Complete nucleotide sequence and genome organization of Olive latent virus 3, a new putative member of the family Tymoviridae.

Science.gov (United States)

Alabdullah, Abdulkader; Minafra, Angelantonio; Elbeaino, Toufic; Saponari, Maria; Savino, Vito; Martelli, Giovanni P

2010-09-01

The complete nucleotide sequence and the genome organization were determined of a putative new member of the family Tymoviridae, tentatively named Olive latent virus 3 (OLV-3), recovered in southern Italy from a symptomless olive tree. The sequenced ssRNA genome comprises 7148 nucleotides excluding the poly(A) tail and contains four open reading frames (ORFs). ORF1 encodes a polyprotein of 221.6kDa in size, containing the conserved signatures of the methyltransferase (MTR), papain-like protease (PRO), helicase (HEL) and RNA-dependent RNA polymerase (RdRp) domains of the replication-associated proteins of positive-strand RNA viruses. ORF2 overlaps completely ORF1 and encodes a putative protein of 43.33kDa showing limited sequence similarity with the putative movement protein of Maize rayado fino virus (MRFV). ORF3 codes for a protein with predicted molecular mass of 28.46kDa, identified as the coat protein (CP), whereas ORF4 overlaps ORF3 and encodes a putative protein of 16kDa with sequence similarity to the p16 and p31 proteins of Citrus sudden death-associated virus (CSDaV) and Grapevine fleck virus (GFkV), respectively. Within the family Tymoviridae, OLV-3 genome has the closest identity level (49-52%) with members of the genus Marafivirus, from which, however, it differs because of the diverse genome organization and the presence of a single type of CP subunits. Copyright (c) 2010 Elsevier B.V. All rights reserved.

Role of Pea Enation Mosaic Virus Coat Protein in the Host Plant and Aphid Vector.

Science.gov (United States)

Doumayrou, Juliette; Sheber, Melissa; Bonning, Bryony C; Miller, W Allen

2016-11-18

Understanding the molecular mechanisms involved in plant virus-vector interactions is essential for the development of effective control measures for aphid-vectored epidemic plant diseases. The coat proteins (CP) are the main component of the viral capsids, and they are implicated in practically every stage of the viral infection cycle. Pea enation mosaic virus 1 (PEMV1, Enamovirus , Luteoviridae ) and Pea enation mosaic virus 2 (PEMV2, Umbravirus , Tombusviridae ) are two RNA viruses in an obligate symbiosis causing the pea enation mosaic disease. Sixteen mutant viruses were generated with mutations in different domains of the CP to evaluate the role of specific amino acids in viral replication, virion assembly, long-distance movement in Pisum sativum , and aphid transmission. Twelve mutant viruses were unable to assemble but were able to replicate in inoculated leaves, move long-distance, and express the CP in newly infected leaves. Four mutant viruses produced virions, but three were not transmissible by the pea aphid, Acyrthosiphon pisum . Three-dimensional modeling of the PEMV CP, combined with biological assays for virion assembly and aphid transmission, allowed for a model of the assembly of PEMV coat protein subunits.

Expression of tomato yellow leaf curl virus coat protein using baculovirus expression system and evaluation of its utility as a viral antigen.

Science.gov (United States)

Elgaied, Lamiaa; Salem, Reda; Elmenofy, Wael

2017-08-01

DNA encoding the coat protein (CP) of an Egyptian isolate of tomato yellow leaf curl virus (TYLCV) was inserted into the genome of Autographa californica nucleopolyhedrovirus (AcNPV) under the control of polyhedrin promoter. The generated recombinant baculovirus construct harboring the coat protein gene was characterized using PCR analysis. The recombinant coat protein expressed in infected insect cells was used as a coating antigen in an indirect Enzyme-linked immunosorbent assay (ELISA) and dot blot to test its utility for the detection of antibody generated against TYLCV virus particles. The results of ELISA and dot blot showed that the TYLCV-antibodies reacted positively with extracts of infected cells using the recombinant virus as a coating antigen with strong signals as well as the TYLCV infected tomato and beat plant extracts as positive samples. Scanning electron microscope examination showed that the expressed TYLCV coat protein was self-assembled into virus-like particles (VLPs) similar in size and morphology to TYLCV virus particles. These results concluded that, the expressed coat protein of TYLCV using baculovirus vector system is a reliable candidate for generation of anti-CP antibody for inexpensive detection of TYLCV-infected plants using indirect CP-ELISA or dot blot with high specificity.

Resistance Evaluation of Radish (Raphanus sativus L. Inbred Lines against Turnip mosaic virus

Directory of Open Access Journals (Sweden)

Ju-Yeon Yoon

2017-03-01

Full Text Available Leaves of twenties radish (Raphanus sativus L. inbred lines were mechanically inoculated with Turnip mosaic virus (TuMV strain HY to evaluate TuMV resistance of the radish inbred lines. The inoculated radish plants were incubated at 22°C±3°C and resistance assessment was examined using symptom development for 4 weeks. Based on the reactions of differential radish inbred lines, 16 radish lines were produced mild mosaic, mottling, mosaic and severe mosaic symptoms by TuMV infection. These results were confirmed by RT-PCR analysis of TuMV coat protein gene, suggesting that TuMV is responsible for the disease symptoms. Four resistant radish lines did not induce systemic mosaic symptoms on upper leaves and chlorosis in stem tissues for 4 weeks, showing they were symptomless by 8 weeks. Further examination of TuMV infection in the 4 radish lines showed no TuMV infection in all systemic leaves. These results suggest that the 4 radish lines are highly resistant to TuMV.

Are PEI-coated SWCNTs conjugated with hepatitis A virus? A chemical study with SEM, Z-potential, EDXD and RT-PCR

International Nuclear Information System (INIS)

Carbone, M; Valentini, F; Palleschi, G; Caminiti, R; Petrinca, A R; Donia, D; Divizia, M

2010-01-01

The conjugation between nanotubes, coated with different doses of polyethylene imine (PEI) and hepatitis A virus (HAV) was investigated by scanning electron microscopy, Z-potential, thermogravimetric and differential thermal analysis, transmission electron microscopy, energy dispersive x-ray diffraction (EDXD) and reverse transcript polymerase chain reaction (RT-PCR). For the first time, to our knowledge, evidence is obtained that conjugation between the nanotubes and the HAV occurs and that it has an (at least a partial) electrostatic character. Since all components of the conjugated systems, nanotubes, coating material and virus are characterized by different peak shapes in the selected q range, it was possible to infer that conjugation occurred. RT-PCR measurements confirmed that the conjugation of the coated nanotubes and HAV occurred and the result was stable. This opens up the prospect of probing the coated nanotubes as intra-cellular carriers in transfection processes of the virus. Further biological applications will concern a possible vaccine especially for non-replicative viruses.

Role of Pea Enation Mosaic Virus Coat Protein in the Host Plant and Aphid Vector

Directory of Open Access Journals (Sweden)

Juliette Doumayrou

2016-11-01

Full Text Available Understanding the molecular mechanisms involved in plant virus–vector interactions is essential for the development of effective control measures for aphid-vectored epidemic plant diseases. The coat proteins (CP are the main component of the viral capsids, and they are implicated in practically every stage of the viral infection cycle. Pea enation mosaic virus 1 (PEMV1, Enamovirus, Luteoviridae and Pea enation mosaic virus 2 (PEMV2, Umbravirus, Tombusviridae are two RNA viruses in an obligate symbiosis causing the pea enation mosaic disease. Sixteen mutant viruses were generated with mutations in different domains of the CP to evaluate the role of specific amino acids in viral replication, virion assembly, long-distance movement in Pisum sativum, and aphid transmission. Twelve mutant viruses were unable to assemble but were able to replicate in inoculated leaves, move long-distance, and express the CP in newly infected leaves. Four mutant viruses produced virions, but three were not transmissible by the pea aphid, Acyrthosiphon pisum. Three-dimensional modeling of the PEMV CP, combined with biological assays for virion assembly and aphid transmission, allowed for a model of the assembly of PEMV coat protein subunits.

Survival of Newcastle disease virus (NDV) strain V4- UPM coated on ...

African Journals Online (AJOL)

STORAGESEVER

2008-08-04

Aug 4, 2008 ... Results showed that the virus coated onto the carrier foods offal without additive remained stable at ≥ MID value for ≈3 ... meat (Shane, 1984). Velogenic .... the byproducts of food processing that is expected to eliminate any ...

Partial characterization of the lettuce infectious yellows virus genomic RNAs, identification of the coat protein gene and comparison of its amino acid sequence with those of other filamentous RNA plant viruses.

Science.gov (United States)

Klaassen, V A; Boeshore, M; Dolja, V V; Falk, B W

1994-07-01

Purified virions of lettuce infectious yellows virus (LIYV), a tentative member of the closterovirus group, contained two RNAs of approximately 8500 and 7300 nucleotides (RNAs 1 and 2 respectively) and a single coat protein species with M(r) of approximately 28,000. LIYV-infected plants contained multiple dsRNAs. The two largest were the correct size for the replicative forms of LIYV virion RNAs 1 and 2. To assess the relationships between LIYV RNAs 1 and 2, cDNAs corresponding to the virion RNAs were cloned. Northern blot hybridization analysis showed no detectable sequence homology between these RNAs. A partial amino acid sequence obtained from purified LIYV coat protein was found to align in the most upstream of four complete open reading frames (ORFs) identified in a LIYV RNA 2 cDNA clone. The identity of this ORF was confirmed as the LIYV coat protein gene by immunological analysis of the gene product expressed in vitro and in Escherichia coli. Computer analysis of the LIYV coat protein amino acid sequence indicated that it belongs to a large family of proteins forming filamentous capsids of RNA plant viruses. The LIYV coat protein appears to be most closely related to the coat proteins of two closteroviruses, beet yellows virus and citrus tristeza virus.

Polyclonal Antibodies to a Recombinant Coat Protein of Potato Virus A

Czech Academy of Sciences Publication Activity Database

Čeřovská, Noemi; Moravec, Tomáš; Velemínský, Jiří

2002-01-01

Roč. 46, - (2002), s. 147-151 ISSN 0001-723X R&D Projects: GA ČR GA310/00/0381 Institutional research plan: CEZ:AV0Z5038910 Keywords : Potato virus A * recombinant coat protein * Escherichia coli Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.660, year: 2002

RNA2 of grapevine fanleaf virus: sequence analysis and coat protein cistron location.

Science.gov (United States)

Serghini, M A; Fuchs, M; Pinck, M; Reinbolt, J; Walter, B; Pinck, L

1990-07-01

The nucleotide sequence of the genomic RNA2 (3774 nucleotides) of grapevine fanleaf virus strain F13 was determined from overlapping cDNA clones and its genetic organization was deduced. Two rapid and efficient methods were used for cDNA cloning of the 5' region of RNA2. The complete sequence contained only one long open reading frame of 3555 nucleotides (1184 codons, 131K product). The analysis of the N-terminal sequence of purified coat protein (CP) and identification of its C-terminal residue have allowed the CP cistron to be precisely positioned within the polyprotein. The CP produced by proteolytic cleavage at the Arg/Gly site between residues 680 and 681 contains 504 amino acids (Mr 56019) and has hydrophobic properties. The Arg/Gly cleavage site deduced by N-terminal amino acid sequence analysis is the first for a nepovirus coat protein and for plant viruses expressing their genomic RNAs by polyprotein synthesis. Comparison of GFLV RNA2 with M RNA of cowpea mosaic comovirus and with RNA2 of two closely related nepoviruses, tomato black ring virus and Hungarian grapevine chrome mosaic virus, showed strong similarities among the 3' non-coding regions but less similarity among the 5' end non-coding sequences than reported among other nepovirus RNAs.

The 96th Amino Acid of the Coat Protein of Cucumber Green Mottle Mosaic Virus Affects Virus Infectivity

Directory of Open Access Journals (Sweden)

Zhenwei Zhang

2017-12-01

Full Text Available Cucumber green mottle mosaic virus (CGMMV is one of the most devastating viruses infecting members of the family Cucurbitaceae. The assembly initiation site of CGMMV is located in the coding region of the coat protein, which is not only involved in virion assembly but is also a key factor determining the long-distance movement of the virus. To understand the effect of assembly initiation site and the adjacent region on CGMMV infectivity, we created a GTT deletion mutation in the GAGGTTG assembly initiation site of the infectious clone of CGMMV, which we termed V97 (deletion mutation at residue 97 of coat protein, followed by the construction of the V94A and T104A mutants. We observed that these three mutations caused mosaic after Agrobacterium-mediated transformation in Nicotiana benthamiana, albeit with a significant delay compared to the wild type clone. The mutants also had a common spontaneous E96K mutation in the coat protein. These results indicated that the initial assembly site and the sequence of the adjacent region affected the infectivity of the virus and that E96 might play an essential role in this process. We constructed two single point mutants—E96A and E96K—and three double mutants—V94A-E96K, V97-E96K and T104A-E96K—to further understand the role of E96 in CGMMV pathogenesis. After inoculation in N. benthamiana, E96A showed delayed systemic symptoms, but the E96K and three double mutants exhibited typical symptoms of mosaic at seven days post-infection. Then, sap from CGMMV-infected N. benthamiana leaves was mechanically inoculated on watermelon plants. We confirmed that E96 affected CGMMV infection using double antibody sandwich-enzyme-linked immunosorbent assay (DAS-ELISA, reverse transcription-polymerase chain reaction (RT-PCR, and sequencing, which further confirmed the successful infection of the related mutants, and that E96K can compensate the effect of the V94, V97, and T104 mutations on virus infectivity. In

Reverse Transcription Polymerase Chain Reaction-based System for Simultaneous Detection of Multiple Lily-infecting Viruses

Directory of Open Access Journals (Sweden)

Ji Yeon Kwon

2013-09-01

Full Text Available A detection system based on a multiplex reverse transcription (RT polymerase chain reaction (PCR was developed to simultaneously identify multiple viruses in the lily plant. The most common viruses infecting lily plants are the cucumber mosaic virus (CMV, lily mottle virus (LMoV, lily symptomless virus (LSV. Leaf samples were collected at lily-cultivation facilities located in the Kangwon province of Korea and used to evaluate the detection system. Simplex and multiplex RT-PCR were performed using virus-specific primers to detect single-or mixed viral infections in lily plants. Our results demonstrate the selective detection of 3 different viruses (CMV, LMoV and LSV by using specific primers as well as the potential of simultaneously detecting 2 or 3 different viruses in lily plants with mixed infections. Three sets of primers for each target virus, and one set of internal control primers were used to evaluate the detection system for efficiency, reliability, and reproducibility.

Stability of Newcastle Disease Virus Strain V4-UPM Coated on ...

African Journals Online (AJOL)

Protection of village chickens against Newcastle disease (ND) is considered feasible through food-delivered vaccines. Vaccine virus strain V4-UPM coated on cassava granules with or without additive (2% gelatin) was tested for stability at room temperature (RT) for 8 weeks and 40oC for 12 hours at weekly and two hourly ...

Expression and the antigenicity of recombinant coat proteins of tungro viruses expressed in Escherichia coli.

Science.gov (United States)

Yee, Siew Fung; Chu, Chia Huay; Poili, Evenni; Sum, Magdline Sia Henry

2017-02-01

Rice tungro disease (RTD) is a recurring disease affecting rice farming especially in the South and Southeast Asia. The disease is commonly diagnosed by visual observation of the symptoms on diseased plants in paddy fields and by polymerase chain reaction (PCR). However, visual observation is unreliable and PCR can be costly. High-throughput as well as relatively cheap detection methods are important for RTD management for screening large number of samples. Due to this, detection by serological assays such as immunoblotting assays and enzyme-linked immunosorbent assay are preferred. However, these serological assays are limited by lack of continuous supply of antibodies as reagents due to the difficulty in preparing sufficient purified virions as antigens. This study aimed to generate and evaluate the reactivity of the recombinant coat proteins of Rice tungro bacilliform virus (RTBV) and Rice tungro spherical virus (RTSV) as alternative antigens to generate antibodies. The genes encoding the coat proteins of both viruses, RTBV (CP), and RTSV (CP1, CP2 and CP3) were cloned and expressed as recombinant fusion proteins in Escherichia coli. All of the recombinant fusion proteins, with the exception of the recombinant fusion protein of the CP2 of RTSV, were reactive against our in-house anti-tungro rabbit serum. In conclusion, our study showed the potential use of the recombinant fusion coat proteins of the tungro viruses as alternative antigens for production of antibodies for diagnostic purposes. Copyright © 2016 Elsevier B.V. All rights reserved.

Survey of Cherry necrotic rusty mottle virus and Cherry green ring mottle virus incidence in Korea by Duplex RT-PCR

Directory of Open Access Journals (Sweden)

Seung-Yeol Lee

2014-12-01

Full Text Available The incidence of Cherry necrotic rusty mottle virus (CNRMV and Cherry green ring mottle virus (CGRMV have recently been occurred in Korea, posing a problem for sweet cherry cultivation. Since infected trees have symptomless leaves or ring-like spots on the pericarp, it is difficult to identify a viral infection. In this study, the incidence of CNRMV and CGRMV in sweet cherry in Gyeongbuk province was surveyed using a newly developed duplex reverse transcriptase polymerase chain reaction (RT-PCR method that can detect both viruses in a single reaction. CNRMV and CGRMV co-infection rates were 29.6%, 53.6%, and 17.6%, respectively, in samples collected from three different sites (Daegu, Gyeongju and Gyeongsan in Gyeongbuk province during 2012 and 2013. This duplex RT-PCR method offers a simple, rapid, and effective way of identifying CNRMV and CGRMV simultaneously in sweet cherry trees, which can aid in the management of viral infections that could undermine yield.

Preparation of recombinant coat protein of Prunus necrotic ringspot virus.

Science.gov (United States)

Petrzik, K; Mráz, I; Kubelková, D

2001-02-01

The coat protein (CP) gene of Prunus necrotic ringspot virus (PNRSV) was cloned into pET 16b vector and expressed in Escherichia coli. CP-enriched fractions were prepared from whole cell lysate by differential centrifugation. The fraction sedimenting at 20,000 x g for 30 mins was used for preparation of a rabbit antiserum to CP. This antiserum had a titer of 1:2048 and reacted in a double-antibody sandwich ELISA (DAS-ELISA).

Protective hybrid coating containing silver, copper and zinc cations effective against human immunodeficiency virus and other enveloped viruses

Czech Academy of Sciences Publication Activity Database

Hodek, Jan; Zajícová, V.; Lovětinská-Šlamborová, I.; Stibor, I.; Müllerová, J.; Weber, Jan

2016-01-01

Roč. 16, Apr 1 (2016), č. článku 56. ISSN 1471-2180 R&D Projects: GA MŠk(CZ) LK11207 Institutional support: RVO:61388963 Keywords : hybrid coating * virucidal effect * HIV * enveloped viruses Subject RIV: EE - Microbiology, Virology Impact factor: 2.644, year: 2016 http://bmcmicrobiol.biomedcentral.com/articles/10.1186/s12866-016-0675-x

Zucchini yellow mosaic virus: biological properties, detection procedures and comparison of coat protein gene sequences.

Science.gov (United States)

Coutts, B A; Kehoe, M A; Webster, C G; Wylie, S J; Jones, R A C

2011-12-01

Between 2006 and 2010, 5324 samples from at least 34 weed, two cultivated legume and 11 native species were collected from three cucurbit-growing areas in tropical or subtropical Western Australia. Two new alternative hosts of zucchini yellow mosaic virus (ZYMV) were identified, the Australian native cucurbit Cucumis maderaspatanus, and the naturalised legume species Rhyncosia minima. Low-level (0.7%) seed transmission of ZYMV was found in seedlings grown from seed collected from zucchini (Cucurbita pepo) fruit infected with isolate Cvn-1. Seed transmission was absent in >9500 pumpkin (C. maxima and C. moschata) seedlings from fruit infected with isolate Knx-1. Leaf samples from symptomatic cucurbit plants collected from fields in five cucurbit-growing areas in four Australian states were tested for the presence of ZYMV. When 42 complete coat protein (CP) nucleotide (nt) sequences from the new ZYMV isolates obtained were compared to those of 101 complete CP nt sequences from five other continents, phylogenetic analysis of the 143 ZYMV sequences revealed three distinct groups (A, B and C), with four subgroups in A (I-IV) and two in B (I-II). The new Australian sequences grouped according to collection location, fitting within A-I, A-II and B-II. The 16 new sequences from one isolated location in tropical northern Western Australia all grouped into subgroup B-II, which contained no other isolates. In contrast, the three sequences from the Northern Territory fitted into A-II with 94.6-99.0% nt identities with isolates from the United States, Iran, China and Japan. The 23 new sequences from the central west coast and two east coast locations all fitted into A-I, with 95.9-98.9% nt identities to sequences from Europe and Japan. These findings suggest that (i) there have been at least three separate ZYMV introductions into Australia and (ii) there are few changes to local isolate CP sequences following their establishment in remote growing areas. Isolates from A-I and B

Lima Ekstrak Tumbuhan untuk Menekan Infeksi Bean common mosaic virus pada Tanaman Kacang Panjang

Directory of Open Access Journals (Sweden)

Lulu Kurnianingsih

2013-08-01

Full Text Available Bean common mosaic virus (BCMV is one of major virus infecting legumes and is difficult to manage. Utilization of plant extracts as systemic resistance inducer against virus is needed to study. The aim of the research is to evaluate the potency of five leaf extracts, i.e. from pagoda flower, spiny amaranth, four o’clock flower, Chenopodium amaranticolor, and herba andrographitis against BCMV. The effectiveness of leaf extracts were tested by spraying yard long bean leaves. Plants treated by spine spinach shown varied symptoms, while other treatments showed mild mosaic up to symptomless. The highest to lowest of disease incidence was showed by crude leaf extract of spine spinach (70%, four o’clock (10%, herba andrographitis (10%, while C. amaranticolor and pagoda are still uninfected. These results had positive correlation to disease severity and virus inhibition. Four of five tested leaf extracts, except spine spinach, showed their potency as systemic resistance inducer against BCMV.  Key words: BCMV, plant extract, yard long bean

Production of Polyclonal Antibodies to a Recombinant Coat Protein of Potato mop-top virus

Czech Academy of Sciences Publication Activity Database

Čeřovská, Noemi; Moravec, Tomáš; Rosecká, Pavla; Dědič, P.; Filigarová, Marie

2003-01-01

Roč. 151, č. 4 (2003), s. 195-200 ISSN 0931-1785 R&D Projects: GA ČR GA522/01/1121 Institutional research plan: CEZ:AV0Z5038910 Keywords : potato mop-top virus * recombinant coat protein * Escherichia Coli Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.557, year: 2003

The movement protein and coat protein of alfalfa mosaic virus accumulate in structurally modified plasmodesmata

NARCIS (Netherlands)

van der Wel, N. N.; Goldbach, R. W.; van Lent, J. W.

1998-01-01

In systemically infected tissues of Nicotiana benthamiana, alfalfa mosaic virus (AMV) coat protein (CP) and movement protein (MP) are detected in plasmodesmata in a layer of three to four cells at the progressing front of infection. Besides the presence of these viral proteins, the plasmodesmata are

Molecular characterization and intermolecular interaction of coat protein of Prunus necrotic ringspot virus: implications for virus assembly.

Science.gov (United States)

Kulshrestha, Saurabh; Hallan, Vipin; Sharma, Anshul; Seth, Chandrika Attri; Chauhan, Anjali; Zaidi, Aijaz Asghar

2013-09-01

Coat protein (CP) and RNA3 from Prunus necrotic ringspot virus (PNRSV-rose), the most prevalent virus infecting rose in India, were characterized and regions in the coat protein important for self-interaction, during dimer formation were identified. The sequence analysis of CP and partial RNA 3 revealed that the rose isolate of PNRSV in India belongs to PV-32 group of PNRSV isolates. Apart from the already established group specific features of PV-32 group member's additional group-specific and host specific features were also identified. Presence of methionine at position 90 in the amino acid sequence alignment of PNRSV CP gene (belonging to PV-32 group) was identified as the specific conserved feature for the rose isolates of PNRSV. As protein-protein interaction plays a vital role in the infection process, an attempt was made to identify the portions of PNRSV CP responsible for self-interaction using yeast two-hybrid system. It was found (after analysis of the deletion clones) that the C-terminal region of PNRSV CP (amino acids 153-226) plays a vital role in this interaction during dimer formation. N-terminal of PNRSV CP is previously known to be involved in CP-RNA interactions, but our results also suggested that N-terminal of PNRSV CP represented by amino acids 1-77 also interacts with C-terminal (amino acids 153-226) in yeast two-hybrid system, suggesting its probable involvement in the CP-CP interaction.

Apple latent spherical virus vectors for reliable and effective virus-induced gene silencing among a broad range of plants including tobacco, tomato, Arabidopsis thaliana, cucurbits, and legumes

International Nuclear Information System (INIS)

Igarashi, Aki; Yamagata, Kousuke; Sugai, Tomokazu; Takahashi, Yukari; Sugawara, Emiko; Tamura, Akihiro; Yaegashi, Hajime; Yamagishi, Noriko; Takahashi, Tsubasa; Isogai, Masamichi; Takahashi, Hideki; Yoshikawa, Nobuyuki

2009-01-01

Apple latent spherical virus (ALSV) vectors were evaluated for virus-induced gene silencing (VIGS) of endogenous genes among a broad range of plant species. ALSV vectors carrying partial sequences of a subunit of magnesium chelatase (SU) and phytoene desaturase (PDS) genes induced highly uniform knockout phenotypes typical of SU and PDS inhibition on model plants such as tobacco and Arabidopsis thaliana, and economically important crops such as tomato, legume, and cucurbit species. The silencing phenotypes persisted throughout plant growth in these plants. In addition, ALSV vectors could be successfully used to silence a meristem gene, proliferating cell nuclear antigen and disease resistant N gene in tobacco and RCY1 gene in A. thaliana. As ALSV infects most host plants symptomlessly and effectively induces stable VIGS for long periods, the ALSV vector is a valuable tool to determine the functions of interested genes among a broad range of plant species.

Symptomless endophytic fungi suppress endogenous levels of salicylic acid and interact with the jasmonate-dependent indirect defense traits of their host, lima bean (Phaseolus lunatus).

Science.gov (United States)

Navarro-Meléndez, Ariana L; Heil, Martin

2014-07-01

Symptomless ‘type II’ fungal endophytes colonize their plant host horizontally and exert diverse effects on its resistance phenotype. Here, we used wild Lima bean (Phaseolus lunatus) plants that were experimentally colonized with one of three strains of natural endophytes (Bartalinia pondoensis, Fusarium sp., or Cochliobolus lunatus) to investigate the effects of fungal colonization on the endogenous levels of salicylic acid (SA) and jasmonic acid (JA) and on two JA-dependent indirect defense traits. Colonization with Fusarium sp. enhanced JA levels in intact leaves, whereas B. pondoensis suppressed the induction of endogenous JA in mechanically damaged leaves. Endogenous SA levels in intact leaves were significantly decreased by all strains and B. pondoensis and Fusarium sp. decreased SA levels after mechanical damage. Colonization with Fusarium sp. or C. lunatus enhanced the number of detectable volatile organic compounds (VOCs) emitted from intact leaves, and all three strains enhanced the relative amount of several VOCs emitted from intact leaves as well as the number of detectable VOCs emitted from slightly damaged leaves. All three strains completely suppressed the induced secretion of extrafloral nectar (EFN) after the exogenous application of JA. Symptomless endophytes interact in complex and strain-specific ways with the endogenous levels of SA and JA and with the defense traits that are controlled by these hormones. These interactions can occur both upstream and downstream of the defense hormones.

Coat protein deletion mutants elicit more severe symptoms than wild-type virus in multiple cereal hosts

Science.gov (United States)

The coat protein (CP) of Wheat streak mosaic virus (WSMV; genus Tritimovirus, family Potyviridae) tolerates deletion of amino acids 36 to 84 for efficient systemic infection of wheat. This study demonstrates that deletion of CP amino acids 58 to 84, but not 36 to 57, from WSMV genome induced severe ...

Wheat streak mosaic virus coat protein is a determinant for vector transmission by the wheat curl mite

Science.gov (United States)

Wheat streak mosaic virus (WSMV; genus Tritimovirus; family Potyviridae), is transmitted by the wheat curl mite (Aceria tosichella Keifer). The requirement of coat protein (CP) for WSMV transmission by the wheat curl mite was examined using a series of viable deletion and point mutations. Mite trans...

Simultaneous detection of three lily viruses using Triplex IC-RT-PCR.

Science.gov (United States)

Zhang, Yubao; Wang, Yajun; Xie, Zhongkui; Yang, Guo; Guo, Zhihong; Wang, Le

2017-11-01

Viruses commonly infecting lily (Lilium spp.) include: Lily symptomless virus (LSV), Cucumber mosaic virus (CMV) and Lily mottle virus (LMoV). These viruses usually co-infect lilies causing severe economic losses in terms of quantity and quality of flower and bulb production around the world. Reliable and precise detection systems need to be developed for virus identification. We describe the development of a triplex immunocapture (IC) reverse transcription (RT) polymerase chain reaction (PCR) assay for the simultaneous detection of LSV, CMV and LMoV. The triplex IC-RT-PCR was compared with a quadruplex RT-PCR assay. Relative to the quadruplex RT-PCR, the specificity of the triplex IC-RT-PCR system for LSV, CMV and LMoV was 100% for field samples. The sensitivity of the triplex IC-RT-PCR system was 99.4%, 81.4% and 98.7% for LSV, CMV and LMoV, respectively. Agreement (κ) between the results obtained from the two tests was 0.968, 0.844 and 0.984 for LSV, CMV and LMoV, respectively. This is the first report of the simultaneous detection of LSV, CMV and LMoV in a triplex IC-RT-PCR assay. In particular we believe this convenient and reliable triplex IC-RT-PCR method could be used routinely for large-scale field surveys or crop health monitoring of lily. Copyright © 2017. Published by Elsevier B.V.

40 CFR 174.516 - Coat protein of cucumber mosaic virus; exemption from the requirement of a tolerance.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Coat protein of cucumber mosaic virus; exemption from the requirement of a tolerance. 174.516 Section 174.516 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS PROCEDURES AND REQUIREMENTS FOR PLANT-INCORPORATED PROTECTANTS Tolerances and Tolerance...

40 CFR 174.515 - Coat Protein of Papaya Ringspot Virus; exemption from the requirement of a tolerance.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Coat Protein of Papaya Ringspot Virus; exemption from the requirement of a tolerance. 174.515 Section 174.515 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS PROCEDURES AND REQUIREMENTS FOR PLANT-INCORPORATED PROTECTANTS Tolerances and Tolerance...

Virus Incidence of Sweet Potato in Korea from 2011 to 2014.

Science.gov (United States)

Kim, Jaedeok; Yang, Jung Wook; Kwak, Hae-Ryun; Kim, Mi-Kyeong; Seo, Jang-Kyun; Chung, Mi-Nam; Lee, Hyeong-Un; Lee, Kyeong-Bo; Nam, Sang Sik; Kim, Chang-Seok; Lee, Gwan-Seok; Kim, Jeong-Soo; Lee, Sukchan; Choi, Hong-Soo

2017-10-01

A nationwide survey was performed to investigate the current incidence of viral diseases in Korean sweet potatoes for germplasm and growing fields from 2011 to 2014. A total of 83.8% of the germplasm in Korea was infected with viruses in 2011. Commercial cultivars that were used to supply growing fields were infected at a rate of 62.1% in 2012. Among surveyed viruses, the incidence of five Potyvirus species that infect sweet potato decreased between 2012 and 2013, and then increased again in 2014. Representatively, the incidence of Sweet potato feathery mottle virus (SPFMV) was 87.0% in 2012, 20.7% in 2013 and then increased to 35.3% in 2014. Unlike RNA viruses, DNA viruses were shown to decrease continuously. The incidence of Sweet potato leaf curl virus (SPLCV) was 5.5% in 2003, 59.5% in 2011, and 47.4% in 2012. It then decreased continuously year by year to 33.2% in 2013, and then 25.6% in 2014. While the infection rate of each virus species showed a tendency to decline, the virus infection status was more variable in 2013 and 2014. Nevertheless, the high rate of single infections and mixed infection combinations were more variable than the survey results from 2012. As shown in the results from 2013, the most prevalent virus infection was a single infection at 27.6%, with the highest rate of infection belonging to sweet potato symptomless virus-1 (SPSMV-1) (12.9%). Compared to 2013, infection combinations were more varied in 2014, with a total of 122 kinds of mixed infection.

The current incidence of viral disease in korean sweet potatoes and development of multiplex rt-PCR assays for simultaneous detection of eight sweet potato viruses.

Science.gov (United States)

Kwak, Hae-Ryun; Kim, Mi-Kyeong; Shin, Jun-Chul; Lee, Ye-Ji; Seo, Jang-Kyun; Lee, Hyeong-Un; Jung, Mi-Nam; Kim, Sun-Hyung; Choi, Hong-Soo

2014-12-01

Sweet potato is grown extensively from tropical to temperate regions and is an important food crop worldwide. In this study, we established detection methods for 17 major sweet potato viruses using single and multiplex RT-PCR assays. To investigate the current incidence of viral diseases, we collected 154 samples of various sweet potato cultivars showing virus-like symptoms from 40 fields in 10 Korean regions, and analyzed them by RT-PCR using specific primers for each of the 17 viruses. Of the 17 possible viruses, we detected eight in our samples. Sweet potato feathery mottle virus (SPFMV) and sweet potato virus C (SPVC) were most commonly detected, infecting approximately 87% and 85% of samples, respectively. Furthermore, Sweet potato symptomless virus 1 (SPSMV-1), Sweet potato virus G (SPVG), Sweet potato leaf curl virus (SPLCV), Sweet potato virus 2 ( SPV2), Sweet potato chlorotic fleck virus (SPCFV), and Sweet potato latent virus (SPLV) were detected in 67%, 58%, 47%, 41%, 31%, and 20% of samples, respectively. This study presents the first documented occurrence of four viruses (SPVC, SPV2, SPCFV, and SPSMV-1) in Korea. Based on the results of our survey, we developed multiplex RT-PCR assays for simple and simultaneous detection of the eight sweet potato viruses we recorded.

The Current Incidence of Viral Disease in Korean Sweet Potatoes and Development of Multiplex RT-PCR Assays for Simultaneous Detection of Eight Sweet Potato Viruses

Directory of Open Access Journals (Sweden)

Hae-Ryun Kwak

2014-12-01

Full Text Available Sweet potato is grown extensively from tropical to temperate regions and is an important food crop worldwide. In this study, we established detection methods for 17 major sweet potato viruses using single and multiplex RT-PCR assays. To investigate the current incidence of viral diseases, we collected 154 samples of various sweet potato cultivars showing virus-like symptoms from 40 fields in 10 Korean regions, and analyzed them by RT-PCR using specific primers for each of the 17 viruses. Of the 17 possible viruses, we detected eight in our samples. Sweet potato feathery mottle virus (SPFMV and sweet potato virus C (SPVC were most commonly detected, infecting approximately 87% and 85% of samples, respectively. Furthermore, Sweet potato symptomless virus 1 (SPSMV-1, Sweet potato virus G (SPVG, Sweet potato leaf curl virus (SPLCV, Sweet potato virus 2 ( SPV2, Sweet potato chlorotic fleck virus (SPCFV, and Sweet potato latent virus (SPLV were detected in 67%, 58%, 47%, 41%, 31%, and 20% of samples, respectively. This study presents the first documented occurrence of four viruses (SPVC, SPV2, SPCFV, and SPSMV-1 in Korea. Based on the results of our survey, we developed multiplex RT-PCR assays for simple and simultaneous detection of the eight sweet potato viruses we recorded.

Nucleotide sequence of the coat protein gene of Lettuce big-vein virus.

Science.gov (United States)

Sasaya, T; Ishikawa, K; Koganezawa, H

2001-06-01

A sequence of 1425 nt was established that included the complete coat protein (CP) gene of Lettuce big-vein virus (LBVV). The LBVV CP gene encodes a 397 amino acid protein with a predicted M(r) of 44486. Antisera raised against synthetic peptides corresponding to N-terminal or C-terminal parts of the LBVV CP reacted in Western blot analysis with a protein with an M(r) of about 48000. RNA extracted from purified particles of LBVV by using proteinase K, SDS and phenol migrated in gels as two single-stranded RNA species of approximately 7.3 kb (ss-1) and 6.6 kb (ss-2). After denaturation by heat and annealing at room temperature, the RNA migrated as four species, ss-1, ss-2 and two additional double-stranded RNAs (ds-1 and ds-2). The Northern blot hybridization analysis using riboprobes from a full-length clone of the LBVV CP gene indicated that ss-2 has a negative-sense nature and contains the LBVV CP gene. Moreover, ds-2 is a double-stranded form of ss-2. Database searches showed that the LBVV CP most resembled the nucleocapsid proteins of rhabdoviruses. These results indicate that it would be appropriate to classify LBVV as a negative-sense single-stranded RNA virus rather than as a double-stranded RNA virus.

Solution structures of potato virus X and narcissus mosaic virus from Raman optical activity

DEFF Research Database (Denmark)

Blanch, Ewan W.; Robinson, David J.; Hecht, Lutz

2002-01-01

Potato virus X (PVX) and narcissus mosaic virus (NMV) were studied using vibrational Raman optical activity (ROA) in order to obtain new information on the structures of their coat protein subunits. The ROA spectra of the two intact virions are very similar to each other and similar to that of to......Potato virus X (PVX) and narcissus mosaic virus (NMV) were studied using vibrational Raman optical activity (ROA) in order to obtain new information on the structures of their coat protein subunits. The ROA spectra of the two intact virions are very similar to each other and similar...

Identification and Prevalence of Grapevine fanleaf virus in Khorasan-Razavi Vineyards

Directory of Open Access Journals (Sweden)

Z. Gholampour

2016-02-01

phosphate buffer. Total plant RNA were extracted from fresh leaves using silicon dioxide (Boom et al. 1990. The cDNA strand was synthesized using Moloney murine leukemia virus (MMuLV reverse transcriptase. The partial length of coat protein gene of GFLV isolates was further amplified using DetF (CGGCAGACTGGCAAGCTGT and DetR (GGTCCAGTTTAATTGCCATCCA specific primer pair by RT-PCR in leaf samples that were positive in DAS-ELISA. PCR products were run on 1% agarose gel containing 0.5 µg/ml DNA Green Viewer, and visualized under UV irradiation. The PCR products were purified using the Qiaquick PCR purification kit (Qiagen, then were sequenced bidirectionally using DetF/DetRspecific primer pair. Consensus sequences were verified using the BLAST program in NCBI database. Multiple sequence alignments of the nucleotide sequences of the coat protein gene Phylogenetic analysis were carried out by the Neighbour-joining method implemented in MEGA v.5 Results and Discussion: 187 out of 280 samples were found to be infected with GFLV in indirect ELISA. Based on ELISA results, GFLV infection rate in Khorasan-Razavi ranging from 32% to 63%. Kashmar had the most infected vineyards with the prevalence of the virus in 90% of the samples. GFLV induced yellow mosaic and vein banding in infected leaves. Shorten internode, the zigzag growth of stem and double nude were observed in infected grapevines, however, most of the GFLV infected vines were symptomless. Mechanical inoculation with sap extracts from the GFLV positive leaf samples, induced chlorotic local lesions followed by vein clearing in systemic leaves of Chenopodium quinoa two weeks post inoculation. RT-PCR using specific primers amplify 1000 bp fragment corresponding to the GFLV coat protein gene. No fragment was observed in healthy control. Pairwise comparisons of the coat protein gene of four Iranian isolates showed 89%–97% nucleotide sequence identity and 90%–92% identity at the amino acid level with those of previously

The specific transmission of Grapevine fanleaf virus by its nematode vector Xiphinema index is solely determined by the viral coat protein

International Nuclear Information System (INIS)

Andret-Link, Peggy; Schmitt-Keichinger, Corinne; Demangeat, Gerard; Komar, Veronique; Fuchs, Marc

2004-01-01

The viral determinants involved in the specific transmission of Grapevine fanleaf virus (GFLV) by its nematode vector Xiphinema index are located within the 513 C-terminal residues of the RNA2-encoded polyprotein, that is, the 9 C-terminal amino acids of the movement protein (2B MP ) and contiguous 504 amino acids of the coat protein (2C CP ) [Virology 291 (2001) 161]. To further delineate the viral determinants responsible for the specific spread, the four amino acids that are different within the 9 C-terminal 2B MP residues between GFLV and Arabis mosaic virus (ArMV), another nepovirus which is transmitted by Xiphinema diversicaudatum but not by X. index, were subjected to mutational analysis. Of the recombinant viruses derived from transcripts of GFLV RNA1 and RNA2 mutants that systemically infected herbaceous host plants, all with the 2C CP of GFLV were transmitted by X. index unlike none with the 2C CP of ArMV, regardless of the mutations within the 2B MP C-terminus. These results demonstrate that the coat protein is the sole viral determinant for the specific spread of GFLV by X. index

Replication of alfalfa mosaic virus RNA 3 with movement and coat protein genes replaced by corresponding genes of Prunus necrotic ringspot ilarvirus.

Science.gov (United States)

Sánchez-Navarro, J A; Reusken, C B; Bol, J F; Pallás, V

1997-12-01

Alfalfa mosaic virus (AMV) and Prunus necrotic ringspot virus (PNRSV) are tripartite positive-strand RNA plant viruses that encode functionally similar translation products. Although the two viruses are phylogenetically closely related, they infect a very different range of natural hosts. The coat protein (CP) gene, the movement protein (MP) gene or both genes in AMV RNA 3 were replaced by the corresponding genes of PNRSV. The chimeric viruses were tested for heterologous encapsidation, replication in protoplasts from plants transformed with AMV replicase genes P1 and P2 (P12 plants) and for cell-to-cell transport in P12 plants. The chimeric viruses exhibited basic competence for encapsidation and replication in P12 protoplasts and for a low level of cell-to-cell movement in P12 plants. The potential involvement of the MP gene in determining host specificity in ilarviruses is discussed.

Role of alfalfa mosaic virus coat protein in regulation of the balance between viral plus and minus strand RNA synthesis

NARCIS (Netherlands)

van der Kuyl, A. C.; Neeleman, L.; Bol, J. F.

1991-01-01

Replication of wild type RNA 3 of alfalfa mosaic virus (AIMV) and mutants with frameshifts in the P3 or coat protein (CP) genes was studied in protoplasts from tobacco plants transformed with DNA copies of AIMV RNAs 1 and 2. Accumulation of viral plus and minus strand RNAs was monitored with

Production of Polyclonal Antibodies to the Recombinant Potato virus M (PVM) Non-structural Triple Gene Block Protein 1 and Coat Protein

Czech Academy of Sciences Publication Activity Database

Čeřovská, Noemi; Moravec, Tomáš; Plchová, Helena; Hoffmeisterová, Hana; Dědič, P.

2012-01-01

Roč. 160, č. 5 (2012), s. 251-254 ISSN 0931-1785 R&D Projects: GA MŠk 1M06030 Institutional research plan: CEZ:AV0Z50380511 Keywords : Potato virus M * recombinant protein * coat protein Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.000, year: 2012

Putative recombination events and evolutionary history of five economically important viruses of fruit trees based on coat protein-encoding gene sequence analysis.

Science.gov (United States)

Boulila, Moncef

2010-06-01

To enhance the knowledge of recombination as an evolutionary process, 267 accessions retrieved from GenBank were investigated, all belonging to five economically important viruses infecting fruit crops (Plum pox, Apple chlorotic leaf spot, Apple mosaic, Prune dwarf, and Prunus necrotic ringspot viruses). Putative recombinational events were detected in the coat protein (CP)-encoding gene using RECCO and RDP version 3.31beta algorithms. Based on RECCO results, all five viruses were shown to contain potential recombination signals in the CP gene. Reconstructed trees with modified topologies were proposed. Furthermore, RECCO performed better than the RDP package in detecting recombination events and exhibiting their evolution rate along the sequences of the five viruses. RDP, however, provided the possible major and minor parents of the recombinants. Thus, the two methods should be considered complementary.

Immunity to potato mop-top virus in Nicotiana benthamiana plants expressing the coat protein gene is effective against fungal inoculation of the virus.

Science.gov (United States)

Reavy, B; Arif, M; Kashiwazaki, S; Webster, K D; Barker, H

1995-01-01

Nicotiana benthamiana stem tissue was transformed with Agrobacterium tumefaciens harboring a binary vector containing the potato mop-top virus (PMTV) coat protein (CP) gene. PMTV CP was expressed in large amounts in some of the primary transformants. The five transgenic lines which produced the most CP were selected for resistance testing. Flowers on transformed plants were allowed to self-fertilize. Transgenic seedlings selected from the T1 seed were mechanically inoculated with two strains of PMTV. Virus multiplication, assayed by infectivity, was detected in only one transgenic plant of 98 inoculated. T1 plants were also highly resistant to graft inoculation; PMTV multiplied in only one plant of 45 inoculated. Transgenic T1 seedlings were challenged in a bait test in which they were grown in soil containing viruliferous spores of the vector fungus Spongospora subterranea. In these tests only two plants out of 99 became infected. Of the five transgenic lines tested, plants of three lines were immune to infection following manual, graft, or fungal inoculation.

Molecular identification based on coat protein sequences of the Barley yellow dwarf virus from Brazil

Directory of Open Access Journals (Sweden)

Talita Bernardon Mar

2013-12-01

Full Text Available Yellow dwarf disease, one of the most important diseases of cereal crops worldwide, is caused by virus species belonging to the Luteoviridae family. Forty-two virus isolates obtained from oat (Avena sativa L., wheat (Triticum aestivum L., barley (Hordeum vulgare L., corn (Zea mays L., and ryegrass (Lolium multiflorum Lam. collected between 2007 and 2008 from winter cereal crop regions in southern Brazil were screened by polymerase chain reaction (PCR with primers designed on ORF 3 (coat protein - CP for the presence of Barley yellow dwarf virus and Cereal yellow dwarf virus (B/CYDV. PCR products of expected size (~357 bp for subgroup II and (~831 bp for subgroup I were obtained for three and 39 samples, respectively. These products were cloned and sequenced. The subgroup II 3' partial CP amino acid deduced sequences were identified as BYDV-RMV (92 - 93 % of identity with "Illinois" Z14123 isolate. The complete CP amino acid deduced sequences of subgroup I isolates were confirmed as BYDV-PAV (94 - 99 % of identity and established a very homogeneous group (identity higher than 99 %. These results support the prevalence of BYDV-PAV in southern Brazil as previously diagnosed by Enzyme-Linked Immunosorbent Assay (ELISA and suggest that this population is very homogeneous. To our knowledge, this is the first report of BYDV-RMV in Brazil and the first genetic diversity study on B/CYDV in South America.

