live recombinant adenovirus and modified vaccinia virus Ankara (MVA) vectors onto solid microneedle arrays. An effective spray-coating method, using conventional pharmaceutical processes, was developed, in tandem with suitable sugar-based formulations, which produces arrays with a unique coating of viable virus in a dry form around the shaft of each microneedle on the array. Administration of live virus-coated microneedle arrays successfully resulted in virus delivery, transcutaneous infection and induced an antibody or CD8+ T cell response in mice that was comparable to that obtained by needle-and-syringe intradermal immunization. To our knowledge, this is the first report of successful vaccination with recombinant live viral vectored vaccines coated on microneedle delivery devices. PMID:22245683

  7. Zucchini yellow mosaic virus: biological properties, detection procedures and comparison of coat protein gene sequences.

    Science.gov (United States)

    Coutts, B A; Kehoe, M A; Webster, C G; Wylie, S J; Jones, R A C

    2011-12-01

    Between 2006 and 2010, 5324 samples from at least 34 weed, two cultivated legume and 11 native species were collected from three cucurbit-growing areas in tropical or subtropical Western Australia. Two new alternative hosts of zucchini yellow mosaic virus (ZYMV) were identified, the Australian native cucurbit Cucumis maderaspatanus, and the naturalised legume species Rhyncosia minima. Low-level (0.7%) seed transmission of ZYMV was found in seedlings grown from seed collected from zucchini (Cucurbita pepo) fruit infected with isolate Cvn-1. Seed transmission was absent in >9500 pumpkin (C. maxima and C. moschata) seedlings from fruit infected with isolate Knx-1. Leaf samples from symptomatic cucurbit plants collected from fields in five cucurbit-growing areas in four Australian states were tested for the presence of ZYMV. When 42 complete coat protein (CP) nucleotide (nt) sequences from the new ZYMV isolates obtained were compared to those of 101 complete CP nt sequences from five other continents, phylogenetic analysis of the 143 ZYMV sequences revealed three distinct groups (A, B and C), with four subgroups in A (I-IV) and two in B (I-II). The new Australian sequences grouped according to collection location, fitting within A-I, A-II and B-II. The 16 new sequences from one isolated location in tropical northern Western Australia all grouped into subgroup B-II, which contained no other isolates. In contrast, the three sequences from the Northern Territory fitted into A-II with 94.6-99.0% nt identities with isolates from the United States, Iran, China and Japan. The 23 new sequences from the central west coast and two east coast locations all fitted into A-I, with 95.9-98.9% nt identities to sequences from Europe and Japan. These findings suggest that (i) there have been at least three separate ZYMV introductions into Australia and (ii) there are few changes to local isolate CP sequences following their establishment in remote growing areas. Isolates from A-I and B

  8. Extraction of total nucleic acid based on silica-coated magnetic particles for RT-qPCR detection of plant RNA virus/viroid.

    Science.gov (United States)

    Sun, Ning; Deng, Congliang; Zhao, Xiaoli; Zhou, Qi; Ge, Guanglu; Liu, Yi; Yan, Wenlong; Xia, Qiang

    2014-02-01

    In this study, a nucleic acid extraction method based on silica-coated magnetic particles (SMPs) and RT-qPCR assay was developed to detect Arabis mosaic virus (ArMV), Lily symptomless virus (LSV), Hop stunt viroid (HSVd) and grape yellow speckle viroid 1 (GYSVd-1). The amplification sequences of RT-qPCR were reversely transcribed in vitro as RNA standard templates. The standard curves covered six or seven orders of magnitude with a detection limit of 100 copies per each assay. Extraction efficiency of the SMPs method was evaluated by recovering spiked ssRNAs from plant samples and compared to two commercial kits (TRIzol and RNeasy Plant mini kit). Results showed that the recovery rate of SMPs method was comparable to the commercial kits when spiked ssRNAs were extracted from lily leaves, whereas it was two or three times higher than commercial kits when spiked ssRNAs were extracted from grapevine leaves. SMPs method was also used to extract viral nucleic acid from15 ArMV-positive lily leaf samples and 15 LSV-positive lily leaf samples. SMPs method did not show statistically significant difference from other methods on detecting ArMV, but LSV. The SMPs method has the same level of virus load as the TRIzol, and its mean virus load of was 0.5log10 lower than the RNeasy Plant mini kit. Nucleic acid was extracted from 19 grapevine-leaf samples with SMPs and the two commercial kits and subsequently screened for HSVd and GYSVd-1 by RT-qPCR. Regardless of HSVd or GYSVd-1, SMPs method outperforms other methods on both positive rate and the viroid load. In conclusion, SMPs method was able to efficiently extract the nucleic acid of RNA viruses or viroids, especially grapevine viroids, from lily-leaf or grapevine-leaf samples for RT-qPCR detection. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Preparation of recombinant coat protein of Prunus necrotic ringspot virus.

    Science.gov (United States)

    Petrzik, K; Mráz, I; Kubelková, D

    2001-02-01

    The coat protein (CP) gene of Prunus necrotic ringspot virus (PNRSV) was cloned into pET 16b vector and expressed in Escherichia coli. CP-enriched fractions were prepared from whole cell lysate by differential centrifugation. The fraction sedimenting at 20,000 x g for 30 mins was used for preparation of a rabbit antiserum to CP. This antiserum had a titer of 1:2048 and reacted in a double-antibody sandwich ELISA (DAS-ELISA).

  10. 40 CFR 174.531 - Coat protein of plum pox virus; exemption from the requirement of a tolerance.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Coat protein of plum pox virus...-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.531 Coat protein of plum pox virus; exemption from the requirement of a tolerance. Residues of the coat protein of plum pox virus in or on the...

  11. 40 CFR 174.512 - Coat Protein of Potato Virus Y; exemption from the requirement of a tolerance.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Coat Protein of Potato Virus Y...-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.512 Coat Protein of Potato Virus Y; exemption from the requirement of a tolerance. Residues of Coat Protein of Potato Virus Y are exempt from...

  12. 40 CFR 174.514 - Coat Protein of Watermelon Mosaic Virus-2 and Zucchini Yellow Mosaic Virus; exemption from the...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Coat Protein of Watermelon Mosaic Virus-2 and Zucchini Yellow Mosaic Virus; exemption from the requirement for a tolerance. 174.514 Section 174.514 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS PROCEDURES AND REQUIREMENTS FOR PLANT-INCORPORATED...

  13. A novel, polymer-coated oncolytic measles virus overcomes immune suppression and induces robust antitumor activity

    Directory of Open Access Journals (Sweden)

    Kaname Nosaki

    2016-01-01

    Full Text Available Although various therapies are available to treat cancers, including surgery, chemotherapy, and radiotherapy, cancer has been the leading cause of death in Japan for the last 30 years, and new therapeutic modalities are urgently needed. As a new modality, there has recently been great interest in oncolytic virotherapy, with measles virus being a candidate virus expected to show strong antitumor effects. The efficacy of virotherapy, however, was strongly limited by the host immune response in previous clinical trials. To enhance and prolong the antitumor activity of virotherapy, we combined the use of two newly developed tools: the genetically engineered measles virus (MV-NPL and the multilayer virus-coating method of layer-by-layer deposition of ionic polymers. We compared the oncolytic effects of this polymer-coated MV-NPL with the naked MV-NPL, both in vitro and in vivo. In the presence of anti-MV neutralizing antibodies, the polymer-coated virus showed more enhanced oncolytic activity than did the naked MV-NPL in vitro. We also examined antitumor activities in virus-treated mice. Complement-dependent cytotoxicity and antitumor activities were higher in mice treated with polymer-coated MV-NPL than in mice treated with the naked virus. This novel, polymer-coated MV-NPL is promising for clinical cancer therapy in the future.

  14. Different virucidal activities of hyperbranched quaternary ammonium coatings on poliovirus and influenza virus

    NARCIS (Netherlands)

    Tuladhar, E.; Koning, de M.C.; Fundeanu, I.; Beumer, R.R.; Duizer, E.

    2012-01-01

    Virucidal activity of immobilized quaternary ammonium compounds (IQACs) coated onto glass and plastic surfaces was tested against enveloped influenza A (H1N1) virus and nonenveloped poliovirus Sabin1. The IQACs tested were virucidal against the influenza virus within 2 min, but no virucidal effect

  15. Screening of Potential Inhibitor against Coat Protein of Apple Chlorotic Leaf Spot Virus.

    Science.gov (United States)

    Purohit, Rituraj; Kumar, Sachin; Hallan, Vipin

    2018-06-01

    In this study, we analyzed Coat protein (CP) of Apple chlorotic leaf spot virus (ACLSV), an important latent virus on Apple. Incidence of the virus is upto 60% in various apple cultivars, affecting yield losses of the order of 10-40% (depending upon the cultivar). CP plays an important role as the sole building block of the viral capsid. Homology approach was used to model 193 amino acid sequence of the coat protein. We used various servers such as ConSurf, TargetS, OSML, COACH, COFACTOR for the prediction of active site residues in coat protein. Virtual screening strategy was employed to search potential inhibitors for CP. Top twenty screened molecules considered for drugability, and toxicity analysis and one potential molecule was further analyzed by docking analysis. Here, we reported a potent molecule which could inhibit the formation of viron assembly by targeting the CP protein of virus.

  16. A pospiviroid from symptomless portulaca plants closely related to iresine viroid 1.

    Science.gov (United States)

    Verhoeven, J Th J; Roenhorst, J W; Hooftman, M; Meekes, E T M; Flores, R; Serra, P

    2015-07-02

    In symptomless plants of portulaca a potential new pospiviroid was characterized. Analysis by both double and return PAGE showed the presence of a circular RNA. RT-PCR and sequencing revealed a genome of 351 nt with properties characteristic of members of the genus Pospiviroid and with highest sequence identity (circa 80%) with iresine viroid 1 (IrVd-1). The circular RNA from portulaca was shown to replicate independently in its original host, thus showing that it is indeed a viroid. Based on its molecular characteristics, it should be considered a new species. However, since no biological differences have yet been found with its closest relative IrVd-1, the viroid from portulaca does not fulfil all criteria for species demarcation of the ICTV. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Natural supramolecular building blocks: from virus coat proteins to viral nanoparticles.

    Science.gov (United States)

    Liu, Zhi; Qiao, Jing; Niu, Zhongwei; Wang, Qian

    2012-09-21

    Viruses belong to a fascinating class of natural supramolecular structures, composed of multiple copies of coat proteins (CPs) that assemble into different shapes with a variety of sizes from tens to hundreds of nanometres. Because of their advantages including simple/economic production, well-defined structural features, unique shapes and sizes, genetic programmability and robust chemistries, recently viruses and virus-like nanoparticles (VLPs) have been used widely in biomedical applications and materials synthesis. In this critical review, we highlight recent advances in the use of virus coat proteins (VCPs) and viral nanoparticles (VNPs) as building blocks in self-assembly studies and materials development. We first discuss the self-assembly of VCPs into VLPs, which can efficiently incorporate a variety of different materials as cores inside the viral protein shells. Then, the self-assembly of VNPs at surfaces or interfaces is summarized. Finally, we discuss the co-assembly of VNPs with different functional materials (178 references).

  18. Fabrication and characterization of gold nano-wires templated on virus-like arrays of tobacco mosaic virus coat proteins

    International Nuclear Information System (INIS)

    Wnęk, M; Stockley, P G; Górzny, M Ł; Evans, S D; Ward, M B; Brydson, R; Wälti, C; Davies, A G

    2013-01-01

    The rod-shaped plant virus tobacco mosaic virus (TMV) is widely used as a nano-fabrication template, and chimeric peptide expression on its major coat protein has extended its potential applications. Here we describe a simple bacterial expression system for production and rapid purification of recombinant chimeric TMV coat protein carrying C-terminal peptide tags. These proteins do not bind TMV RNA or form disks at pH 7. However, they retain the ability to self-assemble into virus-like arrays at acidic pH. C-terminal peptide tags in such arrays are exposed on the protein surface, allowing interaction with target species. We have utilized a C-terminal His-tag to create virus coat protein-templated nano-rods able to bind gold nanoparticles uniformly. These can be transformed into gold nano-wires by deposition of additional gold atoms from solution, followed by thermal annealing. The resistivity of a typical annealed wire created by this approach is significantly less than values reported for other nano-wires made using different bio-templates. This expression construct is therefore a useful additional tool for the creation of chimeric TMV-like nano-rods for bio-templating. (paper)

  19. Fabrication and characterization of gold nano-wires templated on virus-like arrays of tobacco mosaic virus coat proteins

    Science.gov (United States)

    Wnęk, M.; Górzny, M. Ł.; Ward, M. B.; Wälti, C.; Davies, A. G.; Brydson, R.; Evans, S. D.; Stockley, P. G.

    2013-01-01

    The rod-shaped plant virus tobacco mosaic virus (TMV) is widely used as a nano-fabrication template, and chimeric peptide expression on its major coat protein has extended its potential applications. Here we describe a simple bacterial expression system for production and rapid purification of recombinant chimeric TMV coat protein carrying C-terminal peptide tags. These proteins do not bind TMV RNA or form disks at pH 7. However, they retain the ability to self-assemble into virus-like arrays at acidic pH. C-terminal peptide tags in such arrays are exposed on the protein surface, allowing interaction with target species. We have utilized a C-terminal His-tag to create virus coat protein-templated nano-rods able to bind gold nanoparticles uniformly. These can be transformed into gold nano-wires by deposition of additional gold atoms from solution, followed by thermal annealing. The resistivity of a typical annealed wire created by this approach is significantly less than values reported for other nano-wires made using different bio-templates. This expression construct is therefore a useful additional tool for the creation of chimeric TMV-like nano-rods for bio-templating.

  20. Coat protein sequence shows that Cucumber mosaic virus isolate

    Indian Academy of Sciences (India)

    A viral disease was identified on geraniums (Pelargonium spp.) grown in a greenhouse at the Institute of Himalayan Bioresource Technology (IHBT), Palampur, exhibiting mild mottling and stunting. The causal virus (Cucumber mosaic virus, CMV) was identified and characterized on the basis of host range, aphid ...

  1. Role of Pea Enation Mosaic Virus Coat Protein in the Host Plant and Aphid Vector.

    Science.gov (United States)

    Doumayrou, Juliette; Sheber, Melissa; Bonning, Bryony C; Miller, W Allen

    2016-11-18

    Understanding the molecular mechanisms involved in plant virus-vector interactions is essential for the development of effective control measures for aphid-vectored epidemic plant diseases. The coat proteins (CP) are the main component of the viral capsids, and they are implicated in practically every stage of the viral infection cycle. Pea enation mosaic virus 1 (PEMV1, Enamovirus , Luteoviridae ) and Pea enation mosaic virus 2 (PEMV2, Umbravirus , Tombusviridae ) are two RNA viruses in an obligate symbiosis causing the pea enation mosaic disease. Sixteen mutant viruses were generated with mutations in different domains of the CP to evaluate the role of specific amino acids in viral replication, virion assembly, long-distance movement in Pisum sativum , and aphid transmission. Twelve mutant viruses were unable to assemble but were able to replicate in inoculated leaves, move long-distance, and express the CP in newly infected leaves. Four mutant viruses produced virions, but three were not transmissible by the pea aphid, Acyrthosiphon pisum . Three-dimensional modeling of the PEMV CP, combined with biological assays for virion assembly and aphid transmission, allowed for a model of the assembly of PEMV coat protein subunits.

  2. Survival of Newcastle disease virus (NDV) strain V4- UPM coated on ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-08-04

    Aug 4, 2008 ... Results showed that the virus coated onto the carrier foods offal without additive remained stable at ≥ MID value for ≈3 ... meat (Shane, 1984). Velogenic .... the byproducts of food processing that is expected to eliminate any ...

  3. Stability of Newcastle Disease Virus Strain V4-UPM Coated on ...

    African Journals Online (AJOL)

    Protection of village chickens against Newcastle disease (ND) is considered feasible through food-delivered vaccines. Vaccine virus strain V4-UPM coated on cassava granules with or without additive (2% gelatin) was tested for stability at room temperature (RT) for 8 weeks and 40oC for 12 hours at weekly and two hourly ...

  4. The movement protein and coat protein of alfalfa mosaic virus accumulate in structurally modified plasmodesmata

    NARCIS (Netherlands)

    van der Wel, N. N.; Goldbach, R. W.; van Lent, J. W.

    1998-01-01

    In systemically infected tissues of Nicotiana benthamiana, alfalfa mosaic virus (AMV) coat protein (CP) and movement protein (MP) are detected in plasmodesmata in a layer of three to four cells at the progressing front of infection. Besides the presence of these viral proteins, the plasmodesmata are

  5. Production of Polyclonal Antibodies to a Recombinant Coat Protein of Potato mop-top virus

    Czech Academy of Sciences Publication Activity Database

    Čeřovská, Noemi; Moravec, Tomáš; Rosecká, Pavla; Dědič, P.; Filigarová, Marie

    2003-01-01

    Roč. 151, č. 4 (2003), s. 195-200 ISSN 0931-1785 R&D Projects: GA ČR GA522/01/1121 Institutional research plan: CEZ:AV0Z5038910 Keywords : potato mop-top virus * recombinant coat protein * Escherichia Coli Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.557, year: 2003

  6. Polyclonal Antibodies to a Recombinant Coat Protein of Potato Virus A

    Czech Academy of Sciences Publication Activity Database

    Čeřovská, Noemi; Moravec, Tomáš; Velemínský, Jiří

    2002-01-01

    Roč. 46, - (2002), s. 147-151 ISSN 0001-723X R&D Projects: GA ČR GA310/00/0381 Institutional research plan: CEZ:AV0Z5038910 Keywords : Potato virus A * recombinant coat protein * Escherichia coli Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.660, year: 2002

  7. Protective hybrid coating containing silver, copper and zinc cations effective against human immunodeficiency virus and other enveloped viruses

    Czech Academy of Sciences Publication Activity Database

    Hodek, Jan; Zajícová, V.; Lovětinská-Šlamborová, I.; Stibor, I.; Müllerová, J.; Weber, Jan

    2016-01-01

    Roč. 16, Apr 1 (2016), č. článku 56. ISSN 1471-2180 R&D Projects: GA MŠk(CZ) LK11207 Institutional support: RVO:61388963 Keywords : hybrid coating * virucidal effect * HIV * enveloped viruses Subject RIV: EE - Microbiology, Virology Impact factor: 2.644, year: 2016 http://bmcmicrobiol.biomedcentral.com/articles/10.1186/s12866-016-0675-x

  8. Role of Pea Enation Mosaic Virus Coat Protein in the Host Plant and Aphid Vector

    Directory of Open Access Journals (Sweden)

    Juliette Doumayrou

    2016-11-01

    Full Text Available Understanding the molecular mechanisms involved in plant virus–vector interactions is essential for the development of effective control measures for aphid-vectored epidemic plant diseases. The coat proteins (CP are the main component of the viral capsids, and they are implicated in practically every stage of the viral infection cycle. Pea enation mosaic virus 1 (PEMV1, Enamovirus, Luteoviridae and Pea enation mosaic virus 2 (PEMV2, Umbravirus, Tombusviridae are two RNA viruses in an obligate symbiosis causing the pea enation mosaic disease. Sixteen mutant viruses were generated with mutations in different domains of the CP to evaluate the role of specific amino acids in viral replication, virion assembly, long-distance movement in Pisum sativum, and aphid transmission. Twelve mutant viruses were unable to assemble but were able to replicate in inoculated leaves, move long-distance, and express the CP in newly infected leaves. Four mutant viruses produced virions, but three were not transmissible by the pea aphid, Acyrthosiphon pisum. Three-dimensional modeling of the PEMV CP, combined with biological assays for virion assembly and aphid transmission, allowed for a model of the assembly of PEMV coat protein subunits.

  9. Coat protein sequence shows that Cucumber mosaic virus isolate ...

    Indian Academy of Sciences (India)

    Madhu

    crop is reported to be infecetd by a number of pests and dis- eases (Rao et al 2000) including a ... Plant Virus Lab, Floriculture Division, Institute of Himalayan Bioresource Technology, Palampur 176 061, India. *Corresponding author (Fax ..... ELISA test used in testing the plants (either mechanical- ly inoculated or naturally ...

  10. Coat protein sequence shows that Cucumber mosaic virus isolate ...

    Indian Academy of Sciences (India)

    Madhu

    A viral disease was identified on geraniums (Pelargonium spp.) grown in a greenhouse at the .... DNA was cloned in p-GEM Teasy vector (Promega, USA) as per the ... M. persicae and A. gossypii transmitted the virus in non persistent manner ...

  11. Expression and the antigenicity of recombinant coat proteins of tungro viruses expressed in Escherichia coli.

    Science.gov (United States)

    Yee, Siew Fung; Chu, Chia Huay; Poili, Evenni; Sum, Magdline Sia Henry

    2017-02-01

    Rice tungro disease (RTD) is a recurring disease affecting rice farming especially in the South and Southeast Asia. The disease is commonly diagnosed by visual observation of the symptoms on diseased plants in paddy fields and by polymerase chain reaction (PCR). However, visual observation is unreliable and PCR can be costly. High-throughput as well as relatively cheap detection methods are important for RTD management for screening large number of samples. Due to this, detection by serological assays such as immunoblotting assays and enzyme-linked immunosorbent assay are preferred. However, these serological assays are limited by lack of continuous supply of antibodies as reagents due to the difficulty in preparing sufficient purified virions as antigens. This study aimed to generate and evaluate the reactivity of the recombinant coat proteins of Rice tungro bacilliform virus (RTBV) and Rice tungro spherical virus (RTSV) as alternative antigens to generate antibodies. The genes encoding the coat proteins of both viruses, RTBV (CP), and RTSV (CP1, CP2 and CP3) were cloned and expressed as recombinant fusion proteins in Escherichia coli. All of the recombinant fusion proteins, with the exception of the recombinant fusion protein of the CP2 of RTSV, were reactive against our in-house anti-tungro rabbit serum. In conclusion, our study showed the potential use of the recombinant fusion coat proteins of the tungro viruses as alternative antigens for production of antibodies for diagnostic purposes. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Expression and purification of coat protein of citrus tristeza virus ...

    African Journals Online (AJOL)

    CTV coat protein gene (CTV-cp) cloned in pQE30 vector and transformed to DH5α containing 666bp long from Thailand MK-50 isolate was amplified with a forward primer CTV-CP1 (5' CAC CGA CGA AAC AAA GAA ATT GAA GAA CA 3') and a reverse primer CTVCP2 (5' TCA ACG TGT GTT AAA TTT CCC AAG C 3') and ...

  13. Coated microneedle arrays for transcutaneous delivery of live virus vaccines

    OpenAIRE

    Vrdoljak, Anto; McGrath, Marie G.; Carey, John B.; Draper, Simon J.; Hill, Adrian V.S.; O’Mahony, Conor; Crean, Abina M.; Moore, Anne C.

    2011-01-01

    Vaccines are sensitive biologics that require continuous refrigerated storage to maintain their viability. The vast majority of vaccines are also administered using needles and syringes. The need for cold chain storage and the significant logistics surrounding needle-and-syringe vaccination is constraining the success of immunization programs. Recombinant live viral vectors are a promising platform for the development of vaccines against a number of infectious diseases, however these viruses ...

  14. The 96th Amino Acid of the Coat Protein of Cucumber Green Mottle Mosaic Virus Affects Virus Infectivity

    Directory of Open Access Journals (Sweden)

    Zhenwei Zhang

    2017-12-01

    Full Text Available Cucumber green mottle mosaic virus (CGMMV is one of the most devastating viruses infecting members of the family Cucurbitaceae. The assembly initiation site of CGMMV is located in the coding region of the coat protein, which is not only involved in virion assembly but is also a key factor determining the long-distance movement of the virus. To understand the effect of assembly initiation site and the adjacent region on CGMMV infectivity, we created a GTT deletion mutation in the GAGGTTG assembly initiation site of the infectious clone of CGMMV, which we termed V97 (deletion mutation at residue 97 of coat protein, followed by the construction of the V94A and T104A mutants. We observed that these three mutations caused mosaic after Agrobacterium-mediated transformation in Nicotiana benthamiana, albeit with a significant delay compared to the wild type clone. The mutants also had a common spontaneous E96K mutation in the coat protein. These results indicated that the initial assembly site and the sequence of the adjacent region affected the infectivity of the virus and that E96 might play an essential role in this process. We constructed two single point mutants—E96A and E96K—and three double mutants—V94A-E96K, V97-E96K and T104A-E96K—to further understand the role of E96 in CGMMV pathogenesis. After inoculation in N. benthamiana, E96A showed delayed systemic symptoms, but the E96K and three double mutants exhibited typical symptoms of mosaic at seven days post-infection. Then, sap from CGMMV-infected N. benthamiana leaves was mechanically inoculated on watermelon plants. We confirmed that E96 affected CGMMV infection using double antibody sandwich-enzyme-linked immunosorbent assay (DAS-ELISA, reverse transcription-polymerase chain reaction (RT-PCR, and sequencing, which further confirmed the successful infection of the related mutants, and that E96K can compensate the effect of the V94, V97, and T104 mutations on virus infectivity. In

  15. RNA2 of grapevine fanleaf virus: sequence analysis and coat protein cistron location.

    Science.gov (United States)

    Serghini, M A; Fuchs, M; Pinck, M; Reinbolt, J; Walter, B; Pinck, L

    1990-07-01

    The nucleotide sequence of the genomic RNA2 (3774 nucleotides) of grapevine fanleaf virus strain F13 was determined from overlapping cDNA clones and its genetic organization was deduced. Two rapid and efficient methods were used for cDNA cloning of the 5' region of RNA2. The complete sequence contained only one long open reading frame of 3555 nucleotides (1184 codons, 131K product). The analysis of the N-terminal sequence of purified coat protein (CP) and identification of its C-terminal residue have allowed the CP cistron to be precisely positioned within the polyprotein. The CP produced by proteolytic cleavage at the Arg/Gly site between residues 680 and 681 contains 504 amino acids (Mr 56019) and has hydrophobic properties. The Arg/Gly cleavage site deduced by N-terminal amino acid sequence analysis is the first for a nepovirus coat protein and for plant viruses expressing their genomic RNAs by polyprotein synthesis. Comparison of GFLV RNA2 with M RNA of cowpea mosaic comovirus and with RNA2 of two closely related nepoviruses, tomato black ring virus and Hungarian grapevine chrome mosaic virus, showed strong similarities among the 3' non-coding regions but less similarity among the 5' end non-coding sequences than reported among other nepovirus RNAs.

  16. Molecular characterization and intermolecular interaction of coat protein of Prunus necrotic ringspot virus: implications for virus assembly.

    Science.gov (United States)

    Kulshrestha, Saurabh; Hallan, Vipin; Sharma, Anshul; Seth, Chandrika Attri; Chauhan, Anjali; Zaidi, Aijaz Asghar

    2013-09-01

    Coat protein (CP) and RNA3 from Prunus necrotic ringspot virus (PNRSV-rose), the most prevalent virus infecting rose in India, were characterized and regions in the coat protein important for self-interaction, during dimer formation were identified. The sequence analysis of CP and partial RNA 3 revealed that the rose isolate of PNRSV in India belongs to PV-32 group of PNRSV isolates. Apart from the already established group specific features of PV-32 group member's additional group-specific and host specific features were also identified. Presence of methionine at position 90 in the amino acid sequence alignment of PNRSV CP gene (belonging to PV-32 group) was identified as the specific conserved feature for the rose isolates of PNRSV. As protein-protein interaction plays a vital role in the infection process, an attempt was made to identify the portions of PNRSV CP responsible for self-interaction using yeast two-hybrid system. It was found (after analysis of the deletion clones) that the C-terminal region of PNRSV CP (amino acids 153-226) plays a vital role in this interaction during dimer formation. N-terminal of PNRSV CP is previously known to be involved in CP-RNA interactions, but our results also suggested that N-terminal of PNRSV CP represented by amino acids 1-77 also interacts with C-terminal (amino acids 153-226) in yeast two-hybrid system, suggesting its probable involvement in the CP-CP interaction.

  17. Development and characterization of the first infectious clone of alfalfa latent virus, a strain of Pea streak virus

    Science.gov (United States)

    Alfalfa (Medicago sativa) is a natural host plant for many plant pathogens including fungi, bacteria, nematodes and viruses. Alfalfa latent virus (ALV) is a member of the carlavirus group and occurs symptomlessly in alfalfa. The first complete genomic sequence of the ALV that was recently obtained i...

  18. Molecular identification based on coat protein sequences of the Barley yellow dwarf virus from Brazil

    Directory of Open Access Journals (Sweden)

    Talita Bernardon Mar

    2013-12-01

    Full Text Available Yellow dwarf disease, one of the most important diseases of cereal crops worldwide, is caused by virus species belonging to the Luteoviridae family. Forty-two virus isolates obtained from oat (Avena sativa L., wheat (Triticum aestivum L., barley (Hordeum vulgare L., corn (Zea mays L., and ryegrass (Lolium multiflorum Lam. collected between 2007 and 2008 from winter cereal crop regions in southern Brazil were screened by polymerase chain reaction (PCR with primers designed on ORF 3 (coat protein - CP for the presence of Barley yellow dwarf virus and Cereal yellow dwarf virus (B/CYDV. PCR products of expected size (~357 bp for subgroup II and (~831 bp for subgroup I were obtained for three and 39 samples, respectively. These products were cloned and sequenced. The subgroup II 3' partial CP amino acid deduced sequences were identified as BYDV-RMV (92 - 93 % of identity with "Illinois" Z14123 isolate. The complete CP amino acid deduced sequences of subgroup I isolates were confirmed as BYDV-PAV (94 - 99 % of identity and established a very homogeneous group (identity higher than 99 %. These results support the prevalence of BYDV-PAV in southern Brazil as previously diagnosed by Enzyme-Linked Immunosorbent Assay (ELISA and suggest that this population is very homogeneous. To our knowledge, this is the first report of BYDV-RMV in Brazil and the first genetic diversity study on B/CYDV in South America.

  19. Prediction of protein-protein interactions in dengue virus coat proteins guided by low resolution cryoEM structures

    Directory of Open Access Journals (Sweden)

    Srinivasan Narayanaswamy

    2010-06-01

    Full Text Available Abstract Background Dengue virus along with the other members of the flaviviridae family has reemerged as deadly human pathogens. Understanding the mechanistic details of these infections can be highly rewarding in developing effective antivirals. During maturation of the virus inside the host cell, the coat proteins E and M undergo conformational changes, altering the morphology of the viral coat. However, due to low resolution nature of the available 3-D structures of viral assemblies, the atomic details of these changes are still elusive. Results In the present analysis, starting from Cα positions of low resolution cryo electron microscopic structures the residue level details of protein-protein interaction interfaces of dengue virus coat proteins have been predicted. By comparing the preexisting structures of virus in different phases of life cycle, the changes taking place in these predicted protein-protein interaction interfaces were followed as a function of maturation process of the virus. Besides changing the current notion about the presence of only homodimers in the mature viral coat, the present analysis indicated presence of a proline-rich motif at the protein-protein interaction interface of the coat protein. Investigating the conservation status of these seemingly functionally crucial residues across other members of flaviviridae family enabled dissecting common mechanisms used for infections by these viruses. Conclusions Thus, using computational approach the present analysis has provided better insights into the preexisting low resolution structures of virus assemblies, the findings of which can be made use of in designing effective antivirals against these deadly human pathogens.

  20. Nucleotide sequence of the coat protein gene of Lettuce big-vein virus.

    Science.gov (United States)

    Sasaya, T; Ishikawa, K; Koganezawa, H

    2001-06-01

    A sequence of 1425 nt was established that included the complete coat protein (CP) gene of Lettuce big-vein virus (LBVV). The LBVV CP gene encodes a 397 amino acid protein with a predicted M(r) of 44486. Antisera raised against synthetic peptides corresponding to N-terminal or C-terminal parts of the LBVV CP reacted in Western blot analysis with a protein with an M(r) of about 48000. RNA extracted from purified particles of LBVV by using proteinase K, SDS and phenol migrated in gels as two single-stranded RNA species of approximately 7.3 kb (ss-1) and 6.6 kb (ss-2). After denaturation by heat and annealing at room temperature, the RNA migrated as four species, ss-1, ss-2 and two additional double-stranded RNAs (ds-1 and ds-2). The Northern blot hybridization analysis using riboprobes from a full-length clone of the LBVV CP gene indicated that ss-2 has a negative-sense nature and contains the LBVV CP gene. Moreover, ds-2 is a double-stranded form of ss-2. Database searches showed that the LBVV CP most resembled the nucleocapsid proteins of rhabdoviruses. These results indicate that it would be appropriate to classify LBVV as a negative-sense single-stranded RNA virus rather than as a double-stranded RNA virus.

  1. Wheat streak mosaic virus coat protein is a determinant for vector transmission by the wheat curl mite

    Science.gov (United States)

    Wheat streak mosaic virus (WSMV; genus Tritimovirus; family Potyviridae), is transmitted by the wheat curl mite (Aceria tosichella Keifer). The requirement of coat protein (CP) for WSMV transmission by the wheat curl mite was examined using a series of viable deletion and point mutations. Mite trans...

  2. Coat protein deletion mutants elicit more severe symptoms than wild-type virus in multiple cereal hosts

    Science.gov (United States)

    The coat protein (CP) of Wheat streak mosaic virus (WSMV; genus Tritimovirus, family Potyviridae) tolerates deletion of amino acids 36 to 84 for efficient systemic infection of wheat. This study demonstrates that deletion of CP amino acids 58 to 84, but not 36 to 57, from WSMV genome induced severe ...

  3. Role of alfalfa mosaic virus coat protein in regulation of the balance between viral plus and minus strand RNA synthesis

    NARCIS (Netherlands)

    van der Kuyl, A. C.; Neeleman, L.; Bol, J. F.

    1991-01-01

    Replication of wild type RNA 3 of alfalfa mosaic virus (AIMV) and mutants with frameshifts in the P3 or coat protein (CP) genes was studied in protoplasts from tobacco plants transformed with DNA copies of AIMV RNAs 1 and 2. Accumulation of viral plus and minus strand RNAs was monitored with

  4. 40 CFR 174.516 - Coat protein of cucumber mosaic virus; exemption from the requirement of a tolerance.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Coat protein of cucumber mosaic virus; exemption from the requirement of a tolerance. 174.516 Section 174.516 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS PROCEDURES AND REQUIREMENTS FOR PLANT-INCORPORATED PROTECTANTS Tolerances and Tolerance...

  5. 40 CFR 174.515 - Coat Protein of Papaya Ringspot Virus; exemption from the requirement of a tolerance.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Coat Protein of Papaya Ringspot Virus; exemption from the requirement of a tolerance. 174.515 Section 174.515 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS PROCEDURES AND REQUIREMENTS FOR PLANT-INCORPORATED PROTECTANTS Tolerances and Tolerance...

  6. Nucleotide sequence of the coat protein gene of the Skierniewice isolate of plum pox virus (PPV)

    International Nuclear Information System (INIS)

    Wypijewski, K.; Musial, W.; Augustyniak, J.; Malinowski, T.

    1994-01-01

    The coat protein (CP) gene of the Skierniewice isolate of plum pox virus (PPV-S) has been amplified using the reverse transcription - polymerase chain reaction (RT-PCR), cloned and sequenced. The nucleotide sequence of the gene and the deduced amino-acid sequences of PPV-S CP were compared with those of other PPV strains. The nucleotide sequence showed very high homology to most of the published sequences. The motif: Asp-Ala-Gly (DAG), important for the aphid transmissibility, was present in the amino-acid sequence. Our isolate did not react in ELISA with monoclonal antibodies MAb06 supposed to be specific for PPV-D. (author). 32 refs, 1 fig., 2 tabs

  7. Transgenic Sugarcane Resistant to Sorghum mosaic virus Based on Coat Protein Gene Silencing by RNA Interference

    Directory of Open Access Journals (Sweden)

    Jinlong Guo

    2015-01-01

    Full Text Available As one of the critical diseases of sugarcane, sugarcane mosaic disease can lead to serious decline in stalk yield and sucrose content. It is mainly caused by Potyvirus sugarcane mosaic virus (SCMV and/or Sorghum mosaic virus (SrMV, with additional differences in viral strains. RNA interference (RNAi is a novel strategy for producing viral resistant plants. In this study, based on multiple sequence alignment conducted on genomic sequences of different strains and isolates of SrMV, the conserved region of coat protein (CP genes was selected as the target gene and the interference sequence with size of 423 bp in length was obtained through PCR amplification. The RNAi vector pGII00-HACP with an expression cassette containing both hairpin interference sequence and cp4-epsps herbicide-tolerant gene was transferred to sugarcane cultivar ROC22 via Agrobacterium-mediated transformation. After herbicide screening, PCR molecular identification, and artificial inoculation challenge, anti-SrMV positive transgenic lines were successfully obtained. SrMV resistance rate of the transgenic lines with the interference sequence was 87.5% based on SrMV challenge by artificial inoculation. The genetically modified SrMV-resistant lines of cultivar ROC22 provide resistant germplasm for breeding lines and can also serve as resistant lines having the same genetic background for study of resistance mechanisms.

  8. Genetic diversity and molecular evolution of Ornithogalum mosaic virus based on the coat protein gene sequence

    Directory of Open Access Journals (Sweden)

    Fangluan Gao

    2018-03-01

    Full Text Available Ornithogalum mosaic virus (OrMV has a wide host range and affects the production of a variety of ornamentals. In this study, the coat protein (CP gene of OrMVwas used to investigate the molecular mechanisms underlying the evolution of this virus. The 36 OrMV isolates fell into two groups which have significant subpopulation differentiation with an FST value of 0.470. One isolate was identified as a recombinant and the other 35 recombination-free isolates could be divided into two major clades under different evolutionary constraints with dN/dS values of 0.055 and 0.028, respectively, indicating a role of purifying selection in the differentiation of OrMV. In addition, the results from analysis of molecular variance (AMOVA indicated that the effect of host species on the genetic divergence of OrMV is greater than that of geography. Furthermore, OrMV isolates from the genera Ornithogalum, Lachenalia and Diuri tended to group together, indicating that OrMV diversification was maintained, in part, by host-driven adaptation.

  9. Prevalence of Tobacco mosaic virus in Iran and Evolutionary Analyses of the Coat Protein Gene

    Directory of Open Access Journals (Sweden)

    Athar Alishiri

    2013-09-01

    Full Text Available The incidence and distribution of Tobacco mosaic virus (TMV and related tobamoviruses was determined using an enzyme-linked immunosorbent assay on 1,926 symptomatic horticultural crops and 107 asymptomatic weed samples collected from 78 highly infected fields in the major horticultural crop-producing areas in 17 provinces throughout Iran. The results were confirmed by host range studies and reverse transcription-polymerase chain reaction. The overall incidence of infection by these viruses in symptomatic plants was 11.3%. The coat protein (CP gene sequences of a number of isolates were determined and disclosed to be a high identity (up to 100% among the Iranian isolates. Phylogenetic analysis of all known TMV CP genes showed three clades on the basis of nucleotide sequences with all Iranian isolates distinctly clustered in clade II. Analysis using the complete CP amino acid sequence showed one clade with two subgroups, IA and IB, with Iranian isolates in both subgroups. The nucleotide diversity within each sub-group was very low, but higher between the two clades. No correlation was found between genetic distance and geographical origin or host species of isolation. Statistical analyses suggested a negative selection and demonstrated the occurrence of gene flow from the isolates in other clades to the Iranian population.

  10. Expression of tomato yellow leaf curl virus coat protein using baculovirus expression system and evaluation of its utility as a viral antigen.

    Science.gov (United States)

    Elgaied, Lamiaa; Salem, Reda; Elmenofy, Wael

    2017-08-01

    DNA encoding the coat protein (CP) of an Egyptian isolate of tomato yellow leaf curl virus (TYLCV) was inserted into the genome of Autographa californica nucleopolyhedrovirus (AcNPV) under the control of polyhedrin promoter. The generated recombinant baculovirus construct harboring the coat protein gene was characterized using PCR analysis. The recombinant coat protein expressed in infected insect cells was used as a coating antigen in an indirect Enzyme-linked immunosorbent assay (ELISA) and dot blot to test its utility for the detection of antibody generated against TYLCV virus particles. The results of ELISA and dot blot showed that the TYLCV-antibodies reacted positively with extracts of infected cells using the recombinant virus as a coating antigen with strong signals as well as the TYLCV infected tomato and beat plant extracts as positive samples. Scanning electron microscope examination showed that the expressed TYLCV coat protein was self-assembled into virus-like particles (VLPs) similar in size and morphology to TYLCV virus particles. These results concluded that, the expressed coat protein of TYLCV using baculovirus vector system is a reliable candidate for generation of anti-CP antibody for inexpensive detection of TYLCV-infected plants using indirect CP-ELISA or dot blot with high specificity.

  11. Analysis of the epitope structure of Plum pox virus coat protein.

    Science.gov (United States)

    Candresse, Thierry; Saenz, Pilar; García, Juan Antonio; Boscia, Donato; Navratil, Milan; Gorris, Maria Teresa; Cambra, Mariano

    2011-05-01

    Typing of the particular Plum pox virus (PPV) strain responsible in an outbreak has important practical implications and is frequently performed using strain-specific monoclonal antibodies (MAbs). Analysis in Western blots of the reactivity of 24 MAbs to a 112-amino-acid N-terminal fragment of the PPV coat protein (CP) expressed in Escherichia coli showed that 21 of the 24 MAbs recognized linear or denaturation-insensitive epitopes. A series of eight C-truncated CP fragments allowed the mapping of the epitopes recognized by the MAbs. In all, 14 of them reacted to the N-terminal hypervariable region, defining a minimum of six epitopes, while 7 reacted to the beginning of the core region, defining a minimum of three epitopes. Sequence comparisons allowed the more precise positioning of regions recognized by several MAbs, including those recognized by the 5B-IVIA universal MAb (amino acids 94 to 100) and by the 4DG5 and 4DG11 D serogroup-specific MAbs (amino acids 43 to 64). A similar approach coupled with infectious cDNA clone mutagenesis showed that a V74T mutation in the N-terminus of the CP abolished the binding of the M serogroup-specific AL MAb. Taken together, these results provide a detailed positioning of the epitopes recognized by the most widely used PPV detection and typing MAbs.

  12. Hibiscus chlorotic ringspot virus coat protein upregulates sulfur metabolism genes for enhanced pathogen defense.

    Science.gov (United States)

    Gao, Ruimin; Ng, Florence Kai Lin; Liu, Peng; Wong, Sek-Man

    2012-12-01

    In both Hibiscus chlorotic ringspot virus (HCRSV)-infected and HCRSV coat protein (CP) agroinfiltrated plant leaves, we showed that sulfur metabolism pathway related genes-namely, sulfite oxidase (SO), sulfite reductase, and adenosine 5'-phosphosulfate kinase-were upregulated. It led us to examine a plausible relationship between sulfur-enhanced resistance (SED) and HCRSV infection. We broadened an established method to include different concentrations of sulfur (0S, 1S, 2S, and 3S) to correlate them to symptom development of HCRSV-infected plants. We treated plants with glutathione and its inhibitor to verify the SED effect. Disease resistance was induced through elevated glutathione contents during HCRSV infection. The upregulation of SO was related to suppression of symptom development induced by sulfur treatment. In this study, we established that HCRSV-CP interacts with SO which, in turn, triggers SED and leads to enhanced plant resistance. Thus, we have discovered a new function of SO in the SED pathway. This is the first report to demonstrate that the interaction of a viral protein and host protein trigger SED in plants. It will be interesting if such interaction applies generally to other host-pathogen interactions that will lead to enhanced pathogen defense.

  13. Localization of the N-terminal domain of cauliflower mosaic virus coat protein precursor

    International Nuclear Information System (INIS)

    Champagne, Julie; Benhamou, Nicole; Leclerc, Denis

    2004-01-01

    Cauliflower mosaic virus (CaMV) open reading frame (ORF) IV encodes a coat protein precursor (pre-CP) harboring an N-terminal extension that is cleaved off by the CaMV-encoded protease. In transfected cells, pre-CP is present in the cytoplasm, while the processed form (p44) of CP is targeted to the nucleus, suggesting that the N-terminal extension might be involved in keeping the pre-CP in the cytoplasm for viral assembly. This study reports for the first time the intracellular localization of the N-terminal extension during CaMV infection in Brassica rapa. Immunogold-labeling electron microscopy using polyclonal antibodies directed to the N-terminal extension of the pre-CP revealed that this region is closely associated with viral particles present in small aggregates, which we called small bodies, adjacent to the main inclusion bodies typical of CaMV infection. Based on these results, we propose a model for viral assembly of CaMV

  14. Synthesis and magnetic property of T4 virus-supported gold-coated iron ternary nanocomposite

    Energy Technology Data Exchange (ETDEWEB)

    Xu Ziming; Sun Hongjing; Gao Faming, E-mail: fmgao@ysu.edu.cn; Hou Li; Li Na [Yanshan University, Key Laboratory of Applied Chemistry (China)

    2012-12-15

    Herein, we present a novel method based on the use of the symmetrical T4 bacteriophage capsid as a scaffold for preparing the gold-coated iron ternary core/shell nanostructure. Results showed that the thick gold shell was obtained to effectively protect Fe core from oxidation. Magnetic measurements showed that the nanocomposites were superparamagnetic at room temperature with a blocking temperature of about 35 K. At 3 K, its coercivity of 1142.86 Oe was larger than the existing experimental values. The magnetic property of Au/T4 was also tested, demonstrating the source of the magnetic sample arising from the Fe core only. The absorption spectrum of the Fe-Au/T4 complex was measured and compared with gold/virus. Different thickness gold shells were controlled in the synthesis by tuning the Au salt addition. On the basis of results and discussion, we further speculated the general growing mechanism of the template-supported Fe-Au process.

  15. Synthesis and magnetic property of T4 virus-supported gold-coated iron ternary nanocomposite

    Science.gov (United States)

    Xu, Ziming; Sun, Hongjing; Gao, Faming; Hou, Li; Li, Na

    2012-12-01

    Herein, we present a novel method based on the use of the symmetrical T4 bacteriophage capsid as a scaffold for preparing the gold-coated iron ternary core/shell nanostructure. Results showed that the thick gold shell was obtained to effectively protect Fe core from oxidation. Magnetic measurements showed that the nanocomposites were superparamagnetic at room temperature with a blocking temperature of about 35 K. At 3 K, its coercivity of 1142.86 Oe was larger than the existing experimental values. The magnetic property of Au/T4 was also tested, demonstrating the source of the magnetic sample arising from the Fe core only. The absorption spectrum of the Fe@Au/T4 complex was measured and compared with gold/virus. Different thickness gold shells were controlled in the synthesis by tuning the Au salt addition. On the basis of results and discussion, we further speculated the general growing mechanism of the template-supported Fe@Au process.

  16. Polyclonal antibodies against the recombinantly expressed coat protein of the Citrus psorosis virus

    Directory of Open Access Journals (Sweden)

    Reda Salem

    2018-05-01

    Full Text Available Psorosis is a damaging disease of citrus that is widespread in many parts of the world. Citrus psorosis virus (CPsV, the type species of the genus Ophiovirus, is the putative causal agent of psorosis. Detection of CPsV by laboratory methods, serology in particular is a primary requirement for large-scale surveys but their production has been impaired by the difficulty of obtaining sufficient clean antigen for immunization. Specific PAbs against coat protein were produced in E. coli using recombinant DNA approach. The full length CP gene fragment was amplified by RT-PCR using total RNA extracted from CPsV infected citrus leaves and CP specific primers. The obtained product (1320bp was cloned, sequenced and sub-cloned into pET-30(+ expression vector. Expression was induced and screened in different bacterial clones by the presence of the expressed protein (48kDa and optimized in one clone. Expressed CP was purified using batch chromatography under denaturing conditions. Specificity of expressed protein was demonstrated by ELISA before used as antigen for raising PAbs in mice. Specificity of the raised PAbs to CPsV was verified by ELISA and western blotting. The raised PAbs were showed highly effectiveness in screening by ELISA comparing with the commercial antibodies purchased from Agritest, Valanzano, Italy.The expression of CPsV CP gene in E. coli, production of PAbs using recombinant protein as an antigen, the suitability of these antibodies for use in immunodiagnostics against the CPsV Egyptian isolate have been accomplished in this work. Keywords: CPsV, CP, PAbs, RT-PCR, ELISA, Western blotting

  17. Analysis of potato virus Y coat protein epitopes recognized by three commercial monoclonal antibodies.

    Science.gov (United States)

    Tian, Yan-Ping; Hepojoki, Jussi; Ranki, Harri; Lankinen, Hilkka; Valkonen, Jari P T

    2014-01-01

    Potato virus Y (PVY, genus Potyvirus) causes substantial economic losses in solanaceous plants. Routine screening for PVY is an essential part of seed potato certification, and serological assays are often used. The commercial, commonly used monoclonal antibodies, MAb1128, MAb1129, and MAb1130, recognize the viral coat protein (CP) of PVY and distinguish PVYN strains from PVYO and PVYC strains, or detect all PVY strains, respectively. However, the minimal epitopes recognized by these antibodies have not been identified. SPOT peptide array was used to map the epitopes in CP recognized by MAb1128, MAb1129, and MAb1130. Then alanine replacement as well as N- and C-terminal deletion analysis of the identified peptide epitopes was done to determine critical amino acids for antibody recognition and the respective minimal epitopes. The epitopes of all antibodies were located within the 30 N-terminal-most residues. The minimal epitope of MAb1128 was 25NLNKEK30. Replacement of 25N or 27N with alanine weakened the recognition by MAb1128, and replacement of 26L, 29E, or 30K nearly precluded recognition. The minimal epitope for MAb1129 was 16RPEQGSIQSNP26 and the most critical residues for recognition were 22I and 23Q. The epitope of MAb1130 was defined by residues 5IDAGGS10. Mutation of residue 6D abrogated and mutation of 9G strongly reduced recognition of the peptide by MAb1130. Amino acid sequence alignment demonstrated that these epitopes are relatively conserved among PVY strains. Finally, recombinant CPs were produced to demonstrate that mutations in the variable positions of the epitope regions can affect detection with the MAbs. The epitope data acquired can be compared with data on PVY CP-encoding sequences produced by laboratories worldwide and utilized to monitor how widely the new variants of PVY can be detected with current seed potato certification schemes or during the inspection of imported seed potatoes as conducted with these MAbs.

  18. The effect of surface demineralization of cortical bone allograft on the properties of recombinant adeno-associated virus coatings.

    Science.gov (United States)

    Yazici, Cemal; Yanoso, Laura; Xie, Chao; Reynolds, David G; Samulski, R Jude; Samulski, Jade; Yannariello-Brown, Judith; Gertzman, Arthur A; Zhang, Xinping; Awad, Hani A; Schwarz, Edward M

    2008-10-01

    Freeze-dried recombinant adeno-associated virus (rAAV) coated structural allografts have emerged as an approach to engender necrotic cortical bone with host factors that will persist for weeks following surgery to facilitate revascularization, osteointegration, and remodeling. However, one major limitation is the nonporous cortical surface that prohibits uniform distribution of the rAAV coating prior to freeze-drying. To overcome this we have developed a demineralization method to increase surface absorbance while retaining the structural integrity of the allograft. Demineralized bone wafers (DBW) made from human femoral allograft rings demonstrated a significant 21.1% (73.6+/-3.9% versus 52.5+/-2.6%; pcoating versus mineralized controls. Co-incubation of rAAV-luciferase (rAAV-Luc) coated DBW with a monolayer of C3H10T1/2 cells in culture led to peak luciferase levels that were not significantly different from soluble rAAV-Luc controls (p>0.05), although the peaks occurred at 60h and 12h, respectively. To assess the transduction efficiency of rAAV-Luc coated DBW in vivo, we first performed a dose response with allografts containing 10(7), 10(9) or 10(10) particles that were surgically implanted into the quadriceps of mice, and assayed by in vivo bioluminescence imaging (BLI) on days 1, 3, 5, 7, 10, 14, and 21. The results demonstrated a dose response in which the DBW coated with 10(10) rAAV-Luc particles achieved peak gene expression levels on day 3, which persisted until day 21, and was significantly greater than the 10(7) dose throughout this time period (pcoated with 10(10) rAAV-Luc particles failed to demonstrate any significant differences in transduction kinetics or efficiency in vivo. Thus, surface demineralization of human cortical bone allograft increases its absorbance for uniform rAAV coating, without affecting vector transduction efficiency.

  19. Design and self-assembly of simple coat proteins for artificial viruses

    NARCIS (Netherlands)

    Hernandez-Garcia, Armando; Kraft, Daniela J.; Janssen, Anne F J; Bomans, Paul H H; Sommerdijk, Nico A J M; Thies-Weesie, Dominique M E; Favretto, Marco E.; Brock, Roland; De Wolf, Frits A.; Werten, Marc W T; Van Der Schoot, Paul; Stuart, Martien Cohen; De Vries, Renko

    2014-01-01

    Viruses are among the simplest biological systems and are highly effective vehicles for the delivery of genetic material into susceptible host cells1. Artificial viruses can be used as model systems for providing insights into natural viruses and can be considered a testing ground for developing

  20. Partial characterization of the lettuce infectious yellows virus genomic RNAs, identification of the coat protein gene and comparison of its amino acid sequence with those of other filamentous RNA plant viruses.

    Science.gov (United States)

    Klaassen, V A; Boeshore, M; Dolja, V V; Falk, B W

    1994-07-01

    Purified virions of lettuce infectious yellows virus (LIYV), a tentative member of the closterovirus group, contained two RNAs of approximately 8500 and 7300 nucleotides (RNAs 1 and 2 respectively) and a single coat protein species with M(r) of approximately 28,000. LIYV-infected plants contained multiple dsRNAs. The two largest were the correct size for the replicative forms of LIYV virion RNAs 1 and 2. To assess the relationships between LIYV RNAs 1 and 2, cDNAs corresponding to the virion RNAs were cloned. Northern blot hybridization analysis showed no detectable sequence homology between these RNAs. A partial amino acid sequence obtained from purified LIYV coat protein was found to align in the most upstream of four complete open reading frames (ORFs) identified in a LIYV RNA 2 cDNA clone. The identity of this ORF was confirmed as the LIYV coat protein gene by immunological analysis of the gene product expressed in vitro and in Escherichia coli. Computer analysis of the LIYV coat protein amino acid sequence indicated that it belongs to a large family of proteins forming filamentous capsids of RNA plant viruses. The LIYV coat protein appears to be most closely related to the coat proteins of two closteroviruses, beet yellows virus and citrus tristeza virus.

  1. Symptomless endophytic fungi suppress endogenous levels of salicylic acid and interact with the jasmonate-dependent indirect defense traits of their host, lima bean (Phaseolus lunatus).

    Science.gov (United States)

    Navarro-Meléndez, Ariana L; Heil, Martin

    2014-07-01

    Symptomless ‘type II’ fungal endophytes colonize their plant host horizontally and exert diverse effects on its resistance phenotype. Here, we used wild Lima bean (Phaseolus lunatus) plants that were experimentally colonized with one of three strains of natural endophytes (Bartalinia pondoensis, Fusarium sp., or Cochliobolus lunatus) to investigate the effects of fungal colonization on the endogenous levels of salicylic acid (SA) and jasmonic acid (JA) and on two JA-dependent indirect defense traits. Colonization with Fusarium sp. enhanced JA levels in intact leaves, whereas B. pondoensis suppressed the induction of endogenous JA in mechanically damaged leaves. Endogenous SA levels in intact leaves were significantly decreased by all strains and B. pondoensis and Fusarium sp. decreased SA levels after mechanical damage. Colonization with Fusarium sp. or C. lunatus enhanced the number of detectable volatile organic compounds (VOCs) emitted from intact leaves, and all three strains enhanced the relative amount of several VOCs emitted from intact leaves as well as the number of detectable VOCs emitted from slightly damaged leaves. All three strains completely suppressed the induced secretion of extrafloral nectar (EFN) after the exogenous application of JA. Symptomless endophytes interact in complex and strain-specific ways with the endogenous levels of SA and JA and with the defense traits that are controlled by these hormones. These interactions can occur both upstream and downstream of the defense hormones.

  2. The influence of the N- and C- terminal modifications of Potato virus X coat protein on virus properties

    Czech Academy of Sciences Publication Activity Database

    Hoffmeisterová, Hana; Moravec, Tomáš; Plchová, Helena; Folwarczna, Jitka; Čeřovská, Noemi

    2012-01-01

    Roč. 56, č. 4 (2012), s. 775-779 ISSN 0006-3134 R&D Projects: GA ČR GA521/09/1525 Institutional research plan: CEZ:AV0Z50380511 Keywords : chimeric coat protein * expression of recombinant protein * Nicotiana benthamiana Subject RIV: EI - Biotechnology ; Bionics Impact factor: 1.692, year: 2012

  3. Replication of alfalfa mosaic virus RNA 3 with movement and coat protein genes replaced by corresponding genes of Prunus necrotic ringspot ilarvirus.