Production of polyclonal antisera using recombinant coat proteins of Grapevine leafroll-associated virus 2 and Grapevine virus B Produção de anti-soros policlonais a partir de proteínas capsidiais recombinantes de Grapevine leafroll-associated virus 2 e Grapevine virus B

Directory of Open Access Journals (Sweden)

Paula Radaelli

2008-10-01

Full Text Available The objective of this work was to produce and characterize specific antisera against Brazilian isolates of Grapevine leafroll-associated virus 2 (GLRaV-2 and Grapevine virus B (GVB, developed from expressed coat proteins (CPs in Escherichia coli, and to test their possible use for the detection of these two viruses in diseased grapevines. The coat protein (CP genes were RT-PCR-amplified, cloned and sequenced. The CP genes were subsequently subcloned, and the recombinant plasmids were used to transform E. coli cells and express the coat proteins. The recombinant coat proteins were purified, and their identities were confirmed by SDS-PAGE and Western blot and used for rabbit immunizations. Antisera raised against these proteins were able to recognize the corresponding recombinant proteins in Western blots and to detect GLRaV-2 and GVB in infected grapevine tissues, by indirect ELISA, discriminating healthy and infected grapevines with absorbances (A405 of 0.08/1.15 and 0.12/1.30, respectively. Expressing CP genes can yield high amount of viral protein with high antigenicity, and GLRaV-2 and GVB antisera obtained in this study can allow reliable virus disease diagnosis.O objetivo deste trabalho foi produzir e caracterizar anti-soros específicos contra isolados brasileiros do Vírus do enrolamento-da-folha da videira 2 (GLRaV-2 e do Vírus B da videira (GVB, desenvolvidos a partir das proteínas capsidiais expressas em Escherichia coli, e testar seu possível uso para a detecção destes dois vírus em videiras infectadas. Os genes da proteína capsidial (CP foram amplificados via RT-PCR, clonados e seqüenciados. Foram, subseqüentemente, subclonados, e os plasmídeos recombinantes foram empregados na transformação das células de E. coli e na expressão das proteínas capsidiais. As proteínas capsidiais recombinantes foram purificadas, e suas identidades foram confirmadas em SDS-PAGE e "Western blot" e utilizadas para imunizar coelhos. Os anti

Transdermal influenza immunization with vaccine-coated microneedle arrays.

Directory of Open Access Journals (Sweden)

Dimitrios G Koutsonanos

Full Text Available Influenza is a contagious disease caused by a pathogenic virus, with outbreaks all over the world and thousands of hospitalizations and deaths every year. Due to virus antigenic drift and short-lived immune responses, annual vaccination is required. However, vaccine coverage is incomplete, and improvement in immunization is needed. The objective of this study is to investigate a novel method for transdermal delivery using metal microneedle arrays (MN coated with inactivated influenza virus to determine whether this route is a simpler and safer approach than the conventional immunization, capable to induce robust immune responses and confer protection against lethal virus challenge.Inactivated A/Aichi/2/68 (H3N2 influenza virus was coated on metal microneedle arrays and applied to mice as a vaccine in the caudal dorsal skin area. Substantial antibody titers with hemagglutination inhibition activity were detected in sera collected two and four weeks after a single vaccine dose. Challenge studies in mice with 5 x LD(50 of mouse adapted Aichi virus demonstrated complete protection. Microneedle vaccination induced a broad spectrum of immune responses including CD4+ and CD8+ responses in the spleen and draining lymph node, a high frequency of antigen-secreting cells in the lung and induction of virus-specific memory B-cells. In addition, the use of MN showed a dose-sparing effect and a strong Th2 bias when compared to an intramuscular (IM reference immunization.The present results show that delivery of inactivated influenza virus through the skin using metal microneedle arrays induced strong humoral and cellular immune responses capable of conferring protection against virus challenge as efficiently as intramuscular immunization, which is the standard vaccination route. In view of the convenience of delivery and the potential for self-administration, vaccine-coated metal microneedles may provide a novel and highly effective immunization method.

Detection of viruses in olive trees in Croatian Istria

Directory of Open Access Journals (Sweden)

Marta LUIGI

2011-05-01

Full Text Available Normal 0 14 false false false IT ZH-TW X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Tabella normale"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin-top:0cm; mso-para-margin-right:0cm; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0cm; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} Following identification of four viruses in a general survey of olive trees throughout Croatia, a detailed survey was conducted in 2009 in the field collection of the Institute of Agriculture and Tourism in Poreč (an important reservoir of Istrian native olive germplasm in order to evaluate the sanitary status of the most important Croatian Istria olive cultivars. Twenty five samples from symptomatic or symptomless trees were collected from five autochthonous and four exotic cultivars. All the samples were tested by RT-PCR for the presence of: Olive leaf yellowing associated virus (OLYaV, Cherry leaf roll virus (CLRV, Strawberry latent ring spot virus (SLRSV, Arabis mosaic virus (ArMV, Olive latent virus-1 (OLV-1, Cucumber mosaic virus (CMV, Olive latent virus-2 (OLV-2 and Tobacco necrosis virus D (TNV-D. Six of the 25 plants were found positive to CLRV; all infected plants showed leaf and fruit deformation and leaf yellowing. Four positive samples were from the native cv. Buža whereas the other two were from two exotic cultivars: Ascolana tenera and Frantoio. The presence of CLRV,  either in native or imported plants, highlights the importance of strict phytosanitary regulations to prevent incursion of key

The 42-kDa coat protein of Andean potato mottle virus acts as a transcriptional activator in yeast

Directory of Open Access Journals (Sweden)

Vidal M.S.

2002-01-01

Full Text Available Interactions of viral proteins play an important role in the virus life cycle, especially in capsid assembly. Andean potato mottle comovirus (APMoV is a plant RNA virus with a virion formed by two coat proteins (CP42 and CP22. Both APMoV coat protein open reading frames were cloned into pGBT9 and pGAD10, two-hybrid system vectors. HF7c yeast cells transformed with the p9CP42 construct grew on yeast dropout selection media lacking tryptophan and histidine. Clones also exhibited ß-galactosidase activity in both qualitative and quantitative assays. These results suggest that CP42 protein contains an amino acid motif able to activate transcription of His3 and lacZ reporter genes in Saccharomyces cerevisiae. Several deletions of the CP42 gene were cloned into the pGBT9 vector to locate the region involved in this activation. CP42 constructions lacking 12 residues from the C-terminal region and another one with 267 residues deleted from the N-terminus are still able to activate transcription of reporter genes. However, transcription activation was not observed with construction p9CP42deltaC57, which does not contain the last 57 amino acid residues. These results demonstrate that a transcription activation domain is present at the C-terminus of CP42 between residues 267 and 374.

Marburg virus VP35 can both fully coat the backbone and cap the ends of dsRNA for interferon antagonism.

Directory of Open Access Journals (Sweden)

Shridhar Bale

2012-09-01

Full Text Available Filoviruses, including Marburg virus (MARV and Ebola virus (EBOV, cause fatal hemorrhagic fever in humans and non-human primates. All filoviruses encode a unique multi-functional protein termed VP35. The C-terminal double-stranded (dsRNA-binding domain (RBD of VP35 has been implicated in interferon antagonism and immune evasion. Crystal structures of the VP35 RBD from two ebolaviruses have previously demonstrated that the viral protein caps the ends of dsRNA. However, it is not yet understood how the expanses of dsRNA backbone, between the ends, are masked from immune surveillance during filovirus infection. Here, we report the crystal structure of MARV VP35 RBD bound to dsRNA. In the crystal structure, molecules of dsRNA stack end-to-end to form a pseudo-continuous oligonucleotide. This oligonucleotide is continuously and completely coated along its sugar-phosphate backbone by the MARV VP35 RBD. Analysis of dsRNA binding by dot-blot and isothermal titration calorimetry reveals that multiple copies of MARV VP35 RBD can indeed bind the dsRNA sugar-phosphate backbone in a cooperative manner in solution. Further, MARV VP35 RBD can also cap the ends of the dsRNA in solution, although this arrangement was not captured in crystals. Together, these studies suggest that MARV VP35 can both coat the backbone and cap the ends, and that for MARV, coating of the dsRNA backbone may be an essential mechanism by which dsRNA is masked from backbone-sensing immune surveillance molecules.

Ruptured congenital aneurysm of the right sinus of Valsalva into the right ventricle: with special reference to pathoanatomic and hemodynamic characteristics in symptomless cases.

Science.gov (United States)

Chen, J J; Lien, W P; Chang, F Z; Lee, Y S; Hung, C R; Chu, S S; Wu, T L

1980-02-01

Clinical features of 19 cases with congenital aneurysm of the right sinus of Valsalva rupturing into the right ventricular outflow region (Type 1) were analysed in relation to their pathoanatomic lesions and hemodynamic alterations. Sixteen cases were operated with one surgical death. All were catheterized together with ascending aortographic study. Rupture of the aneurysm in many cases was silent or symptomless and progressive heart failure was not quite common. Symptomatology of the patients did not seem to be related entirely to status of the pathoanatomical lesions or hemodynamic alterations. Time of the rupture, and inherent right ventricular characteristics, tolerating volume overload rather well, might be, in part, responsible for its better prognosis in some cases. However, all patients with ruptured aneurysm of the sinus of Valsalva should be treated surgically. Bacterial endocarditis is a serious complication leading to death.

Natural minus-strand RNAs of alfalfa mosaic virus as in vitro templates for viral RNA polymerase. 3'-Terminal non-coded guanosine and coat protein are insufficient factors for full-size plus-strand synthesis

NARCIS (Netherlands)

Houwing, C.J.; Huis in 't Veld, M.; Zuidema, D.; Graaff, de M.; Jaspars, E.M.J.

2001-01-01

Replication complexes of alfalfa mosaic virus produce in vivo large quantities of plus-strand RNAs, but this production is fully dependent on the presence of coat protein. In order to study this process of RNA-dependent and coat protein-regulated RNA synthesis we have isolated the three natural

The effect of surface demineralization of cortical bone allograft on the properties of recombinant adeno-associated virus coatings.

Science.gov (United States)

Yazici, Cemal; Yanoso, Laura; Xie, Chao; Reynolds, David G; Samulski, R Jude; Samulski, Jade; Yannariello-Brown, Judith; Gertzman, Arthur A; Zhang, Xinping; Awad, Hani A; Schwarz, Edward M

2008-10-01

Freeze-dried recombinant adeno-associated virus (rAAV) coated structural allografts have emerged as an approach to engender necrotic cortical bone with host factors that will persist for weeks following surgery to facilitate revascularization, osteointegration, and remodeling. However, one major limitation is the nonporous cortical surface that prohibits uniform distribution of the rAAV coating prior to freeze-drying. To overcome this we have developed a demineralization method to increase surface absorbance while retaining the structural integrity of the allograft. Demineralized bone wafers (DBW) made from human femoral allograft rings demonstrated a significant 21.1% (73.6+/-3.9% versus 52.5+/-2.6%; pcoating versus mineralized controls. Co-incubation of rAAV-luciferase (rAAV-Luc) coated DBW with a monolayer of C3H10T1/2 cells in culture led to peak luciferase levels that were not significantly different from soluble rAAV-Luc controls (p>0.05), although the peaks occurred at 60h and 12h, respectively. To assess the transduction efficiency of rAAV-Luc coated DBW in vivo, we first performed a dose response with allografts containing 10(7), 10(9) or 10(10) particles that were surgically implanted into the quadriceps of mice, and assayed by in vivo bioluminescence imaging (BLI) on days 1, 3, 5, 7, 10, 14, and 21. The results demonstrated a dose response in which the DBW coated with 10(10) rAAV-Luc particles achieved peak gene expression levels on day 3, which persisted until day 21, and was significantly greater than the 10(7) dose throughout this time period (pcoated with 10(10) rAAV-Luc particles failed to demonstrate any significant differences in transduction kinetics or efficiency in vivo. Thus, surface demineralization of human cortical bone allograft increases its absorbance for uniform rAAV coating, without affecting vector transduction efficiency.

The Generation of Turnip Crinkle Virus-Like Particles in Plants by the Transient Expression of Wild-Type and Modified Forms of Its Coat Protein.

Science.gov (United States)

Saunders, Keith; Lomonossoff, George P

2015-01-01

Turnip crinkle virus (TCV), a member of the genus carmovirus of the Tombusviridae family, has a genome consisting of a single positive-sense RNA molecule that is encapsidated in an icosahedral particle composed of 180 copies of a single type of coat protein. We have employed the CPMV-HT transient expression system to investigate the formation of TCV-like particles following the expression of the wild-type coat protein or modified forms of it that contain either deletions and/or additions. Transient expression of the coat protein in plants results in the formation of capsid structures that morphologically resemble TCV virions (T = 3 structure) but encapsidate heterogeneous cellular RNAs, rather than the specific TCV coat protein messenger RNA. Expression of an amino-terminal deleted form of the coat protein resulted in the formation of smaller T = 1 structures that are free of RNA. The possibility of utilizing TCV as a carrier for the presentation of foreign proteins on the particle surface was also explored by fusing the sequence of GFP to the C-terminus of the coat protein. The expression of coat protein-GFP hybrids permitted the formation of VLPs but the yield of particles is diminished compared to the yield obtained with unmodified coat protein. Our results confirm the importance of the N-terminus of the coat protein for the encapsidation of RNA and show that the coat protein's exterior P domain plays a key role in particle formation.

Induced mutation for disease resistance in legumes

International Nuclear Information System (INIS)

Bravo, A.

1984-01-01

Mutation breeding has been used for developing genotypes that may contain resistance to: a) A necrotic strain of common mosaic virus, in common bean (Phaseolus vulgaris L.); b) Soil fungi causing root rots in chickpea (Cicer arietinum L.); c) The fungus Uromyces fabae that causes rust in lentil plants (Lens culinaria). Seeds of these three species were treated with gamma rays in doses of 1,000, 3,000, 6,000, and 9,000 rads. Treated materials and controls were grown during 1979. Chickpea M2 plants were grown in a naturally infested soil with soil-borne fungi. Lentil plants were sprayed with a suspension of spores of the rust fungus. Common bean M2 plants were sprayed with a solution containing virus particles. Ninety-three symptomless chickpea plants were identified in the M2 population. For lentil there were 47 symptomless plants and for common bean, 244 M2 plants with minor virus damage. Eight M3 progenies of chickpea, originated from symptomless M2 plants, had a high rate of survival and showed none or very little damage by root rots. In addition, some morphological changes were detected in other M3 chickpea progenies. Two progenies had larger leaflets, as compared to the control plants and those of other progenies. One progeny showed a more erect growth habit. These new traits have been attributed to genetic changes induced by the radiation treatments. By contrast to these promising results with chickpea no progress has been detected in the plant populations of common bean and lentil. (author)

Genetic diversity and molecular evolution of Ornithogalum mosaic virus based on the coat protein gene sequence

Directory of Open Access Journals (Sweden)

Fangluan Gao

2018-03-01

Full Text Available Ornithogalum mosaic virus (OrMV has a wide host range and affects the production of a variety of ornamentals. In this study, the coat protein (CP gene of OrMVwas used to investigate the molecular mechanisms underlying the evolution of this virus. The 36 OrMV isolates fell into two groups which have significant subpopulation differentiation with an FST value of 0.470. One isolate was identified as a recombinant and the other 35 recombination-free isolates could be divided into two major clades under different evolutionary constraints with dN/dS values of 0.055 and 0.028, respectively, indicating a role of purifying selection in the differentiation of OrMV. In addition, the results from analysis of molecular variance (AMOVA indicated that the effect of host species on the genetic divergence of OrMV is greater than that of geography. Furthermore, OrMV isolates from the genera Ornithogalum, Lachenalia and Diuri tended to group together, indicating that OrMV diversification was maintained, in part, by host-driven adaptation.

Nucleotide sequence of the coat protein gene of the Skierniewice isolate of plum pox virus (PPV)

International Nuclear Information System (INIS)

Wypijewski, K.; Musial, W.; Augustyniak, J.; Malinowski, T.

1994-01-01

The coat protein (CP) gene of the Skierniewice isolate of plum pox virus (PPV-S) has been amplified using the reverse transcription - polymerase chain reaction (RT-PCR), cloned and sequenced. The nucleotide sequence of the gene and the deduced amino-acid sequences of PPV-S CP were compared with those of other PPV strains. The nucleotide sequence showed very high homology to most of the published sequences. The motif: Asp-Ala-Gly (DAG), important for the aphid transmissibility, was present in the amino-acid sequence. Our isolate did not react in ELISA with monoclonal antibodies MAb06 supposed to be specific for PPV-D. (author). 32 refs, 1 fig., 2 tabs

Virus-membrane interactions : spectroscopic studies

NARCIS (Netherlands)

Datema, K.P.

1987-01-01

In this thesis some new aspects of the infection process of nonenveloped viruses are reported. The interaction of a rod-shaped (TMV) and three spherical (CCMV, BMV, SBMV) plant viruses, of the filamentous bacteriophage M13, and of their coat proteins with membranes have been investigated. A

Field and laboratory investigations of inactivation of viruses (PRD1 and MS2) attached to iron oxide-coated quartz san

Science.gov (United States)

Ryan, Joseph N.; Harvey, Ronald W.; Metge, David W.; Elimelech, Menachem; Navigato, Theresa; Pieper, Ann P.

2002-01-01

Field and laboratory experiments were conducted to investigate inactivation of viruses attached to mineral surfaces. In a natural gradient transport field experiment, bacteriophage PRD1, radiolabeled with 32P, was injected into a ferric oxyhydroxide-coated sand aquifer with bromide and linear alkylbenzene sulfonates. In a zone of the aquifer contaminated by secondary sewage infiltration, small fractions of infective and 32P-labeled PRD1 broke through with the bromide tracer, followed by the slow release of 84% of the 32P activity and only 0.011% of the infective PRD1. In the laboratory experiments, the inactivation of PRD1, labeled with 35S (protein capsid), and MS2, dual radiolabeled with 35S (protein capsid) and 32P (nucleic acid), was monitored in the presence of groundwater and sediment from the contaminated zone of the field site. Release of infective viruses decreased at a much faster rate than release of the radiolabels, indicating that attached viruses were undergoing surface inactivation. Disparities between 32P and35S release suggest that the inactivated viruses were released in a disintegrated state. Comparison of estimated solution and surface inactivation rates indicates solution inactivation is ∼3 times as fast as surface inactivation. The actual rate of surface inactivation may be substantially underestimated owing to slow release of inactivated viruses.

In vitro evidence for RNA binding properties of the coat protein of prunus necrotic ringspot ilarvirus and their comparison to related and unrelated viruses.

Science.gov (United States)

Pallás, V; Sánchez-Navarro, J A; Díez, J

1999-01-01

The RNA binding properties of the prunus necrotic ringspot virus (PNRSV) coat protein (CP) were demonstrated by northwestern and dot-blot analyses. The capability to bind PNRSV RNA 4 was compared with viruses representing three different interactions prevailing in the assembly and architecture of virions. The results showed that cucumber mosaic virus (CMV) and PNRSV CPs, which stabilise their virions mainly through RNA-protein interactions bound PNRSV RNA 4 even at very high salt concentrations. The CP of cherry leaf roll nepovirus, whose virions are predominantly stabilised by protein-protein interactions did not bind even at the lowest salt concentration tested. Finally the CP of carnation mottle carmovirus, that has an intermediate position in which both RNA-protein and protein-protein interactions are equally important showed a salt-dependent RNA binding.

Fungal transmission of plant viruses.

Science.gov (United States)

Campbell, R N

1996-01-01

Thirty soilborne viruses or virus-like agents are transmitted by five species of fungal vectors. Ten polyhedral viruses, of which nine are in the family Tombusviridae, are acquired in the in vitro manner and do not occur within the resting spores of their vectors, Olpidium brassicae and O. bornovanus. Fungal vectors for other viruses in the family should be sought even though tombusviruses are reputed to be soil transmitted without a vector. Eighteen rod-shaped viruses belonging to the furo- and bymovirus groups and to an unclassified group are acquired in the in vivo manner and survive within the resting spores of their vector, O. brassicae, Polymyxa graminis, P. betae, and Spongospora subterranea. The viral coat protein has an essential role in in vitro transmission. With in vivo transmission a site in the coat protein-read through protein (CP-RT) of beet necrotic yellow vein furovirus determines vector transmissibility as does a site in a similar 98-kDa polyprotein of barley mild mosaic bymovirus. The mechanisms by which virions move (or are moved) into and out of the protoplasm of zoospores or of thalli needs study.

Characterization of cowpea chlorotic mottle virus and its assembly

NARCIS (Netherlands)

Verduin, B.J.M.

1978-01-01

This thesis decribes the conditions for isolation of cowpea chlorotic mottle virus (CCMV), its ribonucleic acid (RNA) and the coat protein, the characterization of the virus and its constituents (chapter 3, 4 and 5) and the dissociation and assembly behaviour of the virus (chapter 6 and

Prevalence of Tobacco mosaic virus in Iran and Evolutionary Analyses of the Coat Protein Gene

Directory of Open Access Journals (Sweden)

Athar Alishiri

2013-09-01

Full Text Available The incidence and distribution of Tobacco mosaic virus (TMV and related tobamoviruses was determined using an enzyme-linked immunosorbent assay on 1,926 symptomatic horticultural crops and 107 asymptomatic weed samples collected from 78 highly infected fields in the major horticultural crop-producing areas in 17 provinces throughout Iran. The results were confirmed by host range studies and reverse transcription-polymerase chain reaction. The overall incidence of infection by these viruses in symptomatic plants was 11.3%. The coat protein (CP gene sequences of a number of isolates were determined and disclosed to be a high identity (up to 100% among the Iranian isolates. Phylogenetic analysis of all known TMV CP genes showed three clades on the basis of nucleotide sequences with all Iranian isolates distinctly clustered in clade II. Analysis using the complete CP amino acid sequence showed one clade with two subgroups, IA and IB, with Iranian isolates in both subgroups. The nucleotide diversity within each sub-group was very low, but higher between the two clades. No correlation was found between genetic distance and geographical origin or host species of isolation. Statistical analyses suggested a negative selection and demonstrated the occurrence of gene flow from the isolates in other clades to the Iranian population.

Localization of the N-terminal domain of cauliflower mosaic virus coat protein precursor

International Nuclear Information System (INIS)

Champagne, Julie; Benhamou, Nicole; Leclerc, Denis

2004-01-01

Cauliflower mosaic virus (CaMV) open reading frame (ORF) IV encodes a coat protein precursor (pre-CP) harboring an N-terminal extension that is cleaved off by the CaMV-encoded protease. In transfected cells, pre-CP is present in the cytoplasm, while the processed form (p44) of CP is targeted to the nucleus, suggesting that the N-terminal extension might be involved in keeping the pre-CP in the cytoplasm for viral assembly. This study reports for the first time the intracellular localization of the N-terminal extension during CaMV infection in Brassica rapa. Immunogold-labeling electron microscopy using polyclonal antibodies directed to the N-terminal extension of the pre-CP revealed that this region is closely associated with viral particles present in small aggregates, which we called small bodies, adjacent to the main inclusion bodies typical of CaMV infection. Based on these results, we propose a model for viral assembly of CaMV

Correlation between particle multiplicity and location on virion RNA of the assembly initiation site for viruses of the tobacco mosaic virus group.

Science.gov (United States)

Fukuda, M; Meshi, T; Okada, Y; Otsuki, Y; Takebe, I

1981-07-01

The initiation site for reconstitution on genome RNA was determined by electron microscopic serology for a watermelon strain of cucumber green mottle mosaic virus (CGMMV-W), which is chemically and serologically related to tobacco mosaic virus (TMV). The initiation site was located at the same position as that of the cowpea strain, a virus that produces short rods of encapsidated subgenomic messenger RNA for the coat protein (a two-component TMV), being about 320 nucleotides away from the 3' terminus, and hence within the coat protein cistron. Although CGMMV-W was until now believed to be a single-component TMV, the location of the initiation site indicated the presence of short rods containing coat protein messenger RNA in CGMMV-W-infected tissue, as in the case for the cowpea strain. We found such short rods in CGMMV-W-infected tissue. The results confirmed our previous hypothesis that the site of the initiation region for reconstitution determines the rod multiplicity of TMV. The finding of the second two-component TMV, CGMMV, indicates that the cowpea strain of TMV is not unique in being a two-component virus and that the location of the assembly initiation site on the genome RNA can be a criterion for grouping of viruses.

Occurrence of Cucumber mosaic virus on vanilla

Indian Academy of Sciences (India)

Cucumber mosaic virus (CMV) causing mosaic, leaf distortion and stunting of vanilla (Vanilla planifolia Andrews) in India was characterized on the basis of biological and coat protein (CP) nucleotide sequence properties. In mechanical inoculation tests, the virus was found to infect members of Chenopodiaceae, ...

Genetic transformation of sweet orange with the coat protein gene of Citrus psorosis virus and evaluation of resistance against the virus.

Science.gov (United States)

Zanek, María Cecilia; Reyes, Carina Andrea; Cervera, Magdalena; Peña, Eduardo José; Velázquez, Karelia; Costa, Norma; Plata, Maria Inés; Grau, Oscar; Peña, Leandro; García, María Laura

2008-01-01

Citrus psorosis is a serious viral disease affecting citrus trees in many countries. Its causal agent is Citrus psorosis virus (CPsV), the type member of genus Ophiovirus. CPsV infects most important citrus varieties, including oranges, mandarins and grapefruits, as well as hybrids and citrus relatives used as rootstocks. Certification programs have not been sufficient to control the disease and no sources of natural resistance have been found. Pathogen-derived resistance (PDR) can provide an efficient alternative to control viral diseases in their hosts. For this purpose, we have produced 21 independent lines of sweet orange expressing the coat protein gene of CPsV and five of them were challenged with the homologous CPV 4 isolate. Two different viral loads were evaluated to challenge the transgenic plants, but so far, no resistance or tolerance has been found in any line after 1 year of observations. In contrast, after inoculation all lines showed characteristic symptoms of psorosis in the greenhouse. The transgenic lines expressed low and variable amounts of the cp gene and no correlation was found between copy number and transgene expression. One line contained three copies of the cp gene, expressed low amounts of the mRNA and no coat protein. The ORF was cytosine methylated suggesting a PTGS mechanism, although the transformant failed to protect against the viral load used. Possible causes for the failed protection against the CPsV are discussed.

Multiple loci condition seed transmission of soybean mosaic virus (SMV) and SMV-induced seed coat mottling in soybean.

Science.gov (United States)

Domier, Leslie L; Hobbs, Houston A; McCoppin, Nancy K; Bowen, Charles R; Steinlage, Todd A; Chang, Sungyul; Wang, Yi; Hartman, Glen L

2011-06-01

Infection of soybean plants with Soybean mosaic virus (SMV), which is transmitted by aphids and through seed, can cause significant reductions in seed production and quality. Because seedborne infections are the primary sources of inoculum for SMV infections in North America, host-plant resistance to seed transmission can limit the pool of plants that can serve as sources of inoculum. To examine the inheritance of SMV seed transmission in soybean, crosses were made between plant introductions (PIs) with high (PI88799), moderate (PI60279), and low (PI548391) rates of transmission of SMV through seed. In four F(2) populations, SMV seed transmission segregated as if conditioned by two or more genes. Consequently, a recombinant inbred line population was derived from a cross between PIs 88799 and 548391 and evaluated for segregation of SMV seed transmission, seed coat mottling, and simple sequence repeat markers. Chromosomal regions on linkage groups C1 and C2 were significantly associated with both transmission of isolate SMV 413 through seed and SMV-induced seed coat mottling, and explained ≈42.8 and 46.4% of the variability in these two traits, respectively. Chromosomal regions associated with seed transmission and seed coat mottling contained homologues of Arabidopsis genes DCL3 and RDR6, which encode enzymes involved in RNA-mediated transcriptional and posttranscriptional gene silencing.

Genetic variation of coat protein gene among the isolates of Rice tungro spherical virus from tungro-endemic states of the India.

Science.gov (United States)

Mangrauthia, Satendra K; Malathi, P; Agarwal, Surekha; Ramkumar, G; Krishnaveni, D; Neeraja, C N; Madhav, M Sheshu; Ladhalakshmi, D; Balachandran, S M; Viraktamath, B C

2012-06-01

Rice tungro disease, one of the major constraints to rice production in South and Southeast Asia, is caused by a combination of two viruses: Rice tungro spherical virus (RTSV) and Rice tungro bacilliform virus (RTBV). The present study was undertaken to determine the genetic variation of RTSV population present in tungro endemic states of Indian subcontinent. Phylogenetic analysis based on coat protein sequences showed distinct divergence of Indian RTSV isolates into two groups; one consisted isolates from Hyderabad (Andhra Pradesh), Cuttack (Orissa), and Puducherry and another from West Bengal, Coimbatore (Tamil Nadu), and Kanyakumari (Tamil Nadu). The results obtained from phylogenetic study were further supported with the SNPs (single nucleotide polymorphism), INDELs (insertion and deletion) and evolutionary distance analysis. In addition, sequence difference count matrix revealed 2-68 nucleotides differences among all the Indian RTSV isolates taken in this study. However, at the protein level these differences were not significant as revealed by Ka/Ks ratio calculation. Sequence identity at nucleotide and amino acid level was 92-100% and 97-100%, respectively, among Indian isolates of RTSV. Understanding of the population structure of RTSV from tungro endemic regions of India would potentially provide insights into the molecular diversification of this virus.

Minor Coat and Heat Shock Proteins Are Involved in the Binding of Citrus Tristeza Virus to the Foregut of Its Aphid Vector, Toxoptera citricida.

Science.gov (United States)

Killiny, N; Harper, S J; Alfaress, S; El Mohtar, C; Dawson, W O

2016-11-01

Vector transmission is a critical stage in the viral life cycle, yet for most plant viruses how they interact with their vector is unknown or is explained by analogy with previously described relatives. Here we examined the mechanism underlying the transmission of citrus tristeza virus (CTV) by its aphid vector, Toxoptera citricida, with the objective of identifying what virus-encoded proteins it uses to interact with the vector. Using fluorescently labeled virions, we demonstrated that CTV binds specifically to the lining of the cibarium of the aphid. Through in vitro competitive binding assays between fluorescent virions and free viral proteins, we determined that the minor coat protein is involved in vector interaction. We also found that the presence of two heat shock-like proteins, p61 and p65, reduces virion binding in vitro Additionally, treating the dissected mouthparts with proteases did not affect the binding of CTV virions. In contrast, chitinase treatment reduced CTV binding to the foregut. Finally, competition with glucose, N-acetyl-β-d-glucosamine, chitobiose, and chitotriose reduced the binding. These findings together suggest that CTV binds to the sugar moieties of the cuticular surface of the aphid cibarium, and the binding involves the concerted activity of three virus-encoded proteins. Limited information is known about the specific interactions between citrus tristeza virus and its aphid vectors. These interactions are important for the process of successful transmission. In this study, we localized the CTV retention site as the cibarium of the aphid foregut. Moreover, we demonstrated that the nature of these interactions is protein-carbohydrate binding. The viral proteins, including the minor coat protein and two heat shock proteins, bind to sugar moieties on the surface of the foregut. These findings will help in understanding the transmission mechanism of CTV by the aphid vector and may help in developing control strategies which interfere

Molecular adaptation within the coat protein-encoding gene of Tunisian almond isolates of Prunus necrotic ringspot virus.

Science.gov (United States)

Boulila, Moncef; Ben Tiba, Sawssen; Jilani, Saoussen

2013-04-01

The sequence alignments of five Tunisian isolates of Prunus necrotic ringspot virus (PNRSV) were searched for evidence of recombination and diversifying selection. Since failing to account for recombination can elevate the false positive error rate in positive selection inference, a genetic algorithm (GARD) was used first and led to the detection of potential recombination events in the coat protein-encoding gene of that virus. The Recco algorithm confirmed these results by identifying, additionally, the potential recombinants. For neutrality testing and evaluation of nucleotide polymorphism in PNRSV CP gene, Tajima's D, and Fu and Li's D and F statistical tests were used. About selection inference, eight algorithms (SLAC, FEL, IFEL, REL, FUBAR, MEME, PARRIS, and GA branch) incorporated in HyPhy package were utilized to assess the selection pressure exerted on the expression of PNRSV capsid. Inferred phylogenies pointed out, in addition to the three classical groups (PE-5, PV-32, and PV-96), the delineation of a fourth cluster having the new proposed designation SW6, and a fifth clade comprising four Tunisian PNRSV isolates which underwent recombination and selective pressure and to which the name Tunisian outgroup was allocated.

Cultivated grapevines represent a symptomless reservoir for the transmission of hop stunt viroid to hop crops: 15 years of evolutionary analysis.

Directory of Open Access Journals (Sweden)

Yoko Kawaguchi-Ito

Full Text Available Hop stunt was a mysterious disorder that first emerged in the 1940s in commercial hops in Japan. To investigate the origin of this disorder, we infected hops with natural Hop stunt viroid (HpSVd isolates derived from four host species (hop, grapevine, plum and citrus, which except for hop represent possible sources of the ancestral viroid. These plants were maintained for 15 years, then analyzed the HpSVd variants present. Here we show that the variant originally found in cultivated grapevines gave rise to various combinations of mutations at positions 25, 26, 54, 193, and 281. However, upon prolonged infection, these variants underwent convergent evolution resulting in a limited number of adapted mutants. Some of them showed nucleotide sequences identical to those currently responsible for hop stunt epidemics in commercial hops in Japan, China, and the United States. Therefore, these results indicate that we have successfully reproduced the original process by which a natural HpSVd variant naturally introduced into cultivated hops was able to mutate into the HpSVd variants that are currently present in commercial hops. Furthermore, and importantly, we have identified cultivated grapevines as a symptomless reservoir in which HSVd can evolve and be transmitted to hop crops to cause epidemics.

Development of transgenic papayas expressing the coat protein gene from a Brazilian isolate of Papaya ringspot virus (PRSV) = Desenvolvimento de mamoeiros transgênicos resistentes a vírus expressando o gene da capa protéica de um isolado brasileiro de Papaya ringspot virus

NARCIS (Netherlands)

Souza, M.T.; Níckel, O.; Gonsalves, D.

2005-01-01

Translatable and nontranslatable versions of the coat protein (cp) gene of a Papaya ringspot virus (PRSV) isolate collected in the state of Bahia, Brazil, were engineered for expression in Sunrise and Sunset Solo varieties of papaya (Carica papaya). The biolistic system was used to transform

Stability and infectivity of novel pandemic influenza A (H1N1) virus in blood-derived matrices under different storage conditions.

Science.gov (United States)

Wang, Xue; Zoueva, Olga; Zhao, Jiangqin; Ye, Zhiping; Hewlett, Indira

2011-12-22

Influenza A virus has been detected in the blood of some infected individuals, and may pose a safety concern for collection, handling and transport of specimens for epidemiological and public health investigations if infectious virus is present in samples. Furthermore the effect of storage on virus stability and infectivity has not been well studied. We examined the stability of novel pandemic influenza A (H1N1) virus RNA when the virus was stored in phosphate buffered saline (PBS), plasma, or buffy coated blood at either room temperature or 4°C using a sensitive Taqman RT-PCR assay. We also investigated virus infectivity using the EID(50) assay when virus was stored in PBS, plasma, or buffy coats isolated from blood at 4°C. Viral RNA stability was affected by the matrix used for storage. The recovery of viral RNA was highest when virus was stored in PBS with lower amounts being recovered from plasma and buffy coats at either room temperature or 4°C. Incubation time did not appear to be a major factor for viral RNA stability, although there was gradual decline after longer periods post-incubation. Both sample matrix and incubation time affected virus infectivity. The decay in virus infectivity was greatest in PBS followed by buffy coats and plasma. Virus infectivity was abolished in buffy coats at day 20 post-incubation when virus concentrations were low. These data indicate that encapsidated viral RNA was stable overall in all three liquid matrices at room temperature or 4°C although it was most stable in PBS; virus infectivity in buffy coats at 4°C decayed in a time dependent manner while it remained unchanged in plasma. These findings have implications for storage, handling and transport of blood derived samples from influenza patients for epidemiological and laboratory investigations. It should be noted that there is little known about influenza viremia, and whether influenza viruses can be transmitted by blood or blood derived samples.

Stability and infectivity of novel pandemic influenza A (H1N1 virus in blood-derived matrices under different storage conditions

Directory of Open Access Journals (Sweden)

Wang Xue

2011-12-01

Full Text Available Abstract Background Influenza A virus has been detected in the blood of some infected individuals, and may pose a safety concern for collection, handling and transport of specimens for epidemiological and public health investigations if infectious virus is present in samples. Furthermore the effect of storage on virus stability and infectivity has not been well studied. Methods We examined the stability of novel pandemic influenza A (H1N1 virus RNA when the virus was stored in phosphate buffered saline (PBS, plasma, or buffy coated blood at either room temperature or 4°C using a sensitive Taqman RT-PCR assay. We also investigated virus infectivity using the EID50 assay when virus was stored in PBS, plasma, or buffy coats isolated from blood at 4°C. Results Viral RNA stability was affected by the matrix used for storage. The recovery of viral RNA was highest when virus was stored in PBS with lower amounts being recovered from plasma and buffy coats at either room temperature or 4°C. Incubation time did not appear to be a major factor for viral RNA stability, although there was gradual decline after longer periods post-incubation. Both sample matrix and incubation time affected virus infectivity. The decay in virus infectivity was greatest in PBS followed by buffy coats and plasma. Virus infectivity was abolished in buffy coats at day 20 post-incubation when virus concentrations were low. Conclusion These data indicate that encapsidated viral RNA was stable overall in all three liquid matrices at room temperature or 4°C although it was most stable in PBS; virus infectivity in buffy coats at 4°C decayed in a time dependent manner while it remained unchanged in plasma. These findings have implications for storage, handling and transport of blood derived samples from influenza patients for epidemiological and laboratory investigations. It should be noted that there is little known about influenza viremia, and whether influenza viruses can be

Synthesis and magnetic property of T4 virus-supported gold-coated iron ternary nanocomposite

Energy Technology Data Exchange (ETDEWEB)

Xu Ziming; Sun Hongjing; Gao Faming, E-mail: fmgao@ysu.edu.cn; Hou Li; Li Na [Yanshan University, Key Laboratory of Applied Chemistry (China)

2012-12-15

Herein, we present a novel method based on the use of the symmetrical T4 bacteriophage capsid as a scaffold for preparing the gold-coated iron ternary core/shell nanostructure. Results showed that the thick gold shell was obtained to effectively protect Fe core from oxidation. Magnetic measurements showed that the nanocomposites were superparamagnetic at room temperature with a blocking temperature of about 35 K. At 3 K, its coercivity of 1142.86 Oe was larger than the existing experimental values. The magnetic property of Au/T4 was also tested, demonstrating the source of the magnetic sample arising from the Fe core only. The absorption spectrum of the Fe-Au/T4 complex was measured and compared with gold/virus. Different thickness gold shells were controlled in the synthesis by tuning the Au salt addition. On the basis of results and discussion, we further speculated the general growing mechanism of the template-supported Fe-Au process.

Synthesis and magnetic property of T4 virus-supported gold-coated iron ternary nanocomposite

Science.gov (United States)

Xu, Ziming; Sun, Hongjing; Gao, Faming; Hou, Li; Li, Na

2012-12-01

Herein, we present a novel method based on the use of the symmetrical T4 bacteriophage capsid as a scaffold for preparing the gold-coated iron ternary core/shell nanostructure. Results showed that the thick gold shell was obtained to effectively protect Fe core from oxidation. Magnetic measurements showed that the nanocomposites were superparamagnetic at room temperature with a blocking temperature of about 35 K. At 3 K, its coercivity of 1142.86 Oe was larger than the existing experimental values. The magnetic property of Au/T4 was also tested, demonstrating the source of the magnetic sample arising from the Fe core only. The absorption spectrum of the Fe@Au/T4 complex was measured and compared with gold/virus. Different thickness gold shells were controlled in the synthesis by tuning the Au salt addition. On the basis of results and discussion, we further speculated the general growing mechanism of the template-supported Fe@Au process.

Induction of resistance to rice tungro virus disease in rice cultivar Pusa 2-21 through irradiation

International Nuclear Information System (INIS)

Mathur, S.C.; Rao, M.; Prakash, Jitendra

1979-01-01

The dry seeds of Pusa 2-21, a moderately resistant rice cultivar, were subjected to 10, 15 and 20 Krad (dose rate 12.3 Krad/min) radiation dosages of gamma rays to induce resistance against rice tungro virus disease. The height of M 1 seedling was significantly reduced in 15 and 20 Krad treatments. However, there was no effect of gamma irradiation on seed germination. A limited population of M 2 and M 3 generation was screened at the rate of 3 viruliferous leafhoppers/seedling using single plant caging technique. In M 2 generation 22.0, 17.6 and 25.0 percent seedlings exhibited green colour (symptomless) representing resistant reaction to the disease in 10, 15 and 20 Krad treatments, respectively. Out of 1470 seedlings in M 3 generation, 2.7 percent seedlings showing no symptoms of tungro could be isolated indicating the possibility of inducing higher degree of resistance than that of the parent to RTV through irradiation for the first time. (auth.)

Detection of sweet potato virus C, sweet potato virus 2 and sweet potato feathery mottle virus in Portugal.

Science.gov (United States)

Varanda, Carla M R; Santos, Susana J; Oliveira, Mônica D M; Clara, Maria Ivone E; Félix, Maria Rosário F

2015-06-01

Field sweet potato plants showing virus-like symptoms, as stunting, leaf distortion, mosaic and chlorosis, were collected in southwest Portugal and tested for the presence of four potyviruses, sweet potato virus C (SPVC), sweet potato virus 2 (SPV2), sweet potato feathery mottle virus (SPFMV), sweet potato virus G (SPVG), and the crinivirus sweet potato chlorotic stunt virus (SPCSV). DsRNA fractions were extracted from symptomatic leaves and used as templates in single and multiplex RT-PCR assays using previously described specific primers for each analyzed virus. The amplified reaction products for SPVC, SPV2 and SPFMV were of expected size, and direct sequencing of PCR products revealed that they correspond to the coat protein gene (CP) and showed 98%, 99% and 99% identity, respectively, to those viruses. Comparison of the CP genomic and amino acid sequences of the Portuguese viral isolates recovered here with those of ten other sequences of isolates obtained in different countries retrieved from the GenBank showed very few differences. The application of the RT-PCR assays revealed for the first time the presence of SPVC and SPFMV in the sweet potato crop in Portugal, the absence of SPVG and SPCSV in tested plants, as well as the occurrence of triple virus infections under field conditions.

Coat protein sequence shows that Cucumber mosaic virus isolate

Indian Academy of Sciences (India)

A viral disease was identified on geraniums (Pelargonium spp.) grown in a greenhouse at the Institute of Himalayan Bioresource Technology (IHBT), Palampur, exhibiting mild mottling and stunting. The causal virus (Cucumber mosaic virus, CMV) was identified and characterized on the basis of host range, aphid ...

In vitro and in vivo mapping of the Prunus necrotic ringspot virus coat protein C-terminal dimerization domain by bimolecular fluorescence complementation.

Science.gov (United States)

Aparicio, Frederic; Sánchez-Navarro, Jesús A; Pallás, Vicente

2006-06-01

Interactions between viral proteins are critical for virus viability. Bimolecular fluorescent complementation (BiFC) technique determines protein interactions in real-time under almost normal physiological conditions. The coat protein (CP) of Prunus necrotic ringspot virus is required for multiple functions in its replication cycle. In this study, the region involved in CP dimerization has been mapped by BiFC in both bacteria and plant tissue. Full-length and C-terminal deleted forms of the CP gene were fused in-frame to the N- and C-terminal fragments of the yellow fluorescent protein. The BiFC analysis showed that a domain located between residues 9 and 27 from the C-end plays a critical role in dimerization. The importance of this C-terminal region in dimer formation and the applicability of the BiFC technique to analyse viral protein interactions are discussed.

Au nanocrystals grown on a better-defined one-dimensional tobacco mosaic virus coated protein template genetically modified by a hexahistidine tag

International Nuclear Information System (INIS)

Liu Nan; Zhang Wei; Luo Zhaopeng; Zhai Niu; Zhang Hongfei; Li Zhonghao; Jiang Xingyi; Tang Gangling; Hu Qingyuan; Wang Chong; Tian Dandan

2012-01-01

In this paper, tobacco mosaic virus (TMV) coated protein (CP) was genetically modified by introducing a hexahistidine tag into it for a well-defined one-dimensional template, on which Au nanocrystals (NCs) were grown. The results showed that genetic modification could not only ameliorate the one-dimensional structure of the template, but also improve the growth density of Au NCs on the template. This indicated that genetic modification could be an effective method to modulate the structure of the TMVCP template-based nanocomposites allowing for a broader application of them. (paper)

Ultramicroscopic observation of recombinant adenoassociated virus ...

African Journals Online (AJOL)

Ultramicroscopic observation of recombinant adenoassociated virus type 2 on the surface of formvarcarbon coated copper grids under different relative humidity and incubation time using negative stain transmission electron microscopy.

Solanum americanum: reservoir for Potato virus Y and Cucumber mosaic virus in sweet pepper crops

Directory of Open Access Journals (Sweden)

Monika Fecury Moura

2014-03-01

Full Text Available Weeds can act as important reservoirs for viruses. Solanum americanum (Black nightshade is a common weed in Brazil and samples showing mosaic were collected from sweet pepper crops to verify the presence of viruses. One sample showed mixed infection between Cucumber mosaic virus (CMV and Potato virus Y (PVY and one sample showed simple infection by PVY. Both virus species were transmitted by plant extract and caused mosaic in tomato (Solanum lycopersicum cv. Santa Clara, sweet pepper (Capsicum annuum cv. Magda, Nicotiana benthamiana and N. tabaccum TNN, and local lesions on Chenopodium quinoa, C. murale and C. amaranticolor. The coat protein sequences for CMV and PVY found in S. americanum are phylogenetically more related to isolates from tomato. We conclude that S. americanum can act as a reservoir for different viruses during and between sweet pepper crop seasons.

Identification of Cherry green ring mottle virus on Sweet Cherry Trees in Korea

Directory of Open Access Journals (Sweden)

In-Sook Cho

2013-12-01

Full Text Available During the 2012 growing season, 154 leaf samples were collected from sweet cherry trees in Hwaseong, Pyeongtaek, Gyeongju, Kimcheon, Daegu, Yeongju and Eumseong and tested for the presence of Cherry green ring mottle virus (CGRMV. PCR products of the expected size (807 bp were obtained from 6 samples. The PCR products were cloned and sequenced. The nucleotide sequences of the clones showed over 88% identities to published coat protein sequences of CGRMV isolates in the GenBank database. The sequences of CGRMV isolates, CGR-KO 1−6 shared 98.8 to 99.8% nucleotide and 99.6 to 100% amino acid similarities. Phylogenetic analysis indicated that the Korean CGRMV isolates belong to the group II of CGRMV coat protein genes. The CGRMV infected sweet cherry trees were also tested for Apple chlorotic leaf spot virus (ACLSV, Apple mosaic virus (ApMV, Cherry necrotic rusty mottle virus (CNRMV, Cherry mottle leaf virus (CMLV, Cherry rasp leaf virus (CRLV, Cherry leafroll virus (CLRV, Cherry virus A (CVA, Little cherry virus 1 (LChV1, Prune dwarf virus (PDV and Prunus necrotic ringspot virus (PNRSV by RT-PCR. All of the tested trees were also infected with ACLSV.

Transgenic Sugarcane Resistant to Sorghum mosaic virus Based on Coat Protein Gene Silencing by RNA Interference

Directory of Open Access Journals (Sweden)

Jinlong Guo

2015-01-01

Full Text Available As one of the critical diseases of sugarcane, sugarcane mosaic disease can lead to serious decline in stalk yield and sucrose content. It is mainly caused by Potyvirus sugarcane mosaic virus (SCMV and/or Sorghum mosaic virus (SrMV, with additional differences in viral strains. RNA interference (RNAi is a novel strategy for producing viral resistant plants. In this study, based on multiple sequence alignment conducted on genomic sequences of different strains and isolates of SrMV, the conserved region of coat protein (CP genes was selected as the target gene and the interference sequence with size of 423 bp in length was obtained through PCR amplification. The RNAi vector pGII00-HACP with an expression cassette containing both hairpin interference sequence and cp4-epsps herbicide-tolerant gene was transferred to sugarcane cultivar ROC22 via Agrobacterium-mediated transformation. After herbicide screening, PCR molecular identification, and artificial inoculation challenge, anti-SrMV positive transgenic lines were successfully obtained. SrMV resistance rate of the transgenic lines with the interference sequence was 87.5% based on SrMV challenge by artificial inoculation. The genetically modified SrMV-resistant lines of cultivar ROC22 provide resistant germplasm for breeding lines and can also serve as resistant lines having the same genetic background for study of resistance mechanisms.

Incidence of Lettuce mosaic virus in lettuce and its detection by polyclonal antibodies produced against recombinant coat protein expressed in Escherichia coli.

Science.gov (United States)

Sharma, Prachi; Sharma, Susheel; Singh, Jasvir; Saha, Swati; Baranwal, V K

2016-04-01

Lettuce mosaic virus (LMV), a member of the genus Potyvirus of family Potyviridae, causes mosaic disease in lettuce has recently been identified in India. The virus is seed borne and secondary infection occurs through aphids. To ensure virus freedom in seeds it is important to develop diagnostic tools, for serological methods the production of polyclonal antibodies is a prerequisite. The coat protein (CP) gene of LMV was amplified, cloned and expressed using pET-28a vector in Escherichia coli BL21DE3 competent cells. The LMV CP was expressed as a fusion protein containing a fragment of the E. coli His tag. The LMV CP/His protein reacted positively with a commercial antiserum against LMV in an immunoblot assay. Polyclonal antibodies purified from serum of rabbits immunized with the fusion protein gave positive results when LMV infected lettuce (Lactuca sativa) was tested at 1:1000 dilution in PTA-ELISA. These were used for specific detection of LMV in screening lettuce accessions. The efficacy of the raised polyclonal antiserum was high and it can be utilized in quarantine and clean seed production. Copyright © 2016 Elsevier B.V. All rights reserved.

Analysis of the epitope structure of Plum pox virus coat protein.

Science.gov (United States)

Candresse, Thierry; Saenz, Pilar; García, Juan Antonio; Boscia, Donato; Navratil, Milan; Gorris, Maria Teresa; Cambra, Mariano

2011-05-01

Typing of the particular Plum pox virus (PPV) strain responsible in an outbreak has important practical implications and is frequently performed using strain-specific monoclonal antibodies (MAbs). Analysis in Western blots of the reactivity of 24 MAbs to a 112-amino-acid N-terminal fragment of the PPV coat protein (CP) expressed in Escherichia coli showed that 21 of the 24 MAbs recognized linear or denaturation-insensitive epitopes. A series of eight C-truncated CP fragments allowed the mapping of the epitopes recognized by the MAbs. In all, 14 of them reacted to the N-terminal hypervariable region, defining a minimum of six epitopes, while 7 reacted to the beginning of the core region, defining a minimum of three epitopes. Sequence comparisons allowed the more precise positioning of regions recognized by several MAbs, including those recognized by the 5B-IVIA universal MAb (amino acids 94 to 100) and by the 4DG5 and 4DG11 D serogroup-specific MAbs (amino acids 43 to 64). A similar approach coupled with infectious cDNA clone mutagenesis showed that a V74T mutation in the N-terminus of the CP abolished the binding of the M serogroup-specific AL MAb. Taken together, these results provide a detailed positioning of the epitopes recognized by the most widely used PPV detection and typing MAbs.

Characterization of Brugmansia mosaic virus Isolated from Brugmansia spp. in Korea

Directory of Open Access Journals (Sweden)

Chung Youl Park

2014-12-01

Full Text Available In May 2013, an angel’s trumpet leaves showing mosaic and malformation symptoms were collected from Suwon city, Gyeonggi-do. An analysis of the collected sample by transmission electron microscopy observation showed filamentous rod particles of 720-800 nm in length. On the basis of the these observations, we performed PCR against three reported Potyviruses (Brugmansia mosaic virus, Colombian datura virus and Brugmansia suaveolens mottle virus, and the sample was positive for BruMV. Pathogenicity and host range test of BruMV was determined by mechanical inoculation. Solanaceae (tobacco, tomato and eggplant and Amaranthaceae (ground cherry appeared typical virus symptoms. To determine coat protein of this virus, we designed specific primer pairs, and performed PCR amplification, cloning, and sequencing. Phylogenetic analysis showed that BruMV-SW was most closely related to BruMV isolate SK. Comparison of the BruMV-SW coat protein nucleotide sequences showed 92% to 99% identities to the other BruMV isolates.

Design and self-assembly of simple coat proteins for artificial viruses

NARCIS (Netherlands)

Hernandez-Garcia, Armando; Kraft, Daniela J.; Janssen, Anne F J; Bomans, Paul H H; Sommerdijk, Nico A J M; Thies-Weesie, Dominique M E; Favretto, Marco E.; Brock, Roland; De Wolf, Frits A.; Werten, Marc W T; Van Der Schoot, Paul; Stuart, Martien Cohen; De Vries, Renko

2014-01-01

Viruses are among the simplest biological systems and are highly effective vehicles for the delivery of genetic material into susceptible host cells1. Artificial viruses can be used as model systems for providing insights into natural viruses and can be considered a testing ground for developing

Loss of aphid transmissibility of plum pox virus isolates

NARCIS (Netherlands)

Kamenova, I.; Lohuis, H.; Peters, D.

2002-01-01

The aphid transmissibility of seven Plum pox virus (PPV) isolates and the amino acid sequences of their coat proteins were analysed Two aphid transmissible isolates PPV-A and PPV-P contained the DAG amino triplet, while DAL or NAG replaced this triplet in the coat proteins of non-aphid transmissible

Frequência de Lettuce big-vein associated virus e Mirafiori lettuce big-vein virus em Plantas de alface no Estado de São Paulo e transmissão através de extrato vegetal e solo Frequency of Lettuce big-vein associated virus and Mirafiori lettuce big-vein virus in symptomatic and assymptomatic lettuce plants and sap and soil transmission

Directory of Open Access Journals (Sweden)

Márcio Martinello Sanches

2007-12-01

condições de laboratório.The occurrence of big vein disease symptoms and the association of Lettuce big-vein associated virus (LBVaV and Mirafiori lettuce big-vein virus (MLBVV was evaluated by RT-PCR using specific primers for both viruses. A total of 366 symptomatic plants were collected during June and September 2004 and during April and July 2005 at Bauru, Campinas and Mogi das Cruzes in São Paulo state, and 18 symptomless plants were collected in Mogi das Cruzes on December 2004. Mixed infection was detected in 76,2% of the symptomatic plants, 11,5% had only MLBVV and 6,6% had only LBVaV. In the symptomless plants collected in areas with high incidence of the disease throughout the winter, MLBVV was found in 9 plants and LBVaV in 7 plants. Four plants had both viruses, indicating that symptom development depends on abiotic factors, such as temperature. Plants with MLBVV and LBVaV (mixed infection were used as source of virus in a host range assay at 16C/ 10°C (day/ night and 11h light period. MLBVV was transmitted to Nicotiana tabacum TNN, N. rustica, N. occidentalis, Chenopodium quinoa and lettuce cv. Trocadero and White Boston, while LBVaV was transmitted only to lettuce cv. White Boston. No symptons could be verified for these plants with the exception of C. quinoa that showed local lesions. Transmission through soil in areas with high incidence of the disease was observed for LBVaV to lettuce cv. White Boston and MLBVV for lettuce cv. Trocadero and White Boston, but only cv. White Boston showed symptoms. Together, these results demonstrate the difficulties in transmitting both viruses, even under controlled laboratory conditions.

Virus-Assembled Flexible Electrode-Electrolyte Interfaces for Enhanced Polymer-Based Battery Applications

Directory of Open Access Journals (Sweden)

Ayan Ghosh

2012-01-01

Full Text Available High-aspect-ratio cobalt-oxide-coated Tobacco mosaic virus (TMV- assembled polytetrafluoroethylene (PTFE nonstick surfaces were integrated with a solvent-free polymer electrolyte to create an anode-electrolyte interface for use in lithium-ion batteries. The virus-assembled PTFE surfaces consisted primarily of cobalt oxide and were readily intercalated with a low-molecular-weight poly (ethylene oxide (PEO based diblock copolymer electrolyte to produce a solid anode-electrolyte system. The resulting polymer-coated virus-based system was then peeled from the PTFE backing to produce a flexible electrode-electrolyte component. Electrochemical studies indicated the virus-structured metal-oxide PEO-based interface was stable and displayed robust charge transfer kinetics. Combined, these studies demonstrate the development of a novel solid-state electrode architecture with a unique peelable and flexible processing attribute.

NIR-assisted orchid virus therapy using urchin bimetallic nanomaterials in phalaenopsis

International Nuclear Information System (INIS)

Chen, Shin-Yu; Do, Yi-Yin; Huang, Pung-Ling; Cheng, Liang-Chien; Chen, Chieh-Wei; Lee, Po-Han; Liu, Ru-Shi; Yu, Fengjiao; Zhou, Wuzong

2013-01-01

The use of nanoparticles has drawn special attention, particularly in the treatment of plant diseases. Cymbidium mosaic virus (CymMV) and Odontoglossum ring spot virus (ORSV) are the most prevalent and serious diseases that affect the development of the orchid industry. In this study we treated nanoparticles as a strategy for enhancing the resistance of orchids against CymMV and ORSV. After chitosan-modified gold nanoparticles (Au NPs) were injected into Phalaenopsis leaves, the injected leaves were exposed to 980 nm laser for light–heat conversion. To evaluate virus elimination in the treated Phalaenopsis leaves, the transcripts of coat protein genes and the production of viral proteins were assessed by reverse transcription-Polymerase chain reaction and enzyme-linked immunosorbent assay, respectively. The expression of coat protein genes for both CymMV and ORSV was significantly lower in the chitosan-modified Au NP-treated Phalaenopsis leaves than in the control. Similarly, the amount of coat proteins for both viruses in the Phalaenopsis leaves was lower than that in the control (without nanoparticle injection). We propose that the temperature increase in the chitosan-modified Au NP-treated Phalaenopsis tissues after laser exposure reduces the viral population, consequently conferring resistance against CymMV and ORSV. Our findings suggest that the application of chitosan-modified Au NPs is a promising new strategy for orchid virus therapy. (paper)

Prime-boost therapeutic vaccination in mice with DNA/DNA or DNA/Fowlpox virus recombinants expressing the Human Papilloma Virus type 16 E6 and E7 mutated proteins fused to the coat protein of Potato virus X.

Science.gov (United States)

Illiano, Elena; Bissa, Massimiliano; Paolini, Francesca; Zanotto, Carlo; De Giuli Morghen, Carlo; Franconi, Rosella; Radaelli, Antonia; Venuti, Aldo

2016-10-02

The therapeutic antitumor potency of a prime-boost vaccination strategy was explored, based on the mutated, nontransforming forms of the E6 (E6 F47R ) and E7 (E7 GGG ) oncogenes of Human Papilloma Virus type 16 (HPV16), fused to the Potato virus X (PVX) coat protein (CP) sequence. Previous data showed that CP fusion improves the immunogenicity of tumor-associated antigens and may thus increase their efficacy. After verifying the correct expression of E6 F47R CP and E7 GGG CP inserted into DNA and Fowlpox virus recombinants by Western blotting and immunofluorescence, their combined use was evaluated for therapy in a pre-clinical mouse model of HPV16-related tumorigenicity. Immunization protocols were applied using homologous (DNA/DNA) or heterologous (DNA/Fowlpox) prime-boost vaccine regimens. The humoral immune responses were determined by ELISA, and the therapeutic efficacy evaluated by the delay in tumor appearance and reduced tumor volume after inoculation of syngeneic TC-1* tumor cells. Homologous DNA/DNA genetic vaccines were able to better delay tumor appearance and inhibit tumor growth when DNAE6 F47R CP and DNAE7 GGG CP were administered in combination. However, the heterologous DNA/Fowlpox vaccination strategy was able to delay tumor appearance in a higher number of animals when E6 F47R CP and in particular E7 GGG CP were administered alone. Copyright © 2016 Elsevier B.V. All rights reserved.

Nucleotide sequence of tomato ringspot virus RNA-2.

Science.gov (United States)

Rott, M E; Tremaine, J H; Rochon, D M

1991-07-01

The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

Effect of Osmotic Pressure on the Stability of Whole Inactivated Influenza Vaccine for Coating on Microneedles.

Directory of Open Access Journals (Sweden)

Hyo-Jick Choi

Full Text Available Enveloped virus vaccines can be damaged by high osmotic strength solutions, such as those used to protect the vaccine antigen during drying, which contain high concentrations of sugars. We therefore studied shrinkage and activity loss of whole inactivated influenza virus in hyperosmotic solutions and used those findings to improve vaccine coating of microneedle patches for influenza vaccination. Using stopped-flow light scattering analysis, we found that the virus underwent an initial shrinkage on the order of 10% by volume within 5 s upon exposure to a hyperosmotic stress difference of 217 milliosmolarity. During this shrinkage, the virus envelope had very low osmotic water permeability (1 - 6×10-4 cm s-1 and high Arrhenius activation energy (Ea = 15.0 kcal mol-1, indicating that the water molecules diffused through the viral lipid membranes. After a quasi-stable state of approximately 20 s to 2 min, depending on the species and hypertonic osmotic strength difference of disaccharides, there was a second phase of viral shrinkage. At the highest osmotic strengths, this led to an undulating light scattering profile that appeared to be related to perturbation of the viral envelope resulting in loss of virus activity, as determined by in vitro hemagglutination measurements and in vivo immunogenicity studies in mice. Addition of carboxymethyl cellulose effectively prevented vaccine activity loss in vitro and in vivo, believed to be due to increasing the viscosity of concentrated sugar solution and thereby reducing osmotic stress during coating of microneedles. These results suggest that hyperosmotic solutions can cause biphasic shrinkage of whole inactivated influenza virus which can damage vaccine activity at high osmotic strength and that addition of a viscosity enhancer to the vaccine coating solution can prevent osmotically driven damage and thereby enable preparation of stable microneedle coating formulations for vaccination.

Hibiscus Chlorotic Ringspot Virus Coat Protein Is Essential for Cell-to-Cell and Long-Distance Movement but Not for Viral RNA Replication

Science.gov (United States)

Niu, Shengniao; Gil-Salas, Francisco M.; Tewary, Sunil Kumar; Samales, Ashwin Kuppusamy; Johnson, John; Swaminathan, Kunchithapadam; Wong, Sek-Man

2014-01-01

Hibiscus chlorotic ringspot virus (HCRSV) is a member of the genus Carmovirus in the family Tombusviridae. In order to study its coat protein (CP) functions on virus replication and movement in kenaf (Hibiscus cannabinus L.), two HCRSV mutants, designated as p2590 (A to G) in which the first start codon ATG was replaced with GTG and p2776 (C to G) in which proline 63 was replaced with alanine, were constructed. In vitro transcripts of p2590 (A to G) were able to replicate to a similar level as wild type without CP expression in kenaf protoplasts. However, its cell-to-cell movement was not detected in the inoculated kenaf cotyledons. Structurally the proline 63 in subunit C acts as a kink for β-annulus formation during virion assembly. Progeny of transcripts derived from p2776 (C to G) was able to move from cell-to-cell in inoculated cotyledons but its long-distance movement was not detected. Virions were not observed in partially purified mutant virus samples isolated from 2776 (C to G) inoculated cotyledons. Removal of the N-terminal 77 amino acids of HCRSV CP by trypsin digestion of purified wild type HCRSV virions resulted in only T = 1 empty virus-like particles. Taken together, HCRSV CP is dispensable for viral RNA replication but essential for cell-to-cell movement, and virion is required for the virus systemic movement. The proline 63 is crucial for HCRSV virion assembly in kenaf plants and the N-terminal 77 amino acids including the β-annulus domain is required in T = 3 assembly in vitro. PMID:25402344

Hibiscus chlorotic ringspot virus coat protein is essential for cell-to-cell and long-distance movement but not for viral RNA replication.

Directory of Open Access Journals (Sweden)

Shengniao Niu

Full Text Available Hibiscus chlorotic ringspot virus (HCRSV is a member of the genus Carmovirus in the family Tombusviridae. In order to study its coat protein (CP functions on virus replication and movement in kenaf (Hibiscus cannabinus L., two HCRSV mutants, designated as p2590 (A to G in which the first start codon ATG was replaced with GTG and p2776 (C to G in which proline 63 was replaced with alanine, were constructed. In vitro transcripts of p2590 (A to G were able to replicate to a similar level as wild type without CP expression in kenaf protoplasts. However, its cell-to-cell movement was not detected in the inoculated kenaf cotyledons. Structurally the proline 63 in subunit C acts as a kink for β-annulus formation during virion assembly. Progeny of transcripts derived from p2776 (C to G was able to move from cell-to-cell in inoculated cotyledons but its long-distance movement was not detected. Virions were not observed in partially purified mutant virus samples isolated from 2776 (C to G inoculated cotyledons. Removal of the N-terminal 77 amino acids of HCRSV CP by trypsin digestion of purified wild type HCRSV virions resulted in only T = 1 empty virus-like particles. Taken together, HCRSV CP is dispensable for viral RNA replication but essential for cell-to-cell movement, and virion is required for the virus systemic movement. The proline 63 is crucial for HCRSV virion assembly in kenaf plants and the N-terminal 77 amino acids including the β-annulus domain is required in T = 3 assembly in vitro.

Evidence for Non-Transmission of Rice Yellow Mottle Virus (RYMV through Rice Seed

Directory of Open Access Journals (Sweden)

Sy, AA.

2004-01-01

Full Text Available An indexing of the organs (radicle and plumule and components (husk, endosperm and embryo of rice seeds using Enzyme Linked Immunosorbent Assay (ELISA was carried out to detect Rice yellow mottle virus (RYMV and establish the exact location of the virus in the rice seed. RYMV was detected only in the husk (seed coat but not in the endosperm, plumule, radicle, nor embryo. None of the seedlings raised from the seeds expressed RYMV symptoms. No virus particle was detected by the ELISA test in the leaves of the screenhouse-reared plants obtained from seeds of infected plants. The results indicate that RYMV is apparently not transmitted through rice seed probably because the virus is seed-borne in the husk (seed coat of mature rice seeds.

Kinetics of cellular uptake of viruses and nanoparticles via clathrin-mediated endocytosis

Science.gov (United States)

Banerjee, Anand; Berezhkovskii, Alexander; Nossal, Ralph

2016-02-01

Several viruses exploit clathrin-mediated endocytosis to gain entry into host cells. This process is also used extensively in biomedical applications to deliver nanoparticles (NPs) to diseased cells. The internalization of these nano-objects is controlled by the assembly of a clathrin-containing protein coat on the cytoplasmic side of the plasma membrane, which drives the invagination of the membrane and the formation of a cargo-containing endocytic vesicle. Current theoretical models of receptor-mediated endocytosis of viruses and NPs do not explicitly take coat assembly into consideration. In this paper we study cellular uptake of viruses and NPs with a focus on coat assembly. We characterize the internalization process by the mean time between the binding of a particle to the membrane and its entry into the cell. Using a coarse-grained model which maps the stochastic dynamics of coat formation onto a one-dimensional random walk, we derive an analytical formula for this quantity. A study of the dependence of the mean internalization time on NP size shows that there is an upper bound above which this time becomes extremely large, and an optimal size at which it attains a minimum. Our estimates of these sizes compare well with experimental data. We also study the sensitivity of the obtained results on coat parameters to identify factors which significantly affect the internalization kinetics.

Poinsettia latent virus is not a cryptic virus, but a natural polerovirus-sobemovirus hybrid

International Nuclear Information System (INIS)

Siepen, Marc aus dem; Pohl, Jens O.; Koo, Bong-Jin; Wege, Christina; Jeske, Holger

2005-01-01

The biochemical and genetic features of Poinsettia latent virus (PnLV, formerly named Poinsettia cryptic virus), which is spread worldwide in commercial cultivars of Euphorbia pulcherrima without inducing symptoms, have been determined using virus-purification, immunological techniques, electron microscopy, cloning, and sequencing. PnLV was found to be a chimeric virus with one 4652 bases, plus strand RNA showing a close relationship to poleroviruses within the first three quarters of its genome but to sobemoviruses in the last quarter. Thus, we propose to classify this virus as 'polemovirus'. Similarities of protein and nucleic acid sequences at the 5' and extreme 3' end of its RNA suggest a replication mode like that of poleroviruses, whereas the coat protein sequence is closely related to that of sobemoviruses. Consistent with these results, PnLV forms stable icosahedra of 34 nm in diameter. The consequences for the taxonomy of PnLV and for gardeners' practice are discussed

Characterization of viruses associated with garlic plants propagated from different reproductive tissues from Italy and other geographic regions

Directory of Open Access Journals (Sweden)

Leonardo PARRANO

2013-01-01

Full Text Available Garlic is an important crop cultivated worldwide and several different viruses have been associated with propagative material. Garlic is propagated from bulbs and/or from vegetative topsets of the inflorescences known as bulbils. The effects of the geographic origin and the type of the propagative material on the phylogenetic relationships and genetic variability of the coat protein genes of four allium viruses are presented here. Onion yellow dwarf virus (OYDV, Leek yellow stripe virus (LYSV, Garlic virus X (GVX, and Garlic common latent virus (GCLV were detected in single and mixed infections in plants grown either from bulbils and/or bulbs originating from Italy, China, Argentina, and the U.S.A. OYDV and LYSV fell into five and three well supported clades respectively whereas isolates of GVX and GCLV all clustered into one well-supported clade each. Some of the OYDV and LYSV clades presented evidence of host tissue selection while some phylogenetic structuring based on the geographic origin or host was also observed for some virus clades. Unique haplotypes and novel coat protein amino acid sequence patterns were identified for all viruses. An OYDV coat protein amino acid signature unique to Chenopodium quinoa, an uncommon host of the virus, was of particular interest. The type of propagative material affected the population dynamics of all of the viruses. The virus populations in plants propagated from bulbs were more diverse than in plants propagated from bulbils.

Enzymes and Enzyme Activity Encoded by Nonenveloped Viruses.

Science.gov (United States)

Azad, Kimi; Banerjee, Manidipa; Johnson, John E

2017-09-29

Viruses are obligate intracellular parasites that rely on host cell machineries for their replication and survival. Although viruses tend to make optimal use of the host cell protein repertoire, they need to encode essential enzymatic or effector functions that may not be available or accessible in the host cellular milieu. The enzymes encoded by nonenveloped viruses-a group of viruses that lack any lipid coating or envelope-play vital roles in all the stages of the viral life cycle. This review summarizes the structural, biochemical, and mechanistic information available for several classes of enzymes and autocatalytic activity encoded by nonenveloped viruses. Advances in research and development of antiviral inhibitors targeting specific viral enzymes are also highlighted.

Use of gamma rays to induce mutants resistant to cocoa swollen shoot disease in Theobroma cacao L

International Nuclear Information System (INIS)

Adu Ampomah, Y.; Owusu, G.K.; Sackey, S.; Padi, B.; Abdul Karimu, A.

1996-01-01

Vegetative buds of three cocoa varieties, ‘Amelonado’ (P30), ‘Trinitario’ (K5) and ‘Upper Amazon’ (T85/799) were irradiated with 15, 20 and 25 Gy of γ-rays, respectively, and budded on to rootstocks to generate MV1 shoots. The terminal buds of the shoots were removed to induce the formation of MV2 shoots, from which MV3 shoots were similarly derived. The MV3 plants were screened for resistance to the Cocoa Swollen Shoot Virus (CSSV) by patch-graft inoculation of the root-stocks. Only a few plants from each of the three cocoa varieties were found to be symptomless after indexing. These plants were multiplied by budding to the MV4 and MV5 stages and screened at each stage for CSSV resistance by inoculation using virus-carrying mealybugs. At the MV5 stage, some plants still remained symptomless and this was confirmed with enzyme-linked immunosorbent assay (ELISA). The study reveals that γ-rays can be used to induce genetic variability for resistance to CSSV in cocoa, as well as for other traits such as chlorophyll deficiency. (author)

Characterization of petunia flower mottle virus (PetFMV), a new potyvirus infecting Petunia x hybrida.

Science.gov (United States)

Feldhoff, A; Wetzel, T; Peters, D; Kellner, R; Krczal, G

1998-01-01

With the introduction of cutting-grown Petunia x hybrida plants on the European market, a new potyvirus which showed no serological reaction with antisera against any other potyviruses infecting petunias was discovered. Infected leaves contained flexuous rod-shaped virus particles of 750-800 nm in length and inclusion bodies (pinwheel structures) typical for potyviruses in ultrathin leaf sections. The purified coat protein with a Mr of approximately 36 kDa could be detected in Western immunoblots with a specific antibody to the coat protein of the petunia-infecting virus. The 3' end of the viral genome encompassing the 3' non-coding region, the coat protein gene, and part of the NIb gene was amplified from infected leaf material by IC/PCR using degenerate and specific primers. Sequences of PCR-generated cDNA clones were compared to other known sequences of potyviruses. Maximum homology of 56% was found in the 3' non-coding region between the petunia isolate and other potyviruses. A maximum homology of 69% was found between the amino acid sequence of the coat protein of the petunia isolate and corresponding sequences of other potyviruses. These data indicate that the petunia-infecting virus is a previously undescribed potyvirus and the name petunia flower mottle virus (PetFMV) is suggested.

Evidence for lysine acetylation in the coat protein of a polerovirus.

Science.gov (United States)

Cilia, Michelle; Johnson, Richard; Sweeney, Michelle; DeBlasio, Stacy L; Bruce, James E; MacCoss, Michael J; Gray, Stewart M

2014-10-01

Virions of the RPV strain of Cereal yellow dwarf virus-RPV were purified from infected oat tissue and analysed by MS. Two conserved residues, K147 and K181, in the virus coat protein, were confidently identified to contain epsilon-N-acetyl groups. While no functional data are available for K147, K181 lies within an interfacial region critical for virion assembly and stability. The signature immonium ion at m/z 126.0919 demonstrated the presence of N-acetyllysine, and the sequence fragment ions enabled an unambiguous assignment of the epsilon-N-acetyl modification on K181. We hypothesize that selection favours acetylation of K181 in a fraction of coat protein monomers to stabilize the capsid by promoting intermonomer salt bridge formation.

A Sequence-Independent, Unstructured Internal Ribosome Entry Site Is Responsible for Internal Expression of the Coat Protein of Turnip Crinkle Virus.

Science.gov (United States)

May, Jared; Johnson, Philip; Saleem, Huma; Simon, Anne E

2017-04-15

To maximize the coding potential of viral genomes, internal ribosome entry sites (IRES) can be used to bypass the traditional requirement of a 5' cap and some/all of the associated translation initiation factors. Although viral IRES typically contain higher-order RNA structure, an unstructured sequence of about 84 nucleotides (nt) immediately upstream of the Turnip crinkle virus (TCV) coat protein (CP) open reading frame (ORF) has been found to promote internal expression of the CP from the genomic RNA (gRNA) both in vitro and in vivo An absence of extensive RNA structure was predicted using RNA folding algorithms and confirmed by selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) RNA structure probing. Analysis of the IRES region in vitro by use of both the TCV gRNA and reporter constructs did not reveal any sequence-specific elements but rather suggested that an overall lack of structure was an important feature for IRES activity. The CP IRES is A-rich, independent of orientation, and strongly conserved among viruses in the same genus. The IRES was dependent on eIF4G, but not eIF4E, for activity. Low levels of CP accumulated in vivo in the absence of detectable TCV subgenomic RNAs, strongly suggesting that the IRES was active in the gRNA in vivo Since the TCV CP also serves as the viral silencing suppressor, early translation of the CP from the viral gRNA is likely important for countering host defenses. Cellular mRNA IRES also lack extensive RNA structures or sequence conservation, suggesting that this viral IRES and cellular IRES may have similar strategies for internal translation initiation. IMPORTANCE Cap-independent translation is a common strategy among positive-sense, single-stranded RNA viruses for bypassing the host cell requirement of a 5' cap structure. Viral IRES, in general, contain extensive secondary structure that is critical for activity. In contrast, we demonstrate that a region of viral RNA devoid of extensive secondary

Hibiscus chlorotic ringspot virus coat protein upregulates sulfur metabolism genes for enhanced pathogen defense.

Science.gov (United States)

Gao, Ruimin; Ng, Florence Kai Lin; Liu, Peng; Wong, Sek-Man

2012-12-01

In both Hibiscus chlorotic ringspot virus (HCRSV)-infected and HCRSV coat protein (CP) agroinfiltrated plant leaves, we showed that sulfur metabolism pathway related genes-namely, sulfite oxidase (SO), sulfite reductase, and adenosine 5'-phosphosulfate kinase-were upregulated. It led us to examine a plausible relationship between sulfur-enhanced resistance (SED) and HCRSV infection. We broadened an established method to include different concentrations of sulfur (0S, 1S, 2S, and 3S) to correlate them to symptom development of HCRSV-infected plants. We treated plants with glutathione and its inhibitor to verify the SED effect. Disease resistance was induced through elevated glutathione contents during HCRSV infection. The upregulation of SO was related to suppression of symptom development induced by sulfur treatment. In this study, we established that HCRSV-CP interacts with SO which, in turn, triggers SED and leads to enhanced plant resistance. Thus, we have discovered a new function of SO in the SED pathway. This is the first report to demonstrate that the interaction of a viral protein and host protein trigger SED in plants. It will be interesting if such interaction applies generally to other host-pathogen interactions that will lead to enhanced pathogen defense.

The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.

Science.gov (United States)

Hammond, R W; Crosslin, J M

1995-04-01

The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.

Induction of protective immunity in swine by recombinant bamboo mosaic virus expressing foot-and-mouth disease virus epitopes

Directory of Open Access Journals (Sweden)

Lin Na-Sheng

2007-09-01

Full Text Available Abstract Background Plant viruses can be employed as versatile vectors for the production of vaccines by expressing immunogenic epitopes on the surface of chimeric viral particles. Although several viruses, including tobacco mosaic virus, potato virus X and cowpea mosaic virus, have been developed as vectors, we aimed to develop a new viral vaccine delivery system, a bamboo mosaic virus (BaMV, that would carry larger transgene loads, and generate better immunity in the target animals with fewer adverse environmental effects. Methods We engineered the BaMV as a vaccine vector expressing the antigenic epitope(s of the capsid protein VP1 of foot-and-mouth disease virus (FMDV. The recombinant BaMV plasmid (pBVP1 was constructed by replacing DNA encoding the 35 N-terminal amino acid residues of the BaMV coat protein with that encoding 37 amino acid residues (T128-N164 of FMDV VP1. Results The pBVP1 was able to infect host plants and to generate a chimeric virion BVP1 expressing VP1 epitopes in its coat protein. Inoculation of swine with BVP1 virions resulted in the production of anti-FMDV neutralizing antibodies. Real-time PCR analysis of peripheral blood mononuclear cells from the BVP1-immunized swine revealed that they produced VP1-specific IFN-γ. Furthermore, all BVP1-immunized swine were protected against FMDV challenge. Conclusion Chimeric BaMV virions that express partial sequence of FMDV VP1 can effectively induce not only humoral and cell-mediated immune responses but also full protection against FMDV in target animals. This BaMV-based vector technology may be applied to other vaccines that require correct expression of antigens on chimeric viral particles.

Chitosan-coated poly(lactic-co-glycolic acid nanoparticles as an efficient delivery system for Newcastle disease virus DNA vaccine

Directory of Open Access Journals (Sweden)

Zhao K

2014-09-01

Full Text Available Kai Zhao,1,* Yang Zhang,1,2,* Xiaoyan Zhang,1,* Ci Shi,1,2 Xin Wang,1 Xiaohua Wang,1 Zheng Jin,3 Shangjin Cui2 1Laboratory of Microbiology, School of Life Science, Heilongjiang University, 2Division of Swine Infectious Diseases, State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute, 3Key Laboratory of Chemical Engineering Process and Technology for High-efficiency Conversion, Heilongjiang University, Harbin, People’s Republic of China *These authors contributed equally to this work Abstract: We determined the efficacy and safety of chitosan (CS-coated poly(lactic-co-glycolic acid (PLGA nanoparticles (NPs as a delivery system for a vaccine to protect chickens against Newcastle disease virus (NDV. The newly constructed vaccine contained DNA (the F gene of NDV. The Newcastle disease virus (NDV F gene deoxyribonucleic acid (DNA plasmid (pFDNA-CS/PLGA-NPs were spherical (diameter =699.1±5.21 nm [mean ± ­standard deviation] and smooth, with an encapsulation efficiency of 98.1% and a Zeta potential of +6.35 mV. An in vitro release assay indicated that CS controlled the burst release of plasmid DNA, such that up to 67.4% of the entire quantity of plasmid DNA was steadily released from the pFDNA-CS/PLGA-NPs. An in vitro expression assay indicated that the expression of nanoparticles (NPs was maintained in the NPs. In an immunization test with specific pathogen-free chickens, the pFDNA-CS/PLGA-NPs induced stronger cellular, humoral, and mucosal immune responses than the plasmid DNA vaccine alone. The pFDNA-CS/PLGA-NPs did not harm 293T cells in an in vitro assay and did not harm chickens in an in vivo assay. Overall, the results indicated that CS-coated PLGA NPs can serve as an efficient and safe mucosal immune delivery system for NDV DNA vaccine.Keywords: mucosal immune delivery system, immune effect

Stability of RNA silencing-based traits after virus infection

DEFF Research Database (Denmark)

Jørgensen, Bodil; Albrechtsen, Merete

2007-01-01

with constructs based on virus coat protein (CP) genes or other viral genes has been successfully used to engineer PTGS-mediated virus resistance into a large number of crop plants and some transgenic lines have been commercially exploited. However the discovery that plant viruses encode suppressors of gene...... silencing has raised concerns that virus infection of crop plants might reverse the new silencing-based traits. Most studies of virus suppression of silencing have used model systems based on silencing of reporter genes. A few studies have analysed the effects of virus infections on plants with genetically...... engineered virus resistance based on either a simple sense or an inverted repeat construct. We decided to use genetically engineered virus resistance in potato as a model system for further studies of the effect of virus infection on genetically engineered traits. We present for the first time a comparison...

An isoform of eukaryotic initiation factor 4E from Chrysanthemum morifolium interacts with Chrysanthemum virus B coat protein.

Directory of Open Access Journals (Sweden)

Aiping Song

Full Text Available BACKGROUND: Eukaryotic translation initiation factor 4E (eIF4E plays an important role in plant virus infection as well as the regulation of gene translation. METHODOLOGY/PRINCIPAL FINDINGS: Here, we describe the isolation of a cDNA encoding CmeIF(iso4E (GenBank accession no. JQ904592, an isoform of eIF4E from chrysanthemum, using RACE PCR. We used the CmeIF(iso4E cDNA for expression profiling and to analyze the interaction between CmeIF(iso4E and the Chrysanthemum virus B coat protein (CVBCP. Multiple sequence alignment and phylogenetic tree analysis showed that the sequence similarity of CmeIF(iso4E with other reported plant eIF(iso4E sequences varied between 69.12% and 89.18%, indicating that CmeIF(iso4E belongs to the eIF(iso4E subfamily of the eIF4E family. CmeIF(iso4E was present in all chrysanthemum organs, but was particularly abundant in the roots and flowers. Confocal microscopy showed that a transiently transfected CmeIF(iso4E-GFP fusion protein distributed throughout the whole cell in onion epidermis cells. A yeast two hybrid assay showed CVBCP interacted with CmeIF(iso4E but not with CmeIF4E. BiFC assay further demonstrated the interaction between CmeIF(iso4E and CVBCP. Luminescence assay showed that CVBCP increased the RLU of Luc-CVB, suggesting CVBCP might participate in the translation of viral proteins. CONCLUSIONS/SIGNIFICANCE: These results inferred that CmeIF(iso4E as the cap-binding subunit eIF(iso4F may be involved in Chrysanthemum Virus B infection in chrysanthemum through its interaction with CVBCP in spatial.

Phylogenetic relationships and the occurrence of interspecific recombination between beet chlorosis virus (BChV) and Beet mild yellowing virus (BMYV).

Science.gov (United States)

Kozlowska-Makulska, Anna; Hasiow-Jaroszewska, Beata; Szyndel, Marek S; Herrbach, Etienne; Bouzoubaa, Salah; Lemaire, Olivier; Beuve, Monique

2015-02-01

Samples containing two viruses belonging to the genus Polerovirus, beet chlorosis virus (BChV) and beet mild yellowing virus (BMYV), were collected from French and Polish sugar beet fields. The molecular properties of 24 isolates of BChV and BMYV were investigated, and their genetic diversity was examined in the coat protein (CP)- and P0-encoding genes. For the first time, we have demonstrated that beet polerovirus populations include recombinants between BChV and BMYV containing breakpoints within the CP gene. Moreover, a partial correlation between geographic origin and phylogenetic clustering was observed for BMYV isolates.

'Let the phage do the work': Using the phage P22 coat protein structures as a framework to understand its folding and assembly mutants

International Nuclear Information System (INIS)

Teschke, Carolyn M.; Parent, Kristin N.

2010-01-01

The amino acid sequence of viral capsid proteins contains information about their folding, structure and self-assembly processes. While some viruses assemble from small preformed oligomers of coat proteins, other viruses such as phage P22 and herpesvirus assemble from monomeric proteins (Fuller and King, 1980). The subunit assembly process is strictly controlled through protein:protein interactions such that icosahedral structures are formed with specific symmetries, rather than aberrant structures. dsDNA viruses commonly assemble by first forming a precursor capsid that serves as a DNA packaging machine. DNA packaging is accompanied by a conformational transition of the small precursor procapsid into a larger capsid for isometric viruses. Here we highlight the pseudo-atomic structures of phage P22 coat protein and rationalize several decades of data about P22 coat protein folding, assembly and maturation generated from a combination of genetics and biochemistry.

Detection and Molecular Characterization of Grapevine Virus A in Jordan

Directory of Open Access Journals (Sweden)

G. Anfoka

2004-12-01

Full Text Available In a study on grapevines in Jordan conducted between 2002 and 2003, grapevine virus A (GVA was detected in all areas where grapevines were planted. DAS-ELISA analysis of samples from symptomatic trees found that 16.1% of samples were infected with GVA. Using a GVA- specific primer pair (H587/C995, a portion of the coat protein gene of the virus was amplified by IC-RT-PCR and RT-PCR, using leaf extracts and RNA extracted from infected grapevines respectively. After cloning and sequencing the coat protein gene of the Jordanian isolate of GVA (GVA-Jo, the sequence of the amplified product was compared with sequences of other GVA isolates from different countries.

Coat protein-mediated resistance against an Indian isolate of the ...

Indian Academy of Sciences (India)

Coat protein (CP)-mediated resistance against an Indian isolate of the Cucumber mosaic virus (CMV) subgroup IB was demonstrated in transgenic lines of Nicotiana benthamiana through Agrobacterium tumefaciens-mediated transformation. Out of the fourteen independently transformed lines developed, two lines were ...

Coat protein of Turnip mosaic virus in oilseed rape (Brassica napus)

African Journals Online (AJOL)

mohammad

2Department of Plant Breeding and Biotechnology, Faculty of Agriculture, Ferdowsi University of Mashhad, Mashhad,. Iran. Accepted 15 August, 2012 ... led to prevalence of infectious diseases. Turnip mosaic virus (TuMV) is an .... During the sampling of canola plants for the detection of virus, some colonies of aphids were ...

Genetic diversity of the movement and coat protein genes of South American isolates of Prunus necrotic ringspot virus.

Science.gov (United States)

Fiore, Nicola; Fajardo, Thor V M; Prodan, Simona; Herranz, María Carmen; Aparicio, Frederic; Montealegre, Jaime; Elena, Santiago F; Pallás, Vicente; Sánchez-Navarro, Jesús

2008-01-01

Prunus necrotic ringspot virus (PNRSV) is distributed worldwide, but no molecular data have been previously reported from South American isolates. The nucleotide sequences corresponding to the movement (MP) and coat (CP) proteins of 23 isolates of PNRSV from Chile, Brazil, and Uruguay, and from different Prunus species, have been obtained. Phylogenetic analysis performed with full-length MP and CP sequences from all the PNRSV isolates confirmed the clustering of the isolates into the previously reported PV32-I, PV96-II and PE5-III phylogroups. No association was found between specific sequences and host, geographic origin or symptomatology. Comparative analysis showed that both MP and CP have phylogroup-specific amino acids and all of the motifs previously characterized for both proteins. The study of the distribution of synonymous and nonsynonymous changes along both open reading frames revealed that most amino acid sites are under the effect of negative purifying selection.

Silica-coated Gd(DOTA)-loaded protein nanoparticles enable magnetic resonance imaging of macrophages

Science.gov (United States)

Bruckman, Michael A.; Randolph, Lauren N.; Gulati, Neetu M.; Stewart, Phoebe L.; Steinmetz, Nicole F.

2015-01-01

The molecular imaging of in vivo targets allows non-invasive disease diagnosis. Nanoparticles offer a promising platform for molecular imaging because they can deliver large payloads of imaging reagents to the site of disease. Magnetic resonance imaging (MRI) is often preferred for clinical diagnosis because it uses non-ionizing radiation and offers both high spatial resolution and excellent penetration. We have explored the use of plant viruses as the basis of for MRI contrast reagents, specifically Tobacco mosaic virus (TMV), which can assemble to form either stiff rods or spheres. We loaded TMV particles with paramagnetic Gd ions, increasing the ionic relaxivity compared to free Gd ions. The loaded TMV particles were then coated with silica maintaining high relaxivities. Interestingly, we found that when Gd(DOTA) was loaded into the interior channel of TMV and the exterior was coated with silica, the T1 relaxivities increased by three-fold from 10.9 mM−1 s−1 to 29.7 mM−1s−1 at 60 MHz compared to uncoated Gd-loaded TMV. To test the performance of the contrast agents in a biological setting, we focused on interactions with macrophages because the active or passive targeting of immune cells is a popular strategy to investigate the cellular components involved in disease progression associated with inflammation. In vitro assays and phantom MRI experiments indicate efficient targeting and imaging of macrophages, enhanced contrast-to-noise ratio was observed by shape-engineering (SNP > TMV) and silica-coating (Si-TMV/SNP > TMV/SNP). Because plant viruses are in the food chain, antibodies may be prevalent in the population. Therefore we investigated whether the silica-coating could prevent antibody recognition; indeed our data indicate that mineralization can be used as a stealth coating option to reduce clearance. Therefore, we conclude that the silica-coated protein-based contrast agent may provide an interesting candidate material for further investigation

Role of the 25-26 nt siRNA in the resistance of transgenic Prunus domestica graft inoculated with plum pox virus.

Science.gov (United States)

Kundu, Jiban Kumar; Briard, Pascal; Hily, Jean Michel; Ravelonandro, Michel; Scorza, Ralph

2008-02-01

The reaction of a genetically engineered plum clone (C5) resistant to plum pox virus (PPV) by graft inoculation with the virus was evaluated. The resistance in this clone has been demonstrated to be mediated through post-transcriptional gene silencing (PTGS). A single C5 plant out of 30 plants inoculated with PPV M strain by double chip-budding showed mild diffuse mosaic 'Sharka' symptom at the bottom section of the scion. The upper leaves of this PPV-infected C5 plant remained symptomless and the virus was not detected in them by either DAS-ELISA or RT-PCR. An RNA silencing associated small interfering RNA duplex, siRNA (21-26 nt), was detected in non-inoculated C5 plants and in the portions of inoculated C5 plant in which PPV could not be detected. In the PPV-infected portion of the C5 plant and in C6 PPV susceptible plants only the approximately 21-22 nt siRNAs was detected. Cytosine-methylation was confirmed in C5 plants both uninfected and showing PPV symptoms. The 25-26 nt siRNA normally present in C5 was absent in PPV-infected C5 tissues confirming the critical role of this siRNA in the resistance of clone C5 to PPV infection. We also show that this PPV infection was limited and transient. It was only detected in one plant at one of four post-dormancy sampling dates and did not appear to affect the overall PPV resistance of the C5 clone.

Implication of the C terminus of the Prunus necrotic ringspot virus movement protein in cell-to-cell transport and in its interaction with the coat protein.

Science.gov (United States)

Aparicio, Frederic; Pallás, Vicente; Sánchez-Navarro, Jesús

2010-07-01

The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is required for viral transport. Previous analysis with MPs of other members of the family Bromoviridae has shown that the C-terminal part of these MPs plays a critical role in the interaction with the cognate coat protein (CP) and in cell-to-cell transport. Bimolecular fluorescence complementation and overlay analysis confirm an interaction between the C-terminal 38 aa of PNRSV MP and its cognate CP. Mutational analysis of the C-terminal region of the PNRSV MP revealed that its C-terminal 38 aa are dispensable for virus transport, however, the 4 aa preceding the dispensable C terminus are necessary to target the MP to the plasmodesmata and for the functionality of the protein. The capacity of the PNRSV MP to use either a CP-dependent or a CP-independent cell-to-cell transport is discussed.

Hydrogel based QCM aptasensor for detection of avian influenza virus.