    Science.gov (United States)

    Sánchez-Navarro, J A; Reusken, C B; Bol, J F; Pallás, V

    1997-12-01

    Alfalfa mosaic virus (AMV) and Prunus necrotic ringspot virus (PNRSV) are tripartite positive-strand RNA plant viruses that encode functionally similar translation products. Although the two viruses are phylogenetically closely related, they infect a very different range of natural hosts. The coat protein (CP) gene, the movement protein (MP) gene or both genes in AMV RNA 3 were replaced by the corresponding genes of PNRSV. The chimeric viruses were tested for heterologous encapsidation, replication in protoplasts from plants transformed with AMV replicase genes P1 and P2 (P12 plants) and for cell-to-cell transport in P12 plants. The chimeric viruses exhibited basic competence for encapsidation and replication in P12 protoplasts and for a low level of cell-to-cell movement in P12 plants. The potential involvement of the MP gene in determining host specificity in ilarviruses is discussed.

  4. The Generation of Turnip Crinkle Virus-Like Particles in Plants by the Transient Expression of Wild-Type and Modified Forms of Its Coat Protein.

    Science.gov (United States)

    Saunders, Keith; Lomonossoff, George P

    2015-01-01

    Turnip crinkle virus (TCV), a member of the genus carmovirus of the Tombusviridae family, has a genome consisting of a single positive-sense RNA molecule that is encapsidated in an icosahedral particle composed of 180 copies of a single type of coat protein. We have employed the CPMV-HT transient expression system to investigate the formation of TCV-like particles following the expression of the wild-type coat protein or modified forms of it that contain either deletions and/or additions. Transient expression of the coat protein in plants results in the formation of capsid structures that morphologically resemble TCV virions (T = 3 structure) but encapsidate heterogeneous cellular RNAs, rather than the specific TCV coat protein messenger RNA. Expression of an amino-terminal deleted form of the coat protein resulted in the formation of smaller T = 1 structures that are free of RNA. The possibility of utilizing TCV as a carrier for the presentation of foreign proteins on the particle surface was also explored by fusing the sequence of GFP to the C-terminus of the coat protein. The expression of coat protein-GFP hybrids permitted the formation of VLPs but the yield of particles is diminished compared to the yield obtained with unmodified coat protein. Our results confirm the importance of the N-terminus of the coat protein for the encapsidation of RNA and show that the coat protein's exterior P domain plays a key role in particle formation.

  5. The 42-kDa coat protein of Andean potato mottle virus acts as a transcriptional activator in yeast

    Directory of Open Access Journals (Sweden)

    Vidal M.S.

    2002-01-01

    Full Text Available Interactions of viral proteins play an important role in the virus life cycle, especially in capsid assembly. Andean potato mottle comovirus (APMoV is a plant RNA virus with a virion formed by two coat proteins (CP42 and CP22. Both APMoV coat protein open reading frames were cloned into pGBT9 and pGAD10, two-hybrid system vectors. HF7c yeast cells transformed with the p9CP42 construct grew on yeast dropout selection media lacking tryptophan and histidine. Clones also exhibited ß-galactosidase activity in both qualitative and quantitative assays. These results suggest that CP42 protein contains an amino acid motif able to activate transcription of His3 and lacZ reporter genes in Saccharomyces cerevisiae. Several deletions of the CP42 gene were cloned into the pGBT9 vector to locate the region involved in this activation. CP42 constructions lacking 12 residues from the C-terminal region and another one with 267 residues deleted from the N-terminus are still able to activate transcription of reporter genes. However, transcription activation was not observed with construction p9CP42deltaC57, which does not contain the last 57 amino acid residues. These results demonstrate that a transcription activation domain is present at the C-terminus of CP42 between residues 267 and 374.

  6. Multiple loci condition seed transmission of soybean mosaic virus (SMV) and SMV-induced seed coat mottling in soybean.

    Science.gov (United States)

    Domier, Leslie L; Hobbs, Houston A; McCoppin, Nancy K; Bowen, Charles R; Steinlage, Todd A; Chang, Sungyul; Wang, Yi; Hartman, Glen L

    2011-06-01

    Infection of soybean plants with Soybean mosaic virus (SMV), which is transmitted by aphids and through seed, can cause significant reductions in seed production and quality. Because seedborne infections are the primary sources of inoculum for SMV infections in North America, host-plant resistance to seed transmission can limit the pool of plants that can serve as sources of inoculum. To examine the inheritance of SMV seed transmission in soybean, crosses were made between plant introductions (PIs) with high (PI88799), moderate (PI60279), and low (PI548391) rates of transmission of SMV through seed. In four F(2) populations, SMV seed transmission segregated as if conditioned by two or more genes. Consequently, a recombinant inbred line population was derived from a cross between PIs 88799 and 548391 and evaluated for segregation of SMV seed transmission, seed coat mottling, and simple sequence repeat markers. Chromosomal regions on linkage groups C1 and C2 were significantly associated with both transmission of isolate SMV 413 through seed and SMV-induced seed coat mottling, and explained ≈42.8 and 46.4% of the variability in these two traits, respectively. Chromosomal regions associated with seed transmission and seed coat mottling contained homologues of Arabidopsis genes DCL3 and RDR6, which encode enzymes involved in RNA-mediated transcriptional and posttranscriptional gene silencing.

  7. Coat protein of Turnip mosaic virus in oilseed rape (Brassica napus)

    African Journals Online (AJOL)

    mohammad

    2Department of Plant Breeding and Biotechnology, Faculty of Agriculture, Ferdowsi University of Mashhad, Mashhad,. Iran. Accepted 15 August, 2012 ... led to prevalence of infectious diseases. Turnip mosaic virus (TuMV) is an .... During the sampling of canola plants for the detection of virus, some colonies of aphids were ...

  8. Genetic transformation of sweet orange with the coat protein gene of Citrus psorosis virus and evaluation of resistance against the virus.

    Science.gov (United States)

    Zanek, María Cecilia; Reyes, Carina Andrea; Cervera, Magdalena; Peña, Eduardo José; Velázquez, Karelia; Costa, Norma; Plata, Maria Inés; Grau, Oscar; Peña, Leandro; García, María Laura

    2008-01-01

    Citrus psorosis is a serious viral disease affecting citrus trees in many countries. Its causal agent is Citrus psorosis virus (CPsV), the type member of genus Ophiovirus. CPsV infects most important citrus varieties, including oranges, mandarins and grapefruits, as well as hybrids and citrus relatives used as rootstocks. Certification programs have not been sufficient to control the disease and no sources of natural resistance have been found. Pathogen-derived resistance (PDR) can provide an efficient alternative to control viral diseases in their hosts. For this purpose, we have produced 21 independent lines of sweet orange expressing the coat protein gene of CPsV and five of them were challenged with the homologous CPV 4 isolate. Two different viral loads were evaluated to challenge the transgenic plants, but so far, no resistance or tolerance has been found in any line after 1 year of observations. In contrast, after inoculation all lines showed characteristic symptoms of psorosis in the greenhouse. The transgenic lines expressed low and variable amounts of the cp gene and no correlation was found between copy number and transgene expression. One line contained three copies of the cp gene, expressed low amounts of the mRNA and no coat protein. The ORF was cytosine methylated suggesting a PTGS mechanism, although the transformant failed to protect against the viral load used. Possible causes for the failed protection against the CPsV are discussed.

  9. Production of Polyclonal Antibodies to the Recombinant Potato virus M (PVM) Non-structural Triple Gene Block Protein 1 and Coat Protein

    Czech Academy of Sciences Publication Activity Database

    Čeřovská, Noemi; Moravec, Tomáš; Plchová, Helena; Hoffmeisterová, Hana; Dědič, P.

    2012-01-01

    Roč. 160, č. 5 (2012), s. 251-254 ISSN 0931-1785 R&D Projects: GA MŠk 1M06030 Institutional research plan: CEZ:AV0Z50380511 Keywords : Potato virus M * recombinant protein * coat protein Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.000, year: 2012

  10. Are PEI-coated SWCNTs conjugated with hepatitis A virus? A chemical study with SEM, Z-potential, EDXD and RT-PCR

    International Nuclear Information System (INIS)

    Carbone, M; Valentini, F; Palleschi, G; Caminiti, R; Petrinca, A R; Donia, D; Divizia, M

    2010-01-01

    The conjugation between nanotubes, coated with different doses of polyethylene imine (PEI) and hepatitis A virus (HAV) was investigated by scanning electron microscopy, Z-potential, thermogravimetric and differential thermal analysis, transmission electron microscopy, energy dispersive x-ray diffraction (EDXD) and reverse transcript polymerase chain reaction (RT-PCR). For the first time, to our knowledge, evidence is obtained that conjugation between the nanotubes and the HAV occurs and that it has an (at least a partial) electrostatic character. Since all components of the conjugated systems, nanotubes, coating material and virus are characterized by different peak shapes in the selected q range, it was possible to infer that conjugation occurred. RT-PCR measurements confirmed that the conjugation of the coated nanotubes and HAV occurred and the result was stable. This opens up the prospect of probing the coated nanotubes as intra-cellular carriers in transfection processes of the virus. Further biological applications will concern a possible vaccine especially for non-replicative viruses.

  11. Molecular characterization of a novel cryptic virus infecting pigeonpea plants.

    Directory of Open Access Journals (Sweden)

    Surender Kumar

    Full Text Available A new member of the genus Deltapartitivirus was identified containing three dsRNAs with an estimated size of 1.71, 1.49 and 1.43 kb. The dsRNAs were extracted from symptomless pigeonpea [Cajanus cajan (L. Millspaugh] plants cv. Erra Kandulu. This new virus with 4.64 kb genome was tentatively named Arhar cryptic virus-1 (ArCV-1. The genomic RNAs were amplified and characterized by sequence independent single primer amplification. The dsRNAs shared a highly conserved 16 nt 5' non-coding region (5'-GATAATGATCCAAGGA-3'. The largest dsRNA (dsRNA-1 was identified as the viral RNA dependent RNA polymerase (replicase, predicted to encode a putative 55.34 kDa protein (P1. The two other smaller dsRNAs (dsRNA-2 and dsRNA-3 predicted to encode for putative capsid proteins of 38.50kDa (P2 and 38.51kDa (P3, respectively. Phylogenetic analysis indicated that ArCV-1 formed a clade together with Fragaria chiloensis cryptic virus, Rosa multiflora cryptic virus and Rose cryptic virus-1, indicating that ArCV-1 could be a new member of the genus Deltapartitivirus. ArCV-1 3Dpol structure revealed several interesting features. The 3Dpol in its full-length shares structural similarities with members of the family Caliciviridaeand family Picornaviridae. In addition, fourth dsRNA molecule (dsRNA-2A, not related to ArCV-1 genome, was found in the same plant tissue. The dsRNA-2A (1.6 kb encodes a protein (P4, with a predicted size of 44.5 kDa. P4 shares similarity with coat protein genes of several cryptic viruses, in particular the bipartite cryptic viruses including Raphanus sativus cryptic virus-3. This is the first report of occurrence of a cryptic virus in pigeonpea plants.

  12. Immunity to potato mop-top virus in Nicotiana benthamiana plants expressing the coat protein gene is effective against fungal inoculation of the virus.

    Science.gov (United States)

    Reavy, B; Arif, M; Kashiwazaki, S; Webster, K D; Barker, H

    1995-01-01

    Nicotiana benthamiana stem tissue was transformed with Agrobacterium tumefaciens harboring a binary vector containing the potato mop-top virus (PMTV) coat protein (CP) gene. PMTV CP was expressed in large amounts in some of the primary transformants. The five transgenic lines which produced the most CP were selected for resistance testing. Flowers on transformed plants were allowed to self-fertilize. Transgenic seedlings selected from the T1 seed were mechanically inoculated with two strains of PMTV. Virus multiplication, assayed by infectivity, was detected in only one transgenic plant of 98 inoculated. T1 plants were also highly resistant to graft inoculation; PMTV multiplied in only one plant of 45 inoculated. Transgenic T1 seedlings were challenged in a bait test in which they were grown in soil containing viruliferous spores of the vector fungus Spongospora subterranea. In these tests only two plants out of 99 became infected. Of the five transgenic lines tested, plants of three lines were immune to infection following manual, graft, or fungal inoculation.

  13. Ruptured congenital aneurysm of the right sinus of Valsalva into the right ventricle: with special reference to pathoanatomic and hemodynamic characteristics in symptomless cases.

    Science.gov (United States)

    Chen, J J; Lien, W P; Chang, F Z; Lee, Y S; Hung, C R; Chu, S S; Wu, T L

    1980-02-01

    Clinical features of 19 cases with congenital aneurysm of the right sinus of Valsalva rupturing into the right ventricular outflow region (Type 1) were analysed in relation to their pathoanatomic lesions and hemodynamic alterations. Sixteen cases were operated with one surgical death. All were catheterized together with ascending aortographic study. Rupture of the aneurysm in many cases was silent or symptomless and progressive heart failure was not quite common. Symptomatology of the patients did not seem to be related entirely to status of the pathoanatomical lesions or hemodynamic alterations. Time of the rupture, and inherent right ventricular characteristics, tolerating volume overload rather well, might be, in part, responsible for its better prognosis in some cases. However, all patients with ruptured aneurysm of the sinus of Valsalva should be treated surgically. Bacterial endocarditis is a serious complication leading to death.

  14. Genetic diversity of the movement and coat protein genes of South American isolates of Prunus necrotic ringspot virus.

    Science.gov (United States)

    Fiore, Nicola; Fajardo, Thor V M; Prodan, Simona; Herranz, María Carmen; Aparicio, Frederic; Montealegre, Jaime; Elena, Santiago F; Pallás, Vicente; Sánchez-Navarro, Jesús

    2008-01-01

    Prunus necrotic ringspot virus (PNRSV) is distributed worldwide, but no molecular data have been previously reported from South American isolates. The nucleotide sequences corresponding to the movement (MP) and coat (CP) proteins of 23 isolates of PNRSV from Chile, Brazil, and Uruguay, and from different Prunus species, have been obtained. Phylogenetic analysis performed with full-length MP and CP sequences from all the PNRSV isolates confirmed the clustering of the isolates into the previously reported PV32-I, PV96-II and PE5-III phylogroups. No association was found between specific sequences and host, geographic origin or symptomatology. Comparative analysis showed that both MP and CP have phylogroup-specific amino acids and all of the motifs previously characterized for both proteins. The study of the distribution of synonymous and nonsynonymous changes along both open reading frames revealed that most amino acid sites are under the effect of negative purifying selection.

  15. Binding constants of Southern rice black-streaked dwarf virus Coat Protein with ferulic acid derivatives

    Directory of Open Access Journals (Sweden)

    Longlu Ran

    2018-04-01

    Full Text Available The data present binding constants between ferulic acid derivatives and the Coat Protein (P10 by fluorescence titration in this article, which is hosted in the research article entitled “Interaction Research on an Antiviral Molecule that Targets the Coat Protein of Southern rice black-streaked dwarf virus’’ (Ran et al., 2017 [1]. The data include fluorescence quenching spectrum, Stern–Volmer quenching constants, and binding parameters. In this article, a more comprehensive data interpretation and analysis is explained.

  16. Papaya ringspot virus coat protein gene for antigen presentation Escherichia coli

    Czech Academy of Sciences Publication Activity Database

    Chatchen, S.; Juříček, Miloslav; Rueda, P.; Kertbundit, Sunee

    2006-01-01

    Roč. 39, č. 1 (2006), s. 16-21 ISSN 1225-8687 Grant - others:Thai Research Fund(TH) BT-B-06-PG-14-4503 Institutional research plan: CEZ:AV0Z50380511 Source of funding: V - iné verejné zdroje Keywords : antigen presentation * canine parvo virus * epitope * papaya ringspot virus Subject RIV: EF - Botanics Impact factor: 1.465, year: 2006 http://www.jbmb.or.kr/view_article.php3?cont=jbmb&kid=174&mid=3&pid=3

  17. Molecular adaptation within the coat protein-encoding gene of Tunisian almond isolates of Prunus necrotic ringspot virus.

    Science.gov (United States)

    Boulila, Moncef; Ben Tiba, Sawssen; Jilani, Saoussen

    2013-04-01

    The sequence alignments of five Tunisian isolates of Prunus necrotic ringspot virus (PNRSV) were searched for evidence of recombination and diversifying selection. Since failing to account for recombination can elevate the false positive error rate in positive selection inference, a genetic algorithm (GARD) was used first and led to the detection of potential recombination events in the coat protein-encoding gene of that virus. The Recco algorithm confirmed these results by identifying, additionally, the potential recombinants. For neutrality testing and evaluation of nucleotide polymorphism in PNRSV CP gene, Tajima's D, and Fu and Li's D and F statistical tests were used. About selection inference, eight algorithms (SLAC, FEL, IFEL, REL, FUBAR, MEME, PARRIS, and GA branch) incorporated in HyPhy package were utilized to assess the selection pressure exerted on the expression of PNRSV capsid. Inferred phylogenies pointed out, in addition to the three classical groups (PE-5, PV-32, and PV-96), the delineation of a fourth cluster having the new proposed designation SW6, and a fifth clade comprising four Tunisian PNRSV isolates which underwent recombination and selective pressure and to which the name Tunisian outgroup was allocated.

  18. An isoform of eukaryotic initiation factor 4E from Chrysanthemum morifolium interacts with Chrysanthemum virus B coat protein.

    Directory of Open Access Journals (Sweden)

    Aiping Song

    Full Text Available BACKGROUND: Eukaryotic translation initiation factor 4E (eIF4E plays an important role in plant virus infection as well as the regulation of gene translation. METHODOLOGY/PRINCIPAL FINDINGS: Here, we describe the isolation of a cDNA encoding CmeIF(iso4E (GenBank accession no. JQ904592, an isoform of eIF4E from chrysanthemum, using RACE PCR. We used the CmeIF(iso4E cDNA for expression profiling and to analyze the interaction between CmeIF(iso4E and the Chrysanthemum virus B coat protein (CVBCP. Multiple sequence alignment and phylogenetic tree analysis showed that the sequence similarity of CmeIF(iso4E with other reported plant eIF(iso4E sequences varied between 69.12% and 89.18%, indicating that CmeIF(iso4E belongs to the eIF(iso4E subfamily of the eIF4E family. CmeIF(iso4E was present in all chrysanthemum organs, but was particularly abundant in the roots and flowers. Confocal microscopy showed that a transiently transfected CmeIF(iso4E-GFP fusion protein distributed throughout the whole cell in onion epidermis cells. A yeast two hybrid assay showed CVBCP interacted with CmeIF(iso4E but not with CmeIF4E. BiFC assay further demonstrated the interaction between CmeIF(iso4E and CVBCP. Luminescence assay showed that CVBCP increased the RLU of Luc-CVB, suggesting CVBCP might participate in the translation of viral proteins. CONCLUSIONS/SIGNIFICANCE: These results inferred that CmeIF(iso4E as the cap-binding subunit eIF(iso4F may be involved in Chrysanthemum Virus B infection in chrysanthemum through its interaction with CVBCP in spatial.

  19. Chick embryo lethal orphan virus can be polymer-coated and retargeted to infect mammalian cells

    Czech Academy of Sciences Publication Activity Database

    Stevenson, M.; Boos, E.; Herbert, C. W.; Hale, A. B.; Green, N.; Lyons, M.; Chandler, L.; Ulbrich, Karel; van Rooijen, N.; Mautner, V.; Fisher, K.; Seymour, L.

    2006-01-01

    Roč. 13, č. 4 (2006), s. 356-368 ISSN 0969-7128 EU Projects: European Commission(XE) 512087 - GIANT Institutional research plan: CEZ:AV0Z40500505 Keywords : CELO virus * N-(2-hydroxypropyl)methacrylamide * retargeting Subject RIV: CE - Biochemistry Impact factor: 4.782, year: 2006

  20. Role of alfalfa mosaic virus coat protein gene in symptom formation

    NARCIS (Netherlands)

    Neeleman, L.; van der Kuyl, A. C.; Bol, J. F.

    1991-01-01

    On Samsun NN tobacco plants strains 425 and YSMV of alfalfa mosaic virus (AIMV) cause mild chlorosis and local necrotic lesions, respectively. DNA copies of RNA3 of both strains were transcribed in vitro into infectious RNA molecules. When the 425 and YSMV transcripts were inoculated to tobacco

  1. Production of Polyclonal Antibodies to Potato virus X Using Recombinant Coat Protein

    Czech Academy of Sciences Publication Activity Database

    Čeřovská, Noemi; Moravec, Tomáš; Plchová, Helena; Hoffmeisterová, Hana; Kmoníčková, Jitka; Dědič, P.

    2010-01-01

    Roč. 158, č. 1 (2010), s. 66-68 ISSN 0931-1785 R&D Projects: GA MŠk 1M06030 Institutional research plan: CEZ:AV0Z50380511 Keywords : Potato virus X * recombinant viral antigen * antibodies Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.937, year: 2010

  2. The Impact of "Coat Protein-Mediated Virus Resistance" in Applied Plant Pathology and Basic Research.

    Science.gov (United States)

    Lindbo, John A; Falk, Bryce W

    2017-06-01

    Worldwide, plant viruses cause serious reductions in marketable crop yield and in some cases even plant death. In most cases, the most effective way to control virus diseases is through genetically controlled resistance. However, developing virus-resistant (VR) crops through traditional breeding can take many years, and in some cases is not even possible. Because of this, the demonstration of the first VR transgenic plants in 1985 generated much attention. This seminal report served as an inflection point for research in both basic and applied plant pathology, the results of which have dramatically changed both basic research and in a few cases, commercial crop production. The typical review article on this topic has focused on only basic or only applied research results stemming from this seminal discovery. This can make it difficult for the reader to appreciate the full impact of research on transgenic virus resistance, and the contributions from fundamental research that led to translational applications of this technology. In this review, we take a global view of this topic highlighting the significant changes to both basic and applied plant pathology research and commercial food production that have accumulated in the last 30 plus years. We present these milestones in the historical context of some of the scientific, economic, and environmental drivers for developing specific VR crops. The intent of this review is to provide a single document that adequately records the significant accomplishments of researchers in both basic and applied plant pathology research on this topic and how they relate to each other. We hope this review therefore serves as both an instructional tool for students new to the topic, as well as a source of conversation and discussion for how the technology of engineered virus resistance could be applied in the future.

  3. Putative recombination events and evolutionary history of five economically important viruses of fruit trees based on coat protein-encoding gene sequence analysis.

    Science.gov (United States)

    Boulila, Moncef

    2010-06-01

    To enhance the knowledge of recombination as an evolutionary process, 267 accessions retrieved from GenBank were investigated, all belonging to five economically important viruses infecting fruit crops (Plum pox, Apple chlorotic leaf spot, Apple mosaic, Prune dwarf, and Prunus necrotic ringspot viruses). Putative recombinational events were detected in the coat protein (CP)-encoding gene using RECCO and RDP version 3.31beta algorithms. Based on RECCO results, all five viruses were shown to contain potential recombination signals in the CP gene. Reconstructed trees with modified topologies were proposed. Furthermore, RECCO performed better than the RDP package in detecting recombination events and exhibiting their evolution rate along the sequences of the five viruses. RDP, however, provided the possible major and minor parents of the recombinants. Thus, the two methods should be considered complementary.

  4. Prime-boost therapeutic vaccination in mice with DNA/DNA or DNA/Fowlpox virus recombinants expressing the Human Papilloma Virus type 16 E6 and E7 mutated proteins fused to the coat protein of Potato virus X.

    Science.gov (United States)

    Illiano, Elena; Bissa, Massimiliano; Paolini, Francesca; Zanotto, Carlo; De Giuli Morghen, Carlo; Franconi, Rosella; Radaelli, Antonia; Venuti, Aldo

    2016-10-02

    The therapeutic antitumor potency of a prime-boost vaccination strategy was explored, based on the mutated, nontransforming forms of the E6 (E6 F47R ) and E7 (E7 GGG ) oncogenes of Human Papilloma Virus type 16 (HPV16), fused to the Potato virus X (PVX) coat protein (CP) sequence. Previous data showed that CP fusion improves the immunogenicity of tumor-associated antigens and may thus increase their efficacy. After verifying the correct expression of E6 F47R CP and E7 GGG CP inserted into DNA and Fowlpox virus recombinants by Western blotting and immunofluorescence, their combined use was evaluated for therapy in a pre-clinical mouse model of HPV16-related tumorigenicity. Immunization protocols were applied using homologous (DNA/DNA) or heterologous (DNA/Fowlpox) prime-boost vaccine regimens. The humoral immune responses were determined by ELISA, and the therapeutic efficacy evaluated by the delay in tumor appearance and reduced tumor volume after inoculation of syngeneic TC-1* tumor cells. Homologous DNA/DNA genetic vaccines were able to better delay tumor appearance and inhibit tumor growth when DNAE6 F47R CP and DNAE7 GGG CP were administered in combination. However, the heterologous DNA/Fowlpox vaccination strategy was able to delay tumor appearance in a higher number of animals when E6 F47R CP and in particular E7 GGG CP were administered alone. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Complete nucleotide sequence and genome organization of Olive latent virus 3, a new putative member of the family Tymoviridae.

    Science.gov (United States)

    Alabdullah, Abdulkader; Minafra, Angelantonio; Elbeaino, Toufic; Saponari, Maria; Savino, Vito; Martelli, Giovanni P

    2010-09-01

    The complete nucleotide sequence and the genome organization were determined of a putative new member of the family Tymoviridae, tentatively named Olive latent virus 3 (OLV-3), recovered in southern Italy from a symptomless olive tree. The sequenced ssRNA genome comprises 7148 nucleotides excluding the poly(A) tail and contains four open reading frames (ORFs). ORF1 encodes a polyprotein of 221.6kDa in size, containing the conserved signatures of the methyltransferase (MTR), papain-like protease (PRO), helicase (HEL) and RNA-dependent RNA polymerase (RdRp) domains of the replication-associated proteins of positive-strand RNA viruses. ORF2 overlaps completely ORF1 and encodes a putative protein of 43.33kDa showing limited sequence similarity with the putative movement protein of Maize rayado fino virus (MRFV). ORF3 codes for a protein with predicted molecular mass of 28.46kDa, identified as the coat protein (CP), whereas ORF4 overlaps ORF3 and encodes a putative protein of 16kDa with sequence similarity to the p16 and p31 proteins of Citrus sudden death-associated virus (CSDaV) and Grapevine fleck virus (GFkV), respectively. Within the family Tymoviridae, OLV-3 genome has the closest identity level (49-52%) with members of the genus Marafivirus, from which, however, it differs because of the diverse genome organization and the presence of a single type of CP subunits. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  6. Synthetic scaffold coating with adeno-associated virus encoding BMP2 to promote endogenous bone repair.

    Science.gov (United States)

    Dupont, Kenneth M; Boerckel, Joel D; Stevens, Hazel Y; Diab, Tamim; Kolambkar, Yash M; Takahata, Masahiko; Schwarz, Edward M; Guldberg, Robert E

    2012-03-01

    Biomaterial scaffolds functionalized to stimulate endogenous repair mechanisms via the incorporation of osteogenic cues offer a potential alternative to bone grafting for the treatment of large bone defects. We first quantified the ability of a self-complementary adeno-associated viral vector encoding bone morphogenetic protein 2 (scAAV2.5-BMP2) to enhance human stem cell osteogenic differentiation in vitro. In two-dimensional culture, scAAV2.5-BMP2-transduced human mesenchymal stem cells (hMSCs) displayed significant increases in BMP2 production and alkaline phosphatase activity compared with controls. hMSCs and human amniotic-fluid-derived stem cells (hAFS cells) seeded on scAAV2.5-BMP2-coated three-dimensional porous polymer Poly(ε-caprolactone) (PCL) scaffolds also displayed significant increases in BMP2 production compared with controls during 12 weeks of culture, although only hMSC-seeded scaffolds displayed significantly increased mineral formation. PCL scaffolds coated with scAAV2.5-BMP2 were implanted into critically sized immunocompromised rat femoral defects, both with or without pre-seeding of hMSCs, representing ex vivo and in vivo gene therapy treatments, respectively. After 12 weeks, defects treated with acellular scAAV2.5-BMP2-coated scaffolds displayed increased bony bridging and had significantly higher bone ingrowth and mechanical properties compared with controls, whereas defects treated with scAAV2.5-BMP2 scaffolds pre-seeded with hMSCs failed to display significant differences relative to controls. When pooled, defect treatment with scAAV2.5-BMP2-coated scaffolds, both with or without inclusion of pre-seeded hMSCs, led to significant increases in defect mineral formation at all time points and increased mechanical properties compared with controls. This study thus presents a novel acellular bone-graft-free endogenous repair therapy for orthotopic tissue-engineered bone regeneration.

  7. Resistance Evaluation of Radish (Raphanus sativus L. Inbred Lines against Turnip mosaic virus

    Directory of Open Access Journals (Sweden)

    Ju-Yeon Yoon

    2017-03-01

    Full Text Available Leaves of twenties radish (Raphanus sativus L. inbred lines were mechanically inoculated with Turnip mosaic virus (TuMV strain HY to evaluate TuMV resistance of the radish inbred lines. The inoculated radish plants were incubated at 22°C±3°C and resistance assessment was examined using symptom development for 4 weeks. Based on the reactions of differential radish inbred lines, 16 radish lines were produced mild mosaic, mottling, mosaic and severe mosaic symptoms by TuMV infection. These results were confirmed by RT-PCR analysis of TuMV coat protein gene, suggesting that TuMV is responsible for the disease symptoms. Four resistant radish lines did not induce systemic mosaic symptoms on upper leaves and chlorosis in stem tissues for 4 weeks, showing they were symptomless by 8 weeks. Further examination of TuMV infection in the 4 radish lines showed no TuMV infection in all systemic leaves. These results suggest that the 4 radish lines are highly resistant to TuMV.

  8. Natural minus-strand RNAs of alfalfa mosaic virus as in vitro templates for viral RNA polymerase. 3'-Terminal non-coded guanosine and coat protein are insufficient factors for full-size plus-strand synthesis

    NARCIS (Netherlands)

    Houwing, C.J.; Huis in 't Veld, M.; Zuidema, D.; Graaff, de M.; Jaspars, E.M.J.

    2001-01-01

    Replication complexes of alfalfa mosaic virus produce in vivo large quantities of plus-strand RNAs, but this production is fully dependent on the presence of coat protein. In order to study this process of RNA-dependent and coat protein-regulated RNA synthesis we have isolated the three natural

  9. Cultivated grapevines represent a symptomless reservoir for the transmission of hop stunt viroid to hop crops: 15 years of evolutionary analysis.

    Directory of Open Access Journals (Sweden)

    Yoko Kawaguchi-Ito

    Full Text Available Hop stunt was a mysterious disorder that first emerged in the 1940s in commercial hops in Japan. To investigate the origin of this disorder, we infected hops with natural Hop stunt viroid (HpSVd isolates derived from four host species (hop, grapevine, plum and citrus, which except for hop represent possible sources of the ancestral viroid. These plants were maintained for 15 years, then analyzed the HpSVd variants present. Here we show that the variant originally found in cultivated grapevines gave rise to various combinations of mutations at positions 25, 26, 54, 193, and 281. However, upon prolonged infection, these variants underwent convergent evolution resulting in a limited number of adapted mutants. Some of them showed nucleotide sequences identical to those currently responsible for hop stunt epidemics in commercial hops in Japan, China, and the United States. Therefore, these results indicate that we have successfully reproduced the original process by which a natural HpSVd variant naturally introduced into cultivated hops was able to mutate into the HpSVd variants that are currently present in commercial hops. Furthermore, and importantly, we have identified cultivated grapevines as a symptomless reservoir in which HSVd can evolve and be transmitted to hop crops to cause epidemics.

  10. In vitro evidence for RNA binding properties of the coat protein of prunus necrotic ringspot ilarvirus and their comparison to related and unrelated viruses.

    Science.gov (United States)

    Pallás, V; Sánchez-Navarro, J A; Díez, J

    1999-01-01

    The RNA binding properties of the prunus necrotic ringspot virus (PNRSV) coat protein (CP) were demonstrated by northwestern and dot-blot analyses. The capability to bind PNRSV RNA 4 was compared with viruses representing three different interactions prevailing in the assembly and architecture of virions. The results showed that cucumber mosaic virus (CMV) and PNRSV CPs, which stabilise their virions mainly through RNA-protein interactions bound PNRSV RNA 4 even at very high salt concentrations. The CP of cherry leaf roll nepovirus, whose virions are predominantly stabilised by protein-protein interactions did not bind even at the lowest salt concentration tested. Finally the CP of carnation mottle carmovirus, that has an intermediate position in which both RNA-protein and protein-protein interactions are equally important showed a salt-dependent RNA binding.

  11. Adaptive covariation between the coat and movement proteins of prunus necrotic ringspot virus.

    Science.gov (United States)

    Codoñer, Francisco M; Fares, Mario A; Elena, Santiago F

    2006-06-01

    The relative functional and/or structural importance of different amino acid sites in a protein can be assessed by evaluating the selective constraints to which they have been subjected during the course of evolution. Here we explore such constraints at the linear and three-dimensional levels for the movement protein (MP) and coat protein (CP) encoded by RNA 3 of prunus necrotic ringspot ilarvirus (PNRSV). By a maximum-parsimony approach, the nucleotide sequences from 46 isolates of PNRSV varying in symptomatology, host tree, and geographic origin have been analyzed and sites under different selective pressures have been identified in both proteins. We have also performed covariation analyses to explore whether changes in certain amino acid sites condition subsequent variation in other sites of the same protein or the other protein. These covariation analyses shed light on which particular amino acids should be involved in the physical and functional interaction between MP and CP. Finally, we discuss these findings in the light of what is already known about the implication of certain sites and domains in structure and protein-protein and RNA-protein interactions.

  12. Field and laboratory investigations of inactivation of viruses (PRD1 and MS2) attached to iron oxide-coated quartz san

    Science.gov (United States)

    Ryan, Joseph N.; Harvey, Ronald W.; Metge, David W.; Elimelech, Menachem; Navigato, Theresa; Pieper, Ann P.

    2002-01-01

    Field and laboratory experiments were conducted to investigate inactivation of viruses attached to mineral surfaces. In a natural gradient transport field experiment, bacteriophage PRD1, radiolabeled with 32P, was injected into a ferric oxyhydroxide-coated sand aquifer with bromide and linear alkylbenzene sulfonates. In a zone of the aquifer contaminated by secondary sewage infiltration, small fractions of infective and 32P-labeled PRD1 broke through with the bromide tracer, followed by the slow release of 84% of the 32P activity and only 0.011% of the infective PRD1. In the laboratory experiments, the inactivation of PRD1, labeled with 35S (protein capsid), and MS2, dual radiolabeled with 35S (protein capsid) and 32P (nucleic acid), was monitored in the presence of groundwater and sediment from the contaminated zone of the field site. Release of infective viruses decreased at a much faster rate than release of the radiolabels, indicating that attached viruses were undergoing surface inactivation. Disparities between 32P and35S release suggest that the inactivated viruses were released in a disintegrated state. Comparison of estimated solution and surface inactivation rates indicates solution inactivation is ∼3 times as fast as surface inactivation. The actual rate of surface inactivation may be substantially underestimated owing to slow release of inactivated viruses.

  13. Minor Coat and Heat Shock Proteins Are Involved in the Binding of Citrus Tristeza Virus to the Foregut of Its Aphid Vector, Toxoptera citricida.

    Science.gov (United States)

    Killiny, N; Harper, S J; Alfaress, S; El Mohtar, C; Dawson, W O

    2016-11-01

    Vector transmission is a critical stage in the viral life cycle, yet for most plant viruses how they interact with their vector is unknown or is explained by analogy with previously described relatives. Here we examined the mechanism underlying the transmission of citrus tristeza virus (CTV) by its aphid vector, Toxoptera citricida, with the objective of identifying what virus-encoded proteins it uses to interact with the vector. Using fluorescently labeled virions, we demonstrated that CTV binds specifically to the lining of the cibarium of the aphid. Through in vitro competitive binding assays between fluorescent virions and free viral proteins, we determined that the minor coat protein is involved in vector interaction. We also found that the presence of two heat shock-like proteins, p61 and p65, reduces virion binding in vitro Additionally, treating the dissected mouthparts with proteases did not affect the binding of CTV virions. In contrast, chitinase treatment reduced CTV binding to the foregut. Finally, competition with glucose, N-acetyl-β-d-glucosamine, chitobiose, and chitotriose reduced the binding. These findings together suggest that CTV binds to the sugar moieties of the cuticular surface of the aphid cibarium, and the binding involves the concerted activity of three virus-encoded proteins. Limited information is known about the specific interactions between citrus tristeza virus and its aphid vectors. These interactions are important for the process of successful transmission. In this study, we localized the CTV retention site as the cibarium of the aphid foregut. Moreover, we demonstrated that the nature of these interactions is protein-carbohydrate binding. The viral proteins, including the minor coat protein and two heat shock proteins, bind to sugar moieties on the surface of the foregut. These findings will help in understanding the transmission mechanism of CTV by the aphid vector and may help in developing control strategies which interfere

  14. The specific transmission of Grapevine fanleaf virus by its nematode vector Xiphinema index is solely determined by the viral coat protein

    International Nuclear Information System (INIS)

    Andret-Link, Peggy; Schmitt-Keichinger, Corinne; Demangeat, Gerard; Komar, Veronique; Fuchs, Marc

    2004-01-01

    The viral determinants involved in the specific transmission of Grapevine fanleaf virus (GFLV) by its nematode vector Xiphinema index are located within the 513 C-terminal residues of the RNA2-encoded polyprotein, that is, the 9 C-terminal amino acids of the movement protein (2B MP ) and contiguous 504 amino acids of the coat protein (2C CP ) [Virology 291 (2001) 161]. To further delineate the viral determinants responsible for the specific spread, the four amino acids that are different within the 9 C-terminal 2B MP residues between GFLV and Arabis mosaic virus (ArMV), another nepovirus which is transmitted by Xiphinema diversicaudatum but not by X. index, were subjected to mutational analysis. Of the recombinant viruses derived from transcripts of GFLV RNA1 and RNA2 mutants that systemically infected herbaceous host plants, all with the 2C CP of GFLV were transmitted by X. index unlike none with the 2C CP of ArMV, regardless of the mutations within the 2B MP C-terminus. These results demonstrate that the coat protein is the sole viral determinant for the specific spread of GFLV by X. index

  15. Wheat streak mosaic virus coat protein is a host-specific long-distance transport determinant in oat

    Science.gov (United States)

    Viral determinants involved in systemic infection of hosts by monocot-infecting plant viruses are poorly understood. Wheat streak mosaic virus (WSMV, genus Tritimovirus, family Potyviridae) exclusively infects monocotyledonous crops such as wheat, oat, barley, maize, triticale, and rye. Previously, ...

  16. Wipes coated with a singlet-oxygen-producing photosensitizer are effective against human influenza virus but not against norovirus

    NARCIS (Netherlands)

    Verhaelen, Katharina; Bouwknegt, Martijn; Rutjes, Saskia; de Roda Husman, Ana Maria; Duizer, Erwin

    2014-01-01

    Transmission of enteric and respiratory viruses, including human norovirus (hNoV) and human influenza virus, may involve surfaces. In food preparation and health care settings, surfaces are cleaned with wipes; however, wiping may not efficiently reduce contamination or may even spread viruses,

  17. Au nanocrystals grown on a better-defined one-dimensional tobacco mosaic virus coated protein template genetically modified by a hexahistidine tag

    International Nuclear Information System (INIS)

    Liu Nan; Zhang Wei; Luo Zhaopeng; Zhai Niu; Zhang Hongfei; Li Zhonghao; Jiang Xingyi; Tang Gangling; Hu Qingyuan; Wang Chong; Tian Dandan

    2012-01-01

    In this paper, tobacco mosaic virus (TMV) coated protein (CP) was genetically modified by introducing a hexahistidine tag into it for a well-defined one-dimensional template, on which Au nanocrystals (NCs) were grown. The results showed that genetic modification could not only ameliorate the one-dimensional structure of the template, but also improve the growth density of Au NCs on the template. This indicated that genetic modification could be an effective method to modulate the structure of the TMVCP template-based nanocomposites allowing for a broader application of them. (paper)

  18. Implication of the C terminus of the Prunus necrotic ringspot virus movement protein in cell-to-cell transport and in its interaction with the coat protein.

    Science.gov (United States)

    Aparicio, Frederic; Pallás, Vicente; Sánchez-Navarro, Jesús

    2010-07-01

    The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is required for viral transport. Previous analysis with MPs of other members of the family Bromoviridae has shown that the C-terminal part of these MPs plays a critical role in the interaction with the cognate coat protein (CP) and in cell-to-cell transport. Bimolecular fluorescence complementation and overlay analysis confirm an interaction between the C-terminal 38 aa of PNRSV MP and its cognate CP. Mutational analysis of the C-terminal region of the PNRSV MP revealed that its C-terminal 38 aa are dispensable for virus transport, however, the 4 aa preceding the dispensable C terminus are necessary to target the MP to the plasmodesmata and for the functionality of the protein. The capacity of the PNRSV MP to use either a CP-dependent or a CP-independent cell-to-cell transport is discussed.

  19. In vitro and in vivo mapping of the Prunus necrotic ringspot virus coat protein C-terminal dimerization domain by bimolecular fluorescence complementation.

    Science.gov (United States)

    Aparicio, Frederic; Sánchez-Navarro, Jesús A; Pallás, Vicente

    2006-06-01

    Interactions between viral proteins are critical for virus viability. Bimolecular fluorescent complementation (BiFC) technique determines protein interactions in real-time under almost normal physiological conditions. The coat protein (CP) of Prunus necrotic ringspot virus is required for multiple functions in its replication cycle. In this study, the region involved in CP dimerization has been mapped by BiFC in both bacteria and plant tissue. Full-length and C-terminal deleted forms of the CP gene were fused in-frame to the N- and C-terminal fragments of the yellow fluorescent protein. The BiFC analysis showed that a domain located between residues 9 and 27 from the C-end plays a critical role in dimerization. The importance of this C-terminal region in dimer formation and the applicability of the BiFC technique to analyse viral protein interactions are discussed.

  20. Genetic variation of coat protein gene among the isolates of Rice tungro spherical virus from tungro-endemic states of the India.

    Science.gov (United States)

    Mangrauthia, Satendra K; Malathi, P; Agarwal, Surekha; Ramkumar, G; Krishnaveni, D; Neeraja, C N; Madhav, M Sheshu; Ladhalakshmi, D; Balachandran, S M; Viraktamath, B C

    2012-06-01

    Rice tungro disease, one of the major constraints to rice production in South and Southeast Asia, is caused by a combination of two viruses: Rice tungro spherical virus (RTSV) and Rice tungro bacilliform virus (RTBV). The present study was undertaken to determine the genetic variation of RTSV population present in tungro endemic states of Indian subcontinent. Phylogenetic analysis based on coat protein sequences showed distinct divergence of Indian RTSV isolates into two groups; one consisted isolates from Hyderabad (Andhra Pradesh), Cuttack (Orissa), and Puducherry and another from West Bengal, Coimbatore (Tamil Nadu), and Kanyakumari (Tamil Nadu). The results obtained from phylogenetic study were further supported with the SNPs (single nucleotide polymorphism), INDELs (insertion and deletion) and evolutionary distance analysis. In addition, sequence difference count matrix revealed 2-68 nucleotides differences among all the Indian RTSV isolates taken in this study. However, at the protein level these differences were not significant as revealed by Ka/Ks ratio calculation. Sequence identity at nucleotide and amino acid level was 92-100% and 97-100%, respectively, among Indian isolates of RTSV. Understanding of the population structure of RTSV from tungro endemic regions of India would potentially provide insights into the molecular diversification of this virus.

  1. Hibiscus Chlorotic Ringspot Virus Coat Protein Is Essential for Cell-to-Cell and Long-Distance Movement but Not for Viral RNA Replication

    Science.gov (United States)

    Niu, Shengniao; Gil-Salas, Francisco M.; Tewary, Sunil Kumar; Samales, Ashwin Kuppusamy; Johnson, John; Swaminathan, Kunchithapadam; Wong, Sek-Man

    2014-01-01

    Hibiscus chlorotic ringspot virus (HCRSV) is a member of the genus Carmovirus in the family Tombusviridae. In order to study its coat protein (CP) functions on virus replication and movement in kenaf (Hibiscus cannabinus L.), two HCRSV mutants, designated as p2590 (A to G) in which the first start codon ATG was replaced with GTG and p2776 (C to G) in which proline 63 was replaced with alanine, were constructed. In vitro transcripts of p2590 (A to G) were able to replicate to a similar level as wild type without CP expression in kenaf protoplasts. However, its cell-to-cell movement was not detected in the inoculated kenaf cotyledons. Structurally the proline 63 in subunit C acts as a kink for β-annulus formation during virion assembly. Progeny of transcripts derived from p2776 (C to G) was able to move from cell-to-cell in inoculated cotyledons but its long-distance movement was not detected. Virions were not observed in partially purified mutant virus samples isolated from 2776 (C to G) inoculated cotyledons. Removal of the N-terminal 77 amino acids of HCRSV CP by trypsin digestion of purified wild type HCRSV virions resulted in only T = 1 empty virus-like particles. Taken together, HCRSV CP is dispensable for viral RNA replication but essential for cell-to-cell movement, and virion is required for the virus systemic movement. The proline 63 is crucial for HCRSV virion assembly in kenaf plants and the N-terminal 77 amino acids including the β-annulus domain is required in T = 3 assembly in vitro. PMID:25402344

  2. Hibiscus chlorotic ringspot virus coat protein is essential for cell-to-cell and long-distance movement but not for viral RNA replication.

    Directory of Open Access Journals (Sweden)

    Shengniao Niu

    Full Text Available Hibiscus chlorotic ringspot virus (HCRSV is a member of the genus Carmovirus in the family Tombusviridae. In order to study its coat protein (CP functions on virus replication and movement in kenaf (Hibiscus cannabinus L., two HCRSV mutants, designated as p2590 (A to G in which the first start codon ATG was replaced with GTG and p2776 (C to G in which proline 63 was replaced with alanine, were constructed. In vitro transcripts of p2590 (A to G were able to replicate to a similar level as wild type without CP expression in kenaf protoplasts. However, its cell-to-cell movement was not detected in the inoculated kenaf cotyledons. Structurally the proline 63 in subunit C acts as a kink for β-annulus formation during virion assembly. Progeny of transcripts derived from p2776 (C to G was able to move from cell-to-cell in inoculated cotyledons but its long-distance movement was not detected. Virions were not observed in partially purified mutant virus samples isolated from 2776 (C to G inoculated cotyledons. Removal of the N-terminal 77 amino acids of HCRSV CP by trypsin digestion of purified wild type HCRSV virions resulted in only T = 1 empty virus-like particles. Taken together, HCRSV CP is dispensable for viral RNA replication but essential for cell-to-cell movement, and virion is required for the virus systemic movement. The proline 63 is crucial for HCRSV virion assembly in kenaf plants and the N-terminal 77 amino acids including the β-annulus domain is required in T = 3 assembly in vitro.

  3. Marburg virus VP35 can both fully coat the backbone and cap the ends of dsRNA for interferon antagonism.

    Directory of Open Access Journals (Sweden)

    Shridhar Bale

    2012-09-01

    Full Text Available Filoviruses, including Marburg virus (MARV and Ebola virus (EBOV, cause fatal hemorrhagic fever in humans and non-human primates. All filoviruses encode a unique multi-functional protein termed VP35. The C-terminal double-stranded (dsRNA-binding domain (RBD of VP35 has been implicated in interferon antagonism and immune evasion. Crystal structures of the VP35 RBD from two ebolaviruses have previously demonstrated that the viral protein caps the ends of dsRNA. However, it is not yet understood how the expanses of dsRNA backbone, between the ends, are masked from immune surveillance during filovirus infection. Here, we report the crystal structure of MARV VP35 RBD bound to dsRNA. In the crystal structure, molecules of dsRNA stack end-to-end to form a pseudo-continuous oligonucleotide. This oligonucleotide is continuously and completely coated along its sugar-phosphate backbone by the MARV VP35 RBD. Analysis of dsRNA binding by dot-blot and isothermal titration calorimetry reveals that multiple copies of MARV VP35 RBD can indeed bind the dsRNA sugar-phosphate backbone in a cooperative manner in solution. Further, MARV VP35 RBD can also cap the ends of the dsRNA in solution, although this arrangement was not captured in crystals. Together, these studies suggest that MARV VP35 can both coat the backbone and cap the ends, and that for MARV, coating of the dsRNA backbone may be an essential mechanism by which dsRNA is masked from backbone-sensing immune surveillance molecules.

  4. Nucleotide and amino acid sequences of a coat protein of an Ukrainian isolate of Potato virus Y: comparison with homologous sequences of other isolates and phylogenetic analysis

    Directory of Open Access Journals (Sweden)

    Budzanivska I. G.

    2014-03-01

    Full Text Available Aim. Identification of the widespread Ukrainian isolate(s of PVY (Potato virus Y in different potato cultivars and subsequent phylogenetic analysis of detected PVY isolates based on NA and AA sequences of coat protein. Methods. ELISA, RT-PCR, DNA sequencing and phylogenetic analysis. Results. PVY has been identified serologically in potato cultivars of Ukrainian selection. In this work we have optimized a method for total RNA extraction from potato samples and offered a sensitive and specific PCR-based test system of own design for diagnostics of the Ukrainian PVY isolates. Part of the CP gene of the Ukrainian PVY isolate has been sequenced and analyzed phylogenetically. It is demonstrated that the Ukrainian isolate of Potato virus Y (CP gene has a higher percentage of homology with the recombinant isolates (strains of this pathogen (approx. 98.8– 99.8 % of homology for both nucleotide and translated amino acid sequences of the CP gene. The Ukrainian isolate of PVY is positioned in the separate cluster together with the isolates found in Syria, Japan and Iran; these isolates possibly have common origin. The Ukrainian PVY isolate is confirmed to be recombinant. Conclusions. This work underlines the need and provides the means for accurate monitoring of Potato virus Y in the agroecosystems of Ukraine. Most importantly, the phylogenetic analysis demonstrated the recombinant nature of this PVY isolate which has been attributed to the strain group O, subclade N:O.

  5. Initial infection of roots and leaves reveals different resistance phenotypes associated with coat protein gene-mediated resistance to Potato mop-top virus.

    Science.gov (United States)

    Germundsson, Anna; Sandgren, Maria; Barker, Hugh; Savenkov, Eugene I; Valkonen, Jari P T

    2002-05-01

    Resistance to the pomovirus Potato mop-top virus (PMTV) was studied in potato (Solanum tuberosum cv. Saturna) and Nicotiana benthamiana transformed with the coat protein (CP) gene of PMTV. The incidence of PMTV infections was reduced in tubers of the CP-transgenic potatoes grown in the field in soil infested with the viruliferous vector, Spongospora subterranea. However, in those tubers that were infected, all three virus RNAs were detected and virus titres were high. The CP-transgenic N. benthamiana plants were inoculated with PMTV using two methods. Following mechanical inoculation of leaves, no RNA 3 (the CP-encoding RNA homologous to the transgene) was detected in leaves, but in some plants low amounts of RNA 3 were detected in roots; RNA 2 was readily detected in leaves and roots of several plants. Inoculation of roots using viruliferous S. subterranea resulted in infection of roots in all plants and the three PMTV RNAs were detected. However, no systemic movement of PMTV from roots to the above-ground parts was observed, indicating a novel expression of resistance. These data indicate that the CP gene-mediated resistance to PMTV specifically restricts accumulation of PMTV RNA 3, and is more effective in leaves than roots. Furthermore, expression of resistance is different depending on whether leaves or roots are inoculated. Data do not exclude the possibility that both a protein-mediated and an RNA-mediated resistance mechanism are involved.

  6. Incidence of Lettuce mosaic virus in lettuce and its detection by polyclonal antibodies produced against recombinant coat protein expressed in Escherichia coli.

    Science.gov (United States)

    Sharma, Prachi; Sharma, Susheel; Singh, Jasvir; Saha, Swati; Baranwal, V K

    2016-04-01

    Lettuce mosaic virus (LMV), a member of the genus Potyvirus of family Potyviridae, causes mosaic disease in lettuce has recently been identified in India. The virus is seed borne and secondary infection occurs through aphids. To ensure virus freedom in seeds it is important to develop diagnostic tools, for serological methods the production of polyclonal antibodies is a prerequisite. The coat protein (CP) gene of LMV was amplified, cloned and expressed using pET-28a vector in Escherichia coli BL21DE3 competent cells. The LMV CP was expressed as a fusion protein containing a fragment of the E. coli His tag. The LMV CP/His protein reacted positively with a commercial antiserum against LMV in an immunoblot assay. Polyclonal antibodies purified from serum of rabbits immunized with the fusion protein gave positive results when LMV infected lettuce (Lactuca sativa) was tested at 1:1000 dilution in PTA-ELISA. These were used for specific detection of LMV in screening lettuce accessions. The efficacy of the raised polyclonal antiserum was high and it can be utilized in quarantine and clean seed production. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. The coat protein of Alternanthera mosaic virus is the elicitor of a temperature-sensitive systemic necrosis in Nicotiana benthamiana, and interacts with a host boron transporter protein

    International Nuclear Information System (INIS)

    Lim, Hyoun-Sub; Nam, Jiryun; Seo, Eun-Young; Nam, Moon; Vaira, Anna Maria; Bae, Hanhong; Jang, Chan-Yong; Lee, Cheol Ho; Kim, Hong Gi; Roh, Mark; Hammond, John

    2014-01-01

    Different isolates of Alternanthera mosaic virus (AltMV; Potexvirus), including four infectious clones derived from AltMV-SP, induce distinct systemic symptoms in Nicotiana benthamiana. Virus accumulation was enhanced at 15 °C compared to 25 °C; severe clone AltMV 3-7 induced systemic necrosis (SN) and plant death at 15 °C. No interaction with potexvirus resistance gene Rx was detected, although SN was ablated by silencing of SGT1, as for other cases of potexvirus-induced necrosis. Substitution of AltMV 3-7 coat protein (CP SP ) with that from AltMV-Po (CP Po ) eliminated SN at 15 °C, and ameliorated symptoms in Alternanthera dentata and soybean. Substitution of only two residues from CP Po [either MN(13,14)ID or LA(76,77)IS] efficiently ablated SN in N. benthamiana. CP SP but not CP Po interacted with Arabidopsis boron transporter protein AtBOR1 by yeast two-hybrid assay; N. benthamiana homolog NbBOR1 interacted more strongly with CP SP than CP Po in bimolecular fluorescence complementation, and may affect recognition of CP as an elicitor of SN. - Highlights: • Alternanthera mosaic virus CP is an elicitor of systemic necrosis in N. benthamiana. • Virus-induced systemic necrosis is enhanced at 15 °C compared to 25 °C. • Induction of systemic necrosis is dependent on as few as two CP amino acid residues. • These residues are at subunit interfaces within the same turn of the virion helix. • Inducer/non-inducer CPs interact differentially with a boron transporter protein

  8. The coat protein of Alternanthera mosaic virus is the elicitor of a temperature-sensitive systemic necrosis in Nicotiana benthamiana, and interacts with a host boron transporter protein

    Energy Technology Data Exchange (ETDEWEB)

    Lim, Hyoun-Sub, E-mail: hyounlim@cnu.ac.kr [Department of Applied Biology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Nam, Jiryun, E-mail: jilyoon@naver.com [Department of Applied Biology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Seo, Eun-Young, E-mail: sey22@cnu.ac.kr [Department of Applied Biology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Nam, Moon, E-mail: moonlit51@cnu.ac.kr [Department of Applied Biology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Vaira, Anna Maria, E-mail: a.vaira@ivv.cnr.it [Floral and Nursery Plants Research Unit, US National Arboretum, USDA-ARS, 10300 Baltimore Avenue B-010A, Beltsville, MD 20705 (United States); Istituto di Virologia Vegetale, CNR, Strada delle Cacce 73, Torino 10135 (Italy); Bae, Hanhong, E-mail: hanhongbae@ynu.ac.kr [School of Biotechnology, Yeungnam University, Geongsan 712-749 (Korea, Republic of); Jang, Chan-Yong, E-mail: sunbispirit@gmail.com [Department of Applied Biology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Lee, Cheol Ho, E-mail: chlee1219@hanmail.net [Department of Chemical and Biological Engineering, Seokyoung University, Seoul 136-704 (Korea, Republic of); Kim, Hong Gi, E-mail: hgkim@cnu.ac.kr [Department of Applied Biology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Roh, Mark, E-mail: marksroh@gmail.com [Floral and Nursery Plants Research Unit, US National Arboretum, USDA-ARS, 10300 Baltimore Avenue B-010A, Beltsville, MD 20705 (United States); Laboratory of Floriculture and Plant Physiology, School of Bio-Resource Science, Dankook University, Cheonan, Chungnam 330-714 (Korea, Republic of); Hammond, John, E-mail: john.hammond@ars.usda.gov [Floral and Nursery Plants Research Unit, US National Arboretum, USDA-ARS, 10300 Baltimore Avenue B-010A, Beltsville, MD 20705 (United States)

    2014-03-15

    Different isolates of Alternanthera mosaic virus (AltMV; Potexvirus), including four infectious clones derived from AltMV-SP, induce distinct systemic symptoms in Nicotiana benthamiana. Virus accumulation was enhanced at 15 °C compared to 25 °C; severe clone AltMV 3-7 induced systemic necrosis (SN) and plant death at 15 °C. No interaction with potexvirus resistance gene Rx was detected, although SN was ablated by silencing of SGT1, as for other cases of potexvirus-induced necrosis. Substitution of AltMV 3-7 coat protein (CP{sub SP}) with that from AltMV-Po (CP{sub Po}) eliminated SN at 15 °C, and ameliorated symptoms in Alternanthera dentata and soybean. Substitution of only two residues from CP{sub Po} [either MN(13,14)ID or LA(76,77)IS] efficiently ablated SN in N. benthamiana. CP{sub SP} but not CP{sub Po} interacted with Arabidopsis boron transporter protein AtBOR1 by yeast two-hybrid assay; N. benthamiana homolog NbBOR1 interacted more strongly with CP{sub SP} than CP{sub Po} in bimolecular fluorescence complementation, and may affect recognition of CP as an elicitor of SN. - Highlights: • Alternanthera mosaic virus CP is an elicitor of systemic necrosis in N. benthamiana. • Virus-induced systemic necrosis is enhanced at 15 °C compared to 25 °C. • Induction of systemic necrosis is dependent on as few as two CP amino acid residues. • These residues are at subunit interfaces within the same turn of the virion helix. • Inducer/non-inducer CPs interact differentially with a boron transporter protein.