Science.gov (United States)

Wang, Ronghui; Li, Yanbin

2013-04-15

The objective of this study was to develop a quartz crystal microbalance (QCM) aptasensor based on ssDNA crosslinked polymeric hydrogel for rapid, sensitive and specific detection of avian influenza virus (AIV) H5N1. A selected aptamer with high affinity and specificity against AIV H5N1 surface protein was used, and hybridization between the aptamer and ssDNA formed the crosslinker in the polymer hydrogel. The aptamer hydrogel was immobilized on the gold surface of QCM sensor using a self-assembled monolayer method. The hydrogel remained in the state of shrink if no H5N1 virus was present in the sample because of the crosslinking between the aptamer and ssDNA in the polymer network. When it exposed to target virus, the binding reaction between the aptamer and H5N1 virus caused the dissolution of the linkage between the aptamer and ssDNA, resulting in the abrupt swelling of the hydrogel. The swollen hydrogel was monitored by the QCM sensor in terms of decreased frequency. Three polymeric hydrogels with different ratio (100:1 hydrogel I, 10:1 hydrogel II, 1:1 hydrogel III) of acrylamide and the aptamer monomer were synthesized, respectively, and then were used as the QCM sensor coating material. The results showed that the developed hydrogel QCM aptasensor was capable of detecting target H5N1 virus, and among the three developed aptamer hydrogels, hydrogel III coated QCM aptasensor achieved the highest sensitivity with the detection limit of 0.0128 HAU (HA unit). The total detection time from sampling to detection was only 30 min. In comparison with the anti-H5 antibody coated QCM immunosensor, the hydrogel QCM aptasensor lowered the detection limit and reduced the detection time. Copyright © 2012 Elsevier B.V. All rights reserved.

Serum albumin 'camouflage' of plant virus based nanoparticles prevents their antibody recognition and enhances pharmacokinetics.

Science.gov (United States)

Pitek, Andrzej S; Jameson, Slater A; Veliz, Frank A; Shukla, Sourabh; Steinmetz, Nicole F

2016-05-01

Plant virus-based nanoparticles (VNPs) are a novel class of nanocarriers with unique potential for biomedical applications. VNPs have many advantageous properties such as ease of manufacture and high degree of quality control. Their biocompatibility and biodegradability make them an attractive alternative to synthetic nanoparticles (NPs). Nevertheless, as with synthetic NPs, to be successful in drug delivery or imaging, the carriers need to overcome several biological barriers including innate immune recognition. Plasma opsonization can tag (V)NPs for clearance by the mononuclear phagocyte system (MPS), resulting in shortened circulation half lives and non-specific sequestration in non-targeted organs. PEG coatings have been traditionally used to 'shield' nanocarriers from immune surveillance. However, due to broad use of PEG in cosmetics and other industries, the prevalence of anti-PEG antibodies has been reported, which may limit the utility of PEGylation in nanomedicine. Alternative strategies are needed to tailor the in vivo properties of (plant virus-based) nanocarriers. We demonstrate the use of serum albumin (SA) as a viable alternative. SA conjugation to tobacco mosaic virus (TMV)-based nanocarriers results in a 'camouflage' effect more effective than PEG coatings. SA-'camouflaged' TMV particles exhibit decreased antibody recognition, as well as enhanced pharmacokinetics in a Balb/C mouse model. Therefore, SA-coatings may provide an alternative and improved coating technique to yield (plant virus-based) NPs with improved in vivo properties enhancing drug delivery and molecular imaging. Copyright © 2016 Elsevier Ltd. All rights reserved.

Initial infection of roots and leaves reveals different resistance phenotypes associated with coat protein gene-mediated resistance to Potato mop-top virus.

Science.gov (United States)

Germundsson, Anna; Sandgren, Maria; Barker, Hugh; Savenkov, Eugene I; Valkonen, Jari P T

2002-05-01

Resistance to the pomovirus Potato mop-top virus (PMTV) was studied in potato (Solanum tuberosum cv. Saturna) and Nicotiana benthamiana transformed with the coat protein (CP) gene of PMTV. The incidence of PMTV infections was reduced in tubers of the CP-transgenic potatoes grown in the field in soil infested with the viruliferous vector, Spongospora subterranea. However, in those tubers that were infected, all three virus RNAs were detected and virus titres were high. The CP-transgenic N. benthamiana plants were inoculated with PMTV using two methods. Following mechanical inoculation of leaves, no RNA 3 (the CP-encoding RNA homologous to the transgene) was detected in leaves, but in some plants low amounts of RNA 3 were detected in roots; RNA 2 was readily detected in leaves and roots of several plants. Inoculation of roots using viruliferous S. subterranea resulted in infection of roots in all plants and the three PMTV RNAs were detected. However, no systemic movement of PMTV from roots to the above-ground parts was observed, indicating a novel expression of resistance. These data indicate that the CP gene-mediated resistance to PMTV specifically restricts accumulation of PMTV RNA 3, and is more effective in leaves than roots. Furthermore, expression of resistance is different depending on whether leaves or roots are inoculated. Data do not exclude the possibility that both a protein-mediated and an RNA-mediated resistance mechanism are involved.

KARAKTERISASICYMBIDIUM MOSAIC VIRUS (CYMMV PADA TANAMAN ANGGREK

Directory of Open Access Journals (Sweden)

KHAMDAN KHALIMI

2012-11-01

Full Text Available Characterization ofCymbidium mosaic virus (CymMV on Orchid Plant Orchids are affected by more virus disease problems than most crops, reducing their commercial values considerably. Orchid viruses are widespread in cultivated orchids, withCymbidium mosaic potexvirus (CymMV being the most prevalent. CymMV high incidence in cultivated orchids has been attributed to the stability and ease of transmission of this virus through cultural practices. CymMV induces floral and foliar necrosis. The virus also reduce plant vigor and lower flower quality, which affect their economic value. The objective of the research is to characterize the virus causing mosaic or chlorotic and necrotic on orchids in West Java. A reverse transcription-polymerase chain reaction (RT- PCR assays using oligonucleotide primers specific to CymMV were also successfully amplified the regions of the coat protein (CP gene of the virus. Analysis by using sodium dodecyl sulphate- polyacrylamide gel electrophoresis (SDS-PAGE revealed that the virus have a major structural protein with an estimated molecular weight of 28 kDa. Aligments of partial nucleotide sequences of the CP gene displayed 86 to 92% homology to CymMV isolates from other countries.

Production of Japanese Encephalitis Virus Antigens in Plants Using Bamboo Mosaic Virus-Based Vector

Directory of Open Access Journals (Sweden)

Tsung-Hsien Chen

2017-05-01

Full Text Available Japanese encephalitis virus (JEV is among the major threats to public health in Asia. For disease control and prevention, the efficient production of safe and effective vaccines against JEV is in urgent need. In this study, we produced a plant-made JEV vaccine candidate using a chimeric virus particle (CVP strategy based on bamboo mosaic virus (BaMV for epitope presentation. The chimeric virus, designated BJ2A, was constructed by fusing JEV envelope protein domain III (EDIII at the N-terminus of BaMV coat protein, with an insertion of the foot-and-mouth disease virus 2A peptide to facilitate the production of both unfused and epitope-presenting for efficient assembly of the CVP vaccine candidate. The strategy allowed stable maintenance of the fusion construct over long-term serial passages in plants. Immuno-electron microscopy examination and immunization assays revealed that BJ2A is able to present the EDIII epitope on the surface of the CVPs, which stimulated effective neutralizing antibodies against JEV infection in mice. This study demonstrates the efficient production of an effective CVP vaccine candidate against JEV in plants by the BaMV-based epitope presentation system.

Specific antibodies to detect Tamarillo leaf malformation virus (TALMV) in Tamarillo

International Nuclear Information System (INIS)

Gallo Garcia, Yuliana; Marin Montoya, Mauricio; Gutierrez, Pablo Andres

2011-01-01

In Colombia, yields of Tamarillo are seriously affected by a complex viral disease known as virosis. This pathology was first reported in 1991 in the north of Antioquia and currently affects all Tamarillo growing regions in the country. Recent works have demonstrated the association of two potyviruses (potyviridae) with this disease: potato virus y (PVY) and Tamarillo leaf malformation virus (TALMV, proposed species). Specific diagnostic tools are required for early asymptomatic detection of these viruses and Tamarillo certification programs. In this study, we report the obtention of TALMV specific antibodies using a 15 residues peptide mimicking the n-terminal coat protein. Specificity and sensitivity of the anti-TALMV antibodies was determined by Elisa and dot-blot using recombinant protein and synthetic peptides as controls. The usefulness of these antibodies was validated from a preliminary trial of TALMV detection in plant samples obtained from Tamarillo crops in eastern Antioquia and results were compared with a TALMV specific coat RT-PCR detection protocol.

Systemic transport of Alfalfa mosaic virus can be mediated by the movement proteins of several viruses assigned to five genera of the 30K family.

Science.gov (United States)

Fajardo, Thor V M; Peiró, Ana; Pallás, Vicente; Sánchez-Navarro, Jesús

2013-03-01

We previously showed that the movement protein (MP) gene of Alfalfa mosaic virus (AMV) is functionally exchangeable for the cell-to-cell transport of the corresponding genes of Tobacco mosaic virus (TMV), Brome mosaic virus, Prunus necrotic ringspot virus, Cucumber mosaic virus and Cowpea mosaic virus. We have analysed the capacity of the heterologous MPs to systemically transport the corresponding chimeric AMV genome. All MPs were competent in systemic transport but required the fusion at their C terminus of the coat protein-interacting C-terminal 44 aa (A44) of the AMV MP. Except for the TMV MP, the presence of the hybrid virus in upper leaves correlated with the capacity to move locally. These results suggest that all the MPs assigned to the 30K superfamily should be exchangeable not only for local virus movement but also for systemic transport when the A44 fragment is present.

Aptasensor development for detection of virus in water

DEFF Research Database (Denmark)

Kirkegaard, Julie

of three types of waterborne viruses: norovirus, rotavirus and hepatitis A virus. The development of the aptasensor involved sample preparation for aptamer selection of rotavirus and hepatitis A virus, an iterative design process of the aptasensor, investigation of the surface immobilisation of aptamers...... and finally an impedimetric electrical characterisation of the sensor. The sample preparation of the rotavirus was based on purification and biotinylation of the virus to meet the requirements of the aptamer selection process. The selection process, performed by an external collaborator, was based...... on streptavidin coated magnetic bead separation, hence the needed biotinylation. It was found that the BPH linker gave the highest yield when the biotinylated rotavirus were immobilised onto the beads. The design of the viral aptasensor was determined by an iterative design process. The final chip design...

Coat protein sequence shows that Cucumber mosaic virus isolate ...

Indian Academy of Sciences (India)

Madhu

A viral disease was identified on geraniums (Pelargonium spp.) grown in a greenhouse at the .... DNA was cloned in p-GEM Teasy vector (Promega, USA) as per the ... M. persicae and A. gossypii transmitted the virus in non persistent manner ...

Mutants of alfalfa mosaic virus

International Nuclear Information System (INIS)

Roosien, J.

1983-01-01

In this thesis the isolation and characterization of a number of mutants of alfalfa mosaic virus, a plant virus with a coat protein dependent genome, is described. Thermo-sensitive (ts) mutants were selected since, at least theoretically, ts mutations can be present in all virus coded functions. It was found that a high percentage of spontaneous mutants, isolated because of their aberrant symptoms, were ts. The majority of these isolates could grow at the non-permissive temperature in the presence of a single wild type (wt) component. To increase the mutation rate virus preparations were treated with several mutagens. After nitrous acid treatment or irradiation with ultraviolet light, an increase in the level of mutations was observed. UV irradiation was preferred since it did not require large amounts of purified viral components. During the preliminary characterization of potential ts mutants the author also obtained one structural and several symptom mutants which were analysed further (chapter 7, 8 and 9). The properties of the ts mutants are described in chapter 3-7. (Auth.)

Nucleotide sequence and taxonomy of Cycas necrotic stunt virus. Brief report.

Science.gov (United States)

Han, S S; Karasev, A V; Ieki, H; Iwanami, T

2002-11-01

Cycas necrotic stunt virus (CNSV) is the only well-characterized virus from gymnosperm. cDNA segments corresponding to the bipartite genome RNAs (RNA1, RNA2) were synthesized and sequenced. Each RNA encoded a single polyprotein, flanked by the 5' and 3' non-coding regions (NCR) and followed by a poly (A) tail. The putative polyproteins encoded by RNA1 and RNA2 had sets of motifs, which were characteristic of viruses in the genus Nepovirus. The polyproteins showed higher sequence identities to Artichoke Italian latent virus, Grapevine chrome mosaic virus and Tomato black ring virus, all of which belong to subgroup b of the genus Nepovirus, than to other nepoviruses. Phylogenetic analysis of RNA dependent RNA polymerase and coat protein also showed closer relationships with these viruses than other viruses. The data obtained supported the taxonomical status of CNSV as a definitive member of the genus Nepovirus, subgroup b.

Papaya ringspot virus coat protein gene for antigen presentation Escherichia coli

Czech Academy of Sciences Publication Activity Database

Chatchen, S.; Juříček, Miloslav; Rueda, P.; Kertbundit, Sunee

2006-01-01

Roč. 39, č. 1 (2006), s. 16-21 ISSN 1225-8687 Grant - others:Thai Research Fund(TH) BT-B-06-PG-14-4503 Institutional research plan: CEZ:AV0Z50380511 Source of funding: V - iné verejné zdroje Keywords : antigen presentation * canine parvo virus * epitope * papaya ringspot virus Subject RIV: EF - Botanics Impact factor: 1.465, year: 2006 http://www.jbmb.or.kr/view_article.php3?cont=jbmb&kid=174&mid=3&pid=3

Genomic Variability of Citrus tristeza virus (CTV Isolates Introduced into Morocco

Directory of Open Access Journals (Sweden)

Bouabid Lbida

2004-08-01

Full Text Available Genomic variability of the coat protein gene of Citrus tristeza virus isolates obtained from old Meyer lemon introductions in Morocco and more recent budwood introductions from Spain were studied. The coat protein gene of the virus was amplified directly from infected tissue by immunocapture RT-PCR and analysed by single stranded conformation polymorphism (SSCP and sequencing. Each isolate consisted of several related genomic variants, typical of a quasi-species. Although SSCP analysis has only limited typing ability it could be used in an initial screening to discriminate between isolates of different origin and to analyse the genomic structure of each isolate. Sequence analysis showed that the isolates of Spanish origin were closely related to mild isolates characterised in Florida and in Portugal. The Meyer lemon isolate on the other hand was related to severe strains of Meyer lemon characterised in Florida some years ago and to other severe strains from Brasil. A knowledge of the coat protein gene sequence is useful to trace the origin of the isolates.

An evolutionary analysis of the Secoviridae family of viruses.

Directory of Open Access Journals (Sweden)

Jeremy R Thompson

Full Text Available The plant-infecting Secoviridae family of viruses forms part of the Picornavirales order, an important group of non-enveloped viruses that infect vertebrates, arthropods, plants and algae. The impact of the secovirids on cultivated crops is significant, infecting a wide range of plants from grapevine to rice. The overwhelming majority are transmitted by ecdysozoan vectors such as nematodes, beetles and aphids. In this study, we have applied a variety of computational methods to examine the evolutionary traits of these viruses. Strong purifying selection pressures were calculated for the coat protein (CP sequences of nine species, although for two species evidence of both codon specific and episodic diversifying selection were found. By using Bayesian phylogenetic reconstruction methods CP nucleotide substitution rates for four species were estimated to range from between 9.29×10(-3 to 2.74×10(-3 (subs/site/year, values which are comparable with the short-term estimates of other related plant- and animal-infecting virus species. From these data, we were able to construct a time-measured phylogeny of the subfamily Comovirinae that estimated divergence of ninety-four extant sequences occurred less than 1,000 years ago with present virus species diversifying between 50 and 250 years ago; a period coinciding with the intensification of agricultural practices in industrial societies. Although recombination (modularity was limited to closely related taxa, significant and often unique similarities in the protein domains between secovirid and animal infecting picorna-like viruses, especially for the protease and coat protein, suggested a shared ancestry. We discuss our results in a wider context and find tentative evidence to indicate that some members of the Secoviridae might have their origins in insects, possibly colonizing plants in a number of founding events that have led to speciation. Such a scenario; virus infection between species of

Coat protein sequence shows that Cucumber mosaic virus isolate ...

Indian Academy of Sciences (India)

Madhu

crop is reported to be infecetd by a number of pests and dis- eases (Rao et al 2000) including a ... Plant Virus Lab, Floriculture Division, Institute of Himalayan Bioresource Technology, Palampur 176 061, India. *Corresponding author (Fax ..... ELISA test used in testing the plants (either mechanical- ly inoculated or naturally ...

Viruses affecting lentil (Lens culinaris Medik. in Greece; incidence and genetic variability of Bean leafroll virus and Pea enation mosaic virus

Directory of Open Access Journals (Sweden)

Elisavet K. CHATZIVASSILIOU

2016-07-01

Full Text Available In Greece, lentil (Lens culinaris Medik. crops are mainly established with non-certified seeds of local landraces, implying high risks for seed transmitted diseases. During April and May of the 2007–2012 growing seasons, surveys were conducted in eight regions of Greece (Attiki, Evros, Fthiotida, Korinthos, Kozani, Larissa, Lefkada and Viotia to monitor virus incidence in lentil fields. A total of 1216 lentil samples, from plants exhibiting symptoms suggestive of virus infection, were analyzed from 2007 to 2009, using tissue-blot immunoassays (TBIA. Pea seed-borne mosaic virus (PSbMV overall incidence was 4.9%, followed by Alfalfa mosaic virus (AMV (2.4% and Bean yellow mosaic virus (BYMV (1.0%. When 274 of the samples were tested for the presence of luteoviruses, 38.8% were infected with Bean leafroll virus (BLRV. Since BLRV was not identified in the majority of the samples collected from 2007 to 2009, representative symptomatic plants (360 samples were collected in further surveys performed from 2010 to 2012 and tested by ELISA. Two viruses prevailed in those samples: BLRV (36.1% was associated with stunting, yellowing, and reddening symptoms and Pea enation mosaic virus-1 (PEMV-1 (35.0% was associated with mosaic and mottling symptoms. PSbMV (2.2%, AMV (2.2%, BYMV (3.9% and CMV (2.8% were also detected. When the molecular variability was analyzed for representative isolates, collected from the main Greek lentil production areas, five BLRV isolates showed 95% identity for the coat protein (CP gene and 99% for the 3’ end region. Three Greek PEMV isolates co-clustered with an isolate from Germany when their CP sequence was compared with isolates with no mutation in the aphid transmission gene. Overall, limited genetic variability was detected among Greek isolates of BLRV and PEMV.

Present status of some virus diseases affecting legume crops in Tunisia, and partial characterization of Chickpea chlorotic stunt virus

Directory of Open Access Journals (Sweden)

Asma NAJAR

2011-09-01

Full Text Available Field surveys were conducted in Tunisia during the 2005‒2006, 2006‒2007 and 2009‒2010 growing seasons to identify viruses which produce yellowing, reddening and/or stunting symptoms of chickpea, faba bean and pea crops. Tissue blot immunoassay (TBIA results showed that Chickpea chlorotic stunt virus (CpCSV was the most common virus, followed by Faba bean necrotic yellows virus, Bean leafroll virus and Beet western yellows virus. The coat protein (CP gene nucleotide sequence of seven CpCSV isolates collected from different regions of Tunisia was compared with sequences of five other isolates in the NCBI database. A homology tree of the CP nucleotide sequences was prepared and CpCSV isolates were grouped into two clusters. The first group contained two Tunisian CpCSV chickpea isolates collected from Bizerte and Kef; sequenced regions showed a high nucleotiode homology (95% to that of the Ethiopian and Sudanese CpCSV isolates. The second group included five Tunisian isolates: two from chickpea, two from pea and one from faba bean, which showed a high homology (96% when compared with the Moroccan, Egyptian and Syrian CpCSV isolates.

Line 63-1: A New Virus-resistant Transgenic Papaya

NARCIS (Netherlands)

Tennant, P.; Souza, M.T.; Fitch, M.M.; Manshardt, R.; Slightom, J.L.; Gonsalves, D.

2005-01-01

The disease resistance of a transgenic line expressing the coat protein (CP) gene of the mild strain of the papaya ringspot virus (PRSV) from Hawaii was further analyzed against PRSV isolates from Hawaii and other geographical regions. Line 63-1 originated from the same transformation experiment

Antimicrobial-Coated Granules for Disinfecting Water

Science.gov (United States)

Akse, James R.; Holtsnider, John T.; Kliestik, Helen

2011-01-01

Methods of preparing antimicrobialcoated granules for disinfecting flowing potable water have been developed. Like the methods reported in the immediately preceding article, these methods involve chemical preparation of substrate surfaces (in this case, the surfaces of granules) to enable attachment of antimicrobial molecules to the surfaces via covalent bonds. A variety of granular materials have been coated with a variety of antimicrobial agents that include antibiotics, bacteriocins, enzymes, bactericides, and fungicides. When employed in packed beds in flowing water, these antimicrobial-coated granules have been proven effective against gram-positive bacteria, gram-negative bacteria, fungi, and viruses. Composite beds, consisting of multiple layers containing different granular antimicrobial media, have proven particularly effective against a broad spectrum of microorganisms. These media have also proven effective in enhancing or potentiating the biocidal effects of in-line iodinated resins and of very low levels of dissolved elemental iodine.

Citrus Tristeza Virus on the Island of Crete

DEFF Research Database (Denmark)

Shegani, M.; Tsikou, D.; Velimirovic, A.

2012-01-01

Over a period of two years, more than 5,000 citrus trees were tested for the presence of Citrus tristeza virus (CTV) on the island of Crete, resulting in thirty eight positives. Comparisons of the relative transcript levels of CTV p23, coat protein (CP), polymerase (POL) and an intergenic (POL/p3...

The molecular basis of the antigenic cross-reactivity between measles and cowpea mosaic viruses

International Nuclear Information System (INIS)

Olszewska, Wieslawa; Steward, Michael W.

2003-01-01

Two nonrelated viruses, cowpea mosaic virus (wtCPMV) and measles virus (MV), were found to induce cross-reactive antibodies. The nature of this cross-reactivity was studied and results are presented here demonstrating that antiserum raised against wtCPMV reacted with peptide from the fusion (F) protein of MV. Furthermore, the F protein of MV was shown to share an identical conformational B cell epitope with the small subunit of CPMV coat protein. Passive transfer of anti-wtCPMV antibodies into BALB/c mice conferred partial protection against measles virus induced encephalitis. The results are discussed in the context of cross-protection

Biological effects of rAAV-caAlk2 coating on structural allograft healing

DEFF Research Database (Denmark)

Koefoed, Mette; Ito, Hiromu; Gromov, Kirill

2005-01-01

Structural bone allografts often fracture due to their lack of osteogenic and remodeling potential. To overcome these limitations, we utilized allografts coated with recombinant adeno-associated virus (rAAV) that mediate in vivo gene transfer. Using beta-galactosidase as a reporter gene, we show...

Highly Specific Detection of Five Exotic Quarantine Plant Viruses using RT-PCR

Directory of Open Access Journals (Sweden)

Hoseong Choi

2013-03-01

Full Text Available To detect five plant viruses (Beet black scorch virus, Beet necrotic yellow vein virus, Eggplant mottled dwarf virus, Pelargonium zonate spot virus, and Rice yellow mottle virus for quarantine purposes, we designed 15 RT-PCR primer sets. Primer design was based on the nucleotide sequence of the coat protein gene, which is highly conserved within species. All but one primer set successfully amplified the targets, and gradient PCRs indicated that the optimal temperature for the 14 useful primer sets was 51.9°C. Some primer sets worked well regardless of annealing temperature while others required a very specific annealing temperature. A primer specificity test using plant total RNAs and cDNAs of other plant virus-infected samples demonstrated that the designed primer sets were highly specific and generated reproducible results. The newly developed RT-PCR primer sets would be useful for quarantine inspections aimed at preventing the entry of exotic plant viruses into Korea.

Molecular modeling and in-silico engineering of Cardamom mosaic virus coat protein for the presentation of immunogenic epitopes of Leptospira LipL32.

Science.gov (United States)

Kumar, Vikram; Damodharan, S; Pandaranayaka, Eswari P J; Madathiparambil, Madanan G; Tennyson, Jebasingh

2016-01-01

Expression of Cardamom mosaic virus (CdMV) coat protein (CP) in E. coli forms virus-like particles. In this study, the structure of CdMV CP was predicted and used as a platform to display epitopes of the most abundant surface-associated protein, LipL32 of Leptospira at C, N, and both the termini of CdMV CP. In silico, we have mapped sequential and conformational B-cell epitopes from the crystal structure of LipL32 of Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130 using IEDB Elipro, ABCpred, BCPRED, and VaxiJen servers. Our results show that the epitopes displayed at the N-terminus of CdMV CP are promising vaccine candidates as compared to those displayed at the C-terminus or at both the termini. LipL32 epitopes, EP2, EP3, EP4, and EP6 are found to be promising B-cell epitopes for vaccine development. Based on the type of amino acids, length, surface accessibility, and docking energy with CdMV CP model, the order of antigenicity of the LipL32 epitopes was found to be EP4 > EP3 > EP2 > EP6.

The structure of melon necrotic spot virus determined at 2.8 Å resolution

International Nuclear Information System (INIS)

Wada, Yasunobu; Tanaka, Hideaki; Yamashita, Eiki; Kubo, Chikako; Ichiki-Uehara, Tamaki; Nakazono-Nagaoka, Eiko; Omura, Toshihiro; Tsukihara, Tomitake

2007-01-01

The structure of melon necrotic spot virus is reported. The structure of melon necrotic spot virus (MNSV) was determined at 2.8 Å resolution. Although MNSV is classified into the genus Carmovirus of the family Tombusviridae, the three-dimensional structure of MNSV showed a higher degree of similarity to tomato bushy stunt virus (TBSV), which belongs to the genus Tombusvirus, than to carnation mottle virus (CMtV), turnip crinkle virus (TCV) or cowpea mottle virus (CPMtV) from the genus Carmovirus. Thus, the classification of the family Tombusviridae at the genus level conflicts with the patterns of similarity among coat-protein structures. MNSV is one of the viruses belonging to the genera Tombusvirus or Carmovirus that are naturally transmitted in the soil by zoospores of fungal vectors. The X-ray structure of MNSV provides us with a representative structure of viruses transmitted by fungi

The coat protein of Alternanthera mosaic virus is the elicitor of a temperature-sensitive systemic necrosis in Nicotiana benthamiana, and interacts with a host boron transporter protein

International Nuclear Information System (INIS)

Lim, Hyoun-Sub; Nam, Jiryun; Seo, Eun-Young; Nam, Moon; Vaira, Anna Maria; Bae, Hanhong; Jang, Chan-Yong; Lee, Cheol Ho; Kim, Hong Gi; Roh, Mark; Hammond, John

2014-01-01

Different isolates of Alternanthera mosaic virus (AltMV; Potexvirus), including four infectious clones derived from AltMV-SP, induce distinct systemic symptoms in Nicotiana benthamiana. Virus accumulation was enhanced at 15 °C compared to 25 °C; severe clone AltMV 3-7 induced systemic necrosis (SN) and plant death at 15 °C. No interaction with potexvirus resistance gene Rx was detected, although SN was ablated by silencing of SGT1, as for other cases of potexvirus-induced necrosis. Substitution of AltMV 3-7 coat protein (CP SP ) with that from AltMV-Po (CP Po ) eliminated SN at 15 °C, and ameliorated symptoms in Alternanthera dentata and soybean. Substitution of only two residues from CP Po [either MN(13,14)ID or LA(76,77)IS] efficiently ablated SN in N. benthamiana. CP SP but not CP Po interacted with Arabidopsis boron transporter protein AtBOR1 by yeast two-hybrid assay; N. benthamiana homolog NbBOR1 interacted more strongly with CP SP than CP Po in bimolecular fluorescence complementation, and may affect recognition of CP as an elicitor of SN. - Highlights: • Alternanthera mosaic virus CP is an elicitor of systemic necrosis in N. benthamiana. • Virus-induced systemic necrosis is enhanced at 15 °C compared to 25 °C. • Induction of systemic necrosis is dependent on as few as two CP amino acid residues. • These residues are at subunit interfaces within the same turn of the virion helix. • Inducer/non-inducer CPs interact differentially with a boron transporter protein

Presence and Distribution of Oilseed Pumpkin Viruses and Molecular Detection of Zucchini Yellow Mosaic Virus

Directory of Open Access Journals (Sweden)

Ana Vučurović

2009-01-01

Full Text Available Over the past decade, intensive spread of virus infections of oilseed pumpkin has resulted in significant economic losses in pumpkin crop production, which is currently expanding in our country. In 2007 and 2008, a survey for the presence and distribution of oilseed pumpkin viruses was carried out in order to identify viruses responsible for epidemics and incidences of very destructive symptoms on cucurbit leaves and fruits. Monitoring andcollecting samples of oil pumpkin, as well as other species such as winter and butternut squash and buffalo and bottle gourd with viral infection symptoms, was conducted in several localities of Vojvodina Province. The collected plant samples were tested by DAS-ELISA using polyclonal antisera specific for the detection of six most economically harmful pumpkin viruses: Cucumber mosaic virus (CMV, Zucchini yellow mosaic virus (ZYMV, Watermelon mosaic virus (WMW, Squash mosaic virus (SqMV, Papaya ringspot virus (PRSV and Tobaccoringspot virus (TRSV that are included in A1 quarantine list of harmful organisms in Serbia.Identification of viruses in the collected samples indicated the presence of three viruses, ZYMV, WMV and CMV, in individual and mixed infections. Frequency of the identified viruses varied depending on locality and year of investigations. In 2007, WMV was the most frequent virus (94.2%, while ZYMV was prevalent (98.04% in 2008. High frequency of ZYMV determined in both years of investigation indicated the need for its rapid and reliable molecular detection. During this investigation, a protocol for ZYMVdetection was developed and optimized using specific primers CPfwd/Cprev and commercial kits for total RNA extraction, as well as for RT-PCR. In RT-PCR reaction using these primers, a DNA fragment of approximately 1100 bp, which included coat protein gene, was amplified in the samples of infected pumkin leaves. Although serological methods are still useful for large-scale testing of a great number of

Tomato bushy stunt virus (TBSV) infecting Lycopersicon esculentum.

Science.gov (United States)

Hafez, El Sayed E; Saber, Ghada A; Fattouh, Faiza A

2010-01-01

Tomato bushy stunt virus (TBSV) was detected in tomato crop (Lycopersicon esculentum) in Egypt with characteristic mosaic leaf deformation, stunting, and bushy growth symptoms. TBSV infection was confirmed serologically by ELISA and calculated incidence was 25.5%. Basic physicochemical properties of a purified TBSV Egh isolate were identical to known properties of tombusviruses of isometric 30-nm diameter particles, 41-kDa coat protein and the genome of approximately 4800 nt. This is the first TBSV isolate reported in Egypt. Cloning and partial sequencing of the isolate showed that it is more closely related to TBSV-P and TBSV-Ch than TBSV-Nf and TBSV-S strains of the virus. However, it is distinct from the above strains and could be a new strain of the virus which further confirms the genetic diversity of tombusviruses.

Polyclonal antibodies against the recombinantly expressed coat protein of the Citrus psorosis virus

Directory of Open Access Journals (Sweden)

Reda Salem

2018-05-01

Full Text Available Psorosis is a damaging disease of citrus that is widespread in many parts of the world. Citrus psorosis virus (CPsV, the type species of the genus Ophiovirus, is the putative causal agent of psorosis. Detection of CPsV by laboratory methods, serology in particular is a primary requirement for large-scale surveys but their production has been impaired by the difficulty of obtaining sufficient clean antigen for immunization. Specific PAbs against coat protein were produced in E. coli using recombinant DNA approach. The full length CP gene fragment was amplified by RT-PCR using total RNA extracted from CPsV infected citrus leaves and CP specific primers. The obtained product (1320bp was cloned, sequenced and sub-cloned into pET-30(+ expression vector. Expression was induced and screened in different bacterial clones by the presence of the expressed protein (48kDa and optimized in one clone. Expressed CP was purified using batch chromatography under denaturing conditions. Specificity of expressed protein was demonstrated by ELISA before used as antigen for raising PAbs in mice. Specificity of the raised PAbs to CPsV was verified by ELISA and western blotting. The raised PAbs were showed highly effectiveness in screening by ELISA comparing with the commercial antibodies purchased from Agritest, Valanzano, Italy.The expression of CPsV CP gene in E. coli, production of PAbs using recombinant protein as an antigen, the suitability of these antibodies for use in immunodiagnostics against the CPsV Egyptian isolate have been accomplished in this work. Keywords: CPsV, CP, PAbs, RT-PCR, ELISA, Western blotting

Surface properties, more than size, limiting convective distribution of virus-sized particles and viruses in the central nervous system.

Science.gov (United States)

Chen, Michael Y; Hoffer, Alan; Morrison, Paul F; Hamilton, John F; Hughes, Jeffrey; Schlageter, Kurt S; Lee, Jeongwu; Kelly, Brandon R; Oldfield, Edward H

2005-08-01

Achieving distribution of gene-carrying vectors is a major barrier to the clinical application of gene therapy. Because of the blood-brain barrier, the distribution of genetic vectors to the central nervous system (CNS) is even more challenging than delivery to other tissues. Direct intraparenchymal microinfusion, a minimally invasive technique, uses bulk flow (convection) to distribute suspensions of macromolecules widely through the extracellular space (convection-enhanced delivery [CED]). Although acute injection into solid tissue is often used for delivery of oligonucleotides, viruses, and liposomes, and there is preliminary evidence that certain of these large particles can spread through the interstitial space of the brain by the use of convection, the use of CED for distribution of viruses in the brain has not been systematically examined. That is the goal of this study. Investigators used a rodent model to examine the influence of size, osmolarity of buffering solutions, and surface coating on the volumetric distribution of virus-sized nanoparticles and viruses (adeno-associated viruses and adenoviruses) in the gray matter of the brain. The results demonstrate that channels in the extracellular space of gray matter in the brain are large enough to accommodate virus-sized particles and that the surface characteristics are critical determinants for distribution of viruses in the brain by convection. These results indicate that convective distribution can be used to distribute therapeutic viral vectors in the CNS.

Polyelectrolyte-modified cowpea mosaic virus for the synthesis of gold nanoparticles.

Science.gov (United States)

Aljabali, Alaa A A; Evans, David J

2014-01-01

Polyelectrolyte surface-modified cowpea mosaic virus (CPMV) can be used for the templated synthesis of narrowly dispersed gold nanoparticles. Cationic polyelectrolyte, poly(allylamine) hydrochloride, is electrostatically bound to the external surface of the virus capsid. The polyelectrolyte-coated CPMV promotes adsorption of aqueous gold hydroxide anionic species, prepared from gold(III) chloride and potassium carbonate, that are easily reduced to form CPMV-templated gold nanoparticles. The process is simple and environmentally benign using only water as solvent at ambient temperature.

Identification and characterization of the SSB1 locus involved in symptom development by Spring beauty latent virus infection in Arabidopsis thaliana.

Science.gov (United States)

Fujisaki, Koki; Hagihara, Fumi; Azukawa, Yoshihiro; Kaido, Masanori; Okuno, Tetsuro; Mise, Kazuyuki

2004-09-01

The natural variation of Arabidopsis thaliana in response to a bromovirus, Spring beauty latent virus (SBLV), was examined. Of 63 Arabidopsis accessions tested, all were susceptible when inoculated with SBLV, although there was a large degree of variation in symptom development. Most accessions, including Columbia (Col-0), were symptomless or developed only mild symptoms, but four accessions, including S96, showed severe symptoms of SBLV infection. Genetic analysis suggested that the difference in the responses of Col-0 and S96 to SBLV was controlled by a single semidominant locus. We have designated this locus SSB1 (symptom development by SBLV infection). By using genetic markers, SSB1 was mapped to chromosome IV. The patterns of distribution and accumulation of SBLV in sensitive accessions were similar to those in the insensitive accessions. In addition, symptom development in S96 by SBLV infection was critically interrupted by the presence of the NahG gene, which encodes salicylic acid (SA) hydroxylase. These data suggest that symptom development in A. thaliana controlled by SSB1 is independent of the efficiency of SBLV multiplication and is dependent on SA signaling.

Role of Charge Regulation and Size Polydispersity in Nanoparticle Encapsulation by Viral Coat Proteins

NARCIS (Netherlands)

Kusters, Remy; Lin, Hsiang-Ku; Zandi, Roya; Tsvetkova, Irina; Dragnea, Bogdan; van der Schoot, Paul

2015-01-01

Nanoparticles can be encapsulated by virus coat proteins if their surfaces are functionalized to acquire a sufficiently large negative charge. A minimal surface charge is required to overcome (i) repulsive interactions between the positively charged RNA-binding domains on the proteins and (ii) the

Occurrence and Distribution of Citrus tristeza virus (CTV in the Jordan Valley

Directory of Open Access Journals (Sweden)

G. Anfoka

2005-04-01

Full Text Available In a survey conducted in 2002 and 2003, Citrus tristeza virus (CTV was detected in the Jordan Valley. The direct tissue blot immunoassay (DTBIA indicated that 12.7 and 15.2% of samples tested in the central and northern Jordan Valley respectively were infected with CTV. Similar results showed that all citrus species grown in the Jordan Valley were susceptible to CTV. DAS-ELISA analysis of samples from a citrus orchard in the Dir Alla area with severe CTV symptoms indicated that 49% of samples were infected with CTV. Using a CTV specific primer pair (CTV1/CTV10, the coat protein gene of the virus was successfully amplified from leaf extracts obtained from CTVinfected trees by IC-RT-PCR. After cloning and sequencing the coat protein gene, the sequence of the amplified product was deposited in the GenBank.

The Coat Protein and NIa Protease of Two Potyviridae Family Members Independently Confer Superinfection Exclusion

Science.gov (United States)

French, Roy

2016-01-01

ABSTRACT Superinfection exclusion (SIE) is an antagonistic virus-virus interaction whereby initial infection by one virus prevents subsequent infection by closely related viruses. Although SIE has been described in diverse viruses infecting plants, humans, and animals, its mechanisms, including involvement of specific viral determinants, are just beginning to be elucidated. In this study, SIE determinants encoded by two economically important wheat viruses, Wheat streak mosaic virus (WSMV; genus Tritimovirus, family Potyviridae) and Triticum mosaic virus (TriMV; genus Poacevirus, family Potyviridae), were identified in gain-of-function experiments that used heterologous viruses to express individual virus-encoded proteins in wheat. Wheat plants infected with TriMV expressing WSMV P1, HC-Pro, P3, 6K1, CI, 6K2, NIa-VPg, or NIb cistrons permitted efficient superinfection by WSMV expressing green fluorescent protein (WSMV-GFP). In contrast, wheat infected with TriMV expressing WSMV NIa-Pro or coat protein (CP) substantially excluded superinfection by WSMV-GFP, suggesting that both of these cistrons are SIE effectors encoded by WSMV. Importantly, SIE is due to functional WSMV NIa-Pro or CP rather than their encoding RNAs, as altering the coded protein products by minimally changing RNA sequences led to abolishment of SIE. Deletion mutagenesis further revealed that elicitation of SIE by NIa-Pro requires the entire protein while CP requires only a 200-amino-acid (aa) middle fragment (aa 101 to 300) of the 349 aa. Strikingly, reciprocal experiments with WSMV-mediated expression of TriMV proteins showed that TriMV CP, and TriMV NIa-Pro to a lesser extent, likewise excluded superinfection by TriMV-GFP. Collectively, these data demonstrate that WSMV- and TriMV-encoded CP and NIa-Pro proteins are effectors of SIE and that these two proteins trigger SIE independently of each other. IMPORTANCE Superinfection exclusion (SIE) is an antagonistic virus-virus interaction that

The coat protein of Alternanthera mosaic virus is the elicitor of a temperature-sensitive systemic necrosis in Nicotiana benthamiana, and interacts with a host boron transporter protein

Energy Technology Data Exchange (ETDEWEB)

Lim, Hyoun-Sub, E-mail: hyounlim@cnu.ac.kr [Department of Applied Biology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Nam, Jiryun, E-mail: jilyoon@naver.com [Department of Applied Biology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Seo, Eun-Young, E-mail: sey22@cnu.ac.kr [Department of Applied Biology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Nam, Moon, E-mail: moonlit51@cnu.ac.kr [Department of Applied Biology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Vaira, Anna Maria, E-mail: a.vaira@ivv.cnr.it [Floral and Nursery Plants Research Unit, US National Arboretum, USDA-ARS, 10300 Baltimore Avenue B-010A, Beltsville, MD 20705 (United States); Istituto di Virologia Vegetale, CNR, Strada delle Cacce 73, Torino 10135 (Italy); Bae, Hanhong, E-mail: hanhongbae@ynu.ac.kr [School of Biotechnology, Yeungnam University, Geongsan 712-749 (Korea, Republic of); Jang, Chan-Yong, E-mail: sunbispirit@gmail.com [Department of Applied Biology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Lee, Cheol Ho, E-mail: chlee1219@hanmail.net [Department of Chemical and Biological Engineering, Seokyoung University, Seoul 136-704 (Korea, Republic of); Kim, Hong Gi, E-mail: hgkim@cnu.ac.kr [Department of Applied Biology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Roh, Mark, E-mail: marksroh@gmail.com [Floral and Nursery Plants Research Unit, US National Arboretum, USDA-ARS, 10300 Baltimore Avenue B-010A, Beltsville, MD 20705 (United States); Laboratory of Floriculture and Plant Physiology, School of Bio-Resource Science, Dankook University, Cheonan, Chungnam 330-714 (Korea, Republic of); Hammond, John, E-mail: john.hammond@ars.usda.gov [Floral and Nursery Plants Research Unit, US National Arboretum, USDA-ARS, 10300 Baltimore Avenue B-010A, Beltsville, MD 20705 (United States)

2014-03-15

Different isolates of Alternanthera mosaic virus (AltMV; Potexvirus), including four infectious clones derived from AltMV-SP, induce distinct systemic symptoms in Nicotiana benthamiana. Virus accumulation was enhanced at 15 °C compared to 25 °C; severe clone AltMV 3-7 induced systemic necrosis (SN) and plant death at 15 °C. No interaction with potexvirus resistance gene Rx was detected, although SN was ablated by silencing of SGT1, as for other cases of potexvirus-induced necrosis. Substitution of AltMV 3-7 coat protein (CP{sub SP}) with that from AltMV-Po (CP{sub Po}) eliminated SN at 15 °C, and ameliorated symptoms in Alternanthera dentata and soybean. Substitution of only two residues from CP{sub Po} [either MN(13,14)ID or LA(76,77)IS] efficiently ablated SN in N. benthamiana. CP{sub SP} but not CP{sub Po} interacted with Arabidopsis boron transporter protein AtBOR1 by yeast two-hybrid assay; N. benthamiana homolog NbBOR1 interacted more strongly with CP{sub SP} than CP{sub Po} in bimolecular fluorescence complementation, and may affect recognition of CP as an elicitor of SN. - Highlights: • Alternanthera mosaic virus CP is an elicitor of systemic necrosis in N. benthamiana. • Virus-induced systemic necrosis is enhanced at 15 °C compared to 25 °C. • Induction of systemic necrosis is dependent on as few as two CP amino acid residues. • These residues are at subunit interfaces within the same turn of the virion helix. • Inducer/non-inducer CPs interact differentially with a boron transporter protein.

PREFACE The physics of virus assembly The physics of virus assembly

Science.gov (United States)

Stockley, Peter G.; Twarock, Reidun

2010-12-01

Viruses are pathogens in every kingdom of life and are major causes of human disease and suffering. They are known to encompass a size range that overlaps with that of the smallest bacterial cells, and the largest viruses now seem to be hosts of their own viral pathogens. Recent genomic sequencing efforts show that many organisms have genes that are likely to be descended in evolution from viral progenitors. Even more astonishingly, analysis of the world's oceans has shown that some of the simplest viruses, the tailed dsDNA phages, are the most common biological entities on the planet, with estimates of their numbers ranging up to 1031, with ~ 1021 infection events every second, leading to a turnover of around 20% of the biomass in the sea every few days. These cycles of infection and lysis of oceanic bacteria and algae provide the nutrients for the smallest organisms lying at the bottom of the food chain. Without viruses, therefore, life on Earth would probably not be sustainable. These are remarkable facts for systems that are non-living in the strict sense, and are composed of simple materials—nucleic acids, proteins and lipids. Many viruses consist of little more than a protective protein coat surrounding their genomic nucleic acids, which can be either DNA or RNA. Their simplicity leads to highly symmetrical structures with protein containers based on helical or icosahedral lattices. Many simple viruses self-assemble rapidly and with great fidelity, and many groups are busy trying to exploit these properties to make virus-like particles for a wide range of applications, including targeted drug-delivery, medical imaging and even novel materials. This issue of Physical Biology contains a series of papers describing some of the latest experimental and theoretical research on viruses, their structures and assembly, as well as their regulated disassembly during infection. These range from a dissection of the in vivo assembly mechanism of a filamentous virus

Expression and purification of coat protein of citrus tristeza virus ...

African Journals Online (AJOL)

CTV coat protein gene (CTV-cp) cloned in pQE30 vector and transformed to DH5α containing 666bp long from Thailand MK-50 isolate was amplified with a forward primer CTV-CP1 (5' CAC CGA CGA AAC AAA GAA ATT GAA GAA CA 3') and a reverse primer CTVCP2 (5' TCA ACG TGT GTT AAA TTT CCC AAG C 3') and ...

Extension of the ELISA method to the measurement of the specific radioactivity of viruses in crude cellular extracts

Energy Technology Data Exchange (ETDEWEB)

Konate, G; Fritig, B [Institut de Biologie Moleculaire et Cellulaire, 67-Strasbourg (France). Lab. de Virologie

1983-06-01

The double-antibody sandwich method of ELISA, which allows accurate quantitative determination of plant viruses, was extended to a radiochemical procedure which permits direct measurement of the specific radioactivity of virus labelled in vivo and present in very crude plant homogenates. Evidence is presented showing that 20 to 50% of the virus introduced in the polystyrene wells during the antigen incubation step could be trapped in the sandwich. The percentage of virus bound increased with the concentration of the coating antibody and was almost proportional to the concentration of the antigen and to the incubation time of the antigens. Complete dissociation of the double-antibody sandwich was achieved by incubation with 0.2 M KOH or NaOH (pH 13.3), and the label carried by the virus was measured by scintillation counting of the solubilization fluid. The ratio infected/healthy was much higher for the radiochemical procedure than for the immunosorbent assay itself since binding of the virus to the coating antibody was not accompanied by any nonspecific trapping of radioactive contaminants in the double-antibody sandwich. The procedure was highly sensitive since the background corresponded to the scintillation counting background. The detection of the label carried by tobacco mosaic virus was possible when the tobacco samples contained at least 5 ng of virus carrying a label as low as 40 dpm /sup 3/H or 20 dpm /sup 14/C.

Highly specific salt bridges govern bacteriophage P22 icosahedral capsid assembly: identification of the site in coat protein responsible for interaction with scaffolding protein.