  9. Diverse amino acid changes at specific positions in the N-terminal region of the coat protein allow Plum pox virus to adapt to new hosts.

    Science.gov (United States)

    Carbonell, Alberto; Maliogka, Varvara I; Pérez, José de Jesús; Salvador, Beatriz; León, David San; García, Juan Antonio; Simón-Mateo, Carmen

    2013-10-01

    Plum pox virus (PPV)-D and PPV-R are two isolates from strain D of PPV that differ in host specificity. Previous analyses of chimeras originating from PPV-R and PPV-D suggested that the N terminus of the coat protein (CP) includes host-specific pathogenicity determinants. Here, these determinants were mapped precisely by analyzing the infectivity in herbaceous and woody species of chimeras containing a fragment of the 3' region of PPV-D (including the region coding for the CP) in a PPV-R backbone. These chimeras were not infectious in Prunus persica, but systemically infected Nicotiana clevelandii and N. benthamiana when specific amino acids were modified or deleted in a short 30-amino-acid region of the N terminus of the CP. Most of these mutations did not reduce PPV fitness in Prunus spp. although others impaired systemic infection in this host. We propose a model in which the N terminus of the CP, highly relevant for virus systemic movement, is targeted by a host defense mechanism in Nicotiana spp. Mutations in this short region allow PPV to overcome the defense response in this host but can compromise the efficiency of PPV systemic movement in other hosts such as Prunus spp.

  10. Molecular modeling and in-silico engineering of Cardamom mosaic virus coat protein for the presentation of immunogenic epitopes of Leptospira LipL32.

    Science.gov (United States)

    Kumar, Vikram; Damodharan, S; Pandaranayaka, Eswari P J; Madathiparambil, Madanan G; Tennyson, Jebasingh

    2016-01-01

    Expression of Cardamom mosaic virus (CdMV) coat protein (CP) in E. coli forms virus-like particles. In this study, the structure of CdMV CP was predicted and used as a platform to display epitopes of the most abundant surface-associated protein, LipL32 of Leptospira at C, N, and both the termini of CdMV CP. In silico, we have mapped sequential and conformational B-cell epitopes from the crystal structure of LipL32 of Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130 using IEDB Elipro, ABCpred, BCPRED, and VaxiJen servers. Our results show that the epitopes displayed at the N-terminus of CdMV CP are promising vaccine candidates as compared to those displayed at the C-terminus or at both the termini. LipL32 epitopes, EP2, EP3, EP4, and EP6 are found to be promising B-cell epitopes for vaccine development. Based on the type of amino acids, length, surface accessibility, and docking energy with CdMV CP model, the order of antigenicity of the LipL32 epitopes was found to be EP4 > EP3 > EP2 > EP6.

  11. A Sequence-Independent, Unstructured Internal Ribosome Entry Site Is Responsible for Internal Expression of the Coat Protein of Turnip Crinkle Virus.

    Science.gov (United States)

    May, Jared; Johnson, Philip; Saleem, Huma; Simon, Anne E

    2017-04-15

    To maximize the coding potential of viral genomes, internal ribosome entry sites (IRES) can be used to bypass the traditional requirement of a 5' cap and some/all of the associated translation initiation factors. Although viral IRES typically contain higher-order RNA structure, an unstructured sequence of about 84 nucleotides (nt) immediately upstream of the Turnip crinkle virus (TCV) coat protein (CP) open reading frame (ORF) has been found to promote internal expression of the CP from the genomic RNA (gRNA) both in vitro and in vivo An absence of extensive RNA structure was predicted using RNA folding algorithms and confirmed by selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) RNA structure probing. Analysis of the IRES region in vitro by use of both the TCV gRNA and reporter constructs did not reveal any sequence-specific elements but rather suggested that an overall lack of structure was an important feature for IRES activity. The CP IRES is A-rich, independent of orientation, and strongly conserved among viruses in the same genus. The IRES was dependent on eIF4G, but not eIF4E, for activity. Low levels of CP accumulated in vivo in the absence of detectable TCV subgenomic RNAs, strongly suggesting that the IRES was active in the gRNA in vivo Since the TCV CP also serves as the viral silencing suppressor, early translation of the CP from the viral gRNA is likely important for countering host defenses. Cellular mRNA IRES also lack extensive RNA structures or sequence conservation, suggesting that this viral IRES and cellular IRES may have similar strategies for internal translation initiation. IMPORTANCE Cap-independent translation is a common strategy among positive-sense, single-stranded RNA viruses for bypassing the host cell requirement of a 5' cap structure. Viral IRES, in general, contain extensive secondary structure that is critical for activity. In contrast, we demonstrate that a region of viral RNA devoid of extensive secondary

  12. RNA packaging of MRFV virus-like particles: The interplay between RNA pools and capsid coat protein

    Science.gov (United States)

    Virus-like particles (VLPs) can be produced through self-assembly of capsid protein (CP) into particles with discrete shapes and sizes and containing different types of RNA molecules. The general principle that governs particle assembly and RNA packaging is determined by unique interactions between ...

  13. Development of transgenic papayas expressing the coat protein gene from a Brazilian isolate of Papaya ringspot virus (PRSV) = Desenvolvimento de mamoeiros transgênicos resistentes a vírus expressando o gene da capa protéica de um isolado brasileiro de Papaya ringspot virus

    NARCIS (Netherlands)

    Souza, M.T.; Níckel, O.; Gonsalves, D.

    2005-01-01

    Translatable and nontranslatable versions of the coat protein (cp) gene of a Papaya ringspot virus (PRSV) isolate collected in the state of Bahia, Brazil, were engineered for expression in Sunrise and Sunset Solo varieties of papaya (Carica papaya). The biolistic system was used to transform

  14. Production of polyclonal antisera using recombinant coat proteins of Grapevine leafroll-associated virus 2 and Grapevine virus B Produção de anti-soros policlonais a partir de proteínas capsidiais recombinantes de Grapevine leafroll-associated virus 2 e Grapevine virus B

    Directory of Open Access Journals (Sweden)

    Paula Radaelli

    2008-10-01

    Full Text Available The objective of this work was to produce and characterize specific antisera against Brazilian isolates of Grapevine leafroll-associated virus 2 (GLRaV-2 and Grapevine virus B (GVB, developed from expressed coat proteins (CPs in Escherichia coli, and to test their possible use for the detection of these two viruses in diseased grapevines. The coat protein (CP genes were RT-PCR-amplified, cloned and sequenced. The CP genes were subsequently subcloned, and the recombinant plasmids were used to transform E. coli cells and express the coat proteins. The recombinant coat proteins were purified, and their identities were confirmed by SDS-PAGE and Western blot and used for rabbit immunizations. Antisera raised against these proteins were able to recognize the corresponding recombinant proteins in Western blots and to detect GLRaV-2 and GVB in infected grapevine tissues, by indirect ELISA, discriminating healthy and infected grapevines with absorbances (A405 of 0.08/1.15 and 0.12/1.30, respectively. Expressing CP genes can yield high amount of viral protein with high antigenicity, and GLRaV-2 and GVB antisera obtained in this study can allow reliable virus disease diagnosis.O objetivo deste trabalho foi produzir e caracterizar anti-soros específicos contra isolados brasileiros do Vírus do enrolamento-da-folha da videira 2 (GLRaV-2 e do Vírus B da videira (GVB, desenvolvidos a partir das proteínas capsidiais expressas em Escherichia coli, e testar seu possível uso para a detecção destes dois vírus em videiras infectadas. Os genes da proteína capsidial (CP foram amplificados via RT-PCR, clonados e seqüenciados. Foram, subseqüentemente, subclonados, e os plasmídeos recombinantes foram empregados na transformação das células de E. coli e na expressão das proteínas capsidiais. As proteínas capsidiais recombinantes foram purificadas, e suas identidades foram confirmadas em SDS-PAGE e "Western blot" e utilizadas para imunizar coelhos. Os anti

  15. O-GlcNAc modification of the coat protein of the potyvirus Plum pox virus enhances viral infection.

    Science.gov (United States)

    Pérez, José de Jesús; Udeshi, Namrata D; Shabanowitz, Jeffrey; Ciordia, Sergio; Juárez, Silvia; Scott, Cheryl L; Olszewski, Neil E; Hunt, Donald F; García, Juan Antonio

    2013-08-01

    O-GlcNAcylation is a dynamic protein modification which has been studied mainly in metazoans. We reported previously that an Arabidopsis thaliana O-GlcNAc transferase modifies at least two threonine residues of the Plum pox virus (PPV) capsid protein (CP). Now, six additional residues were shown to be involved in O-GlcNAc modification of PPV CP. CP O-GlcNAcylation was abolished in the PPV CP7-T/A mutant, in which seven threonines were mutated. PPV CP7-T/A infected Nicotiana clevelandii, Nicotiana benthamiana, and Prunus persica without noticeable defects. However, defects in infection of A. thaliana were readily apparent. In mixed infections of wild-type arabidopsis, the CP7-T/A mutant was outcompeted by wild-type virus. These results indicate that CP O-GlcNAcylation has a major role in the infection process. O-GlcNAc modification may have a role in virion assembly and/or stability as the CP of PPV CP7-T/A was more sensitive to protease digestion than that of the wild-type virus. Copyright © 2013 Elsevier Inc. All rights reserved.

  16. Chitosan-coated poly(lactic-co-glycolic acid nanoparticles as an efficient delivery system for Newcastle disease virus DNA vaccine

    Directory of Open Access Journals (Sweden)

    Zhao K

    2014-09-01

    Full Text Available Kai Zhao,1,* Yang Zhang,1,2,* Xiaoyan Zhang,1,* Ci Shi,1,2 Xin Wang,1 Xiaohua Wang,1 Zheng Jin,3 Shangjin Cui2 1Laboratory of Microbiology, School of Life Science, Heilongjiang University, 2Division of Swine Infectious Diseases, State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute, 3Key Laboratory of Chemical Engineering Process and Technology for High-efficiency Conversion, Heilongjiang University, Harbin, People’s Republic of China *These authors contributed equally to this work Abstract: We determined the efficacy and safety of chitosan (CS-coated poly(lactic-co-glycolic acid (PLGA nanoparticles (NPs as a delivery system for a vaccine to protect chickens against Newcastle disease virus (NDV. The newly constructed vaccine contained DNA (the F gene of NDV. The Newcastle disease virus (NDV F gene deoxyribonucleic acid (DNA plasmid (pFDNA-CS/PLGA-NPs were spherical (diameter =699.1±5.21 nm [mean ± ­standard deviation] and smooth, with an encapsulation efficiency of 98.1% and a Zeta potential of +6.35 mV. An in vitro release assay indicated that CS controlled the burst release of plasmid DNA, such that up to 67.4% of the entire quantity of plasmid DNA was steadily released from the pFDNA-CS/PLGA-NPs. An in vitro expression assay indicated that the expression of nanoparticles (NPs was maintained in the NPs. In an immunization test with specific pathogen-free chickens, the pFDNA-CS/PLGA-NPs induced stronger cellular, humoral, and mucosal immune responses than the plasmid DNA vaccine alone. The pFDNA-CS/PLGA-NPs did not harm 293T cells in an in vitro assay and did not harm chickens in an in vivo assay. Overall, the results indicated that CS-coated PLGA NPs can serve as an efficient and safe mucosal immune delivery system for NDV DNA vaccine.Keywords: mucosal immune delivery system, immune effect

  17. The coat protein of prunus necrotic ringspot virus specifically binds to and regulates the conformation of its genomic RNA.

    Science.gov (United States)

    Aparicio, Frederic; Vilar, Marçal; Perez-Payá, Enrique; Pallás, Vicente

    2003-08-15

    Binding of coat protein (CP) to the 3' nontranslated region (3'-NTR) of viral RNAs is a crucial requirement to establish the infection of Alfamo- and Ilarviruses. In vitro binding properties of the Prunus necrotic ringspot ilarvirus (PNRSV) CP to the 3'-NTR of its genomic RNA using purified E. coli- expressed CP and different synthetic peptides corresponding to a 26-residue sequence near the N-terminus were investigated by electrophoretic mobility shift assays. PNRSV CP bound to, at least, three different sites existing on the 3'-NTR. Moreover, the N-terminal region between amino acid residues 25 to 50 of the protein could function as an independent RNA-binding domain. Single exchange of some arginine residues by alanine eliminated the RNA-interaction capacity of the synthetic peptides, consistent with a crucial role for Arg residues common to many RNA-binding proteins possessing Arg-rich domains. Circular dichroism spectroscopy revealed that the RNA conformation is altered when amino-terminal CP peptides bind to the viral RNA. Finally, mutational analysis of the 3'-NTR suggested the presence of a pseudoknotted structure at this region on the PNRSV RNA that, when stabilized by the presence of Mg(2+), lost its capability to bind the coat protein. The existence of two mutually exclusive conformations for the 3'-NTR of PNRSV strongly suggests a similar regulatory mechanism at the 3'-NTR level in Alfamo- and Ilarvirus genera.

  18. The coat protein of prunus necrotic ringspot virus specifically binds to and regulates the conformation of its genomic RNA

    International Nuclear Information System (INIS)

    Aparicio, Frederic; Vilar, Marcal; Perez-Paya, Enrique; Pallas, Vicente

    2003-01-01

    Binding of coat protein (CP) to the 3' nontranslated region (3'-NTR) of viral RNAs is a crucial requirement to establish the infection of Alfamo- and Ilarviruses. In vitro binding properties of the Prunus necrotic ringspot ilarvirus (PNRSV) CP to the 3'-NTR of its genomic RNA using purified E. coli- expressed CP and different synthetic peptides corresponding to a 26-residue sequence near the N-terminus were investigated by electrophoretic mobility shift assays. PNRSV CP bound to, at least, three different sites existing on the 3'-NTR. Moreover, the N-terminal region between amino acid residues 25 to 50 of the protein could function as an independent RNA-binding domain. Single exchange of some arginine residues by alanine eliminated the RNA-interaction capacity of the synthetic peptides, consistent with a crucial role for Arg residues common to many RNA-binding proteins possessing Arg-rich domains. Circular dichroism spectroscopy revealed that the RNA conformation is altered when amino-terminal CP peptides bind to the viral RNA. Finally, mutational analysis of the 3'-NTR suggested the presence of a pseudoknotted structure at this region on the PNRSV RNA that, when stabilized by the presence of Mg 2+ , lost its capability to bind the coat protein. The existence of two mutually exclusive conformations for the 3'-NTR of PNRSV strongly suggests a similar regulatory mechanism at the 3'-NTR level in Alfamo- and Ilarvirus genera

  19. Rapid, highly sensitive detection of herpes simplex virus-1 using multiple antigenic peptide-coated superparamagnetic beads.

    Science.gov (United States)

    Ran, Ying-Fen; Fields, Conor; Muzard, Julien; Liauchuk, Viktoryia; Carr, Michael; Hall, William; Lee, Gil U

    2014-12-07

    A sensitive, rapid, and label free magnetic bead aggregation (MBA) assay has been developed that employs superparamagnetic (SPM) beads to capture, purify, and detect model proteins and the herpes simplex virus (HSV). The MBA assay is based on monitoring the aggregation state of a population of SPM beads using light scattering of individual aggregates. A biotin-streptavidin MBA assay had a femtomolar (fM) level sensitivity for analysis times less than 10 minutes, but the response of the assay becomes nonlinear at high analyte concentrations. A MBA assay for the detection of HSV-1 based on a novel peptide probe resulted in the selective detection of the virus at concentrations as low as 200 viral particles (vp) per mL in less than 30 min. We define the parameters that determine the sensitivity and response of the MBA assay, and the mechanism of enhanced sensitivity of the assay for HSV. The speed, relatively low cost, and ease of application of the MBA assay promise to make it useful for the identification of viral load in resource-limited and point-of-care settings where molecular diagnostics cannot be easily implemented.

  20. Mutations that alter a conserved element upstream of the potato virus X triple block and coat protein genes affect subgenomic RNA accumulation.

    Science.gov (United States)

    Kim, K H; Hemenway, C

    1997-05-26

    The putative subgenomic RNA (sgRNA) promoter regions upstream of the potato virus X (PVX) triple block and coat protein (CP) genes contain sequences common to other potexviruses. The importance of these sequences to PVX sgRNA accumulation was determined by inoculation of Nicotiana tabacum NT1 cell suspension protoplasts with transcripts derived from wild-type and modified PVX cDNA clones. Analyses of RNA accumulation by S1 nuclease digestion and primer extension indicated that a conserved octanucleotide sequence element and the spacing between this element and the start-site for sgRNA synthesis are critical for accumulation of the two major sgRNA species. The impact of mutations on CP sgRNA levels was also reflected in the accumulation of CP. In contrast, genomic minus- and plus-strand RNA accumulation were not significantly affected by mutations in these regions. Studies involving inoculation of tobacco plants with the modified transcripts suggested that the conserved octanucleotide element functions in sgRNA accumulation and some other aspect of the infection process.

  1. The Importance of the KR-Rich Region of the Coat Protein of Ourmia melon virus for Host Specificity, Tissue Tropism, and Interference With Antiviral Defense.

    Science.gov (United States)

    Rossi, Marika; Vallino, Marta; Abbà, Simona; Ciuffo, Marina; Balestrini, Raffaella; Genre, Andrea; Turina, Massimo

    2015-01-01

    The N-terminal region of the Ourmia melon virus (OuMV) coat protein (CP) contains a short lysine/arginine-rich (KR) region. By alanine scanning mutagenesis, we showed that the KR region influences pathogenicity and virulence of OuMV without altering viral particle assembly. A mutant, called OuMV6710, with three basic residue substitutions in the KR region, was impaired in the ability to maintain the initial systemic infection in Nicotiana benthamiana and to infect both cucumber and melon plants systemically. The integrity of this protein region was also crucial for encapsidation of viral genomic RNA; in fact, certain mutations within the KR region partially compromised the RNA encapsidation efficiency of the CP. In Arabidopsis thaliana Col-0, OuMV6710 was impaired in particle accumulation; however, this phenotype was abolished in dcl2/dcl4 and dcl2/dcl3/dcl4 Arabidopsis mutants defective for antiviral silencing. Moreover, in contrast to CPwt, in situ immunolocalization experiments indicated that CP6710 accumulates efficiently in the spongy mesophyll tissue of infected N. benthamiana and A. thaliana leaves but only occasionally infects palisade tissues. These results provided strong evidence of a crucial role for OuMV CP during viral infection and highlighted the relevance of the KR region in determining tissue tropism, host range, pathogenicity, and RNA affinity, which may be all correlated with a possible CP silencing-suppression activity.

  2. Clonagem e purificação de fragmento da proteína capsidial de Banana streak OL virus Cloning and purification of Banana streak OL virus coat protein fragment

    Directory of Open Access Journals (Sweden)

    Ricardo Lombardi

    2010-08-01

    Full Text Available O objetivo deste trabalho foi clonar e induzir a expressão de fragmento da proteína capsidial de Banana streak OL virus (BSOLV-CP em Escherichia coli, bem como purificar a proteína recombinante obtida. Empregou-se um par de iniciadores específicos para amplificar, em PCR, um fragmento de aproximadamente 390 pb, da região codificadora da porção central da BSOLV-CP. O fragmento obtido foi clonado em vetor pGEM-T Easy, subclonado em vetor pQE-30 e transformado em células de E. coli M15 (pREP4 por choque térmico. A expressão da proteína foi induzida por tiogalactopiranosídeo de isopropila (IPTG, e a proteína recombinante BSOLV-rcCP de 14 kDa foi detectada em Western blot e Dot blot. A expressão da proteína BSOLV-rcCP abre novas possibilidades para a obtenção de antígenos para a produção de antissoros contra o BSOLV.The objective of this work was to clone and to induce the expression of a fragment of Banana streak OL virus coat protein (BSOLV-CP in Escherichia coli, as well as to purify the obtained recombinant protein. Two specific primers were used for the PCR-amplification of approximately 390-bp fragment of the codifying region of the BSOLV-CP central portion. The obtained fragment was cloned in pGEM-T Easy vector, subcloned in pQE-30 expression vector and transformed into competent E. coli M15 (pREP4 cells by heat shock. The protein expression was induced by isopropyl thiogalactopyranoside (IPTG and the 14-kDa BSOLV-rcCP recombinant protein was detected in Western and Dot blotting. The expression of the BSOLV-rcCP protein enables new approaches to the obtention of antigens for the antisera production against BSOLV.

  3. Phylogeny of geminivirus coat protein sequences and digital PCR aid in identifying Spissistilus festinus (Say) as a vector of Grapevine red blotch-associated virus

    Science.gov (United States)

    Grapevine red blotch-associated virus (GRBaV) is a newly identified virus of grapevines, and a putative member of a new genus within the family Geminiviridae. This virus is associated with red blotch disease that was first reported in California in 2008. It affects the profitability of vineyards by ...

  4. The current incidence of viral disease in korean sweet potatoes and development of multiplex rt-PCR assays for simultaneous detection of eight sweet potato viruses.

    Science.gov (United States)

    Kwak, Hae-Ryun; Kim, Mi-Kyeong; Shin, Jun-Chul; Lee, Ye-Ji; Seo, Jang-Kyun; Lee, Hyeong-Un; Jung, Mi-Nam; Kim, Sun-Hyung; Choi, Hong-Soo

    2014-12-01

    Sweet potato is grown extensively from tropical to temperate regions and is an important food crop worldwide. In this study, we established detection methods for 17 major sweet potato viruses using single and multiplex RT-PCR assays. To investigate the current incidence of viral diseases, we collected 154 samples of various sweet potato cultivars showing virus-like symptoms from 40 fields in 10 Korean regions, and analyzed them by RT-PCR using specific primers for each of the 17 viruses. Of the 17 possible viruses, we detected eight in our samples. Sweet potato feathery mottle virus (SPFMV) and sweet potato virus C (SPVC) were most commonly detected, infecting approximately 87% and 85% of samples, respectively. Furthermore, Sweet potato symptomless virus 1 (SPSMV-1), Sweet potato virus G (SPVG), Sweet potato leaf curl virus (SPLCV), Sweet potato virus 2 ( SPV2), Sweet potato chlorotic fleck virus (SPCFV), and Sweet potato latent virus (SPLV) were detected in 67%, 58%, 47%, 41%, 31%, and 20% of samples, respectively. This study presents the first documented occurrence of four viruses (SPVC, SPV2, SPCFV, and SPSMV-1) in Korea. Based on the results of our survey, we developed multiplex RT-PCR assays for simple and simultaneous detection of the eight sweet potato viruses we recorded.

  5. The Current Incidence of Viral Disease in Korean Sweet Potatoes and Development of Multiplex RT-PCR Assays for Simultaneous Detection of Eight Sweet Potato Viruses

    Directory of Open Access Journals (Sweden)

    Hae-Ryun Kwak

    2014-12-01

    Full Text Available Sweet potato is grown extensively from tropical to temperate regions and is an important food crop worldwide. In this study, we established detection methods for 17 major sweet potato viruses using single and multiplex RT-PCR assays. To investigate the current incidence of viral diseases, we collected 154 samples of various sweet potato cultivars showing virus-like symptoms from 40 fields in 10 Korean regions, and analyzed them by RT-PCR using specific primers for each of the 17 viruses. Of the 17 possible viruses, we detected eight in our samples. Sweet potato feathery mottle virus (SPFMV and sweet potato virus C (SPVC were most commonly detected, infecting approximately 87% and 85% of samples, respectively. Furthermore, Sweet potato symptomless virus 1 (SPSMV-1, Sweet potato virus G (SPVG, Sweet potato leaf curl virus (SPLCV, Sweet potato virus 2 ( SPV2, Sweet potato chlorotic fleck virus (SPCFV, and Sweet potato latent virus (SPLV were detected in 67%, 58%, 47%, 41%, 31%, and 20% of samples, respectively. This study presents the first documented occurrence of four viruses (SPVC, SPV2, SPCFV, and SPSMV-1 in Korea. Based on the results of our survey, we developed multiplex RT-PCR assays for simple and simultaneous detection of the eight sweet potato viruses we recorded.

  6. Apple latent spherical virus vectors for reliable and effective virus-induced gene silencing among a broad range of plants including tobacco, tomato, Arabidopsis thaliana, cucurbits, and legumes

    International Nuclear Information System (INIS)

    Igarashi, Aki; Yamagata, Kousuke; Sugai, Tomokazu; Takahashi, Yukari; Sugawara, Emiko; Tamura, Akihiro; Yaegashi, Hajime; Yamagishi, Noriko; Takahashi, Tsubasa; Isogai, Masamichi; Takahashi, Hideki; Yoshikawa, Nobuyuki

    2009-01-01

    Apple latent spherical virus (ALSV) vectors were evaluated for virus-induced gene silencing (VIGS) of endogenous genes among a broad range of plant species. ALSV vectors carrying partial sequences of a subunit of magnesium chelatase (SU) and phytoene desaturase (PDS) genes induced highly uniform knockout phenotypes typical of SU and PDS inhibition on model plants such as tobacco and Arabidopsis thaliana, and economically important crops such as tomato, legume, and cucurbit species. The silencing phenotypes persisted throughout plant growth in these plants. In addition, ALSV vectors could be successfully used to silence a meristem gene, proliferating cell nuclear antigen and disease resistant N gene in tobacco and RCY1 gene in A. thaliana. As ALSV infects most host plants symptomlessly and effectively induces stable VIGS for long periods, the ALSV vector is a valuable tool to determine the functions of interested genes among a broad range of plant species.

  7. Field and experimental symptomless infections support wandering donkeys as healthy carriers of Trypanosoma vivax in the Brazilian Semiarid, a region of outbreaks of high mortality in cattle and sheep.

    Science.gov (United States)

    Rodrigues, Carla M F; Batista, Jael S; Lima, Joseney M; Freitas, Francisco J C; Barros, Isabella O; Garcia, Herakles A; Rodrigues, Adriana C; Camargo, Erney P; Teixeira, Marta M G

    2015-10-28

    report of T. vivax in donkeys in Brazil and, to our knowledge, the first experimental infection of donkeys with T. vivax. The symptomless field and experimental infections corroborated that donkeys are more tolerant to T. vivax than other livestock species as shown in African countries. Therefore, farmers, veterinaries and control programmes should be aware of healthy carrier donkeys as a possible source of T. vivax for susceptible livestock species in the Brazilian Semiarid.

  8. Identification and Prevalence of Grapevine fanleaf virus in Khorasan-Razavi Vineyards

    Directory of Open Access Journals (Sweden)

    Z. Gholampour

    2016-02-01

    phosphate buffer. Total plant RNA were extracted from fresh leaves using silicon dioxide (Boom et al. 1990. The cDNA strand was synthesized using Moloney murine leukemia virus (MMuLV reverse transcriptase. The partial length of coat protein gene of GFLV isolates was further amplified using DetF (CGGCAGACTGGCAAGCTGT and DetR (GGTCCAGTTTAATTGCCATCCA specific primer pair by RT-PCR in leaf samples that were positive in DAS-ELISA. PCR products were run on 1% agarose gel containing 0.5 µg/ml DNA Green Viewer, and visualized under UV irradiation. The PCR products were purified using the Qiaquick PCR purification kit (Qiagen, then were sequenced bidirectionally using DetF/DetRspecific primer pair. Consensus sequences were verified using the BLAST program in NCBI database. Multiple sequence alignments of the nucleotide sequences of the coat protein gene Phylogenetic analysis were carried out by the Neighbour-joining method implemented in MEGA v.5 Results and Discussion: 187 out of 280 samples were found to be infected with GFLV in indirect ELISA. Based on ELISA results, GFLV infection rate in Khorasan-Razavi ranging from 32% to 63%. Kashmar had the most infected vineyards with the prevalence of the virus in 90% of the samples. GFLV induced yellow mosaic and vein banding in infected leaves. Shorten internode, the zigzag growth of stem and double nude were observed in infected grapevines, however, most of the GFLV infected vines were symptomless. Mechanical inoculation with sap extracts from the GFLV positive leaf samples, induced chlorotic local lesions followed by vein clearing in systemic leaves of Chenopodium quinoa two weeks post inoculation. RT-PCR using specific primers amplify 1000 bp fragment corresponding to the GFLV coat protein gene. No fragment was observed in healthy control. Pairwise comparisons of the coat protein gene of four Iranian isolates showed 89%–97% nucleotide sequence identity and 90%–92% identity at the amino acid level with those of previously

  9. Reverse Transcription Polymerase Chain Reaction-based System for Simultaneous Detection of Multiple Lily-infecting Viruses

    Directory of Open Access Journals (Sweden)

    Ji Yeon Kwon

    2013-09-01

    Full Text Available A detection system based on a multiplex reverse transcription (RT polymerase chain reaction (PCR was developed to simultaneously identify multiple viruses in the lily plant. The most common viruses infecting lily plants are the cucumber mosaic virus (CMV, lily mottle virus (LMoV, lily symptomless virus (LSV. Leaf samples were collected at lily-cultivation facilities located in the Kangwon province of Korea and used to evaluate the detection system. Simplex and multiplex RT-PCR were performed using virus-specific primers to detect single-or mixed viral infections in lily plants. Our results demonstrate the selective detection of 3 different viruses (CMV, LMoV and LSV by using specific primers as well as the potential of simultaneously detecting 2 or 3 different viruses in lily plants with mixed infections. Three sets of primers for each target virus, and one set of internal control primers were used to evaluate the detection system for efficiency, reliability, and reproducibility.

  10. The coat protein of Alfalfa mosaic virus interacts and interferes with the transcriptional activity of the bHLH transcription factor ILR3 promoting salicylic acid-dependent defence signalling response.

    Science.gov (United States)

    Aparicio, Frederic; Pallás, Vicente

    2017-02-01

    During virus infection, specific viral component-host factor interaction elicits the transcriptional reprogramming of diverse cellular pathways. Alfalfa mosaic virus (AMV) can establish a compatible interaction in tobacco and Arabidopsis hosts. We show that the coat protein (CP) of AMV interacts directly with transcription factor (TF) ILR3 of both species. ILR3 is a basic helix-loop-helix (bHLH) family member of TFs, previously proposed to participate in diverse metabolic pathways. ILR3 has been shown to regulate NEET in Arabidopsis, a critical protein in plant development, senescence, iron metabolism and reactive oxygen species (ROS) homeostasis. We show that the AMV CP-ILR3 interaction causes a fraction of this TF to relocate from the nucleus to the nucleolus. ROS, pathogenesis-related protein 1 (PR1) mRNAs, salicylic acid (SA) and jasmonic acid (JA) contents are increased in healthy Arabidopsis loss-of-function ILR3 mutant (ilr3.2) plants, which implicates ILR3 in the regulation of plant defence responses. In AMV-infected wild-type (wt) plants, NEET expression is reduced slightly, but is induced significantly in ilr3.2 mutant plants. Furthermore, the accumulation of SA and JA is induced in Arabidopsis wt-infected plants. AMV infection in ilr3.2 plants increases JA by over 10-fold, and SA is reduced significantly, indicating an antagonist crosstalk effect. The accumulation levels of viral RNAs are decreased significantly in ilr3.2 mutants, but the virus can still systemically invade the plant. The AMV CP-ILR3 interaction may down-regulate a host factor, NEET, leading to the activation of plant hormone responses to obtain a hormonal equilibrium state, where infection remains at a level that does not affect plant viability. © 2016 BSPP AND JOHN WILEY & SONS LTD.

  11. Expression of a recombinant Human papillomavirus 16 E6GT oncoprotein fused to N- and C-termini of Potato virus X coat protein in Nicotiana benthamiana

    Czech Academy of Sciences Publication Activity Database

    Čeřovská, Noemi; Moravec, Tomáš; Hoffmeisterová, Hana; Plchová, Helena; Synková, Helena; Poláková, I.; Dušková, M.; Šmahel, M.

    2013-01-01

    Roč. 113, č. 1 (2013), s. 81-90 ISSN 0167-6857 R&D Projects: GA ČR GA521/09/1525; GA ČR(CZ) GAP501/12/1761 Institutional research plan: CEZ:AV0Z50380511 Keywords : Transient expression * Molecular farming * Potato virus X Subject RIV: EE - Microbiology, Virology Impact factor: 2.612, year: 2013

  12. Simultaneous detection of three lily viruses using Triplex IC-RT-PCR.

    Science.gov (United States)

    Zhang, Yubao; Wang, Yajun; Xie, Zhongkui; Yang, Guo; Guo, Zhihong; Wang, Le

    2017-11-01

    Viruses commonly infecting lily (Lilium spp.) include: Lily symptomless virus (LSV), Cucumber mosaic virus (CMV) and Lily mottle virus (LMoV). These viruses usually co-infect lilies causing severe economic losses in terms of quantity and quality of flower and bulb production around the world. Reliable and precise detection systems need to be developed for virus identification. We describe the development of a triplex immunocapture (IC) reverse transcription (RT) polymerase chain reaction (PCR) assay for the simultaneous detection of LSV, CMV and LMoV. The triplex IC-RT-PCR was compared with a quadruplex RT-PCR assay. Relative to the quadruplex RT-PCR, the specificity of the triplex IC-RT-PCR system for LSV, CMV and LMoV was 100% for field samples. The sensitivity of the triplex IC-RT-PCR system was 99.4%, 81.4% and 98.7% for LSV, CMV and LMoV, respectively. Agreement (κ) between the results obtained from the two tests was 0.968, 0.844 and 0.984 for LSV, CMV and LMoV, respectively. This is the first report of the simultaneous detection of LSV, CMV and LMoV in a triplex IC-RT-PCR assay. In particular we believe this convenient and reliable triplex IC-RT-PCR method could be used routinely for large-scale field surveys or crop health monitoring of lily. Copyright © 2017. Published by Elsevier B.V.

  13. Ebola Virus and Marburg Virus

    Science.gov (United States)

    Ebola virus and Marburg virus Overview Ebola virus and Marburg virus are related viruses that cause hemorrhagic fevers — illnesses marked by severe bleeding (hemorrhage), organ failure and, in many ...

  14. Virus Incidence of Sweet Potato in Korea from 2011 to 2014.

    Science.gov (United States)

    Kim, Jaedeok; Yang, Jung Wook; Kwak, Hae-Ryun; Kim, Mi-Kyeong; Seo, Jang-Kyun; Chung, Mi-Nam; Lee, Hyeong-Un; Lee, Kyeong-Bo; Nam, Sang Sik; Kim, Chang-Seok; Lee, Gwan-Seok; Kim, Jeong-Soo; Lee, Sukchan; Choi, Hong-Soo

    2017-10-01

    A nationwide survey was performed to investigate the current incidence of viral diseases in Korean sweet potatoes for germplasm and growing fields from 2011 to 2014. A total of 83.8% of the germplasm in Korea was infected with viruses in 2011. Commercial cultivars that were used to supply growing fields were infected at a rate of 62.1% in 2012. Among surveyed viruses, the incidence of five Potyvirus species that infect sweet potato decreased between 2012 and 2013, and then increased again in 2014. Representatively, the incidence of Sweet potato feathery mottle virus (SPFMV) was 87.0% in 2012, 20.7% in 2013 and then increased to 35.3% in 2014. Unlike RNA viruses, DNA viruses were shown to decrease continuously. The incidence of Sweet potato leaf curl virus (SPLCV) was 5.5% in 2003, 59.5% in 2011, and 47.4% in 2012. It then decreased continuously year by year to 33.2% in 2013, and then 25.6% in 2014. While the infection rate of each virus species showed a tendency to decline, the virus infection status was more variable in 2013 and 2014. Nevertheless, the high rate of single infections and mixed infection combinations were more variable than the survey results from 2012. As shown in the results from 2013, the most prevalent virus infection was a single infection at 27.6%, with the highest rate of infection belonging to sweet potato symptomless virus-1 (SPSMV-1) (12.9%). Compared to 2013, infection combinations were more varied in 2014, with a total of 122 kinds of mixed infection.

  15. Polymethacrylate Coated Electrospun PHB Fibers as a Functionalized Platform for Bio-Diagnostics: Confirmation Analysis on the Presence of Immobilized IgG Antibodies against Dengue Virus

    Directory of Open Access Journals (Sweden)

    Samira Hosseini

    2017-10-01

    Full Text Available In this article, a combination of far field electrospinning (FFES and free-radical polymerization has been used to create a unique platform for protein immobilization via the physical attachment of biomolecules to the surface of the fiber mats. The large specific surface area of the fibers with its tailored chemistry provides a desirable platform for effective analyte-surface interaction. The detailed analysis of protein immobilization on a newly developed bio-receptive surface plays a vital role to gauge its advantages in bio-diagnostic applications. We relied on scanning electron microscopy (SEM, diameter range analysis, and X-ray photoelectron spectroscopy (XPS, along with thermal gravimetric analysis (TGA, water-in-air contact angle analysis (WCA, Fourier transform infrared spectroscopy (FTIR, and atomic force microscopy (AFM to study our developed platforms and to provide valuable information regarding the presence of biomolecular entities on the surface. Detailed analyses of the fiber mats before and after antibody immobilization have shown obvious changes on the surface of the bioreceptive surface including: (i an additional peak corresponding to the presence of an antibody in TGA analysis; (ii extra FTIR peaks corresponding to the presence of antibodies on the coated fiber platforms; and (iii a clear alteration in surface roughness recorded by AFM analysis. Confirmation analyses on protein immobilization are of great importance as they underlay substantial grounds for various biosensing applications.

  16. Ultramicroscopic observation of recombinant adenoassociated virus ...

    African Journals Online (AJOL)

    Ultramicroscopic observation of recombinant adenoassociated virus type 2 on the surface of formvarcarbon coated copper grids under different relative humidity and incubation time using negative stain transmission electron microscopy.

  17. Hard coatings

    International Nuclear Information System (INIS)

    Dan, J.P.; Boving, H.J.; Hintermann, H.E.

    1993-01-01

    Hard, wear resistant and low friction coatings are presently produced on a world-wide basis, by different processes such as electrochemical or electroless methods, spray technologies, thermochemical, CVD and PVD. Some of the most advanced processes, especially those dedicated to thin film depositions, basically belong to CVD or PVD technologies, and will be looked at in more detail. The hard coatings mainly consist of oxides, nitrides, carbides, borides or carbon. Over the years, many processes have been developed which are variations and/or combinations of the basic CVD and PVD methods. The main difference between these two families of deposition techniques is that the CVD is an elevated temperature process (≥ 700 C), while the PVD on the contrary, is rather a low temperature process (≤ 500 C); this of course influences the choice of substrates and properties of the coating/substrate systems. Fundamental aspects of the vapor phase deposition techniques and some of their influences on coating properties will be discussed, as well as the very important interactions between deposit and substrate: diffusions, internal stress, etc. Advantages and limitations of CVD and PVD respectively will briefly be reviewed and examples of applications of the layers will be given. Parallel to the development and permanent updating of surface modification technologies, an effort was made to create novel characterisation methods. A close look will be given to the coating adherence control by means of the scratch test, at the coating hardness measurement by means of nanoindentation, at the coating wear resistance by means of a pin-on-disc tribometer, and at the surface quality evaluation by Atomic Force Microscopy (AFM). Finally, main important trends will be highlighted. (orig.)

  18. Protective Coatings

    Science.gov (United States)

    1980-01-01

    General Magnaplate Corporation's pharmaceutical machine is used in the industry for high speed pressing of pills and capsules. Machine is automatic system for molding glycerine suppositories. These machines are typical of many types of drug production and packaging equipment whose metal parts are treated with space spinoff coatings that promote general machine efficiency and contribute to compliance with stringent federal sanitation codes for pharmaceutical manufacture. Collectively known as "synergistic" coatings, these dry lubricants are bonded to a variety of metals to form an extremely hard slippery surface with long lasting self lubrication. The coatings offer multiple advantages; they cannot chip, peel or be rubbed off. They protect machine parts from corrosion and wear longer, lowering maintenance cost and reduce undesired heat caused by power-robbing friction.

  19. Lima Ekstrak Tumbuhan untuk Menekan Infeksi Bean common mosaic virus pada Tanaman Kacang Panjang

    Directory of Open Access Journals (Sweden)

    Lulu Kurnianingsih

    2013-08-01

    Full Text Available Bean common mosaic virus (BCMV is one of major virus infecting legumes and is difficult to manage. Utilization of plant extracts as systemic resistance inducer against virus is needed to study. The aim of the research is to evaluate the potency of five leaf extracts, i.e. from pagoda flower, spiny amaranth, four o’clock flower, Chenopodium amaranticolor, and herba andrographitis against BCMV. The effectiveness of leaf extracts were tested by spraying yard long bean leaves. Plants treated by spine spinach shown varied symptoms, while other treatments showed mild mosaic up to symptomless. The highest to lowest of disease incidence was showed by crude leaf extract of spine spinach (70%, four o’clock (10%, herba andrographitis (10%, while C. amaranticolor and pagoda are still uninfected. These results had positive correlation to disease severity and virus inhibition. Four of five tested leaf extracts, except spine spinach, showed their potency as systemic resistance inducer against BCMV.  Key words: BCMV, plant extract, yard long bean

  20. Solution structures of potato virus X and narcissus mosaic virus from Raman optical activity

    DEFF Research Database (Denmark)

    Blanch, Ewan W.; Robinson, David J.; Hecht, Lutz

    2002-01-01

    Potato virus X (PVX) and narcissus mosaic virus (NMV) were studied using vibrational Raman optical activity (ROA) in order to obtain new information on the structures of their coat protein subunits. The ROA spectra of the two intact virions are very similar to each other and similar to that of to......Potato virus X (PVX) and narcissus mosaic virus (NMV) were studied using vibrational Raman optical activity (ROA) in order to obtain new information on the structures of their coat protein subunits. The ROA spectra of the two intact virions are very similar to each other and similar...

  1. Detection of viruses in olive trees in Croatian Istria

    Directory of Open Access Journals (Sweden)

    Marta LUIGI

    2011-05-01

    Full Text Available Normal 0 14 false false false IT ZH-TW X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Tabella normale"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin-top:0cm; mso-para-margin-right:0cm; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0cm; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} Following identification of four viruses in a general survey of olive trees throughout Croatia, a detailed survey was conducted in 2009 in the field collection of the Institute of Agriculture and Tourism in Poreč (an important reservoir of Istrian native olive germplasm in order to evaluate the sanitary status of the most important Croatian Istria olive cultivars. Twenty five samples from symptomatic or symptomless trees were collected from five autochthonous and four exotic cultivars. All the samples were tested by RT-PCR for the presence of: Olive leaf yellowing associated virus (OLYaV, Cherry leaf roll virus (CLRV, Strawberry latent ring spot virus (SLRSV, Arabis mosaic virus (ArMV, Olive latent virus-1 (OLV-1, Cucumber mosaic virus (CMV, Olive latent virus-2 (OLV-2 and Tobacco necrosis virus D (TNV-D. Six of the 25 plants were found positive to CLRV; all infected plants showed leaf and fruit deformation and leaf yellowing. Four positive samples were from the native cv. Buža whereas the other two were from two exotic cultivars: Ascolana tenera and Frantoio. The presence of CLRV,  either in native or imported plants, highlights the importance of strict phytosanitary regulations to prevent incursion of key

  2. Occurrence of Cucumber mosaic virus on vanilla

    Indian Academy of Sciences (India)

    Cucumber mosaic virus (CMV) causing mosaic, leaf distortion and stunting of vanilla (Vanilla planifolia Andrews) in India was characterized on the basis of biological and coat protein (CP) nucleotide sequence properties. In mechanical inoculation tests, the virus was found to infect members of Chenopodiaceae, ...

  3. Virus-membrane interactions : spectroscopic studies

    NARCIS (Netherlands)

    Datema, K.P.

    1987-01-01

    In this thesis some new aspects of the infection process of nonenveloped viruses are reported. The interaction of a rod-shaped (TMV) and three spherical (CCMV, BMV, SBMV) plant viruses, of the filamentous bacteriophage M13, and of their coat proteins with membranes have been investigated. A

  4. Characterization of cowpea chlorotic mottle virus and its assembly

    NARCIS (Netherlands)

    Verduin, B.J.M.

    1978-01-01

    This thesis decribes the conditions for isolation of cowpea chlorotic mottle virus (CCMV), its ribonucleic acid (RNA) and the coat protein, the characterization of the virus and its constituents (chapter 3, 4 and 5) and the dissociation and assembly behaviour of the virus (chapter 6 and

  5. Survey of Cherry necrotic rusty mottle virus and Cherry green ring mottle virus incidence in Korea by Duplex RT-PCR

    Directory of Open Access Journals (Sweden)

    Seung-Yeol Lee

    2014-12-01

    Full Text Available The incidence of Cherry necrotic rusty mottle virus (CNRMV and Cherry green ring mottle virus (CGRMV have recently been occurred in Korea, posing a problem for sweet cherry cultivation. Since infected trees have symptomless leaves or ring-like spots on the pericarp, it is difficult to identify a viral infection. In this study, the incidence of CNRMV and CGRMV in sweet cherry in Gyeongbuk province was surveyed using a newly developed duplex reverse transcriptase polymerase chain reaction (RT-PCR method that can detect both viruses in a single reaction. CNRMV and CGRMV co-infection rates were 29.6%, 53.6%, and 17.6%, respectively, in samples collected from three different sites (Daegu, Gyeongju and Gyeongsan in Gyeongbuk province during 2012 and 2013. This duplex RT-PCR method offers a simple, rapid, and effective way of identifying CNRMV and CGRMV simultaneously in sweet cherry trees, which can aid in the management of viral infections that could undermine yield.

  6. ECHO virus

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/001340.htm ECHO virus To use the sharing features on this page, please enable JavaScript. Enteric cytopathic human orphan (ECHO) viruses are a group of viruses that can lead ...

  7. Extreme resistance to two Brazilian strains of Potato virus Y (PVY in transgenic potato, cv. Achat, expressing the PVYº coat protein Resistência extrema a duas estirpes do Potato virus Y (PVY de batata transgênica, cv. Achat, expressando o gene da capa protéica do PVY O

    Directory of Open Access Journals (Sweden)

    Eduardo Romano

    2001-07-01

    Full Text Available The coat protein (CP gene of the potato virus Y strain "o" (PVY O was introduced into potato, cultivar Achat, via Agrobacterium tumefaciens-mediated transformation. Sixty three putative transgenic lines were challenged against the Brazilian strains PVY-OBR and PVY-NBR. An extremely resistant phenotype, against the two strains, was observed in one line, denominated 1P. No symptoms or positive ELISA results were observed in 16 challenged plants from this line. Another clone, named as 63P, showed a lower level of resistance. Southern blot analysis showed five copies of the CP gene in the extremely resistant line and at least three copies in the other resistant line. The stability of the integrated transgenes in the extreme resistant line was examined during several in vitro multiplications over a period of three years, with no modification in the Southern pattern was observed. The stability of the transgenes, the absence of primary infections and the relatively broad spectrum of resistance suggest that the extremely resistant line obtained in this work can be useful for agricultural purposes.O gene da capa protéica (CP do Potato virus Y estirpe "o", foi introduzido em batata cultivar Achat, via Agrobacterium tumefaciens. Sessenta e três linhas possivelmente transgênicas foram desafiadas com as estirpes brasileiras PVY-OBR e PVY-NBR. Uma linha apresentou extrema resistência às duas estirpes inoculadas, e foi denominado clone 1P. Não foram observados sintomas sistêmicos de infecção e as plantas foram negativas em Elisa. Outra linha, denominada clone 63P, mostrou algum nível de resistência. Análises por Southern blot indicaram a presença de pelo menos cinco cópias do gen CP no clone 1P e pelo menos três cópias no clone 63P. A estabilidade do gene introduzido no clone 1P foi avaliada durante três anos, após várias multiplicações in vitro. Não foram observadas mudanças no padrão do Southern blot. A estabilidade do transgene, na

  8. Coating materials

    International Nuclear Information System (INIS)

    Ozeki, Takao; Kimura, Tadashi; Kobayashi, Juichi; Maeda, Yutaka; Nakamoto, Hideo.

    1969-01-01

    A non-solvent type coating material composition having properties as good as thermosetting acrylic or amino alkid resins is provided by employing active energy irradiation, particularly electron beams, using a radically polymerizable low molecular compound (A) (hereafter called an oligomer) containing at least two vinyl radicals in one molecule. This oligomer is produced by reacting an epoxy-containing vinyl monomer with alpha-, beta-ethylene unsaturated carboxylic acids or their anhydrides. The composition (I) contains 10% - 100% of this oligomer. In embodiments, an oligomer having a fiberous trivinyl construction is produced by reacting 180 parts by weight of glycidyl methacrylate ester with 130 parts of itaconic acid in the presence of a polymerization-inhibitor and an addition reaction catalyst at 90 0 C for 6 hours. In practice, the coating material compositions (1), consist of the whole oligomer [I-1]; (2), consist of 10-90% of (A) component and 90%-10% of vinyl monomers containing at least 30% (meth) acrylic monomer [I-2]; (3), 10%-90% of component (A) and 90%-10% of other monomers containing at least two vinyl radicals [I-3]; (4), a mixture of (I-2) and (I-3), [I-4]; and (5), consist of 50% or less unsaturated polyester of 500-5,000 molecular weight range or drying oil, or alkyd resin of 500-5,000 molecular weight range modified by drying oil, [I-5]. As a catalyst a tertiary amino vinyl compound is preferred. Five examples are given. (Iwakiri, K.)

  9. Coatings and Corrosion Laboratory

    Data.gov (United States)

    Federal Laboratory Consortium — Purpose: The mission of the Coatings and Corrosion Laboratory is to develop and analyze the effectiveness of innovative coatings test procedures while evaluating the...

  10. Graphene Coatings

    DEFF Research Database (Denmark)

    Stoot, Adam Carsten; Camilli, Luca; Bøggild, Peter

    2014-01-01

    Owing to its remarkable electrical and mechanical properties, graphene has been attracting tremendous interest in materials science. In particular, its chemical stability and impermeability make it a promising protective membrane. However, recent investigations reveal that single layer graphene...... cannot be used as a barrier in the long run, due to galvanic corrosion phenomena arising when oxygen or water penetrate through graphene cracks or domain boundaries. Here, we overcome this issue by using a multilayered (ML) graphene coating. Our lab- as well as industrial-scale tests demonstrate that ML...... graphene can effectively protect Ni in harsh environments, even after long term exposure. This is made possible by the presence of a high number of graphene layers, which can efficiently mask the cracks and domain boundaries defects found in individual layers of graphene. Our findings thus show...

  11. Coating materials

    International Nuclear Information System (INIS)

    Ozeki, Takao; Kimura, Tadashi; Kobayashi, Juichi; Maeda, Yutaka; Nakamoto, Hideo.

    1969-01-01

    A non-solvent type coating material composition is provided which can be hardened by irradiation with active energy, particularly electron beams, using a composition which contains 10%-100% of a radically polymerizable low molecular compound (A), (hereafter called an oligomer), having at least two vinyl radicals in one molecule. These compositions have a high degree of polymerization and characteristics equivalent to thermosetting acrylic or amino alkyd resin. The oligomer (A) is produced by reacting an epoxy-containing vinyl monomer with saturated polycarboxylic acids or anhydrides. In one embodiment, 146 parts by weight of adipic acid and 280 parts of glycidyl methacrylate ester undergo addition reaction in the presence of a polymerization-inhibitor and a catalyst at 90 0 C for 6 hours to produce an oligomer having a fiberous divinyl construction. The coating composition utilizes this oligomer in the forms of (I-1), a whole oligomer; (I-2), 0%-90% of this oligomer and 90%-10% of a vinyl monomer containing at least 30% of (meth) acrylic monomer; (I-3), 10%-90% of such oligomer and 90%-10% of other monomers containing at least two vinyl radicals in one molecule; (I-4), a mixture of (I-2) and (I-3) in proportion of 1/9 to 9/1, and (I-5), above four compositions each containing 50% or less unsaturated polyester or drying oil having 500-5,000 molecules or a drying oil-modified alkyd resin having 500-5,000 molecules. Four examples are given. (Iwakiri, K.)

  12. Electrocurtain coating process for coating solar mirrors

    Science.gov (United States)

    Kabagambe, Benjamin; Boyd, Donald W.; Buchanan, Michael J.; Kelly, Patrick; Kutilek, Luke A.; McCamy, James W.; McPheron, Douglas A.; Orosz, Gary R.; Limbacher, Raymond D.

    2013-10-15

    An electrically conductive protective coating or film is provided over the surface of a reflective coating of a solar mirror by flowing or directing a cation containing liquid and an anion containing liquid onto the conductive surface. The cation and the anion containing liquids are spaced from, and preferably out of contact with one another on the surface of the reflective coating as an electric current is moved through the anion containing liquid, the conductive surface between the liquids and the cation containing liquid to coat the conductive surface with the electrically conductive coating.

  13. Low Temperature Powder Coating

    Science.gov (United States)

    2011-02-09

    of volatile organic compounds (VOCs) and hazardous air pollutants (HAPs) • Legacy primers contain hexavalent chrome • Conventional powder coatings...coatings both in laboratory and field service evaluations • LTCPC allows environmental cost reductions through VOC/HAP elimination and hexavalent ... chrome reduction. • The LTCPC process greatly shortens the coating operation (LTCPC cures much more rapidly then conventional wet coatings) resulting in

  14. Stability of RNA silencing-based traits after virus infection

    DEFF Research Database (Denmark)

    Jørgensen, Bodil; Albrechtsen, Merete

    2007-01-01

    with constructs based on virus coat protein (CP) genes or other viral genes has been successfully used to engineer PTGS-mediated virus resistance into a large number of crop plants and some transgenic lines have been commercially exploited. However the discovery that plant viruses encode suppressors of gene...... silencing has raised concerns that virus infection of crop plants might reverse the new silencing-based traits. Most studies of virus suppression of silencing have used model systems based on silencing of reporter genes. A few studies have analysed the effects of virus infections on plants with genetically...... engineered virus resistance based on either a simple sense or an inverted repeat construct. We decided to use genetically engineered virus resistance in potato as a model system for further studies of the effect of virus infection on genetically engineered traits. We present for the first time a comparison...

  15. Fungal transmission of plant viruses.

    Science.gov (United States)

    Campbell, R N

    1996-01-01

    Thirty soilborne viruses or virus-like agents are transmitted by five species of fungal vectors. Ten polyhedral viruses, of which nine are in the family Tombusviridae, are acquired in the in vitro manner and do not occur within the resting spores of their vectors, Olpidium brassicae and O. bornovanus. Fungal vectors for other viruses in the family should be sought even though tombusviruses are reputed to be soil transmitted without a vector. Eighteen rod-shaped viruses belonging to the furo- and bymovirus groups and to an unclassified group are acquired in the in vivo manner and survive within the resting spores of their vector, O. brassicae, Polymyxa graminis, P. betae, and Spongospora subterranea. The viral coat protein has an essential role in in vitro transmission. With in vivo transmission a site in the coat protein-read through protein (CP-RT) of beet necrotic yellow vein furovirus determines vector transmissibility as does a site in a similar 98-kDa polyprotein of barley mild mosaic bymovirus. The mechanisms by which virions move (or are moved) into and out of the protoplasm of zoospores or of thalli needs study.

  16. Chikungunya virus

    Science.gov (United States)

    Chikungunya virus infection; Chikungunya ... Where Chikungunya is Found Before 2013, the virus was found in Africa, Asia, Europe, and the Indian and Pacific oceans. In late 2013, outbreaks occurred for the first time in the ...

  17. Zika Virus

    Science.gov (United States)

    ... through blood transfusions. There have been outbreaks of Zika virus in the United States, Africa, Southeast Asia, the ... not travel to areas where there is a Zika virus outbreak. If you do decide to travel, first ...