Science.gov (United States)

Cortines, Juliana R; Motwani, Tina; Vyas, Aashay A; Teschke, Carolyn M

2014-05-01

Icosahedral virus assembly requires a series of concerted and highly specific protein-protein interactions to produce a proper capsid. In bacteriophage P22, only coat protein (gp5) and scaffolding protein (gp8) are needed to assemble a procapsid-like particle, both in vivo and in vitro. In scaffolding protein's coat binding domain, residue R293 is required for procapsid assembly, while residue K296 is important but not essential. Here, we investigate the interaction of scaffolding protein with acidic residues in the N-arm of coat protein, since this interaction has been shown to be electrostatic. Through site-directed mutagenesis of genes 5 and 8, we show that changing coat protein N-arm residue 14 from aspartic acid to alanine causes a lethal phenotype. Coat protein residue D14 is shown by cross-linking to interact with scaffolding protein residue R293 and, thus, is intimately involved in proper procapsid assembly. To a lesser extent, coat protein N-arm residue E18 is also implicated in the interaction with scaffolding protein and is involved in capsid size determination, since a cysteine mutation at this site generated petite capsids. The final acidic residue in the N-arm that was tested, E15, is shown to only weakly interact with scaffolding protein's coat binding domain. This work supports growing evidence that surface charge density may be the driving force of virus capsid protein interactions. Bacteriophage P22 infects Salmonella enterica serovar Typhimurium and is a model for icosahedral viral capsid assembly. In this system, coat protein interacts with an internal scaffolding protein, triggering the assembly of an intermediate called a procapsid. Previously, we determined that there is a single amino acid in scaffolding protein required for P22 procapsid assembly, although others modulate affinity. Here, we identify partners in coat protein. We show experimentally that relatively weak interactions between coat and scaffolding proteins are capable of driving

Distribution and molecular detection of apple mosaic virus in apple ...

African Journals Online (AJOL)

... pair for real time polymerase chain reaction (RT-PCR) detection of coat protein gene for Turkish ApMV isolates. Apple mosaic virus isolates were collected in 2007 to 2010 and the presence of the pathogen was detected by double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) and RT-PCR tests.

Serological and molecular studies of a novel virus isolate causing yellow mosaic of Patchouli [Pogostemon cablin (Blanco) Benth].

Science.gov (United States)

Zaim, Mohammad; Ali, Ashif; Joseph, Jomon; Khan, Feroz

2013-01-01

Here we have identified and characterized a devastating virus capable of inducing yellow mosaic on the leaves of Patchouli [Pogostemon cablin (Blanco) Benth]. The diagnostic tools used were host range, transmission studies, cytopathology, electron microscopy, serology and partial coat protein (CP) gene sequencing. Evidence from biological, serological and sequence data suggested that the causal virus belonged to genus Potyvirus, family Potyviridae. The isolate, designated as Patchouli Yellow Mosaic Virus (PaYMV), was transmitted through grafting, sap and the insect Myzus persicae (Sulz.). Flexuous rod shaped particles with a mean length of 800 nm were consistently observed in leaf-dip preparations from natural as well as alternate hosts, and in purified preparation. Cytoplasmic cylindrical inclusions, pinwheels and laminar aggregates were observed in ultra-thin sections of infected patchouli leaves. The purified capsid protein has a relative mass of 43 kDa. Polyclonal antibodies were raised in rabbits against the coat protein separated on SDS - PAGE; which were used in ELISA and western blotting. Using specific antibodies in ELISA, PaYMV was frequently detected at patchouli plantations at Lucknow and Bengaluru. Potyvirus-specific degenerate primer pair (U335 and D335) had consistently amplified partial CP gene from crude preparations of infected tissues by reverse transcription polymerase chain reaction (RT-PCR). Comparison of the PCR product sequence (290 bp) with the corresponding regions of established potyviruses showed 78-82% and 91-95% sequence similarity at the nucleotide and amino acid levels, respectively. The results clearly established that the virus under study has close homology with watermelon mosaic virus (WMV) in the coat protein region and therefore could share a common ancestor family. Further studies are required to authenticate the identity of PaYMV as a distinct virus or as an isolate of WMV.

The detection of HBV DNA with gold-coated iron oxide nanoparticle gene probes

International Nuclear Information System (INIS)

Xi Dong; Luo Xiaoping; Lu Qianghua; Yao Kailun; Liu Zuli; Ning Qin

2008-01-01

Gold-coated iron oxide nanoparticle Hepatitis B virus (HBV) DNA probes were prepared, and their application for HBV DNA measurement was studied. Gold-coated iron oxide nanoparticles were prepared by the citrate reduction of tetra-chloroauric acid in the presence of iron oxide nanoparticles which were added as seeds. With a fluorescence-based method, the maximal surface coverage of hexaethiol 30-mer oligonucleotides and the maximal percentage of hybridization strands on gold-coated iron oxide nanoparticles were (120 ± 8) oligonucleotides per nanoparticle, and (14 ± 2%), respectively, which were comparable with those of (132 ± 10) and (22 ± 3%) in Au nanoparticle groups. Large network aggregates were formed when gold-coated iron oxide nanoparticle HBV DNA gene probe was applied to detect HBV DNA molecules as evidenced by transmission electron microscopy and the high specificity was verified by blot hybridization. Our results further suggested that detecting DNA with iron oxide nanoparticles and magnetic separator was feasible and might be an alternative effective method

Rapid immunohistochemical diagnosis of tobacco mosaic virus disease by microwave-assisted plant sample preparation

Science.gov (United States)

Zellnig, Günther; Möstl, Stefan; Zechmann, Bernd

2013-01-01

Immunoelectron microscopy is a powerful method to diagnose viral diseases and to study the distribution of the viral agent within plant cells and tissues. Nevertheless, current protocols for the immunological detection of viral diseases with transmission electron microscopy (TEM) in plants take between 3 and 6 days and are therefore not suited for rapid diagnosis of virus diseases in plants. In this study, we describe a method that allows rapid cytohistochemical detection of tobacco mosaic virus (TMV) in leaves of tobacco plants. With the help of microwave irradiation, sample preparation of the leaves was reduced to 90 min. After sample sectioning, virus particles were stained on the sections by immunogold labelling of the viral coat protein, which took 100 min. After investigation with the TEM, a clear visualization of TMV in tobacco cells was achieved altogether in about half a day. Comparison of gold particle density by image analysis revealed that samples prepared with the help of microwave irradiation yielded significantly higher gold particle density as samples prepared conventionally at room temperature. This study clearly demonstrates that microwave-assisted plant sample preparation in combination with cytohistochemical localization of viral coat protein is well suited for rapid diagnosis of plant virus diseases in altogether about half a day by TEM. PMID:23580761

Nucleotide and amino acid sequences of a coat protein of an Ukrainian isolate of Potato virus Y: comparison with homologous sequences of other isolates and phylogenetic analysis

Directory of Open Access Journals (Sweden)

Budzanivska I. G.

2014-03-01

Full Text Available Aim. Identification of the widespread Ukrainian isolate(s of PVY (Potato virus Y in different potato cultivars and subsequent phylogenetic analysis of detected PVY isolates based on NA and AA sequences of coat protein. Methods. ELISA, RT-PCR, DNA sequencing and phylogenetic analysis. Results. PVY has been identified serologically in potato cultivars of Ukrainian selection. In this work we have optimized a method for total RNA extraction from potato samples and offered a sensitive and specific PCR-based test system of own design for diagnostics of the Ukrainian PVY isolates. Part of the CP gene of the Ukrainian PVY isolate has been sequenced and analyzed phylogenetically. It is demonstrated that the Ukrainian isolate of Potato virus Y (CP gene has a higher percentage of homology with the recombinant isolates (strains of this pathogen (approx. 98.8– 99.8 % of homology for both nucleotide and translated amino acid sequences of the CP gene. The Ukrainian isolate of PVY is positioned in the separate cluster together with the isolates found in Syria, Japan and Iran; these isolates possibly have common origin. The Ukrainian PVY isolate is confirmed to be recombinant. Conclusions. This work underlines the need and provides the means for accurate monitoring of Potato virus Y in the agroecosystems of Ukraine. Most importantly, the phylogenetic analysis demonstrated the recombinant nature of this PVY isolate which has been attributed to the strain group O, subclade N:O.

Diverse amino acid changes at specific positions in the N-terminal region of the coat protein allow Plum pox virus to adapt to new hosts.

Science.gov (United States)

Carbonell, Alberto; Maliogka, Varvara I; Pérez, José de Jesús; Salvador, Beatriz; León, David San; García, Juan Antonio; Simón-Mateo, Carmen

2013-10-01

Plum pox virus (PPV)-D and PPV-R are two isolates from strain D of PPV that differ in host specificity. Previous analyses of chimeras originating from PPV-R and PPV-D suggested that the N terminus of the coat protein (CP) includes host-specific pathogenicity determinants. Here, these determinants were mapped precisely by analyzing the infectivity in herbaceous and woody species of chimeras containing a fragment of the 3' region of PPV-D (including the region coding for the CP) in a PPV-R backbone. These chimeras were not infectious in Prunus persica, but systemically infected Nicotiana clevelandii and N. benthamiana when specific amino acids were modified or deleted in a short 30-amino-acid region of the N terminus of the CP. Most of these mutations did not reduce PPV fitness in Prunus spp. although others impaired systemic infection in this host. We propose a model in which the N terminus of the CP, highly relevant for virus systemic movement, is targeted by a host defense mechanism in Nicotiana spp. Mutations in this short region allow PPV to overcome the defense response in this host but can compromise the efficiency of PPV systemic movement in other hosts such as Prunus spp.

tRNA-like structure regulates translation of Brome mosaic virus RNA.

Science.gov (United States)

Barends, Sharief; Rudinger-Thirion, Joëlle; Florentz, Catherine; Giegé, Richard; Pleij, Cornelis W A; Kraal, Barend

2004-04-01

For various groups of plant viruses, the genomic RNAs end with a tRNA-like structure (TLS) instead of the 3' poly(A) tail of common mRNAs. The actual function of these TLSs has long been enigmatic. Recently, however, it became clear that for turnip yellow mosaic virus, a tymovirus, the valylated TLS(TYMV) of the single genomic RNA functions as a bait for host ribosomes and directs them to the internal initiation site of translation (with N-terminal valine) of the second open reading frame for the polyprotein. This discovery prompted us to investigate whether the much larger TLSs of a different genus of viruses have a comparable function in translation. Brome mosaic virus (BMV), a bromovirus, has a tripartite RNA genome with a subgenomic RNA4 for coat protein expression. All four RNAs carry a highly conserved and bulky 3' TLS(BMV) (about 200 nucleotides) with determinants for tyrosylation. We discovered TLS(BMV)-catalyzed self-tyrosylation of the tyrosyl-tRNA synthetase but could not clearly detect tyrosine incorporation into any virus-encoded protein. We established that BMV proteins do not need TLS(BMV) tyrosylation for their initiation. However, disruption of the TLSs strongly reduced the translation of genomic RNA1, RNA2, and less strongly, RNA3, whereas coat protein expression from RNA4 remained unaffected. This aberrant translation could be partially restored by providing the TLS(BMV) in trans. Intriguingly, a subdomain of the TLS(BMV) could even almost fully restore translation to the original pattern. We discuss here a model with a central and dominant role for the TLS(BMV) during the BMV infection cycle.

Thermally joining and/or coating or thermally separating the workpieces having heat-sensitive coating, comprises restoring coating by thermally coating the coating material after thermally joining and/or coating or thermally separating

OpenAIRE

Riedel, Frank; Winkelmann, Ralf; Puschmann, Markus

2011-01-01

The method for thermally joining and/or coating or thermally separating the workpieces (1), which have a heat-sensitive coating (2), comprises restoring the coating by thermally coating a coating material (3) after thermally joining and/or coating or thermally separating the workpieces. A part of the thermal energy introduced in the workpiece for joining and/or coating or separating or in the workpieces is used for thermally coating the coating material. Two workpieces are welded or soldered ...

HIV-1 Nef hijacks clathrin coats by stabilizing AP-1:Arf1 polygons.

Science.gov (United States)

Shen, Qing-Tao; Ren, Xuefeng; Zhang, Rui; Lee, Il-Hyung; Hurley, James H

2015-10-23

The lentiviruses HIV and simian immunodeficiency virus (SIV) subvert intracellular membrane traffic as part of their replication cycle. The lentiviral Nef protein helps viruses evade innate and adaptive immune defenses by hijacking the adaptor protein 1 (AP-1) and AP-2 clathrin adaptors. We found that HIV-1 Nef and the guanosine triphosphatase Arf1 induced trimerization and activation of AP-1. Here we report the cryo-electron microscopy structures of the Nef- and Arf1-bound AP-1 trimer in the active and inactive states. A central nucleus of three Arf1 molecules organizes the trimers. We combined the open trimer with a known dimer structure and thus predicted a hexagonal assembly with inner and outer faces that bind the membranes and clathrin, respectively. Hexagons were directly visualized and the model validated by reconstituting clathrin cage assembly. Arf1 and Nef thus play interconnected roles in allosteric activation, cargo recruitment, and coat assembly, revealing an unexpectedly intricate organization of the inner AP-1 layer of the clathrin coat. Copyright © 2015, American Association for the Advancement of Science.

Protein synthesis directed by cowpea mosaic virus RNAs

International Nuclear Information System (INIS)

Stuik, E.

1979-01-01

The thesis concerns the proteins synthesized under direction of Cowpea mosaic virus RNAs. Sufficient radioactive labelling of proteins was achieved when 35 S as sulphate was administered to intact Vigna plants, cultivated in Hoagland solution. The large polypeptides synthesized under direction of B- and M-RNA are probably precursor molecules from which the coat proteins are generated by a mechanism of posttranslational cleavage. (Auth.)

Nucleotide sequence of a chickpea chlorotic stunt virus relative that infects pea and faba bean in China.

Science.gov (United States)

Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

2012-07-01

We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were Polerovirus, and the name pea mild chlorosis virus is proposed.

Sensitive radioimmunoassay for the determination of antibodies to mouse hepatitis virus

Energy Technology Data Exchange (ETDEWEB)

Leibowitz, J L [California Univ., San Diego, La Jolla (USA); Fung, L S; Levy, G A [Toronto Univ., Ontario (Canada)

1983-05-01

A solid-phase radioimmunoassay is described for the detection of antibodies to mouse hepatitis virus. Viruses were purified by velocity and isopycnic gradient centrifugation and 96-well plastic plates were coated with viral antigens. To allow the detection of most serotypes of low titered antisera, a pool of antigens from several viral serotypes were employed. The second antibody, an affinity-purified goat antimouse immunoglobulin, detects IgG, IgM and IgA antibodies. This assay is more sensitive than either the plaque reduction assay or the commercially available enzyme-linked immunosorbant assay and proved to be useful for screening mouse colonies for the presence of mouse hepatitis virus, following seroconversion in experimental animals and in the production of monoclonal antibodies to both structural and nonstructural proteins.

Recognition of cis-acting sequences in RNA 3 of Prunus necrotic ringspot virus by the replicase of Alfalfa mosaic virus.

Science.gov (United States)

Aparicio, F; Sánchez-Navarro, J A; Olsthoorn, R C; Pallás, V; Bol, J F

2001-04-01

Alfalfa mosaic virus (AMV) and Prunus necrotic ringspot virus (PNRSV) belong to the genera ALFAMOVIRUS: and ILARVIRUS:, respectively, of the family BROMOVIRIDAE: Initiation of infection by AMV and PNRSV requires binding of a few molecules of coat protein (CP) to the 3' termini of the inoculum RNAs and the CPs of the two viruses are interchangeable in this early step of the replication cycle. CIS:-acting sequences in PNRSV RNA 3 that are recognized by the AMV replicase were studied in in vitro replicase assays and by inoculation of AMV-PNRSV RNA 3 chimeras to tobacco plants and protoplasts transformed with the AMV replicase genes (P12 plants). The results showed that the AMV replicase recognized the promoter for minus-strand RNA synthesis in PNRSV RNA 3 but not the promoter for plus-strand RNA synthesis. A chimeric RNA with PNRSV movement protein and CP genes accumulated in tobacco, which is a non-host for PNRSV.

Survey of Viruses Present in Radish Fields in 2014

Directory of Open Access Journals (Sweden)

Jinsoo Chung

2015-09-01

Full Text Available A 2014 nationwide survey in radish fields investigated the distribution of common viruses and possible emerging viruses. Radish leaves with virus-like symptoms were collected and 108 samples assayed by RT-PCR using specific primers for Radish mosaic virus (RaMV, Cucumber mosaic virus (CMV, and Turnip mosaic virus (TuMV; 47 samples were TuMV positive, and RaMV and CMV were detected in 3 and 2 samples, respectively. No samples showed double infection of TuMV/RaMV, or RaMV/CMV, but two double infections of TuMV/CMV were detected. TuMV isolates were sorted by symptom severity, and three isolates (R007-mild; R041 and R065-severe selected for BLAST and phylogenetic analysis, which indicated that the coat protein (CP of these isolates (R007, R041, and R065 have approx. 98-99% homology to a previously reported TuMV isolate. RaMV CP showed approx. 99% homology to a previously reported isolate, and the CMV CP is identical to a previously reported Korean isolate (GenBank : GU327368. Three isolates of TuMV showing different pathogenicity (degree of symptom severity will be valuable to study determinants of pathogenicity.

Frequency and Molecular Characterization of Watermelon Mosaic Virus from Serbia

Directory of Open Access Journals (Sweden)

Ana Vučurović

2010-01-01

Full Text Available Watermelon mosaic virus (WMV is widespread in cucurbit crops, most commonly occuring in temperate and Mediterranean regions. In Serbia WMV has been detected in single and mixed infections with Zucchini yellow mosaic virus and Cucumber mosaic virus in field-grown pumpkin and squash crops. Among pumpkin-affecting viruses WMV is the most frequent one, both by the number of localities and its incidence at each location. During the growing season of 2009, samples from 583 plants of Cucurbita pepo cvs. Olinka, Belgrade zucchini and Tosca (Zucchini group, as well as from C. maxima and C. moschata showing symptoms of virus infection were collected from 12 commercial fields at eight localities and analyzed by DAS-ELISA using polyclonal antisera specific to six most important cucurbit viruses. Interestingly, WMV was detected at fewer sites and had lower ncidence rate than in two previous years. In single infections, WMV was found in 11% of tested plants in three fields; in mixed infections with ZYMV, it was recorded in 9.9% of plants in five fields and with CMV in only 0.2% in one field. The partial coat protein gene and 3’ non-translated region from two representativeisolates of WMV originating from different localities and host plant species were amplified by RT-PCR, sequenced, and compared with the sequences available in GenBank database. The PCR-amplified fragment of predicted size of approximately 1017 bp was obtained. The sequences of isolates 137-08 (Acc. No. GQ259958 and 159-08 (GU144020 proved to be 94-99% identical at the nucleotide level with those from other parts of the world. The sequences of these two isolates differed from each other only at two nucleotide positions, without any amino acid substitution. Phylogenetic analysis of 57 isolates based on 750 bp sequences of the coat protein gene showed no correlation between isolates and their geographic origin, and italso indicated that these isolates fell into three molecular groups of

PENGKLONAN DAN PERUNUTAN NUKLEOTIDA GEN SELUBUNG PROTEIN DAN 3’UTR (untranslated region PEANUT STRIPE VIRUS

Directory of Open Access Journals (Sweden)

Hasriadi Mat Akin

2011-10-01

Full Text Available Cloning and sequencing of coat protein gene and 3’UTR (untranslated region of peanut stripe virus. The cDNA of 3' terminal of peanut stripe virus genomic RNA was cloned and sequenced. The cDNA was ligated with plasmid vector pGEM-T Easy and transformed to competent cells of Escherichia coli. The 3' terminal of PstV genomic RNA contained 1195 nucleotides (nts.  The region included the nucleotide sequences of NIb (nuclear inclusion body (129 nts, CP gene (coat protein gene (861 nts, and 3'UTR (untranslated region (205 nts. The nucleotide sequence of a CP gene contained one long uninterrupted open reading frame (ORF without a start codon, which ended a UAG stop codon. The 287 amino acid residues of PStV coat protein were predicted from the CP gene.  The amino acid was analyzed for the presence of consensus polyprotein cleavage site for maturation of potyvirus polyprotein.  A putative cleavage site was found at position 43 (Q/S following the Valine (V residue at -4 position.  This isolate of PstV can be expected to be aphid transmissible because the coat protein contained a DAG triplet at position 53-55.

pH-Dependent Formation and Disintegration of the Influenza A Virus Protein Scaffold To Provide Tension for Membrane Fusion.

Science.gov (United States)

Batishchev, O V; Shilova, L A; Kachala, M V; Tashkin, V Y; Sokolov, V S; Fedorova, N V; Baratova, L A; Knyazev, D G; Zimmerberg, J; Chizmadzhev, Y A

2016-01-01

Influenza virus is taken up from a pH-neutral extracellular milieu into an endosome, whose contents then acidify, causing changes in the viral matrix protein (M1) that coats the inner monolayer of the viral lipid envelope. At a pH of ~6, M1 interacts with the viral ribonucleoprotein (RNP) in a putative priming stage; at this stage, the interactions of the M1 scaffold coating the lipid envelope are intact. The M1 coat disintegrates as acidification continues to a pH of ~5 to clear a physical path for the viral genome to transit from the viral interior to the cytoplasm. Here we investigated the physicochemical mechanism of M1's pH-dependent disintegration. In neutral media, the adsorption of M1 protein on the lipid bilayer was electrostatic in nature and reversible. The energy of the interaction of M1 molecules with each other in M1 dimers was about 10 times as weak as that of the interaction of M1 molecules with the lipid bilayer. Acidification drives conformational changes in M1 molecules due to changes in the M1 charge, leading to alterations in their electrostatic interactions. Dropping the pH from 7.1 to 6.0 did not disturb the M1 layer; dropping it lower partially desorbed M1 because of increased repulsion between M1 monomers still stuck to the membrane. Lipid vesicles coated with M1 demonstrated pH-dependent rupture of the vesicle membrane, presumably because of the tension generated by this repulsive force. Thus, the disruption of the vesicles coincident with M1 protein scaffold disintegration at pH 5 likely stretches the lipid membrane to the point of rupture, promoting fusion pore widening for RNP release. Influenza remains a top killer of human beings throughout the world, in part because of the influenza virus's rapid binding to cells and its uptake into compartments hidden from the immune system. To attack the influenza virus during this time of hiding, we need to understand the physical forces that allow the internalized virus to infect the cell. In

Development of transgenic watermelon resistant to Cucumber mosaic virus and Watermelon mosaic virus by using a single chimeric transgene construct.

Science.gov (United States)

Lin, Ching-Yi; Ku, Hsin-Mei; Chiang, Yi-Hua; Ho, Hsiu-Yin; Yu, Tsong-Ann; Jan, Fuh-Jyh

2012-10-01

Watermelon, an important fruit crop worldwide, is prone to attack by several viruses that often results in destructive yield loss. To develop a transgenic watermelon resistant to multiple virus infection, a single chimeric transgene comprising a silencer DNA from the partial N gene of Watermelon silver mottle virus (WSMoV) fused to the partial coat protein (CP) gene sequences of Cucumber mosaic virus (CMV), Cucumber green mottle mosaic virus (CGMMV) and Watermelon mosaic virus (WMV) was constructed and transformed into watermelon (cv. Feeling) via Agrobacterium-mediated transformation. Single or multiple transgene copies randomly inserted into various locations in the genome were confirmed by Southern blot analysis. Transgenic watermelon R(0) plants were individually challenged with CMV, CGMMV or WMV, or with a mixture of these three viruses for resistance evaluation. Two lines were identified to exhibit resistance to CMV, CGMMV, WMV individually, and a mixed inoculation of the three viruses. The R(1) progeny of the two resistant R(0) lines showed resistance to CMV and WMV, but not to CGMMV. Low level accumulation of transgene transcripts in resistant plants and small interfering (si) RNAs specific to CMV and WMV were readily detected in the resistant R(1) plants by northern blot analysis, indicating that the resistance was established via RNA-mediated post-transcriptional gene silencing (PTGS). Loss of the CGMMV CP-transgene fragment in R1 progeny might be the reason for the failure to resistant CGMMV infection, as shown by the absence of a hybridization signal and no detectable siRNA specific to CGMMV in Southern and northern blot analyses. In summary, this study demonstrated that fusion of different viral CP gene fragments in transgenic watermelon contributed to multiple virus resistance via PTGS. The construct and resistant watermelon lines developed in this study could be used in a watermelon breeding program for resistance to multiple viruses.

Stability and assembly in vitro of bacteriophage PP7 virus-like particles

Directory of Open Access Journals (Sweden)

Peabody David S

2007-11-01

Full Text Available Abstract Background The stability of a virus-like particle (VLP is an important consideration for its use in nanobiotechnology. The icosahedral capsid of the RNA bacteriophage PP7 is cross-linked by disulfide bonds between coat protein dimers at its 5-fold and quasi-6-fold symmetry axes. This work determined the effects of these disulfides on the VLP's thermal stability. Results Measurements of the thermal denaturation behavior of PP7 VLPs in the presence and absence of a reducing agent show that disulfide cross-links substantially stabilize them against thermal denaturation. Although dimers in the capsid are linked to one another by disulfides, the two subunits of dimers themselves are held together only by non-covalent interactions. In an effort to confer even greater stability a new cross-link was introduced by genetically fusing two coat protein monomers, thus producing a "single-chain dimer" that assembles normally into a completely cross-linked VLP. However, subunit fusion failed to increase the thermal stability of the particles, even though it stabilized the isolated dimer. As a step toward gaining control of the internal composition of the capsid, conditions that promote the assembly of PP7 coat protein dimers into virus-like particles in vitro were established. Conclusion The presence of inter-dimer disulfide bonds greatly stabilizes the PP7 virus-like particle against thermal denaturation. Covalently cross-linking the subunits of the dimers themselves by genetically fusing them through a dipeptide linker sequence, offers no further stabilization of the VLP, although it does stabilize the dimer. PP7 capsids readily assemble in vitro in a reaction that requires RNA.

The influence of the N- and C- terminal modifications of Potato virus X coat protein on virus properties

Czech Academy of Sciences Publication Activity Database

Hoffmeisterová, Hana; Moravec, Tomáš; Plchová, Helena; Folwarczna, Jitka; Čeřovská, Noemi

2012-01-01

Roč. 56, č. 4 (2012), s. 775-779 ISSN 0006-3134 R&D Projects: GA ČR GA521/09/1525 Institutional research plan: CEZ:AV0Z50380511 Keywords : chimeric coat protein * expression of recombinant protein * Nicotiana benthamiana Subject RIV: EI - Biotechnology ; Bionics Impact factor: 1.692, year: 2012

Coated microneedle arrays for transcutaneous delivery of live virus vaccines

OpenAIRE

Vrdoljak, Anto; McGrath, Marie G.; Carey, John B.; Draper, Simon J.; Hill, Adrian V.S.; O’Mahony, Conor; Crean, Abina M.; Moore, Anne C.

2011-01-01

Vaccines are sensitive biologics that require continuous refrigerated storage to maintain their viability. The vast majority of vaccines are also administered using needles and syringes. The need for cold chain storage and the significant logistics surrounding needle-and-syringe vaccination is constraining the success of immunization programs. Recombinant live viral vectors are a promising platform for the development of vaccines against a number of infectious diseases, however these viruses ...

Role of alfalfa mosaic virus coat protein gene in symptom formation

NARCIS (Netherlands)

Neeleman, L.; van der Kuyl, A. C.; Bol, J. F.

1991-01-01

On Samsun NN tobacco plants strains 425 and YSMV of alfalfa mosaic virus (AIMV) cause mild chlorosis and local necrotic lesions, respectively. DNA copies of RNA3 of both strains were transcribed in vitro into infectious RNA molecules. When the 425 and YSMV transcripts were inoculated to tobacco

Maize rayado fino virus capsid proteins assemble into virus-like particles in Escherichia coli.

Science.gov (United States)

Hammond, Rosemarie W; Hammond, John

2010-02-01

Maize rayado fino virus (MRFV; genus Marafivirus; family Tymoviridae) is an isometric plant virus of 30 nm containing two components: empty shells and complete virus particles (encapsidating the 6.3 kb genomic RNA). Both particles are composed of two serologically related, carboxy co-terminal, coat proteins (CP) of apparent molecular mass 21-22 kDa (CP2) and 24-28 kDa (CP1) in a molar ratio of 3:1, respectively; CP1 contains a 37 amino acid amino terminal extension of CP2. In our study, expression of CP1 or CP2 in Escherichia coli resulted in assembly of each capsid protein into virus-like particles (VLPs), appearing in electron microscopy as stain-permeable (CP2) or stain-impermeable particles (CP1). CP1 VLPs encapsidated bacterial 16S ribosomal RNA, but not CP mRNA, while CP2 VLPs encapsidated neither CP mRNA nor 16S ribosomal RNA. Expression of CP1 and CP2 in E. coli using a co-expression vector resulted in the assembly of VLPs which were stain-impermeable and encapsidated CP mRNA. These results suggest that the N-terminal 37 amino acid residues of CP1, although not required for particle formation, may be involved in the assembly of complete virions and that the presence of both CP1 and CP2 in the particle is required for specific encapsidation of MRFV CP mRNA. (c) 2009 Elsevier B.V. All rights reserved.

RNASEK Is a V-ATPase-Associated Factor Required for Endocytosis and the Replication of Rhinovirus, Influenza A Virus, and Dengue Virus

Directory of Open Access Journals (Sweden)

Jill M. Perreira

2015-08-01

Full Text Available Human rhinovirus (HRV causes upper respiratory infections and asthma exacerbations. We screened multiple orthologous RNAi reagents and identified host proteins that modulate HRV replication. Here, we show that RNASEK, a transmembrane protein, was needed for the replication of HRV, influenza A virus, and dengue virus. RNASEK localizes to the cell surface and endosomal pathway and closely associates with the vacuolar ATPase (V-ATPase proton pump. RNASEK is required for endocytosis, and its depletion produces enlarged clathrin-coated pits (CCPs at the cell surface. These enlarged CCPs contain endocytic cargo and are bound by the scissioning GTPase, DNM2. Loss of RNASEK alters the localization of multiple V-ATPase subunits and lowers the levels of the ATP6AP1 subunit. Together, our results show that RNASEK closely associates with the V-ATPase and is required for its function; its loss prevents the early events of endocytosis and the replication of multiple pathogenic viruses.

A sensitive radioimmunoassay for the determination of antibodies to mouse hepatitis virus

International Nuclear Information System (INIS)

Leibowitz, J.L.; Fung, L.S.; Levy, G.A.

1983-01-01

A solid-phase radioimmunoassay is described for the detection of antibodies to mouse hepatitis virus. Viruses were purified by velocity and isopycnic gradient centrifugation and 96-well plastic plates were coated with viral antigens. To allow the detection of most serotypes of low titered antisera, a pool of antigens from several viral serotypes were employed. The second antibody, an affinity-purified goat antimouse immunoglobulin, detects IgG, IgM and IgA antibodies. This assay is more sensitive than either the plaque reduction assay or the commercially available enzyme-linked immunosorbant assay and proved to be useful for screening mouse colonies for the presence of mouse hepatitis virus, following seroconversion in experimental animals and in the production of monoclonal antibodies to both structural and nonstructural proteins. (Auth.)

Allergenicity assessment of genetically modified cucumber mosaic virus (CMV) resistant tomato (Solanum lycopersicon).

Science.gov (United States)

Lin, Chih-Hui; Sheu, Fuu; Lin, Hsin-Tang; Pan, Tzu-Ming

2010-02-24

Cucumber mosaic virus (CMV) has been identified as the causal agent of several disease epidemics in most countries of the world. Insect-mediated virus diseases, such as those caused by CMV, caused remarkable loss of tomato (Solanum lycopersicon) production in Taiwan. With expression of the CMV coat protein gene (Cmvcp) in a local popular tomato cultivar L4783, transgenic tomato line R8 has showed consistent CMV resistance through T(0) to T(8). In this report, the allergenicity of the CMV coat protein (CMV cp) expressed in transgenic tomato R8 was assessed by investigation of the expression of the transgene source of protein, sequence similarity with known allergens, and resistance to pepsin hydrolysis. There is no known account for either the CMV or its coat protein being an allergen. The result of a bioinformatic search also showed no significant homology between CMV cp and any known allergen. The pepsin-susceptible property of recombinant CMV cp was revealed by a simulated gastric fluid (SGF) assay. Following the most recent FAO/WHO decision tree, all results have indicated that CMV cp was a protein with low possibility to be an allergen and the transgenic tomato R8 should be considered as safe as its host.

RNA virus interference via CRISPR/Cas13a system in plants

KAUST Repository

Aman, Rashid

2017-11-04

CRISPR/Cas systems confer immunity against invading nucleic acids and phages in bacteria and archaea. CRISPR/Cas13a (known previously as C2c2) is a class 2 type VI-A ribonuclease capable of targeting and cleaving single stranded RNA (ssRNA) molecules of the phage genome. Here, we employ CRISPR/Cas13a to engineer interference with an RNA virus, Turnip Mosaic Virus (TuMV), in plants. CRISPR/Cas13a produced interference against green fluorescent protein (GFP) expressing TuMV in transient assays and stable overexpression lines of Nicotiana benthamiana. crRNAs targeting the HC-Pro and GFP sequences exhibited better interference than those targeting other regions such as coat protein (CP) sequence. Cas13a can also process pre-crRNAs into functional crRNAs. Our data indicate that CRISPR/Cas13a can be used for engineering interference against RNA viruses, providing a potential novel mechanism for RNA-guided immunity against RNA viruses, and for other RNA manipulations in plants.

European coatings conference - Marine coatings. Proceedings

Energy Technology Data Exchange (ETDEWEB)

NONE

2008-07-01

This volume contains 13 lectures (manuscripts or powerpoint foils) with the following topics: 1. Impact of containerization on polyurethane and polyurea in marine and protective coatings (Malte Homann); 2. The application of combinatorial/high-throughput methods to the development of marine coatings (Bret Chisholm); 3. Progress and perspectives in the AMBIO (advanced nanostructured surfaces for the control of biofouling) Project (James Callow); 4. Release behaviour due to shear and pull-off of silicone coatings with a thickness gradient (James G. Kohl); 5. New liquid rheology additives for high build marine coatings (Andreas Freytag); 6. Effective corrosion protection with polyaniline, polpyrrole and polythiophene as anticorrosice additives for marine paints (Carlos Aleman); 7. Potential applications of sol gel technology for marine applications (Robert Akid); 8: Performance of biocide-free Antifouling Coatings for leisure boats (Bernd Daehne); 9. Novel biocidefree nanostructured antifouling coatings - can nano do the job? (Corne Rentrop); 10. One component high solids, VOC compliant high durability finish technology (Adrian Andrews); 11. High solid coatings - the hybrid solution (Luca Prezzi); 12. Unique organofunctional silicone resins for environmentally friendly high-performance coatings (Dieter Heldmann); 13. Silicone-alkyd paints for marine applications: from battleship-grey to green (Thomas Easton).

Coated Glass Slides TACAS Are Applicable to Heat-Assisted Immunostaining and In Situ Hybridization at the Electron Microscopy Level

International Nuclear Information System (INIS)

Matsui, Takahiro; Onouchi, Takanori; Shiogama, Kazuya; Mizutani, Yasuyoshi; Inada, Ken-ichi; Yu, Fuxun; Hayasaka, Daisuke; Morita, Koichi; Ogawa, Hirohisa; Mahara, Fumihiko; Tsutsumi, Yutaka

2015-01-01

We performed pre-embedding electron microscopic study for visualizing the antigen and genome of severe fever with thrombocytopenia syndrome (SFTS) virus in the cytoplasm of macrophages of the human splenic red pulp, both requesting preheating treatment of sections. To pursue this, coated glass slides with unique characteristics are needed. Namely, during staining they must prevent detaching off sections, but after staining the sections must be transferred to epoxy resin. Aminopropyltriexoxysilane-coated glass slides, widely used for immunostaining, were resistant to transfer to epoxy resin. In contrast, coated glass slides designated as Thinlayer Advanced Cytology Assay System (TACAS) were suitable for this purpose. The technique is also applicable to the coated glass slide-requiring cytology practice, in which immunocytochemical evaluation is needed after cell transfer to another glass slide

Binding constants of Southern rice black-streaked dwarf virus Coat Protein with ferulic acid derivatives

Directory of Open Access Journals (Sweden)

Longlu Ran

2018-04-01

Full Text Available The data present binding constants between ferulic acid derivatives and the Coat Protein (P10 by fluorescence titration in this article, which is hosted in the research article entitled “Interaction Research on an Antiviral Molecule that Targets the Coat Protein of Southern rice black-streaked dwarf virus’’ (Ran et al., 2017 [1]. The data include fluorescence quenching spectrum, Stern–Volmer quenching constants, and binding parameters. In this article, a more comprehensive data interpretation and analysis is explained.

Previously unknown and highly divergent ssDNA viruses populate the oceans.

Science.gov (United States)

Labonté, Jessica M; Suttle, Curtis A

2013-11-01

Single-stranded DNA (ssDNA) viruses are economically important pathogens of plants and animals, and are widespread in oceans; yet, the diversity and evolutionary relationships among marine ssDNA viruses remain largely unknown. Here we present the results from a metagenomic study of composite samples from temperate (Saanich Inlet, 11 samples; Strait of Georgia, 85 samples) and subtropical (46 samples, Gulf of Mexico) seawater. Most sequences (84%) had no evident similarity to sequenced viruses. In total, 608 putative complete genomes of ssDNA viruses were assembled, almost doubling the number of ssDNA viral genomes in databases. These comprised 129 genetically distinct groups, each represented by at least one complete genome that had no recognizable similarity to each other or to other virus sequences. Given that the seven recognized families of ssDNA viruses have considerable sequence homology within them, this suggests that many of these genetic groups may represent new viral families. Moreover, nearly 70% of the sequences were similar to one of these genomes, indicating that most of the sequences could be assigned to a genetically distinct group. Most sequences fell within 11 well-defined gene groups, each sharing a common gene. Some of these encoded putative replication and coat proteins that had similarity to sequences from viruses infecting eukaryotes, suggesting that these were likely from viruses infecting eukaryotic phytoplankton and zooplankton.

Wheat streak mosaic virus coat protein is a host-specific long-distance transport determinant in oat

Science.gov (United States)

Viral determinants involved in systemic infection of hosts by monocot-infecting plant viruses are poorly understood. Wheat streak mosaic virus (WSMV, genus Tritimovirus, family Potyviridae) exclusively infects monocotyledonous crops such as wheat, oat, barley, maize, triticale, and rye. Previously, ...

Mutations that alter a conserved element upstream of the potato virus X triple block and coat protein genes affect subgenomic RNA accumulation.

Science.gov (United States)

Kim, K H; Hemenway, C

1997-05-26

The putative subgenomic RNA (sgRNA) promoter regions upstream of the potato virus X (PVX) triple block and coat protein (CP) genes contain sequences common to other potexviruses. The importance of these sequences to PVX sgRNA accumulation was determined by inoculation of Nicotiana tabacum NT1 cell suspension protoplasts with transcripts derived from wild-type and modified PVX cDNA clones. Analyses of RNA accumulation by S1 nuclease digestion and primer extension indicated that a conserved octanucleotide sequence element and the spacing between this element and the start-site for sgRNA synthesis are critical for accumulation of the two major sgRNA species. The impact of mutations on CP sgRNA levels was also reflected in the accumulation of CP. In contrast, genomic minus- and plus-strand RNA accumulation were not significantly affected by mutations in these regions. Studies involving inoculation of tobacco plants with the modified transcripts suggested that the conserved octanucleotide element functions in sgRNA accumulation and some other aspect of the infection process.

Nanoparticle/Polymer Nanocomposite Bond Coat or Coating

Science.gov (United States)

Miller, Sandi G.

2011-01-01

This innovation addresses the problem of coatings (meant to reduce gas permeation) applied to polymer matrix composites spalling off in service due to incompatibility with the polymer matrix. A bond coat/coating has been created that uses chemically functionalized nanoparticles (either clay or graphene) to create a barrier film that bonds well to the matrix resin, and provides an outstanding barrier to gas permeation. There is interest in applying clay nanoparticles as a coating/bond coat to a polymer matrix composite. Often, nanoclays are chemically functionalized with an organic compound intended to facilitate dispersion of the clay in a matrix. That organic modifier generally degrades at the processing temperature of many high-temperature polymers, rendering the clay useless as a nano-additive to high-temperature polymers. However, this innovation includes the use of organic compounds compatible with hightemperature polymer matrix, and is suitable for nanoclay functionalization, the preparation of that clay into a coating/bondcoat for high-temperature polymers, the use of the clay as a coating for composites that do not have a hightemperature requirement, and a comparable approach to the preparation of graphene coatings/bond coats for polymer matrix composites.

Wipes coated with a singlet-oxygen-producing photosensitizer are effective against human influenza virus but not against norovirus

NARCIS (Netherlands)

Verhaelen, Katharina; Bouwknegt, Martijn; Rutjes, Saskia; de Roda Husman, Ana Maria; Duizer, Erwin

2014-01-01

Transmission of enteric and respiratory viruses, including human norovirus (hNoV) and human influenza virus, may involve surfaces. In food preparation and health care settings, surfaces are cleaned with wipes; however, wiping may not efficiently reduce contamination or may even spread viruses,

Complete nucleotide sequence of the RNA-2 of grapevine deformation and Grapevine Anatolian ringspot viruses.

Science.gov (United States)

Ghanem-Sabanadzovic, Nina Abou; Sabanadzovic, Sead; Digiaro, Michele; Martelli, Giovanni P

2005-05-01

The nucleotide sequence of RNA-2 of Grapevine Anatolian ringspot virus (GARSV) and Grapevine deformation virus (GDefV), two recently described nepoviruses, has been determined. These RNAs are 3753 nt (GDefV) and 4607 nt (GARSV) in size and contain a single open reading frame encoding a polyprotein of 122 kDa (GDefV) and 150 kDa (GARSV). Full-length nucleotide sequence comparison disclosed 71-73% homology between GDefV RNA-2 and that of Grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV), and 62-64% homology between GARSV RNA-2 and that of Grapevine chrome mosaic virus (GCMV) and Tomato black ring virus (TBRV). As previously observed in other nepoviruses, the 5' non-coding regions of both RNAs are capable of forming stem-loop structures. Phylogenetic analysis of the three proteins encoded by RNA-2 (i.e. protein 2A, movement protein and coat protein) confirmed that GDefV and GARSV are distinct viruses which can be assigned as definitive species in subgroup A and subgroup B of the genus Nepovirus, respectively.

The Paradox of Feline Coronavirus Pathogenesis: A Review

Directory of Open Access Journals (Sweden)

Luciana Wanderley Myrrha

2011-01-01

Full Text Available Feline coronavirus (FCoV is an enveloped single-stranded RNA virus, of the family Coronaviridae and the order Nidovirales. FCoV is an important pathogen of wild and domestic cats and can cause a mild or apparently symptomless enteric infection, especially in kittens. FCoV is also associated with a lethal, systemic disease known as feline infectious peritonitis (FIP. Although the precise cause of FIP pathogenesis remains unclear, some hypotheses have been suggested. In this review we present results from different FCoV studies and attempt to elucidate existing theories on the pathogenesis of FCoV infection.

New species of RNA formed during tobacco mosaic virus infection

Energy Technology Data Exchange (ETDEWEB)

Siegel, A.; Hari, V.; Montgomery, I.; Kolacz, K.

1976-01-01

Previous investigations have demonstrated that extracts of TMV infected leaf tissue contain several unique virus related RNA species, including viral RNA, RF, RI and a low-molecular-weight component (LMC) of approximately 2.5 x 10/sup 5/ daltons. We have found that LMC becomes heavily labelled when infected tissue is incubated in the dark in the presence of actinomycin D and /sup 3/H-uridine. This component was isolated by sucrose-density gradient centrifugation and polyacrylamide gel electrophoresis and was used as a messenger in a wheat-germ derived cell-free protein synthesizing system. Analysis of the products produced by SDS-gel electrophoresis revealed a protein the same size as TMV coat protein. It was confirmed as coat protein by its reaction with specific antiserum in a gel-diffusion test. We conclude that LMC acts as a messenger for coat protein in the in vitro system and deduce that it probably does so in vivo. During the course of isolating LMC, we have observed several previously unreported new RNA species, probably unique to infected tissue. Among these are a component of approximately 1.1 x 10/sup 6/ daltons and another of a size similar to that of, but distinct from, viral RNA. There are indications that other unique RNA species may also be present and evidence for these will be presented. Our evidence to date points to the likelihood that TMV RNA may be processed into smaller pieces for translation rather than, as in the case of poliovirus, being translated into a polyprotein. It is possible that other groups of non-split genome plant viruses may behave in manner similar to that of TMV in this regard. We have observed that tobacco etch virus (a member of the Pot Y group) infected tissue also contains a component similar to that of LMC but larger (ca. 350,000 daltons). A peculiar feature of this system is that it appears to be sensitive to actinomycin D.

A Molecular Staple: D-Loops in the I Domain of Bacteriophage P22 Coat Protein Make Important Intercapsomer Contacts Required for Procapsid Assembly

Science.gov (United States)

D'Lima, Nadia G.

2015-01-01

ABSTRACT Bacteriophage P22, a double-stranded DNA (dsDNA) virus, has a nonconserved 124-amino-acid accessory domain inserted into its coat protein, which has the canonical HK97 protein fold. This I domain is involved in virus capsid size determination and stability, as well as protein folding. The nuclear magnetic resonance (NMR) solution structure of the I domain revealed the presence of a D-loop, which was hypothesized to make important intersubunit contacts between coat proteins in adjacent capsomers. Here we show that amino acid substitutions of residues near the tip of the D-loop result in aberrant assembly products, including tubes and broken particles, highlighting the significance of the D-loops in proper procapsid assembly. Using disulfide cross-linking, we showed that the tips of the D-loops are positioned directly across from each other both in the procapsid and the mature virion, suggesting their importance in both states. Our results indicate that D-loop interactions act as “molecular staples” at the icosahedral 2-fold symmetry axis and significantly contribute to stabilizing the P22 capsid for DNA packaging. IMPORTANCE Many dsDNA viruses have morphogenic pathways utilizing an intermediate capsid, known as a procapsid. These procapsids are assembled from a coat protein having the HK97 fold in a reaction driven by scaffolding proteins or delta domains. Maturation of the capsid occurs during DNA packaging. Bacteriophage HK97 uniquely stabilizes its capsid during maturation by intercapsomer cross-linking, but most virus capsids are stabilized by alternate means. Here we show that the I domain that is inserted into the coat protein of bacteriophage P22 is important in the process of proper procapsid assembly. Specifically, the I domain allows for stabilizing interactions across the capsid 2-fold axis of symmetry via a D-loop. When amino acid residues at the tip of the D-loop are mutated, aberrant assembly products, including tubes, are formed instead

Structure and behaviour of proteins, nucleic acids and viruses from vibrational Raman optical activity

DEFF Research Database (Denmark)

Barron, L.D.; Blanch, E.W.; McColl, I.H.

2003-01-01

stacking arrangement and the mutual orientation of the sugar and base rings around the C-N glycosidic link. The ROA spectra of intact viruses provide information on the folds of the coat proteins and the nucleic acid structure. The large number of structure-sensitive bands in protein ROA spectra...... is especially favourable for fold determination using pattern recognition techniques. This article gives a brief account of the ROA technique and presents the ROA spectra of a selection of proteins, nucleic acids and viruses that illustrate the applications of ROA spectroscopy in biomolecular research....