  18. Zika Virus

    Science.gov (United States)

    ... Funding CDC Activities For Healthcare Providers Clinical Evaluation & Disease Sexual Transmission HIV Infection & Zika Virus Testing for Zika Test Specimens – At Time of Birth Diagnostic Tests Understanding Zika Virus Test Results ...

  19. The everyday elasticity of compliance in a symptomless disease

    DEFF Research Database (Denmark)

    Felde, Lina Hoel

    2011-01-01

    Medically, compliance refers to the extent to which a patient's response to medical advice coincides with doctors' orders. Rather than this absolute standard, this article treats compliance as an institutionally available discourse continually figured in practice. The aim of this article is to de......Medically, compliance refers to the extent to which a patient's response to medical advice coincides with doctors' orders. Rather than this absolute standard, this article treats compliance as an institutionally available discourse continually figured in practice. The aim of this article...... give-and-take. This elasticity of compliance reveals a reflexive critique of medical compliance as a moral standard and leads us to discuss how people are adequately compliant in everyday moral contexts....

  20. Loss of aphid transmissibility of plum pox virus isolates

    NARCIS (Netherlands)

    Kamenova, I.; Lohuis, H.; Peters, D.

    2002-01-01

    The aphid transmissibility of seven Plum pox virus (PPV) isolates and the amino acid sequences of their coat proteins were analysed Two aphid transmissible isolates PPV-A and PPV-P contained the DAG amino triplet, while DAL or NAG replaced this triplet in the coat proteins of non-aphid transmissible

  1. Flow coating apparatus and method of coating

    Science.gov (United States)

    Hanumanthu, Ramasubrahmaniam; Neyman, Patrick; MacDonald, Niles; Brophy, Brenor; Kopczynski, Kevin; Nair, Wood

    2014-03-11

    Disclosed is a flow coating apparatus, comprising a slot that can dispense a coating material in an approximately uniform manner along a distribution blade that increases uniformity by means of surface tension and transfers the uniform flow of coating material onto an inclined substrate such as for example glass, solar panels, windows or part of an electronic display. Also disclosed is a method of flow coating a substrate using the apparatus such that the substrate is positioned correctly relative to the distribution blade, a pre-wetting step is completed where both the blade and substrate are completed wetted with a pre-wet solution prior to dispensing of the coating material onto the distribution blade from the slot and hence onto the substrate. Thereafter the substrate is removed from the distribution blade and allowed to dry, thereby forming a coating.

  2. Transdermal influenza immunization with vaccine-coated microneedle arrays.

    Directory of Open Access Journals (Sweden)

    Dimitrios G Koutsonanos

    Full Text Available Influenza is a contagious disease caused by a pathogenic virus, with outbreaks all over the world and thousands of hospitalizations and deaths every year. Due to virus antigenic drift and short-lived immune responses, annual vaccination is required. However, vaccine coverage is incomplete, and improvement in immunization is needed. The objective of this study is to investigate a novel method for transdermal delivery using metal microneedle arrays (MN coated with inactivated influenza virus to determine whether this route is a simpler and safer approach than the conventional immunization, capable to induce robust immune responses and confer protection against lethal virus challenge.Inactivated A/Aichi/2/68 (H3N2 influenza virus was coated on metal microneedle arrays and applied to mice as a vaccine in the caudal dorsal skin area. Substantial antibody titers with hemagglutination inhibition activity were detected in sera collected two and four weeks after a single vaccine dose. Challenge studies in mice with 5 x LD(50 of mouse adapted Aichi virus demonstrated complete protection. Microneedle vaccination induced a broad spectrum of immune responses including CD4+ and CD8+ responses in the spleen and draining lymph node, a high frequency of antigen-secreting cells in the lung and induction of virus-specific memory B-cells. In addition, the use of MN showed a dose-sparing effect and a strong Th2 bias when compared to an intramuscular (IM reference immunization.The present results show that delivery of inactivated influenza virus through the skin using metal microneedle arrays induced strong humoral and cellular immune responses capable of conferring protection against virus challenge as efficiently as intramuscular immunization, which is the standard vaccination route. In view of the convenience of delivery and the potential for self-administration, vaccine-coated metal microneedles may provide a novel and highly effective immunization method.

  3. European coatings conference - Marine coatings. Proceedings

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2008-07-01

    This volume contains 13 lectures (manuscripts or powerpoint foils) with the following topics: 1. Impact of containerization on polyurethane and polyurea in marine and protective coatings (Malte Homann); 2. The application of combinatorial/high-throughput methods to the development of marine coatings (Bret Chisholm); 3. Progress and perspectives in the AMBIO (advanced nanostructured surfaces for the control of biofouling) Project (James Callow); 4. Release behaviour due to shear and pull-off of silicone coatings with a thickness gradient (James G. Kohl); 5. New liquid rheology additives for high build marine coatings (Andreas Freytag); 6. Effective corrosion protection with polyaniline, polpyrrole and polythiophene as anticorrosice additives for marine paints (Carlos Aleman); 7. Potential applications of sol gel technology for marine applications (Robert Akid); 8: Performance of biocide-free Antifouling Coatings for leisure boats (Bernd Daehne); 9. Novel biocidefree nanostructured antifouling coatings - can nano do the job? (Corne Rentrop); 10. One component high solids, VOC compliant high durability finish technology (Adrian Andrews); 11. High solid coatings - the hybrid solution (Luca Prezzi); 12. Unique organofunctional silicone resins for environmentally friendly high-performance coatings (Dieter Heldmann); 13. Silicone-alkyd paints for marine applications: from battleship-grey to green (Thomas Easton).

  4. PIT Coating Requirements Analysis

    International Nuclear Information System (INIS)

    MINTEER, D.J.

    2000-01-01

    This study identifies the applicable requirements for procurement and installation of a coating intended for tank farm valve and pump pit interior surfaces. These requirements are intended to be incorporated into project specification documents and design media. This study also evaluates previously recommended coatings and identifies requirement-compliant coating products

  5. PIT Coating Requirements Analysis

    Energy Technology Data Exchange (ETDEWEB)

    MINTEER, D.J.

    2000-10-20

    This study identifies the applicable requirements for procurement and installation of a coating intended for tank farm valve and pump pit interior surfaces. These requirements are intended to be incorporated into project specification documents and design media. This study also evaluates previously recommended coatings and identifies requirement-compliant coating products.

  6. Coatings for laser fusion

    International Nuclear Information System (INIS)

    Lowdermilk, W.H.

    1981-01-01

    Optical coatings are used in lasers systems for fusion research to control beam propagation and reduce surface reflection losses. The performance of coatings is important in the design, reliability, energy output, and cost of the laser systems. Significant developments in coating technology are required for future lasers for fusion research and eventual power reactors

  7. Fuel particle coating data

    International Nuclear Information System (INIS)

    Hollabaugh, C.M.; Wagner, P.; Wahman, L.A.; White, R.W.

    1977-01-01

    Development of coating on nuclear fuel particles for the High-Temperature Fuels Technology program at the Los Alamos Scientific Laboratory included process studies for low-density porous and high-density isotropic carbon coats, and for ZrC and ''alloy'' C/ZrC coats. This report documents the data generated by these studies

  8. Solanum americanum: reservoir for Potato virus Y and Cucumber mosaic virus in sweet pepper crops

    Directory of Open Access Journals (Sweden)

    Monika Fecury Moura

    2014-03-01

    Full Text Available Weeds can act as important reservoirs for viruses. Solanum americanum (Black nightshade is a common weed in Brazil and samples showing mosaic were collected from sweet pepper crops to verify the presence of viruses. One sample showed mixed infection between Cucumber mosaic virus (CMV and Potato virus Y (PVY and one sample showed simple infection by PVY. Both virus species were transmitted by plant extract and caused mosaic in tomato (Solanum lycopersicum cv. Santa Clara, sweet pepper (Capsicum annuum cv. Magda, Nicotiana benthamiana and N. tabaccum TNN, and local lesions on Chenopodium quinoa, C. murale and C. amaranticolor. The coat protein sequences for CMV and PVY found in S. americanum are phylogenetically more related to isolates from tomato. We conclude that S. americanum can act as a reservoir for different viruses during and between sweet pepper crop seasons.

  9. ATHENA optimized coating design

    DEFF Research Database (Denmark)

    Ferreira, Desiree Della Monica; Christensen, Finn Erland; Jakobsen, Anders Clemen

    2012-01-01

    The optimization of coating design for the ATHENA mission si described and the possibility of increasing the telescope effective area in the range between 0.1 and 10 keV is investigated. An independent computation of the on-axis effective area based on the mirror design of ATHENA is performed...... in order to review the current coating baseline. The performance of several material combinations, considering a simple bi-layer, simple multilayer and linear graded multilayer coatings are tested and simulation of the mirror performance considering both the optimized coating design and the coating...

  10. Metallic coating of microspheres

    International Nuclear Information System (INIS)

    Meyer, S.F.

    1980-01-01

    Extremely smooth, uniform metal coatings of micrometer thicknesses on microscopic glass spheres (microspheres) are often needed as targets for inertial confinement fusion (ICF) experiments. The first part of this paper reviews those methods used successfully to provide metal coated microspheres for ICF targets, including magnetron sputtering, electro- and electroless plating, and chemical vapor pyrolysis. The second part of this paper discusses some of the critical aspects of magnetron sputter coating of microspheres, including substrate requirements, the sticking of microspheres during coating (preventing a uniform coating), and the difficulties in growing the desired dense, smooth, uniform microstructure on continuously moving spherical substrates

  11. Antibacterial polymer coatings.

    Energy Technology Data Exchange (ETDEWEB)

    Wilson, Mollye C.; Allen, Ashley N.; Barnhart, Meghan; Tucker, Mark David; Hibbs, Michael R.

    2009-09-01

    A series of poly(sulfone)s with quaternary ammonium groups and another series with aldehyde groups are synthesized and tested for biocidal activity against vegetative bacteria and spores, respectively. The polymers are sprayed onto substrates as coatings which are then exposed to aqueous suspensions of organisms. The coatings are inherently biocidal and do not release any agents into the environment. The coatings adhere well to both glass and CARC-coated coupons and they exhibit significant biotoxicity. The most effective quaternary ammonium polymers kills 99.9% of both gram negative and gram positive bacteria and the best aldehyde coating kills 81% of the spores on its surface.

  12. Detection of sweet potato virus C, sweet potato virus 2 and sweet potato feathery mottle virus in Portugal.

    Science.gov (United States)

    Varanda, Carla M R; Santos, Susana J; Oliveira, Mônica D M; Clara, Maria Ivone E; Félix, Maria Rosário F

    2015-06-01

    Field sweet potato plants showing virus-like symptoms, as stunting, leaf distortion, mosaic and chlorosis, were collected in southwest Portugal and tested for the presence of four potyviruses, sweet potato virus C (SPVC), sweet potato virus 2 (SPV2), sweet potato feathery mottle virus (SPFMV), sweet potato virus G (SPVG), and the crinivirus sweet potato chlorotic stunt virus (SPCSV). DsRNA fractions were extracted from symptomatic leaves and used as templates in single and multiplex RT-PCR assays using previously described specific primers for each analyzed virus. The amplified reaction products for SPVC, SPV2 and SPFMV were of expected size, and direct sequencing of PCR products revealed that they correspond to the coat protein gene (CP) and showed 98%, 99% and 99% identity, respectively, to those viruses. Comparison of the CP genomic and amino acid sequences of the Portuguese viral isolates recovered here with those of ten other sequences of isolates obtained in different countries retrieved from the GenBank showed very few differences. The application of the RT-PCR assays revealed for the first time the presence of SPVC and SPFMV in the sweet potato crop in Portugal, the absence of SPVG and SPCSV in tested plants, as well as the occurrence of triple virus infections under field conditions.

  13. Coated Aerogel Beads

    Science.gov (United States)

    Littman, Howard (Inventor); Plawsky, Joel L. (Inventor); Paccione, John D. (Inventor)

    2014-01-01

    Methods and apparatus for coating particulate material are provided. The apparatus includes a vessel having a top and a bottom, a vertically extending conduit having an inlet in the vessel and an outlet outside of the vessel, a first fluid inlet in the bottom of the vessel for introducing a transfer fluid, a second fluid inlet in the bottom of the vessel for introducing a coating fluid, and a fluid outlet from the vessel. The method includes steps of agitating a material, contacting the material with a coating material, and drying the coating material to produce a coated material. The invention may be adapted to coat aerogel beads, among other materials. A coated aerogel bead and an aerogel-based insulation material are also disclosed.

  14. Anticorrosive coatings: a review

    DEFF Research Database (Denmark)

    Sørensen, Per Aggerholm; Kiil, Søren; Dam-Johansen, Kim

    2009-01-01

    of volatile organic compounds (VOCs) have caused significant changes in the anticorrosive coating industry. The requirement for new VOC-compliant coating technologies means that coating manufacturers can no longer rely on the extensive track record of their time-served products to convince consumers...... of their suitability for use. An important aspect in the development of new VOC-compliant, high-performance anticorrosive coating systems is a thorough knowledge of the components in anticorrosive coatings, their interactions, their advantages and limitations, as well as a detailed knowledge on the failure modes......, and inhibitive coatings are outlined. In the past decades, several alternatives to organic solvent-borne coatings have reached the commercial market. This review also presents some of these technologies and discusses some of their advantages and limitations. Finally, some of the mechanisms leading to degradation...

  15. Pixelated coatings and advanced IR coatings

    Science.gov (United States)

    Pradal, Fabien; Portier, Benjamin; Oussalah, Meihdi; Leplan, Hervé

    2017-09-01

    Reosc developed pixelated infrared coatings on detector. Reosc manufactured thick pixelated multilayer stacks on IR-focal plane arrays for bi-spectral imaging systems, demonstrating high filter performance, low crosstalk, and no deterioration of the device sensitivities. More recently, a 5-pixel filter matrix was designed and fabricated. Recent developments in pixelated coatings, shows that high performance infrared filters can be coated directly on detector for multispectral imaging. Next generation space instrument can benefit from this technology to reduce their weight and consumptions.

  16. Combustion chemical vapor desposited coatings for thermal barrier coating systems

    Energy Technology Data Exchange (ETDEWEB)

    Hampikian, J.M.; Carter, W.B. [Georgia Institute of Technology, Atlanta, GA (United States)

    1995-10-01

    The new deposition process, combustion chemical vapor deposition, shows a great deal of promise in the area of thermal barrier coating systems. This technique produces dense, adherent coatings, and does not require a reaction chamber. Coatings can therefore be applied in the open atmosphere. The process is potentially suitable for producing high quality CVD coatings for use as interlayers between the bond coat and thermal barrier coating, and/or as overlayers, on top of thermal barrier coatings.

  17. Phytophthora viruses.

    Science.gov (United States)

    Cai, Guohong; Hillman, Bradley I

    2013-01-01

    Phytophthora sp. is a genus in the oomycetes, which are similar to filamentous fungi in morphology and habitat, but phylogenetically more closely related to brown algae and diatoms and fall in the kingdom Stramenopila. In the past few years, several viruses have been characterized in Phytophthora species, including four viruses from Phytophthora infestans, the late blight pathogen, and an endornavirus from an unnamed Phytophthora species from Douglas fir. Studies on Phytophthora viruses have revealed several interesting systems. Phytophthora infestans RNA virus 1 (PiRV-1) and PiRV-2 are likely the first members of two new virus families; studies on PiRV-3 support the establishment of a new virus genus that is not affiliated with established virus families; PiRV-4 is a member of Narnaviridae, most likely in the genus Narnavirus; and Phytophthora endornavirus 1 (PEV1) was the first nonplant endornavirus at the time of reporting. Viral capsids have not been found in any of the above-mentioned viruses. PiRV-1 demonstrated a unique genome organization that requires further examination, and PiRV-2 may have played a role in late blight resurgence in 1980s-1990s. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. Schmallenberg Virus

    Indian Academy of Sciences (India)

    IAS Admin

    explore the potential of this infection crossing the species barrier and thereby .... The virus targets mainly the brain of the unborn animal resulting in neurological ... The virus is located in the blood of the adult infected animal or in the central ...

  19. Zika Virus

    Science.gov (United States)

    ... with facebook share with twitter share with linkedin Zika Virus Credit: NIAID A female Aedes mosquito. This type of mosquito can transmit Zika, ... transmitted to humans through the bite of infected Aedes aegypti mosquitoes. Zika virus can be transmitted from an infected pregnant woman ...

  20. CHANDIPURA VIRUS

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. CHANDIPURA VIRUS. First isolated from a village called Chandipura near Nagpur in 1965 in India. Belongs to rhabdoviridae family. Used as a Model System to study RNA virus multiplication in the infected cell at molecular level. Notes:

  1. Preliminary coating design and coating developments for ATHENA

    DEFF Research Database (Denmark)

    Jakobsen, Anders Clemen; Ferreira, Desiree Della Monica; Christensen, Finn Erland

    2011-01-01

    We present initial novel coating design for ATHENA. We make use of both simple bilayer coatings of Ir and B4C and more complex constant period multilayer coatings to enhance the effective area and cover the energy range from 0.1 to 10 keV. We also present the coating technology used...... for these designs and present test results from coatings....

  2. Plasma sprayed thermoregulating coatings

    International Nuclear Information System (INIS)

    Kudinov, V.V.; Puzanov, A.A.; Zambrzhitskij, A.P.; Soboleva, V.V.

    1979-01-01

    Shown is the possibility of plasma spraying application for thermoregulating coating formation. Given are test results of service properties of BeO, Al 2 O 2 plasma coatings on the substrates of the MA2-1 magnesium alloy. Described is a device for studying durability of coating optical parameters under ultraviolet irradiation in deep vacuum. Dynamics of absorption coefficient, growth caused by an increase in absorption centers amount under such irradiation is investigated

  3. Zinc phosphate conversion coatings

    Science.gov (United States)

    Sugama, Toshifumi

    1997-01-01

    Zinc phosphate conversion coatings for producing metals which exhibit enhanced corrosion prevention characteristics are prepared by the addition of a transition-metal-compound promoter comprising a manganese, iron, cobalt, nickel, or copper compound and an electrolyte such as polyacrylic acid, polymethacrylic acid, polyitaconic acid and poly-L-glutamic acid to a phosphating solution. These coatings are further improved by the incorporation of Fe ions. Thermal treatment of zinc phosphate coatings to generate .alpha.-phase anhydrous zinc phosphate improves the corrosion prevention qualities of the resulting coated metal.

  4. Silica coatings on clarithromycin.

    Science.gov (United States)

    Bele, Marjan; Dmitrasinovic, Dorde; Planinsek, Odon; Salobir, Mateja; Srcic, Stane; Gaberscek, Miran; Jamnik, Janko

    2005-03-03

    Pre-crystallized clarithromycin (6-O-methylerythromycin A) particles were coated with silica from the tetraethyl orthosilicate (TEOS)-ethanol-aqueous ammonia system. The coatings had a typical thickness of 100-150 nm and presented about 15 wt.% of the silica-drug composite material. The properties of the coatings depended on reactant concentration, temperature and mixing rate and, in particular, on the presence of a cationic surfactant (cetylpyridinium chloride). In the presence of cetylpyridinium chloride the silica coatings slightly decreased the rate of pure clarithromycin dissolution.

  5. Antimicrobial-Coated Granules for Disinfecting Water

    Science.gov (United States)

    Akse, James R.; Holtsnider, John T.; Kliestik, Helen

    2011-01-01

    Methods of preparing antimicrobialcoated granules for disinfecting flowing potable water have been developed. Like the methods reported in the immediately preceding article, these methods involve chemical preparation of substrate surfaces (in this case, the surfaces of granules) to enable attachment of antimicrobial molecules to the surfaces via covalent bonds. A variety of granular materials have been coated with a variety of antimicrobial agents that include antibiotics, bacteriocins, enzymes, bactericides, and fungicides. When employed in packed beds in flowing water, these antimicrobial-coated granules have been proven effective against gram-positive bacteria, gram-negative bacteria, fungi, and viruses. Composite beds, consisting of multiple layers containing different granular antimicrobial media, have proven particularly effective against a broad spectrum of microorganisms. These media have also proven effective in enhancing or potentiating the biocidal effects of in-line iodinated resins and of very low levels of dissolved elemental iodine.

  6. Poinsettia latent virus is not a cryptic virus, but a natural polerovirus-sobemovirus hybrid

    International Nuclear Information System (INIS)

    Siepen, Marc aus dem; Pohl, Jens O.; Koo, Bong-Jin; Wege, Christina; Jeske, Holger

    2005-01-01

    The biochemical and genetic features of Poinsettia latent virus (PnLV, formerly named Poinsettia cryptic virus), which is spread worldwide in commercial cultivars of Euphorbia pulcherrima without inducing symptoms, have been determined using virus-purification, immunological techniques, electron microscopy, cloning, and sequencing. PnLV was found to be a chimeric virus with one 4652 bases, plus strand RNA showing a close relationship to poleroviruses within the first three quarters of its genome but to sobemoviruses in the last quarter. Thus, we propose to classify this virus as 'polemovirus'. Similarities of protein and nucleic acid sequences at the 5' and extreme 3' end of its RNA suggest a replication mode like that of poleroviruses, whereas the coat protein sequence is closely related to that of sobemoviruses. Consistent with these results, PnLV forms stable icosahedra of 34 nm in diameter. The consequences for the taxonomy of PnLV and for gardeners' practice are discussed

  7. KARAKTERISASICYMBIDIUM MOSAIC VIRUS (CYMMV PADA TANAMAN ANGGREK

    Directory of Open Access Journals (Sweden)

    KHAMDAN KHALIMI

    2012-11-01

    Full Text Available Characterization ofCymbidium mosaic virus (CymMV on Orchid Plant Orchids are affected by more virus disease problems than most crops, reducing their commercial values considerably. Orchid viruses are widespread in cultivated orchids, withCymbidium mosaic potexvirus (CymMV being the most prevalent. CymMV high incidence in cultivated orchids has been attributed to the stability and ease of transmission of this virus through cultural practices. CymMV induces floral and foliar necrosis. The virus also reduce plant vigor and lower flower quality, which affect their economic value. The objective of the research is to characterize the virus causing mosaic or chlorotic and necrotic on orchids in West Java. A reverse transcription-polymerase chain reaction (RT- PCR assays using oligonucleotide primers specific to CymMV were also successfully amplified the regions of the coat protein (CP gene of the virus. Analysis by using sodium dodecyl sulphate- polyacrylamide gel electrophoresis (SDS-PAGE revealed that the virus have a major structural protein with an estimated molecular weight of 28 kDa. Aligments of partial nucleotide sequences of the CP gene displayed 86 to 92% homology to CymMV isolates from other countries.

  8. Superhydrophobic silica coating by dip coating method

    International Nuclear Information System (INIS)

    Mahadik, Satish A.; Parale, Vinayak; Vhatkara, Rajiv S.; Mahadik, Dinesh B.; Kavale, Mahendra S.; Wagh, Pratap B.; Gupta, Satish; Gurav, Jyoti

    2013-01-01

    Herein, we report a simple and low cost method for the fabrication of superhydrophobic coating surface on quartz substrates via sol-gel dip coating method at room temperature. Desired surface chemistry and texture growth for superhydrophobicity developed under double step sol–gel process at room temperature. The resultant superhydrophobic surfaces were characterized by Field-emission scanning electron microscopy (FE-SEM), Atomic force microscopy (AFM), water contact angle (WCA) measurement, differential thermal gravimetric analysis-differential thermal analysis (TGA-DTA) calorimetry and optical spectrometer. Coating shows the ultra high water contact angle about 168 ± 2° and water sliding angle 3 ± 1° and superoleophilic with petroleum oils. This approach allows a simple strategy for the fabrication process of superhydrophilic–superhydrophobic on same surfaces with high thermal stability of superhydrophobicity up to 560 °C. Thus, durability, special wettability and thermal stability of superhydrophobicity expand their application fields.

  9. Coated electroactive materials

    Science.gov (United States)

    Amine, Khalil; Abouimrane, Ali

    2016-08-30

    A process includes suspending an electroactive material in a solvent, suspending or dissolving a carbon precursor in the solvent; and depositing the carbon precursor on the electroactive material to form a carbon-coated electroactive material. Compositions include a graphene-coated electroactive material prepared from a solution phase mixture or suspension of an electroactive material and graphene, graphene oxide, or a mixture thereof.

  10. Rock-hard coatings

    OpenAIRE

    Muller, M.

    2007-01-01

    Aircraft jet engines have to be able to withstand infernal conditions. Extreme heat and bitter cold tax coatings to the limit. Materials expert Dr Ir. Wim Sloof fits atoms together to develop rock-hard coatings. The latest invention in this field is known as ceramic matrix composites. Sloof has signed an agreement with a number of parties to investigate this material further.

  11. Metallurgical coating system

    International Nuclear Information System (INIS)

    Daniels, L.C.; Whittaker, G.S.

    1984-01-01

    The present invention relates to a novel metallurgical coating system which provides corrosion resistance and non-stick properties to metallic components which are subjected to unusually severe operating conditions. The coating system comprises a first layer comprising tantalum which is deposited upon a substrate and a second layer comprising molybdenum disilicide which is deposited upon the first layer

  12. Rock-hard coatings

    NARCIS (Netherlands)

    Muller, M.

    2007-01-01

    Aircraft jet engines have to be able to withstand infernal conditions. Extreme heat and bitter cold tax coatings to the limit. Materials expert Dr Ir. Wim Sloof fits atoms together to develop rock-hard coatings. The latest invention in this field is known as ceramic matrix composites. Sloof has

  13. Unobtrusive graphene coatings

    NARCIS (Netherlands)

    Mugele, Friedrich Gunther

    2012-01-01

    The contact angle of water drops on substrates for which the wettability is dominated by van der Waals forces remains unchanged when the substrates are coated with a monolayer of graphene. Such 'wetting transparency' could lead to superior conducting and hydrophobic graphene-coated surfaces with

  14. Coating thickness measurement

    International Nuclear Information System (INIS)

    1976-12-01

    The standard specifies measurements of the coating thickness, which make use of beta backscattering and/or x-ray fluorescence. For commonly used combinations of coating material and base material the appropriate measuring ranges and radionuclides to be used are given for continuous as well as for discontinuous measurements

  15. Duplex aluminized coatings

    Science.gov (United States)

    Gedwill, M. A.; Grisaffe, S. J. (Inventor)

    1975-01-01

    The surface of a metallic base system is initially coated with a metallic alloy layer that is ductile and oxidation resistant. An aluminide coating is then applied to the metallic alloy layer. The chemistry of the metallic alloy layer is such that the oxidation resistance of the subsequently aluminized outermost layer is not seriously degraded.

  16. Coated ceramic breeder materials

    Science.gov (United States)

    Tam, Shiu-Wing; Johnson, Carl E.

    1987-01-01

    A breeder material for use in a breeder blanket of a nuclear reactor is disclosed. The breeder material comprises a core material of lithium containing ceramic particles which has been coated with a neutron multiplier such as Be or BeO, which coating has a higher thermal conductivity than the core material.

  17. Ganjam virus.

    Science.gov (United States)

    Sudeep, A B; Jadi, R S; Mishra, A C

    2009-11-01

    Ganjam virus (GANV), a member of genus Nairovirus of family Bunyavirdae is of considerable veterinary importance in India. Though, predominantly tick borne, GANV was also isolated from mosquitoes, man and sheep. Neutralizing and complement fixing antibodies to GANV have been detected in animal and human sera collected from different parts of the country. Thirty three strains of GANV have been isolated from India, mainly from Haemaphysalis ticks. The virus replicated in certain vertebrate and mosquito cell lines and found pathogenic to laboratory animals. One natural infection and five laboratory-acquired infections in men were also reported. GANV is antigenically related to Nairobi sheep disease virus (NSDV) of Africa, which is highly pathogenic for sheep and goats causing 70-90 per cent mortality among the susceptible population. Recent molecular studies have demonstrated that GANV is an Asian variant of NSDV and both these viruses are related to the dreaded Crimean Congo haemorrhagic fever (CCHF) group viruses. The versatility of the virus to replicate in different arthropod species, its ability to infect sheep, goat and man makes it an important zoonotic agent.

  18. Radiation curable coating compositions

    International Nuclear Information System (INIS)

    Jenkinson, R.D.; Carder, C.H.

    1979-01-01

    The present invention provides a low-toxicity diluent component for radiation curable coating compositions that contain an acrylyl or methacryly oligomer or resin component such as an acrylyl urethane oligomer. The low-toxicity diluent component of this invention is chosen from the group consisting of tetraethlorthosilicate and tetraethoxyethylorthosilicate. When the diluent component is used as described, benefits in addition to viscosity reduction, may be realized. Application characteristics of the uncured coatings composition, such as flowability, leveling, and smoothness are notably improved. Upon curing by exposure to actinic radiation, the coating composition forms a solid, non-tacky surface free of pits, fissures or other irregularities. While there is no readily apparent reactive mechanism by which the orthosilicate becomes chemically bonded to the cured coating, the presence of silicon in the cured coating has been confirmed by scanning electron microscopy. 12 drawing

  19. Charged-particle coating

    International Nuclear Information System (INIS)

    Johnson, W.L.; Crane, J.K.; Hendricks, C.D.

    1980-01-01

    Advanced target designs require thicker (approx. 300 μm) coatings and better surface finishes that can be produced with current coating techniques. An advanced coating technique is proposed to provide maximum control of the coating flux and optimum manipulation of the shell during processing. In this scheme a small beam of ions or particles of known incident energy are collided with a levitated spherical mandrel. Precise control of the incident energy and angle of the deposition flux optimizes the control of the coating morphology while controlled rotation and noncontact support of the shell minimizes the possibility of particulate or damage generated defects. Almost infinite variability of the incident energy and material in this process provides increased flexibility of the target designs which can be physically realized

  20. Coating thickness measuring device

    International Nuclear Information System (INIS)

    Joffe, B.B.; Sawyer, B.E.; Spongr, J.J.

    1984-01-01

    A device especially adapted for measuring the thickness of coatings on small, complexly-shaped parts, such as, for example, electronic connectors, electronic contacts, or the like. The device includes a source of beta radiation and a radiation detector whereby backscatter of the radiation from the coated part can be detected and the thickness of the coating ascertained. The radiation source and detector are positioned in overlying relationship to the coated part and a microscope is provided to accurately position the device with respect to the part. Means are provided to control the rate of descent of the radiation source and radiation detector from its suspended position to its operating position and the resulting impact it makes with the coated part to thereby promote uniformity of readings from operator to operator, and also to avoid excessive impact with the part, thereby improving accuracy of measurement and eliminating damage to the parts

  1. Powassan (POW) Virus Basics

    Science.gov (United States)

    ... Health Professionals Related Topics For International Travelers Powassan Virus Disease Basics Download this fact sheet formatted for ... Virus Disease Fact Sheet (PDF) What is Powassan virus? Powassan virus is a tickborne flavivirus that is ...

  2. Fluorine Based Superhydrophobic Coatings

    Directory of Open Access Journals (Sweden)

    Jean-Denis Brassard

    2012-05-01

    Full Text Available Superhydrophobic coatings, inspired by nature, are an emerging technology. These water repellent coatings can be used as solutions for corrosion, biofouling and even water and air drag reduction applications. In this work, synthesis of monodispersive silica nanoparticles of ~120 nm diameter has been realized via Stöber process and further functionalized using fluoroalkylsilane (FAS-17 molecules to incorporate the fluorinated groups with the silica nanoparticles in an ethanolic solution. The synthesized fluorinated silica nanoparticles have been spin coated on flat aluminum alloy, silicon and glass substrates. Functionalization of silica nanoparticles with fluorinated groups has been confirmed by Fourier Transform Infrared spectroscopy (FTIR by showing the presence of C-F and Si-O-Si bonds. The water contact angles and surface roughness increase with the number of spin-coated thin films layers. The critical size of ~119 nm renders aluminum surface superhydrophobic with three layers of coating using as-prepared nanoparticle suspended solution. On the other hand, seven layers are required for a 50 vol.% diluted solution to achieve superhydrophobicity. In both the cases, water contact angles were more than 150°, contact angle hysteresis was less than 2° having a critical roughness value of ~0.700 µm. The fluorinated silica nanoparticle coated surfaces are also transparent and can be used as paint additives to obtain transparent coatings.

  3. Coatings to prevent frost

    DEFF Research Database (Denmark)

    Lusada, Ricardo; Holberg, Stefan; Bennedsen, Jeanette Marianne Dalgaard

    2016-01-01

    The ability of hydrophobic, organic–inorganic hybrid coatings to decelerate frost propagation was investigated. Compared to a bare aluminum surface, the coatings do not significantly reduce the freezing probability of supercooled water drops. On both surfaces, the probability for ice nucleation...... at temperatures just below 0°C, for example at −4°C, is low. Freezing of a single drop on aluminum leads, however, to instant freezing of the complete surface. On hydrophobic coatings, such a freezing drop is isolated; the frozen area grows slowly. At −4°C surface temperature in a +12°C/90% relative humidity...

  4. Mutants of alfalfa mosaic virus

    International Nuclear Information System (INIS)

    Roosien, J.

    1983-01-01

    In this thesis the isolation and characterization of a number of mutants of alfalfa mosaic virus, a plant virus with a coat protein dependent genome, is described. Thermo-sensitive (ts) mutants were selected since, at least theoretically, ts mutations can be present in all virus coded functions. It was found that a high percentage of spontaneous mutants, isolated because of their aberrant symptoms, were ts. The majority of these isolates could grow at the non-permissive temperature in the presence of a single wild type (wt) component. To increase the mutation rate virus preparations were treated with several mutagens. After nitrous acid treatment or irradiation with ultraviolet light, an increase in the level of mutations was observed. UV irradiation was preferred since it did not require large amounts of purified viral components. During the preliminary characterization of potential ts mutants the author also obtained one structural and several symptom mutants which were analysed further (chapter 7, 8 and 9). The properties of the ts mutants are described in chapter 3-7. (Auth.)

  5. Induction of resistance to rice tungro virus disease in rice cultivar Pusa 2-21 through irradiation

    International Nuclear Information System (INIS)

    Mathur, S.C.; Rao, M.; Prakash, Jitendra

    1979-01-01

    The dry seeds of Pusa 2-21, a moderately resistant rice cultivar, were subjected to 10, 15 and 20 Krad (dose rate 12.3 Krad/min) radiation dosages of gamma rays to induce resistance against rice tungro virus disease. The height of M 1 seedling was significantly reduced in 15 and 20 Krad treatments. However, there was no effect of gamma irradiation on seed germination. A limited population of M 2 and M 3 generation was screened at the rate of 3 viruliferous leafhoppers/seedling using single plant caging technique. In M 2 generation 22.0, 17.6 and 25.0 percent seedlings exhibited green colour (symptomless) representing resistant reaction to the disease in 10, 15 and 20 Krad treatments, respectively. Out of 1470 seedlings in M 3 generation, 2.7 percent seedlings showing no symptoms of tungro could be isolated indicating the possibility of inducing higher degree of resistance than that of the parent to RTV through irradiation for the first time. (auth.)

  6. Systemic transport of Alfalfa mosaic virus can be mediated by the movement proteins of several viruses assigned to five genera of the 30K family.

    Science.gov (United States)

    Fajardo, Thor V M; Peiró, Ana; Pallás, Vicente; Sánchez-Navarro, Jesús

    2013-03-01

    We previously showed that the movement protein (MP) gene of Alfalfa mosaic virus (AMV) is functionally exchangeable for the cell-to-cell transport of the corresponding genes of Tobacco mosaic virus (TMV), Brome mosaic virus, Prunus necrotic ringspot virus, Cucumber mosaic virus and Cowpea mosaic virus. We have analysed the capacity of the heterologous MPs to systemically transport the corresponding chimeric AMV genome. All MPs were competent in systemic transport but required the fusion at their C terminus of the coat protein-interacting C-terminal 44 aa (A44) of the AMV MP. Except for the TMV MP, the presence of the hybrid virus in upper leaves correlated with the capacity to move locally. These results suggest that all the MPs assigned to the 30K superfamily should be exchangeable not only for local virus movement but also for systemic transport when the A44 fragment is present.

  7. Ebola Virus

    Directory of Open Access Journals (Sweden)

    Anusha Rangare Lakshman

    2015-09-01

    Full Text Available The disease Ebola takes its name from the Ebola River situated near a village in the Democratic Republic of Congo, where the disease first appeared in 1976. It is caused by a virus from the Filoviridae family (filovirus. The present outbreak of Ebola Virus Disease (EVD concerns four countries in West Africa, namely Guinea, Liberia, Sierra Leone and Nigeria till date. Further to widespread transmission of the disease, it has been declared as a Public Health Emergency of International Concern by the World Health Organisation on 8 August 2014. As of 4 August 2014, countries have reported 1,711 cases (1,070 confirmed, 436 probable, 205 suspect, including 932 deaths. This review paper enlightens about the awareness of Ebola virus and its preventive measures. [Archives Medical Review Journal 2015; 24(3.000: 296-305

  8. Thermally joining and/or coating or thermally separating the workpieces having heat-sensitive coating, comprises restoring coating by thermally coating the coating material after thermally joining and/or coating or thermally separating

    OpenAIRE

    Riedel, Frank; Winkelmann, Ralf; Puschmann, Markus

    2011-01-01

    The method for thermally joining and/or coating or thermally separating the workpieces (1), which have a heat-sensitive coating (2), comprises restoring the coating by thermally coating a coating material (3) after thermally joining and/or coating or thermally separating the workpieces. A part of the thermal energy introduced in the workpiece for joining and/or coating or separating or in the workpieces is used for thermally coating the coating material. Two workpieces are welded or soldered ...

  9. POWDER COAT APPLICATIONS

    Science.gov (United States)

    The report discusses an investigation of critical factors that affect the use of powder coatings on the environment, cost, quality, and production. The investigation involved a small business representative working with the National Defense Center for Environmental Excellence (ND...

  10. Inorganic Coatings Laboratory

    Data.gov (United States)

    Federal Laboratory Consortium — The inorganic Coatings Lab provides expertise to Navy and Joint Service platforms acquisition IPTs to aid in materials and processing choices which balance up-front...

  11. Robust Fiber Coatings

    National Research Council Canada - National Science Library

    Goettler, Richard

    2002-01-01

    The highly desired ceramic matrix composite is the one in which the high strength and strain-to-failure is achieved through judicious selection of a fiber coating that can survive the high-temperature...

  12. Coating of substrates

    International Nuclear Information System (INIS)

    Cairns, J.A.; Nelson, R.L.; Woodhead, J.L.

    1979-01-01

    The process is concerned with providing substrates with coatings obtainable from sols, for example to protect the substrate (such as in nuclear reactors or hydrocarbon cracking plant) or to provide a carrier for catalytically active material. Hitherto, coatings obtained from sols have had a high porosity and high surface area so that they have not been entirely satisfactory for the above applications. In the process described, dense, low-porosity coatings are provided by contacting the substrate with a sol of refractory material (e.g. CeO 2 or SiO 2 ) convertible to a gel of density at least 40% of the theoretical density of the refractory material, and converting the sol to the gel. Optionally, the gel may be converted to a ceramic coating by firing. (author)

  13. Friction surfaced Stellite6 coatings

    International Nuclear Information System (INIS)

    Rao, K. Prasad; Damodaram, R.; Rafi, H. Khalid; Ram, G.D. Janaki; Reddy, G. Madhusudhan; Nagalakshmi, R.

    2012-01-01

    Solid state Stellite6 coatings were deposited on steel substrate by friction surfacing and compared with Stellite6 cast rod and coatings deposited by gas tungsten arc and plasma transferred arc welding processes. Friction surfaced coatings exhibited finer and uniformly distributed carbides and were characterized by the absence of solidification structure and compositional homogeneity compared to cast rod, gas tungsten arc and plasma transferred coatings. Friction surfaced coating showed relatively higher hardness. X-ray diffraction of samples showed only face centered cubic Co peaks while cold worked coating showed hexagonally close packed Co also. - Highlights: ► Stellite6 used as coating material for friction surfacing. ► Friction surfaced (FS) coatings compared with casting, GTA and PTA processes. ► Finer and uniformly distributed carbides in friction surfaced coatings. ► Absence of melting results compositional homogeneity in FS Stellite6 coatings.

  14. Radiation hardening coating material

    International Nuclear Information System (INIS)

    McDonald, W.H.; Prucnal, P.J.; DeMajistre, Robert.

    1977-01-01

    This invention concerns a radiation hardening coating material. First a resin is prepared by reaction of bisphenol diglycidylic ether with acrylic or methacrylic acids. Then the reactive solvent is prepared by reaction of acrylic or methacrylic acids with epichlorhydrine or epibromhydrine. Then a solution consisting of the resin dissolved in the reactive solvent is prepared. A substrate (wood, paper, polyesters, polyamines etc.) is coated with this composition and exposed to ionizing radiations (electron beams) or ultraviolet radiations [fr

  15. Hydroxyapatite coatings for biomedical applications

    CERN Document Server

    Zhang, Sam

    2013-01-01

    Hydroxyapatite coatings are of great importance in the biological and biomedical coatings fields, especially in the current era of nanotechnology and bioapplications. With a bonelike structure that promotes osseointegration, hydroxyapatite coating can be applied to otherwise bioinactive implants to make their surface bioactive, thus achieving faster healing and recovery. In addition to applications in orthopedic and dental implants, this coating can also be used in drug delivery. Hydroxyapatite Coatings for Biomedical Applications explores developments in the processing and property characteri

  16. Biocompatibility of Niobium Coatings

    Directory of Open Access Journals (Sweden)

    René Olivares-Navarrete

    2011-09-01

    Full Text Available Niobium coatings deposited by magnetron sputtering were evaluated as a possible surface modification for stainless steel (SS substrates in biomedical implants. The Nb coatings were deposited on 15 mm diameter stainless steel substrates having an average surface roughness of 2 mm. To evaluate the biocompatibility of the coatings three different in vitro tests, using human alveolar bone derived cells, were performed: cellular adhesion, proliferation and viability. Stainless steel substrates and tissue culture plastic were also studied, in order to give comparative information. No toxic response was observed for any of the surfaces, indicating that the Nb coatings act as a biocompatible, bioinert material. Cell morphology was also studied by immune-fluorescence and the results confirmed the healthy state of the cells on the Nb surface. X-ray diffraction analysis of the coating shows that the film is polycrystalline with a body centered cubic structure. The surface composition and corrosion resistance of both the substrate and the Nb coating were also studied by X-ray photoelectron spectroscopy and potentiodynamic tests. Water contact angle measurements showed that the Nb surface is more hydrophobic than the SS substrate.

  17. Coated particle waste form development

    International Nuclear Information System (INIS)

    Oma, K.H.; Buckwalter, C.Q.; Chick, L.A.

    1981-12-01

    Coated particle waste forms have been developed as part of the multibarrier concept at Pacific Northwest Laboratory under the Alternative Waste Forms Program for the Department of Energy. Primary efforts were to coat simulated nuclear waste glass marbles and ceramic pellets with low-temperature pyrolytic carbon (LT-PyC) coatings via the process of chemical vapor deposition (CVD). Fluidized bed (FB) coaters, screw agitated coaters (SAC), and rotating tube coaters were used. Coating temperatures were reduced by using catalysts and plasma activation. In general, the LT-PyC coatings did not provide the expected high leach resistance as previously measured for carbon alone. The coatings were friable and often spalled off the substrate. A totally different concept, thermal spray coating, was investigated at PNL as an alternative to CVD coating. Flame spray, wire gun, and plasma gun systems were evaluated using glass, ceramic, and metallic coating materials. Metal plasma spray coatings (Al, Sn, Zn, Pb) provided a two to three orders-of-magnitude increase in chemical durability. Because the aluminum coatings were porous, the superior leach resistance must be due to either a chemical interaction or to a pH buffer effect. Because they are complex, coated waste form processes rank low in process feasibility. Of all the possible coated particle processes, plasma sprayed marbles have the best rating. Carbon coating of pellets by CVD ranked ninth when compared with ten other processes. The plasma-spray-coated marble process ranked sixth out of eleven processes

  18. SARS virus

    Indian Academy of Sciences (India)

    ... consequence.Protein spike similar. HE gene absent. 2787 nucleotides. Largest genome. Jumps species by genetic deletion. < 300 compounds screened. Glycyrrhizin (liquorics/mullatha) seems attractive. Antivirals not effective. Vaccines – animal model only in monkeys. Killed corona or knockout weakened virus as targets.

  19. The structure of melon necrotic spot virus determined at 2.8 Å resolution

    International Nuclear Information System (INIS)

    Wada, Yasunobu; Tanaka, Hideaki; Yamashita, Eiki; Kubo, Chikako; Ichiki-Uehara, Tamaki; Nakazono-Nagaoka, Eiko; Omura, Toshihiro; Tsukihara, Tomitake

    2007-01-01

    The structure of melon necrotic spot virus is reported. The structure of melon necrotic spot virus (MNSV) was determined at 2.8 Å resolution. Although MNSV is classified into the genus Carmovirus of the family Tombusviridae, the three-dimensional structure of MNSV showed a higher degree of similarity to tomato bushy stunt virus (TBSV), which belongs to the genus Tombusvirus, than to carnation mottle virus (CMtV), turnip crinkle virus (TCV) or cowpea mottle virus (CPMtV) from the genus Carmovirus. Thus, the classification of the family Tombusviridae at the genus level conflicts with the patterns of similarity among coat-protein structures. MNSV is one of the viruses belonging to the genera Tombusvirus or Carmovirus that are naturally transmitted in the soil by zoospores of fungal vectors. The X-ray structure of MNSV provides us with a representative structure of viruses transmitted by fungi

  20. Nucleotide sequence and taxonomy of Cycas necrotic stunt virus. Brief report.

    Science.gov (United States)

    Han, S S; Karasev, A V; Ieki, H; Iwanami, T

    2002-11-01

    Cycas necrotic stunt virus (CNSV) is the only well-characterized virus from gymnosperm. cDNA segments corresponding to the bipartite genome RNAs (RNA1, RNA2) were synthesized and sequenced. Each RNA encoded a single polyprotein, flanked by the 5' and 3' non-coding regions (NCR) and followed by a poly (A) tail. The putative polyproteins encoded by RNA1 and RNA2 had sets of motifs, which were characteristic of viruses in the genus Nepovirus. The polyproteins showed higher sequence identities to Artichoke Italian latent virus, Grapevine chrome mosaic virus and Tomato black ring virus, all of which belong to subgroup b of the genus Nepovirus, than to other nepoviruses. Phylogenetic analysis of RNA dependent RNA polymerase and coat protein also showed closer relationships with these viruses than other viruses. The data obtained supported the taxonomical status of CNSV as a definitive member of the genus Nepovirus, subgroup b.

  1. Characterization of viruses associated with garlic plants propagated from different reproductive tissues from Italy and other geographic regions

    Directory of Open Access Journals (Sweden)

    Leonardo PARRANO

    2013-01-01

    Full Text Available Garlic is an important crop cultivated worldwide and several different viruses have been associated with propagative material. Garlic is propagated from bulbs and/or from vegetative topsets of the inflorescences known as bulbils. The effects of the geographic origin and the type of the propagative material on the phylogenetic relationships and genetic variability of the coat protein genes of four allium viruses are presented here. Onion yellow dwarf virus (OYDV, Leek yellow stripe virus (LYSV, Garlic virus X (GVX, and Garlic common latent virus (GCLV were detected in single and mixed infections in plants grown either from bulbils and/or bulbs originating from Italy, China, Argentina, and the U.S.A. OYDV and LYSV fell into five and three well supported clades respectively whereas isolates of GVX and GCLV all clustered into one well-supported clade each. Some of the OYDV and LYSV clades presented evidence of host tissue selection while some phylogenetic structuring based on the geographic origin or host was also observed for some virus clades. Unique haplotypes and novel coat protein amino acid sequence patterns were identified for all viruses. An OYDV coat protein amino acid signature unique to Chenopodium quinoa, an uncommon host of the virus, was of particular interest. The type of propagative material affected the population dynamics of all of the viruses. The virus populations in plants propagated from bulbs were more diverse than in plants propagated from bulbils.

  2. Coatings for directional eutectics

    Science.gov (United States)

    Rairden, J. R.; Jackson, M. R.

    1976-01-01

    Coatings developed to provide oxidation protection for the directionally-solidified eutectic alloy NiTaC-B (4.4 weight percent Cr) were evaluated. Of seven Co-, Fe- and Ni-base coatings that were initially investigated, best resistance to cyclic oxidation was demonstrated by duplex coatings fabricated by depositing a layer of NiCrAl(Y) by vacuum evaporation from an electron beam source followed by deposition of an Al overlayer using the pack cementation process. It was found that addition of carbon to the coating alloy substantially eliminated the problem of fiber denudation in TaC-type eutectic alloys. Burner rig cycled NiTaC-B samples coated with Ni-20Cr-5Al-0.1C-0.1Y+Al and rupture-tested at 1100 deg C performed as well as or better than uncoated, vacuum cycled and air-tested NiTaC-13; however, a slight degradation with respect to uncoated material was noted in air-stress rupture tests at 870 deg C for both cycled and uncycled samples.

  3. METHOD OF PROTECTIVELY COATING URANIUM

    Science.gov (United States)

    Eubank, L.D.; Boller, E.R.

    1959-02-01

    A method is described for protectively coating uranium with zine comprising cleaning the U for coating by pickling in concentrated HNO/sub 3/, dipping the cleaned U into a bath of molten zinc between 430 to 600 C and containing less than 0 01% each of Fe and Pb, and withdrawing and cooling to solidify the coating. The zinccoated uranium may be given a; econd coating with another metal niore resistant to the corrosive influences particularly concerned. A coating of Pb containing small proportions of Ag or Sn, or Al containing small proportions of Si may be applied over the zinc coatings by dipping in molten baths of these metals.

  4. Identification of Cherry green ring mottle virus on Sweet Cherry Trees in Korea

    Directory of Open Access Journals (Sweden)

    In-Sook Cho

    2013-12-01

    Full Text Available During the 2012 growing season, 154 leaf samples were collected from sweet cherry trees in Hwaseong, Pyeongtaek, Gyeongju, Kimcheon, Daegu, Yeongju and Eumseong and tested for the presence of Cherry green ring mottle virus (CGRMV. PCR products of the expected size (807 bp were obtained from 6 samples. The PCR products were cloned and sequenced. The nucleotide sequences of the clones showed over 88% identities to published coat protein sequences of CGRMV isolates in the GenBank database. The sequences of CGRMV isolates, CGR-KO 1−6 shared 98.8 to 99.8% nucleotide and 99.6 to 100% amino acid similarities. Phylogenetic analysis indicated that the Korean CGRMV isolates belong to the group II of CGRMV coat protein genes. The CGRMV infected sweet cherry trees were also tested for Apple chlorotic leaf spot virus (ACLSV, Apple mosaic virus (ApMV, Cherry necrotic rusty mottle virus (CNRMV, Cherry mottle leaf virus (CMLV, Cherry rasp leaf virus (CRLV, Cherry leafroll virus (CLRV, Cherry virus A (CVA, Little cherry virus 1 (LChV1, Prune dwarf virus (PDV and Prunus necrotic ringspot virus (PNRSV by RT-PCR. All of the tested trees were also infected with ACLSV.

  5. Zirconium nitride hard coatings

    International Nuclear Information System (INIS)

    Roman, Daiane; Amorim, Cintia Lugnani Gomes de; Soares, Gabriel Vieira; Figueroa, Carlos Alejandro; Baumvol, Israel Jacob Rabin; Basso, Rodrigo Leonardo de Oliveira

    2010-01-01

    Zirconium nitride (ZrN) nanometric films were deposited onto different substrates, in order to study the surface crystalline microstructure and also to investigate the electrochemical behavior to obtain a better composition that minimizes corrosion reactions. The coatings were produced by physical vapor deposition (PVD). The influence of the nitrogen partial pressure, deposition time and temperature over the surface properties was studied. Rutherford backscattering spectrometry (RBS), X-ray photoelectron spectroscopy (XPS), X-ray diffraction (XRD), scanning electron microscopy (SEM) and corrosion experiments were performed to characterize the ZrN hard coatings. The ZrN films properties and microstructure changes according to the deposition parameters. The corrosion resistance increases with temperature used in the films deposition. Corrosion tests show that ZrN coating deposited by PVD onto titanium substrate can improve the corrosion resistance. (author)

  6. Distribution and molecular detection of apple mosaic virus in apple ...

    African Journals Online (AJOL)

    ... pair for real time polymerase chain reaction (RT-PCR) detection of coat protein gene for Turkish ApMV isolates. Apple mosaic virus isolates were collected in 2007 to 2010 and the presence of the pathogen was detected by double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) and RT-PCR tests.

  7. Citrus Tristeza Virus on the Island of Crete

    DEFF Research Database (Denmark)

    Shegani, M.; Tsikou, D.; Velimirovic, A.

    2012-01-01

    Over a period of two years, more than 5,000 citrus trees were tested for the presence of Citrus tristeza virus (CTV) on the island of Crete, resulting in thirty eight positives. Comparisons of the relative transcript levels of CTV p23, coat protein (CP), polymerase (POL) and an intergenic (POL/p3...

  8. Nanophase hardfaced coatings

    Energy Technology Data Exchange (ETDEWEB)

    Reisgen, U.; Stein, L.; Balashov, B.; Geffers, C. [RWTH Aachen University (Germany). ISF - Welding and Joining Institute

    2009-08-15

    This paper demonstrates the possibility of producing iron or chromium-based nanophase hardfaced coatings by means of common arc welding methods (TIG, PTA). The appropriate composition of the alloys to be deposited allows to control the structural properties and thus also the coating properties of the weld metal. Specific variations of the alloying elements allow also the realisation of a nanostructured solidification of the carbides and borides with cooling rates that are common for arc surfacing processes. The hardfaced coatings, which had been thus produced, showed phase dimensions of approximately 100-300 nm. Based on the results it is established that the influence of the surfacing parameters and of the coating thickness and thus the influence of the heat control on the nanostructuring process is, compared with the influence of the alloy composition, of secondary importance. The generation of nanoscale structures in hardfaced coatings allows the improvement of mechanical properties, wear resistance and corrosion resistance. Potential applications for these types of hardfaced coatings lie, in particular, in the field of cutting tools that are exposed to corrosion and wear. (Abstract Copyright [2009], Wiley Periodicals, Inc.) [German] Diese Arbeit demonstriert die Moeglichkeit zur Herstellung Eisen- und Chrom-basierter nanophasiger Hartauftragschweissschichten mithilfe ueblicher Lichtbogenschweissverfahren (WIG-, Plasma-Pulver-Auftragschweissen - PPA). Eine geeignete Zusammensetzung der aufzutragenden Legierungen ermoeglicht es, die Gefuegeeigenschaften und damit die Schichteigenschaften des Schweissgutes zu kontrollieren. Gezielte Variationen der Legierungselemente erlauben die Realisierung einer nanostrukturierten Erstarrung der Karbide und Boride bei fuer Lichtbogen-Auftragschweissprozessen ueblichen Abkuehlgeschwindigkeiten. In den so erzeugten Hartschichten werden Phasengroessen von ca. 100-300 nm erreicht. Auf Basis der gewonnenen Ergebnisse kann

  9. Presence and Distribution of Oilseed Pumpkin Viruses and Molecular Detection of Zucchini Yellow Mosaic Virus

    Directory of Open Access Journals (Sweden)

    Ana Vučurović

    2009-01-01

    Full Text Available Over the past decade, intensive spread of virus infections of oilseed pumpkin has resulted in significant economic losses in pumpkin crop production, which is currently expanding in our country. In 2007 and 2008, a survey for the presence and distribution of oilseed pumpkin viruses was carried out in order to identify viruses responsible for epidemics and incidences of very destructive symptoms on cucurbit leaves and fruits. Monitoring andcollecting samples of oil pumpkin, as well as other species such as winter and butternut squash and buffalo and bottle gourd with viral infection symptoms, was conducted in several localities of Vojvodina Province. The collected plant samples were tested by DAS-ELISA using polyclonal antisera specific for the detection of six most economically harmful pumpkin viruses: Cucumber mosaic virus (CMV, Zucchini yellow mosaic virus (ZYMV, Watermelon mosaic virus (WMW, Squash mosaic virus (SqMV, Papaya ringspot virus (PRSV and Tobaccoringspot virus (TRSV that are included in A1 quarantine list of harmful organisms in Serbia.Identification of viruses in the collected samples indicated the presence of three viruses, ZYMV, WMV and CMV, in individual and mixed infections. Frequency of the identified viruses varied depending on locality and year of investigations. In 2007, WMV was the most frequent virus (94.2%, while ZYMV was prevalent (98.04% in 2008. High frequency of ZYMV determined in both years of investigation indicated the need for its rapid and reliable molecular detection. During this investigation, a protocol for ZYMVdetection was developed and optimized using specific primers CPfwd/Cprev and commercial kits for total RNA extraction, as well as for RT-PCR. In RT-PCR reaction using these primers, a DNA fragment of approximately 1100 bp, which included coat protein gene, was amplified in the samples of infected pumkin leaves. Although serological methods are still useful for large-scale testing of a great number of

  10. Enzymes and Enzyme Activity Encoded by Nonenveloped Viruses.

    Science.gov (United States)

    Azad, Kimi; Banerjee, Manidipa; Johnson, John E

    2017-09-29

    Viruses are obligate intracellular parasites that rely on host cell machineries for their replication and survival. Although viruses tend to make optimal use of the host cell protein repertoire, they need to encode essential enzymatic or effector functions that may not be available or accessible in the host cellular milieu. The enzymes encoded by nonenveloped viruses-a group of viruses that lack any lipid coating or envelope-play vital roles in all the stages of the viral life cycle. This review summarizes the structural, biochemical, and mechanistic information available for several classes of enzymes and autocatalytic activity encoded by nonenveloped viruses. Advances in research and development of antiviral inhibitors targeting specific viral enzymes are also highlighted.

  11. Influenza (Flu) Viruses

    Science.gov (United States)

    ... Types Seasonal Avian Swine Variant Pandemic Other Influenza (Flu) Viruses Language: English (US) Español Recommend on Facebook ... influenza circulate and cause illness. More Information about Flu Viruses Types of Influenza Viruses Influenza A and ...

  12. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus ... Patient Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your ...

  13. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and ... Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus ...

  14. Zika Virus and Pregnancy

    Science.gov (United States)

    ... Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and ... Patient Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus ...

  15. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and ... Patient Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus ...

  16. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and Pregnancy Page ... Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus if you ...

  17. Computer Viruses: An Overview.

    Science.gov (United States)

    Marmion, Dan

    1990-01-01

    Discusses the early history and current proliferation of computer viruses that occur on Macintosh and DOS personal computers, mentions virus detection programs, and offers suggestions for how libraries can protect themselves and their users from damage by computer viruses. (LRW)

  18. Tribology and coatings

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-06-01

    The future use of fuel-efficient, low-emission, advanced transportation systems (for example, those using low-heat-rejection diesel engines or advanced gas turbines) presents new challenges to tribologists and materials scientists. High service temperatures, corrosive environments, and extreme contact pressures are among the concerns that make necessary new tribological designs, novel materials, and effective lubrication concepts. Argonne is working on methods to reduce friction, wear and corrosion, such as soft metal coatings on ceramics, layered compounds, diamond coatings, and hard surfaces.

  19. Active Packaging Coatings

    Directory of Open Access Journals (Sweden)

    Luis J. Bastarrachea

    2015-11-01

    Full Text Available Active food packaging involves the packaging of foods with materials that provide an enhanced functionality, such as antimicrobial, antioxidant or biocatalytic functions. This can be achieved through the incorporation of active compounds into the matrix of the commonly used packaging materials, or by the application of coatings with the corresponding functionality through surface modification. The latter option offers the advantage of preserving the packaging materials’ bulk properties nearly intact. Herein, different coating technologies like embedding for controlled release, immobilization, layer-by-layer deposition, and photografting are explained and their potential application for active food packaging is explored and discussed.

  20. Mechanically Invisible Polymer Coatings

    DEFF Research Database (Denmark)

    2014-01-01

    phase comprises particles, said particles comprising a filler material and an encapsulating coating of a second polymeric material, wherein the backbones of the first and second polymeric materials are the same. The composition may be used in electroactive polymers (EAPs) in order to obtain mechanically......The present invention relates to a composition comprising encapsulated particles in a polymeric material. The composition comprises a continuous phase and a discontinuous phase incorporated therein, wherein the continuous phase comprises a first polymeric material and wherein the discontinuous...... invisible polymer coatings....

  1. Methods and means for coating paper by film coating

    NARCIS (Netherlands)

    van der Maarel, Marc; Ter Veer, Arend Berend Cornelis; Vrieling-Smit, Annet; Delnoye, Pierre

    2015-01-01

    This invention relates to the field of paper coating, more in particular to means and methods for providing paper with at least one layer of pigment using film coating to obtain a well printable surface. Provided is a method for preparing coated paper comprising the steps of: a) providing a

  2. Dengue virus receptor

    OpenAIRE

    Hidari, Kazuya I.P.J.; Suzuki, Takashi

    2011-01-01

    Dengue virus is an arthropod-borne virus transmitted by Aedes mosquitoes. Dengue virus causes fever and hemorrhagic disorders in humans and non-human primates. Direct interaction of the virus introduced by a mosquito bite with host receptor molecule(s) is crucial for virus propagation and the pathological progression of dengue diseases. Therefore, elucidation of the molecular mechanisms underlying the interaction between dengue virus and its receptor(s) in both humans and mosquitoes is essent...

  3. Computer Virus and Trends

    OpenAIRE

    Tutut Handayani; Soenarto Usna,Drs.MMSI

    2004-01-01

    Since its appearance the first time in the mid-1980s, computer virus has invited various controversies that still lasts to this day. Along with the development of computer systems technology, viruses komputerpun find new ways to spread itself through a variety of existing communications media. This paper discusses about some things related to computer viruses, namely: the definition and history of computer viruses; the basics of computer viruses; state of computer viruses at this time; and ...

  4. AntiReflection Coating D

    International Nuclear Information System (INIS)

    AIKEN, DANIEL J.

    1999-01-01

    Analytical expressions used to optimize AR coatings for single junction solar cells are extended for use in monolithic, series interconnected multi-junction solar cell AR coating design. The result is an analytical expression which relates the solar cell performance (through J(sub sc)) directly to the AR coating design through the device reflectance. It is also illustrated how AR coating design be used to provide an additional degree of freedom for current matching multi-junction devices

  5. UV Coatings, Polarization, and Coronagraphy

    Science.gov (United States)

    Bolcar, Matthew R.; Quijada, Manuel; West, Garrett; Balasubramanian, Bala; Krist, John; Martin, Stefan; Sabatke, Derek

    2016-01-01

    Presenation for the Large UltraViolet Optical Infrared (LUVOIR) and Habitable Exoplanet Imager (HabEx) Science and Technology Definition Teams (STDT) on technical considerations regarding ultraviolet coatings, polarization, and coronagraphy. The presentations review the state-of-the-art in ultraviolet coatings, how those coatings generate polarization aberrations, and recent study results from both the LUVOIR and HabEx teams.

  6. Coatings for transport industry

    Directory of Open Access Journals (Sweden)

    Krzysztof LUKASZKOWICZ

    2014-09-01

    Full Text Available The investigations concerned structural analysis, as well as mechanical properties and wear resistant of MeN/DLC double-layer coating deposited by hybrid PVD/PACVD method. In sliding dry friction conditions, after the break-in time, the friction coefficient for the investigated elements is set in the range between 0.03-0.06.

  7. Ion Deposited Carbon Coatings.

    Science.gov (United States)

    1983-07-01

    PAGE ("’hen Dita t,,I,, efl TABLE OF CONTENTS Section No. Title Page No. 1.0 OBJECTIVE 1 2.0 SCOPE 2 3.0 BACKGROUND 3 4.0 COATINGS DEPOSITION 4 4.1...scientific, ards of measure. The Committee, and Confer- technical, practical, and teaching purposes.ence voting members, are leading professional On the

  8. Polydopamine-coated capsules

    Science.gov (United States)

    White, Scott R.; Sottos, Nancy R.; Kang, Sen; Baginska, Marta B.

    2018-04-17

    One aspect of the invention is a polymer material comprising a capsule coated with PDA. In certain embodiments, the capsule encapsulates a functional agent. The encapsulated functional agent may be an indicating agent, healing agent, protecting agent, pharmaceutical drug, food additive, or a combination thereof.

  9. Identification and characterization of the SSB1 locus involved in symptom development by Spring beauty latent virus infection in Arabidopsis thaliana.

    Science.gov (United States)

    Fujisaki, Koki; Hagihara, Fumi; Azukawa, Yoshihiro; Kaido, Masanori; Okuno, Tetsuro; Mise, Kazuyuki

    2004-09-01

    The natural variation of Arabidopsis thaliana in response to a bromovirus, Spring beauty latent virus (SBLV), was examined. Of 63 Arabidopsis accessions tested, all were susceptible when inoculated with SBLV, although there was a large degree of variation in symptom development. Most accessions, including Columbia (Col-0), were symptomless or developed only mild symptoms, but four accessions, including S96, showed severe symptoms of SBLV infection. Genetic analysis suggested that the difference in the responses of Col-0 and S96 to SBLV was controlled by a single semidominant locus. We have designated this locus SSB1 (symptom development by SBLV infection). By using genetic markers, SSB1 was mapped to chromosome IV. The patterns of distribution and accumulation of SBLV in sensitive accessions were similar to those in the insensitive accessions. In addition, symptom development in S96 by SBLV infection was critically interrupted by the presence of the NahG gene, which encodes salicylic acid (SA) hydroxylase. These data suggest that symptom development in A. thaliana controlled by SSB1 is independent of the efficiency of SBLV multiplication and is dependent on SA signaling.

  10. Active coatings technologies for tailorable military coating systems

    Science.gov (United States)

    Zunino, J. L., III

    2007-04-01

    The main objective of the U.S. Army's Active Coatings Technologies Program is to develop technologies that can be used in combination to tailor coatings for utilization on Army Materiel. The Active Coatings Technologies Program, ACT, is divided into several thrusts, including the Smart Coatings Materiel Program, Munitions Coatings Technologies, Active Sensor packages, Systems Health Monitoring, Novel Technology Development, as well as other advanced technologies. The goal of the ACT Program is to conduct research leading to the development of multiple coatings systems for use on various military platforms, incorporating unique properties such as self repair, selective removal, corrosion resistance, sensing, ability to modify coatings' physical properties, colorizing, and alerting logistics staff when tanks or weaponry require more extensive repair. A partnership between the U.S. Army Corrosion Office at Picatinny Arsenal, NJ along with researchers at the New Jersey Institute of Technology, NJ, Clemson University, SC, University of New Hampshire, NH, and University of Massachusetts (Lowell), MA, are developing the next generation of Smart Coatings Materiel via novel technologies such as nanotechnology, Micro-electromechanical Systems (MEMS), meta-materials, flexible electronics, electrochromics, electroluminescence, etc. This paper will provide the reader with an overview of the Active Coatings Technologies Program, including an update of the on-going Smart Coatings Materiel Program, its progress thus far, description of the prototype Smart Coatings Systems and research tasks as well as future nanotechnology concepts, and applications for the Department of Defense.

  11. Identification and Characterization of Citrus tristeza virus Isolates Breaking Resistance in Trifoliate Orange in California.

    Science.gov (United States)

    Yokomi, Raymond K; Selvaraj, Vijayanandraj; Maheshwari, Yogita; Saponari, Maria; Giampetruzzi, Annalisa; Chiumenti, Michela; Hajeri, Subhas

    2017-07-01

    Most Citrus tristeza virus (CTV) isolates in California are biologically mild and symptomless in commercial cultivars on CTV tolerant rootstocks. However, to better define California CTV isolates showing divergent serological and genetic profiles, selected isolates were subjected to deep sequencing of small RNAs. Full-length sequences were assembled, annotated and trifoliate orange resistance-breaking (RB) isolates of CTV were identified. Phylogenetic relationships based on their full genomes placed three isolates in the RB clade: CA-RB-115, CA-RB-AT25, and CA-RB-AT35. The latter two isolates were obtained by aphid transmission from Murcott and Dekopon trees, respectively, containing CTV mixtures. The California RB isolates were further distinguished into two subclades. Group I included CA-RB-115 and CA-RB-AT25 with 99% nucleotide sequence identity with RB type strain NZRB-G90; and group II included CA-RB-AT35 with 99 and 96% sequence identity with Taiwan Pumelo/SP/T1 and HA18-9, respectively. The RB phenotype was confirmed by detecting CTV replication in graft-inoculated Poncirus trifoliata and transmission from P. trifoliata to sweet orange. The California RB isolates induced mild symptoms compared with severe isolates in greenhouse indexing tests. Further examination of 570 CTV accessions, acquired from approximately 1960 and maintained in planta at the Central California Tristeza Eradication Agency, revealed 16 RB positive isolates based on partial p65 sequences. Six isolates collected from 1992 to 2011 from Tulare and Kern counties were CA-RB-115-like; and 10 isolates collected from 1968 to 2010 from Riverside, Fresno, and Kern counties were CA-RB-AT35-like. The presence of the RB genotype is relevant because P. trifoliata and its hybrids are the most popular rootstocks in California.

  12. Role of the 25-26 nt siRNA in the resistance of transgenic Prunus domestica graft inoculated with plum pox virus.

    Science.gov (United States)

    Kundu, Jiban Kumar; Briard, Pascal; Hily, Jean Michel; Ravelonandro, Michel; Scorza, Ralph

    2008-02-01

    The reaction of a genetically engineered plum clone (C5) resistant to plum pox virus (PPV) by graft inoculation with the virus was evaluated. The resistance in this clone has been demonstrated to be mediated through post-transcriptional gene silencing (PTGS). A single C5 plant out of 30 plants inoculated with PPV M strain by double chip-budding showed mild diffuse mosaic 'Sharka' symptom at the bottom section of the scion. The upper leaves of this PPV-infected C5 plant remained symptomless and the virus was not detected in them by either DAS-ELISA or RT-PCR. An RNA silencing associated small interfering RNA duplex, siRNA (21-26 nt), was detected in non-inoculated C5 plants and in the portions of inoculated C5 plant in which PPV could not be detected. In the PPV-infected portion of the C5 plant and in C6 PPV susceptible plants only the approximately 21-22 nt siRNAs was detected. Cytosine-methylation was confirmed in C5 plants both uninfected and showing PPV symptoms. The 25-26 nt siRNA normally present in C5 was absent in PPV-infected C5 tissues confirming the critical role of this siRNA in the resistance of clone C5 to PPV infection. We also show that this PPV infection was limited and transient. It was only detected in one plant at one of four post-dormancy sampling dates and did not appear to affect the overall PPV resistance of the C5 clone.

  13. Coat protein-mediated resistance against an Indian isolate of the ...

    Indian Academy of Sciences (India)

    Coat protein (CP)-mediated resistance against an Indian isolate of the Cucumber mosaic virus (CMV) subgroup IB was demonstrated in transgenic lines of Nicotiana benthamiana through Agrobacterium tumefaciens-mediated transformation. Out of the fourteen independently transformed lines developed, two lines were ...

  14. Role of Charge Regulation and Size Polydispersity in Nanoparticle Encapsulation by Viral Coat Proteins

    NARCIS (Netherlands)

    Kusters, Remy; Lin, Hsiang-Ku; Zandi, Roya; Tsvetkova, Irina; Dragnea, Bogdan; van der Schoot, Paul

    2015-01-01

    Nanoparticles can be encapsulated by virus coat proteins if their surfaces are functionalized to acquire a sufficiently large negative charge. A minimal surface charge is required to overcome (i) repulsive interactions between the positively charged RNA-binding domains on the proteins and (ii) the

  15. Biological effects of rAAV-caAlk2 coating on structural allograft healing

    DEFF Research Database (Denmark)

    Koefoed, Mette; Ito, Hiromu; Gromov, Kirill

    2005-01-01

    Structural bone allografts often fracture due to their lack of osteogenic and remodeling potential. To overcome these limitations, we utilized allografts coated with recombinant adeno-associated virus (rAAV) that mediate in vivo gene transfer. Using beta-galactosidase as a reporter gene, we show...

  16. carbon coated copper grids

    African Journals Online (AJOL)

    PRECIOUS

    2009-11-02

    Nov 2, 2009 ... Structure, Academic Press Inc (London) Ltd., London. Hemmes JH, Winkler KC, Kool SM (1960). Virus survival as a seasonal factor in influenza and poliomyelitis. Nature, 188: 430-431. Ijaz MK (1985). Studies on the airborne survival of rotaviruses and a human coronavirus. Ph.D. thesis, Univ. of Ottawa, ...

  17. New temperable solar coatings: Tempsol

    Science.gov (United States)

    Demiryont, Hulya

    2001-11-01

    This paper deals with the large area deposition and coating properties of the thermo-stable (temperable/bendable) solar coating material, CuO, and some new optical coating systems comprising CuO films for architectural and automotive/transportation applications. The CuO solar coating is combined with other coating layers, for example, an anti-reflection film, a reflection film, a coloration coating layer, etc., which are also thermo-stable. The film systems are developed at the research laboratory by D.C. Magnetron reactive sputtering process. The new developed technologies then transferred to the production line. Product performances are compared before and after heat treatment of the coating systems. Performance tables and other physical properties, including optical parameters, mechanical and environmental stability, storage properties, etc., are also presented for this new product series.

  18. Flow accelerated organic coating degradation

    Science.gov (United States)

    Zhou, Qixin

    Applying organic coatings is a common and the most cost effective way to protect metallic objects and structures from corrosion. Water entry into coating-metal interface is usually the main cause for the deterioration of organic coatings, which leads to coating delamination and underfilm corrosion. Recently, flowing fluids over sample surface have received attention due to their capability to accelerate material degradation. A plethora of works has focused on the flow induced metal corrosion, while few studies have investigated the flow accelerated organic coating degradation. Flowing fluids above coating surface affect corrosion by enhancing the water transport and abrading the surface due to fluid shear. Hence, it is of great importance to understand the influence of flowing fluids on the degradation of corrosion protective organic coatings. In this study, a pigmented marine coating and several clear coatings were exposed to the laminar flow and stationary immersion. The laminar flow was pressure driven and confined in a flow channel. A 3.5 wt% sodium chloride solution and pure water was employed as the working fluid with a variety of flow rates. The corrosion protective properties of organic coatings were monitored inline by Electrochemical Impedance Spectroscopy (EIS) measurement. Equivalent circuit models were employed to interpret the EIS spectra. The time evolution of coating resistance and capacitance obtained from the model was studied to demonstrate the coating degradation. Thickness, gloss, and other topography characterizations were conducted to facilitate the assessment of the corrosion. The working fluids were characterized by Fourier Transform Infrared Spectrometer (FTIR) and conductivity measurement. The influence of flow rate, fluid shear, fluid composition, and other effects in the coating degradation were investigated. We conclude that flowing fluid on the coating surface accelerates the transport of water, oxygen, and ions into the coating, as

  19. The molecular basis of the antigenic cross-reactivity between measles and cowpea mosaic viruses

    International Nuclear Information System (INIS)

    Olszewska, Wieslawa; Steward, Michael W.

    2003-01-01

    Two nonrelated viruses, cowpea mosaic virus (wtCPMV) and measles virus (MV), were found to induce cross-reactive antibodies. The nature of this cross-reactivity was studied and results are presented here demonstrating that antiserum raised against wtCPMV reacted with peptide from the fusion (F) protein of MV. Furthermore, the F protein of MV was shown to share an identical conformational B cell epitope with the small subunit of CPMV coat protein. Passive transfer of anti-wtCPMV antibodies into BALB/c mice conferred partial protection against measles virus induced encephalitis. The results are discussed in the context of cross-protection

  20. Coating of metals

    International Nuclear Information System (INIS)

    Smith, F.

    1978-01-01

    A method is described for coating the surface of an article of Ti, Zr or Ta, or an alloy thereof, with a tinning metal or alloy, the article having a shape other than that of a sheet. The method comprises contacting the surface of the article at an elevated temperature with the molten tinning metal and moving an ultrasonically excited probe over the surface to be coated, the probe being in contact with the surface of the article and with the tinning metal. The tinning metal may be Sn or Zn or a binary alloy of Sn with Zn, Cd or Bi at a temperature of 300 0 to 450 0 C. The head of the probe may be shaped to conform with the surface of the article. The method may be used to form composite articles, and may be applied to a pre-tinned steel article. (U.K.)

  1. Coat of Arms.

    Science.gov (United States)

    Smith, Bryan

    1998-01-01

    Describes an activity, the "coat of arms," that can serve as an ice-breaker or warm-up for the first day of an English-as-a-Second/Foreign-Language class, as a motivating start to the week, or act as an innovative segue between skill lessons. The technique can be adapted for students ranging from elementary school to adult language learners of all…

  2. Scientific coats of arms.

    Science.gov (United States)

    Fara, Patricia

    2005-09-01

    With their mythical creatures and arcane symbolism, coats of arms seem to have little connection with modern science. Yet despite its chivalric origins, the ancient language of heraldry has long fascinated famous scientists. Although this idiosyncratic tradition was parodied by Victorian geologists, who laughingly replaced unicorns and griffins with images of dinosaurs that they had recently discovered, it has been perpetuated since by Ernest Rutherford, who liked to present himself as a new alchemist.

  3. Anti-Corrosion Coating

    Science.gov (United States)

    1986-01-01

    SuperSpan RM 8000 is an anti-corrosion coating which effectively counteracts acid degradation, abrasive wear, and cracking in power industry facilities. It was developed by RM Industrial Products Company, Inc. with NERAC assistance. It had previously been necessary to shut down plants to repair or replace corroded duct-work in coal burning utilities. NASA-developed technology was especially useful in areas relating to thermoconductivity of carbon steel and the bonding characteristics of polymers. The product has sold well.

  4. Epstein - Barr Virus

    OpenAIRE

    Štorkánová, Lenka

    2011-01-01

    Epstein-Barr virus Bachelor thesis summarizes the findings of Epstein-Barr virus (EBV), its general characteristics, transmission and spread of the virus, symptoms of disease and subsequent therapy and recovery. More specifically, it focuses on infectious mononucleosis, as well as more generally to other diseases, which the Epstein-Barr virus causes. It includes details of the vaccine against EB virus. There are the statistics on the incidence of infectious mononucleosis.

  5. for zeolite coating

    Directory of Open Access Journals (Sweden)

    Carlos Renato Rambo

    2006-01-01

    Full Text Available Biotemplating is the processing of microcellular ceramics by reproduction of natural morphologies, where the microstructural features of the biotemplate are maintained in the biomorphic ceramic. Different biotemplates with distinct pore anatomies were used to produce biomorphic supports for the zeolite coating: wood, cardboard, sea-sponge and sisal. The biomorphic ceramics were produced by distinguished processing routes: Al-gas infiltration-reaction, liquid-metal infiltration, dip-coating and sol-gel synthesis, in order to produce nitrides, carbides and oxides, depending on the processing conditions. The zeolite coating was performed by hydrothermal growth of MFI-type (Silicalite-1 and ZSM-5 zeolite crystals onto the internal pore walls of the biomorphic templates. The final biomorphic ceramic-zeolite composites were physically characterized, evaluated in terms of their gas adsorption capabilities and correlated to their microstructure and specific pore anatomy. The combination of the properties of the biomorphic ceramics with the adsorption properties of zeolites results in materials with distinct properties as potential candidates for adsorption and catalytic applications due to their characteristic porosity, molecular sieving capabilities and high thermo-mechanical strength.

  6. Expression and Purification of Coat Protein of Citrus Tristeza Virus ...

    African Journals Online (AJOL)

    5' TCA ACG TGT GTT AAA TTT CCC AAG C 3') and cloned into TOPO vector and transformed to TOP10 E. coli competent cell. Six colonies of TOP10 E. coli were selected and checked for the appropriate insertion of cp gene with PCR.

  7. Expression and Purification of Coat Protein of Citrus Tristeza Virus ...

    African Journals Online (AJOL)

    Ethiopian Institute of Agricultural Research, P.O. Box 436 Nazareth, Ethiopia ... Citrus is one of the major fruit crop in Thailand and in present day production value of ..... The QIAexpressionist™ A handbook for high-level expression and ... application of a multiplex reverse-transcription polymerase chain reaction assay for.

  8. Coating and curing apparatus and methods

    Science.gov (United States)

    Brophy, Brenor L; Maghsoodi, Sina; Neyman, Patrick J; Gonsalves, Peter R; Hirsch, Jeffrey G; Yang, Yu S

    2015-02-24

    Disclosed are coating apparatus including flow coating and roll-coating that may be used for uniform sol-gel coating of substrates such as glass, solar panels, windows or part of an electronic display. Also disclosed are methods for substrate preparation, flow coating and roll coating. Lastly systems and methods for skin curing sol-gel coatings deposited onto the surface of glass substrates using a high temperature air-knife are disclosed.

  9. Lotus Dust Mitigation Coating and Molecular Adsorber Coating

    Science.gov (United States)

    O'Connor, Kenneth M.; Abraham, Nithin S.

    2015-01-01

    NASA Goddard Space Flight Center has developed two unique coating formulations that will keep surfaces clean and sanitary and contain contaminants.The Lotus Dust Mitigation Coating, modeled after the self-cleaning, water-repellant lotus leaf, disallows buildup of dust, dirt, water, and more on surfaces. This coating, has been successfully tested on painted, aluminum, glass, silica, and some composite surfaces, could aid in keeping medical assets clean.The Molecular Adsorber Coating is a zeolite-based, sprayable molecular adsorber coating, designed to prevent outgassing in materials in vacuums. The coating works well to adsorb volatiles and contaminates in manufacturing and processing, such as in pharmaceutical production. The addition of a biocide would also aid in controlling bacteria levels.

  10. 'Let the phage do the work': Using the phage P22 coat protein structures as a framework to understand its folding and assembly mutants

    International Nuclear Information System (INIS)

    Teschke, Carolyn M.; Parent, Kristin N.

    2010-01-01

    The amino acid sequence of viral capsid proteins contains information about their folding, structure and self-assembly processes. While some viruses assemble from small preformed oligomers of coat proteins, other viruses such as phage P22 and herpesvirus assemble from monomeric proteins (Fuller and King, 1980). The subunit assembly process is strictly controlled through protein:protein interactions such that icosahedral structures are formed with specific symmetries, rather than aberrant structures. dsDNA viruses commonly assemble by first forming a precursor capsid that serves as a DNA packaging machine. DNA packaging is accompanied by a conformational transition of the small precursor procapsid into a larger capsid for isometric viruses. Here we highlight the pseudo-atomic structures of phage P22 coat protein and rationalize several decades of data about P22 coat protein folding, assembly and maturation generated from a combination of genetics and biochemistry.

  11. Composition superconductive plumbous coatings

    International Nuclear Information System (INIS)

    Volodin, V.N.; Tuleushev, A.Zh.; Tuleushev, Yu.Zh.; Lisizin, V.N.

    2002-01-01

    Independent dispersion of two or more targets, precipitation of pulverized material on substrate and possibility of composition change in wide range of component concentrations made possible ion-plasma forming of film composition materials from materials with different chemical and physical qualities, particularly in lead-aluminum, lead-beryllium and lead-graphite systems. Named systems are characterized in wide sphere of immiscibility in solid and liquid state and absence of intermediate compounds. It is impossible to receive materials from them in traditional method in conditions of gravitational field. In lead-aluminum system there was received a number of film coatings with aluminum content up to 95 at. % at coating thickness up to 2 μm. Owing to X-ray investigations it is fixed that lead and aluminum have been performed by separate phases. Lead in sprayed layer represents well-crystallized phase with grain size more than 100 nm; texturing is not found. Study of physical qualities has shown that materials with lead base 21.6 at. % Al) have enough high crystalline current in comparison with compact lead, which reaches (2.5-3.0)·10 5 A)·cm 2 , while materials with aluminum base (21.6 at. % Al) loose this effect and critical temperature of transition is reduced from 7.1 to 5.8 K. It was impossible to carry out X-rayed analysis for lead-beryllium film because of weak intensity of beryllium lines against a background of lead owing to a quite large difference of atomic balance. Cryogen tests have shown the increase of critical current strength up to (3.1-3.6)·10 4 A)·cm 2 or composition coating of lead-beryllium (56.99 at. % or 5,45 mas. % Be), at that the critical temperature of transition does not differ from lead temperature. Samples of lead edge of state diagram have been received in the lead-graphite system. X-ray investigation subjected coating contained 6.81 at. % (55.82 mas. %) of lead. Choice of the composition is conditioned on possibilities of

  12. Analysis of the solvent accessibility of cysteine residues on Maize rayado fino virus virus-like particles produced in Nicotiana benthamiana plants and cross-linking of peptides to VLPs.

    Science.gov (United States)

    Natilla, Angela; Hammond, Rosemarie W

    2013-02-14

    Mimicking and exploiting virus properties and physicochemical and physical characteristics holds promise to provide solutions to some of the world's most pressing challenges. The sheer range and types of viruses coupled with their intriguing properties potentially give endless opportunities for applications in virus-based technologies. Viruses have the ability to self- assemble into particles with discrete shape and size, specificity of symmetry, polyvalence, and stable properties under a wide range of temperature and pH conditions. Not surprisingly, with such a remarkable range of properties, viruses are proposed for use in biomaterials, vaccines, electronic materials, chemical tools, and molecular electronic containers. In order to utilize viruses in nanotechnology, they must be modified from their natural forms to impart new functions. This challenging process can be performed through several mechanisms including genetic modification of the viral genome and chemically attaching foreign or desired molecules to the virus particle reactive groups. The ability to modify a virus primarily depends upon the physiochemical and physical properties of the virus. In addition, the genetic or physiochemical modifications need to be performed without adversely affecting the virus native structure and virus function. Maize rayado fino virus (MRFV) coat proteins self-assemble in Escherichia coli producing stable and empty VLPs that are stabilized by protein-protein interactions and that can be used in virus-based technologies applications. VLPs produced in tobacco plants were examined as a scaffold on which a variety of peptides can be covalently displayed. Here, we describe the steps to 1) determine which of the solvent-accessible cysteines in a virus capsid are available for modification, and 2) bioconjugate peptides to the modified capsids. By using native or mutationally-inserted amino acid residues and standard coupling technologies, a wide variety of materials have been

  13. Properties of a virus causing mosaic and leaf curl disease of Celosia argentea L. in Nigeria.

    Science.gov (United States)

    Owolabi, T A; Taiwo, M A; Thottappilly, G A; Shoyinka, S A; Proll, E; Rabenstein, F

    1998-06-01

    A sap transmissible virus, causing mosaic and leaf curl disease of Celosia argentea, was isolated at vegetable farms in Amuwo Odofin, Tejuoso, and Abule Ado, Lagos, Nigeria. The virus had a restricted host range confined to a few species of the Amaranthaceae, Chenopodiaceae and Solanaceae families. It failed to infect several other species of the Aizoaceae, Brassicaceae, Cucurbitaceae, Fabaceae, Lamiaceae, Malvaceae, Poaceae and Tiliaceae families. The virus was transmitted in a non-persistent manner by Aphis spiraecola and Toxoptera citricidus but not by eight other aphid species tested. There was no evidence of transmission by seeds of C. argentae varieties. The viral coat protein had a relative molecular mass (M(r)) of about 30.2 K. Electron microscopy of purified virus preparations revealed flexuous rod shaped particles of about 750 nm in length. Serological studies were performed using the enzyme-linked immunosorbent assay (ELISA), immunosorbent electron microscopy (ISEM) and Western blot analysis. The virus reacted positively with an universal potyvirus group monoclonal antibody (MoAb) and MoAb P-3-3H8 raised against peanut stripe potyvirus. It also reacted with polyclonal antibodies raised against several potyviruses including asparagus virus-1 (AV-1), turnip mosaic virus (TuMV), maize dwarf mosaic virus (MDMV), watermelon mosaic virus (WMV-2), plum pox virus (PPV), soybean mosaic virus (SoyMV), lettuce mosaic virus (LMV), bean common mosaic virus (BCMV) and beet mosaic virus (BMV) in at least one of the serological assays used. On the basis of host range, mode of transmission, and available literature data, the celosia virus seems to be different from potyviruses previously reported to infect vegetables in Nigeria. The name celosia mosaic virus (CIMV) has been proposed for this virus.

  14. Effect of Osmotic Pressure on the Stability of Whole Inactivated Influenza Vaccine for Coating on Microneedles.

    Directory of Open Access Journals (Sweden)

    Hyo-Jick Choi

    Full Text Available Enveloped virus vaccines can be damaged by high osmotic strength solutions, such as those used to protect the vaccine antigen during drying, which contain high concentrations of sugars. We therefore studied shrinkage and activity loss of whole inactivated influenza virus in hyperosmotic solutions and used those findings to improve vaccine coating of microneedle patches for influenza vaccination. Using stopped-flow light scattering analysis, we found that the virus underwent an initial shrinkage on the order of 10% by volume within 5 s upon exposure to a hyperosmotic stress difference of 217 milliosmolarity. During this shrinkage, the virus envelope had very low osmotic water permeability (1 - 6×10-4 cm s-1 and high Arrhenius activation energy (Ea = 15.0 kcal mol-1, indicating that the water molecules diffused through the viral lipid membranes. After a quasi-stable state of approximately 20 s to 2 min, depending on the species and hypertonic osmotic strength difference of disaccharides, there was a second phase of viral shrinkage. At the highest osmotic strengths, this led to an undulating light scattering profile that appeared to be related to perturbation of the viral envelope resulting in loss of virus activity, as determined by in vitro hemagglutination measurements and in vivo immunogenicity studies in mice. Addition of carboxymethyl cellulose effectively prevented vaccine activity loss in vitro and in vivo, believed to be due to increasing the viscosity of concentrated sugar solution and thereby reducing osmotic stress during coating of microneedles. These results suggest that hyperosmotic solutions can cause biphasic shrinkage of whole inactivated influenza virus which can damage vaccine activity at high osmotic strength and that addition of a viscosity enhancer to the vaccine coating solution can prevent osmotically driven damage and thereby enable preparation of stable microneedle coating formulations for vaccination.

  15. Nanoparticle/Polymer Nanocomposite Bond Coat or Coating

    Science.gov (United States)

    Miller, Sandi G.

    2011-01-01

    This innovation addresses the problem of coatings (meant to reduce gas permeation) applied to polymer matrix composites spalling off in service due to incompatibility with the polymer matrix. A bond coat/coating has been created that uses chemically functionalized nanoparticles (either clay or graphene) to create a barrier film that bonds well to the matrix resin, and provides an outstanding barrier to gas permeation. There is interest in applying clay nanoparticles as a coating/bond coat to a polymer matrix composite. Often, nanoclays are chemically functionalized with an organic compound intended to facilitate dispersion of the clay in a matrix. That organic modifier generally degrades at the processing temperature of many high-temperature polymers, rendering the clay useless as a nano-additive to high-temperature polymers. However, this innovation includes the use of organic compounds compatible with hightemperature polymer matrix, and is suitable for nanoclay functionalization, the preparation of that clay into a coating/bondcoat for high-temperature polymers, the use of the clay as a coating for composites that do not have a hightemperature requirement, and a comparable approach to the preparation of graphene coatings/bond coats for polymer matrix composites.

  16. Virus-Vectored Influenza Virus Vaccines

    Science.gov (United States)

    Tripp, Ralph A.; Tompkins, S. Mark

    2014-01-01

    Despite the availability of an inactivated vaccine that has been licensed for >50 years, the influenza virus continues to cause morbidity and mortality worldwide. Constant evolution of circulating influenza virus strains and the emergence of new strains diminishes the effectiveness of annual vaccines that rely on a match with circulating influenza strains. Thus, there is a continued need for new, efficacious vaccines conferring cross-clade protection to avoid the need for biannual reformulation of seasonal influenza vaccines. Recombinant virus-vectored vaccines are an appealing alternative to classical inactivated vaccines because virus vectors enable native expression of influenza antigens, even from virulent influenza viruses, while expressed in the context of the vector that can improve immunogenicity. In addition, a vectored vaccine often enables delivery of the vaccine to sites of inductive immunity such as the respiratory tract enabling protection from influenza virus infection. Moreover, the ability to readily manipulate virus vectors to produce novel influenza vaccines may provide the quickest path toward a universal vaccine protecting against all influenza viruses. This review will discuss experimental virus-vectored vaccines for use in humans, comparing them to licensed vaccines and the hurdles faced for licensure of these next-generation influenza virus vaccines. PMID:25105278

  17. Modeling of Thermal Barrier Coatings

    Science.gov (United States)

    Ferguson, B. L.; Petrus, G. J.; Krauss, T. M.

    1992-01-01

    The project examined the effectiveness of studying the creep behavior of thermal barrier coating system through the use of a general purpose, large strain finite element program, NIKE2D. Constitutive models implemented in this code were applied to simulate thermal-elastic and creep behavior. Four separate ceramic-bond coat interface geometries were examined in combination with a variety of constitutive models and material properties. The reason for focusing attention on the ceramic-bond coat interface is that prior studies have shown that cracking occurs in the ceramic near interface features which act as stress concentration points. The model conditions examined include: (1) two bond coat coefficient of thermal expansion curves; (2) the creep coefficient and creep exponent of the bond coat for steady state creep; (3) the interface geometry; and (4) the material model employed to represent the bond coat, ceramic, and superalloy base.

  18. Tablet coating by injection molding technology - Optimization of coating formulation attributes and coating process parameters.

    Science.gov (United States)

    Desai, Parind M; Puri, Vibha; Brancazio, David; Halkude, Bhakti S; Hartman, Jeremy E; Wahane, Aniket V; Martinez, Alexander R; Jensen, Keith D; Harinath, Eranda; Braatz, Richard D; Chun, Jung-Hoon; Trout, Bernhardt L

    2018-01-01

    We developed and evaluated a solvent-free injection molding (IM) coating technology that could be suitable for continuous manufacturing via incorporation with IM tableting. Coating formulations (coating polymers and plasticizers) were prepared using hot-melt extrusion and screened via stress-strain analysis employing a universal testing machine. Selected coating formulations were studied for their melt flow characteristics. Tablets were coated using a vertical injection molding unit. Process parameters like softening temperature, injection pressure, and cooling temperature played a very important role in IM coating processing. IM coating employing polyethylene oxide (PEO) based formulations required sufficient room humidity (>30% RH) to avoid immediate cracks, whereas other formulations were insensitive to the room humidity. Tested formulations based on Eudrajit E PO and Kollicoat IR had unsuitable mechanical properties. Three coating formulations based on hydroxypropyl pea starch, PEO 1,000,000 and Opadry had favorable mechanical (35% elongation, >95×10 4 J/m 3 toughness) and melt flow (>0.4g/min) characteristics, that rendered acceptable IM coats. These three formulations increased the dissolution time by 10, 15 and 35min, respectively (75% drug release), compared to the uncoated tablets (15min). Coated tablets stored in several environmental conditions remained stable to cracking for the evaluated 8-week time period. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Aptasensor development for detection of virus in water

    DEFF Research Database (Denmark)

    Kirkegaard, Julie

    of three types of waterborne viruses: norovirus, rotavirus and hepatitis A virus. The development of the aptasensor involved sample preparation for aptamer selection of rotavirus and hepatitis A virus, an iterative design process of the aptasensor, investigation of the surface immobilisation of aptamers...... and finally an impedimetric electrical characterisation of the sensor. The sample preparation of the rotavirus was based on purification and biotinylation of the virus to meet the requirements of the aptamer selection process. The selection process, performed by an external collaborator, was based...... on streptavidin coated magnetic bead separation, hence the needed biotinylation. It was found that the BPH linker gave the highest yield when the biotinylated rotavirus were immobilised onto the beads. The design of the viral aptasensor was determined by an iterative design process. The final chip design...

  20. Viruses infecting reptiles.

    Science.gov (United States)

    Marschang, Rachel E

    2011-11-01

    A large number of viruses have been described in many different reptiles. These viruses include arboviruses that primarily infect mammals or birds as well as viruses that are specific for reptiles. Interest in arboviruses infecting reptiles has mainly focused on the role reptiles may play in the epidemiology of these viruses, especially over winter. Interest in reptile specific viruses has concentrated on both their importance for reptile medicine as well as virus taxonomy and evolution. The impact of many viral infections on reptile health is not known. Koch's postulates have only been fulfilled for a limited number of reptilian viruses. As diagnostic testing becomes more sensitive, multiple infections with various viruses and other infectious agents are also being detected. In most cases the interactions between these different agents are not known. This review provides an update on viruses described in reptiles, the animal species in which they have been detected, and what is known about their taxonomic positions.

  1. Viruses Infecting Reptiles

    Directory of Open Access Journals (Sweden)

    Rachel E. Marschang

    2011-11-01

    Full Text Available A large number of viruses have been described in many different reptiles. These viruses include arboviruses that primarily infect mammals or birds as well as viruses that are specific for reptiles. Interest in arboviruses infecting reptiles has mainly focused on the role reptiles may play in the epidemiology of these viruses, especially over winter. Interest in reptile specific viruses has concentrated on both their importance for reptile medicine as well as virus taxonomy and evolution. The impact of many viral infections on reptile health is not known. Koch’s postulates have only been fulfilled for a limited number of reptilian viruses. As diagnostic testing becomes more sensitive, multiple infections with various viruses and other infectious agents are also being detected. In most cases the interactions between these different agents are not known. This review provides an update on viruses described in reptiles, the animal species in which they have been detected, and what is known about their taxonomic positions.

  2. Article Including Environmental Barrier Coating System

    Science.gov (United States)

    Lee, Kang N. (Inventor)

    2015-01-01

    An enhanced environmental barrier coating for a silicon containing substrate. The enhanced barrier coating may include a bond coat doped with at least one of an alkali metal oxide and an alkali earth metal oxide. The enhanced barrier coating may include a composite mullite bond coat including BSAS and another distinct second phase oxide applied over said surface.

  3. Coatings for fusion reactor environments

    International Nuclear Information System (INIS)

    Mattox, D.M.

    1979-01-01

    The internal surfaces of a tokamak fusion reactor control the impurity injection and gas recycling into the fusion plasma. Coating of internal surfaces may provide a desirable and possibly necessary design flexibility for achieving the temperatures, ion densities and containment times necessary for net energy production from fusion reactions to take place. In this paper the reactor environments seen by various componentare reviewed along with possible materials responses. Characteristics of coating-substrate systems, important to fusion applications, are delineated and the present status of coating development for fusion applications is reviewed. Coating development for fusion applications is just beginning and poses a unique and important challenge for materials development

  4. Properties of radiation cured coatings

    International Nuclear Information System (INIS)

    Larson, E.G.; Spencer, D.S.; Boettcher, T.E.; Melbauer, M.A.; Skarjune, R.P.

    1987-01-01

    Coatings were prepared from acrylate or methacrylate functionalized resins to study the effect of end group functionality on the physical properties of u.v. and electron beam cured coatings. Cure response was measured by solid state NMR and gel extraction, as expected, methacrylate resins cured much slower. Thermal Gravimetric Analysis (TGA) revealed acrylate coatings have greater thermal stability. Properties such as tensile strength and hardness showed little effect of end group functionality or curing method. The O 2 and H 2 O permeabilities of the coating were correlated with the processing conditions. (author)

  5. Decontamination and coating of lead

    International Nuclear Information System (INIS)

    Rankin, W.N.; Bush, S.P.; Lyon, C.E.; Walker, V.

    1988-01-01

    Technology is being developed to decontaminate lead used in shielding applications in contaminated environments for recycle as shieldings. Technology is also being developed to coat either decontaminated lead or new lead before it is used in contaminated environments. The surface of the coating is expected to be much easier to decontaminate than the original lead surface. If contamination becomes severely embedded in the coating and cannot be removed, it can be easily cut with a knife and removed from the lead. The used coating can be disposed of as radioactive (hot hazardous) waste. The lead can then be recoated for further use as a shielding material

  6. Coatings Technology Integration Office (CTIO)

    Data.gov (United States)

    Federal Laboratory Consortium — CTIO serves as the Air Force's central resource for aircraft coating systems and their applications. CTIO's primary objectives are pollution prevention and improved...

  7. Coating material composition

    International Nuclear Information System (INIS)

    Kimura, Tadashi; Ozeki, Takao; Kobayashi, Juichi; Nakamoto, Hideo; Maeda, Yutaka.

    1969-01-01

    A coating material composition is provided which can easily be cross-linked by irradiation with active energy, particularly electron beams and ultraviolet light, using a mixture of a prepolymer (a) with an addition reaction product (b). Such compositions have coating properties as good as thermosetting acrylic or amino alkyd resins. The prepolymer (a) is produced by primarily reacting at least 0.1 mol of saturated cyclocarboxylic acid anhydrides and/or alpha-, beta-ethylene unsaturated carboxylic acid anhydrides by addition reaction with one mol of hydroxyl radicals of a basic polymer having a molecular weight of 1,000 to 100,000, the basic polymer being obtained from 1%-40% of a hydroxyl radical containing vinyl monomer and at least 30% of (meth)acrylate monomer. One mol of the sum of hydroxyl radicals and carboxyl radicals of the primary reaction product undergoes a secondary addition reaction with at least 0.1 mol of an epoxy radical-containing vinyl monomer to form the prepolymer(a). The addition reaction product(b) is produced by reacting an epoxy radical-containing vinyl monomer with alpha-, beta-ethylene unsaturated carboxylic acids or their anhydrides. The coating material composition contains a majority of a mixture consisting of 10%-90% of (a) and 90%-10% of (b) above by weight. Four examples of the production of basic polymers, seven examples of the production of prepolymers, seven examples of the production of oligomers, and five examples of applications are given. (Iwakiri, K.)

  8. An evolutionary analysis of the Secoviridae family of viruses.

    Directory of Open Access Journals (Sweden)

    Jeremy R Thompson

    Full Text Available The plant-infecting Secoviridae family of viruses forms part of the Picornavirales order, an important group of non-enveloped viruses that infect vertebrates, arthropods, plants and algae. The impact of the secovirids on cultivated crops is significant, infecting a wide range of plants from grapevine to rice. The overwhelming majority are transmitted by ecdysozoan vectors such as nematodes, beetles and aphids. In this study, we have applied a variety of computational methods to examine the evolutionary traits of these viruses. Strong purifying selection pressures were calculated for the coat protein (CP sequences of nine species, although for two species evidence of both codon specific and episodic diversifying selection were found. By using Bayesian phylogenetic reconstruction methods CP nucleotide substitution rates for four species were estimated to range from between 9.29×10(-3 to 2.74×10(-3 (subs/site/year, values which are comparable with the short-term estimates of other related plant- and animal-infecting virus species. From these data, we were able to construct a time-measured phylogeny of the subfamily Comovirinae that estimated divergence of ninety-four extant sequences occurred less than 1,000 years ago with present virus species diversifying between 50 and 250 years ago; a period coinciding with the intensification of agricultural practices in industrial societies. Although recombination (modularity was limited to closely related taxa, significant and often unique similarities in the protein domains between secovirid and animal infecting picorna-like viruses, especially for the protease and coat protein, suggested a shared ancestry. We discuss our results in a wider context and find tentative evidence to indicate that some members of the Secoviridae might have their origins in insects, possibly colonizing plants in a number of founding events that have led to speciation. Such a scenario; virus infection between species of

  9. Microplasma sprayed hydroxyapatite coatings

    CERN Document Server

    Dey, Arjun

    2015-01-01

    ""This unique book on development of microplasma sprayed HAp coating has been organized in a very compact yet comprehensive manner. This book also highlights the horizons of future research that invites the attention of global community, particularly those in bio-medical materials and bio-medical engineering field. This book will surely act as a very useful reference material for both graduate/post-graduate students and researchers in the field of biomedical, orthopedic and manufacturing engineering and research. I truly believ that this is the first ever effort which covers almost all the

  10. SPS: scrubbing or coating ?

    CERN Document Server

    Jimenez, J M

    2012-01-01

    The operation of the SPS with high intensity bunched beams is limited by the electron cloud building-up in both the arcs and long straight sections. Two consolidation options have been considered: mitigation of the electron cloud using coatings or relying, as before, on the scrubbing runs. A status report on both options will be given with a particular emphasis on measurements plans for 2012 and pending issues. The testing needs, corresponding beam parameters and MD time in 2012 will be addressed. The criteria for the decision making and the corresponding schedule will be discussed.

  11. SPS: scrubbing or coating?

    International Nuclear Information System (INIS)

    Jimenez, J.M.

    2012-01-01

    The operation of the SPS with high intensity bunched beams is limited by the electron cloud building-up in both the arcs and long straight sections. Two consolidation options have been considered: suppression of the electron cloud build-up using coatings or relying, as before, on the scrubbing mitigation. A status report on both options will be given with a particular emphasis on measurements plans for 2012 and pending issues. The testing needs, corresponding beam parameters and MD time in 2012 will be addressed. The criteria for the decision making and the corresponding schedule will be discussed. (author)

  12. Radiation hardenable coating mixture

    International Nuclear Information System (INIS)

    Howard, D.D.

    1977-01-01

    This invention relates to coatings that harden under radiation and to their compositions. Specifically, this invention concerns unsaturated urethane resins polymerisable by addition and to compositions, hardening under the effect of radiation, containing these resins. These resins feature the presence of at least one unsaturated ethylenic terminal group of structure CH 2 =C and containing the product of the reaction of an organic isocyanate compound with at least two isocyanate groups and one polyester polyol with at least two hydroxyl groups, and one unsaturated monomer compound polymerisable by addition having a single active hydrogen group reacting with the isocyanate [fr

  13. Zika virus disease

    Directory of Open Access Journals (Sweden)

    Adel I Al-Afaleq

    2017-01-01

    Full Text Available The Zika virus is an arbovirus belonging to the virus family Flaviviridae. The virus was isolated in 1947 from a rhesus monkey in the Zika Forest of Uganda. The virus causes sporadic mild human infections in Africa and later in Asia. However, by 2007 a major shift in its infection pattern was noticed and thousands of human infections were reported in the State of Yap and Federated States of Micronesia. In the last 3 years, major outbreaks have continued to occur and the virus has spread to several Pacific and American countries. These outbreaks were mostly asymptomatic; however, there were more severe clinical signs associated with the infections. Those signs included microcephaly and Guillain–Barre syndrome. It is believed that various species of mosquitoes can biologically transmit the virus. However, Aedes aegypti is most widely associated with the Zika virus. Recently, new modes of virus transmission have been reported, including mother-to-fetus, sexual, blood transfusion, animal bites, laboratory exposure and breast milk. Differential diagnosis is very important as some other arboviruses such as yellow fever virus, West Nile virus, dengue virus, and chikungunya virus have similar clinical manifestations to the Zika virus infection as well as relating serologically to some of these viruses. Established laboratory diagnostic tests to detect the Zika virus are limited, with reverse transcription polymerase chain reaction being the most widely used test. Taking into consideration the quickness of the spread of infection, size of the infected population and change of the infection severity pattern, the Zika virus infection merits collective efforts on all levels to prevent and control the disease. Limited research work and data, concurrent infection with other arboviruses, involvement of biological vectors, mass crowd events, human and trade movements and lack of vaccines are some of the challenges that we face in our efforts to prevent and

  14. Federal Highway Administration 100-year coating study.

    Science.gov (United States)

    2012-11-01

    The Federal Highway Administration 100-Year Coating Study was initiated in August 2009 to search for durable : coating systems at a reasonable cost. The objective of the study was to identify and evaluate coating materials that can : provide 100 year...

  15. Decoding white coat hypertension

    Science.gov (United States)

    Bloomfield, Dennis A; Park, Alex

    2017-01-01

    There is arguably no less understood or more intriguing problem in hypertension that the “white coat” condition, the standard concept of which is significantly blood pressure reading obtained by medical personnel of authoritative standing than that obtained by more junior and less authoritative personnel and by the patients themselves. Using hospital-initiated ambulatory blood pressure monitoring, the while effect manifests as initial and ending pressure elevations, and, in treated patients, a low daytime profile. The effect is essentially systolic. Pure diastolic white coat hypertension appears to be exceedingly rare. On the basis of the studies, we believe that the white coat phenomenon is a common, periodic, neuro-endocrine reflex conditioned by anticipation of having the blood pressure taken and the fear of what this measurement may indicate concerning future illness. It does not change with time, or with prolonged association with the physician, particularly with advancing years, it may be superimposed upon essential hypertension, and in patients receiving hypertensive medication, blunting of the nighttime dip, which occurs in about half the patients, may be a compensatory mechanisms, rather than an indication of cardiovascular risk. Rather than the blunted dip, the morning surge or the widened pulse pressure, cardiovascular risk appears to be related to elevation of the average night time pressure. PMID:28352632

  16. Ceramic protective coating

    International Nuclear Information System (INIS)

    Harbach, F.; Nicoll, A.

    1987-01-01

    The basic material of the above-mentioned layer consists of pure aluminium oxide or essentially aluminium oxide. To improve this protective layer metal oxides from the groups IIA, IIIA, IIIB, VB, VIB, VIIB or VIII of the periodic system are added to its basic material before the said protective coating is applied. In this way a corundum structure is formed in the case of aluminium oxide. Gallium oxide, vanadium oxide, chromium oxide or iron oxide are particularly suited for the correlation of such a corundum structure. The formation of the corundum structure increases the resistance of the protective coating to the corrosive effects of vanadium pentoxide and sodium sulfate. By the addition of a specific quantity of magnesium oxide it is possible not only to stimulate the formation of corundum but also to reduce the increase in grain size in the case of the aluminium oxide. The other metallic oxides are especially favorable to the formation of the corundum structure, so that preferably magnesium oxide is to be added to these metallic oxides in order to reduce the increase in grain size. (author)

  17. Virus-Assembled Flexible Electrode-Electrolyte Interfaces for Enhanced Polymer-Based Battery Applications

    Directory of Open Access Journals (Sweden)

    Ayan Ghosh

    2012-01-01

    Full Text Available High-aspect-ratio cobalt-oxide-coated Tobacco mosaic virus (TMV- assembled polytetrafluoroethylene (PTFE nonstick surfaces were integrated with a solvent-free polymer electrolyte to create an anode-electrolyte interface for use in lithium-ion batteries. The virus-assembled PTFE surfaces consisted primarily of cobalt oxide and were readily intercalated with a low-molecular-weight poly (ethylene oxide (PEO based diblock copolymer electrolyte to produce a solid anode-electrolyte system. The resulting polymer-coated virus-based system was then peeled from the PTFE backing to produce a flexible electrode-electrolyte component. Electrochemical studies indicated the virus-structured metal-oxide PEO-based interface was stable and displayed robust charge transfer kinetics. Combined, these studies demonstrate the development of a novel solid-state electrode architecture with a unique peelable and flexible processing attribute.

  18. Evidence for Non-Transmission of Rice Yellow Mottle Virus (RYMV through Rice Seed

    Directory of Open Access Journals (Sweden)

    Sy, AA.

    2004-01-01

    Full Text Available An indexing of the organs (radicle and plumule and components (husk, endosperm and embryo of rice seeds using Enzyme Linked Immunosorbent Assay (ELISA was carried out to detect Rice yellow mottle virus (RYMV and establish the exact location of the virus in the rice seed. RYMV was detected only in the husk (seed coat but not in the endosperm, plumule, radicle, nor embryo. None of the seedlings raised from the seeds expressed RYMV symptoms. No virus particle was detected by the ELISA test in the leaves of the screenhouse-reared plants obtained from seeds of infected plants. The results indicate that RYMV is apparently not transmitted through rice seed probably because the virus is seed-borne in the husk (seed coat of mature rice seeds.

  19. Production of Japanese Encephalitis Virus Antigens in Plants Using Bamboo Mosaic Virus-Based Vector

    Directory of Open Access Journals (Sweden)

    Tsung-Hsien Chen

    2017-05-01

    Full Text Available Japanese encephalitis virus (JEV is among the major threats to public health in Asia. For disease control and prevention, the efficient production of safe and effective vaccines against JEV is in urgent need. In this study, we produced a plant-made JEV vaccine candidate using a chimeric virus particle (CVP strategy based on bamboo mosaic virus (BaMV for epitope presentation. The chimeric virus, designated BJ2A, was constructed by fusing JEV envelope protein domain III (EDIII at the N-terminus of BaMV coat protein, with an insertion of the foot-and-mouth disease virus 2A peptide to facilitate the production of both unfused and epitope-presenting for efficient assembly of the CVP vaccine candidate. The strategy allowed stable maintenance of the fusion construct over long-term serial passages in plants. Immuno-electron microscopy examination and immunization assays revealed that BJ2A is able to present the EDIII epitope on the surface of the CVPs, which stimulated effective neutralizing antibodies against JEV infection in mice. This study demonstrates the efficient production of an effective CVP vaccine candidate against JEV in plants by the BaMV-based epitope presentation system.

  20. Barley yellow dwarf virus: Luteoviridae or Tombusviridae?

    Science.gov (United States)

    Miller, W Allen; Liu, Sijun; Beckett, Randy

    2002-07-01

    Summary Barley yellow dwarf virus (BYDV), the most economically important virus of small grains, features highly specialised relationships with its aphid vectors, a plethora of novel translation mechanisms mediated by long-distance RNA interactions, and an ambiguous taxonomic status. The structural and movement proteins of BYDV that confer aphid transmission and phloem-limitation properties resemble those of the Luteoviridae, the family in which BYDV is classified. In contrast, many genes and cis-acting signals involved in replication and gene expression most closely resemble those of the Tombusviridae. BYDV is in genus Luteovirus, family Luteoviridae. BYDV includes at least two serotypes or viruses: BYDV-PAV and BYDV-MAV. The former BYDV-RPV is now Cereal yellow dwarf virus-RPV (CYDV-RPV). CYDV is in genus Polerovirus, family Luteoviridae. Genus Luteovirus shares many features with family Tombusviridae. Physical properties: approximately 25 nm icosahedral (T = 3) virions. One major (22 kDa) and one minor (50-55 kDa) coat protein. 5.6-5.8 kb positive sense RNA genome with no 5'-cap and no poly(A) tail. Most grasses. Most important in oats, barley and wheat. Also infects maize and rice. Yellowing and dwarfing in barley, stunting in wheat; reddening, yellowing and blasting in oats. Some isolates cause leaf notching and curling. Key attractions: Model for the study of circulative transmission of aphid-transmitted viruses. Plethora of unusual translation mechanisms. Evidence of recombination in recent evolutionary history creates taxonomic ambiguity. Economically important virus of wheat, barley and oats, worldwide. Useful websites/meetings: International symposium: 'Barley Yellow Dwarf Disease: Recent Advances and Future Strategies', CIMMYT, El Batan, Mexico, 1-5 September 2002, http://www.cimmyt.cgiar.org/Research/wheat/Conf_BYD_02/invitation.htm http://www.cimmyt.org/Research/wheat/BYDVNEWS/htm/BYDVNEWS.htm Aphid transmission animation: http://www.ppws.vt.edu/~sforza/tmv/bydv_aph.html.