Preliminary coating design and coating developments for ATHENA

DEFF Research Database (Denmark)

Jakobsen, Anders Clemen; Ferreira, Desiree Della Monica; Christensen, Finn Erland

2011-01-01

We present initial novel coating design for ATHENA. We make use of both simple bilayer coatings of Ir and B4C and more complex constant period multilayer coatings to enhance the effective area and cover the energy range from 0.1 to 10 keV. We also present the coating technology used...... for these designs and present test results from coatings....

Clonagem e purificação de fragmento da proteína capsidial de Banana streak OL virus Cloning and purification of Banana streak OL virus coat protein fragment

Directory of Open Access Journals (Sweden)

Ricardo Lombardi

2010-08-01

Full Text Available O objetivo deste trabalho foi clonar e induzir a expressão de fragmento da proteína capsidial de Banana streak OL virus (BSOLV-CP em Escherichia coli, bem como purificar a proteína recombinante obtida. Empregou-se um par de iniciadores específicos para amplificar, em PCR, um fragmento de aproximadamente 390 pb, da região codificadora da porção central da BSOLV-CP. O fragmento obtido foi clonado em vetor pGEM-T Easy, subclonado em vetor pQE-30 e transformado em células de E. coli M15 (pREP4 por choque térmico. A expressão da proteína foi induzida por tiogalactopiranosídeo de isopropila (IPTG, e a proteína recombinante BSOLV-rcCP de 14 kDa foi detectada em Western blot e Dot blot. A expressão da proteína BSOLV-rcCP abre novas possibilidades para a obtenção de antígenos para a produção de antissoros contra o BSOLV.The objective of this work was to clone and to induce the expression of a fragment of Banana streak OL virus coat protein (BSOLV-CP in Escherichia coli, as well as to purify the obtained recombinant protein. Two specific primers were used for the PCR-amplification of approximately 390-bp fragment of the codifying region of the BSOLV-CP central portion. The obtained fragment was cloned in pGEM-T Easy vector, subcloned in pQE-30 expression vector and transformed into competent E. coli M15 (pREP4 cells by heat shock. The protein expression was induced by isopropyl thiogalactopyranoside (IPTG and the 14-kDa BSOLV-rcCP recombinant protein was detected in Western and Dot blotting. The expression of the BSOLV-rcCP protein enables new approaches to the obtention of antigens for the antisera production against BSOLV.

Preliminary X-ray data analysis of crystalline hibiscus chlorotic ringspot virus

International Nuclear Information System (INIS)

Cheng, Ao; Speir, Jeffrey A.; Yuan, Y. Adam; Johnson, John E.; Wong, Sek-Man

2009-01-01

Hibiscus chlorotic ringspot virus is a positive-sense monopartite single-stranded RNA virus that belongs to the Carmovirus genus of the Tombusviridae family. Authentic virus harvested from infected host kenaf leaves was purified and virus crystals were grown in multiple conditions. One of the crystals diffracted to 3.2 Å resolution and allowed the collection of a partial data set. Hibiscus chlorotic ringspot virus (HCRSV) is a positive-sense monopartite single-stranded RNA virus that belongs to the Carmovirus genus of the Tombusviridae family, which includes carnation mottle virus (CarMV). The HCRSV virion has a 30 nm diameter icosahedral capsid with T = 3 quasi-symmetry containing 180 copies of a 38 kDa coat protein (CP) and encapsidates a full-length 3.9 kb genomic RNA. Authentic virus was harvested from infected host kenaf leaves and was purified by saturated ammonium sulfate precipitation, sucrose density-gradient centrifugation and anion-exchange chromatography. Virus crystals were grown in multiple conditions; one of the crystals diffracted to 3.2 Å resolution and allowed the collection of a partial data set. The crystal belonged to space group R32, with unit-cell parameters a = b = 336.4, c = 798.5 Å. Packing considerations and rotation-function analysis determined that there were three particles per unit cell, all of which have the same orientation and fixed positions, and resulted in tenfold noncrystallography symmetry for real-space averaging. The crystals used for the structure determination of southern bean mosaic virus (SBMV) have nearly identical characteristics. Together, these findings will greatly aid the high-resolution structure determination of HCRSV

Electrocurtain coating process for coating solar mirrors

Science.gov (United States)

Kabagambe, Benjamin; Boyd, Donald W.; Buchanan, Michael J.; Kelly, Patrick; Kutilek, Luke A.; McCamy, James W.; McPheron, Douglas A.; Orosz, Gary R.; Limbacher, Raymond D.

2013-10-15

An electrically conductive protective coating or film is provided over the surface of a reflective coating of a solar mirror by flowing or directing a cation containing liquid and an anion containing liquid onto the conductive surface. The cation and the anion containing liquids are spaced from, and preferably out of contact with one another on the surface of the reflective coating as an electric current is moved through the anion containing liquid, the conductive surface between the liquids and the cation containing liquid to coat the conductive surface with the electrically conductive coating.

Preliminary X-ray Data Analysis of Crystalline Hibiscus Chlorotic Ringspot Virus

Energy Technology Data Exchange (ETDEWEB)

Cheng, A.; Speir, J; Yuan, Y; Johnson, J; Wong, S

2009-01-01

Hibiscus chlorotic ringspot virus (HCRSV) is a positive-sense monopartite single-stranded RNA virus that belongs to the Carmovirus genus of the Tombusviridae family, which includes carnation mottle virus (CarMV). The HCRSV virion has a 30 nm diameter icosahedral capsid with T = 3 quasi-symmetry containing 180 copies of a 38 kDa coat protein (CP) and encapsidates a full-length 3.9 kb genomic RNA. Authentic virus was harvested from infected host kenaf leaves and was purified by saturated ammonium sulfate precipitation, sucrose density-gradient centrifugation and anion-exchange chromatography. Virus crystals were grown in multiple conditions; one of the crystals diffracted to 3Synchrotron .2 A resolution and allowed the collection of a partial data set. The crystal belonged to space group R32, with unit-cell parameters a = b = 336.4, c = 798.5 . Packing considerations and rotation-function analysis determined that there were three particles per unit cell, all of which have the same orientation and fixed positions, and resulted in tenfold noncrystallography symmetry for real-space averaging. The crystals used for the structure determination of southern bean mosaic virus (SBMV) have nearly identical characteristics. Together, these findings will greatly aid the high-resolution structure determination of HCRSV.

An improved electrochemiluminescence polymerase chain reaction method for highly sensitive detection of plant viruses

International Nuclear Information System (INIS)

Tang Yabing; Xing Da; Zhu Debin; Liu Jinfeng

2007-01-01

Recently, we have reported an electrochemiluminescence polymerase chain reaction (ECL-PCR) method for detection of genetically modified organisms. The ECL-PCR method was further improved in the current study by introducing a multi-purpose nucleic acid sequence that was specific to the tris(bipyridine) ruthenium (TBR) labeled probe, into the 5' terminal of the primers. The method was applied to detect plant viruses. Conserved sequence of the plant viruses was amplified by PCR. The product was hybridized with a biotin labeled probe and a TBR labeled probe. The hybridization product was separated by streptavidin-coated magnetic beads, and detected by measuring the ECL signals of the TBR labeled. Under the optimized conditions, the experiment results show that the detection limit is 50 fmol of PCR products, and the signal-to-noise ratio is in excess of 14.6. The method was used to detect banana streak virus, banana bunchy top virus, and papaya leaf curl virus. The experiment results show that this method could reliably identity viruses infected plant samples. The improved ECL-PCR approach has higher sensitivity and lower cost than previous approach. It can effectively detect the plant viruses with simplicity, stability, and high sensitivity

Analysis of the solvent accessibility of cysteine residues on Maize rayado fino virus virus-like particles produced in Nicotiana benthamiana plants and cross-linking of peptides to VLPs.

Science.gov (United States)

Natilla, Angela; Hammond, Rosemarie W

2013-02-14

Mimicking and exploiting virus properties and physicochemical and physical characteristics holds promise to provide solutions to some of the world's most pressing challenges. The sheer range and types of viruses coupled with their intriguing properties potentially give endless opportunities for applications in virus-based technologies. Viruses have the ability to self- assemble into particles with discrete shape and size, specificity of symmetry, polyvalence, and stable properties under a wide range of temperature and pH conditions. Not surprisingly, with such a remarkable range of properties, viruses are proposed for use in biomaterials, vaccines, electronic materials, chemical tools, and molecular electronic containers. In order to utilize viruses in nanotechnology, they must be modified from their natural forms to impart new functions. This challenging process can be performed through several mechanisms including genetic modification of the viral genome and chemically attaching foreign or desired molecules to the virus particle reactive groups. The ability to modify a virus primarily depends upon the physiochemical and physical properties of the virus. In addition, the genetic or physiochemical modifications need to be performed without adversely affecting the virus native structure and virus function. Maize rayado fino virus (MRFV) coat proteins self-assemble in Escherichia coli producing stable and empty VLPs that are stabilized by protein-protein interactions and that can be used in virus-based technologies applications. VLPs produced in tobacco plants were examined as a scaffold on which a variety of peptides can be covalently displayed. Here, we describe the steps to 1) determine which of the solvent-accessible cysteines in a virus capsid are available for modification, and 2) bioconjugate peptides to the modified capsids. By using native or mutationally-inserted amino acid residues and standard coupling technologies, a wide variety of materials have been

Production of Polyclonal Antibodies to Potato virus X Using Recombinant Coat Protein

Czech Academy of Sciences Publication Activity Database

Čeřovská, Noemi; Moravec, Tomáš; Plchová, Helena; Hoffmeisterová, Hana; Kmoníčková, Jitka; Dědič, P.

2010-01-01

Roč. 158, č. 1 (2010), s. 66-68 ISSN 0931-1785 R&D Projects: GA MŠk 1M06030 Institutional research plan: CEZ:AV0Z50380511 Keywords : Potato virus X * recombinant viral antigen * antibodies Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.937, year: 2010

Active coatings technologies for tailorable military coating systems

Science.gov (United States)

Zunino, J. L., III

2007-04-01

The main objective of the U.S. Army's Active Coatings Technologies Program is to develop technologies that can be used in combination to tailor coatings for utilization on Army Materiel. The Active Coatings Technologies Program, ACT, is divided into several thrusts, including the Smart Coatings Materiel Program, Munitions Coatings Technologies, Active Sensor packages, Systems Health Monitoring, Novel Technology Development, as well as other advanced technologies. The goal of the ACT Program is to conduct research leading to the development of multiple coatings systems for use on various military platforms, incorporating unique properties such as self repair, selective removal, corrosion resistance, sensing, ability to modify coatings' physical properties, colorizing, and alerting logistics staff when tanks or weaponry require more extensive repair. A partnership between the U.S. Army Corrosion Office at Picatinny Arsenal, NJ along with researchers at the New Jersey Institute of Technology, NJ, Clemson University, SC, University of New Hampshire, NH, and University of Massachusetts (Lowell), MA, are developing the next generation of Smart Coatings Materiel via novel technologies such as nanotechnology, Micro-electromechanical Systems (MEMS), meta-materials, flexible electronics, electrochromics, electroluminescence, etc. This paper will provide the reader with an overview of the Active Coatings Technologies Program, including an update of the on-going Smart Coatings Materiel Program, its progress thus far, description of the prototype Smart Coatings Systems and research tasks as well as future nanotechnology concepts, and applications for the Department of Defense.

RNA virus interference via CRISPR/Cas13a system in plants

KAUST Repository

Aman, Rashid

2018-01-04

CRISPR/Cas systems confer immunity against invading nucleic acids and phages in bacteria and archaea. CRISPR/Cas13a (known previously as C2c2) is a class 2 type VI-A ribonuclease capable of targeting and cleaving single-stranded RNA (ssRNA) molecules of the phage genome. Here, we employ CRISPR/Cas13a to engineer interference with an RNA virus, Turnip Mosaic Virus (TuMV), in plants.CRISPR/Cas13a produces interference against green fluorescent protein (GFP)-expressing TuMV in transient assays and stable overexpression lines of Nicotiana benthamiana. CRISPR RNA (crRNAs) targeting the HC-Pro and GFP sequences exhibit better interference than those targeting other regions such as coat protein (CP) sequence. Cas13a can also process pre-crRNAs into functional crRNAs.Our data indicate that CRISPR/Cas13a can be used for engineering interference against RNA viruses, providing a potential novel mechanism for RNA-guided immunity against RNA viruses and for other RNA manipulations in plants.

Flow coating apparatus and method of coating

Science.gov (United States)

Hanumanthu, Ramasubrahmaniam; Neyman, Patrick; MacDonald, Niles; Brophy, Brenor; Kopczynski, Kevin; Nair, Wood

2014-03-11

Disclosed is a flow coating apparatus, comprising a slot that can dispense a coating material in an approximately uniform manner along a distribution blade that increases uniformity by means of surface tension and transfers the uniform flow of coating material onto an inclined substrate such as for example glass, solar panels, windows or part of an electronic display. Also disclosed is a method of flow coating a substrate using the apparatus such that the substrate is positioned correctly relative to the distribution blade, a pre-wetting step is completed where both the blade and substrate are completed wetted with a pre-wet solution prior to dispensing of the coating material onto the distribution blade from the slot and hence onto the substrate. Thereafter the substrate is removed from the distribution blade and allowed to dry, thereby forming a coating.

E-selectin is a viable route of infection for polymer-coated adenovirus retargeting in TNF-.alpha.-activated human umbilical vein endothelial cells

Czech Academy of Sciences Publication Activity Database

Bachtarzi, H.; Stevenson, M.; Šubr, Vladimír; Seymour, L. W.; Fisher, K. D.

2011-01-01

Roč. 19, č. 8 (2011), s. 690-700 ISSN 1061-186X Institutional research plan: CEZ:AV0Z40500505 Keywords : polymer-coated virus * vascular targeting * inflammation Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.696, year: 2011

Promising MS2 mediated virus-like particle vaccine against foot-and-mouth disease.

Science.gov (United States)

Dong, Yan-mei; Zhang, Guo-guang; Huang, Xiao-jun; Chen, Liang; Chen, Hao-tai

2015-05-01

Foot-and-mouth disease (FMD) has caused severe economic losses to millions of farmers worldwide. In this work, the coding genes of 141-160 epitope peptide (EP141-160) of VP1 were inserted into the coat protein (CP) genes of MS2 in prokaryotic expression vector, and the recombinant protein self-assembled into virus-like particles (VLP). Results showed that the CP-EP141-160 VLP had a strong immunoreaction with the FMD virus (FMDV) antigen in vitro, and also had an effective immune response in mice. Further virus challenge tests were carried out on guinea pigs and swine, high-titer neutralizing antibodies were produced and the CP-EP141-160 VLP vaccine could protect most of the animals against FMDV. Copyright © 2015. Published by Elsevier B.V.

The Impact of "Coat Protein-Mediated Virus Resistance" in Applied Plant Pathology and Basic Research.

Science.gov (United States)

Lindbo, John A; Falk, Bryce W

2017-06-01

Worldwide, plant viruses cause serious reductions in marketable crop yield and in some cases even plant death. In most cases, the most effective way to control virus diseases is through genetically controlled resistance. However, developing virus-resistant (VR) crops through traditional breeding can take many years, and in some cases is not even possible. Because of this, the demonstration of the first VR transgenic plants in 1985 generated much attention. This seminal report served as an inflection point for research in both basic and applied plant pathology, the results of which have dramatically changed both basic research and in a few cases, commercial crop production. The typical review article on this topic has focused on only basic or only applied research results stemming from this seminal discovery. This can make it difficult for the reader to appreciate the full impact of research on transgenic virus resistance, and the contributions from fundamental research that led to translational applications of this technology. In this review, we take a global view of this topic highlighting the significant changes to both basic and applied plant pathology research and commercial food production that have accumulated in the last 30 plus years. We present these milestones in the historical context of some of the scientific, economic, and environmental drivers for developing specific VR crops. The intent of this review is to provide a single document that adequately records the significant accomplishments of researchers in both basic and applied plant pathology research on this topic and how they relate to each other. We hope this review therefore serves as both an instructional tool for students new to the topic, as well as a source of conversation and discussion for how the technology of engineered virus resistance could be applied in the future.

HCMV spread and cell tropism are determined by distinct virus populations.

Directory of Open Access Journals (Sweden)

Laura Scrivano

Full Text Available Human cytomegalovirus (HCMV can infect many different cell types in vivo. Two gH/gL complexes are used for entry into cells. gH/gL/pUL(128,130,131A shows no selectivity for its host cell, whereas formation of a gH/gL/gO complex only restricts the tropism mainly to fibroblasts. Here, we describe that depending on the cell type in which virus replication takes place, virus carrying the gH/gL/pUL(128,130,131A complex is either released or retained cell-associated. We observed that virus spread in fibroblast cultures was predominantly supernatant-driven, whereas spread in endothelial cell (EC cultures was predominantly focal. This was due to properties of virus released from fibroblasts and EC. Fibroblasts released virus which could infect both fibroblasts and EC. In contrast, EC released virus which readily infected fibroblasts, but was barely able to infect EC. The EC infection capacities of virus released from fibroblasts or EC correlated with respectively high or low amounts of gH/gL/pUL(128,130,131A in virus particles. Moreover, we found that focal spread in EC cultures could be attributed to EC-tropic virus tightly associated with EC and not released into the supernatant. Preincubation of fibroblast-derived virus progeny with EC or beads coated with pUL131A-specific antibodies depleted the fraction that could infect EC, and left a fraction that could predominantly infect fibroblasts. These data strongly suggest that HCMV progeny is composed of distinct virus populations. EC specifically retain the EC-tropic population, whereas fibroblasts release EC-tropic and non EC-tropic virus. Our findings offer completely new views on how HCMV spread may be controlled by its host cells.

Enumeration and biomass estimation of planktonic bacteria and viruses by transmission electron microscopy

International Nuclear Information System (INIS)

Borsheim, K.Y.; Bratbak, G.; Heldal, M.

1990-01-01

Bacteria and virus particles were harvested from water samples by ultracentrifugation directly onto Formvar-coated electron microscopy grids and counted in a transmission electron microscope. With this technique, we have counted and sized bacteria and viruses in marine water samples and during laboratory incubations. By X-ray microanalysis, we could determine the elemental composition and dry-matter content of individual bacteria. The dry weight/volume ratio for the bacteria was 600 fg of dry weight microns-3. The potassium content of the bacteria was normal compared with previous estimates from other bacterial assemblages; thus, this harvesting procedure did not disrupt the bacterial cells. Virus particles were, by an order of magnitude, more abundant than bacteria in marine coastal waters. During the first 5 to 7 days of incubation, the total number of viruses increased exponentially at a rate of 0.4 day-1 and thereafter declined. The high proliferation rate suggests that viral parasitism may affect mortality of bacteria in aquatic environments

A stable RNA virus-based vector for citrus trees

International Nuclear Information System (INIS)

Folimonov, Alexey S.; Folimonova, Svetlana Y.; Bar-Joseph, Moshe; Dawson, William O.

2007-01-01

Virus-based vectors are important tools in plant molecular biology and plant genomics. A number of vectors based on viruses that infect herbaceous plants are in use for expression or silencing of genes in plants as well as screening unknown sequences for function. Yet there is a need for useful virus-based vectors for woody plants, which demand much greater stability because of the longer time required for systemic infection and analysis. We examined several strategies to develop a Citrus tristeza virus (CTV)-based vector for transient expression of foreign genes in citrus trees using a green fluorescent protein (GFP) as a reporter. These strategies included substitution of the p13 open reading frame (ORF) by the ORF of GFP, construction of a self-processing fusion of GFP in-frame with the major coat protein (CP), or expression of the GFP ORF as an extra gene from a subgenomic (sg) mRNA controlled either by a duplicated CTV CP sgRNA controller element (CE) or an introduced heterologous CE of Beet yellows virus. Engineered vector constructs were examined for replication, encapsidation, GFP expression during multiple passages in protoplasts, and for their ability to infect, move, express GFP, and be maintained in citrus plants. The most successful vectors based on the 'add-a-gene' strategy have been unusually stable, continuing to produce GFP fluorescence after more than 4 years in citrus trees

Tests for Transmission of Prunus Necrotic Ringspot and Two Nepoviruses by Criconemella xenoplax.

Science.gov (United States)

Yuan, W Q; Barnett, O W; Westcott, S W; Scott, S W

1990-10-01

In two of three trials, detectable color reactions in ELISA for Prunus necrotic ringspot virus (PNRSV) were observed for Criconemella xenoplax handpicked from the root zone of infected peach trees. Criconemella xenoplax (500/pot) handpicked from root zones of peach trees infected with PNRSV failed to transmit the virus to cucumber or peach seedlings. The nematode also failed to transmit tomato ringspot (TomRSV) or tobacco ringspot viruses between cucumbers, although Xiphinema americanum transmitted TomRSV under the same conditions. Plants of peach, cucumber, Chenopodium quinoa, and Catharanthus roseus were not infected by PNRSV when grown in soil containing C. xenoplax collected from root zones of PNRSV-infected trees. Shirofugen cherry scions budded on Mazzard cherry seedling rootstocks remained symptomless when transplanted into root zones of PNRSV-infected trees. Virus transmission was not detected by ELISA when C. xenoplax individuals were observed to feed on cucumber root explants that were infected with PNRSV and subsequently fed on roots of Prunus besseyi in agar cultures. Even if virus transmission by C. xenoplax occurs via contamination rather than by a specific mechanism, it must be rare.

Analysis of potato virus Y coat protein epitopes recognized by three commercial monoclonal antibodies.

Science.gov (United States)

Tian, Yan-Ping; Hepojoki, Jussi; Ranki, Harri; Lankinen, Hilkka; Valkonen, Jari P T

2014-01-01

Potato virus Y (PVY, genus Potyvirus) causes substantial economic losses in solanaceous plants. Routine screening for PVY is an essential part of seed potato certification, and serological assays are often used. The commercial, commonly used monoclonal antibodies, MAb1128, MAb1129, and MAb1130, recognize the viral coat protein (CP) of PVY and distinguish PVYN strains from PVYO and PVYC strains, or detect all PVY strains, respectively. However, the minimal epitopes recognized by these antibodies have not been identified. SPOT peptide array was used to map the epitopes in CP recognized by MAb1128, MAb1129, and MAb1130. Then alanine replacement as well as N- and C-terminal deletion analysis of the identified peptide epitopes was done to determine critical amino acids for antibody recognition and the respective minimal epitopes. The epitopes of all antibodies were located within the 30 N-terminal-most residues. The minimal epitope of MAb1128 was 25NLNKEK30. Replacement of 25N or 27N with alanine weakened the recognition by MAb1128, and replacement of 26L, 29E, or 30K nearly precluded recognition. The minimal epitope for MAb1129 was 16RPEQGSIQSNP26 and the most critical residues for recognition were 22I and 23Q. The epitope of MAb1130 was defined by residues 5IDAGGS10. Mutation of residue 6D abrogated and mutation of 9G strongly reduced recognition of the peptide by MAb1130. Amino acid sequence alignment demonstrated that these epitopes are relatively conserved among PVY strains. Finally, recombinant CPs were produced to demonstrate that mutations in the variable positions of the epitope regions can affect detection with the MAbs. The epitope data acquired can be compared with data on PVY CP-encoding sequences produced by laboratories worldwide and utilized to monitor how widely the new variants of PVY can be detected with current seed potato certification schemes or during the inspection of imported seed potatoes as conducted with these MAbs.

Lotus Dust Mitigation Coating and Molecular Adsorber Coating

Science.gov (United States)

O'Connor, Kenneth M.; Abraham, Nithin S.

2015-01-01

NASA Goddard Space Flight Center has developed two unique coating formulations that will keep surfaces clean and sanitary and contain contaminants.The Lotus Dust Mitigation Coating, modeled after the self-cleaning, water-repellant lotus leaf, disallows buildup of dust, dirt, water, and more on surfaces. This coating, has been successfully tested on painted, aluminum, glass, silica, and some composite surfaces, could aid in keeping medical assets clean.The Molecular Adsorber Coating is a zeolite-based, sprayable molecular adsorber coating, designed to prevent outgassing in materials in vacuums. The coating works well to adsorb volatiles and contaminates in manufacturing and processing, such as in pharmaceutical production. The addition of a biocide would also aid in controlling bacteria levels.

Combustion chemical vapor desposited coatings for thermal barrier coating systems

Energy Technology Data Exchange (ETDEWEB)

Hampikian, J.M.; Carter, W.B. [Georgia Institute of Technology, Atlanta, GA (United States)

1995-10-01

The new deposition process, combustion chemical vapor deposition, shows a great deal of promise in the area of thermal barrier coating systems. This technique produces dense, adherent coatings, and does not require a reaction chamber. Coatings can therefore be applied in the open atmosphere. The process is potentially suitable for producing high quality CVD coatings for use as interlayers between the bond coat and thermal barrier coating, and/or as overlayers, on top of thermal barrier coatings.

A versatile SERS-based immunoassay for immunoglobulin detection using antigen-coated gold nanoparticles and malachite green-conjugated protein A/G

Science.gov (United States)

A surface enhanced Raman scattering (SERS) immunoassay for antibody detection in serum is described in the present work. The developed assay is conducted in solution and utilizes Au nanoparticles coated with the envelope (E) protein of West Nile Virus (WNV) as the SERS-active substrate and malachite...

Potato leafroll virus structural proteins manipulate overlapping, yet distinct protein interaction networks during infection.

Science.gov (United States)

DeBlasio, Stacy L; Johnson, Richard; Sweeney, Michelle M; Karasev, Alexander; Gray, Stewart M; MacCoss, Michael J; Cilia, Michelle

2015-06-01

Potato leafroll virus (PLRV) produces a readthrough protein (RTP) via translational readthrough of the coat protein amber stop codon. The RTP functions as a structural component of the virion and as a nonincorporated protein in concert with numerous insect and plant proteins to regulate virus movement/transmission and tissue tropism. Affinity purification coupled to quantitative MS was used to generate protein interaction networks for a PLRV mutant that is unable to produce the read through domain (RTD) and compared to the known wild-type PLRV protein interaction network. By quantifying differences in the protein interaction networks, we identified four distinct classes of PLRV-plant interactions: those plant and nonstructural viral proteins interacting with assembled coat protein (category I); plant proteins in complex with both coat protein and RTD (category II); plant proteins in complex with the RTD (category III); and plant proteins that had higher affinity for virions lacking the RTD (category IV). Proteins identified as interacting with the RTD are potential candidates for regulating viral processes that are mediated by the RTP such as phloem retention and systemic movement and can potentially be useful targets for the development of strategies to prevent infection and/or viral transmission of Luteoviridae species that infect important crop species. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Tablet coating by injection molding technology - Optimization of coating formulation attributes and coating process parameters.

Science.gov (United States)

Desai, Parind M; Puri, Vibha; Brancazio, David; Halkude, Bhakti S; Hartman, Jeremy E; Wahane, Aniket V; Martinez, Alexander R; Jensen, Keith D; Harinath, Eranda; Braatz, Richard D; Chun, Jung-Hoon; Trout, Bernhardt L

2018-01-01

We developed and evaluated a solvent-free injection molding (IM) coating technology that could be suitable for continuous manufacturing via incorporation with IM tableting. Coating formulations (coating polymers and plasticizers) were prepared using hot-melt extrusion and screened via stress-strain analysis employing a universal testing machine. Selected coating formulations were studied for their melt flow characteristics. Tablets were coated using a vertical injection molding unit. Process parameters like softening temperature, injection pressure, and cooling temperature played a very important role in IM coating processing. IM coating employing polyethylene oxide (PEO) based formulations required sufficient room humidity (>30% RH) to avoid immediate cracks, whereas other formulations were insensitive to the room humidity. Tested formulations based on Eudrajit E PO and Kollicoat IR had unsuitable mechanical properties. Three coating formulations based on hydroxypropyl pea starch, PEO 1,000,000 and Opadry had favorable mechanical (35% elongation, >95×10 4 J/m 3 toughness) and melt flow (>0.4g/min) characteristics, that rendered acceptable IM coats. These three formulations increased the dissolution time by 10, 15 and 35min, respectively (75% drug release), compared to the uncoated tablets (15min). Coated tablets stored in several environmental conditions remained stable to cracking for the evaluated 8-week time period. Copyright © 2017 Elsevier B.V. All rights reserved.

Phylogeny of isolates of Prunus necrotic ringspot virus from the Ilarvirus Ringtest and identification of group-specific features.

Science.gov (United States)

Hammond, R W

2003-06-01

Isolates of Prunus necrotic ringspot virus (PNRSV) were examined to establish the level of naturally occurring sequence variation in the coat protein (CP) gene and to identify group-specific genome features that may prove valuable for the generation of diagnostic reagents. Phylogenetic analysis of a 452 bp sequence of 68 virus isolates, 20 obtained from the European Union Ilarvirus Ringtest held in October 1998, confirmed the clustering of the isolates into three distinct groups. Although no correlation was found between the sequence and host or geographic origin, there was a general trend for severe isolates to cluster into one group. Group-specific features have been identified for discrimination between virus strains.

Engineering resistance against Tomato yellow leaf curl virus via the CRISPR/Cas9 system in tomato

KAUST Repository

Mahfouz, Magdy M.

2017-12-22

CRISPR/Cas systems confer molecular immunity against phages and conjugative plasmids in prokaryotes. Recently, CRISPR/Cas9 systems have been used to confer interference against eukaryotic viruses. Here, we engineered Nicotiana benthamiana and tomato (Solanum lycopersicum) plants with the CRISPR/Cas9 system to confer immunity against the Tomato yellow leaf curl virus (TYLCV). Targeting the TYLCV genome with Cas9-single guide RNA at the sequences encoding the coat protein (CP) or replicase (Rep) resulted in efficient virus interference, as evidenced by low accumulation of the TYLCV DNA genome in the transgenic plants. The CRISPR/Cas9-based immunity remained active across multiple generations in the N. benthamiana and tomato plants. Together, our results confirmed the efficiency of the CRISPR/Cas9 system for stable engineering of TYLCV resistance in N. benthamiana and tomato, and opens the possibilities of engineering virus resistance against single and multiple infectious viruses in other crops.

Radioactive probes as diagnostic tools for rice tungro viruses

International Nuclear Information System (INIS)

Azzam, O.; Arboleda, M.; Reyes. J. de los

1996-01-01

Rice tungro bacilliform (RTBV) and rice tungro spherical viruses (RTSV) are the two viral components responsible for rice tungro disease which has seriously affected the irrigated rice ecosystem in Southeast Asia for the last 30 years. RTBV has an 8 Kb double-stranded DNA circular genome, and it is primarily responsible for induction of symptoms in infected plants. RTSV has a 12 kb single-stranded RNA genome. It does not induce any apparent symptoms in the infected plant, and it is transmitted by greenleafhopper. RTBV depends upon RTSV for its own transmission. The two viruses are limited to the vascular tissue of the rice plant and are present at a low titer. Most of the detection methods used for the identification of these viruses have relied on the virus protein properties and therefore, early detection of the virus activity was not possible. We were interested in evaluating tissue printing, dot blot, and southern techniques for early detection of virus nucleic acids in rice plant using radioactive and non radioactive probes. 32 P-labeled T7 or SP6 RNA polymerase transcripts complementary to the RTBV genome and RTSV coat protein genes were used as probes of the positive stand of both viruses. For nonradioactive probes, RTBV DNA genome was labeled using the ECL detection kit (Amersham). Preliminary results show that viral nucleic acids of RTBV and RTSV could be detected using both labelling systems. Non radioactive probes were comparable in their sensitivity to the radioactive probes. Less than 100 pg of viral DNA was detected in the dot-blot assays. More data will be presented to compare the efficiency and reliability of these two techniques in detecting early virus activity in the rice plant. (author)

Barley yellow dwarf virus: Luteoviridae or Tombusviridae?

Science.gov (United States)

Miller, W Allen; Liu, Sijun; Beckett, Randy

2002-07-01

Summary Barley yellow dwarf virus (BYDV), the most economically important virus of small grains, features highly specialised relationships with its aphid vectors, a plethora of novel translation mechanisms mediated by long-distance RNA interactions, and an ambiguous taxonomic status. The structural and movement proteins of BYDV that confer aphid transmission and phloem-limitation properties resemble those of the Luteoviridae, the family in which BYDV is classified. In contrast, many genes and cis-acting signals involved in replication and gene expression most closely resemble those of the Tombusviridae. BYDV is in genus Luteovirus, family Luteoviridae. BYDV includes at least two serotypes or viruses: BYDV-PAV and BYDV-MAV. The former BYDV-RPV is now Cereal yellow dwarf virus-RPV (CYDV-RPV). CYDV is in genus Polerovirus, family Luteoviridae. Genus Luteovirus shares many features with family Tombusviridae. Physical properties: approximately 25 nm icosahedral (T = 3) virions. One major (22 kDa) and one minor (50-55 kDa) coat protein. 5.6-5.8 kb positive sense RNA genome with no 5'-cap and no poly(A) tail. Most grasses. Most important in oats, barley and wheat. Also infects maize and rice. Yellowing and dwarfing in barley, stunting in wheat; reddening, yellowing and blasting in oats. Some isolates cause leaf notching and curling. Key attractions: Model for the study of circulative transmission of aphid-transmitted viruses. Plethora of unusual translation mechanisms. Evidence of recombination in recent evolutionary history creates taxonomic ambiguity. Economically important virus of wheat, barley and oats, worldwide. Useful websites/meetings: International symposium: 'Barley Yellow Dwarf Disease: Recent Advances and Future Strategies', CIMMYT, El Batan, Mexico, 1-5 September 2002, http://www.cimmyt.cgiar.org/Research/wheat/Conf_BYD_02/invitation.htm http://www.cimmyt.org/Research/wheat/BYDVNEWS/htm/BYDVNEWS.htm Aphid transmission animation: http://www.ppws.vt.edu/~sforza/tmv/bydv_aph.html.

Synthetic scaffold coating with adeno-associated virus encoding BMP2 to promote endogenous bone repair.

Science.gov (United States)

Dupont, Kenneth M; Boerckel, Joel D; Stevens, Hazel Y; Diab, Tamim; Kolambkar, Yash M; Takahata, Masahiko; Schwarz, Edward M; Guldberg, Robert E

2012-03-01

Biomaterial scaffolds functionalized to stimulate endogenous repair mechanisms via the incorporation of osteogenic cues offer a potential alternative to bone grafting for the treatment of large bone defects. We first quantified the ability of a self-complementary adeno-associated viral vector encoding bone morphogenetic protein 2 (scAAV2.5-BMP2) to enhance human stem cell osteogenic differentiation in vitro. In two-dimensional culture, scAAV2.5-BMP2-transduced human mesenchymal stem cells (hMSCs) displayed significant increases in BMP2 production and alkaline phosphatase activity compared with controls. hMSCs and human amniotic-fluid-derived stem cells (hAFS cells) seeded on scAAV2.5-BMP2-coated three-dimensional porous polymer Poly(ε-caprolactone) (PCL) scaffolds also displayed significant increases in BMP2 production compared with controls during 12 weeks of culture, although only hMSC-seeded scaffolds displayed significantly increased mineral formation. PCL scaffolds coated with scAAV2.5-BMP2 were implanted into critically sized immunocompromised rat femoral defects, both with or without pre-seeding of hMSCs, representing ex vivo and in vivo gene therapy treatments, respectively. After 12 weeks, defects treated with acellular scAAV2.5-BMP2-coated scaffolds displayed increased bony bridging and had significantly higher bone ingrowth and mechanical properties compared with controls, whereas defects treated with scAAV2.5-BMP2 scaffolds pre-seeded with hMSCs failed to display significant differences relative to controls. When pooled, defect treatment with scAAV2.5-BMP2-coated scaffolds, both with or without inclusion of pre-seeded hMSCs, led to significant increases in defect mineral formation at all time points and increased mechanical properties compared with controls. This study thus presents a novel acellular bone-graft-free endogenous repair therapy for orthotopic tissue-engineered bone regeneration.

Evidencia de orígenes filogenéticos diferentes de dos aislamientos mexicanos del virus del mosaico de la caña de azúcar (SCMV Evidence of different phylogenetic origins of two mexican Sugarcane mosaic virus (SCMV isolates

Directory of Open Access Journals (Sweden)

Giovanni Chaves-Bedoya

2012-01-01

Full Text Available El análisis molecular del cistrón, que codifica para la proteína de la cubierta del virus del mosaico de la caña de azúcar (SCMV reportado en la base de datos del banco de genes (GenBank, reveló la presencia de 45 nucleótidos adicionales que codifican para quince aminoácidos, en la región amino de la secuencia de la proteína de la cubierta del aislamiento mexicano identificado con el número de acceso GU474635. El análisis BLAST indicó que esta característica particular también está presente en el aislamiento D00949, reportado en 1991 en Estados Unidos. El análisis filogenético de 185 secuencias de la proteína de la cubierta de SCMV reportadas de Asia, áfrica, Brasil y Argentina, entro otros, sugiere diferentes orígenes filogeográficos de los aislamientos mexicanos. El aislamiento mexicano GU474635 es filogenéticamente más cercano a aislamientos de SCMV de Brasil y de EE.UU., mientras que secuencias de la proteína de la cubierta del virus SCMV reportadas en China y Alemania son filogenéticamente más cercanas al aislamiento mexicano EU091075. Las características particulares que comparten aislamientos virales de tres países del continente americano, a saber, EE.UU., México y Brasil, sugieren un bajo control fitosanitario en el intercambio de material vegetal.The molecular analysis of the Sugarcane mosaic virus (SCMV for coat protein cistron reported in the public GenBank database, revealed the presence of 45 additional nucleotides coding for 15 amino acids in the N-terminal region of the coat protein sequence of the mexican isolate GU474635. BLAST analysis indicates this particular feature is also present in the coat protein sequence identified with the accession number D00949 reported in the USA in 1991. Phylogenetic analysis of 185 SCMV coat protein sequences reported from Asia, Africa, Brazil and Argentina among others, suggest a putative different phylogeographical origin of the mexican SCMV isolates. Coat protein

Advances in alfalfa mosaic virus-mediated expression of anthrax antigen in planta

International Nuclear Information System (INIS)

Brodzik, R.; Bandurska, K.; Deka, D.; Golovkin, M.; Koprowski, H.

2005-01-01

Plant viruses show great potential for production of pharmaceuticals in plants. Such viruses can harbor a small antigenic peptide(s) as a part of their coat proteins (CP) and elicit an antigen-specific immune response. Here, we report the high yield and consistency in production of recombinant alfalfa mosaic virus (AlMV) particles for specific presentation of the small loop 15 amino acid epitope from domain-4 of the Bacillus anthracis protective antigen (PA-D4s). The epitope was inserted immediately after the first 25 N-terminal amino acids of AlMV CP to retain genome activation and binding of CP to viral RNAs. Recombinant AlMV particles were efficiently produced in tobacco, easily purified for immunological analysis, and exhibited extended stability and systemic proliferation in planta. Intraperitional injections of mice with recombinant plant virus particles harboring the PA-D4s epitope elicited a distinct immune response. Western blotting and ELISA analysis showed that sera from immunized mice recognized both native PA antigen and the AlMV CP

Complete sequence of Fig fleck-associated virus, a novel member of the family Tymoviridae.

Science.gov (United States)

Elbeaino, Toufic; Digiaro, Michele; Martelli, Giovanni P

2011-11-01

The complete nucleotide sequence and the genome organization were determined of a novel virus, tentatively named Fig fleck-associated virus (FFkaV). The viral genome is a positive-sense, single-stranded RNA 7046 nucleotides in size excluding the 3'-terminal poly(A) tract, and comprising two open reading frames. ORF1 encodes a polypeptide of 2161 amino acids (p240), which contains the signatures of replication-associated proteins and the coat protein cistron (p24) at its 3' end. ORF2 codes for a 461 amino acid protein (p50) identified as a putative movement proteins (MP). In phylogenetic trees constructed with sequences of the putative polymerase and CP proteins FFkaV consistently groups with members of the genus Maculavirus, family Tymoviridae. However, the genome organization diverges from that of the two completely sequenced maculaviruses, Grapevine fleck virus (GFkV) and Bombix mori Macula-like virus (BmMLV), as it exhibits a structure resembling that of Maize rayado fino virus (MRFV), the type species of the genus Marafivirus and of Olive latent virus 3 (OLV-3), an unclassified virus in the family Tymoviridae. FFkaV was found in field-grown figs from six Mediterranean countries with an incidence ranging from 15% to 25%. Copyright © 2011 Elsevier B.V. All rights reserved.

Expression of self-complementary hairpin RNA under the control of the rolC promoter confers systemic disease resistance to plum pox virus without preventing local infection.

Science.gov (United States)

Pandolfini, Tiziana; Molesini, Barbara; Avesani, Linda; Spena, Angelo; Polverari, Annalisa

2003-06-25

Homology-dependent selective degradation of RNA, or post-transcriptional gene silencing (PTGS), is involved in several biological phenomena, including adaptative defense mechanisms against plant viruses. Small interfering RNAs mediate the selective degradation of target RNA by guiding a multicomponent RNAse. Expression of self-complementary hairpin RNAs within two complementary regions separated by an intron elicits PTGS with high efficiency. Plum pox virus (PPV) is the etiological agent of sharka disease in Drupaceae, although it can also be transmitted to herbaceous species (e.g. Nicotiana benthamiana). Once inside the plant, PPV is transmitted via plasmodesmata from cell to cell, and at longer distances, via phloem. The rolC promoter drives expression in phloem cells. RolC expression is absent in both epidermal and mesophyll cells. The aim of the present study was to confer systemic disease resistance without preventing local viral infection. In the ihprolC-PP197 gene (intron hair pin rolC PPV 197), a 197 bp sequence homologous to the PPV RNA genome (from base 134 to 330) was placed as two inverted repeats separated by the DNA sequence of the rolA intron. This hairpin construct is under the control of the rolC promoter.N. benthamiana plants transgenic for the ihprolC-PP197 gene contain siRNAs homologous to the 197 bp sequence. The transgenic progeny of ihprolC-PP197 plants are resistant to PPV systemic infection. Local infection is unaffected. Most (80%) transgenic plants are virus free and symptomless. Some plants (20%) contain virus in uninoculated apical leaves; however they show only mild symptoms of leaf mottling. PPV systemic resistance cosegregates with the ihprolC-PP197 transgene and was observed in progeny plants of all independent transgenic lines analyzed. SiRNAs of 23-25 nt homologous to the PPV sequence used in the ihprolC-PP197 construct were detected in transgenic plants before and after inoculation. Transitivity of siRNAs was observed in

Occurrence of Squash yellow mild mottle virus and Pepper golden mosaic virus in Potential New Hosts in Costa Rica.

Science.gov (United States)

Castro, Ruth M; Moreira, Lisela; Rojas, María R; Gilbertson, Robert L; Hernández, Eduardo; Mora, Floribeth; Ramírez, Pilar

2013-09-01

Leaf samples of Solanum lycopersicum, Capsicum annuum, Cucurbita moschata, Cucurbita pepo, Sechium edule and Erythrina spp. were collected. All samples were positive for begomoviruses using polymerase chain reaction and degenerate primers. A sequence of ∼1,100 bp was obtained from the genomic component DNA-A of 14 samples. In addition, one sequence of ∼580 bp corresponding to the coat protein (AV1) was obtained from a chayote (S. edule) leaf sample. The presence of Squash yellow mild mottle virus (SYMMoV) and Pepper golden mosaic virus (PepGMV) were confirmed. The host range reported for SYMMoV includes species of the Cucurbitaceae, Caricaceae and Fabaceae families. This report extends the host range of SYMMoV to include the Solanaceae family, and extends the host range of PepGMV to include C. moschata, C. pepo and the Fabaceae Erythrina spp. This is the first report of a begomovirus (PepGMV) infecting chayote in the Western Hemisphere.

Occurrence of Squash yellow mild mottle virus and Pepper golden mosaic virus in Potential New Hosts in Costa Rica

Directory of Open Access Journals (Sweden)

Ruth M. Castro

2013-09-01

Full Text Available Leaf samples of Solanum lycopersicum, Capsicum annuum, Cucurbita moschata, Cucurbita pepo, Sechium edule and Erythrina spp. were collected. All samples were positive for begomoviruses using polymerase chain reaction and degenerate primers. A sequence of ∼1,100 bp was obtained from the genomic component DNA-A of 14 samples. In addition, one sequence of ∼580 bp corresponding to the coat protein (AV1 was obtained from a chayote (S. edule leaf sample. The presence of Squash yellow mild mottle virus (SYMMoV and Pepper golden mosaic virus (PepGMV were confirmed. The host range reported for SYMMoV includes species of the Cucurbitaceae, Caricaceae and Fabaceae families. This report extends the host range of SYMMoV to include the Solanaceae family, and extends the host range of PepGMV to include C. moschata, C. pepo and the Fabaceae Erythrina spp. This is the first report of a begomovirus (PepGMV infecting chayote in the Western Hemisphere.

Chickpea chlorotic stunt virus: A New Polerovirus Infecting Cool-Season Food Legumes in Ethiopia.

Science.gov (United States)

Abraham, A D; Menzel, W; Lesemann, D-E; Varrelmann, M; Vetten, H J

2006-05-01

ABSTRACT Serological analysis of diseased chickpea and faba bean plantings with yellowing and stunting symptoms suggested the occurrence of an unknown or uncommon member of the family Luteoviridae in Ethiopia. Degenerate primers were used for reverse transcriptase-polymerase chain reaction amplification of the viral coat protein (CP) coding region from both chickpea and faba bean samples. Cloning and sequencing of the amplicons yielded nearly identical (96%) nucleotide sequences of a previously unrecognized species of the family Luteoviridae, with a CP amino acid sequence most closely related (identity of approximately 78%) to that of Groundnut rosette assistor virus. The complete genome (5,900 nts) of a faba bean isolate comprised six major open reading frames characteristic of polero-viruses. Of the four aphid species tested, only Aphis craccivora transmitted the virus in a persistent manner. The host range of the virus was confined to a few species of the family Fabaceae. A rabbit antiserum raised against virion preparations cross-reacted unexpectedly with Beet western yellows virus-like viruses. This necessitated the production of murine monoclonal antibodies which, in combination with the polyclonal antiserum, permitted both sensitive and specific detection of the virus in field samples by triple-antibody sandwich, enzyme-linked immunosorbent assay. Because of the characteristic field and greenhouse symptoms in chickpea, the name Chickpea chlorotic stunt virus is proposed for this new member of the genus Polerovirus (family Luteoviridae).