  1. Ebola (Ebola Virus Disease)

    Science.gov (United States)

    ... Controls Cancel Submit Search the CDC Ebola (Ebola Virus Disease) Note: Javascript is disabled or is not ... gov . Recommend on Facebook Tweet Share Compartir Ebola Virus Disease (EVD) is a rare and deadly disease ...

  2. Hepatitis virus panel

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/003558.htm Hepatitis virus panel To use the sharing features on this page, please enable JavaScript. The hepatitis virus panel is a series of blood tests used ...

  3. Viruses and Breast Cancer

    Science.gov (United States)

    Lawson, James S.; Heng, Benjamin

    2010-01-01

    Viruses are the accepted cause of many important cancers including cancers of the cervix and anogenital area, the liver, some lymphomas, head and neck cancers and indirectly human immunodeficiency virus associated cancers. For over 50 years, there have been serious attempts to identify viruses which may have a role in breast cancer. Despite these efforts, the establishment of conclusive evidence for such a role has been elusive. However, the development of extremely sophisticated new experimental techniques has allowed the recent development of evidence that human papilloma virus, Epstein-Barr virus, mouse mammary tumor virus and bovine leukemia virus may each have a role in the causation of human breast cancers. This is potentially good news as effective vaccines are already available to prevent infections from carcinogenic strains of human papilloma virus, which causes cancer of the uterine cervix. PMID:24281093

  4. Zika virus disease

    Science.gov (United States)

    ... May 2015, the virus was discovered for the first time in Brazil. It has now spread to many territories, states, and countries in: Caribbean Islands Central America Mexico South America Pacific Islands Africa The virus ...

  5. Respiratory Syncytial Virus

    Science.gov (United States)

    ... with facebook share with twitter share with linkedin Respiratory Syncytial Virus (RSV) Credit: CDC This is the ... the United States. Why Is the Study of Respiratory Syncytial Virus (RSV) a Priority for NIAID? In ...

  6. Respiratory syncytial virus (RSV)

    Science.gov (United States)

    RSV; Palivizumab; Respiratory syncytial virus immune globulin; Bronchiolitis - RSV ... Crowe JE. Respiratory syncytial virus. In: Kliegman RM, Stanton BF, St. Geme JW, Schor NF, eds. Nelson Textbook of Pediatrics . 20th ...

  7. Viruses and Breast Cancer

    International Nuclear Information System (INIS)

    Lawson, James S.; Heng, Benjamin

    2010-01-01

    Viruses are the accepted cause of many important cancers including cancers of the cervix and anogenital area, the liver, some lymphomas, head and neck cancers and indirectly human immunodeficiency virus associated cancers. For over 50 years, there have been serious attempts to identify viruses which may have a role in breast cancer. Despite these efforts, the establishment of conclusive evidence for such a role has been elusive. However, the development of extremely sophisticated new experimental techniques has allowed the recent development of evidence that human papilloma virus, Epstein-Barr virus, mouse mammary tumor virus and bovine leukemia virus may each have a role in the causation of human breast cancers. This is potentially good news as effective vaccines are already available to prevent infections from carcinogenic strains of human papilloma virus, which causes cancer of the uterine cervix

  8. Viruses and Breast Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Lawson, James S., E-mail: james.lawson@unsw.edu.au; Heng, Benjamin [School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney (Australia)

    2010-04-30

    Viruses are the accepted cause of many important cancers including cancers of the cervix and anogenital area, the liver, some lymphomas, head and neck cancers and indirectly human immunodeficiency virus associated cancers. For over 50 years, there have been serious attempts to identify viruses which may have a role in breast cancer. Despite these efforts, the establishment of conclusive evidence for such a role has been elusive. However, the development of extremely sophisticated new experimental techniques has allowed the recent development of evidence that human papilloma virus, Epstein-Barr virus, mouse mammary tumor virus and bovine leukemia virus may each have a role in the causation of human breast cancers. This is potentially good news as effective vaccines are already available to prevent infections from carcinogenic strains of human papilloma virus, which causes cancer of the uterine cervix.

  9. Zika Virus - Multiple Languages

    Science.gov (United States)

    ... Are Here: Home → Multiple Languages → All Health Topics → Zika Virus URL of this page: https://medlineplus.gov/languages/ ... V W XYZ List of All Topics All Zika Virus - Multiple Languages To use the sharing features on ...

  10. VIRUS FAMILIES – contd

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. VIRUS FAMILIES – contd. Minus strand RNA viruses. Rhabdovirus e.g. rabies. Paramyxovirus e.g. measles, mumps. Orthomyxovirus e.g. influenza. Retroviruses. RSV, HTLV, MMTV, HIV. Notes:

  11. Human Parainfluenza Viruses

    Science.gov (United States)

    ... Search Form Controls Cancel Submit Search The CDC Human Parainfluenza Viruses (HPIVs) Note: Javascript is disabled or ... CDC.gov . Recommend on Facebook Tweet Share Compartir Human parainfluenza viruses (HPIVs) commonly cause respiratory illnesses in ...

  12. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Guidance & Publications Practice Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and Pregnancy Page Navigation ▼ ACOG Pregnancy ...

  13. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... My ACOG ACOG Departments Donate Shop Career Connection Home Clinical Guidance & Publications Practice Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and Pregnancy Page Navigation ▼ ...

  14. The Coat Protein and NIa Protease of Two Potyviridae Family Members Independently Confer Superinfection Exclusion

    Science.gov (United States)

    French, Roy

    2016-01-01

    ABSTRACT Superinfection exclusion (SIE) is an antagonistic virus-virus interaction whereby initial infection by one virus prevents subsequent infection by closely related viruses. Although SIE has been described in diverse viruses infecting plants, humans, and animals, its mechanisms, including involvement of specific viral determinants, are just beginning to be elucidated. In this study, SIE determinants encoded by two economically important wheat viruses, Wheat streak mosaic virus (WSMV; genus Tritimovirus, family Potyviridae) and Triticum mosaic virus (TriMV; genus Poacevirus, family Potyviridae), were identified in gain-of-function experiments that used heterologous viruses to express individual virus-encoded proteins in wheat. Wheat plants infected with TriMV expressing WSMV P1, HC-Pro, P3, 6K1, CI, 6K2, NIa-VPg, or NIb cistrons permitted efficient superinfection by WSMV expressing green fluorescent protein (WSMV-GFP). In contrast, wheat infected with TriMV expressing WSMV NIa-Pro or coat protein (CP) substantially excluded superinfection by WSMV-GFP, suggesting that both of these cistrons are SIE effectors encoded by WSMV. Importantly, SIE is due to functional WSMV NIa-Pro or CP rather than their encoding RNAs, as altering the coded protein products by minimally changing RNA sequences led to abolishment of SIE. Deletion mutagenesis further revealed that elicitation of SIE by NIa-Pro requires the entire protein while CP requires only a 200-amino-acid (aa) middle fragment (aa 101 to 300) of the 349 aa. Strikingly, reciprocal experiments with WSMV-mediated expression of TriMV proteins showed that TriMV CP, and TriMV NIa-Pro to a lesser extent, likewise excluded superinfection by TriMV-GFP. Collectively, these data demonstrate that WSMV- and TriMV-encoded CP and NIa-Pro proteins are effectors of SIE and that these two proteins trigger SIE independently of each other. IMPORTANCE Superinfection exclusion (SIE) is an antagonistic virus-virus interaction that

  15. Rapidly curable electrically conductive clear coatings

    Energy Technology Data Exchange (ETDEWEB)

    Bowman, Mark P.; Anderson, Lawrence G.; Post, Gordon L.

    2018-01-16

    Rapidly curable electrically conductive clear coatings are applied to substrates. The electrically conductive clear coating includes to clear layer having a resinous binder with ultrafine non-stoichiometric tungsten oxide particles dispersed therein. The clear coating may be rapidly cured by subjecting the coating to infrared radiation that heats the tungsten oxide particles and surrounding resinous binder. Localized heating increases the temperature of the coating to thereby thermally cure the coating, while avoiding unwanted heating of the underlying substrate.

  16. White coat hypertension in pediatrics.

    Science.gov (United States)

    Jurko, Alexander; Minarik, Milan; Jurko, Tomas; Tonhajzerova, Ingrid

    2016-01-15

    The article summarizes current information on blood pressure changes in children during clinic visit. White coat as a general dressing of physicians and health care personnel has been widely accepted at the end of the 19th century. Two problems can be associated with the use of white coat: white coat phenomenon and white coat hypertension. Children often attribute pain and other unpleasant experience to the white coat and refuse afterwards cooperation with examinations. Definition of white coat hypertension in the literature is not uniform. It has been defined as elevated blood pressure in the hospital or clinic with normal blood pressure at home measured during the day by ambulatory blood pressure monitoring system. White coat effect is defined as temporary increase in blood pressure before and during visit in the clinic, regardless what the average daily ambulatory blood pressure values are. Clinical importance of white coat hypertension is mainly because of higher risk for cardiovascular accidents that are dependent on end organ damage (heart, vessels, kidney). Current data do not allow any clear recommendations for the treatment. Pharmacological therapy is usually started in the presence of hypertrophic left ventricle, changes in intimal/medial wall thickness of carotic arteries, microalbuminuria and other cardiovascular risk factors. Nonpharmacological therapy is less controversial and certainly more appropriate. Patients have to change their life style, need to eliminate as much cardiovascular risk factors as possible and sustain a regular blood pressure monitoring.

  17. External coating of colonic anastomoses

    DEFF Research Database (Denmark)

    Pommergaard, Hans-Christian; Achiam, Michael Patrick; Rosenberg, Jacob

    2012-01-01

    Colon anastomotic leakage remains both a frequent and serious complication in gastrointestinal surgery. External coating of colonic anastomoses has been proposed as a means to lower the rate of this complication. The aim of this review was to evaluate existing studies on external coating of colonic...

  18. Moisture transport in coated wood

    NARCIS (Netherlands)

    Meel, P.A. van; Erich, S.J.F.; Huinink, H.P.; Kopinga, K.; Jong, J. DE; Adan, O.C.G.

    2011-01-01

    Moisture accumulation inside wood causes favorable conditions for decay. Application of a coating alters the moisture sorption of wood and prevents accumulation of moisture. This paper presents the results of a nuclear magnetic resonance (NMR) study on the influence of a coating on the moisture

  19. Electroless alloy/composite coatings

    Indian Academy of Sciences (India)

    The market for these coatings is expanding fast as the potential applications are on the rise. In the present article, an attempt has been made to review different electroless alloy/composite coatings with respect to bath types and their composition, properties and applications. Different characterisation studies have been ...

  20. Lignin based controlled release coatings

    NARCIS (Netherlands)

    Mulder, W.J.; Gosselink, R.J.A.; Vingerhoeds, M.H.; Harmsen, P.F.H.; Eastham, D.

    2011-01-01

    Urea is a commonly used fertilizer. Due to its high water-solubility, misuse easily leads to excess nitrogen levels in the soil. The aim of this research was to develop an economically feasible and biodegradable slow-release coating for urea. For this purpose, lignin was selected as coating

  1. Foundry Coating Technology: A Review

    DEFF Research Database (Denmark)

    Nwaogu, Ugochukwu Chibuzoh; Tiedje, Niels Skat

    2011-01-01

    is important. In this review, a detailed description of these topics and examples are provided where necessary. A potential area of research in foundry coating development, using sol-gel process is suggested. The application of sol-gel technology in the development of foundry coatings is a novel approach....

  2. Intumescent coatings under fast heating

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Català, Pere

    2012-01-01

    Intumescent coatings are widely used to delay or minimise the destructive effects of fire. They are usually tested under conditions that simulate the relatively slow build-up of heat in a normal fire. Here, the effects of damage during a fire causing sudden heating of the coating were studied....

  3. Steam initiated hydrotalcite conversion coatings

    DEFF Research Database (Denmark)

    Zhou, Lingli; Friis, Henrik; Roefzaad, Melanie

    2018-01-01

    A facile process of exploiting high-temperature steam to deposit nvironmentally friendly hydrotalcite (HT) coatings on Al alloy 6060 was developed in a spray system. Scanning electron microscopy showed the formationf a continuous and conformal coating comprised of a compact mass of crystallites. ...

  4. [Mumps vaccine virus transmission].

    Science.gov (United States)

    Otrashevskaia, E V; Kulak, M V; Otrashevskaia, A V; Karpov, I A; Fisenko, E G; Ignat'ev, G M

    2013-01-01

    In this work we report the mumps vaccine virus shedding based on the laboratory confirmed cases of the mumps virus (MuV) infection. The likely epidemiological sources of the transmitted mumps virus were children who were recently vaccinated with the mumps vaccine containing Leningrad-Zagreb or Leningrad-3 MuV. The etiology of the described cases of the horizontal transmission of both mumps vaccine viruses was confirmed by PCR with the sequential restriction analysis.

  5. Phylogenetic relationships and the occurrence of interspecific recombination between beet chlorosis virus (BChV) and Beet mild yellowing virus (BMYV).

    Science.gov (United States)

    Kozlowska-Makulska, Anna; Hasiow-Jaroszewska, Beata; Szyndel, Marek S; Herrbach, Etienne; Bouzoubaa, Salah; Lemaire, Olivier; Beuve, Monique

    2015-02-01

    Samples containing two viruses belonging to the genus Polerovirus, beet chlorosis virus (BChV) and beet mild yellowing virus (BMYV), were collected from French and Polish sugar beet fields. The molecular properties of 24 isolates of BChV and BMYV were investigated, and their genetic diversity was examined in the coat protein (CP)- and P0-encoding genes. For the first time, we have demonstrated that beet polerovirus populations include recombinants between BChV and BMYV containing breakpoints within the CP gene. Moreover, a partial correlation between geographic origin and phylogenetic clustering was observed for BMYV isolates.

  6. Evanescent wave assisted nanomaterial coating.

    Science.gov (United States)

    Mondal, Samir K; Pal, Sudipta Sarkar; Kumbhakar, Dharmadas; Tiwari, Umesh; Bhatnagar, Randhir

    2013-08-01

    In this work we present a novel nanomaterial coating technique using evanescent wave (EW). The gradient force in the EW is used as an optical tweezer for tweezing and self-assembling nanoparticles on the source of EW. As a proof of the concept, we have used a laser coupled etched multimode optical fiber, which generates EW for the EW assisted coating. The section-wise etched multimode optical fiber is horizontally and superficially dipped into a silver/gold nanoparticles solution while the laser is switched on. The fiber is left until the solution recedes due to evaporation leaving the fiber in air. The coating time usually takes 40-50 min at room temperature. The scanning electron microscope image shows uniform and thin coating of self-assembled nanoparticles due to EW around the etched section. A coating thickness optical fiber probes and other plasmonic circuits.

  7. Functional Plasma-Deposited Coatings

    Directory of Open Access Journals (Sweden)

    Mykhaylo Pashechko

    2017-12-01

    Full Text Available The paper focuses on the problem of low adhesion of plasma sprayed coatings to the substrate. The subsequent laser treatment modes and their influence on the coating-substrate interface were studied. This allows to decrease the level of metstability of the coating, thus decreasing its hardness down to 11-12 GPa on the surface and to about 9 GPa on depth of 400 µm. The redistribution of alloying elements through solid and liquid diffusion improves mechanical properties and rises the adhesion up to 450 MPa after remelting and up to 90-110 MPa after laser-aided thermal cycling. At he same time, remelting of coating helps to decrease its porosity down to 1%. Obtained complex of properties also allows to improve wear resistance of coatings and to decrease friction factor.

  8. Self-Healing anticorrosive coatings

    DEFF Research Database (Denmark)

    Nesterova, Tatyana

    %. The number is lower than anticipated and needs to be confirmed. Finally, a 3-D model, based on Monte-Carlo simulations, has been developed for prediction of healing efficiency of a microcapsule-based anticorrosive coating. Two kinds of cracks were considered: cracks accommodated within the bulk coating...... associated with development and testing of this type of coating. A laboratory investigation, to identify the most suitable method for production of mechanically stable (filled with industrially relevant core materials) and forming a free-flowing powder upon drying microcapsules, has been performed. Four...... reduces the intensity of crack formation (both in number and length) compared to filler-containing coatings and prevents the coating from flaking upon damage. Based on specular gloss measurements, a preliminary critical pigment (microcapsule) concentration (CPVC) value was estimated to about 30 vol...

  9. Nairobi sheep disease virus/Ganjam virus.

    Science.gov (United States)

    M D, Baron; B, Holzer

    2015-08-01

    Nairobi sheep disease virus (NSDV) is a tick-borne virus which causes a severe disease in sheep and goats, and has been responsible for several outbreaks of disease in East Africa. The virus is also found in the Indian subcontinent, where it is known as Ganjam virus. The virus only spreads through the feeding of competent infected ticks, and is therefore limited in its geographic distribution by the distribution of those ticks, Rhipicephalus appendiculata in Africa and Haemaphysalis intermedia in India. Animals bred in endemic areas do not normally develop disease, and the impact is therefore primarily on animals being moved for trade or breeding purposes. The disease caused by NSDV has similarities to several other ruminant diseases, and laboratory diagnosis is necessary for confirmation. There are published methods for diagnosis based on polymerase chain reaction, for virus growth in cell culture and for other simple diagnostic tests, though none has been commercialised. There is no established vaccine against NSDV, although cell-culture attenuated strains have been developed which show promise and could be put into field trials if it were deemed necessary. The virus is closely related to Crimean-Congo haemorrhagic fever virus, and studies on NSDV may therefore be useful in understanding this important human pathogen.

  10. What's West Nile Virus?

    Science.gov (United States)

    ... for Educators Search English Español What's West Nile Virus? KidsHealth / For Kids / What's West Nile Virus? Print en español ¿Qué es el Virus del Nilo Occidental? What exactly is the West ...

  11. Characteristic of pandemic virus

    Indian Academy of Sciences (India)

    First page Back Continue Last page Graphics. Characteristic of pandemic virus. The virus was highly transmissible. Risk of hospitalization was 2X and risk of death was about 11X more in comparison to seasonal influenza. Virus continues to be susceptible to Osaltamivir, the only drug available. Vaccines are available but ...

  12. Zika Virus Fact Sheet

    Science.gov (United States)

    ... is caused by a virus transmitted primarily by Aedes mosquitoes. People with Zika virus disease can have symptoms including mild fever, skin ... framework. Q&A: Zika virus and complication ... mosquito from the Aedes genus, mainly Aedes aegypti in tropical regions. Aedes ...

  13. Understanding particulate coating microstructure development

    Science.gov (United States)

    Roberts, Christine Cardinal

    How a dispersion of particulates suspended in a solvent dries into a solid coating often is more important to the final coating quality than even its composition. Essential properties like porosity, strength, gloss, particulate order, and concentration gradients are all determined by the way the particles come together as the coating dries. Cryogenic scanning electron microscopy (cryoSEM) is one of the most effective methods to directly visualize a drying coating during film formation. Using this method, the coating is frozen, arresting particulate motion and solidifying the sample so that it be imaged in an SEM. In this thesis, the microstructure development of particulate coatings was explored with several case studies. First, the effect of drying conditions was determined on the collapse of hollow latex particles, which are inexpensive whiteners for paint. Using cryoSEM, it was found that collapse occurs during the last stages of drying and is most likely to occur at high drying temperatures, humidity, and with low binder concentration. From these results, a theoretical model was proposed for the collapse of a hollow latex particle. CryoSEM was also used to verify a theoretical model for the particulate concentration gradients that may develop in a coating during drying for various evaporation, sedimentation and particulate diffusion rates. This work created a simple drying map that will allow others to predict the character of a drying coating based on easily calculable parameters. Finally, the effect of temperature on the coalescence and cracking of latex coatings was explored. A new drying regime for latex coatings was identified, where partial coalescence of particles does not prevent cracking. Silica was shown to be an environmentally friendly additive for preventing crack formation in this regime.

  14. Surface properties, more than size, limiting convective distribution of virus-sized particles and viruses in the central nervous system.

    Science.gov (United States)

    Chen, Michael Y; Hoffer, Alan; Morrison, Paul F; Hamilton, John F; Hughes, Jeffrey; Schlageter, Kurt S; Lee, Jeongwu; Kelly, Brandon R; Oldfield, Edward H

    2005-08-01

    Achieving distribution of gene-carrying vectors is a major barrier to the clinical application of gene therapy. Because of the blood-brain barrier, the distribution of genetic vectors to the central nervous system (CNS) is even more challenging than delivery to other tissues. Direct intraparenchymal microinfusion, a minimally invasive technique, uses bulk flow (convection) to distribute suspensions of macromolecules widely through the extracellular space (convection-enhanced delivery [CED]). Although acute injection into solid tissue is often used for delivery of oligonucleotides, viruses, and liposomes, and there is preliminary evidence that certain of these large particles can spread through the interstitial space of the brain by the use of convection, the use of CED for distribution of viruses in the brain has not been systematically examined. That is the goal of this study. Investigators used a rodent model to examine the influence of size, osmolarity of buffering solutions, and surface coating on the volumetric distribution of virus-sized nanoparticles and viruses (adeno-associated viruses and adenoviruses) in the gray matter of the brain. The results demonstrate that channels in the extracellular space of gray matter in the brain are large enough to accommodate virus-sized particles and that the surface characteristics are critical determinants for distribution of viruses in the brain by convection. These results indicate that convective distribution can be used to distribute therapeutic viral vectors in the CNS.

  15. Evaluation of Jatropha curcas as an alternative host of African cassava mosaic virus

    International Nuclear Information System (INIS)

    Appiah, A.S.

    2010-01-01

    A study was conducted to evaluate ten local accessions of Jatropha curcas L. (physic nut) as an alternative host of African cassava mosaic virus (ACMV). The ten local accessions of J. curcas were planted in a field trial at the research farm of the Biotechnology and Nuclear Agriculture Research Institute, intercropped with ACMV-infected cassava cultivar 'Afisiafi' and left to natural spread of ACMV from the cassava to J. curcas. The J. curcas plants which became infected generally showed mild symptoms, with severity ranging from 1.00 at eight weeks after planting (WAP) to 3.00 at 16 WAP on a scale of 1 (no symptoms) to 5 (severe symptoms). Whitefly populations recorded on the J. curcas accessions in the wet (Sept. - Oct., 2008) and dry (Jan. - Feb., 2009) seasons were generally low. However, significant differences (p < 0.05) were found in the mean whitefly numbers found on the individual J. curcas accessions in the dry season. Disease incidence as determined by symptom expression varied among accessions at eight, twelve and sixteen weeks after planting, though the differences not statistically significant. Leaf samples from the ten J. curcas accessions were tested at six, nine and twelve months after planting (MAP) for the presence of ACMV by enzyme-linked immunosorbent assays (ELISA) and by polymerase chain reaction (PCR). ELISA tests using monoclonal antibody SCRI 33, in a double antibody sandwich ELISA (DAS-ELISA) showed ACMV infection in the J. curcas accessions. Infection ranged from 0% at 6MAP to 50% at 12MAP. Molecular analysis by PCR with a virus-specific primer (JSP001/JSP002) of the viral DNA extracted from leaves of the number of samples tested, as against 37.7% by ELISA. Infection among the accessions as shown by to PCR varied significantly (p < 0.05) and ranged from as low as 16.6% to as high as 91.6%. ACMV infection of the J. curcas plants was further confirmed by infectivity tests on Nicotiana benthamiana indicator plants. Three of (3) out of 132

  16. Development of transgenic watermelon resistant to Cucumber mosaic virus and Watermelon mosaic virus by using a single chimeric transgene construct.

    Science.gov (United States)

    Lin, Ching-Yi; Ku, Hsin-Mei; Chiang, Yi-Hua; Ho, Hsiu-Yin; Yu, Tsong-Ann; Jan, Fuh-Jyh

    2012-10-01

    Watermelon, an important fruit crop worldwide, is prone to attack by several viruses that often results in destructive yield loss. To develop a transgenic watermelon resistant to multiple virus infection, a single chimeric transgene comprising a silencer DNA from the partial N gene of Watermelon silver mottle virus (WSMoV) fused to the partial coat protein (CP) gene sequences of Cucumber mosaic virus (CMV), Cucumber green mottle mosaic virus (CGMMV) and Watermelon mosaic virus (WMV) was constructed and transformed into watermelon (cv. Feeling) via Agrobacterium-mediated transformation. Single or multiple transgene copies randomly inserted into various locations in the genome were confirmed by Southern blot analysis. Transgenic watermelon R(0) plants were individually challenged with CMV, CGMMV or WMV, or with a mixture of these three viruses for resistance evaluation. Two lines were identified to exhibit resistance to CMV, CGMMV, WMV individually, and a mixed inoculation of the three viruses. The R(1) progeny of the two resistant R(0) lines showed resistance to CMV and WMV, but not to CGMMV. Low level accumulation of transgene transcripts in resistant plants and small interfering (si) RNAs specific to CMV and WMV were readily detected in the resistant R(1) plants by northern blot analysis, indicating that the resistance was established via RNA-mediated post-transcriptional gene silencing (PTGS). Loss of the CGMMV CP-transgene fragment in R1 progeny might be the reason for the failure to resistant CGMMV infection, as shown by the absence of a hybridization signal and no detectable siRNA specific to CGMMV in Southern and northern blot analyses. In summary, this study demonstrated that fusion of different viral CP gene fragments in transgenic watermelon contributed to multiple virus resistance via PTGS. The construct and resistant watermelon lines developed in this study could be used in a watermelon breeding program for resistance to multiple viruses.

  17. Detection and Molecular Characterization of Grapevine Virus A in Jordan

    Directory of Open Access Journals (Sweden)

    G. Anfoka

    2004-12-01

    Full Text Available In a study on grapevines in Jordan conducted between 2002 and 2003, grapevine virus A (GVA was detected in all areas where grapevines were planted. DAS-ELISA analysis of samples from symptomatic trees found that 16.1% of samples were infected with GVA. Using a GVA- specific primer pair (H587/C995, a portion of the coat protein gene of the virus was amplified by IC-RT-PCR and RT-PCR, using leaf extracts and RNA extracted from infected grapevines respectively. After cloning and sequencing the coat protein gene of the Jordanian isolate of GVA (GVA-Jo, the sequence of the amplified product was compared with sequences of other GVA isolates from different countries.

  18. Optical coating preparation

    International Nuclear Information System (INIS)

    Belleville, P.; Sabary, F.; Marcel, C.

    2003-01-01

    In order to optimize the properties of optical components, thin film deposition with controlled thickness and refractive index is often needed. Two different deposition techniques are proposed in this article and illustrated with examples: physical vapor deposition (PVD) and liquid sol-gel process (LSG). PVD and LSG techniques are equivalent as far as the following topics are concerned: elaboration of oxide or composite coated material, optical performance, mechanical performance, and laser performance. PVD is better for the elaboration of metallic films, the design of multi-layers or complex pile-up of layers. LSG is better for the treatment of large surfaces, for substrates with complicated shapes and for its low cost. PVD technique has been widely used so it benefited from an industrial maturity and a clean technology concerning wastes and effluents. On the contrary LSG is a new technique not yet widely used in industrial processes but that looks promising. (A.C.)

  19. Novel coating compositions

    International Nuclear Information System (INIS)

    Kimura, Tadashi; Kobayashi, Juichi; Nakamoto, Hideo.

    1969-01-01

    An acrylic coating composition rapidly hardenable by irradiating with ionizing radiations or light beams is given using hydroxyl group-containing vinyl monomers, polycarboxylic acid anhydrides, epoxy group-containing vinyl monomers and an organic solvent having a boiling point of at least 120 0 C. The process comprises the steps of first and second reactions. The first reaction takes place between one mol of a hydroxyl group of a basic polymer and at least 0.1 mol of polycarboxylic acid anhydride, wherein the basic polymer has a molecular weight ranging from 5,000 to 100,000 and consists of 1-40% by weight of vinyl monomer containing hydroxyl group, at least 30% of (meth)acrylic monomer and other vinyl monomers if required. The second reaction takes place between one mol of hydroxyl plus a carboxyl group of the thus obtained basic polymer and at least 0.1 mol of an epoxy group-containing vinyl monomer to produce a prepolymer. The prepolymer is mixed with a solvent such as ethyl benzene to produce the coating material. The electron beam accelerator energy level may be 0.1-2.0 MeV. In light beam polymerization, benzoin is particularly utilized as an intensifying substance. In one example, a basic polymer is produced by reacting 39 parts of styrene, 37 parts of ethyl acrylate, 24 parts of 2-hydroxyl ethyl acrylate, 4 parts of dimethyl amino ethyl methacrylate and others. A prepolymer is produced by reacting this basic polymer with 30 parts of glycidyl acrylate and others. (Iwakiri, K.)

  20. Blueberry (Vaccinium corymbosum)-Virus Diseases

    Science.gov (United States)

    At least six viruses have been found in highbush blueberry plantings in the Pacific Northwest: Blueberry mosaic virus, Blueberry red ringspot virus, Blueberry scorch virus, Blueberry shock virus, Tobacco ringspot virus, and Tomato ringspot virus. Six other virus and virus-like diseases of highbush b...

  1. How PE tape performs under concrete coating

    International Nuclear Information System (INIS)

    Dritt, H.J.

    1984-01-01

    The program objectives were to evaluate the performance of polyethylene tape plant coating and fusion bonded epoxy powder systems with particular respect to the following: 1. Concrete coating application procedures; 2. The shear resistance during laying and retrieving operations of the coating at the various interfaces (a) Pipe and anti-corrosion coating; (b) Anti-corrosion coating and outerwrap; (c) Overlap areas of the anti-corrosion and outerwrap layers; (d) Between concrete and the various corrosion coatings during laying and retrieving operations. 3. Resistance to damage of the coating as a consequence of cracking or slippage of the concrete weight coating. 4. Ability of various coatings to withstand the damage during concrete application by both impact and compression methods; 5. Evaluation of tape and shrink sleeve joint coatings at the cut-back area as well as performance of tape under hot asphalt coating

  2. Viruses of asparagus.

    Science.gov (United States)

    Tomassoli, Laura; Tiberini, Antonio; Vetten, Heinrich-Josef

    2012-01-01

    The current knowledge on viruses infecting asparagus (Asparagus officinalis) is reviewed. Over half a century, nine virus species belonging to the genera Ilarvirus, Cucumovirus, Nepovirus, Tobamovirus, Potexvirus, and Potyvirus have been found in this crop. The potyvirus Asparagus virus 1 (AV1) and the ilarvirus Asparagus virus 2 (AV2) are widespread and negatively affect the economic life of asparagus crops reducing yield and increasing the susceptibility to biotic and abiotic stress. The main properties and epidemiology of AV1 and AV2 as well as diagnostic techniques for their detection and identification are described. Minor viruses and control are briefly outlined. Copyright © 2012 Elsevier Inc. All rights reserved.

  3. Understanding Ebola Virus Transmission

    Directory of Open Access Journals (Sweden)

    Seth Judson

    2015-02-01

    Full Text Available An unprecedented number of Ebola virus infections among healthcare workers and patients have raised questions about our understanding of Ebola virus transmission. Here, we explore different routes of Ebola virus transmission between people, summarizing the known epidemiological and experimental data. From this data, we expose important gaps in Ebola virus research pertinent to outbreak situations. We further propose experiments and methods of data collection that will enable scientists to fill these voids in our knowledge about the transmission of Ebola virus.

  4. Protein synthesis directed by cowpea mosaic virus RNAs

    International Nuclear Information System (INIS)

    Stuik, E.

    1979-01-01

    The thesis concerns the proteins synthesized under direction of Cowpea mosaic virus RNAs. Sufficient radioactive labelling of proteins was achieved when 35 S as sulphate was administered to intact Vigna plants, cultivated in Hoagland solution. The large polypeptides synthesized under direction of B- and M-RNA are probably precursor molecules from which the coat proteins are generated by a mechanism of posttranslational cleavage. (Auth.)

  5. Avian Egg and Egg Coat.

    Science.gov (United States)

    Okumura, Hiroki

    2017-01-01

    An ovulated egg of vertebrates is surrounded by unique extracellular matrix, the egg coat or zona pellucida, playing important roles in fertilization and early development. The vertebrate egg coat is composed of two to six zona pellucida (ZP) glycoproteins that are characterized by the evolutionarily conserved ZP-domain module and classified into six subfamilies based on phylogenetic analyses. Interestingly, investigations of biochemical and functional features of the ZP glycoproteins show that the roles of each ZP-glycoprotein family member in the egg-coat formation and the egg-sperm interactions seemingly vary across vertebrates. This might be one reason why comprehensive understandings of the molecular basis of either architecture or physiological functions of egg coat still remain elusive despite more than 3 decades of intensive investigations. In this chapter, an overview of avian egg focusing on the oogenesis are provided in the first section, and unique features of avian egg coat, i.e., perivitelline layer, including the morphology, biogenesis pathway, and physiological functions are discussed mainly on chicken and quail in terms of the characteristics of ZP glycoproteins in the following sections. In addition, these features of avian egg coat are compared to mammalian zona pellucida, from the viewpoint that the structural and functional varieties of ZP glycoproteins might be associated with the evolutionary adaptation to their reproductive strategies. By comparing the egg coat of birds and mammals whose reproductive strategies are largely different, new insights into the molecular mechanisms of vertebrate egg-sperm interactions might be provided.

  6. Protoplasts and plant viruses

    International Nuclear Information System (INIS)

    Murakishi, H.; Lesney, M.S.; Carlson, P.

    1984-01-01

    The use of protoplasts in the study of plant viruses has attracted considerable attention since its inception in the late 1960s. This article is an attempt to assess the current status of protoplasts (primarily) and all cell cultures (in some instances) in studies of virus infection, virus replication, cytopathology, cross-protection, virus resistance, and the use of in vitro methods and genetic engineering to recover virus-resistant plants. These areas of study proved difficult to do entirely with whole plants or plant parts. However, because protoplasts could be synchronously infected with virus, they provided a valuable alternative means of following biochemical and cytological events in relation to the virus growth cycle in a more precise manner than previously possible

  7. Induction of protective immunity in swine by recombinant bamboo mosaic virus expressing foot-and-mouth disease virus epitopes

    Directory of Open Access Journals (Sweden)

    Lin Na-Sheng

    2007-09-01

    Full Text Available Abstract Background Plant viruses can be employed as versatile vectors for the production of vaccines by expressing immunogenic epitopes on the surface of chimeric viral particles. Although several viruses, including tobacco mosaic virus, potato virus X and cowpea mosaic virus, have been developed as vectors, we aimed to develop a new viral vaccine delivery system, a bamboo mosaic virus (BaMV, that would carry larger transgene loads, and generate better immunity in the target animals with fewer adverse environmental effects. Methods We engineered the BaMV as a vaccine vector expressing the antigenic epitope(s of the capsid protein VP1 of foot-and-mouth disease virus (FMDV. The recombinant BaMV plasmid (pBVP1 was constructed by replacing DNA encoding the 35 N-terminal amino acid residues of the BaMV coat protein with that encoding 37 amino acid residues (T128-N164 of FMDV VP1. Results The pBVP1 was able to infect host plants and to generate a chimeric virion BVP1 expressing VP1 epitopes in its coat protein. Inoculation of swine with BVP1 virions resulted in the production of anti-FMDV neutralizing antibodies. Real-time PCR analysis of peripheral blood mononuclear cells from the BVP1-immunized swine revealed that they produced VP1-specific IFN-γ. Furthermore, all BVP1-immunized swine were protected against FMDV challenge. Conclusion Chimeric BaMV virions that express partial sequence of FMDV VP1 can effectively induce not only humoral and cell-mediated immune responses but also full protection against FMDV in target animals. This BaMV-based vector technology may be applied to other vaccines that require correct expression of antigens on chimeric viral particles.

  8. PREFACE The physics of virus assembly The physics of virus assembly

    Science.gov (United States)

    Stockley, Peter G.; Twarock, Reidun

    2010-12-01

    Viruses are pathogens in every kingdom of life and are major causes of human disease and suffering. They are known to encompass a size range that overlaps with that of the smallest bacterial cells, and the largest viruses now seem to be hosts of their own viral pathogens. Recent genomic sequencing efforts show that many organisms have genes that are likely to be descended in evolution from viral progenitors. Even more astonishingly, analysis of the world's oceans has shown that some of the simplest viruses, the tailed dsDNA phages, are the most common biological entities on the planet, with estimates of their numbers ranging up to 1031, with ~ 1021 infection events every second, leading to a turnover of around 20% of the biomass in the sea every few days. These cycles of infection and lysis of oceanic bacteria and algae provide the nutrients for the smallest organisms lying at the bottom of the food chain. Without viruses, therefore, life on Earth would probably not be sustainable. These are remarkable facts for systems that are non-living in the strict sense, and are composed of simple materials—nucleic acids, proteins and lipids. Many viruses consist of little more than a protective protein coat surrounding their genomic nucleic acids, which can be either DNA or RNA. Their simplicity leads to highly symmetrical structures with protein containers based on helical or icosahedral lattices. Many simple viruses self-assemble rapidly and with great fidelity, and many groups are busy trying to exploit these properties to make virus-like particles for a wide range of applications, including targeted drug-delivery, medical imaging and even novel materials. This issue of Physical Biology contains a series of papers describing some of the latest experimental and theoretical research on viruses, their structures and assembly, as well as their regulated disassembly during infection. These range from a dissection of the in vivo assembly mechanism of a filamentous virus

  9. Intumescent Coatings as Fire Retardants

    Science.gov (United States)

    Parker, J. A.; Fohlen, G. M.; Sawko, P. M.; Fish, R. H.

    1970-01-01

    The development of fire-retardant coatings to protect surfaces which may be exposed to fire or extreme heat is a subject of intense interest to many industries. A fire-retardant paint has been developed which represents a new chemical approach for preparing intumescent coatings, and potentially, is very important to fire-prevention authorities. The requirements for a superior coating include ease of application, suitability to a wide variety of surfaces and finishes, and stability over an extended period of time within a broad range of ambient temperature and humidity conditions. These innovative coatings, when activated by the heat of a fire, react to form a thick, low-density, polymeric coating or char layer. Water vapor and sulphur dioxide are released during the intumescent reaction. Two fire-protection mechanisms thus become available: (1) the char layer retards the flow of heat, due to the extremely low thermal conductivity; and (2) water vapor and sulfur dioxide are released, providing fire quenching properties. Still another mechanism functions in cases where the char, by virtue of its high oxidation resistance and low thermal conductivity, reaches a sufficiently high temperature to re-radiate much of the incident heat load. The coatings consist of dispersions of selective salts of a nitro-amino-arornatic compound. Specifically, para-nitroaniline bisulfate and the ammonium salt of para-nitroaniline-ortho sulphuric acid (2-amino-5-nitrobenzenesulphuric acid) are used. Suitable vehicles are cellulose nitrate of lacquer grade, a nitrite-phenolic modified rubber, or epoxy-polysulfide copolymer. Three separate formulations have been developed. A solvent is usually employed, such as methylethyl ketone, butyl acetate, or toluene, which renders the coatings suitably thin and which evaporates after the coatings are applied. Generally, the intumescent material is treated as insoluble in the vehicle, and is ground and dispersed in the vehicle and solvent like an

  10. Integrated Glass Coating Manufacturing Line

    Energy Technology Data Exchange (ETDEWEB)

    Brophy, Brenor [Enki Technology Inc., San Jose, CA (United States)

    2015-09-30

    This project aims to enable US module manufacturers to coat glass with Enki’s state of the art tunable functionalized AR coatings at the lowest possible cost and highest possible performance by encapsulating Enki’s coating process in an integrated tool that facilitates effective process improvement through metrology and data analysis for greater quality and performance while reducing footprint, operating and capital costs. The Phase 1 objective was a fully designed manufacturing line, including fully specified equipment ready for issue of purchase requisitions; a detailed economic justification based on market prices at the end of Phase 1 and projected manufacturing costs and a detailed deployment plan for the equipment.

  11. Laser-based coatings removal

    International Nuclear Information System (INIS)

    Freiwald, J.G.; Freiwald, D.A.

    1995-01-01

    Over the years as building and equipment surfaces became contaminated with low levels of uranium or plutonium dust, coats of paint were applied to stabilize the contaminants in place. Most of the earlier paint used was lead-based paint. More recently, various non-lead-based paints, such as two-part epoxy, are used. For D ampersand D (decontamination and decommissioning), it is desirable to remove the paints or other coatings rather than having to tear down and dispose of the entire building. This report describes the use of pulse-repetetion laser systems for the removal of paints and coatings

  12. Hydrogen permeation resistant phosphate coatings

    International Nuclear Information System (INIS)

    McGuire, J.C.

    1979-01-01

    A method for reducing hydrogen diffusion through metal wherein the metal is coated with a phosphate-radical-containing, phosphate-glass-forming material on at least one surface thereof. The coating is then heated to at least 350 0 C to form a phosphate glass. This method is especially applicable to nuclear reactors to minimize tritium diffusion. The coating is preferably formed with a solution of phosphoric acid which may also contain compounds such as MnSO 4 , SiO 2 and Na 2 Cr 2 0 7 . (author)

  13. Hydrogen permeation resistant phosphate coatings

    International Nuclear Information System (INIS)

    McGuire, J.C.

    1979-01-01

    A method for reducing hydrogen diffusion through metal is described. The metal is coated with a phosphate-radical-containing, phosphate-glass-forming material on at least one surface. The coating is then heated to at least 350 0 C to form a phosphate glass. This method is especially applicable to nuclear reactors to minimize tritium diffusion. The coating is preferably formed with a solution of phosphoric acid which may also contain compounds such as MnSO 4 , SiO 2 and Na 2 Cr 2 O 7 . (author)

  14. Laser-based coatings removal

    Energy Technology Data Exchange (ETDEWEB)

    Freiwald, J.G.; Freiwald, D.A. [F2 Associates, Inc., Albuquerque, NM (United States)

    1995-10-01

    Over the years as building and equipment surfaces became contaminated with low levels of uranium or plutonium dust, coats of paint were applied to stabilize the contaminants in place. Most of the earlier paint used was lead-based paint. More recently, various non-lead-based paints, such as two-part epoxy, are used. For D&D (decontamination and decommissioning), it is desirable to remove the paints or other coatings rather than having to tear down and dispose of the entire building. This report describes the use of pulse-repetetion laser systems for the removal of paints and coatings.

  15. Correlation between particle multiplicity and location on virion RNA of the assembly initiation site for viruses of the tobacco mosaic virus group.

    Science.gov (United States)

    Fukuda, M; Meshi, T; Okada, Y; Otsuki, Y; Takebe, I

    1981-07-01

    The initiation site for reconstitution on genome RNA was determined by electron microscopic serology for a watermelon strain of cucumber green mottle mosaic virus (CGMMV-W), which is chemically and serologically related to tobacco mosaic virus (TMV). The initiation site was located at the same position as that of the cowpea strain, a virus that produces short rods of encapsidated subgenomic messenger RNA for the coat protein (a two-component TMV), being about 320 nucleotides away from the 3' terminus, and hence within the coat protein cistron. Although CGMMV-W was until now believed to be a single-component TMV, the location of the initiation site indicated the presence of short rods containing coat protein messenger RNA in CGMMV-W-infected tissue, as in the case for the cowpea strain. We found such short rods in CGMMV-W-infected tissue. The results confirmed our previous hypothesis that the site of the initiation region for reconstitution determines the rod multiplicity of TMV. The finding of the second two-component TMV, CGMMV, indicates that the cowpea strain of TMV is not unique in being a two-component virus and that the location of the assembly initiation site on the genome RNA can be a criterion for grouping of viruses.

  16. Nucleotide sequence of tomato ringspot virus RNA-2.

    Science.gov (United States)

    Rott, M E; Tremaine, J H; Rochon, D M

    1991-07-01

    The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

  17. Experimental evaluation of coating delamination in vinyl coated metal forming

    International Nuclear Information System (INIS)

    Son, Young Ki; Lee, Chan Joo; Kim, Byung Min; Lee, Jung Min; Byoen, Sang Doek; Lee, Soen Bong

    2012-01-01

    In this paper, a new evaluation and prediction method for coating delamination during sheet metal forming is presented. On the basis of the forming limit diagram (FLD), the current study evaluates the delamination of PET coating by using a cross cut specimen, dome test, and rectangular cup drawing test. Dome test specimens were subjected to biaxial, plane strain, and uniaxial deformation modes. Rectangular cup drawing test specimens were subjected to the deep drawing deformation mode, and compression deformation mode. A vinyl coated metal (VCM) sheet consists of three layers of polymer on the sheet metals: a protective film, a PET layer and a PVC layer. The areas with coating delamination were identified, and the results of the evaluation were plotted according to major and minor strain values, depicting coating delamination. The constructed delamination limit diagram (DLD) can be used to determine the forming limit of VCM during the complex press forming process. ARGUS (GOM) was employed to identify the strain value and deformation mode of the delaminated surface after the press forming. After identifying the areas of delamination, the DLD of the PET coating can be constructed in a format similar to that of the FLD. The forming limit of the VCM sheet can be evaluated using the superimposition of the delamination limit strain of the coating onto the FLD of VCM sheet. The experimental results showed that the proposed test method will support the sheet metal forming process design for VCM sheets. The assessment method presented in this study can be used to determine the delamination limit strain under plastic deformation of other polymer coated metals. The experimental results suggested that the proposed testing method is effective in evaluating delamination for specific applications

  18. Experimental evaluation of coating delamination in vinyl coated metal forming

    Energy Technology Data Exchange (ETDEWEB)

    Son, Young Ki; Lee, Chan Joo; Kim, Byung Min [Pusan National Univ., Busan (Korea, Republic of); Lee, Jung Min [Korea Institute of Industrial Technology, Busan (Korea, Republic of); Byoen, Sang Doek [HA Digital Engineering Gr., Seongsan Gu (Korea, Republic of); Lee, Soen Bong [Keimyung Univ., Daegu (Korea, Republic of)

    2012-10-15

    In this paper, a new evaluation and prediction method for coating delamination during sheet metal forming is presented. On the basis of the forming limit diagram (FLD), the current study evaluates the delamination of PET coating by using a cross cut specimen, dome test, and rectangular cup drawing test. Dome test specimens were subjected to biaxial, plane strain, and uniaxial deformation modes. Rectangular cup drawing test specimens were subjected to the deep drawing deformation mode, and compression deformation mode. A vinyl coated metal (VCM) sheet consists of three layers of polymer on the sheet metals: a protective film, a PET layer and a PVC layer. The areas with coating delamination were identified, and the results of the evaluation were plotted according to major and minor strain values, depicting coating delamination. The constructed delamination limit diagram (DLD) can be used to determine the forming limit of VCM during the complex press forming process. ARGUS (GOM) was employed to identify the strain value and deformation mode of the delaminated surface after the press forming. After identifying the areas of delamination, the DLD of the PET coating can be constructed in a format similar to that of the FLD. The forming limit of the VCM sheet can be evaluated using the superimposition of the delamination limit strain of the coating onto the FLD of VCM sheet. The experimental results showed that the proposed test method will support the sheet metal forming process design for VCM sheets. The assessment method presented in this study can be used to determine the delamination limit strain under plastic deformation of other polymer coated metals. The experimental results suggested that the proposed testing method is effective in evaluating delamination for specific applications.

  19. Hydrogel based QCM aptasensor for detection of avian influenza virus.

    Science.gov (United States)

    Wang, Ronghui; Li, Yanbin

    2013-04-15

    The objective of this study was to develop a quartz crystal microbalance (QCM) aptasensor based on ssDNA crosslinked polymeric hydrogel for rapid, sensitive and specific detection of avian influenza virus (AIV) H5N1. A selected aptamer with high affinity and specificity against AIV H5N1 surface protein was used, and hybridization between the aptamer and ssDNA formed the crosslinker in the polymer hydrogel. The aptamer hydrogel was immobilized on the gold surface of QCM sensor using a self-assembled monolayer method. The hydrogel remained in the state of shrink if no H5N1 virus was present in the sample because of the crosslinking between the aptamer and ssDNA in the polymer network. When it exposed to target virus, the binding reaction between the aptamer and H5N1 virus caused the dissolution of the linkage between the aptamer and ssDNA, resulting in the abrupt swelling of the hydrogel. The swollen hydrogel was monitored by the QCM sensor in terms of decreased frequency. Three polymeric hydrogels with different ratio (100:1 hydrogel I, 10:1 hydrogel II, 1:1 hydrogel III) of acrylamide and the aptamer monomer were synthesized, respectively, and then were used as the QCM sensor coating material. The results showed that the developed hydrogel QCM aptasensor was capable of detecting target H5N1 virus, and among the three developed aptamer hydrogels, hydrogel III coated QCM aptasensor achieved the highest sensitivity with the detection limit of 0.0128 HAU (HA unit). The total detection time from sampling to detection was only 30 min. In comparison with the anti-H5 antibody coated QCM immunosensor, the hydrogel QCM aptasensor lowered the detection limit and reduced the detection time. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Water permeability of pigmented waterborne coatings

    NARCIS (Netherlands)

    Donkers, P.A.J.; Huinink, H.P.; Erich, S.J.F.; Reuvers, N.J.W.; Adan, O.C.G.

    2013-01-01

    Coatings are used in a variety of applications. Last decades more and more coating systems are transforming from solvent to waterborne coating systems. In this study the influence of pigments on the water permeability of a waterborne coating system is studied, with special interest in the possible

  1. Radiation cured coatings for fiber optics

    International Nuclear Information System (INIS)

    Ketley, A.D.; Morgan, C.R.

    1978-01-01

    A continuous protective coating is formed on a fiber optic by coating the fiber optic in a bath of a liquid radiation curable composition at a temperature up to 90 0 C and exposing the coated conductor to ultraviolet or high energy ionizing radiation to cure the coating

  2. Hex Chrome Free Coatings for Electronics Overview

    Science.gov (United States)

    Kessel, Kurt

    2013-01-01

    The overall objective of the Hex Chrome Free Coatings for Electronics project is to evaluate and test pretreatment coating systems not containing hexavalent chrome in avionics and electronics housing applications. This objective will be accomplished by testing strong performing coating systems from prior NASA and DoD testing or new coating systems as determined by the stakeholders.

  3. [The great virus comeback].

    Science.gov (United States)

    Forterre, Patrick

    2013-01-01

    Viruses have been considered for a long time as by-products of biological evolution. This view is changing now as a result of several recent discoveries. Viral ecologists have shown that viral particles are the most abundant biological entities on our planet, whereas metagenomic analyses have revealed an unexpected abundance and diversity of viral genes in the biosphere. Comparative genomics have highlighted the uniqueness of viral sequences, in contradiction with the traditional view of viruses as pickpockets of cellular genes. On the contrary, cellular genomes, especially eukaryotic ones, turned out to be full of genes derived from viruses or related elements (plasmids, transposons, retroelements and so on). The discovery of unusual viruses infecting archaea has shown that the viral world is much more diverse than previously thought, ruining the traditional dichotomy between bacteriophages and viruses. Finally, the discovery of giant viruses has blurred the traditional image of viruses as small entities. Furthermore, essential clues on virus history have been obtained in the last ten years. In particular, structural analyses of capsid proteins have uncovered deeply rooted homologies between viruses infecting different cellular domains, suggesting that viruses originated before the last universal common ancestor (LUCA). These studies have shown that several lineages of viruses originated independently, i.e., viruses are polyphyletic. From the time of LUCA, viruses have coevolved with their hosts, and viral lineages can be viewed as lianas wrapping around the trunk, branches and leaves of the tree of life. Although viruses are very diverse, with genomes encoding from one to more than one thousand proteins, they can all be simply defined as organisms producing virions. Virions themselves can be defined as infectious particles made of at least one protein associated with the viral nucleic acid, endowed with the capability to protect the viral genome and ensure its

  4. Comparison of additive amount used in spin-coated and roll-coated organic solar cells

    DEFF Research Database (Denmark)

    Cheng, Pei; Lin, Yuze; Zawacka, Natalia Klaudia

    2014-01-01

    All-polymer and polymer/fullerene inverted solar cells were fabricated by spin-coating and roll-coating processes. The spin-coated small-area (0.04 cm(2)) devices were fabricated on indium tin oxide (ITO) coated glass substrates in nitrogen. The roll-coated large-area (1.0 cm(2)) devices were...

  5. Overlay metallic-cermet alloy coating systems

    International Nuclear Information System (INIS)

    Gedwill, M.A.; Glasgow, T.K.; Levine, S.R.

    1982-01-01

    A substrate, such as a turbine blade, vane, or the like, which is subjected to high temperature use is coated with a base coating of an oxide dispersed, metallic alloy (cermet). A top coating of an oxidation, hot corrosion, erosion resistant alloy of nickel, cobalt, or iron is then deposited on the base coating. A heat treatment is used to improve the bonding. The base coating serves as an inhibitor to interdiffusion between the protective top coating and the substrate. Otherwise, the protective top coating would rapidly interact detrimentally with the substrate and degrade by spalling of the protective oxides formed on the outer surface at elevated temperatures

  6. Overlay metallic-cermet alloy coating systems

    Science.gov (United States)

    Gedwill, M. A.; Levine, S. R.; Glasgow, T. K. (Inventor)

    1984-01-01

    A substrate, such as a turbine blade, vane, or the like, which is subjected to high temperature use is coated with a base coating of an oxide dispersed, metallic alloy (cermet). A top coating of an oxidation, hot corrosion, erosion resistant alloy of nickel, cobalt, or iron is then deposited on the base coating. A heat treatment is used to improve the bonding. The base coating serves as an inhibitor to interdiffusion between the protective top coating and the substrate. Otherwise, the protective top coating would rapidly interact detrimentally with the substrate and degrade by spalling of the protective oxides formed on the outer surface at elevated temperatures.

  7. Seal coat binder performance specifications.

    Science.gov (United States)

    2013-11-01

    Need to improve seal coat binder specs: replace empirical tests (penetration, ductility) with : performance-related tests applicable to both : unmodified and modified binders; consider temperatures that cover entire in service : range that are tied t...

  8. Protective coatings for commercial particulates

    DEFF Research Database (Denmark)

    Kindl, B.; Teng, Y.H.; Liu, Y.L.

    1994-01-01

    SiC/Al composites are in large-scale production with Al-Si alloy matrices. The same composites with pure Al or low Si matrices need diffusion barriers on the SiC reinforcement to control the interfacial reaction. The present paper describes various approaches taken to obtain protective coatings...... of alumina and zirconia on SiC particulates by sol-gel techniques. Aqueous and organic precursors have been used. The extent of the reaction, i.e., the Si and Al4C3 content in the matrix, was determined by differential thermal analysis and X-ray diffraction. The reaction rates of some coated particulates...... in liquid Al are decreased by as much as one order of magnitude during the first 15 min of immersion. Pretreatments of the SiC surface, the composition and thickness of the coating interphase and heat treatments of the coated materials have been studied, and are discussed in relation to their effect...

  9. Cementless Hydroxyapatite Coated Hip Prostheses

    Science.gov (United States)

    Herrera, Antonio; Mateo, Jesús; Gil-Albarova, Jorge; Lobo-Escolar, Antonio; Ibarz, Elena; Gabarre, Sergio; Más, Yolanda

    2015-01-01

    More than twenty years ago, hydroxyapatite (HA), calcium phosphate ceramics, was introduced as a coating for cementless hip prostheses. The choice of this ceramic is due to its composition being similar to organic apatite bone crystals. This ceramic is biocompatible, bioactive, and osteoconductive. These qualities facilitate the primary stability and osseointegration of implants. Our surgical experience includes the implantation of more than 4,000 cementless hydroxyapatite coated hip prostheses since 1990. The models implanted are coated with HA in the acetabulum and in the metaphyseal area of the stem. The results corresponding to survival and stability of implants were very satisfactory in the long-term. From our experience, HA-coated hip implants are a reliable alternative which can achieve long term survival, provided that certain requirements are met: good design selection, sound choice of bearing surfaces based on patient life expectancy, meticulous surgical technique, and indications based on adequate bone quality. PMID:25802848

  10. Black Sprayable Molecular Adsorber Coating

    Data.gov (United States)

    National Aeronautics and Space Administration — The main objective of this technology project is to develop, optimize, and flight qualify a black version of the molecular adsorber coating and a conductive version...

  11. Self-stratifying antimicrobial coatings

    NARCIS (Netherlands)

    Yagci, M.B.

    2012-01-01

    Today, antimicrobial polymers/coatings are widely used in various areas, such as biomedical devices, pharmaceuticals, hospital buildings, textiles, food processing, and contact lenses, where sanitation is needed. Such wide application facilities have made antimicrobial materials very attractive for

  12. Smart Coatings for Corrosion Protection

    Science.gov (United States)

    Calle, Luz Marina; Li, Wendy; Buhrow, Jerry W.; Johnsey, Marissa N.

    2016-01-01

    Nearly all metals and their alloys are subject to corrosion that causes them to lose their structural integrity or other critical functionality. It is essential to detect corrosion when it occurs, and preferably at its early stage, so that action can be taken to avoid structural damage or loss of function. Protective coatings are the most commonly used method of corrosion control. However, progressively stricter environmental regulations have resulted in the ban of many commercially available corrosion protective coatings due to the harmful effects of their solvents or corrosion inhibitors. This work concerns the development of a multifunctional, smart coating for the autonomous control of corrosion. This coating is being developed to have the inherent ability to detect the chemical changes associated with the onset of corrosion and respond autonomously to indicate it and control it.

  13. Dielectric coatings on metal substrates

    International Nuclear Information System (INIS)

    Glaros, S.S.; Baker, P.; Milam, D.

    1976-01-01

    Large aperture, beryllium substrate-based mirrors have been used to focus high intensity pulsed laser beams. Finished surfaces have high reflectivity, low wavefront distortion, and high laser damage thresholds. This paper describes the development of a series of metallic coatings, surface finishing techniques, and dielectric overcoatings to meet specified performance requirements. Beryllium substrates were coated with copper, diamond-machined to within 5 micro-inches to final contour, nickel plated, and abrasively figured to final contour. Bond strengths for several bonding processes are presented. Dielectric overcoatings were deposited on finished multimetallic substrates to increase both reflectivity and the damage thresholds. Coatings were deposited using both high and low temperature processes which induce varying stresses in the finished coating substrate system. Data are presented to show the evolution of wavefront distortion, reflectivity, and damage thresholds throughout the many steps involved in fabrication

  14. Cementless Hydroxyapatite Coated Hip Prostheses

    Directory of Open Access Journals (Sweden)

    Antonio Herrera

    2015-01-01

    Full Text Available More than twenty years ago, hydroxyapatite (HA, calcium phosphate ceramics, was introduced as a coating for cementless hip prostheses. The choice of this ceramic is due to its composition being similar to organic apatite bone crystals. This ceramic is biocompatible, bioactive, and osteoconductive. These qualities facilitate the primary stability and osseointegration of implants. Our surgical experience includes the implantation of more than 4,000 cementless hydroxyapatite coated hip prostheses since 1990. The models implanted are coated with HA in the acetabulum and in the metaphyseal area of the stem. The results corresponding to survival and stability of implants were very satisfactory in the long-term. From our experience, HA-coated hip implants are a reliable alternative which can achieve long term survival, provided that certain requirements are met: good design selection, sound choice of bearing surfaces based on patient life expectancy, meticulous surgical technique, and indications based on adequate bone quality.

  15. Postmortem stability of Ebola virus.

    Science.gov (United States)

    Prescott, Joseph; Bushmaker, Trenton; Fischer, Robert; Miazgowicz, Kerri; Judson, Seth; Munster, Vincent J

    2015-05-01

    The ongoing Ebola virus outbreak in West Africa has highlighted questions regarding stability of the virus and detection of RNA from corpses. We used Ebola virus-infected macaques to model humans who died of Ebola virus disease. Viable virus was isolated <7 days posteuthanasia; viral RNA was detectable for 10 weeks.

  16. Viruses affecting lentil (Lens culinaris Medik. in Greece; incidence and genetic variability of Bean leafroll virus and Pea enation mosaic virus

    Directory of Open Access Journals (Sweden)

    Elisavet K. CHATZIVASSILIOU

    2016-07-01

    Full Text Available In Greece, lentil (Lens culinaris Medik. crops are mainly established with non-certified seeds of local landraces, implying high risks for seed transmitted diseases. During April and May of the 2007–2012 growing seasons, surveys were conducted in eight regions of Greece (Attiki, Evros, Fthiotida, Korinthos, Kozani, Larissa, Lefkada and Viotia to monitor virus incidence in lentil fields. A total of 1216 lentil samples, from plants exhibiting symptoms suggestive of virus infection, were analyzed from 2007 to 2009, using tissue-blot immunoassays (TBIA. Pea seed-borne mosaic virus (PSbMV overall incidence was 4.9%, followed by Alfalfa mosaic virus (AMV (2.4% and Bean yellow mosaic virus (BYMV (1.0%. When 274 of the samples were tested for the presence of luteoviruses, 38.8% were infected with Bean leafroll virus (BLRV. Since BLRV was not identified in the majority of the samples collected from 2007 to 2009, representative symptomatic plants (360 samples were collected in further surveys performed from 2010 to 2012 and tested by ELISA. Two viruses prevailed in those samples: BLRV (36.1% was associated with stunting, yellowing, and reddening symptoms and Pea enation mosaic virus-1 (PEMV-1 (35.0% was associated with mosaic and mottling symptoms. PSbMV (2.2%, AMV (2.2%, BYMV (3.9% and CMV (2.8% were also detected. When the molecular variability was analyzed for representative isolates, collected from the main Greek lentil production areas, five BLRV isolates showed 95% identity for the coat protein (CP gene and 99% for the 3’ end region. Three Greek PEMV isolates co-clustered with an isolate from Germany when their CP sequence was compared with isolates with no mutation in the aphid transmission gene. Overall, limited genetic variability was detected among Greek isolates of BLRV and PEMV.

  17. Electrically conductive polymer concrete coatings

    Science.gov (United States)

    Fontana, Jack J.; Elling, David; Reams, Walter

    1990-01-01

    A sprayable electrically conductive polymer concrete coating for vertical d overhead applications is described. The coating is permeable yet has low electrical resistivity (<10 ohm-cm), good bond strength to concrete substrates, and good weatherability. A preferred formulation contains about 60 wt % calcined coke breeze, 40 wt % vinyl ester with 3.5 wt % modified bentonite clay. Such formulations apply evenly and provide enough rigidity for vertical or overhead structures so there is no drip or sag.

  18. Nanocrystalline diamond coatings for machining

    Energy Technology Data Exchange (ETDEWEB)

    Frank, M.; Breidt, D.; Cremer, R. [CemeCon AG, Wuerselen (Germany)

    2007-07-01

    This history of CVD diamond synthesis goes back to the fifties of the last century. However, the scientific and economical potential was only gradually recognized. In the eighties, intensive worldwide research on CVD diamond synthesis and applications was launched. Industrial products, especially diamond-coated cutting tools, were introduced to the market in the middle of the nineties. This article shows the latest developments in this area, which comprises nanocrystalline diamond coating structures. (orig.)

  19. Dry and coating of powders

    International Nuclear Information System (INIS)

    Alonso, M.; Alguacil, F. J.

    1999-01-01

    This paper presents a review on the mixing and coating of powders by dry processes. The reviews surveys fundamental works on mixture characterization (mixing index definitions and sampling techniques), mixing mechanisms and models, segregation with especial emphasis on free-surface segregation, mixing of cohesive powders and interparticle forces, ordered mixing (dry coating) including mechanism, model and applications and mixing equipment selection. (Author) 180 refs

  20. Silicone nanocomposite coatings for fabrics

    Science.gov (United States)

    Eberts, Kenneth (Inventor); Lee, Stein S. (Inventor); Singhal, Amit (Inventor); Ou, Runqing (Inventor)

    2011-01-01

    A silicone based coating for fabrics utilizing dual nanocomposite fillers providing enhanced mechanical and thermal properties to the silicone base. The first filler includes nanoclusters of polydimethylsiloxane (PDMS) and a metal oxide and a second filler of exfoliated clay nanoparticles. The coating is particularly suitable for inflatable fabrics used in several space, military, and consumer applications, including airbags, parachutes, rafts, boat sails, and inflatable shelters.

  1. Coating of silicon pore optics

    DEFF Research Database (Denmark)

    Cooper-Jensen, Carsten P.; Ackermann, M.; Christensen, Finn Erland

    2009-01-01

    For the International X-ray observatory (IXO), a mirror module with an effective area of 3 m2 at 1.25 keV and at least 0.65 m2 at 6 keV has to be realized. To achieve this goal, coated silicon pore optics has been developed over the last years. One of the challenges is to coat the Si plates...

  2. Damage-resistant brittle coatings

    Energy Technology Data Exchange (ETDEWEB)

    Lawn, B.R.; Lee, K.S. [National Inst. of Stand. and Technol., Gaithersburg, MD (United States). Mater. Sci. and Eng. Lab.; Chai, H. [Tel Aviv Univ. (Israel). Faculty of Engineering; Pajares, A. [Universidad de Extremadura, Badajoz (Spain). Dept. de Fisica; Kim, D.K. [Korea Advanced Inst. of Science and Technolgy, Taejon (Korea). Dept. of Materials Science and Engineering; Wuttiphan, S. [National Metal and Materials Technology Center, Bangkok (Thailand); Peterson, I.M. [Corning Inc., NY (United States); Hu Xiaozhi [Western Australia Univ., Nedlands, WA (Australia). Dept. of Mechanical and Materials Engineering

    2000-11-01

    Laminate structures consisting of hard, brittle coatings and soft, tough substrates are important in a wide variety of engineering applications, biological structures, and traditional pottery. In this study the authors introduce a new approach to the design of damage-resistant brittle coatings, based on a combination of new and existing relations for crack initiation in well-defined contact-induced stress fields. (orig.)

  3. Corrosion resistant neutron absorbing coatings

    Science.gov (United States)

    Choi, Jor-Shan [El Cerrito, CA; Farmer, Joseph C [Tracy, CA; Lee, Chuck K [Hayward, CA; Walker, Jeffrey [Gaithersburg, MD; Russell, Paige [Las Vegas, NV; Kirkwood, Jon [Saint Leonard, MD; Yang, Nancy [Lafayette, CA; Champagne, Victor [Oxford, PA

    2012-05-29

    A method of forming a corrosion resistant neutron absorbing coating comprising the steps of spray or deposition or sputtering or welding processing to form a composite material made of a spray or deposition or sputtering or welding material, and a neutron absorbing material. Also a corrosion resistant neutron absorbing coating comprising a composite material made of a spray or deposition or sputtering or welding material, and a neutron absorbing material.

  4. Material Science Smart Coatings

    Energy Technology Data Exchange (ETDEWEB)

    Rubinstein, A. I. [Univ. of Nebraska Medical Center, Omaha, NE (United States); Sabirianov, R. F. [Univ. of Nebraska Medical Center, Omaha, NE (United States); Namavar, Fereydoon [Univ. of Nebraska Medical Center, Omaha, NE (United States)

    2014-07-01

    The contribution of electrostatic interactions to the free energy of binding between model protein and a ceramic implant surface in the aqueous solvent, considered in the framework of the nonlocal electrostatic model, is calculated as a function of the implant low-frequency dielectric constant. We show that the existence of a dynamically ordered (low-dielectric) interfacial solvent layer at the protein-solvent and ceramic-solvent interface markedly increases charging energy of the protein and ceramic implant, and consequently makes the electrostatic contribution to the protein-ceramic binding energy more favorable (attractive). Our analysis shows that the corresponding electrostatic energy between protein and oxide ceramics depends nonmonotonically on the dielectric constant of ceramic, εC. Obtained results indicate that protein can attract electrostatically to the surface if ceramic material has a moderate εC below or about 35 (in particularly ZrO2 or Ta2O5). This is in contrast to classical (local) consideration of the solvent, which demonstrates an unfavorable electrostatic interaction of protein with typical metal oxide ceramic materials (εC>10). Thus, a solid implant coated by combining oxide ceramic with a reduced dielectric constant can be beneficial to strengthen the electrostatic binding of the protein-implant complex.

  5. Silane based coating of aluminium mold

    DEFF Research Database (Denmark)

    2013-01-01

    having at least one closed cavity is provided, at least one surface of the at least one cavity being an aluminium surface coated with a silane based coating layer. The silane based anti-stiction coating improves the anti-stiction properties of the mold which may allow for molding and demolding...... of structures which would otherwise be difficult to mold. The resistance of the coated aluminium mold is significantly improved by applying a silane-based coating layer....

  6. Switchable antifouling coatings and uses thereof

    Science.gov (United States)

    Denton, Michele L. Baca; Dirk, Shawn M.; Johnson, Ross Stefan

    2017-02-28

    The present invention relates to antifouling coatings capable of being switched by using heat or ultraviolet light. Prior to switching, the coating includes an onium cation component having antimicrobial and antibacterial properties. Upon switching, the coating is converted to a conjugated polymer state, and the cationic component is released with any adsorbed biofilm layer. Thus, the coatings herein have switchable and releasable properties. Methods of making and using such coatings are also described.

  7. Survey of Viruses Present in Radish Fields in 2014

    Directory of Open Access Journals (Sweden)

    Jinsoo Chung

    2015-09-01

    Full Text Available A 2014 nationwide survey in radish fields investigated the distribution of common viruses and possible emerging viruses. Radish leaves with virus-like symptoms were collected and 108 samples assayed by RT-PCR using specific primers for Radish mosaic virus (RaMV, Cucumber mosaic virus (CMV, and Turnip mosaic virus (TuMV; 47 samples were TuMV positive, and RaMV and CMV were detected in 3 and 2 samples, respectively. No samples showed double infection of TuMV/RaMV, or RaMV/CMV, but two double infections of TuMV/CMV were detected. TuMV isolates were sorted by symptom severity, and three isolates (R007-mild; R041 and R065-severe selected for BLAST and phylogenetic analysis, which indicated that the coat protein (CP of these isolates (R007, R041, and R065 have approx. 98-99% homology to a previously reported TuMV isolate. RaMV CP showed approx. 99% homology to a previously reported isolate, and the CMV CP is identical to a previously reported Korean isolate (GenBank : GU327368. Three isolates of TuMV showing different pathogenicity (degree of symptom severity will be valuable to study determinants of pathogenicity.

  8. Graphene: corrosion-inhibiting coating.

    Science.gov (United States)

    Prasai, Dhiraj; Tuberquia, Juan Carlos; Harl, Robert R; Jennings, G Kane; Rogers, Bridget R; Bolotin, Kirill I

    2012-02-28

    We report the use of atomically thin layers of graphene as a protective coating that inhibits corrosion of underlying metals. Here, we employ electrochemical methods to study the corrosion inhibition of copper and nickel by either growing graphene on these metals, or by mechanically transferring multilayer graphene onto them. Cyclic voltammetry measurements reveal that the graphene coating effectively suppresses metal oxidation and oxygen reduction. Electrochemical impedance spectroscopy measurements suggest that while graphene itself is not damaged, the metal under it is corroded at cracks in the graphene film. Finally, we use Tafel analysis to quantify the corrosion rates of samples with and without graphene coatings. These results indicate that copper films coated with graphene grown via chemical vapor deposition are corroded 7 times slower in an aerated Na(2)SO(4) solution as compared to the corrosion rate of bare copper. Tafel analysis reveals that nickel with a multilayer graphene film grown on it corrodes 20 times slower while nickel surfaces coated with four layers of mechanically transferred graphene corrode 4 times slower than bare nickel. These findings establish graphene as the thinnest known corrosion-protecting coating.

  9. Polymeric Coatings for Combating Biocorrosion

    Science.gov (United States)

    Guo, Jing; Yuan, Shaojun; Jiang, Wei; Lv, Li; Liang, Bin; Pehkonen, Simo O.

    2018-03-01

    Biocorrosion has been considered as big trouble in many industries and marine environments due to causing great economic loss. The main disadvantages of present approaches to prevent corrosion include being limited by environmental factors, being expensive, inapplicable to field, and sometimes inefficient. Studies show that polymer coatings with anti-corrosion and anti-microbial properties have been widely accepted as a novel and effective approach to preventbiocorrosion. The main purpose of this review is to summarize up the progressive status of polymer coatings used for combating microbially-induced corrosion. Polymers used to synthesize protective coatings are generally divided into three categories: i) traditional polymers incorporated with biocides, ii) antibacterial polymers containing quaternary ammonium compounds, and iii) conductive polymers. The strategies to synthesize polymer coatings resort mainly to grafting anti-bacterial polymers from the metal substrate surface using novel surface-functionalization approaches, such as free radical polymerization, chemically oxidative polymerization and surface-initiated atom transfer radical polymerization, as opposed to the traditional approaches of dip coating or spin coating.

  10. Electron beam-cured coating

    International Nuclear Information System (INIS)

    Kishi, Naoyuki

    1976-01-01

    The method for hardening coatings by the irradiation with electron beams is reviewed. The report is divided into seven parts, namely 1) general description and characteristics of electron beam-cured coating, 2) radiation sources of curing, 3) hardening conditions and reaction behaviour, 4) uses and advantages, 5) latest trends of the industry, 6) practice in the field of construction materials, and 7) economy. The primary characteristics of the electron beam hardening is that graft reaction takes place between base resin and coating to produce strong adhesive coating without any pretreatment. A variety of base resins are developed. High class esters of acrylic acid monomers and methacrylic acid monomers are mainly used as dilutants recently. At present, scanning type accelerators are used, but the practical application of the system producing electron beam of curtain type is expected. The dose rate dependence, the repetitive irradiation and the irradiation atmosphere are briefly described. The filed patent applications on the electron beam hardening were analyzed by the officer of Japan Patent Agency. The production lines for coatings by the electron beam hardening in the world are listed. In the electron beam-cured coating, fifty percent of given energy is consumed effectively for the electron beam hardening, and the solvents discharged from ovens and polluting atmosphere are not used, because the paints of high solid type is used. The running costs of the electron beam process are one sixth of the thermal oven process. (Iwakiri, K.)

  11. Evidence for lysine acetylation in the coat protein of a polerovirus.

    Science.gov (United States)

    Cilia, Michelle; Johnson, Richard; Sweeney, Michelle; DeBlasio, Stacy L; Bruce, James E; MacCoss, Michael J; Gray, Stewart M

    2014-10-01

    Virions of the RPV strain of Cereal yellow dwarf virus-RPV were purified from infected oat tissue and analysed by MS. Two conserved residues, K147 and K181, in the virus coat protein, were confidently identified to contain epsilon-N-acetyl groups. While no functional data are available for K147, K181 lies within an interfacial region critical for virion assembly and stability. The signature immonium ion at m/z 126.0919 demonstrated the presence of N-acetyllysine, and the sequence fragment ions enabled an unambiguous assignment of the epsilon-N-acetyl modification on K181. We hypothesize that selection favours acetylation of K181 in a fraction of coat protein monomers to stabilize the capsid by promoting intermonomer salt bridge formation.

  12. Frequência de Lettuce big-vein associated virus e Mirafiori lettuce big-vein virus em Plantas de alface no Estado de São Paulo e transmissão através de extrato vegetal e solo Frequency of Lettuce big-vein associated virus and Mirafiori lettuce big-vein virus in symptomatic and assymptomatic lettuce plants and sap and soil transmission

    Directory of Open Access Journals (Sweden)

    Márcio Martinello Sanches

    2007-12-01

    condições de laboratório.The occurrence of big vein disease symptoms and the association of Lettuce big-vein associated virus (LBVaV and Mirafiori lettuce big-vein virus (MLBVV was evaluated by RT-PCR using specific primers for both viruses. A total of 366 symptomatic plants were collected during June and September 2004 and during April and July 2005 at Bauru, Campinas and Mogi das Cruzes in São Paulo state, and 18 symptomless plants were collected in Mogi das Cruzes on December 2004. Mixed infection was detected in 76,2% of the symptomatic plants, 11,5% had only MLBVV and 6,6% had only LBVaV. In the symptomless plants collected in areas with high incidence of the disease throughout the winter, MLBVV was found in 9 plants and LBVaV in 7 plants. Four plants had both viruses, indicating that symptom development depends on abiotic factors, such as temperature. Plants with MLBVV and LBVaV (mixed infection were used as source of virus in a host range assay at 16C/ 10°C (day/ night and 11h light period. MLBVV was transmitted to Nicotiana tabacum TNN, N. rustica, N. occidentalis, Chenopodium quinoa and lettuce cv. Trocadero and White Boston, while LBVaV was transmitted only to lettuce cv. White Boston. No symptons could be verified for these plants with the exception of C. quinoa that showed local lesions. Transmission through soil in areas with high incidence of the disease was observed for LBVaV to lettuce cv. White Boston and MLBVV for lettuce cv. Trocadero and White Boston, but only cv. White Boston showed symptoms. Together, these results demonstrate the difficulties in transmitting both viruses, even under controlled laboratory conditions.

  13. Tomato bushy stunt virus (TBSV) infecting Lycopersicon esculentum.

    Science.gov (United States)

    Hafez, El Sayed E; Saber, Ghada A; Fattouh, Faiza A

    2010-01-01

    Tomato bushy stunt virus (TBSV) was detected in tomato crop (Lycopersicon esculentum) in Egypt with characteristic mosaic leaf deformation, stunting, and bushy growth symptoms. TBSV infection was confirmed serologically by ELISA and calculated incidence was 25.5%. Basic physicochemical properties of a purified TBSV Egh isolate were identical to known properties of tombusviruses of isometric 30-nm diameter particles, 41-kDa coat protein and the genome of approximately 4800 nt. This is the first TBSV isolate reported in Egypt. Cloning and partial sequencing of the isolate showed that it is more closely related to TBSV-P and TBSV-Ch than TBSV-Nf and TBSV-S strains of the virus. However, it is distinct from the above strains and could be a new strain of the virus which further confirms the genetic diversity of tombusviruses.

  14. Coatings and Tints of Spectacle Lenses

    Directory of Open Access Journals (Sweden)

    H. Zeki Büyükyıldız

    2012-10-01

    Full Text Available Spectacle lenses are made of mineral or organic (plastic materials. Various coatings and tints are applied to the spectacle lenses according to the characteristic of the lens material, and for the personal needs and cosmetic purpose. The coatings may be classified in seven groups: 1 Anti-reflection coatings, 2 Hard coatings, 3 Clean coat, 4 Mirror coatings, 5 Color tint coating (one of coloring processes, 6 Photochromic coating (one of photochromic processes, and 7 Anti-fog coatings. Anti-reflection coatings reduce unwanted reflections from the lens surfaces and increase light transmission. Hard coatings are applied for preventing the plastic lens surface from scratches and abrasion. Hard coatings are not required for the mineral lenses due to their hardness. Clean coat makes the lens surface smooth and hydrophobic. Thus, it prevents the adherence of dust, tarnish, and dirt particles on the lens surface. Mirror coatings are applied onto the sunglasses for cosmetic purpose. Color tinted and photochromic lenses are used for sun protection and absorption of the harmful UV radiations. Anti-fog coatings make the lens surface hydrophilic and prevent the coalescence of tiny water droplets on the lens surface that reduces light transmission. (Turk J Ophthalmol 2012; 42: 359-69

  15. Line 63-1: A New Virus-resistant Transgenic Papaya

    NARCIS (Netherlands)

    Tennant, P.; Souza, M.T.; Fitch, M.M.; Manshardt, R.; Slightom, J.L.; Gonsalves, D.

    2005-01-01

    The disease resistance of a transgenic line expressing the coat protein (CP) gene of the mild strain of the papaya ringspot virus (PRSV) from Hawaii was further analyzed against PRSV isolates from Hawaii and other geographical regions. Line 63-1 originated from the same transformation experiment

  16. Characterization of petunia flower mottle virus (PetFMV), a new potyvirus infecting Petunia x hybrida.

    Science.gov (United States)

    Feldhoff, A; Wetzel, T; Peters, D; Kellner, R; Krczal, G

    1998-01-01

    With the introduction of cutting-grown Petunia x hybrida plants on the European market, a new potyvirus which showed no serological reaction with antisera against any other potyviruses infecting petunias was discovered. Infected leaves contained flexuous rod-shaped virus particles of 750-800 nm in length and inclusion bodies (pinwheel structures) typical for potyviruses in ultrathin leaf sections. The purified coat protein with a Mr of approximately 36 kDa could be detected in Western immunoblots with a specific antibody to the coat protein of the petunia-infecting virus. The 3' end of the viral genome encompassing the 3' non-coding region, the coat protein gene, and part of the NIb gene was amplified from infected leaf material by IC/PCR using degenerate and specific primers. Sequences of PCR-generated cDNA clones were compared to other known sequences of potyviruses. Maximum homology of 56% was found in the 3' non-coding region between the petunia isolate and other potyviruses. A maximum homology of 69% was found between the amino acid sequence of the coat protein of the petunia isolate and corresponding sequences of other potyviruses. These data indicate that the petunia-infecting virus is a previously undescribed potyvirus and the name petunia flower mottle virus (PetFMV) is suggested.

  17. Present status of some virus diseases affecting legume crops in Tunisia, and partial characterization of Chickpea chlorotic stunt virus

    Directory of Open Access Journals (Sweden)

    Asma NAJAR

    2011-09-01

    Full Text Available Field surveys were conducted in Tunisia during the 2005‒2006, 2006‒2007 and 2009‒2010 growing seasons to identify viruses which produce yellowing, reddening and/or stunting symptoms of chickpea, faba bean and pea crops. Tissue blot immunoassay (TBIA results showed that Chickpea chlorotic stunt virus (CpCSV was the most common virus, followed by Faba bean necrotic yellows virus, Bean leafroll virus and Beet western yellows virus. The coat protein (CP gene nucleotide sequence of seven CpCSV isolates collected from different regions of Tunisia was compared with sequences of five other isolates in the NCBI database. A homology tree of the CP nucleotide sequences was prepared and CpCSV isolates were grouped into two clusters. The first group contained two Tunisian CpCSV chickpea isolates collected from Bizerte and Kef; sequenced regions showed a high nucleotiode homology (95% to that of the Ethiopian and Sudanese CpCSV isolates. The second group included five Tunisian isolates: two from chickpea, two from pea and one from faba bean, which showed a high homology (96% when compared with the Moroccan, Egyptian and Syrian CpCSV isolates.

  18. Sugar coated semiconductors

    International Nuclear Information System (INIS)

    Mastandrea, M.; Bednarski, M.D.

    1990-01-01

    Certain molecules when placed in contact with a surface can bind to form well-ordered two dimensional arrays. This process is called molecular self-assembly (MSA), and it is emerging as an important method to control the interactions between a surface and its environment (interfacial properties). Molecular self-assembly uses the fundamental forces between molecules 9Van der Waals interactions, hydrophobic effects and hydrogen bonding) to form highly ordered macromolecular systems. This process has been used to synthesize molecular films on a variety of surfaces including glass, gold, alumina, platinum, and silicon. The objective of this paper is to describe the application of molecular self-assembled films to the study of biological systems. Specifically, they describe methods to synthesize and characterize surfaces that contain molecules that bind to bacteria and viruses. They also evaluate the use of surface science techniques to characterize the physical and chemical properties of these surfaces and they attempt to correlate these properties with the adhesion of biological molecules

  19. Zika virus infection.

    Science.gov (United States)

    Pougnet, Laurence; Thill, Chloé; Pougnet, Richard; Auvinet, Henri; Giacardi, Christophe; Drouillard, Isabelle

    2016-12-01

    A 21-year old woman from New-Caledonia had 40 ̊C fever with vomiting, arthralgia, myalgia, and measles-like rash. Etiological analyses showed primary infection with Zika virus. Because of severe clinical presentation, she was hospitalized in the intensive care unit of the Brest military Hospital. Zika virus is mainly transmitted by Aedes mosquitoes. If they settle in Metropolitan France, Zika virus might also spread there.

  20. Kinetics of cellular uptake of viruses and nanoparticles via clathrin-mediated endocytosis

    Science.gov (United States)

    Banerjee, Anand; Berezhkovskii, Alexander; Nossal, Ralph

    2016-02-01

    Several viruses exploit clathrin-mediated endocytosis to gain entry into host cells. This process is also used extensively in biomedical applications to deliver nanoparticles (NPs) to diseased cells. The internalization of these nano-objects is controlled by the assembly of a clathrin-containing protein coat on the cytoplasmic side of the plasma membrane, which drives the invagination of the membrane and the formation of a cargo-containing endocytic vesicle. Current theoretical models of receptor-mediated endocytosis of viruses and NPs do not explicitly take coat assembly into consideration. In this paper we study cellular uptake of viruses and NPs with a focus on coat assembly. We characterize the internalization process by the mean time between the binding of a particle to the membrane and its entry into the cell. Using a coarse-grained model which maps the stochastic dynamics of coat formation onto a one-dimensional random walk, we derive an analytical formula for this quantity. A study of the dependence of the mean internalization time on NP size shows that there is an upper bound above which this time becomes extremely large, and an optimal size at which it attains a minimum. Our estimates of these sizes compare well with experimental data. We also study the sensitivity of the obtained results on coat parameters to identify factors which significantly affect the internalization kinetics.

  1. Ebola (Ebola Virus Disease): Diagnosis

    Science.gov (United States)

    ... Search Form Controls Cancel Submit Search the CDC Ebola (Ebola Virus Disease) Note: Javascript is disabled or is ... message, please visit this page: About CDC.gov . Ebola (Ebola Virus Disease) What is Ebola Virus Disease? ...

  2. Ebola (Ebola Virus Disease): Transmission

    Science.gov (United States)

    ... Search Form Controls Cancel Submit Search the CDC Ebola (Ebola Virus Disease) Note: Javascript is disabled or is ... message, please visit this page: About CDC.gov . Ebola (Ebola Virus Disease) What is Ebola Virus Disease? ...

  3. Ebola (Ebola Virus Disease): Treatment

    Science.gov (United States)

    ... Search Form Controls Cancel Submit Search the CDC Ebola (Ebola Virus Disease) Note: Javascript is disabled or is ... message, please visit this page: About CDC.gov . Ebola (Ebola Virus Disease) What is Ebola Virus Disease? ...

  4. Stability and infectivity of novel pandemic influenza A (H1N1) virus in blood-derived matrices under different storage conditions.

    Science.gov (United States)

    Wang, Xue; Zoueva, Olga; Zhao, Jiangqin; Ye, Zhiping; Hewlett, Indira

    2011-12-22

    Influenza A virus has been detected in the blood of some infected individuals, and may pose a safety concern for collection, handling and transport of specimens for epidemiological and public health investigations if infectious virus is present in samples. Furthermore the effect of storage on virus stability and infectivity has not been well studied. We examined the stability of novel pandemic influenza A (H1N1) virus RNA when the virus was stored in phosphate buffered saline (PBS), plasma, or buffy coated blood at either room temperature or 4°C using a sensitive Taqman RT-PCR assay. We also investigated virus infectivity using the EID(50) assay when virus was stored in PBS, plasma, or buffy coats isolated from blood at 4°C. Viral RNA stability was affected by the matrix used for storage. The recovery of viral RNA was highest when virus was stored in PBS with lower amounts being recovered from plasma and buffy coats at either room temperature or 4°C. Incubation time did not appear to be a major factor for viral RNA stability, although there was gradual decline after longer periods post-incubation. Both sample matrix and incubation time affected virus infectivity. The decay in virus infectivity was greatest in PBS followed by buffy coats and plasma. Virus infectivity was abolished in buffy coats at day 20 post-incubation when virus concentrations were low. These data indicate that encapsidated viral RNA was stable overall in all three liquid matrices at room temperature or 4°C although it was most stable in PBS; virus infectivity in buffy coats at 4°C decayed in a time dependent manner while it remained unchanged in plasma. These findings have implications for storage, handling and transport of blood derived samples from influenza patients for epidemiological and laboratory investigations. It should be noted that there is little known about influenza viremia, and whether influenza viruses can be transmitted by blood or blood derived samples.

  5. Stability and infectivity of novel pandemic influenza A (H1N1 virus in blood-derived matrices under different storage conditions

    Directory of Open Access Journals (Sweden)

    Wang Xue

    2011-12-01

    Full Text Available Abstract Background Influenza A virus has been detected in the blood of some infected individuals, and may pose a safety concern for collection, handling and transport of specimens for epidemiological and public health investigations if infectious virus is present in samples. Furthermore the effect of storage on virus stability and infectivity has not been well studied. Methods We examined the stability of novel pandemic influenza A (H1N1 virus RNA when the virus was stored in phosphate buffered saline (PBS, plasma, or buffy coated blood at either room temperature or 4°C using a sensitive Taqman RT-PCR assay. We also investigated virus infectivity using the EID50 assay when virus was stored in PBS, plasma, or buffy coats isolated from blood at 4°C. Results Viral RNA stability was affected by the matrix used for storage. The recovery of viral RNA was highest when virus was stored in PBS with lower amounts being recovered from plasma and buffy coats at either room temperature or 4°C. Incubation time did not appear to be a major factor for viral RNA stability, although there was gradual decline after longer periods post-incubation. Both sample matrix and incubation time affected virus infectivity. The decay in virus infectivity was greatest in PBS followed by buffy coats and plasma. Virus infectivity was abolished in buffy coats at day 20 post-incubation when virus concentrations were low. Conclusion These data indicate that encapsidated viral RNA was stable overall in all three liquid matrices at room temperature or 4°C although it was most stable in PBS; virus infectivity in buffy coats at 4°C decayed in a time dependent manner while it remained unchanged in plasma. These findings have implications for storage, handling and transport of blood derived samples from influenza patients for epidemiological and laboratory investigations. It should be noted that there is little known about influenza viremia, and whether influenza viruses can be

  6. Yeast for virus research

    Science.gov (United States)

    Zhao, Richard Yuqi

    2017-01-01

    Budding yeast (Saccharomyces cerevisiae) and fission yeast (Schizosaccharomyces pombe) are two popular model organisms for virus research. They are natural hosts for viruses as they carry their own indigenous viruses. Both yeasts have been used for studies of plant, animal and human viruses. Many positive sense (+) RNA viruses and some DNA viruses replicate with various levels in yeasts, thus allowing study of those viral activities during viral life cycle. Yeasts are single cell eukaryotic organisms. Hence, many of the fundamental cellular functions such as cell cycle regulation or programed cell death are highly conserved from yeasts to higher eukaryotes. Therefore, they are particularly suited to study the impact of those viral activities on related cellular activities during virus-host interactions. Yeasts present many unique advantages in virus research over high eukaryotes. Yeast cells are easy to maintain in the laboratory with relative short doubling time. They are non-biohazardous, genetically amendable with small genomes that permit genome-wide analysis of virologic and cellular functions. In this review, similarities and differences of these two yeasts are described. Studies of virologic activities such as viral translation, viral replication and genome-wide study of virus-cell interactions in yeasts are highlighted. Impacts of viral proteins on basic cellular functions such as cell cycle regulation and programed cell death are discussed. Potential applications of using yeasts as hosts to carry out functional analysis of small viral genome and to develop high throughput drug screening platform for the discovery of antiviral drugs are presented. PMID:29082230

  7. Viruses infecting marine molluscs.

    Science.gov (United States)

    Arzul, Isabelle; Corbeil, Serge; Morga, Benjamin; Renault, Tristan

    2017-07-01

    Although a wide range of viruses have been reported in marine molluscs, most of these reports rely on ultrastructural examination and few of these viruses have been fully characterized. The lack of marine mollusc cell lines restricts virus isolation capacities and subsequent characterization works. Our current knowledge is mostly restricted to viruses affecting farmed species such as oysters Crassostrea gigas, abalone Haliotis diversicolor supertexta or the scallop Chlamys farreri. Molecular approaches which are needed to identify virus affiliation have been carried out for a small number of viruses, most of them belonging to the Herpesviridae and birnaviridae families. These last years, the use of New Generation Sequencing approach has allowed increasing the number of sequenced viral genomes and has improved our capacity to investigate the diversity of viruses infecting marine molluscs. This new information has in turn allowed designing more efficient diagnostic tools. Moreover, the development of experimental infection protocols has answered some questions regarding the pathogenesis of these viruses and their interactions with their hosts. Control and management of viral diseases in molluscs mostly involve active surveillance, implementation of effective bio security measures and development of breeding programs. However factors triggering pathogen development and the life cycle and status of the viruses outside their mollusc hosts still need further investigations. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Expression of self-complementary hairpin RNA under the control of the rolC promoter confers systemic disease resistance to plum pox virus without preventing local infection.

    Science.gov (United States)

    Pandolfini, Tiziana; Molesini, Barbara; Avesani, Linda; Spena, Angelo; Polverari, Annalisa

    2003-06-25

    Homology-dependent selective degradation of RNA, or post-transcriptional gene silencing (PTGS), is involved in several biological phenomena, including adaptative defense mechanisms against plant viruses. Small interfering RNAs mediate the selective degradation of target RNA by guiding a multicomponent RNAse. Expression of self-complementary hairpin RNAs within two complementary regions separated by an intron elicits PTGS with high efficiency. Plum pox virus (PPV) is the etiological agent of sharka disease in Drupaceae, although it can also be transmitted to herbaceous species (e.g. Nicotiana benthamiana). Once inside the plant, PPV is transmitted via plasmodesmata from cell to cell, and at longer distances, via phloem. The rolC promoter drives expression in phloem cells. RolC expression is absent in both epidermal and mesophyll cells. The aim of the present study was to confer systemic disease resistance without preventing local viral infection. In the ihprolC-PP197 gene (intron hair pin rolC PPV 197), a 197 bp sequence homologous to the PPV RNA genome (from base 134 to 330) was placed as two inverted repeats separated by the DNA sequence of the rolA intron. This hairpin construct is under the control of the rolC promoter.N. benthamiana plants transgenic for the ihprolC-PP197 gene contain siRNAs homologous to the 197 bp sequence. The transgenic progeny of ihprolC-PP197 plants are resistant to PPV systemic infection. Local infection is unaffected. Most (80%) transgenic plants are virus free and symptomless. Some plants (20%) contain virus in uninoculated apical leaves; however they show only mild symptoms of leaf mottling. PPV systemic resistance cosegregates with the ihprolC-PP197 transgene and was observed in progeny plants of all independent transgenic lines analyzed. SiRNAs of 23-25 nt homologous to the PPV sequence used in the ihprolC-PP197 construct were detected in transgenic plants before and after inoculation. Transitivity of siRNAs was observed in

  9. Expression of self-complementary hairpin RNA under the control of the rolC promoter confers systemic disease resistance to plum pox virus without preventing local infection

    Directory of Open Access Journals (Sweden)

    Spena Angelo

    2003-06-01

    Full Text Available Abstract Background Homology-dependent selective degradation of RNA, or post-transcriptional gene silencing (PTGS, is involved in several biological phenomena, including adaptative defense mechanisms against plant viruses. Small interfering RNAs mediate the selective degradation of target RNA by guiding a multicomponent RNAse. Expression of self-complementary hairpin RNAs within two complementary regions separated by an intron elicits PTGS with high efficiency. Plum pox virus (PPV is the etiological agent of sharka disease in Drupaceae, although it can also be transmitted to herbaceous species (e.g. Nicotiana benthamiana. Once inside the plant, PPV is transmitted via plasmodesmata from cell to cell, and at longer distances, via phloem. The rolC promoter drives expression in phloem cells. RolC expression is absent in both epidermal and mesophyll cells. The aim of the present study was to confer systemic disease resistance without preventing local viral infection. Results In the ihprolC-PP197 gene (intron hair pin rolC PPV 197, a 197 bp sequence homologous to the PPV RNA genome (from base 134 to 330 was placed as two inverted repeats separated by the DNA sequence of the rolA intron. This hairpin construct is under the control of the rolC promoter.N. benthamiana plants transgenic for the ihprolC-PP197 gene contain siRNAs homologous to the 197 bp sequence. The transgenic progeny of ihprolC-PP197 plants are resistant to PPV systemic infection. Local infection is unaffected. Most (80% transgenic plants are virus free and symptomless. Some plants (20% contain virus in uninoculated apical leaves; however they show only mild symptoms of leaf mottling. PPV systemic resistance cosegregates with the ihprolC-PP197 transgene and was observed in progeny plants of all independent transgenic lines analyzed. SiRNAs of 23–25 nt homologous to the PPV sequence used in the ihprolC-PP197 construct were detected in transgenic plants before and after inoculation

  10. Analysis of Capillary Coating Die Flow in an Optical Fiber Coating Applicator

    OpenAIRE

    Kyoungjin Kim

    2011-01-01

    Viscous heating becomes significant in the high speed resin coating process of glass fibers for optical fiber manufacturing. This study focuses on the coating resin flows inside the capillary coating die of optical fiber coating applicator and they are numerically simulated to examine the effects of viscous heating and subsequent temperature increase in coating resin. Resin flows are driven by fast moving glass fiber and the pressurization at the coating die inlet, while ...

  11. Pin Wire Coating Trip Report

    International Nuclear Information System (INIS)

    Spellman, G P

    2004-01-01

    A meeting to discuss the current pin wire coating problems was held at the Reynolds plant in Los Angeles on 2MAR04. The attendance list for Reynolds personnel is attached. there was an initial presentation which gave a brief history and the current status of pin wire coating at Reynolds. There was a presentation by Lori Primus on the requirements and issues for the coating. There was a presentation by Jim Smith of LANL on the chemistry and to some extent process development done to date. There was a long session covering what steps should be taken in the short term and, to a lesser extent, the long term. The coating currently being used is a blend of two polymers, polyethersulfone and polyparabanic acid (PPA) and some TiO2 filler. This system was accepted and put into production when the pin wire coating was outsourced to another company in 1974. When that company no longer was interested, the wire coating was brought in-house to Reynolds. At that time polyparabanic acid was actually a commercial product available from Exxon under the trade name Tradlon. However, it appears that the material used at Reynolds was synthesized locally. Also, it appears that a single large batch was synthesized in that time period and used up to 1997 when the supply ran out. The reason for the inclusion of TiO2 is not known although it does act as a rheological thickener. However, a more controlled thickening can be obtained with materials such as fumed silica. This material would have less likelihood of causing point imperfections in the coatings. Also, the mixing technique being used for all stages of the process is a relatively low shear ball mill process and the author recommends a high shear process such as a three roll paint mill, at least for the final mixing. Since solvent is added to the powder at Reynolds, it may be that they need to have the paint mill there

  12. NIR-assisted orchid virus therapy using urchin bimetallic nanomaterials in phalaenopsis

    International Nuclear Information System (INIS)

    Chen, Shin-Yu; Do, Yi-Yin; Huang, Pung-Ling; Cheng, Liang-Chien; Chen, Chieh-Wei; Lee, Po-Han; Liu, Ru-Shi; Yu, Fengjiao; Zhou, Wuzong

    2013-01-01

    The use of nanoparticles has drawn special attention, particularly in the treatment of plant diseases. Cymbidium mosaic virus (CymMV) and Odontoglossum ring spot virus (ORSV) are the most prevalent and serious diseases that affect the development of the orchid industry. In this study we treated nanoparticles as a strategy for enhancing the resistance of orchids against CymMV and ORSV. After chitosan-modified gold nanoparticles (Au NPs) were injected into Phalaenopsis leaves, the injected leaves were exposed to 980 nm laser for light–heat conversion. To evaluate virus elimination in the treated Phalaenopsis leaves, the transcripts of coat protein genes and the production of viral proteins were assessed by reverse transcription-Polymerase chain reaction and enzyme-linked immunosorbent assay, respectively. The expression of coat protein genes for both CymMV and ORSV was significantly lower in the chitosan-modified Au NP-treated Phalaenopsis leaves than in the control. Similarly, the amount of coat proteins for both viruses in the Phalaenopsis leaves was lower than that in the control (without nanoparticle injection). We propose that the temperature increase in the chitosan-modified Au NP-treated Phalaenopsis tissues after laser exposure reduces the viral population, consequently conferring resistance against CymMV and ORSV. Our findings suggest that the application of chitosan-modified Au NPs is a promising new strategy for orchid virus therapy. (paper)

  13. Advanced Marine Coatings for Naval Vessels - Phase 1. Antifouling and Fouling Release Coatings

    National Research Council Canada - National Science Library

    McCarthy, Gregory

    2003-01-01

    ... in combinatorial materials chemistry high-throughput discovery and evaluation methodology. The protective coatings application being addressed is environmentally compliant antifouling and fouling release coating for Navy ships...

  14. Radioactive probes as diagnostic tools for rice tungro viruses

    International Nuclear Information System (INIS)

    Azzam, O.; Arboleda, M.; Reyes. J. de los

    1996-01-01

    Rice tungro bacilliform (RTBV) and rice tungro spherical viruses (RTSV) are the two viral components responsible for rice tungro disease which has seriously affected the irrigated rice ecosystem in Southeast Asia for the last 30 years. RTBV has an 8 Kb double-stranded DNA circular genome, and it is primarily responsible for induction of symptoms in infected plants. RTSV has a 12 kb single-stranded RNA genome. It does not induce any apparent symptoms in the infected plant, and it is transmitted by greenleafhopper. RTBV depends upon RTSV for its own transmission. The two viruses are limited to the vascular tissue of the rice plant and are present at a low titer. Most of the detection methods used for the identification of these viruses have relied on the virus protein properties and therefore, early detection of the virus activity was not possible. We were interested in evaluating tissue printing, dot blot, and southern techniques for early detection of virus nucleic acids in rice plant using radioactive and non radioactive probes. 32 P-labeled T7 or SP6 RNA polymerase transcripts complementary to the RTBV genome and RTSV coat protein genes were used as probes of the positive stand of both viruses. For nonradioactive probes, RTBV DNA genome was labeled using the ECL detection kit (Amersham). Preliminary results show that viral nucleic acids of RTBV and RTSV could be detected using both labelling systems. Non radioactive probes were comparable in their sensitivity to the radioactive probes. Less than 100 pg of viral DNA was detected in the dot-blot assays. More data will be presented to compare the efficiency and reliability of these two techniques in detecting early virus activity in the rice plant. (author)

  15. Process for preparing coating materials

    International Nuclear Information System (INIS)

    Ryoke, Hideyasu; Kobayashi, Juichi; Kobayashi, Kei.

    1972-01-01

    A coating material curable with ionizing radiations or ultraviolet radiation can be prepared by reacting a compound (A) having one OH group and at least one α,β-ethylenic or allyl group with a polyisocyanate. (A) is a diester of a dicarboxylic acid. One of the ester groups may have a terminal α,β-ethylenic or allyl group and the other contains one OH and one α,β-ethylenic or allyl group. (A) is reacted with a polyisocyanate to yield an urethane. The latter may be diluted with a vinyl monomer. When exposed to a radiation, the coating material cures to give a film excellent in adhesion, impact strength and resistances to pollution, water and solvents. Dose of the ionizing radiation (α-, β-, γ-rays, electron beams) is 0.2-20 Mrad. In one example, 116 parts of 2-hydroxyethyl acrylate was reacted with 148 parts of phthalic anhydride and 142 parts of glycidyl methacrylate to give (A). (A) was reacted with 87 parts of tolylenediisocyanate. A metallic panel was coated with the coating material and cured with electron beams (5 Mrad). Pencil hardness was H, and gel fraction measured in acetone was above 97%. The coating was excellent in resistances to solvent and chemicals, impact strength and adhesion. (Kaichi, S.)

  16. The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.

    Science.gov (United States)

    Hammond, R W; Crosslin, J M

    1995-04-01

    The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.

  17. Coated Glass Slides TACAS Are Applicable to Heat-Assisted Immunostaining and In Situ Hybridization at the Electron Microscopy Level

    International Nuclear Information System (INIS)

    Matsui, Takahiro; Onouchi, Takanori; Shiogama, Kazuya; Mizutani, Yasuyoshi; Inada, Ken-ichi; Yu, Fuxun; Hayasaka, Daisuke; Morita, Koichi; Ogawa, Hirohisa; Mahara, Fumihiko; Tsutsumi, Yutaka

    2015-01-01

    We performed pre-embedding electron microscopic study for visualizing the antigen and genome of severe fever with thrombocytopenia syndrome (SFTS) virus in the cytoplasm of macrophages of the human splenic red pulp, both requesting preheating treatment of sections. To pursue this, coated glass slides with unique characteristics are needed. Namely, during staining they must prevent detaching off sections, but after staining the sections must be transferred to epoxy resin. Aminopropyltriexoxysilane-coated glass slides, widely used for immunostaining, were resistant to transfer to epoxy resin. In contrast, coated glass slides designated as Thinlayer Advanced Cytology Assay System (TACAS) were suitable for this purpose. The technique is also applicable to the coated glass slide-requiring cytology practice, in which immunocytochemical evaluation is needed after cell transfer to another glass slide

  18. Chromate conversion coatings and their current application

    Directory of Open Access Journals (Sweden)

    P. Pokorny

    2016-04-01

    Full Text Available This paper describes formation, composition and possible production technologies of application chromate coatings. Summation of common examples of applications of these coatings in corrosion protection of metals and alloys is provided. Individual chromate coatings are divided by their dominant anions either with CrVI or CrIII. Restrictions of chromate coatings with dominantly CrVI and related toxicity of hexavalent chromium is discussed in detail. In conclusion, examples of both chromium and other, alternative coatings are summed up. Application of these coatings as a protection for concrete hot-dip galvanized reinforcement is also reviewed.

  19. Radiation curable compositions useful as transfer coatings

    International Nuclear Information System (INIS)

    McCarty, W.H.; Nagy, F.A.; Guarino, J.P.

    1983-01-01

    The invention is on a method for applying a coating to a thin porous substrate and reducing absorption of the coating into the substrate by applying a radiation-curable composition to a carrying web; the radiation-curable coating composition having a crosslink density of 0.02 to about 1.0 determined by calculation of the gram moles of branch points per 100 grams of uncured coating, and a glass transition temperature of the radiation cured coating within the approximate range of -80 degrees to +100 degrees C. The carrying web being of a nature such that the coating composition, when cured, will not adhere to its surface

  20. Pepino mosaic virus

    NARCIS (Netherlands)

    Vlugt, van der R.A.A.

    2009-01-01

    Pepino mosaic virus (PepMV) is a relatively new plant virus that has become a signifi cant agronomical problem in a relatively short period of time. It is a member of the genus Potexvirus within the family Flexiviridae and is readily mechanically transmissible. It is capable of infecting tomato

  1. Avian influenza virus

    Science.gov (United States)

    Avian influenza virus (AIV) is type A influenza that is adapted to avian host species. Although the virus can be isolated from numerous avian species, the natural host reservoir species are dabbling ducks, shorebirds and gulls. Domestic poultry species (poultry being defined as birds that are rais...

  2. Hepatitis viruses overview

    African Journals Online (AJOL)

    Hepatitis is major cause of morbidity or mortality worldwide, particularly in the developing world. The major causes of infective hepatitis are hepatitis viruses. A, B, C, D or E. In the acute phase, there are no clinical features that can reliably differentiate between these viruses. Infection may be asymptomatic or can present as.

  3. Viral Haemorrhagic Septicaemia Virus

    DEFF Research Database (Denmark)

    Olesen, Niels Jørgen; Skall, Helle Frank

    2013-01-01

    This chapter covers the genetics (genotypes and serotypes), clinical signs, host species, transmission, prevalence, diagnosis, control and prevention of viral haemorrhagic septicaemia virus.......This chapter covers the genetics (genotypes and serotypes), clinical signs, host species, transmission, prevalence, diagnosis, control and prevention of viral haemorrhagic septicaemia virus....

  4. Tobacco ringspot virus

    Science.gov (United States)

    Tobacco ringspot virus (TRSV), and its vector, the dagger nematodes (Xiphinema americanum and related species) are widely distributed throughout the world. Cucumber, melon, and watermelon are particularly affected by TRSV. Symptoms can vary with plant age, the strain of the virus, and environment...

  5. Respiratory Syncytial Virus (RSV)

    Centers for Disease Control (CDC) Podcasts

    Respiratory Syncytial Virus, or RSV, causes cold-like symptoms but can be serious for infants and older adults. In this podcast, CDC’s Dr. Eileen Schneider discusses this common virus and offers tips to prevent its spread.

  6. Viruses in reptiles.

    Science.gov (United States)

    Ariel, Ellen

    2011-09-21

    The etiology of reptilian viral diseases can be attributed to a wide range of viruses occurring across different genera and families. Thirty to forty years ago, studies of viruses in reptiles focused mainly on the zoonotic potential of arboviruses in reptiles and much effort went into surveys and challenge trials of a range of reptiles with eastern and western equine encephalitis as well as Japanese encephalitis viruses. In the past decade, outbreaks of infection with West Nile virus in human populations and in farmed alligators in the USA has seen the research emphasis placed on the issue of reptiles, particularly crocodiles and alligators, being susceptible to, and reservoirs for, this serious zoonotic disease. Although there are many recognised reptilian viruses, the evidence for those being primary pathogens is relatively limited. Transmission studies establishing pathogenicity and cofactors are likewise scarce, possibly due to the relatively low commercial importance of reptiles, difficulties with the availability of animals and permits for statistically sound experiments, difficulties with housing of reptiles in an experimental setting or the inability to propagate some viruses in cell culture to sufficient titres for transmission studies. Viruses as causes of direct loss of threatened species, such as the chelonid fibropapilloma associated herpesvirus and ranaviruses in farmed and wild tortoises and turtles, have re-focused attention back to the characterisation of the viruses as well as diagnosis and pathogenesis in the host itself.

  7. ICTV Virus Taxonomy Profile

    DEFF Research Database (Denmark)

    Simmonds, Peter; Becher, Paul; Bukh, Jens

    2017-01-01

    The Flaviviridae is a family of small enveloped viruses with RNA genomes of 9000-13 000 bases. Most infect mammals and birds. Many flaviviruses are host-specific and pathogenic, such as hepatitis C virus in the genus Hepacivirus. The majority of known members in the genus Flavivirus are arthropod...

  8. ICTV virus taxonomy profile

    NARCIS (Netherlands)

    Purdy, Michael A.; Harrison, Tim J.; Jameel, S.; Meng, X.J.; Okamoto, H.; Poel, Van Der W.H.M.; Smith, Donald B.; Lefkowitz, Elliot J.; Davison, Andrew J.; Siddell, Stuart G.; Simmonds, Peter; Adams, Michael J.; Smith, Donald B.; Orton, Richard J.; Knowles, Nick J.

    2017-01-01

    The family Hepeviridae includes enterically transmitted small non-enveloped positive-sense RNA viruses. It includes the genera Piscihepevirus, whose members infect fish, and Orthohepevirus, whose members infect mammals and birds. Members of the genus Orthohepevirus include hepatitis E virus, which

  9. Viruses of the Archaea

    DEFF Research Database (Denmark)

    Prangishvili,, David; Basta, Tamara; Garrett, Roger Antony

    2016-01-01

    Viruses infecting members of Archaea, the third domain of life, constitute an integral, yet unique part of the virosphere. Many of these viruses, specifically the species that infect hyperthermophilic hosts, display morphotypes – for example, bottle shaped, spindle shaped, droplet shaped, coil sh...

  10. Diversity and environmental relations of cryptic, systemic Botrytis infections in symptomless hosts.

    Directory of Open Access Journals (Sweden)

    Michael W. Shaw

    2016-05-01

    Full Text Available Botrytis species are generally considered to be aggressive, necrotrophic plant pathogens. By contrast to this general perception, however, Botrytis species could frequently be isolated from the interior of multiple tissues in apparently healthy hosts of many species. Infection frequencies reached 50% of samples or more, but were commonly less, and cryptic infections were rare or absent in some plant species. Prevalence varied substantially from year to year and from tissue to tissue, but some host species routinely had high prevalence. The same genotype was found to occur throughout a host, representing mycelial spread. B. cinerea and B. pseudocinerea are the species that most commonly occur as cryptic infections, but phylogenetically distant isolates of Botrytis were also detected, one of which does not correspond to previously described species. Sporulation and visible damage occurred only when infected tissues were stressed, or became mature or senescent. There was no evidence of cryptic infection having a deleterious effect on growth of the host, and prevalence was probably greater in plants grown in high light conditions. Isolates from cryptic infections were often capable of causing disease (to varying extents when spore suspensions were inoculated onto their own host as well as on distinct host species, arguing against co-adaptation between cryptic isolates and their hosts. These data collectively suggest that several Botrytis species, including the most notorious pathogenic species, exist frequently in cryptic form to an extent that has thus far largely been neglected, and do not need to cause disease on healthy hosts in order to complete their life-cycles.

  11. A Case of Old Calcifying Epithelioma Processed Symptomless over 40 Years

    Directory of Open Access Journals (Sweden)

    Shinji Yamaguchi

    2013-01-01

    Full Text Available Calcifying epithelioma, a benign tumor derived from the hair apparatus and consisted of hair matrix cells, is relatively prevalent in females. We report a case of right preauricular calcifying epithelioma that was incidentally detected at the examination of multiple facial fractures and became an old lesion without symptoms for 40 years. The patient who was a 42-year-old male visited our department for the first time in October 2011 with a chief complaint of multiple facial fractures. Radiographic imaging demonstrated fracture lines at the anterior and posterior walls of the left maxillary sinus and zygomatic arch and revealed a mass at a right preauricular area. The extraction was performed under general anaesthesia. No recurrence has been observed 15 months after surgery. We also reviewed the literature of calcifying epithelioma.