Biological and molecular characterization of Brazilian isolates of Zucchini yellow mosaic virus

Directory of Open Access Journals (Sweden)

David Marques de Almeida Spadotti

2015-02-01

Full Text Available Zucchini yellow mosaic virus (ZYMV causes substantial economic losses in cucurbit crops. Although ZYMV has been present in Brazil for more than 20 years, there is little information about the biological and molecular characteristics of the isolates found in the country. This study aimed to characterize the experimental hosts, pathotypes and genetic diversity of a collection of eleven Brazilian ZYMV isolates within the coat protein gene. For biological analysis, plant species from Amaranthaceae, Chenopodiaceae, Cucurbitaceae, Fabaceae, Solanaceae, and Pedaliaceae were mechanically inoculated and pathotypes were identified based on the reaction of a resistant Cucumis melo, accession PI414723. All of the cucurbit species/varieties and Sesamum indicum were systemically infected with all isolates. The nucleotide sequence variability of the coat protein gene ranged from 82 % to 99 % compared to the corresponding sequences of ZYMV isolates from different geographical locations. No recombination event was detected in the coat protein gene of the isolates.

Pixelated coatings and advanced IR coatings

Science.gov (United States)

Pradal, Fabien; Portier, Benjamin; Oussalah, Meihdi; Leplan, Hervé

2017-09-01

Reosc developed pixelated infrared coatings on detector. Reosc manufactured thick pixelated multilayer stacks on IR-focal plane arrays for bi-spectral imaging systems, demonstrating high filter performance, low crosstalk, and no deterioration of the device sensitivities. More recently, a 5-pixel filter matrix was designed and fabricated. Recent developments in pixelated coatings, shows that high performance infrared filters can be coated directly on detector for multispectral imaging. Next generation space instrument can benefit from this technology to reduce their weight and consumptions.

A novel single-stranded RNA virus isolated from a phytopathogenic filamentous fungus, Rosellinia necatrix, with similarity to hypo-like viruses

Directory of Open Access Journals (Sweden)

Rui eZhang

2014-07-01

Full Text Available Here we report a biological and molecular characterization of a novel positive-sense RNA virus isolated from a field isolate (NW10 of a filamentous phytopathogenic fungus, the white root rot fungus that is designated as Rosellinia necatrix fusarivirus 1 (RnFV1. A recently developed technology using zinc ions allowed us to transfer RnFV1 to two mycelially incompatible Rosellinia necatrix strains. A biological comparison of the virus-free and -recipient isogenic fungal strains suggested that RnFV1 infects latently and thus has no potential as a virocontrol agent. The virus has an undivided positive-sense RNA genome of 6286 nucleotides excluding a poly (A tail. The genome possesses two non-overlapping open reading frames (ORFs: a large ORF1 that encodes polypeptides with RNA replication functions and a smaller ORF2 that encodes polypeptides of unknown function. A lack of coat protein genes was suggested by the failure of virus particles from infected mycelia. No evidence was obtained by Northern analysis or classical 5'-RACE for the presence of subgenomic RNA for the downstream ORF. Sequence similarities were found in amino-acid sequence between RnFV1 putative proteins and counterparts of a previously reported mycovirus, Fusarium graminearum virus 1 (FgV1. Interestingly, several related sequences were detected by BLAST searches of independent transcriptome assembly databases one of which probably represents an entire virus genome. Phylogenetic analysis based on the conserved RNA-dependent RNA polymerase showed that RnFV1, FgV1, and these similar sequences are grouped in a cluster distinct from distantly related hypoviruses. It is proposed that a new taxonomic family termed Fusariviridae be created to include RnFV1and FgV1.

Ebola Virus and Marburg Virus

Science.gov (United States)

Ebola virus and Marburg virus Overview Ebola virus and Marburg virus are related viruses that cause hemorrhagic fevers — illnesses marked by severe bleeding (hemorrhage), organ failure and, in many ...

Expression of artificial microRNAs in transgenic Arabidopsis thaliana confers virus resistance.

Science.gov (United States)

Niu, Qi-Wen; Lin, Shih-Shun; Reyes, Jose Luis; Chen, Kuan-Chun; Wu, Hui-Wen; Yeh, Shyi-Dong; Chua, Nam-Hai

2006-11-01

Plant microRNAs (miRNAs) regulate the abundance of target mRNAs by guiding their cleavage at the sequence complementary region. We have modified an Arabidopsis thaliana miR159 precursor to express artificial miRNAs (amiRNAs) targeting viral mRNA sequences encoding two gene silencing suppressors, P69 of turnip yellow mosaic virus (TYMV) and HC-Pro of turnip mosaic virus (TuMV). Production of these amiRNAs requires A. thaliana DICER-like protein 1. Transgenic A. thaliana plants expressing amiR-P69(159) and amiR-HC-Pro(159) are specifically resistant to TYMV and TuMV, respectively. Expression of amiR-TuCP(159) targeting TuMV coat protein sequences also confers specific TuMV resistance. However, transgenic plants that express both amiR-P69(159) and amiR-HC-Pro(159) from a dimeric pre-amiR-P69(159)/amiR-HC-Pro(159) transgene are resistant to both viruses. The virus resistance trait is displayed at the cell level and is hereditable. More important, the resistance trait is maintained at 15 degrees C, a temperature that compromises small interfering RNA-mediated gene silencing. The amiRNA-mediated approach should have broad applicability for engineering multiple virus resistance in crop plants.

The coat protein of Alfalfa mosaic virus interacts and interferes with the transcriptional activity of the bHLH transcription factor ILR3 promoting salicylic acid-dependent defence signalling response.

Science.gov (United States)

Aparicio, Frederic; Pallás, Vicente

2017-02-01

During virus infection, specific viral component-host factor interaction elicits the transcriptional reprogramming of diverse cellular pathways. Alfalfa mosaic virus (AMV) can establish a compatible interaction in tobacco and Arabidopsis hosts. We show that the coat protein (CP) of AMV interacts directly with transcription factor (TF) ILR3 of both species. ILR3 is a basic helix-loop-helix (bHLH) family member of TFs, previously proposed to participate in diverse metabolic pathways. ILR3 has been shown to regulate NEET in Arabidopsis, a critical protein in plant development, senescence, iron metabolism and reactive oxygen species (ROS) homeostasis. We show that the AMV CP-ILR3 interaction causes a fraction of this TF to relocate from the nucleus to the nucleolus. ROS, pathogenesis-related protein 1 (PR1) mRNAs, salicylic acid (SA) and jasmonic acid (JA) contents are increased in healthy Arabidopsis loss-of-function ILR3 mutant (ilr3.2) plants, which implicates ILR3 in the regulation of plant defence responses. In AMV-infected wild-type (wt) plants, NEET expression is reduced slightly, but is induced significantly in ilr3.2 mutant plants. Furthermore, the accumulation of SA and JA is induced in Arabidopsis wt-infected plants. AMV infection in ilr3.2 plants increases JA by over 10-fold, and SA is reduced significantly, indicating an antagonist crosstalk effect. The accumulation levels of viral RNAs are decreased significantly in ilr3.2 mutants, but the virus can still systemically invade the plant. The AMV CP-ILR3 interaction may down-regulate a host factor, NEET, leading to the activation of plant hormone responses to obtain a hormonal equilibrium state, where infection remains at a level that does not affect plant viability. © 2016 BSPP AND JOHN WILEY & SONS LTD.

Functional diversification upon leader protease domain duplication in the Citrus tristeza virus genome: Role of RNA sequences and the encoded proteins.

Science.gov (United States)

Kang, Sung-Hwan; Atallah, Osama O; Sun, Yong-Duo; Folimonova, Svetlana Y

2018-01-15

Viruses from the family Closteroviridae show an example of intra-genome duplications of more than one gene. In addition to the hallmark coat protein gene duplication, several members possess a tandem duplication of papain-like leader proteases. In this study, we demonstrate that domains encoding the L1 and L2 proteases in the Citrus tristeza virus genome underwent a significant functional divergence at the RNA and protein levels. We show that the L1 protease is crucial for viral accumulation and establishment of initial infection, whereas its coding region is vital for virus transport. On the other hand, the second protease is indispensable for virus infection of its natural citrus host, suggesting that L2 has evolved an important adaptive function that mediates virus interaction with the woody host. Copyright © 2017 Elsevier Inc. All rights reserved.

Evidence from lateral mobility studies for dynamic interactions of a mutant influenza hemagglutinin with coated pits.

Science.gov (United States)

Fire, E; Zwart, D E; Roth, M G; Henis, Y I

1991-12-01

Replacement of cysteine at position 543 by tyrosine in the influenza virus hemagglutinin (HA) protein enables the endocytosis of the mutant protein (Tyr 543) through coated pits (Lazarovits, J., and M. G. Roth. 1988. Cell. 53:743-752). To investigate the interactions between Tyr 543 and the clathrin coats in the plasma membrane of live cells, we performed fluorescence photobleaching recovery measurements comparing the lateral mobilities of Tyr 543 (which enters coated pits) and wild-type HA (HA wt, which is excluded from coated pits), following their expression in CV-1 cells by SV-40 vectors. While both proteins exhibited the same high mobile fractions, the lateral diffusion rate of Tyr 543 was significantly slower than that of HA wt. Incubation of the cells in a sucrose-containing hypertonic medium, a treatment that disperses the membrane-associated coated pits, resulted in similar lateral mobilities for Tyr 543 and HA wt. These findings indicate that the lateral motion of Tyr 543 (but not of HA wt) is inhibited by transient interactions with coated pits (which are essentially immobile on the time scale of the lateral mobility measurements). Acidification of the cytoplasm by prepulsing the cells with NH4Cl (a treatment that arrests the pinching-off of coated vesicles from the plasma membrane and alters the clathrin lattice morphology) led to immobilization of a significant part of the Tyr 543 molecules, presumably due to their entrapment in coated pits for the entire duration of the lateral mobility measurement. Furthermore, in both untreated and cytosol-acidified cells, the restrictions on Tyr 543 mobility were less pronounced in the cold, suggesting that the mobility-restricting interactions are temperature dependent and become weaker at low temperatures. From these studies we conclude the following. (a) Lateral mobility measurements are capable of detecting interactions of transmembrane proteins with coated pits in intact cells. (b) The interactions of Tyr 543

Characterization of rice black-streaked dwarf virus- and rice stripe virus-derived siRNAs in singly and doubly infected insect vector Laodelphax striatellus.

Directory of Open Access Journals (Sweden)

Junmin Li

Full Text Available Replication of RNA viruses in insect cells triggers an antiviral defense that is mediated by RNA interference (RNAi which generates viral-derived small interfering RNAs (siRNAs. However, it is not known whether an antiviral RNAi response is also induced in insects by reoviruses, whose double-stranded RNA genome replication is thought to occur within core particles. Deep sequencing of small RNAs showed that when the small brown planthopper (Laodelphax striatellus was infected by Rice black-streaked dwarf virus (RBSDV (Reoviridae; Fijivirus, more viral-derived siRNAs accumulated than when the vector insect was infected by Rice stripe virus (RSV, a negative single-stranded RNA virus. RBSDV siRNAs were predominantly 21 and 22 nucleotides long and there were almost equal numbers of positive and negative sense. RBSDV siRNAs were frequently generated from hotspots in the 5'- and 3'-terminal regions of viral genome segments but these hotspots were not associated with any predicted RNA secondary structures. Under laboratory condition, L. striatellus can be infected simultaneously with RBSDV and RSV. Double infection enhanced the accumulation of particular genome segments but not viral coat protein of RBSDV and correlated with an increase in the abundance of siRNAs derived from RBSDV. The results of this study suggest that reovirus replication in its insect vector potentially induces an RNAi-mediated antiviral response.

Coated Aerogel Beads

Science.gov (United States)

Littman, Howard (Inventor); Plawsky, Joel L. (Inventor); Paccione, John D. (Inventor)

2014-01-01

Methods and apparatus for coating particulate material are provided. The apparatus includes a vessel having a top and a bottom, a vertically extending conduit having an inlet in the vessel and an outlet outside of the vessel, a first fluid inlet in the bottom of the vessel for introducing a transfer fluid, a second fluid inlet in the bottom of the vessel for introducing a coating fluid, and a fluid outlet from the vessel. The method includes steps of agitating a material, contacting the material with a coating material, and drying the coating material to produce a coated material. The invention may be adapted to coat aerogel beads, among other materials. A coated aerogel bead and an aerogel-based insulation material are also disclosed.

Discovery and small RNA profile of Pecan mosaic-associated virus, a novel potyvirus of pecan trees.

Science.gov (United States)

Su, Xiu; Fu, Shuai; Qian, Yajuan; Zhang, Liqin; Xu, Yi; Zhou, Xueping

2016-05-26

A novel potyvirus was discovered in pecan (Carya illinoensis) showing leaf mosaic symptom through the use of deep sequencing of small RNAs. The complete genome of this virus was determined to comprise of 9,310 nucleotides (nt), and shared 24.0% to 58.9% nucleotide similarities with that of other Potyviridae viruses. The genome was deduced to encode a single open reading frame (polyprotein) on the plus strand. Phylogenetic analysis based on the whole genome sequence and coat protein amino acid sequence showed that this virus is most closely related to Lettuce mosaic virus. Using electron microscopy, the typical Potyvirus filamentous particles were identified in infected pecan leaves with mosaic symptoms. Our results clearly show that this virus is a new member of the genus Potyvirus in the family Potyviridae. The virus is tentatively named Pecan mosaic-associated virus (PMaV). Additionally, profiling of the PMaV-derived small RNA (PMaV-sRNA) showed that the most abundant PMaV-sRNAs were 21-nt in length. There are several hotspots for small RNA production along the PMaV genome; two 21-nt PMaV-sRNAs starting at 811 nt and 610 nt of the minus-strand genome were highly repeated.

Properties of a virus causing mosaic and leaf curl disease of Celosia argentea L. in Nigeria.

Science.gov (United States)

Owolabi, T A; Taiwo, M A; Thottappilly, G A; Shoyinka, S A; Proll, E; Rabenstein, F

1998-06-01

A sap transmissible virus, causing mosaic and leaf curl disease of Celosia argentea, was isolated at vegetable farms in Amuwo Odofin, Tejuoso, and Abule Ado, Lagos, Nigeria. The virus had a restricted host range confined to a few species of the Amaranthaceae, Chenopodiaceae and Solanaceae families. It failed to infect several other species of the Aizoaceae, Brassicaceae, Cucurbitaceae, Fabaceae, Lamiaceae, Malvaceae, Poaceae and Tiliaceae families. The virus was transmitted in a non-persistent manner by Aphis spiraecola and Toxoptera citricidus but not by eight other aphid species tested. There was no evidence of transmission by seeds of C. argentae varieties. The viral coat protein had a relative molecular mass (M(r)) of about 30.2 K. Electron microscopy of purified virus preparations revealed flexuous rod shaped particles of about 750 nm in length. Serological studies were performed using the enzyme-linked immunosorbent assay (ELISA), immunosorbent electron microscopy (ISEM) and Western blot analysis. The virus reacted positively with an universal potyvirus group monoclonal antibody (MoAb) and MoAb P-3-3H8 raised against peanut stripe potyvirus. It also reacted with polyclonal antibodies raised against several potyviruses including asparagus virus-1 (AV-1), turnip mosaic virus (TuMV), maize dwarf mosaic virus (MDMV), watermelon mosaic virus (WMV-2), plum pox virus (PPV), soybean mosaic virus (SoyMV), lettuce mosaic virus (LMV), bean common mosaic virus (BCMV) and beet mosaic virus (BMV) in at least one of the serological assays used. On the basis of host range, mode of transmission, and available literature data, the celosia virus seems to be different from potyviruses previously reported to infect vegetables in Nigeria. The name celosia mosaic virus (CIMV) has been proposed for this virus.

Chayote mosaic virus, a New Tymovirus Infecting Cucurbitaceae.

Science.gov (United States)

Bernal, J J; Jiménez, I; Moreno, M; Hord, M; Rivera, C; Koenig, R; Rodríguez-Cerezo, E

2000-10-01

ABSTRACT Chayote mosaic virus (ChMV) is a putative tymovirus isolated from chayote crops in Costa Rica. ChMV was characterized at the host range, serological, and molecular levels. ChMV was transmitted mechanically and induced disease symptoms mainly in Cucurbitaceae hosts. Asymptomatic infections were detected in other host families. Serologically, ChMV is related to the Andean potato latent virus (APLV) and the Eggplant mosaic virus (EMV), both members of the genus Tymovirus infecting solanaceous hosts in the Caribbean Basin and South America. The sequence of the genomic RNA of ChMV was determined and its genetic organization was typical of tymoviruses. Comparisons with other tymoviral sequences showed that ChMV was a new member of the genus Tymovirus. The phylogenetic analyses of the coat protein gene were consistent with serological comparisons and positioned ChMV within a cluster of tymoviruses infecting mainly cucurbit or solanaceous hosts, including APLV and EMV. Phylogenetic analyses of the replicase protein gene confirmed the close relationship of ChMV and EMV. Our results suggest that ChMV is related to two tymoviruses (APLV and EMV) of proximal geographical provenance but with different natural host ranges. ChMV is the first cucurbit-infecting tymovirus to be fully characterized at the genomic level.

Amino acid sequences mediating vascular cell adhesion molecule 1 binding to integrin alpha 4: homologous DSP sequence found for JC polyoma VP1 coat protein

Directory of Open Access Journals (Sweden)

Michael Andrew Meyer

2013-07-01

Full Text Available The JC polyoma viral coat protein VP1 was analyzed for amino acid sequences homologies to the IDSP sequence which mediates binding of VLA-4 (integrin alpha 4 to vascular cell adhesion molecule 1. Although the full sequence was not found, a DSP sequence was located near the critical arginine residue linked to infectivity of the virus and binding to sialic acid containing molecules such as integrins (3. For the JC polyoma virus, a DSP sequence was found at residues 70, 71 and 72 with homology also noted for the mouse polyoma virus and SV40 virus. Three dimensional modeling of the VP1 molecule suggests that the DSP loop has an accessible site for interaction from the external side of the assembled viral capsid pentamer.

Effect of coating parameters on the microstructure of cerium oxide conversion coatings

Energy Technology Data Exchange (ETDEWEB)

Johnson, Benedict Y.; Edington, Joe; O' Keefe, Matthew J

2003-11-25

The microstructure and morphology of cerium oxide conversion coatings prepared under different deposition conditions were characterized by transmission electron microscopy (TEM). The coatings were formed by a spontaneous reaction between a water-based solution containing CeCl{sub 3} and aluminum alloy 7075-T6 substrates. Microstructural characterization was performed to determine the crystallinity of the coatings and to obtain a better understanding of the deposition parameters on coating microstructure. The results of TEM imaging and electron diffraction analysis indicated that the as-deposited coating was composed of nanocrystalline particles of a previously unreported cerium compound. The particles of the coatings produced using glycerol as an additive were found to be much finer than those of the coatings prepared in the absence of glycerol. This indicates that glycerol may act as a grain refiner and/or growth inhibitor during coating deposition. After deposition, the coated panels were treated for 5 min in a phosphate sealing solution. The sealing treatment converted the as-deposited coating into hydrated cerium phosphate. Panels coated from solutions containing no glycerol followed by phosphate sealing performed poorly in salt fog tests. With glycerol addition, the corrosion resistance of the coatings that were phosphate sealed improved considerably, achieving an average passing rate of 85%.

Analysis of Capillary Coating Die Flow in an Optical Fiber Coating Applicator

OpenAIRE

Kyoungjin Kim

2011-01-01

Viscous heating becomes significant in the high speed resin coating process of glass fibers for optical fiber manufacturing. This study focuses on the coating resin flows inside the capillary coating die of optical fiber coating applicator and they are numerically simulated to examine the effects of viscous heating and subsequent temperature increase in coating resin. Resin flows are driven by fast moving glass fiber and the pressurization at the coating die inlet, while ...

Methods and means for coating paper by film coating

NARCIS (Netherlands)

van der Maarel, Marc; Ter Veer, Arend Berend Cornelis; Vrieling-Smit, Annet; Delnoye, Pierre

2015-01-01

This invention relates to the field of paper coating, more in particular to means and methods for providing paper with at least one layer of pigment using film coating to obtain a well printable surface. Provided is a method for preparing coated paper comprising the steps of: a) providing a

Cryo-electron tomography investigation of serum albumin-camouflaged tobacco mosaic virus nanoparticles.

Science.gov (United States)

Gulati, Neetu M; Pitek, Andrzej S; Steinmetz, Nicole F; Stewart, Phoebe L

2017-03-09

Nanoparticles offer great potential in drug delivery and imaging, but shielding strategies are necessary to increase circulation time and performance. Structure-function studies are required to define the design rules to achieve effective shielding. With several formulations reaching clinical testing and approval, the ability to assess and detail nanoparticle formulations at the single particle level is becoming increasingly important. To address this need, we use cryo-electron tomography (cryo-ET) to investigate stealth-coated nanoparticles. As a model system, we studied the soft matter nanotubes formed by tobacco mosaic virus (TMV) coated with human serum albumin (SA) stealth proteins. Cryo-ET and subtomogram averaging allow for visualization of individual SA molecules and determination of their orientations relative to the TMV surface, and also for measurement of the surface coverage provided by added stealth proteins. This information fills a critical gap in the understanding of the structural morphology of stealth-coated nanoparticles, and therefore cryo-ET may play an important role in guiding the development of future nanoparticle-based therapeutics.

Vesicular stomatitis virus expressing a chimeric Sindbis glycoprotein containing an Fc antibody binding domain targets to Her2/neu overexpressing breast cancer cells

International Nuclear Information System (INIS)

Bergman, Ira; Whitaker-Dowling, Patricia; Gao Yanhua; Griffin, Judith A.; Watkins, Simon C.

2003-01-01

Vesicular stomatitis virus (VSV) is a candidate for development for cancer therapy. It is an oncolytic virus that is safe in humans. Recombinant virus can be made directly from plasmid components. We attempted to create a virus that targeted specifically to breast cancer cells. Nonreplicating and replicating pseudotype VSV were created whose only surface glycoprotein (gp) was a Sindbis gp, called Sindbis-ZZ, modified to severely reduce its native binding function and to contain the Fc-binding domain of Staphylococcus aureus protein A. When titered on Her2/neu overexpressing SKBR3 human breast cancer cells, pseudotype VSV coated with Sindbis-ZZ had 5 /ml. This work demonstrates the ability to easily create, directly from plasmid components, an oncolytic replicating VSV with a restricted host cell range

Stent Coating Integrity of Durable and Biodegradable Coated Drug Eluting Stents.

Science.gov (United States)

Yazdani, Saami K; Sheehy, Alexander; Pacetti, Stephen; Rittlemeyer, Brandon; Kolodgie, Frank D; Virmani, Renu

2016-10-01

Coatings consisting of a polymer and drug are widely used in drug-eluting stents (DES) and are essential in providing programmable drug release kinetics. Among other factors, stent coating technologies can influence blood compatibility, affect acute and sub-acute healing, and potentially trigger a chronic inflammatory response. The aim of this study was to investigate the short-term (7 and 28 days) and long-term (90 and 180 days) coating integrity of the Xience Prime Everolimus-Eluting Stent (EES), Resolute Zotarolimus-Eluting Stent (ZES), Taxus Paclitaxel-Eluting Stent (PES), and Nobori Biolimus A9-Eluting Stent (BES) in a rabbit ilio-femoral stent model. Stented arteries (n = 48) were harvested and the tissue surrounding the implanted stents digested away with an enzymatic solution. Results demonstrated that the majority of struts of EES were without any coating defects with a few struts showing minor defects. Similarly, for the ZES, most of the struts were without coating defects at all time points except at 180 days. The majority of PES demonstrated mostly webbing and uneven coating. In the BES group, the majority of strut coating showed polymer cracking. Overall, the EES and ZES had fewer coating defects than the PES and BES. Coating defects, however increase over time for the ZES, whereas the percent of coating irregularities remained constant for the EES. These results provide, for the first time, a comparison of the long-term durability of these drug-eluting stent coatings in vivo. © 2016, Wiley Periodicals, Inc.

Development and electrochemical characterization of Ni‐P coated tungsten incorporated electroless nickel coatings

Energy Technology Data Exchange (ETDEWEB)

Shibli, S.M.A., E-mail: smashibli@yahoo.com; Chinchu, K.S.

2016-08-01

Ni‐P-W alloy and composite coatings were prepared by incorporation of sodium tungstate/tungsten and Ni‐P coated tungsten into electroless nickel bath respectively. Good inter-particle interactions among the depositing elements i.e. Ni and P with the incorporating tungsten particles were achieved by means of pre-coated tungsten particle by electroless nickel covering prior to its addition into the electroless bath. The pre-coated tungsten particles got incorporated uniformly into the Ni-P matrix of the coating. The particles and the coatings were characterized at different stages by different techniques including X-ray diffraction (XRD), scanning electron microscopy (SEM) and energy dispersive spectrometry (EDS). The electroless Ni-P coating incorporated with pre-coated tungsten exhibited considerably high hardness, thickness and deposition rate. The performance and corrosion resistance characteristics of the composite coating incorporated with the nickel coated tungsten were found to be superior over other conventional Ni-P-W ternary alloy coatings currently reported. - Highlights: • An amorphous Ni-P coating was effectively formed on tungsten particles. • Electroless ternary Ni-P-W composite coatings were successfully prepared. • Enhancement in the inter-particle interaction in the Ni-P composite matrix was achieved. • Efficient and uniform incorporation of the composite in the internal layer was evident. • The tungsten incorporated coating possessed effective barrier protection.

Inactivation of microbial infectiousness by silver nanoparticles-coated condom: a new approach to inhibit HIV- and HSV-transmitted infection

Directory of Open Access Journals (Sweden)

Mohammed Fayaz A

2012-09-01

Full Text Available A Mohammed Fayaz,1,* Zhujun Ao,1,3,* Morkattu Girilal,2 Liyu Chen,3,4 Xianzhong Xiao,4 PT Kalaichelvan,2 Xiaojian Yao1,31Laboratory of Molecular Human Retrovirology, Department of Medical Microbiology, Faculty of Medicine, University of Manitoba, Winnipeg, MB, Canada; 2CAS in Botany, University of Madras, Guindy Campus, Chennai, Tamil Nadu, India; 3Department of Microbiology, 4School of Basic Medical Sciences, Central South University, Changsha, Hunan, People’s Republic of China*Both authors contributed equally to this workAbstract: Recent research suggests that today’s condoms are only 85% effective in preventing human immunodeficiency virus (HIV and other sexually transmitted diseases. In response, there has been a push to develop more effective ways of decreasing the spread of the disease. The new nanotechnology-based condom holds the promise of being more potent than the first-generation products. The preliminary goal of this study was to develop a silver nanoparticles (Ag-NPs-coated polyurethane condom (PUC and to investigate its antimicrobial potential including the inactivation of HIV and herpes simplex virus (HSV infectiousness. The Ag-NPs-coated PUC was characterized by using ultraviolet-visible spectrophotometry, Fourier transform-infrared spectroscopy, high-resolution scanning electron microscopy, and energy-dispersive analysis of X-ray spectroscopy. Nanoparticles were stable on the PUC and not washed away by water. Morphology of the PUC was retained after coating. The NP binding is due to its interaction with the nitrogen atom of the PUC. No significant toxic effects was observed when human HeLa cells, 293T and C8166 T cells were contacted to Ag-NPs-coated PUC for three hours. Interestingly, our results demonstrated that the contact of the Ag-NPs-coated PUC with HIV-1 and HSV-1/2 was able to efficiently inactivate their infectiousness. In an attempt to elucidate the antiviral action of the Ag-NPs, we have demonstrated that the

TYLCV-Is movement in planta does not require V2 protein

Energy Technology Data Exchange (ETDEWEB)

Hak, Hagit [Institute of Plant Sciences, Agricultural Research Organization, The Volcani Center, Bet Dagan (Israel); Department of Biological Chemistry, The Alexander Silberman Institute of Life Sciences, The Hebrew University of Jerusalem (Israel); Levy, Yael; Chandran, Sam A.; Belausov, Eduard [Institute of Plant Sciences, Agricultural Research Organization, The Volcani Center, Bet Dagan (Israel); Loyter, Abraham [Department of Biological Chemistry, The Alexander Silberman Institute of Life Sciences, The Hebrew University of Jerusalem (Israel); Lapidot, Moshe [Institute of Plant Sciences, Agricultural Research Organization, The Volcani Center, Bet Dagan (Israel); Gafni, Yedidya, E-mail: ygafni@volcani.agri.gov.il [Institute of Plant Sciences, Agricultural Research Organization, The Volcani Center, Bet Dagan (Israel)

2015-03-15

Tomato yellow leaf curl virus (TYLCV), a major tomato pathogen causing extensive crop losses, is a whitefly-transmitted geminivirus. V2 mutants of TYLCV-Is and related viruses tend to induce symptomless infection with attenuated viral DNA levels, while accumulating close to wild-type DNA levels in protoplasts, suggesting V2 as a movement protein. The discovery of plant-silencing mechanisms and viral silencing suppressors, V2 included, led us to reconsider V2's involvement in viral movement. We studied two mutant versions of the virus, one impaired in V2 silencing-suppression activity, and another carrying a non-translatable V2. While both mutant viruses spread in the infected plant to newly emerged leaves at the same rate as the wild-type virus, their DNA-accumulation levels were tenfold lower than in the wild-type virus. Thus, we suggest that the setback in virus proliferation, previously ascribed to a movement impediment, is due to lack of silencing-suppression activity. - Highlights: • TYLCV-Is V2 protein is localized in distinct microbodies throughout the cell cytoplasm, around the nucleus and in association with cytoplasmic strands but is not associated with the plasmodesmata. • Disruption of RNA-silencing suppression activity of TYLCV-Is V2 protein causes low titer of the virus in the infected plants. • The movement of TYLCV-Is in planta does not require a functional V2 protein.

Enveloped viruses disable innate immune responses in dendritic cells by direct activation of TAM receptors.

Science.gov (United States)

Bhattacharyya, Suchita; Zagórska, Anna; Lew, Erin D; Shrestha, Bimmi; Rothlin, Carla V; Naughton, John; Diamond, Michael S; Lemke, Greg; Young, John A T

2013-08-14

Upon activation by the ligands Gas6 and Protein S, Tyro3/Axl/Mer (TAM) receptor tyrosine kinases promote phagocytic clearance of apoptotic cells and downregulate immune responses initiated by Toll-like receptors and type I interferons (IFNs). Many enveloped viruses display the phospholipid phosphatidylserine on their membranes, through which they bind Gas6 and Protein S and engage TAM receptors. We find that ligand-coated viruses activate TAM receptors on dendritic cells (DCs), dampen type I IFN signaling, and thereby evade host immunity and promote infection. Upon virus challenge, TAM-deficient DCs display type I IFN responses that are elevated in comparison to wild-type cells. As a consequence, TAM-deficient DCs are relatively resistant to infection by flaviviruses and pseudotyped retroviruses, but infection can be restored with neutralizing type I IFN antibodies. Correspondingly, a TAM kinase inhibitor antagonizes the infection of wild-type DCs. Thus, TAM receptors are engaged by viruses in order to attenuate type I IFN signaling and represent potential therapeutic targets. Copyright © 2013 Elsevier Inc. All rights reserved.

Molecular characterization of Prunus necrotic ringspot virus isolated from rose in Brazil.

OpenAIRE

FAJARDO, T. V. M.; NASCIMENTO, M. B.; EIRAS, M.; NICKEL, O.; PIO-RIBEIRO, G.

2016-01-01

ABSTRACT: There is no molecular characterization of Brazilian isolates of Prunus necrotic ringspot virus (PNRSV), except for those infecting peach. In this research, the causal agent of rose mosaic was determined and the movement (MP) and coat (CP) protein genes of a PNRSV isolate from rose were molecularly characterized for the first time in Brazil. The nucleotide and deduced amino acid sequences of MP and CP complete genes were aligned and compared with other isolates. Molecular analysis of...

Development of the novel coating formulations for skin vaccination using stainless steel microneedle.

Science.gov (United States)

Kim, Seong-Jin; Shin, Ju-Hyung; Noh, Jin-Yong; Song, Chang-Seon; Kim, Yeu-Chun

2016-10-01

This study focused on the development of novel coating formulations for stainless steel microneedles against influenza A virus. With in vitro studies, various viscosity enhancers and stabilizers were screened based on the hemagglutination activity of the vaccine, which was coated and dried onto a stainless steel chip at room temperature for 1 day. Following the long-term storage test, the hemagglutination activity and particle size of the vaccine, which was formulated with conventional or methylcellulose or hydroxyethyl cellulose and dried onto the microneedle, were monitored. Next, to evaluate the in vivo immunogenicity and protection effect of each dried vaccine formulation, mice were immunized by the antigen-coated microneedle, which had either the conventional or the proposed formulation. Two novel formulations were chosen in the preliminary screening, and in further evaluations, they exhibited a 20 % higher HA activity during storage for 3 months, and no aggregation was observed during storage after drying. In a mouse model, the microneedle with the novel formulation elicited a higher level of IgG and IgG2a was more prevalent in the IgG isotype profile. In addition, mice immunized with the HEC-coated microneedle survived with small weight loss (>90 %) against lethal challenge infection. Overall, the novel formulation hydroxyethyl cellulose preserved significantly higher HA activity during the production and storage of the microneedle as well as improved the in vivo immunogenicity of the vaccine.

Virus-Vectored Influenza Virus Vaccines

Science.gov (United States)

Tripp, Ralph A.; Tompkins, S. Mark

2014-01-01

Despite the availability of an inactivated vaccine that has been licensed for >50 years, the influenza virus continues to cause morbidity and mortality worldwide. Constant evolution of circulating influenza virus strains and the emergence of new strains diminishes the effectiveness of annual vaccines that rely on a match with circulating influenza strains. Thus, there is a continued need for new, efficacious vaccines conferring cross-clade protection to avoid the need for biannual reformulation of seasonal influenza vaccines. Recombinant virus-vectored vaccines are an appealing alternative to classical inactivated vaccines because virus vectors enable native expression of influenza antigens, even from virulent influenza viruses, while expressed in the context of the vector that can improve immunogenicity. In addition, a vectored vaccine often enables delivery of the vaccine to sites of inductive immunity such as the respiratory tract enabling protection from influenza virus infection. Moreover, the ability to readily manipulate virus vectors to produce novel influenza vaccines may provide the quickest path toward a universal vaccine protecting against all influenza viruses. This review will discuss experimental virus-vectored vaccines for use in humans, comparing them to licensed vaccines and the hurdles faced for licensure of these next-generation influenza virus vaccines. PMID:25105278

c-DNA of HIV-1 detection on spot of Buffy-Coat of leukocytes (DBCS)

OpenAIRE

Marco Rossi de Gasperis; Maria Daniela Caione; Carlo Concato; Ersilia Fiscarelli; Nicola Di Pietro; Vittorio Salotti; Lorenza Putignani; Donato Menichella; Francesco Callea

2010-01-01

Introduction:The elective way for the diagnosis of HIV-1-infection in the window period and in children under the age of 16-18 months is to search virus integrated in leukocytes. Aim of the study was to assess the sensitivity and specificity of extraction from Buffy-Dried Coat Spot (DBCS) in leukocyte to detect c-DNA with nested-PCR in HIV-1-infected individuals compared to Dried Blood Spot (DBS) both extracted by automated instrument EZ1 (QIAGEN, Hilden, Germany). Both DBCS and both DBS were...

Crystal structure of the bacteriophage Qβ coat protein in complex with the RNA operator of the replicase gene.

Science.gov (United States)

Rumnieks, Janis; Tars, Kaspars

2014-03-06

The coat proteins of single-stranded RNA bacteriophages specifically recognize and bind to a hairpin structure in their genome at the beginning of the replicase gene. The interaction serves to repress the synthesis of the replicase enzyme late in infection and contributes to the specific encapsidation of phage RNA. While this mechanism is conserved throughout the Leviviridae family, the coat protein and operator sequences from different phages show remarkable variation, serving as prime examples for the co-evolution of protein and RNA structure. To better understand the protein-RNA interactions in this virus family, we have determined the three-dimensional structure of the coat protein from bacteriophage Qβ bound to its cognate translational operator. The RNA binding mode of Qβ coat protein shares several features with that of the widely studied phage MS2, but only one nucleotide base in the hairpin loop makes sequence-specific contacts with the protein. Unlike in other RNA phages, the Qβ coat protein does not utilize an adenine-recognition pocket for binding a bulged adenine base in the hairpin stem but instead uses a stacking interaction with a tyrosine side chain to accommodate the base. The extended loop between β strands E and F of Qβ coat protein makes contacts with the lower part of the RNA stem, explaining the greater length dependence of the RNA helix for optimal binding to the protein. Consequently, the complex structure allows the proposal of a mechanism by which the Qβ coat protein recognizes and discriminates in favor of its cognate RNA. © 2013.

The presence of cucumber mosaic virus in pot marigold (Calendula officinalis L. in Serbia

Directory of Open Access Journals (Sweden)

Milošević Dragana

2015-01-01

Full Text Available During 2014 a total of 67 pot marigold samples from five different localities in the Province in Vojvodina were collected and analysed for the presence of Cucumber mosaic virus (CMV and Impatiens necrotic spot virus (INSV using commercial double-antibody sandwich (DAS-ELISA kits. CMV was detected serologically in all inspected localities in 67.16% collected samples. None of the analysed samples was positive for INSV. The virus was successfully mechanically transmitted to test plants including Chenopodium amaranticolor, C. quinoa, Datura stramonium, Nicotiana tabacum 'Samsun' and N. glutinosa, as well as pot marigold seedlings, confirming the infectious nature of the disease. The presence of CMV in pot marigold plants was further verified by RT-PCR and sequencing, using the specific primers CMV CPfwd/CMVCPrev that amplify coat protein (CP gene. Phylogenetic analysis based on the CP gene sequences showed clustering of the selected isolates into three subgroups, IA, IB and II, and Serbian CMV isolates from pot marigold belong to subgroup II.

Presence and characterization of Zucchini yellow mosaic virus in watermelon in Serbia

Directory of Open Access Journals (Sweden)

Vučurović Ana

2012-01-01

Full Text Available The presence of Zucchini yellow mosaic virus (ZYMV in two out of seven watermelon production localities in Serbia during 2011 was investigated by analyzing leaves sampled from symptomatic and asymptomatic watermelon plants and utilizing DAS-ELISA test. In the locality of Gornji Tavankut, ZYMV was detected in 23.08% of tested plants in single infections, and in the locality of Silbas it was detected in 35.29% of tested plants in mixed infections with Cucumber mosaic virus and Alfalfa mosaic virus. ZYMV was successfully mechanically transmitted from naturally infected watermelon plants to Cucurbita pepo 'Ezra F1'. Molecular detection was performed by RT-PCR and amplification of part of the gene for nuclear inclusions, gene of coat protein and part of 3' non-coding region, which confirmed the identification of the ZYMV isolates. Phylogenetic analysis revealed grouping of the isolate originating from watermelon with other isolates from Serbia and Central Europe within A-I subgroup. Analysis of amino acid sequences of the N terminal end of the CP gene revealed that isolate 550-11 belongs to the Central European branch.

Mixed zirconia calcium phosphate coatings for dental implants: Tailoring coating stability and bioactivity potential

International Nuclear Information System (INIS)

Pardun, Karoline; Treccani, Laura; Volkmann, Eike; Streckbein, Philipp; Heiss, Christian; Destri, Giovanni Li; Marletta, Giovanni; Rezwan, Kurosch

2015-01-01

Enhanced coating stability and adhesion are essential for long-term success of orthopedic and dental implants. In this study, the effect of coating composition on mechanical, physico-chemical and biological properties of coated zirconia specimens is investigated. Zirconia discs and dental screw implants are coated using the wet powder spraying (WPS) technique. The coatings are obtained by mixing yttria-stabilized zirconia (TZ) and hydroxyapatite (HA) in various ratios while a pure HA coating served as reference material. Scanning electron microscopy (SEM) and optical profilometer analysis confirm a similar coating morphology and roughness for all studied coatings, whereas the coating stability can be tailored with composition and is probed by insertion and dissections experiments in bovine bone with coated zirconia screw implants. An increasing content of calcium phosphate (CP) resulted in a decrease of mechanical and chemical stability, while the bioactivity increased in simulated body fluid (SBF). In vitro experiments with human osteoblast cells (HOB) revealed that the cells grew well on all samples but are affected by dissolution behavior of the studied coatings. This work demonstrates the overall good mechanical strength, the excellent interfacial bonding and the bioactivity potential of coatings with higher TZ contents, which provide a highly interesting coating for dental implants. - Highlights: • Different ratios of zirconia (TZ) and calcium phosphate (CP) were deposited on zirconia substrates. • Enhancement of TZ content in mixed coatings increased coating stability. • Enhancement of CP content in mixed coatings increased bioactivity. • All tested coating compositions were non-toxic

Mixed zirconia calcium phosphate coatings for dental implants: Tailoring coating stability and bioactivity potential

Energy Technology Data Exchange (ETDEWEB)

Pardun, Karoline [University of Bremen, Advanced Ceramics, Am Biologischen Garten 2, 28359 Bremen (Germany); Treccani, Laura, E-mail: treccani@uni-bremen.de [University of Bremen, Advanced Ceramics, Am Biologischen Garten 2, 28359 Bremen (Germany); Volkmann, Eike [University of Bremen, Advanced Ceramics, Am Biologischen Garten 2, 28359 Bremen (Germany); Streckbein, Philipp [University Hospital, Justus-Liebig-University Giessen, Department of Cranio-Maxillo-Facial Surgery, Klinikstrasse 33, 35385 Giessen (Germany); Heiss, Christian [University Hospital of Giessen-Marburg, Department of Trauma Surgery, Rudolf-Buchheim-Strasse 7, 35385 Giessen, Germany, (Germany); Laboratory of Experimental Surgery, Kerkraderstrasse 9, 35392 Giessen (Germany); Destri, Giovanni Li; Marletta, Giovanni [Laboratory for Molecular Surfaces and Nanotechnology (LAMSUN), Department of Chemistry, University of Catania and CSGI, Viale A. Doria 6, 95125 Catania (Italy); Rezwan, Kurosch [University of Bremen, Advanced Ceramics, Am Biologischen Garten 2, 28359 Bremen (Germany)

2015-03-01

Enhanced coating stability and adhesion are essential for long-term success of orthopedic and dental implants. In this study, the effect of coating composition on mechanical, physico-chemical and biological properties of coated zirconia specimens is investigated. Zirconia discs and dental screw implants are coated using the wet powder spraying (WPS) technique. The coatings are obtained by mixing yttria-stabilized zirconia (TZ) and hydroxyapatite (HA) in various ratios while a pure HA coating served as reference material. Scanning electron microscopy (SEM) and optical profilometer analysis confirm a similar coating morphology and roughness for all studied coatings, whereas the coating stability can be tailored with composition and is probed by insertion and dissections experiments in bovine bone with coated zirconia screw implants. An increasing content of calcium phosphate (CP) resulted in a decrease of mechanical and chemical stability, while the bioactivity increased in simulated body fluid (SBF). In vitro experiments with human osteoblast cells (HOB) revealed that the cells grew well on all samples but are affected by dissolution behavior of the studied coatings. This work demonstrates the overall good mechanical strength, the excellent interfacial bonding and the bioactivity potential of coatings with higher TZ contents, which provide a highly interesting coating for dental implants. - Highlights: • Different ratios of zirconia (TZ) and calcium phosphate (CP) were deposited on zirconia substrates. • Enhancement of TZ content in mixed coatings increased coating stability. • Enhancement of CP content in mixed coatings increased bioactivity. • All tested coating compositions were non-toxic.

[Establishment of chemiluminescent enzyme immunoassay for detecting antibodies against foot-and-mouth disease virus serotype O in swine].

Science.gov (United States)

Cui, Chen; Huang, Ligang; Li, Jing; Zou, Xingqi; Zhu, Yuanyuan; Xie, Lei; Zhao, Qizu; Yang, Limin; Liu, Wenjun

2016-11-25

Recombinant structural protein VP1 of foot-and-mouth disease virus serotype O was expressed in Escherichia coli and then purified using Nickel affinity chromatography. A chemiluminescent enzyme immunoassay (CLEIA) method was established using the purified recombinant protein as coating antigen to detect antibody of foot-and-mouth disease virus serotype O in swine. The specificity of VP1-CLEIA method is 100%. The coefficients of variation in the plate and between plates are 1.10%-6.70% and 0.66%-4.80%, respectively. Comparing with the commercial indirect ELISA kit or liquid phase block ELISA kit, the calculated coincidence rate is 93.50% or 94.00%. The high specificity and stability suggested this detection method can be used to monitor the antibody level of foot-and-mouth disease virus serotype O in swine.

Antibacterial polymer coatings.

Energy Technology Data Exchange (ETDEWEB)

Wilson, Mollye C.; Allen, Ashley N.; Barnhart, Meghan; Tucker, Mark David; Hibbs, Michael R.

2009-09-01

A series of poly(sulfone)s with quaternary ammonium groups and another series with aldehyde groups are synthesized and tested for biocidal activity against vegetative bacteria and spores, respectively. The polymers are sprayed onto substrates as coatings which are then exposed to aqueous suspensions of organisms. The coatings are inherently biocidal and do not release any agents into the environment. The coatings adhere well to both glass and CARC-coated coupons and they exhibit significant biotoxicity. The most effective quaternary ammonium polymers kills 99.9% of both gram negative and gram positive bacteria and the best aldehyde coating kills 81% of the spores on its surface.

Comparison of TiC coating and TD coating in actual application

International Nuclear Information System (INIS)

Kim, S.K.; Yoo, J.K.

1995-01-01

Large blocks of SKD-11 were treated by CVD-TiC coating process, TD coating process, TD coating process after vacuum heat treating, and vacuum heat treating. Amount of deformation was measured and compared to find the process which gives the least deformation. Wear tests were carried out for specimens treated by each process. Application of CVD-TiC and TD coating to the automotive press mold was studied

Expression of self-complementary hairpin RNA under the control of the rolC promoter confers systemic disease resistance to plum pox virus without preventing local infection

Directory of Open Access Journals (Sweden)

Spena Angelo

2003-06-01

Full Text Available Abstract Background Homology-dependent selective degradation of RNA, or post-transcriptional gene silencing (PTGS, is involved in several biological phenomena, including adaptative defense mechanisms against plant viruses. Small interfering RNAs mediate the selective degradation of target RNA by guiding a multicomponent RNAse. Expression of self-complementary hairpin RNAs within two complementary regions separated by an intron elicits PTGS with high efficiency. Plum pox virus (PPV is the etiological agent of sharka disease in Drupaceae, although it can also be transmitted to herbaceous species (e.g. Nicotiana benthamiana. Once inside the plant, PPV is transmitted via plasmodesmata from cell to cell, and at longer distances, via phloem. The rolC promoter drives expression in phloem cells. RolC expression is absent in both epidermal and mesophyll cells. The aim of the present study was to confer systemic disease resistance without preventing local viral infection. Results In the ihprolC-PP197 gene (intron hair pin rolC PPV 197, a 197 bp sequence homologous to the PPV RNA genome (from base 134 to 330 was placed as two inverted repeats separated by the DNA sequence of the rolA intron. This hairpin construct is under the control of the rolC promoter.N. benthamiana plants transgenic for the ihprolC-PP197 gene contain siRNAs homologous to the 197 bp sequence. The transgenic progeny of ihprolC-PP197 plants are resistant to PPV systemic infection. Local infection is unaffected. Most (80% transgenic plants are virus free and symptomless. Some plants (20% contain virus in uninoculated apical leaves; however they show only mild symptoms of leaf mottling. PPV systemic resistance cosegregates with the ihprolC-PP197 transgene and was observed in progeny plants of all independent transgenic lines analyzed. SiRNAs of 23–25 nt homologous to the PPV sequence used in the ihprolC-PP197 construct were detected in transgenic plants before and after inoculation

Recombination every day: abundant recombination in a virus during a single multi-cellular host infection.