  12. Mixed zirconia calcium phosphate coatings for dental implants: Tailoring coating stability and bioactivity potential

    International Nuclear Information System (INIS)

    Pardun, Karoline; Treccani, Laura; Volkmann, Eike; Streckbein, Philipp; Heiss, Christian; Destri, Giovanni Li; Marletta, Giovanni; Rezwan, Kurosch

    2015-01-01

    Enhanced coating stability and adhesion are essential for long-term success of orthopedic and dental implants. In this study, the effect of coating composition on mechanical, physico-chemical and biological properties of coated zirconia specimens is investigated. Zirconia discs and dental screw implants are coated using the wet powder spraying (WPS) technique. The coatings are obtained by mixing yttria-stabilized zirconia (TZ) and hydroxyapatite (HA) in various ratios while a pure HA coating served as reference material. Scanning electron microscopy (SEM) and optical profilometer analysis confirm a similar coating morphology and roughness for all studied coatings, whereas the coating stability can be tailored with composition and is probed by insertion and dissections experiments in bovine bone with coated zirconia screw implants. An increasing content of calcium phosphate (CP) resulted in a decrease of mechanical and chemical stability, while the bioactivity increased in simulated body fluid (SBF). In vitro experiments with human osteoblast cells (HOB) revealed that the cells grew well on all samples but are affected by dissolution behavior of the studied coatings. This work demonstrates the overall good mechanical strength, the excellent interfacial bonding and the bioactivity potential of coatings with higher TZ contents, which provide a highly interesting coating for dental implants. - Highlights: • Different ratios of zirconia (TZ) and calcium phosphate (CP) were deposited on zirconia substrates. • Enhancement of TZ content in mixed coatings increased coating stability. • Enhancement of CP content in mixed coatings increased bioactivity. • All tested coating compositions were non-toxic

  13. Mixed zirconia calcium phosphate coatings for dental implants: Tailoring coating stability and bioactivity potential

    Energy Technology Data Exchange (ETDEWEB)

    Pardun, Karoline [University of Bremen, Advanced Ceramics, Am Biologischen Garten 2, 28359 Bremen (Germany); Treccani, Laura, E-mail: treccani@uni-bremen.de [University of Bremen, Advanced Ceramics, Am Biologischen Garten 2, 28359 Bremen (Germany); Volkmann, Eike [University of Bremen, Advanced Ceramics, Am Biologischen Garten 2, 28359 Bremen (Germany); Streckbein, Philipp [University Hospital, Justus-Liebig-University Giessen, Department of Cranio-Maxillo-Facial Surgery, Klinikstrasse 33, 35385 Giessen (Germany); Heiss, Christian [University Hospital of Giessen-Marburg, Department of Trauma Surgery, Rudolf-Buchheim-Strasse 7, 35385 Giessen, Germany, (Germany); Laboratory of Experimental Surgery, Kerkraderstrasse 9, 35392 Giessen (Germany); Destri, Giovanni Li; Marletta, Giovanni [Laboratory for Molecular Surfaces and Nanotechnology (LAMSUN), Department of Chemistry, University of Catania and CSGI, Viale A. Doria 6, 95125 Catania (Italy); Rezwan, Kurosch [University of Bremen, Advanced Ceramics, Am Biologischen Garten 2, 28359 Bremen (Germany)

    2015-03-01

    Enhanced coating stability and adhesion are essential for long-term success of orthopedic and dental implants. In this study, the effect of coating composition on mechanical, physico-chemical and biological properties of coated zirconia specimens is investigated. Zirconia discs and dental screw implants are coated using the wet powder spraying (WPS) technique. The coatings are obtained by mixing yttria-stabilized zirconia (TZ) and hydroxyapatite (HA) in various ratios while a pure HA coating served as reference material. Scanning electron microscopy (SEM) and optical profilometer analysis confirm a similar coating morphology and roughness for all studied coatings, whereas the coating stability can be tailored with composition and is probed by insertion and dissections experiments in bovine bone with coated zirconia screw implants. An increasing content of calcium phosphate (CP) resulted in a decrease of mechanical and chemical stability, while the bioactivity increased in simulated body fluid (SBF). In vitro experiments with human osteoblast cells (HOB) revealed that the cells grew well on all samples but are affected by dissolution behavior of the studied coatings. This work demonstrates the overall good mechanical strength, the excellent interfacial bonding and the bioactivity potential of coatings with higher TZ contents, which provide a highly interesting coating for dental implants. - Highlights: • Different ratios of zirconia (TZ) and calcium phosphate (CP) were deposited on zirconia substrates. • Enhancement of TZ content in mixed coatings increased coating stability. • Enhancement of CP content in mixed coatings increased bioactivity. • All tested coating compositions were non-toxic.

  14. Optical characterization of antirelaxation coatings

    Science.gov (United States)

    Tsvetkov, S.; Gateva, S.; Cartaleva, S.; Mariotti, E.; Nasyrov, K.

    2018-03-01

    Antirelaxation coatings (ARC) are used in optical cells containing alkali metal vapor to reduce the depolarization of alkali atoms after collisions with the cell walls. The long-lived ground state polarization is a basis for development of atomic clocks, magnetometers, quantum memory, slow light experiments, precision measurements of fundamental symmetries etc. In this work, a simple method for measuring the number of collisions of the alkali atoms with the cell walls without atomic spin randomization (Nasyrov et al., Proc. SPIE (2015)) was applied to characterize the AR properties of two PDMS coatings prepared from different solutions in ether (PDMS 2% and PDMS 5%). We observed influence of the light-induced atomic desorption (LIAD) on the AR properties of coatings.

  15. Radiation-curable coating composition

    International Nuclear Information System (INIS)

    Mibae, Jiro; Kawamura, Hiroshi; Takahashi, Masao.

    1970-01-01

    A radiation-curable coating composition, suitable for metal precoating, is provided. The composition is prepared by mixing 50 to 90 parts of a long chain fatty acid ester (A) with 10 to 50 parts of monomer (B) which is copolymerizable with (A). (A) is prepared by reacting a dimer acid (particularly the dimer of linolenic acid) with hydroxyalkyl methacrylate or glycidyl methacrylate. Upon irradiation with electron beams (0.1 to 3 MeV) the composition cures to yield a coating of high adhesion, impact resistance and bending resistance. In one example, 100 g of dimer acid (Versadime 216, manufactured by General Mills) was esterified with 50 g of 2-hydroxyethyl methacrylate. A zinc plated iron plate was coated with the product and irradiated with electron beams (2 Mrad). Pencil hardness was F; adhesion 0: impact resistance (Du Pont) 1 kg x 30 cm; bending resistance 2T. (Kaichi, S.)

  16. Evaluation of End Mill Coatings

    Energy Technology Data Exchange (ETDEWEB)

    L. J. Lazarus; R. L. Hester,

    2005-08-01

    Milling tests were run on families of High Speed Steel (HSS) end mills to determine their lives while machining 304 Stainless Steel. The end mills tested were made from M7, M42 and T15-CPM High Speed Steels. The end mills were also evaluated with no coatings as well as with Titanium Nitride (TiN) and Titanium Carbo-Nitride (TiCN) coatings to determine which combination of HSS and coating provided the highest increase in end mill life while increasing the cost of the tool the least. We found end mill made from M42 gave us the largest increase in tool life with the least increase in cost. The results of this study will be used by Cutting Tool Engineering in determining which end mill descriptions will be dropped from our tool catalog.

  17. Strategy as a Virus

    DEFF Research Database (Denmark)

    Obed Madsen, Søren

    This article is based on virus theory (Røvik, 2007, 2011), and proposes to develop a framework that defines technology as a virus that penetrates the organism of an organization. The framework develops a new vocabulary, which can help in analyzing technologies and their negative effects on actors...... and organizations. In this paper, the virus theory is used to analyze a strategy process in an organization as an example of a technology. It shows how the strategy over time creates a memory loss, where the managers who are exposed to the virus forget their critique of the new strategy concept. The article also...... shows how resistant can be understood as being immune to a virus, since the strategy concepts bears resemblance to a former strategy concept. The article also argues that there should be more focus on the negative impacts of management tool and especially how organizations and managers are dealing...

  18. Extension of the ELISA method to the measurement of the specific radioactivity of viruses in crude cellular extracts

    Energy Technology Data Exchange (ETDEWEB)

    Konate, G; Fritig, B [Institut de Biologie Moleculaire et Cellulaire, 67-Strasbourg (France). Lab. de Virologie

    1983-06-01

    The double-antibody sandwich method of ELISA, which allows accurate quantitative determination of plant viruses, was extended to a radiochemical procedure which permits direct measurement of the specific radioactivity of virus labelled in vivo and present in very crude plant homogenates. Evidence is presented showing that 20 to 50% of the virus introduced in the polystyrene wells during the antigen incubation step could be trapped in the sandwich. The percentage of virus bound increased with the concentration of the coating antibody and was almost proportional to the concentration of the antigen and to the incubation time of the antigens. Complete dissociation of the double-antibody sandwich was achieved by incubation with 0.2 M KOH or NaOH (pH 13.3), and the label carried by the virus was measured by scintillation counting of the solubilization fluid. The ratio infected/healthy was much higher for the radiochemical procedure than for the immunosorbent assay itself since binding of the virus to the coating antibody was not accompanied by any nonspecific trapping of radioactive contaminants in the double-antibody sandwich. The procedure was highly sensitive since the background corresponded to the scintillation counting background. The detection of the label carried by tobacco mosaic virus was possible when the tobacco samples contained at least 5 ng of virus carrying a label as low as 40 dpm /sup 3/H or 20 dpm /sup 14/C.

  19. Studies on soft centered coated snacks.

    Science.gov (United States)

    Pavithra, A S; Chetana, Ramakrishna; Babylatha, R; Archana, S N; Bhat, K K

    2013-04-01

    Roasted groundnut seeds, amaranth and dates pulp formed the center filling which was coated with sugar, breadings, desiccated coconut and roasted Bengalgram flour (BGF) to get 4 coated snacks. Physicochemical characteristics, microbiological profile, sorption behaviour and sensory quality of 4 coated snacks were determined. Centre filling to coating ratio of the products were in the range of 3:2-7:1, the product having BGF coating had the thinnest coating. Center filling had soft texture and the moisture content was 10.2-16.2% coating had lower moisture content (4.4-8.6%) except for Bengal gram coating, which had 11.1% moisture. Sugar coated snack has lowest fat (11.6%) and protein (7.2%) contents. Desiccated coconut coated snack has highest fat (25.4%) and Bengal gram flour coated snack had highest protein content (15.4%). Sorption studies showed that the coated snack had critical moisture content of 11.2-13.5%. The products were moisture sensitive and hence require packaging in films having higher moisture barrier property. In freshly prepared snacks coliforms, yeast and mold were absent. Mesophillic aerobes count did not show significant change during 90 days of storage at 27 °C and 37 °C. Sensory analysis showed that products had a unique texture due to combined effect of fairly hard coating and soft center. Flavour and overall quality of all the products were rated as very good.

  20. Nano-Ceramic Coated Plastics

    Science.gov (United States)

    Cho, Junghyun

    2013-01-01

    Plastic products, due to their durability, safety, and low manufacturing cost, are now rapidly replacing cookware items traditionally made of glass and ceramics. Despite this trend, some still prefer relatively expensive and more fragile ceramic/glassware because plastics can deteriorate over time after exposure to foods, which can generate odors, bad appearance, and/or color change. Nano-ceramic coatings can eliminate these drawbacks while still retaining the advantages of the plastic, since the coating only alters the surface of the plastic. The surface coating adds functionality to the plastics such as self-cleaning and disinfectant capabilities that result from a photocatalytic effect of certain ceramic systems. These ceramic coatings can also provide non-stick surfaces and higher temperature capabilities for the base plastics without resorting to ceramic or glass materials. Titanium dioxide (TiO2) and zinc oxide (ZnO) are the candidates for a nano-ceramic coating to deposit on the plastics or plastic films used in cookware and kitchenware. Both are wide-bandgap semiconductors (3.0 to 3.2 eV for TiO2 and 3.2 to 3.3 eV for ZnO), so they exhibit a photocatalytic property under ultraviolet (UV) light. This will lead to decomposition of organic compounds. Decomposed products can be easily washed off by water, so the use of detergents will be minimal. High-crystalline film with large surface area for the reaction is essential to guarantee good photocatalytic performance of these oxides. Low-temperature processing (nano-ceramic coatings (TiO2, ZnO) on plastic materials (silicone, Teflon, PET, etc.) that can possess both photocatalytic oxide properties and flexible plastic properties. Processing cost is low and it does not require any expensive equipment investment. Processing can be scalable to current manufacturing infrastructure.

  1. On niobium sputter coated cavities

    International Nuclear Information System (INIS)

    Arnolds-Mayer, G.; Kaufmann, U.; Downar, H.

    1988-01-01

    To coat copper cavities with a thin film of niobium, facilities for electropolishing and sputter deposition have been installed at Dornier. Experiments have been performed on samples to optimize electropolishing and deposition parameters. In this paper, characteristics concerning surface properties, adhesion of the niobium film to the copper substrate, and film properties were studied on planar samples. A 1.5 GHz single cell cavity made from oxygen free high conductivity (OFHC) copper was sputter coated twice. First rf measurements were performed in the temperature range from 300 K to 2 K

  2. Corrosion-resistant coating development

    Energy Technology Data Exchange (ETDEWEB)

    Stinton, D.P.; Kupp, D.M.; Martin, R.L. [Oak Ridge National Lab., TN (United States)

    1997-12-01

    SiC-based heat exchangers have been identified as the prime candidate material for use as heat exchangers in advanced combined cycle power plants. Unfortunately, hot corrosion of the SiC-based materials created by alkali metal salts present in the combustion gases dictates the need for corrosion-resistant coatings. The well-documented corrosion resistance of CS-50 combined with its low (and tailorable) coefficient of thermal expansion and low modulus makes CS-50 an ideal candidate for this application. Coatings produced by gelcasting and traditional particulate processing have been evaluated.

  3. Coated carbon nanotube array electrodes

    Science.gov (United States)

    Ren, Zhifeng [Newton, MA; Wen, Jian [Newton, MA; Chen, Jinghua [Chestnut Hill, MA; Huang, Zhongping [Belmont, MA; Wang, Dezhi [Wellesley, MA

    2008-10-28

    The present invention provides conductive carbon nanotube (CNT) electrode materials comprising aligned CNT substrates coated with an electrically conducting polymer, and the fabrication of electrodes for use in high performance electrical energy storage devices. In particular, the present invention provides conductive CNTs electrode material whose electrical properties render them especially suitable for use in high efficiency rechargeable batteries. The present invention also provides methods for obtaining surface modified conductive CNT electrode materials comprising an array of individual linear, aligned CNTs having a uniform surface coating of an electrically conductive polymer such as polypyrrole, and their use in electrical energy storage devices.

  4. Laser-based coatings removal

    International Nuclear Information System (INIS)

    Freiwald, J.G.; Freiwald, D.

    1995-01-01

    Over the years as building and equipment surfaces became contaminated with low levels of uranium or plutonium dust, coats of paint were applied to stabilize the contaminants in place. Most of the earlier paint used was lead-based paint. More recently, various non-lead-based paints, such as two-part epoxy, are used. For D ampersand D (decontamination and decommissioning), it is desirable to remove the paints or other coatings rather than having to tear down and dispose of the entire building

  5. Aesthetic coatings for concrete bridge components

    Science.gov (United States)

    Kriha, Brent R.

    This thesis evaluated the durability and aesthetic performance of coating systems for utilization in concrete bridge applications. The principle objectives of this thesis were: 1) Identify aesthetic coating systems appropriate for concrete bridge applications; 2) Evaluate the performance of the selected systems through a laboratory testing regimen; 3) Develop guidelines for coating selection, surface preparation, and application. A series of site visits to various bridges throughout the State of Wisconsin provided insight into the performance of common coating systems and allowed problematic structural details to be identified. To aid in the selection of appropriate coating systems, questionnaires were distributed to coating manufacturers, bridge contractors, and various DOT offices to identify high performing coating systems and best practices for surface preparation and application. These efforts supplemented a literature review investigating recent publications related to formulation, selection, surface preparation, application, and performance evaluation of coating materials.

  6. Coated foams, preparation, uses and articles

    Science.gov (United States)

    Duchane, D.V.; Barthell, B.L.

    1982-10-21

    Hydrophobic cellular material is coated with a thin hydrophilic polymer skin which stretches tightly over the foam but which does not fill the cells of the foam, thus resulting in a polymer-coated foam structure having a smoothness which was not possible in the prior art. In particular, when the hydrophobic cellular material is a specially chosen hydrophobic polymer foam and is formed into arbitrarily chosen shapes prior to the coating with hydrophilic polymer, inertial confinement fusion (ICF) targets of arbitrary shapes can be produced by subsequently coating the shapes with metal or with any other suitable material. New articles of manufacture are produced, including improved ICF targets, improved integrated circuits, and improved solar reflectors and solar collectors. In the coating method, the cell size of the hydrophobic cellular material, the viscosity of the polymer solution used to coat, and the surface tension of the polymer solution used to coat are all very important to the coating.

  7. HCMV spread and cell tropism are determined by distinct virus populations.

    Directory of Open Access Journals (Sweden)

    Laura Scrivano

    Full Text Available Human cytomegalovirus (HCMV can infect many different cell types in vivo. Two gH/gL complexes are used for entry into cells. gH/gL/pUL(128,130,131A shows no selectivity for its host cell, whereas formation of a gH/gL/gO complex only restricts the tropism mainly to fibroblasts. Here, we describe that depending on the cell type in which virus replication takes place, virus carrying the gH/gL/pUL(128,130,131A complex is either released or retained cell-associated. We observed that virus spread in fibroblast cultures was predominantly supernatant-driven, whereas spread in endothelial cell (EC cultures was predominantly focal. This was due to properties of virus released from fibroblasts and EC. Fibroblasts released virus which could infect both fibroblasts and EC. In contrast, EC released virus which readily infected fibroblasts, but was barely able to infect EC. The EC infection capacities of virus released from fibroblasts or EC correlated with respectively high or low amounts of gH/gL/pUL(128,130,131A in virus particles. Moreover, we found that focal spread in EC cultures could be attributed to EC-tropic virus tightly associated with EC and not released into the supernatant. Preincubation of fibroblast-derived virus progeny with EC or beads coated with pUL131A-specific antibodies depleted the fraction that could infect EC, and left a fraction that could predominantly infect fibroblasts. These data strongly suggest that HCMV progeny is composed of distinct virus populations. EC specifically retain the EC-tropic population, whereas fibroblasts release EC-tropic and non EC-tropic virus. Our findings offer completely new views on how HCMV spread may be controlled by its host cells.

  8. Computer Viruses: Pathology and Detection.

    Science.gov (United States)

    Maxwell, John R.; Lamon, William E.

    1992-01-01

    Explains how computer viruses were originally created, how a computer can become infected by a virus, how viruses operate, symptoms that indicate a computer is infected, how to detect and remove viruses, and how to prevent a reinfection. A sidebar lists eight antivirus resources. (four references) (LRW)

  9. A stable RNA virus-based vector for citrus trees

    International Nuclear Information System (INIS)

    Folimonov, Alexey S.; Folimonova, Svetlana Y.; Bar-Joseph, Moshe; Dawson, William O.

    2007-01-01

    Virus-based vectors are important tools in plant molecular biology and plant genomics. A number of vectors based on viruses that infect herbaceous plants are in use for expression or silencing of genes in plants as well as screening unknown sequences for function. Yet there is a need for useful virus-based vectors for woody plants, which demand much greater stability because of the longer time required for systemic infection and analysis. We examined several strategies to develop a Citrus tristeza virus (CTV)-based vector for transient expression of foreign genes in citrus trees using a green fluorescent protein (GFP) as a reporter. These strategies included substitution of the p13 open reading frame (ORF) by the ORF of GFP, construction of a self-processing fusion of GFP in-frame with the major coat protein (CP), or expression of the GFP ORF as an extra gene from a subgenomic (sg) mRNA controlled either by a duplicated CTV CP sgRNA controller element (CE) or an introduced heterologous CE of Beet yellows virus. Engineered vector constructs were examined for replication, encapsidation, GFP expression during multiple passages in protoplasts, and for their ability to infect, move, express GFP, and be maintained in citrus plants. The most successful vectors based on the 'add-a-gene' strategy have been unusually stable, continuing to produce GFP fluorescence after more than 4 years in citrus trees

  10. Friction- and wear-reducing coating

    Science.gov (United States)

    Zhu, Dong [Farmington Hills, MI; Milner, Robert [Warren, MI; Elmoursi, Alaa AbdelAzim [Troy, MI

    2011-10-18

    A coating includes a first layer of a ceramic alloy and a second layer disposed on the first layer and including carbon. The coating has a hardness of from 10 to 20 GPa and a coefficient of friction of less than or equal to 0.12. A method of coating a substrate includes cleaning the substrate, forming the first layer on the substrate, and depositing the second layer onto the first layer to thereby coat the substrate.

  11. Functional coatings: the sol-gel approach

    International Nuclear Information System (INIS)

    Belleville, Ph.

    2010-01-01

    CEA's sol-gel laboratory is specialized in the development of innovative sol-gel optical coatings and has extended its application field to membrane materials and coatings for energy conversion, to electric coatings for microelectronics devices and to thin films for gas sensing. This article describes, by way of examples, the laboratory's research on sol-gel functional coatings, including nano-material synthesis, organic-inorganic hybrid-based solution preparation as well as deposition process development and prototyping. (author)

  12. Sputter coating of microspherical substrates by levitation

    Science.gov (United States)

    Lowe, A.T.; Hosford, C.D.

    Microspheres are substantially uniformly coated with metals or nonmetals by simltaneously levitating them and sputter coating them at total chamber pressures less than 1 torr. A collimated hole structure comprising a parallel array of upwardly projecting individual gas outlets is machined out to form a dimple. Glass microballoons,, which are particularly useful in laser fusion applications, can be substantially uniformly coated using the coating method and apparatus.

  13. Laser reflector with an interference coating

    International Nuclear Information System (INIS)

    Vol'pyan, O D; Semenov, A A; Yakovlev, P P

    1998-01-01

    An analysis was made of the reflectivity of interference coatings intended for the use in optical pumping of solid-state lasers. Ruby and Nd 3+ :YAG lasers were used as models in comparative pumping efficiency measurements, carried out employing reflectors with interference and silver coatings. Estimates of the service life of reflectors with interference coatings were obtained. The power of a thermo-optical lens was reduced by the use of such coatings in cw lasers. (laser system components)

  14. Zika virus infection: a public health emergency!

    OpenAIRE

    Qureshi, Muhammad Salman Haider; Qureshi, Bakhtawar Wajeeha; Khan, Ramsha

    2017-01-01

    Zika virus belongs to the family of Flaviviridae. The Flaviviridae family also includes other human pathogens like West Nile virus (WNV), Yellow fever virus (YFV), mosquito transmitted Dengue virus (DENV), Tick borne encephalitic virus (TBEV) and Japanese encephalitis virus (JEV). Zika virus is a mosquito-borne disease and is transmitted by Aedes aegypti mosquito.

  15. Hepatitis A virus antibody

    International Nuclear Information System (INIS)

    Novak, J.; Kselikova, M.; Urbankova, J.

    1980-01-01

    A description is presented of a radioimmunoassay designed to prove the presence of the antibody against the hepatitis A virus (HA Ab, anti-Ha) using an Abbott HAVAB set. This proof as well as the proof of the antibody against the nucleus of the hepatitis B virus is based on competition between a normal antibody against hepatitis A virus and a 125 I-labelled antibody for the binding sites of a specific antigen spread all over the surface of a tiny ball; this is then indirect proof of the antibody under investigation. The method is described of reading the results from the number of impulses per 60 seconds: the higher the titre of the antibody against the hepatitis A virus in the serum examined, the lower the activity of the specimen concerned. The rate is reported of incidence of the antibody against the hepatitis A virus in a total of 68 convalescents after hepatitis A; the antibody was found in 94.1%. The immunoglobulin made from the convalescents' plasma showed the presence of antibodies in dilutions as high as 1:250 000 while the comparable ratio for normal immunoglobulin Norga was only 1:2500. Differences are discussed in the time incidence of the antibodies against the hepatitis A virus, the antibodies against the surface antigen of hepatitis B, and the antibody against the nucleus of the hepatitis V virus. (author)

  16. Ocular Tropism of Respiratory Viruses

    Science.gov (United States)

    Rota, Paul A.; Tumpey, Terrence M.

    2013-01-01

    SUMMARY Respiratory viruses (including adenovirus, influenza virus, respiratory syncytial virus, coronavirus, and rhinovirus) cause a broad spectrum of disease in humans, ranging from mild influenza-like symptoms to acute respiratory failure. While species D adenoviruses and subtype H7 influenza viruses are known to possess an ocular tropism, documented human ocular disease has been reported following infection with all principal respiratory viruses. In this review, we describe the anatomical proximity and cellular receptor distribution between ocular and respiratory tissues. All major respiratory viruses and their association with human ocular disease are discussed. Research utilizing in vitro and in vivo models to study the ability of respiratory viruses to use the eye as a portal of entry as well as a primary site of virus replication is highlighted. Identification of shared receptor-binding preferences, host responses, and laboratory modeling protocols among these viruses provides a needed bridge between clinical and laboratory studies of virus tropism. PMID:23471620

  17. Absorptive coating for aluminum solar panels

    Science.gov (United States)

    Desmet, D.; Jason, A.; Parr, A.

    1979-01-01

    Method for coating forming coating of copper oxide from copper component of sheet aluminum/copper alloy provides strong durable solar heat collector panels. Copper oxide coating has solar absorption characteristics similar to black chrome and is much simpler and less costly to produce.

  18. Multispectral Image Analysis for Astaxanthin Coating Classification

    DEFF Research Database (Denmark)

    Ljungqvist, Martin Georg; Ersbøll, Bjarne Kjær; Nielsen, Michael Engelbrecht

    2012-01-01

    Industrial quality inspection using image analysis on astaxanthin coating in aquaculture feed pellets is of great importance for automatic production control. The pellets were divided into two groups: one with pellets coated using synthetic astaxanthin in fish oil and the other with pellets coated...

  19. ETV Program Report: Coatings for Wastewater Collection ...

    Science.gov (United States)

    The Standard Cement Materials, Inc. Standard Epoxy Coating 4553™ (SEC 4553) epoxy coating used for wastewater collection system rehabilitation was evaluated by EPA’s Environmental Technology Verification Program under laboratory conditions at the Center for Innovative Grouting Material and Technology (CIGMAT) Laboratory at the University of Houston. Testing was conducted over a period of six months to evaluate the coating’s (1) chemical resistance and (2) bonding strength for infrastructure applications. For chemical resistance, coated concrete and clay bricks with holidays (holes created in the coating) were used to evaluate the chemical resistance of the coating/substrate bond under a corrosive environment. Twenty coated concrete (dry and wet) and 20 coated clay brick (dry and wet) specimens were exposed to DI water and sulfuric acid solution (pH=1), and the specimens were visually inspected and weight changes measured. Evaluation of the coating-to-substrate bonding strength was determined using two modified ASTM test methods – one to determine bond strength of the coating with two specimens sandwiched together using the coating, and the second to determine the bond strength by applying a tensile load to the coating applied to specimens of each substrate. Forty-eight bonding tests were performed over the six month evaluation. The tests resulted in the following conclusions about Standard Cement’s SEC 4553 coating: • After the six-month chemi

  20. Study on nano-coating on uranium

    International Nuclear Information System (INIS)

    Zhang Yongbin; Xian Xiaobin; Lu Xuechao; Lang Dingmu; Li Kexue; Tang Kai

    2002-01-01

    The SiO 2 , TiO 2 coatings on uranium have been prepared by sol-gel method under different processes. By evaluating the coating quality with SEM, the optimal process parameters have been determined. Corrosion test shows that the coatings have anticorrosion property

  1. Latest Developments in PVD Coatings for Tooling

    Directory of Open Access Journals (Sweden)

    Gabriela Strnad

    2010-06-01

    Full Text Available The paper presents the recent developments in the field of PVD coating for manufacturing tools. A review of monoblock, multilayer, nanocomposite, DLC and oxinitride coatings is discussed, with the emphasis on coatings which enables the manufacturers to implement high productivity processes such as high speed cutting and dry speed machining.

  2. Method for coating substrates and mask holder

    NARCIS (Netherlands)

    Bijkerk, Frederik; Yakshin, Andrey; Louis, Eric; Kessels, M.J.H.; Maas, Edward Lambertus Gerardus; Bruineman, Caspar

    2004-01-01

    When coating substrates it is frequently desired that the layer thickness should be a certain function of the position on the substrate to be coated. To control the layer thickness a mask is conventionally arranged between the coating particle source and the substrate. This leads to undesirable

  3. Sonochemical coating of magnetite nanoparticles with silica.

    Science.gov (United States)

    Dang, Feng; Enomoto, Naoya; Hojo, Junichi; Enpuku, Keiji

    2010-01-01

    Magnetite nanoparticles were coated with silica through the hydrolysis and condensation of tetraethyl orthosilicate (TEOS) under ultrasonic irradiation. The ultrasonic irradiation was used to prevent the agglomeration of the magnetite particles and accelerate the hydrolysis and condensation of TEOS. TEM, DLS, XRF, VSM, TG and sedimentation test were used to characterize the silica-coated magnetite particles. The dispersibility of silica-coated magnetite particles in aqueous solution was improved significantly and the agglomerate particle size was decreased to 110 nm. It was found that the agglomerate particle size of silica-coated magnetite particles was mainly decided by the coating temperature and the pH value in the silica-coating process. The weight ratio of silica in silica-coated magnetite particles was mainly decided by the pH value in the silica-coating process. The dispersibility of silica-coated magnetite particles was mainly decided by the agglomerate particle size of the suspension. The oxidation of magnetite particles in air was limited through the coated silica. The magnetism of silica-coated magnetite particles decreased slightly after silica-coating.

  4. Amphiphilic copolymers for fouling-release coatings

    DEFF Research Database (Denmark)

    Noguer, Albert Camós; Olsen, Stefan Møller; Hvilsted, Søren

    of the coatings [9,10,11]. This work shows the effect of an amphiphilic copolymer that induces hydrophilicity on the surface of the silicone-based fouling release coatings. The behaviour of these copolymers within the coating upon immersion and the interaction of these surface-active additives with other...

  5. Modifications of optical properties with ceramic coatings

    International Nuclear Information System (INIS)

    Besmann, T.M.; Abdel-Latif, A.I.

    1990-01-01

    Coatings of ceramic materials that exhibited high thermal absorptivities and emissivities were chemical vapor deposited on graphite and refractory metals. In this paper the coatings prepared were SiC and B 4 C, and the substrates used were graphite, molybdenum, titanium, and Nb-1Zr. The coatings are characterized with regard to adherence, optical properties, and response to potential harsh environments

  6. Coat Hangers across the Curriculum

    Science.gov (United States)

    Kibble, Bob

    2012-01-01

    There are many ways in which wire coat hangers can be used other than for suspending clothes. The author has been making use of them in his teaching for many years--copying ideas from colleagues and creating some for himself. In this article, he shares five examples that can enrich learning about science. (Contains 6 figures.)

  7. Electron curing of surface coatings

    International Nuclear Information System (INIS)

    Nablo, S.V.

    1974-01-01

    The technical development of electron curing of surface coatings has received great impetus since 1970 from dramatic changes in the economics of the conventional thermal process. The most important of these changes are reviewed, including: the Clear Air Act, increasing cost and restrictive allocation of energy, decreased availability and increased costs of solvents, competitive pressure for higher line productivity. The principles of free-radical initiated curing as they pertain to industrial coatings are reviewed. Although such electron initiated processes have been under active development for at least two decades, high volume production applications on an industrial scale have only recently appeared. These installations are surveyed with emphasis on the developments in machinery and coatings which have made this possible. The most significant economic advantages of electron curing are presented. In particular, the ability of electron curing to eliminate substrate damage and to eliminate the curing station (oven) as the pacing element for most industrial surface coating curing applications is discussed. Examples of several new processes of particular interest in the textile industry are reviewed, including the curing of transfer cast urethane films, flock adhesives, and graftable surface finishes

  8. Polymer-coated quantum dots

    NARCIS (Netherlands)

    Tomczak, N.; Liu, Rongrong; Vancso, Gyula J.

    2013-01-01

    Quantum Dots (QDs) are semiconductor nanocrystals with distinct photophysical properties finding applications in biology, biosensing, and optoelectronics. Polymeric coatings of QDs are used primarily to provide long-term colloidal stability to QDs dispersed in solutions and also as a source of

  9. Industrial Coatings at Extreme Conditions

    DEFF Research Database (Denmark)

    Subramanian, Srinath; Pérez Hornero, Clara; Pedersen, Lars Thorslund

    With the gradual depletion of oil wells operable at relatively lower temperatures and pressures, the upstream oil industry relies on High Pressure High Temperature (HPHT) wells to source crude oil and gas. HPHT well extraction and processing require anticorrosive coatings applied on substrates...

  10. Water transport in multilayer coatings

    NARCIS (Netherlands)

    Baukh, V.

    2012-01-01

    Coatings form the interface between structures and the environment in many application domains. They play a crucial role in providing protection, e.g. against corrosion, they form a barrier against an aggressive environment and they create the aesthetic appearance. To fulfill such functionalities,

  11. Evidence from lateral mobility studies for dynamic interactions of a mutant influenza hemagglutinin with coated pits.

    Science.gov (United States)

    Fire, E; Zwart, D E; Roth, M G; Henis, Y I

    1991-12-01

    Replacement of cysteine at position 543 by tyrosine in the influenza virus hemagglutinin (HA) protein enables the endocytosis of the mutant protein (Tyr 543) through coated pits (Lazarovits, J., and M. G. Roth. 1988. Cell. 53:743-752). To investigate the interactions between Tyr 543 and the clathrin coats in the plasma membrane of live cells, we performed fluorescence photobleaching recovery measurements comparing the lateral mobilities of Tyr 543 (which enters coated pits) and wild-type HA (HA wt, which is excluded from coated pits), following their expression in CV-1 cells by SV-40 vectors. While both proteins exhibited the same high mobile fractions, the lateral diffusion rate of Tyr 543 was significantly slower than that of HA wt. Incubation of the cells in a sucrose-containing hypertonic medium, a treatment that disperses the membrane-associated coated pits, resulted in similar lateral mobilities for Tyr 543 and HA wt. These findings indicate that the lateral motion of Tyr 543 (but not of HA wt) is inhibited by transient interactions with coated pits (which are essentially immobile on the time scale of the lateral mobility measurements). Acidification of the cytoplasm by prepulsing the cells with NH4Cl (a treatment that arrests the pinching-off of coated vesicles from the plasma membrane and alters the clathrin lattice morphology) led to immobilization of a significant part of the Tyr 543 molecules, presumably due to their entrapment in coated pits for the entire duration of the lateral mobility measurement. Furthermore, in both untreated and cytosol-acidified cells, the restrictions on Tyr 543 mobility were less pronounced in the cold, suggesting that the mobility-restricting interactions are temperature dependent and become weaker at low temperatures. From these studies we conclude the following. (a) Lateral mobility measurements are capable of detecting interactions of transmembrane proteins with coated pits in intact cells. (b) The interactions of Tyr 543

  12. VHS virus - present situation

    DEFF Research Database (Denmark)

    Skall, Helle Frank; Olesen, Niels Jørgen

    2015-01-01

    of the worldwide distribution of the disease will be given. Virus evolution: Recent studies indicate that only a few amino acid changes in the structural proteins of VHSV can change the virulence patterns significantly, thereby coming closer to assessing the risk of none to low virulent viruses becoming high...... virulent. Virulence factors both depend on the ability of VHSV to enter a cell and on the speed and efficiencyof virus replication in the cells. Apparently the viral nucleocapsid protein plays a very important role for the later and seems to be the target for determination of a virulence marker....

  13. Zika virus in Asia

    Directory of Open Access Journals (Sweden)

    Veasna Duong

    2017-01-01

    Full Text Available Zika virus (ZIKV is an emerging mosquito-borne virus that was first isolated from a sentinel rhesus monkey in the Zika Forest in Uganda in 1947. In Asia, the virus was isolated in Malaysia from Aedes aegypti mosquitoes in 1966, and the first human infections were reported in 1977 in Central Java, Indonesia. In this review, all reported cases of ZIKV infection in Asia as of September 1, 2016 are summarized and some of the hypotheses that could currently explain the apparently low incidence of Zika cases in Asia are explored.

  14. Zika virus in Asia

    OpenAIRE

    Veasna Duong; Philippe Dussart; Philippe Buchy

    2017-01-01

    Zika virus (ZIKV) is an emerging mosquito-borne virus that was first isolated from a sentinel rhesus monkey in the Zika Forest in Uganda in 1947. In Asia, the virus was isolated in Malaysia from Aedes aegypti mosquitoes in 1966, and the first human infections were reported in 1977 in Central Java, Indonesia. In this review, all reported cases of ZIKV infection in Asia as of September 1, 2016 are summarized and some of the hypotheses that could currently explain the apparently low incidence of...

  15. Zika virus in Asia.

    Science.gov (United States)

    Duong, Veasna; Dussart, Philippe; Buchy, Philippe

    2017-01-01

    Zika virus (ZIKV) is an emerging mosquito-borne virus that was first isolated from a sentinel rhesus monkey in the Zika Forest in Uganda in 1947. In Asia, the virus was isolated in Malaysia from Aedes aegypti mosquitoes in 1966, and the first human infections were reported in 1977 in Central Java, Indonesia. In this review, all reported cases of ZIKV infection in Asia as of September 1, 2016 are summarized and some of the hypotheses that could currently explain the apparently low incidence of Zika cases in Asia are explored. Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  16. Viruses in reptiles

    Directory of Open Access Journals (Sweden)

    Ariel Ellen

    2011-09-01

    Full Text Available Abstract The etiology of reptilian viral diseases can be attributed to a wide range of viruses occurring across different genera and families. Thirty to forty years ago, studies of viruses in reptiles focused mainly on the zoonotic potential of arboviruses in reptiles and much effort went into surveys and challenge trials of a range of reptiles with eastern and western equine encephalitis as well as Japanese encephalitis viruses. In the past decade, outbreaks of infection with West Nile virus in human populations and in farmed alligators in the USA has seen the research emphasis placed on the issue of reptiles, particularly crocodiles and alligators, being susceptible to, and reservoirs for, this serious zoonotic disease. Although there are many recognised reptilian viruses, the evidence for those being primary pathogens is relatively limited. Transmission studies establishing pathogenicity and cofactors are likewise scarce, possibly due to the relatively low commercial importance of reptiles, difficulties with the availability of animals and permits for statistically sound experiments, difficulties with housing of reptiles in an experimental setting or the inability to propagate some viruses in cell culture to sufficient titres for transmission studies. Viruses as causes of direct loss of threatened species, such as the chelonid fibropapilloma associated herpesvirus and ranaviruses in farmed and wild tortoises and turtles, have re-focused attention back to the characterisation of the viruses as well as diagnosis and pathogenesis in the host itself. 1. Introduction 2. Methods for working with reptilian viruses 3. Reptilian viruses described by virus families 3.1. Herpesviridae 3.2. Iridoviridae 3.2.1 Ranavirus 3.2.2 Erythrocytic virus 3.2.3 Iridovirus 3.3. Poxviridae 3.4. Adenoviridae 3.5. Papillomaviridae 3.6. Parvoviridae 3.7. Reoviridae 3.8. Retroviridae and inclusion body disease of Boid snakes 3.9. Arboviruses 3.9.1. Flaviviridae 3

  17. BS-virus-finder

    DEFF Research Database (Denmark)

    Gao, Shengjie; Hu, Xuesong; Xu, Fengping

    2018-01-01

    Background: DNA methylation plays a key role in the regulation of gene expression and carcinogenesis. Bisulfite sequencing studies mainly focus on calling SNP, DMR, and ASM. Until now, only a few software tools focus on virus integration using bisulfite sequencing data. Findings: We have developed...... a new and easy-to-use software tool, named BS-virus-finder (BSVF, RRID:SCR_015727), to detect viral integration breakpoints in whole human genomes. The tool is hosted at https://github.com/BGI-SZ/BSVF. Conclusions: BS-virus-finder demonstrates high sensitivity and specificity. It is useful in epigenetic...

  18. UNDERWATER COATINGS FOR CONTAMINATION CONTROL

    International Nuclear Information System (INIS)

    Julia L. Tripp; Kip Archibald; Ann Marie Phillips; Joseph Campbell

    2004-01-01

    The Idaho National Laboratory (INL) deactivated several aging nuclear fuel storage basins. Planners for this effort were greatly concerned that radioactive contamination present on the basin walls could become airborne as the sides of the basins became exposed during deactivation and allowed to dry after water removal. One way to control this airborne contamination was to fix the contamination in place while the pool walls were still submerged. There are many underwater coatings available on the market for marine, naval and other applications. A series of tests were run to determine whether the candidate underwater fixatives were easily applied and adhered well to the substrates (pool wall materials) found in INL fuel pools. Lab-scale experiments were conducted by applying fourteen different commercial underwater coatings to four substrate materials representative of the storage basin construction materials, and evaluating their performance. The coupons included bare concrete, epoxy painted concrete, epoxy painted carbon steel, and stainless steel. The evaluation criteria included ease of application, adherence to the four surfaces of interest, no change on water clarity or chemistry, non-hazardous in final applied form and be proven in underwater applications. A proprietary two-part, underwater epoxy owned by S. G. Pinney and Associates was selected from the underwater coatings tested for application to all four pools. Divers scrubbed loose contamination off the basin walls and floors using a ship hull scrubber and vacuumed up the sludge. The divers then applied the coating using a special powered roller with two separate heated hoses that allowed the epoxy to mix at the roller surface was used to eliminate pot time concerns. The walls were successfully coated and water was removed from the pools with no detectable airborne contamination releases

  19. Atomically Bonded Transparent Superhydrophobic Coatings

    Energy Technology Data Exchange (ETDEWEB)

    Aytug, Tolga [ORNL

    2015-08-01

    Maintaining clarity and avoiding the accumulation of water and dirt on optically transparent surfaces such as US military vehicle windshields, viewports, periscope optical head windows, and electronic equipment cover glasses are critical to providing a high level of visibility, improved survivability, and much-needed safety for warfighters in the field. Through a combination of physical vapor deposition techniques and the exploitation of metastable phase separation in low-alkali borosilicate, a novel technology was developed for the fabrication of optically transparent, porous nanostructured silica thin film coatings that are strongly bonded to glass platforms. The nanotextured films, initially structurally superhydrophilic, exhibit superior superhydrophobicity, hence antisoiling ability, following a simple but robust modification in surface chemistry. The surfaces yield water droplet contact angles as high as 172°. Moreover, the nanostructured nature of these coatings provides increased light scattering in the UV regime and reduced reflectivity (i.e., enhanced transmission) over a broad range of the visible spectrum. In addition to these functionalities, the coatings exhibit superior mechanical resistance to abrasion and are thermally stable to temperatures approaching 500°C. The overall process technology relies on industry standard equipment and inherently scalable manufacturing processes and demands only nontoxic, naturally abundant, and inexpensive base materials. Such coatings, applied to the optical components of current and future combat equipment and military vehicles will provide a significant strategic advantage for warfighters. The inherent self-cleaning properties of such superhydrophobic coatings will also mitigate biofouling of optical windows exposed to high-humidity conditions and can help decrease repair/replacement costs, reduce maintenance, and increase readiness by limiting equipment downtime.

  20. Previously unknown and highly divergent ssDNA viruses populate the oceans.

    Science.gov (United States)

    Labonté, Jessica M; Suttle, Curtis A

    2013-11-01

    Single-stranded DNA (ssDNA) viruses are economically important pathogens of plants and animals, and are widespread in oceans; yet, the diversity and evolutionary relationships among marine ssDNA viruses remain largely unknown. Here we present the results from a metagenomic study of composite samples from temperate (Saanich Inlet, 11 samples; Strait of Georgia, 85 samples) and subtropical (46 samples, Gulf of Mexico) seawater. Most sequences (84%) had no evident similarity to sequenced viruses. In total, 608 putative complete genomes of ssDNA viruses were assembled, almost doubling the number of ssDNA viral genomes in databases. These comprised 129 genetically distinct groups, each represented by at least one complete genome that had no recognizable similarity to each other or to other virus sequences. Given that the seven recognized families of ssDNA viruses have considerable sequence homology within them, this suggests that many of these genetic groups may represent new viral families. Moreover, nearly 70% of the sequences were similar to one of these genomes, indicating that most of the sequences could be assigned to a genetically distinct group. Most sequences fell within 11 well-defined gene groups, each sharing a common gene. Some of these encoded putative replication and coat proteins that had similarity to sequences from viruses infecting eukaryotes, suggesting that these were likely from viruses infecting eukaryotic phytoplankton and zooplankton.

  1. Highly Specific Detection of Five Exotic Quarantine Plant Viruses using RT-PCR

    Directory of Open Access Journals (Sweden)

    Hoseong Choi

    2013-03-01

    Full Text Available To detect five plant viruses (Beet black scorch virus, Beet necrotic yellow vein virus, Eggplant mottled dwarf virus, Pelargonium zonate spot virus, and Rice yellow mottle virus for quarantine purposes, we designed 15 RT-PCR primer sets. Primer design was based on the nucleotide sequence of the coat protein gene, which is highly conserved within species. All but one primer set successfully amplified the targets, and gradient PCRs indicated that the optimal temperature for the 14 useful primer sets was 51.9°C. Some primer sets worked well regardless of annealing temperature while others required a very specific annealing temperature. A primer specificity test using plant total RNAs and cDNAs of other plant virus-infected samples demonstrated that the designed primer sets were highly specific and generated reproducible results. The newly developed RT-PCR primer sets would be useful for quarantine inspections aimed at preventing the entry of exotic plant viruses into Korea.

  2. Chickpea chlorotic stunt virus: A New Polerovirus Infecting Cool-Season Food Legumes in Ethiopia.

    Science.gov (United States)

    Abraham, A D; Menzel, W; Lesemann, D-E; Varrelmann, M; Vetten, H J

    2006-05-01

    ABSTRACT Serological analysis of diseased chickpea and faba bean plantings with yellowing and stunting symptoms suggested the occurrence of an unknown or uncommon member of the family Luteoviridae in Ethiopia. Degenerate primers were used for reverse transcriptase-polymerase chain reaction amplification of the viral coat protein (CP) coding region from both chickpea and faba bean samples. Cloning and sequencing of the amplicons yielded nearly identical (96%) nucleotide sequences of a previously unrecognized species of the family Luteoviridae, with a CP amino acid sequence most closely related (identity of approximately 78%) to that of Groundnut rosette assistor virus. The complete genome (5,900 nts) of a faba bean isolate comprised six major open reading frames characteristic of polero-viruses. Of the four aphid species tested, only Aphis craccivora transmitted the virus in a persistent manner. The host range of the virus was confined to a few species of the family Fabaceae. A rabbit antiserum raised against virion preparations cross-reacted unexpectedly with Beet western yellows virus-like viruses. This necessitated the production of murine monoclonal antibodies which, in combination with the polyclonal antiserum, permitted both sensitive and specific detection of the virus in field samples by triple-antibody sandwich, enzyme-linked immunosorbent assay. Because of the characteristic field and greenhouse symptoms in chickpea, the name Chickpea chlorotic stunt virus is proposed for this new member of the genus Polerovirus (family Luteoviridae).

  3. Ultrasonic tests on materials with protective coatings

    International Nuclear Information System (INIS)

    Whaley, H.L.

    1977-01-01

    Protective coatings are applied to some nuclear components such as reactor vessels to inhibit surface corrosion. Since in-service ultrasonic inspection is required for such components, a study was performed to determine whether the use of protective coatings can affect ultrasonic tests. Two 2 in. thick steel plates were uniformly machined, sandblasted, and used as bases for two types of protective coatings. The type and thickness of the coating and the presence of contamination, such as fingerprints or mild oxidation under the paint, were the independent variables associated with the coating. Tests were run to determine the effects of the protective coatings on ultrasonic tests conducted on the steel plates. Significant variations in ultrasonic test sensitivity occurred as a function of the type and thickness of protective coating, couplant (material that conducts the ultrasound from the transducer into the test part, normally water or some type of oil), transducer wear plate, and ultrasonic test frequency. Ultrasonic tests can be strongly affected by a protective coating on the component to be inspected. As compared to the test sensitivity for an uncoated reference sample, the sensitivity may be dramatically shifted up or down on the coated surface. In certain coating thickness ranges, the sensitivity can fluctuate widely with small changes in coating thickness. If a coating is chosen properly, however, components with protective coatings can be tested ultrasonically with valid results. These results are for the case of ultrasonic input on the coated surface. It is not expected that an ultrasonic test conducted from the front surface would be appreciably affected by a coating on the rear surface

  4. Preparation of sustained release capsules by electrostatic dry powder coating, using traditional dip coating as reference.

    Science.gov (United States)

    Yang, Yan; Shen, Lian; Yuan, Feng; Fu, Hui; Shan, Weiguang

    2018-05-30

    Lately, a great deal of attention is being paid to capsule coating, since the coat protects active pharmaceutical ingredients (APIs) from damage, as is in the case of tablet and pellet. However, moisture and heat sensitivity of gelatin shells make it challenging to coat capsules using the conventional aqueous coating techniques. In an effort to overcome this challenge, the present study aims to coat capsules using two different coating techniques: electrostatic dry powder coating (EDPC) and dip coating (DC). Both capsule coatings and free films were prepared by these two coating techniques, and the effects of coating formulations and processing conditions on the film quality were investigated. The corresponding drug in vitro release and mechanisms were characterized and compared. The results of dissolution tests demonstrated that the drug release behavior of both EDPC and DC coated capsules could be optimized to a sustained release of 24 h, following the Fick's diffusion law. The results of this study suggest that EDPC method is better than DC method for coating capsules, with respect to the higher production efficiency and better stability, indicating that this dry coating technology has promised in gelatin capsule coating applications. Copyright © 2018 Elsevier B.V. All rights reserved.

  5. Levitation, coating, and transport of particulate materials

    International Nuclear Information System (INIS)

    Hendricks, C.D.

    1981-01-01

    Several processes in various fields require uniformly thick coatings and layers on small particles. The particles may be used as carriers of catalytic materials (platinum or other coatings), as laser fusion targets (various polymer or metallic coatings), or for biological or other tracer or interactive processes. We have devised both molecular beam and electro-dynamic techniques for levitation of the particles during coating and electrodynamic methods of controlling and transporting the particles between coating steps and to final use locations. Both molecular beam and electrodynamic techniques are described and several advantages and limitations of each will be discussed. A short movie of an operating electrodynamic levitation and transport apparatus will be shown

  6. Coatings for fast breeder reactor components

    International Nuclear Information System (INIS)

    Johnson, R.N.

    1984-04-01

    Several types of metallurgical coatings are used in the unique environments of the fast breeder reactor. Most of the coatings have been developed for tribological applications, but some also serve as corrosion barriers, diffusion barriers, or radionuclide traps. The materials that have consistently given the best performance as tribological coatings in the breeder reactor environments have been coatings based on chromium carbide, nickel aluminide, or Tribaloy 700 (a nickel-base hard-facing alloy). Other coatings that have been qualified for limited applications include chromium plating for low temperature galling protection and nickel plating for radionuclide trapping

  7. Transparent nanocrystalline diamond coatings and devices

    Science.gov (United States)

    Sumant, Anirudha V.; Khan, Adam

    2017-08-22

    A method for coating a substrate comprises producing a plasma ball using a microwave plasma source in the presence of a mixture of gases. The plasma ball has a diameter. The plasma ball is disposed at a first distance from the substrate and the substrate is maintained at a first temperature. The plasma ball is maintained at the first distance from the substrate, and a diamond coating is deposited on the substrate. The diamond coating has a thickness. Furthermore, the diamond coating has an optical transparency of greater than about 80%. The diamond coating can include nanocrystalline diamond. The microwave plasma source can have a frequency of about 915 MHz.

  8. Evaluation of irradiated coating material specimens

    International Nuclear Information System (INIS)

    Lee, Yong Jin; Nam, Seok Woo; Cho, Lee Moon

    2007-12-01

    Evaluation result of irradiated coating material specimens - Coating material specimens radiated Gamma Energy(Co 60) in air condition. - Evaluation conditions was above 1 X 10 4 Gy/hr, and radiated TID 2.0 X 10 6 Gy. - The radiated coating material specimens, No Checking, Cracking, Flaking, Delamination, Peeling and Blistering. - Coating system at the Kori no. 1 and APR 1400 Nuclear power plant, evaluation of irradiated coating materials is in accordance with owner's requirement(2.0 X 10 6 Gy)

  9. Statistical experimental design for refractory coatings

    International Nuclear Information System (INIS)

    McKinnon, J.A.; Standard, O.C.

    2000-01-01

    The production of refractory coatings on metal casting moulds is critically dependent on the development of suitable rheological characteristics, such as viscosity and thixotropy, in the initial coating slurry. In this paper, the basic concepts of mixture design and analysis are applied to the formulation of a refractory coating, with illustration by a worked example. Experimental data of coating viscosity versus composition are fitted to a statistical model to obtain a reliable method of predicting the optimal formulation of the coating. Copyright (2000) The Australian Ceramic Society

  10. Phylogeny of isolates of Prunus necrotic ringspot virus from the Ilarvirus Ringtest and identification of group-specific features.

    Science.gov (United States)

    Hammond, R W

    2003-06-01

    Isolates of Prunus necrotic ringspot virus (PNRSV) were examined to establish the level of naturally occurring sequence variation in the coat protein (CP) gene and to identify group-specific genome features that may prove valuable for the generation of diagnostic reagents. Phylogenetic analysis of a 452 bp sequence of 68 virus isolates, 20 obtained from the European Union Ilarvirus Ringtest held in October 1998, confirmed the clustering of the isolates into three distinct groups. Although no correlation was found between the sequence and host or geographic origin, there was a general trend for severe isolates to cluster into one group. Group-specific features have been identified for discrimination between virus strains.

  11. Nucleotide sequence of a chickpea chlorotic stunt virus relative that infects pea and faba bean in China.

    Science.gov (United States)

    Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

    2012-07-01

    We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were Polerovirus, and the name pea mild chlorosis virus is proposed.

  12. A versatile SERS-based immunoassay for immunoglobulin detection using antigen-coated gold nanoparticles and malachite green-conjugated protein A/G

    Science.gov (United States)

    A surface enhanced Raman scattering (SERS) immunoassay for antibody detection in serum is described in the present work. The developed assay is conducted in solution and utilizes Au nanoparticles coated with the envelope (E) protein of West Nile Virus (WNV) as the SERS-active substrate and malachite...

  13. E-selectin is a viable route of infection for polymer-coated adenovirus retargeting in TNF-.alpha.-activated human umbilical vein endothelial cells

    Czech Academy of Sciences Publication Activity Database

    Bachtarzi, H.; Stevenson, M.; Šubr, Vladimír; Seymour, L. W.; Fisher, K. D.

    2011-01-01

    Roč. 19, č. 8 (2011), s. 690-700 ISSN 1061-186X Institutional research plan: CEZ:AV0Z40500505 Keywords : polymer-coated virus * vascular targeting * inflammation Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.696, year: 2011

  14. Ebola Virus Disease

    Centers for Disease Control (CDC) Podcasts

    This podcast provides general information about Ebola virus disease and the outbreak in West Africa. The program contains remarks from CDC Director Dr. Tom Frieden, as well as a brief description of CDC’s response efforts.

  15. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Donate Shop Career Connection Home Clinical Guidance & Publications Practice Management Education & Events Advocacy For Patients About ACOG ... Virus and Pregnancy Infographic Resources & Publications Committee Opinions Practice Bulletins Patient Education Green Journal Clinical Updates Practice ...

  16. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Dues Follow us: Women's Health Care Physicians Contact Us My ACOG ACOG Departments Donate Shop Career Connection Home Clinical Guidance & Publications Practice Management Education & Events Advocacy For Patients About ACOG Zika Virus ...

  17. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Departments Donate Shop Career Connection Home Clinical Guidance & Publications Practice Management Education & Events Advocacy For Patients About ... pregnant. Related: Zika Virus and Pregnancy Infographic Resources & Publications Committee Opinions Practice Bulletins Patient Education Green Journal ...

  18. CLASSIFICATION OF VIRUSES

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. CLASSIFICATION OF VIRUSES. On basis of morphology. On basis of chemical composition. On basis of structure of genome. On basis of mode of replication. Notes:

  19. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... ACOG Pregnancy Book Patient Education FAQs Patient Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and ... on Patient Safety For Patients Patient FAQs Spanish Pamphlets Teen Health About ACOG About Us Leadership & Governance ...

  20. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Career Connection Home Clinical Guidance & Publications Practice Management Education & Events Advocacy For Patients About ACOG Zika Virus ... and Pregnancy Page Navigation ▼ ACOG Pregnancy Book Patient Education FAQs Patient Education Pamphlets - Spanish Share: PEV002, September ...