Directory of Open Access Journals (Sweden)

Remy Froissart

2005-03-01

Full Text Available Viral recombination can dramatically impact evolution and epidemiology. In viruses, the recombination rate depends on the frequency of genetic exchange between different viral genomes within an infected host cell and on the frequency at which such co-infections occur. While the recombination rate has been recently evaluated in experimentally co-infected cell cultures for several viruses, direct quantification at the most biologically significant level, that of a host infection, is still lacking. This study fills this gap using the cauliflower mosaic virus as a model. We distributed four neutral markers along the viral genome, and co-inoculated host plants with marker-containing and wild-type viruses. The frequency of recombinant genomes was evaluated 21 d post-inoculation. On average, over 50% of viral genomes recovered after a single host infection were recombinants, clearly indicating that recombination is very frequent in this virus. Estimates of the recombination rate show that all regions of the genome are equally affected by this process. Assuming that ten viral replication cycles occurred during our experiment-based on data on the timing of coat protein detection-the per base and replication cycle recombination rate was on the order of 2 x 10(-5 to 4 x 10(-5. This first determination of a virus recombination rate during a single multi-cellular host infection indicates that recombination is very frequent in the everyday life of this virus.

The Use of Recombinant Hemagglutinine Protein of Rinderpest Virus in Enzyme Immunoassay

OpenAIRE

BULUT, Hakan; BOLAT, Yusuf

2003-01-01

In this study, Rinderpest virus (RPV) recombinant hemagglutinine protein (rH) fused with protein A region of Staphylococcus aureus was expressed in Escherichia coli and purified by IgG affinity chromatography. rH protein was also used to establish enzyme immunoassay. Therefore, to prevent IgG binding to the protein A the wells coated with the rH proteins were blocked by human serum. Afterwards, RPV antigens were added to the wells to evaluate this assay. To this end, serum from mice immunized...

Variability of geographically distinct isolates of maize rayado fino virus in Latin America.

Science.gov (United States)

Hammond, R W; Kogel, R; Ramirez, P

1997-12-01

We have examined the molecular epidemiology of the leafhopper-borne maize rayado fino virus (MRFV) in Latin America. The coat protein gene and 3' non-translated region of 14 isolates of MRFV collected from Latin America and the United States were sequenced and phylogenetic relationships examined. The nucleotide sequence revealed remarkable conservation, with a sequence similarity of 88-99%. Phylogenetic analysis of sequence data obtained from a 633 bp fragment showed that MRFV has diverged into three main clusters, i.e. the geographically distinct northern and southern isolates and the Colombian isolates. Significant differences between the isolates collected from Colombia, previously named maize rayado colombiana virus, based upon differences in symptomatology and serological relationships to MRFV, and the other MRFV isolates, provides additional evidence supporting its designation as a unique strain of MRFV.

Effects of Bond Coating on NiCrBSi-Mo Composite Functional Coating Properties in Plasma Spraying NiCrBSi-Mo/Ni Coating

OpenAIRE

DU Ji-yu; LI Fang-yi; LU Hai-yang; SHANG Jian-tong; LI Zhen

2017-01-01

Nickel-based bond coating and composite functional coating were sprayed on leaf blade steel material FV520B successively by using air plasma spraying system. NiCrBSi-Mo powder deposition rate, coating porosity, bonding strength and surface hardness were tested. The results indicate that, for the NiCrBSi-Mo/Ni coating, bond coating with 180-220μm thickness can improve NiCrBSi-Mo powder deposition rate while the surface coating with lower porosity, higher bonding strength and high hardness is p...

O-GlcNAc modification of the coat protein of the potyvirus Plum pox virus enhances viral infection.

Science.gov (United States)

Pérez, José de Jesús; Udeshi, Namrata D; Shabanowitz, Jeffrey; Ciordia, Sergio; Juárez, Silvia; Scott, Cheryl L; Olszewski, Neil E; Hunt, Donald F; García, Juan Antonio

2013-08-01

O-GlcNAcylation is a dynamic protein modification which has been studied mainly in metazoans. We reported previously that an Arabidopsis thaliana O-GlcNAc transferase modifies at least two threonine residues of the Plum pox virus (PPV) capsid protein (CP). Now, six additional residues were shown to be involved in O-GlcNAc modification of PPV CP. CP O-GlcNAcylation was abolished in the PPV CP7-T/A mutant, in which seven threonines were mutated. PPV CP7-T/A infected Nicotiana clevelandii, Nicotiana benthamiana, and Prunus persica without noticeable defects. However, defects in infection of A. thaliana were readily apparent. In mixed infections of wild-type arabidopsis, the CP7-T/A mutant was outcompeted by wild-type virus. These results indicate that CP O-GlcNAcylation has a major role in the infection process. O-GlcNAc modification may have a role in virion assembly and/or stability as the CP of PPV CP7-T/A was more sensitive to protease digestion than that of the wild-type virus. Copyright © 2013 Elsevier Inc. All rights reserved.

In-situ phosphatizing coatings for aerospace, OEM and coil coating applications

Science.gov (United States)

Neuder, Heather Aurelia

The current metal coating process is a multi-step process. The surface is cleaned, primered, dried and then painted. The process is labor intensive and time consuming. The wash primer is a conversion coating, which prepares metal surface for better paint adhesion. The wash primers currently used often contain hexavalent chromium (Cr6+), which seals the pores in the conversion coating. The presence of hexavalent chromium, a known carcinogen, and volatile organic compounds (VOCs) make waste disposal expensive and pose dangers to workers. The novel technique of in-situ phosphatizing coating (ISPC) is a single-step, chrome-free alternative to the present coating practice. Formulation of an ISPC involves predispersal of an in-situ phosphatizing reagent (ISPR) into the paint system to form a stable formulation. The ISPR reacts with the metal surface and bonds with the paint film simultaneously, which eliminates the need for a conversion coating. In acid catalyzed paint systems, such as polyester-melamine paints, the ISPR also catalyzes cross-linking reactions between the melamine and the polyester polyols. ISPCs are formulated using commercially available coating systems including: polyester-melamine, two-component epoxy, polyurethane and high-hydroxy content polyester-melamine coil coating. The ISPCs are applied to metal substrates and their performances are evaluated using electrochemical, thermal and standard American Society for Testing and Materials (ASTM) testing methods. In addition, ISPCs were designed and formulated based on: (1) phosphate chemistry, (2) polymer chemistry, (3) sol-gel chemistry, and (4) the ion-exchange principle. Organo-functionalized silanes, which serve as excellent coupling and dispersion agents, are incorporated into the optimized ISPC formula and evaluated using standard ASTM testing methods and electrochemical spectroscopy. Also, an ion-exchange pigment, which leads to better adhesion by forming a mixed metal silicate surface, is

Thin coatings for heavy industry: Advanced coatings for pipes and valves

Science.gov (United States)

Vernhes, Luc

Pipes and valves are pressure vessels that regulate the flow of materials (liquids, gases, and slurries) by controlling the passageways. To optimize processes, reduce costs, and comply with government regulations, original equipment manufacturers (OEMs) must maintain their products in state-of-the-art condition. The first valves were invented over 3,000 years ago to supply water to farms and cities. They were made with bronze alloys, providing good corrosion resistance and acceptable tribological performance. The industrial revolution drove manufacturers to develop new and improved tribological materials. In the 20th century, innovative alloys such as Monel copper-nickel and Stellite cobalt-chrome as well as hard chrome plating were introduced to better control tribological properties and maximize in-service life. Since then, new materials have been regularly introduced to extend the range of applications for valves. For example, Teflon fluoropolymers are used in corrosive chemical and petrochemical processes, the nickel-based superalloys Hastelloy and Inconel for petrochemical applications, and creep-resistant chromium-rich F91 steel for supercritical power plants. Recently, the valve industry has embraced the use of hard thermal sprayed coatings for the most demanding applications, and is investing heavily in research to develop the most suitable coatings for specific uses. There is increasing evidence that the optimal solution to erosive, corrosive, and fretting wear problems lies in the design and manufacture of multi-layer, graded, and/or nanostructured coatings and coating systems that combine controlled hardness with high elastic modulus, high toughness, and good adhesion. The overall objectives of this thesis were 1) to report on advances in the development of structurally controlled hard protective coatings with tailored mechanical, elastoplastic, and thermal properties; and 2) to describe enhanced wear-, erosion-, and corrosion-resistance and other

Experimental exposure of pregnant mares to the asinine-94 strain of equine arteritis virus

Directory of Open Access Journals (Sweden)

J.T. Paweska

1997-07-01

Full Text Available Clinical, virological and serological responses were evaluated in 10 pregnant mares after different challenge exposures to the asinine-94 strain of equine arteritis virus (EAV. The outcome of maternal infection on the progeny was also investigated. Mares were inoculated intranasally (n = 4, intramuscularly (n = 2, intravenously (n = 1, or contact-exposed (n = 3. All inoculated mares developed pyrexia, 5 showed mild clinical signs related to EAV infection and 2 remained asymptomatic. Viraemia was detected in all the inoculated animals and shedding of virus from the respiratory tract occurred in 6. Five mares were re-challenged intranasally 7 and 15 weeks after inoculation. Clinical signs of the disease in these mares were limited to mild conjunctivitis. After re-challenge, virus was recovered from buffy coat cultures of 2 mares 2-6 days after re-infection. EAV was not recovered from colostrum and milk samples during the 1st week post partum. All inoculated mares seroconverted to EAV 8-12 days post inoculation and also seroconverted after re-challenge. No clinical signs of EAV infection were observed in the 3 mares kept in close contact during the post-inoculation and re-challenge periods. Serum neutralising antibody to the virus was detected in 1 in-contact mare only, while a detectable concentration of specific IgG was found by ELISA in the colostrum of 1 of the other in-contact mares. Eight of the mares gave birth to clinically normal foals, although 1 was born prematurely. Shortly after birth, 7 foals developed fever and variable clinical signs; 5 foals became septicaemic and 3 of them died 2-5 days after birth, while the remaining 2 were euthanased at 1 month of age. EAV was not recovered from the placenta, from buffy coat fractions of blood collected from foals immediately after birth and 1-3 days later, or from a range of tissues taken from the 3 foals that died and 2 that were euthanased. Virus was not isolated from tissues collected from

Inhibition of HIV Virus by Neutralizing Vhh Attached to Dual Functional Liposomes Encapsulating Dapivirine.

Science.gov (United States)

Wang, Scarlet Xiaoyan; Michiels, Johan; Ariën, Kevin K; New, Roger; Vanham, Guido; Roitt, Ivan

2016-12-01

Although highly active antiretroviral therapy (HAART) has greatly improved the life expectancy of HIV/AIDS patients, the treatment is not curative. It is a global challenge which fosters an urgent need to develop an effective drug or neutralizing antibody delivery approach for the prevention and treatment of this disease. Due to the low density of envelope spikes with restricted mobility present on the surface of HIV virus, which limit the antibody potency and allow virus mutation and escape from the immune system, it is important for a neutralizing antibody to form bivalent or multivalent bonds with the virus. Liposome constructs could fulfil this need due to the flexible mobility of the membrane with its attached antibodies and the capacity for drug encapsulation. In this study, we evaluated the neutralization activity of a range of liposome formulations in different sizes coated with anti-gp120 llama antibody fragments (Vhhs) conjugated via either non-covalent metal chelation or a covalent linkage. The non-covalent construct demonstrated identical binding affinity to HIV-1 envelope glycoprotein gp120 and neutralizing ability for HIV virus as free Vhh. Although covalently linked Vhh showed significant binding affinity to gp120, it unexpectedly had a lower neutralization potency. This may be due to the comparability in size of the viral and liposome particles restricting the number which can be bound to the liposome surface so involving only a fraction of the antibodies, whereas non-covalently attached antibodies dissociate from the surface after acting with gp120 and free the remainder to bind further viruses. Covalently conjugated Vhh might also trigger the cellular uptake of a liposome-virion complex. To explore the possible ability of the antibody-coated liposomes to have a further function, we encapsulated the hydrophobic antiviral drug dapivirine into both of the non-covalently and covalently conjugated liposome formulations, both of which revealed high

Inhibition of HIV Virus by Neutralizing Vhh Attached to Dual Functional Liposomes Encapsulating Dapivirine

Science.gov (United States)

Wang, Scarlet Xiaoyan; Michiels, Johan; Ariën, Kevin K.; New, Roger; Vanham, Guido; Roitt, Ivan

2016-07-01

Although highly active antiretroviral therapy (HAART) has greatly improved the life expectancy of HIV/AIDS patients, the treatment is not curative. It is a global challenge which fosters an urgent need to develop an effective drug or neutralizing antibody delivery approach for the prevention and treatment of this disease. Due to the low density of envelope spikes with restricted mobility present on the surface of HIV virus, which limit the antibody potency and allow virus mutation and escape from the immune system, it is important for a neutralizing antibody to form bivalent or multivalent bonds with the virus. Liposome constructs could fulfil this need due to the flexible mobility of the membrane with its attached antibodies and the capacity for drug encapsulation. In this study, we evaluated the neutralization activity of a range of liposome formulations in different sizes coated with anti-gp120 llama antibody fragments (Vhhs) conjugated via either non-covalent metal chelation or a covalent linkage. The non-covalent construct demonstrated identical binding affinity to HIV-1 envelope glycoprotein gp120 and neutralizing ability for HIV virus as free Vhh. Although covalently linked Vhh showed significant binding affinity to gp120, it unexpectedly had a lower neutralization potency. This may be due to the comparability in size of the viral and liposome particles restricting the number which can be bound to the liposome surface so involving only a fraction of the antibodies, whereas non-covalently attached antibodies dissociate from the surface after acting with gp120 and free the remainder to bind further viruses. Covalently conjugated Vhh might also trigger the cellular uptake of a liposome-virion complex. To explore the possible ability of the antibody-coated liposomes to have a further function, we encapsulated the hydrophobic antiviral drug dapivirine into both of the non-covalently and covalently conjugated liposome formulations, both of which revealed high

Nucleocapsid Gene-Mediated Transgenic Resistance Provides Protection Against Tomato spotted wilt virus Epidemics in the Field.

Science.gov (United States)

Herrero, S; Culbreath, A K; Csinos, A S; Pappu, H R; Rufty, R C; Daub, M E

2000-02-01

ABSTRACT Transformation of plants with the nucleocapsid (N) gene of Tomato spotted wilt tospovirus (TSWV) provides resistance to disease development; however, information is lacking on the response of plants to natural inoculum in the field. Three tobacco cultivars were transformed with the N gene of a dahlia isolate of TSWV (TSWV-D), and plants were evaluated over several generations in the greenhouse. The resistant phenotype was more frequently observed in 'Burley 21' than in 'KY-14' or 'K-326', but highly resistant 'Burley 21' transgenic lines were resistant to only 44% of the heterologous TSWV isolates tested. Advanced generation (R(3) and R(4)) transgenic resistant lines of 'Burley 21' and a 'K-326' F(1) hybrid containing the N genes of two TSWV isolates were evaluated in the field near Tifton, GA, where TSWV is endemic. Disease development was monitored by symptom expression and enzyme-linked immunosorbent assay (ELISA) analysis. Whereas incidence of TSWV infection in 'Burley 21' susceptible controls was 20% in 1996 and 62% in 1997, the mean incidence in transgenic lines was reduced to 4 and 31%, respectively. Three transgenic 'Burley 21' lines were identified that had significantly lower incidence of disease than susceptible controls over the two years of the study. In addition, the rate of disease increase at the onset of the 1997 epidemic was reduced for all the 'Burley 21' transgenic lines compared with the susceptible controls. The 'K-326' F(1) hybrid was as susceptible as the 'K-326' nontransformed control. ELISA analysis demonstrated that symptomless plants from the most resistant 'Burley 21' transgenic lines accumulated detectable nucleocapsid protein, whereas symptomless plants from more susceptible lines did not. We conclude that transgenic resistance to TSWV is effective in reducing incidence of the disease in the field, and that accumulation of transgene protein may be important in broad-spectrum resistance.

Cold-Sprayed AZ91D Coating and SiC/AZ91D Composite Coatings

Directory of Open Access Journals (Sweden)

Yingying Wang

2018-03-01

Full Text Available As an emerging coating building technique, cold spraying has many advantages to elaborate Mg alloy workpieces. In this study, AZ91D coatings and AZ91D-based composite coatings were deposited using cold spraying. Coatings were prepared using different gas temperatures to obtain the available main gas temperature. Compressed air was used as the accelerating gas, and although magnesium alloy is oxidation-sensitive, AZ91D coatings with good performance were obtained. The results show that dense coatings can be fabricated until the gas temperature is higher than 500 °C. The deposition efficiency increases greatly with the gas temperature, but it is lower than 10% for all coating specimens. To analyze the effects of compressed air on AZ91D powder particles and the effects of gas temperature on coatings, the phase composition, porosity, cross-sectional microstructure, and microhardness of coatings were characterized. X-ray diffraction and oxygen content analysis clarified that no phase transformation or oxidation occurred on AZ91D powder particles during cold spraying processes with compressed air. The porosity of AZ91D coatings remained between 3.6% and 3.9%. Impact melting was found on deformed AZ91D particles when the gas temperature increased to 550 °C. As-sprayed coatings exhibit much higher microhardness than as-casted bulk magnesium, demonstrating the dense structure of cold-sprayed coatings. To study the effects of ceramic particles on cold-sprayed AZ91D coatings, 15 vol % SiC powder particles were added into the feedstock powder. Lower SiC content in the coating than in the feedstock powder means that the deposition efficiency of the SiC powder particles is lower than the deposition efficiency of AZ91D particles. The addition of SiC particles reduces the porosity and increases the microhardness of cold-sprayed AZ91D coatings. The corrosion behavior of AZ91D coating and SiC reinforced AZ91D composite coating were examined. The Si

Hard coatings

International Nuclear Information System (INIS)

Dan, J.P.; Boving, H.J.; Hintermann, H.E.

1993-01-01

Hard, wear resistant and low friction coatings are presently produced on a world-wide basis, by different processes such as electrochemical or electroless methods, spray technologies, thermochemical, CVD and PVD. Some of the most advanced processes, especially those dedicated to thin film depositions, basically belong to CVD or PVD technologies, and will be looked at in more detail. The hard coatings mainly consist of oxides, nitrides, carbides, borides or carbon. Over the years, many processes have been developed which are variations and/or combinations of the basic CVD and PVD methods. The main difference between these two families of deposition techniques is that the CVD is an elevated temperature process (≥ 700 C), while the PVD on the contrary, is rather a low temperature process (≤ 500 C); this of course influences the choice of substrates and properties of the coating/substrate systems. Fundamental aspects of the vapor phase deposition techniques and some of their influences on coating properties will be discussed, as well as the very important interactions between deposit and substrate: diffusions, internal stress, etc. Advantages and limitations of CVD and PVD respectively will briefly be reviewed and examples of applications of the layers will be given. Parallel to the development and permanent updating of surface modification technologies, an effort was made to create novel characterisation methods. A close look will be given to the coating adherence control by means of the scratch test, at the coating hardness measurement by means of nanoindentation, at the coating wear resistance by means of a pin-on-disc tribometer, and at the surface quality evaluation by Atomic Force Microscopy (AFM). Finally, main important trends will be highlighted. (orig.)

Unraveling the Role of the C-terminal Helix Turn Helix of the Coat-binding Domain of Bacteriophage P22 Scaffolding Protein*

Science.gov (United States)

Padilla-Meier, G. Pauline; Gilcrease, Eddie B.; Weigele, Peter R.; Cortines, Juliana R.; Siegel, Molly; Leavitt, Justin C.; Teschke, Carolyn M.; Casjens, Sherwood R.

2012-01-01

Many viruses encode scaffolding and coat proteins that co-assemble to form procapsids, which are transient precursor structures leading to progeny virions. In bacteriophage P22, the association of scaffolding and coat proteins is mediated mainly by ionic interactions. The coat protein-binding domain of scaffolding protein is a helix turn helix structure near the C terminus with a high number of charged surface residues. Residues Arg-293 and Lys-296 are particularly important for coat protein binding. The two helices contact each other through hydrophobic side chains. In this study, substitution of the residues of the interface between the helices, and the residues in the β-turn, by aspartic acid was used examine the importance of the conformation of the domain in coat binding. These replacements strongly affected the ability of the scaffolding protein to interact with coat protein. The severity of the defect in the association of scaffolding protein to coat protein was dependent on location, with substitutions at residues in the turn and helix 2 causing the most significant effects. Substituting aspartic acid for hydrophobic interface residues dramatically perturbs the stability of the structure, but similar substitutions in the turn had much less effect on the integrity of this domain, as determined by circular dichroism. We propose that the binding of scaffolding protein to coat protein is dependent on angle of the β-turn and the orientation of the charged surface on helix 2. Surprisingly, formation of the highly complex procapsid structure depends on a relatively simple interaction. PMID:22879595

How baculovirus polyhedra fit square pegs into round holes to robustly package viruses.

Science.gov (United States)

Ji, Xiaoyun; Sutton, Geoff; Evans, Gwyndaf; Axford, Danny; Owen, Robin; Stuart, David I

2010-01-20

Natural protein crystals (polyhedra) armour certain viruses, allowing them to survive for years under hostile conditions. We have determined the structure of polyhedra of the baculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV), revealing a highly symmetrical covalently cross-braced robust lattice, the subunits of which possess a flexible adaptor enabling this supra-molecular assembly to specifically entrap massive baculoviruses. Inter-subunit chemical switches modulate the controlled release of virus particles in the unusual high pH environment of the target insect's gut. Surprisingly, the polyhedrin subunits are more similar to picornavirus coat proteins than to the polyhedrin of cytoplasmic polyhedrosis virus (CPV). It is, therefore, remarkable that both AcMNPV and CPV polyhedra possess identical crystal lattices and crystal symmetry. This crystalline arrangement must be particularly well suited to the functional requirements of the polyhedra and has been either preserved or re-selected during evolution. The use of flexible adaptors to generate a powerful system for packaging irregular particles is characteristic of the AcMNPV polyhedrin and may provide a vehicle to sequester a wide range of objects such as biological nano-particles.

Anticorrosive coatings: a review

DEFF Research Database (Denmark)

Sørensen, Per Aggerholm; Kiil, Søren; Dam-Johansen, Kim

2009-01-01

of volatile organic compounds (VOCs) have caused significant changes in the anticorrosive coating industry. The requirement for new VOC-compliant coating technologies means that coating manufacturers can no longer rely on the extensive track record of their time-served products to convince consumers...... of their suitability for use. An important aspect in the development of new VOC-compliant, high-performance anticorrosive coating systems is a thorough knowledge of the components in anticorrosive coatings, their interactions, their advantages and limitations, as well as a detailed knowledge on the failure modes......, and inhibitive coatings are outlined. In the past decades, several alternatives to organic solvent-borne coatings have reached the commercial market. This review also presents some of these technologies and discusses some of their advantages and limitations. Finally, some of the mechanisms leading to degradation...

Charged-particle coating

International Nuclear Information System (INIS)

Johnson, W.L.; Crane, J.K.; Hendricks, C.D.

1980-01-01

Advanced target designs require thicker (approx. 300 μm) coatings and better surface finishes that can be produced with current coating techniques. An advanced coating technique is proposed to provide maximum control of the coating flux and optimum manipulation of the shell during processing. In this scheme a small beam of ions or particles of known incident energy are collided with a levitated spherical mandrel. Precise control of the incident energy and angle of the deposition flux optimizes the control of the coating morphology while controlled rotation and noncontact support of the shell minimizes the possibility of particulate or damage generated defects. Almost infinite variability of the incident energy and material in this process provides increased flexibility of the target designs which can be physically realized

Comparison of additive amount used in spin-coated and roll-coated organic solar cells

DEFF Research Database (Denmark)

Cheng, Pei; Lin, Yuze; Zawacka, Natalia Klaudia

2014-01-01

All-polymer and polymer/fullerene inverted solar cells were fabricated by spin-coating and roll-coating processes. The spin-coated small-area (0.04 cm(2)) devices were fabricated on indium tin oxide (ITO) coated glass substrates in nitrogen. The roll-coated large-area (1.0 cm(2)) devices were...

Chick embryo lethal orphan virus can be polymer-coated and retargeted to infect mammalian cells

Czech Academy of Sciences Publication Activity Database

Stevenson, M.; Boos, E.; Herbert, C. W.; Hale, A. B.; Green, N.; Lyons, M.; Chandler, L.; Ulbrich, Karel; van Rooijen, N.; Mautner, V.; Fisher, K.; Seymour, L.

2006-01-01

Roč. 13, č. 4 (2006), s. 356-368 ISSN 0969-7128 EU Projects: European Commission(XE) 512087 - GIANT Institutional research plan: CEZ:AV0Z40500505 Keywords : CELO virus * N-(2-hydroxypropyl)methacrylamide * retargeting Subject RIV: CE - Biochemistry Impact factor: 4.782, year: 2006

Coated particle waste form development

International Nuclear Information System (INIS)

Oma, K.H.; Buckwalter, C.Q.; Chick, L.A.

1981-12-01

Coated particle waste forms have been developed as part of the multibarrier concept at Pacific Northwest Laboratory under the Alternative Waste Forms Program for the Department of Energy. Primary efforts were to coat simulated nuclear waste glass marbles and ceramic pellets with low-temperature pyrolytic carbon (LT-PyC) coatings via the process of chemical vapor deposition (CVD). Fluidized bed (FB) coaters, screw agitated coaters (SAC), and rotating tube coaters were used. Coating temperatures were reduced by using catalysts and plasma activation. In general, the LT-PyC coatings did not provide the expected high leach resistance as previously measured for carbon alone. The coatings were friable and often spalled off the substrate. A totally different concept, thermal spray coating, was investigated at PNL as an alternative to CVD coating. Flame spray, wire gun, and plasma gun systems were evaluated using glass, ceramic, and metallic coating materials. Metal plasma spray coatings (Al, Sn, Zn, Pb) provided a two to three orders-of-magnitude increase in chemical durability. Because the aluminum coatings were porous, the superior leach resistance must be due to either a chemical interaction or to a pH buffer effect. Because they are complex, coated waste form processes rank low in process feasibility. Of all the possible coated particle processes, plasma sprayed marbles have the best rating. Carbon coating of pellets by CVD ranked ninth when compared with ten other processes. The plasma-spray-coated marble process ranked sixth out of eleven processes

Friction surfaced Stellite6 coatings

International Nuclear Information System (INIS)

Rao, K. Prasad; Damodaram, R.; Rafi, H. Khalid; Ram, G.D. Janaki; Reddy, G. Madhusudhan; Nagalakshmi, R.

2012-01-01

Solid state Stellite6 coatings were deposited on steel substrate by friction surfacing and compared with Stellite6 cast rod and coatings deposited by gas tungsten arc and plasma transferred arc welding processes. Friction surfaced coatings exhibited finer and uniformly distributed carbides and were characterized by the absence of solidification structure and compositional homogeneity compared to cast rod, gas tungsten arc and plasma transferred coatings. Friction surfaced coating showed relatively higher hardness. X-ray diffraction of samples showed only face centered cubic Co peaks while cold worked coating showed hexagonally close packed Co also. - Highlights: ► Stellite6 used as coating material for friction surfacing. ► Friction surfaced (FS) coatings compared with casting, GTA and PTA processes. ► Finer and uniformly distributed carbides in friction surfaced coatings. ► Absence of melting results compositional homogeneity in FS Stellite6 coatings.

The Influence of Nano-Fibrillated Cellulose as a Coating Component in Paper Coating

Directory of Open Access Journals (Sweden)

Yaxi Xu

2016-03-01

Full Text Available This work investigates nano-fibrillated cellulose (NFC as a component in mineral pigment paper coating. In this work, bleached Eucalyptus pulp was pretreated by TEMPO (2,2,6,6-tetramethyl-1-piperdinyloxy-mediated oxidation. The oxidized pulp was then isolated to obtain NFC by sonication. Aqueous coating colors consisting of calcium carbonate, clay, carboxylated butadiene-styrene latex, additives, and NFC were prepared. The rheology of the coating colors and the surface properties of paper coated with NFC containing coating colors were determined. The rheological properties allowed NFC to be used in small amounts under laboratory conditions. Nano-fibrillated cellulose was found to improve the surface strength and smoothness of the coated paper. The water resistance of coated paper, on the other hand, decreased because of the hydrophilicity of NFC.

Widespread distribution and a new recombinant species of Brazilian virus associated with cotton blue disease

Directory of Open Access Journals (Sweden)

Silvie P

2008-10-01

Full Text Available Abstract Background Cotton blue disease (CBD, an important global cotton crop pathology responsible for major economic losses, is prevalent in the major cotton-producing states of Brazil. Typical CBD symptoms include stunting due to internodal shortening, leaf rolling, intense green foliage, and yellowing veins. Atypical CBD symptoms, including reddish and withered leaves, were also observed in Brazilian cotton fields in 2007. Recently, a Polerovirus named Cotton leafroll dwarf virus (CLRDV was shown to be associated with CBD. Results To understand the distribution and genetic diversity of CLRDV in Brazil, we analyzed 23 CBD-symptomatic plants from susceptible cotton varieties originating from five of the six most important cotton-growing states, from 2004–2007. Here, we report on CLRDV diversity in plants with typical or atypical CBD symptoms by comparing viral coat protein, RNA polymerase (RdRp, and intergenic region genomic sequences. Conclusion The virus had a widespread distribution with a low genetic diversity; however, three divergent isolates were associated with atypical CBD symptoms. These divergent isolates had a CLRDV-related coat protein but a distinct RdRp sequence, and probably arose from recombination events. Based on the taxonomic rules for the family Luteoviridae, we propose that these three isolates represent isolates of a new species in the genus Polerovirus.

Widespread distribution and a new recombinant species of Brazilian virus associated with cotton blue disease.

Science.gov (United States)

Silva, T F; Corrêa, R L; Castilho, Y; Silvie, P; Bélot, J-L; Vaslin, M F S

2008-10-20

Cotton blue disease (CBD), an important global cotton crop pathology responsible for major economic losses, is prevalent in the major cotton-producing states of Brazil. Typical CBD symptoms include stunting due to internodal shortening, leaf rolling, intense green foliage, and yellowing veins. Atypical CBD symptoms, including reddish and withered leaves, were also observed in Brazilian cotton fields in 2007. Recently, a Polerovirus named Cotton leafroll dwarf virus (CLRDV) was shown to be associated with CBD. To understand the distribution and genetic diversity of CLRDV in Brazil, we analyzed 23 CBD-symptomatic plants from susceptible cotton varieties originating from five of the six most important cotton-growing states, from 2004-2007. Here, we report on CLRDV diversity in plants with typical or atypical CBD symptoms by comparing viral coat protein, RNA polymerase (RdRp), and intergenic region genomic sequences. The virus had a widespread distribution with a low genetic diversity; however, three divergent isolates were associated with atypical CBD symptoms. These divergent isolates had a CLRDV-related coat protein but a distinct RdRp sequence, and probably arose from recombination events. Based on the taxonomic rules for the family Luteoviridae, we propose that these three isolates represent isolates of a new species in the genus Polerovirus.

Thermal Stability of RNA Phage Virus-Like Particles Displaying Foreign Peptides

Directory of Open Access Journals (Sweden)

Peabody David S

2011-05-01

Full Text Available Abstract Background To be useful for genetic display of foreign peptides a viral coat protein must tolerate peptide insertions without major disruption of subunit folding and capsid assembly. The folding of the coat protein of RNA phage MS2 does not normally tolerate insertions in its AB-loop, but an engineered single-chain dimer readily accepts them as long as they are restricted to one of its two halves. Results Here we characterize the effects of peptide insertions on the thermal stabilities of MS2 virus-like particles (VLPs displaying a variety of different peptides in one AB-loop of the coat protein single-chain dimer. These particles typically denature at temperatures around 5-10°C lower than unmodified VLPs. Even so, they are generally stable up to about 50°C. VLPs of the related RNA phage PP7 are cross-linked with intersubunit disulfide bonds and are therefore significantly more stable. An AB-loop insertion also reduces the stability of PP7 VLPs, but they only begin to denature above about 70°C. Conclusions VLPs assembled from MS2 single-chain dimer coat proteins with peptide insertions in one of their AB-loops are somewhat less stable than the wild-type particle, but still resist heating up to about 50°C. Because they possess disulfide cross-links, PP7-derived VLPs provide an alternate platform with even higher stability.

Thermal stability of double-ceramic-layer thermal barrier coatings with various coating thickness

International Nuclear Information System (INIS)

Dai Hui; Zhong Xinghua; Li Jiayan; Zhang Yanfei; Meng Jian; Cao Xueqiang

2006-01-01

Double-ceramic-layer (DCL) coatings with various thickness ratios composed of YSZ (6-8 wt.% Y 2 O 3 + ZrO 2 ) and lanthanum zirconate (LZ, La 2 Zr 2 O 7 ) were produced by the atmospheric plasma spraying. Chemical stability of LZ in contact with YSZ in DCL coatings was investigated by calcining powder blends at different temperatures. No obvious reaction was observed when the calcination temperature was lower than 1250 deg. C, implying that LZ and YSZ had good chemical applicability for producing DCL coating. The thermal cycling test indicate that the cycling lives of the DCL coatings are strongly dependent on the thickness ratio of LZ and YSZ, and the coatings with YSZ thickness between 150 and 200 μm have even longer lives than the single-layer YSZ coating. When the YSZ layer is thinner than 100 μm, the DCL coatings failed in the LZ layer close to the interface of YSZ layer and LZ layer. For the coatings with the YSZ thickness above 150 μm, the failure mainly occurs at the interface of the YSZ layer and the bond coat

The C terminus of the polerovirus p5 readthrough domain limits virus infection to the phloem.

Science.gov (United States)

Peter, Kari A; Gildow, Frederick; Palukaitis, Peter; Gray, Stewart M

2009-06-01

Poleroviruses are restricted to vascular phloem tissues from which they are transmitted by their aphid vectors and are not transmissible mechanically. Phloem limitation has been attributed to the absence of virus proteins either facilitating movement or counteracting plant defense. The polerovirus capsid is composed of two forms of coat protein, the major P3 protein and the minor P3/P5 protein, a translational readthrough of P3. P3/P5 is required for insect transmission and acts in trans to facilitate long-distance virus movement in phloem tissue. Specific potato leafroll virus mutants lacking part or all of the P5 domain moved into and infected nonvascular mesophyll tissue when the source-sink relationship of the plant (Solanum sarrachoides) was altered by pruning, with the progeny virus now being transmissible mechanically. However, in a period of months, a phloem-specific distribution of the virus was reestablished in the absence of aphid transmission. Virus from the new phloem-limited infection showed compensatory mutations that would be expected to restore the production of full-length P3/P5 as well as the loss of mechanical transmissibility. The data support our hypothesis that phloem limitation in poleroviruses presumably does not result from a deficiency in the repertoire of virus genes but rather results from P3/P5 accumulation under selection in the infected plant, with the colateral effect of facilitating transmission by phloem-feeding aphid vectors.

The C Terminus of the Polerovirus P5 Readthrough Domain Limits Virus Infection to the Phloem▿

Science.gov (United States)

Peter, Kari A.; Gildow, Frederick; Palukaitis, Peter; Gray, Stewart M.

2009-01-01

Poleroviruses are restricted to vascular phloem tissues from which they are transmitted by their aphid vectors and are not transmissible mechanically. Phloem limitation has been attributed to the absence of virus proteins either facilitating movement or counteracting plant defense. The polerovirus capsid is composed of two forms of coat protein, the major P3 protein and the minor P3/P5 protein, a translational readthrough of P3. P3/P5 is required for insect transmission and acts in trans to facilitate long-distance virus movement in phloem tissue. Specific potato leafroll virus mutants lacking part or all of the P5 domain moved into and infected nonvascular mesophyll tissue when the source-sink relationship of the plant (Solanum sarrachoides) was altered by pruning, with the progeny virus now being transmissible mechanically. However, in a period of months, a phloem-specific distribution of the virus was reestablished in the absence of aphid transmission. Virus from the new phloem-limited infection showed compensatory mutations that would be expected to restore the production of full-length P3/P5 as well as the loss of mechanical transmissibility. The data support our hypothesis that phloem limitation in poleroviruses presumably does not result from a deficiency in the repertoire of virus genes but rather results from P3/P5 accumulation under selection in the infected plant, with the colateral effect of facilitating transmission by phloem-feeding aphid vectors. PMID:19297484

Development of disease-resistant lines of grain legumes through mutation breeding

International Nuclear Information System (INIS)

Bravo, A.

1983-01-01

Mutation breeding has been attempted for developing genotypes that may contain resistance to: (a) a necrotic strain of common mosaic virus in common bean (Phaseolus vulgaris L.); (b) soil fungi causing wilt in chickpea (Cicer arietinum L.); (c) the fungus Uromyces fabae that causes rust in lentil (Lens culinaris). Seeds of these three species were treated with gamma rays and planted in October 1979. Mature M 1 plants were harvested individually in March 1980. M 2 seeds were sown as single-row plant progenies in the fall (June) and spring (September) of 1980. Chickpea and lentil were planted in a soil naturally infested with soil-borne fungi (Fusarium sp. and Phytophthora sp.). Lentil plants were sprayed with a suspension of spores of the rust fungus on two occasions. Bean plants were sprayed with a suspension of virus particles mixed with carborundum. Symptomless plants were selected and harvested. There were 47 such plants of lentils and 246 of chickpea. Progenies of these plants will be tested again in replicated rows. None of the bean plants was free of virus symptoms. The least severely damaged ones were harvested. Some chickpea materials appear fairly promising. (author)

Plant viruses as scaffolds for the presentation of vaccine epitopes

Czech Academy of Sciences Publication Activity Database

Plchová, Helena; Čeřovská, Noemi; Vaculík, Petr; Moravec, Tomáš

2017-01-01

Roč. 61, č. 1 (2017), s. 1-12 ISSN 0006-3134 R&D Projects: GA ČR(CZ) GA15-10768S; GA ČR(CZ) GAP501/12/1761 Grant - others:European Regional Development Fund(XE) CZ.2.16/3.1.00/24014 Institutional support: RVO:61389030 Keywords : tobacco-mosaic-virus * x coat protein * human-papillomavirus type-16 * green fluorescent protein * n-terminal segment * triple gene block * cell-to-cell * transient expression * nicotiana-benthamiana * viral vector * transient expression * plant viral expression vectors Subject RIV: GE - Plant Breeding OBOR OECD: Virology Impact factor: 1.551, year: 2016

Quality of Coated Particles : Physical - Mechanical Characterization of Polymeric Film Coatings

NARCIS (Netherlands)

Perfetti, G.

2012-01-01

All coated particle producers, when applying the coating layer(s) would like to know precisely what is the best coating system to use in order to answer customer’s requests. It is, therefore, of very high relevance for many industries, to have a clear understanding of what are the parameters I need

Flow accelerated organic coating degradation

Science.gov (United States)

Zhou, Qixin

Applying organic coatings is a common and the most cost effective way to protect metallic objects and structures from corrosion. Water entry into coating-metal interface is usually the main cause for the deterioration of organic coatings, which leads to coating delamination and underfilm corrosion. Recently, flowing fluids over sample surface have received attention due to their capability to accelerate material degradation. A plethora of works has focused on the flow induced metal corrosion, while few studies have investigated the flow accelerated organic coating degradation. Flowing fluids above coating surface affect corrosion by enhancing the water transport and abrading the surface due to fluid shear. Hence, it is of great importance to understand the influence of flowing fluids on the degradation of corrosion protective organic coatings. In this study, a pigmented marine coating and several clear coatings were exposed to the laminar flow and stationary immersion. The laminar flow was pressure driven and confined in a flow channel. A 3.5 wt% sodium chloride solution and pure water was employed as the working fluid with a variety of flow rates. The corrosion protective properties of organic coatings were monitored inline by Electrochemical Impedance Spectroscopy (EIS) measurement. Equivalent circuit models were employed to interpret the EIS spectra. The time evolution of coating resistance and capacitance obtained from the model was studied to demonstrate the coating degradation. Thickness, gloss, and other topography characterizations were conducted to facilitate the assessment of the corrosion. The working fluids were characterized by Fourier Transform Infrared Spectrometer (FTIR) and conductivity measurement. The influence of flow rate, fluid shear, fluid composition, and other effects in the coating degradation were investigated. We conclude that flowing fluid on the coating surface accelerates the transport of water, oxygen, and ions into the coating, as

Experimental evaluation of coating delamination in vinyl coated metal forming

International Nuclear Information System (INIS)

Son, Young Ki; Lee, Chan Joo; Kim, Byung Min; Lee, Jung Min; Byoen, Sang Doek; Lee, Soen Bong

2012-01-01

In this paper, a new evaluation and prediction method for coating delamination during sheet metal forming is presented. On the basis of the forming limit diagram (FLD), the current study evaluates the delamination of PET coating by using a cross cut specimen, dome test, and rectangular cup drawing test. Dome test specimens were subjected to biaxial, plane strain, and uniaxial deformation modes. Rectangular cup drawing test specimens were subjected to the deep drawing deformation mode, and compression deformation mode. A vinyl coated metal (VCM) sheet consists of three layers of polymer on the sheet metals: a protective film, a PET layer and a PVC layer. The areas with coating delamination were identified, and the results of the evaluation were plotted according to major and minor strain values, depicting coating delamination. The constructed delamination limit diagram (DLD) can be used to determine the forming limit of VCM during the complex press forming process. ARGUS (GOM) was employed to identify the strain value and deformation mode of the delaminated surface after the press forming. After identifying the areas of delamination, the DLD of the PET coating can be constructed in a format similar to that of the FLD. The forming limit of the VCM sheet can be evaluated using the superimposition of the delamination limit strain of the coating onto the FLD of VCM sheet. The experimental results showed that the proposed test method will support the sheet metal forming process design for VCM sheets. The assessment method presented in this study can be used to determine the delamination limit strain under plastic deformation of other polymer coated metals. The experimental results suggested that the proposed testing method is effective in evaluating delamination for specific applications

Experimental evaluation of coating delamination in vinyl coated metal forming

Energy Technology Data Exchange (ETDEWEB)

Son, Young Ki; Lee, Chan Joo; Kim, Byung Min [Pusan National Univ., Busan (Korea, Republic of); Lee, Jung Min [Korea Institute of Industrial Technology, Busan (Korea, Republic of); Byoen, Sang Doek [HA Digital Engineering Gr., Seongsan Gu (Korea, Republic of); Lee, Soen Bong [Keimyung Univ., Daegu (Korea, Republic of)

2012-10-15

In this paper, a new evaluation and prediction method for coating delamination during sheet metal forming is presented. On the basis of the forming limit diagram (FLD), the current study evaluates the delamination of PET coating by using a cross cut specimen, dome test, and rectangular cup drawing test. Dome test specimens were subjected to biaxial, plane strain, and uniaxial deformation modes. Rectangular cup drawing test specimens were subjected to the deep drawing deformation mode, and compression deformation mode. A vinyl coated metal (VCM) sheet consists of three layers of polymer on the sheet metals: a protective film, a PET layer and a PVC layer. The areas with coating delamination were identified, and the results of the evaluation were plotted according to major and minor strain values, depicting coating delamination. The constructed delamination limit diagram (DLD) can be used to determine the forming limit of VCM during the complex press forming process. ARGUS (GOM) was employed to identify the strain value and deformation mode of the delaminated surface after the press forming. After identifying the areas of delamination, the DLD of the PET coating can be constructed in a format similar to that of the FLD. The forming limit of the VCM sheet can be evaluated using the superimposition of the delamination limit strain of the coating onto the FLD of VCM sheet. The experimental results showed that the proposed test method will support the sheet metal forming process design for VCM sheets. The assessment method presented in this study can be used to determine the delamination limit strain under plastic deformation of other polymer coated metals. The experimental results suggested that the proposed testing method is effective in evaluating delamination for specific applications.

Genetic structure and evidence of putative Darwinian diversifying selection in the Potato yellow vein virus (PYVV

Directory of Open Access Journals (Sweden)

Giovanni Chaves-Bedoya

2013-08-01

Full Text Available The population structure and genetic variation of Potato yellow vein virus (PYVV were estimated by analysis of the nucleotide and deduced amino acid sequence of the coat protein of 69 isolates, reported in GenBank, from Solanum tuberosum (ST and Solanum phureja (SP hosts from different regions; predominantly Cundinamarca, Antioquia and Nariño, located in central and southwestern Colombia. Bioinformatics analysis revealed that despite the wide geographic distribution of different hosts and different collecting years, PYVV maintains a genetic similarity between 97.1 to 100.0%, indicating high spatial and temporal genetic stability of the major coat protein. No recombination events were found, but evidence was seen for the first time that this protein could be undergoing Darwinian diversifying selection

ATHENA optimized coating design

DEFF Research Database (Denmark)

Ferreira, Desiree Della Monica; Christensen, Finn Erland; Jakobsen, Anders Clemen

2012-01-01

The optimization of coating design for the ATHENA mission si described and the possibility of increasing the telescope effective area in the range between 0.1 and 10 keV is investigated. An independent computation of the on-axis effective area based on the mirror design of ATHENA is performed...... in order to review the current coating baseline. The performance of several material combinations, considering a simple bi-layer, simple multilayer and linear graded multilayer coatings are tested and simulation of the mirror performance considering both the optimized coating design and the coating...

Preparation of sustained release capsules by electrostatic dry powder coating, using traditional dip coating as reference.

Science.gov (United States)

Yang, Yan; Shen, Lian; Yuan, Feng; Fu, Hui; Shan, Weiguang

2018-05-30

Lately, a great deal of attention is being paid to capsule coating, since the coat protects active pharmaceutical ingredients (APIs) from damage, as is in the case of tablet and pellet. However, moisture and heat sensitivity of gelatin shells make it challenging to coat capsules using the conventional aqueous coating techniques. In an effort to overcome this challenge, the present study aims to coat capsules using two different coating techniques: electrostatic dry powder coating (EDPC) and dip coating (DC). Both capsule coatings and free films were prepared by these two coating techniques, and the effects of coating formulations and processing conditions on the film quality were investigated. The corresponding drug in vitro release and mechanisms were characterized and compared. The results of dissolution tests demonstrated that the drug release behavior of both EDPC and DC coated capsules could be optimized to a sustained release of 24 h, following the Fick's diffusion law. The results of this study suggest that EDPC method is better than DC method for coating capsules, with respect to the higher production efficiency and better stability, indicating that this dry coating technology has promised in gelatin capsule coating applications. Copyright © 2018 Elsevier B.V. All rights reserved.

Low Temperature Powder Coating

Science.gov (United States)

2011-02-09

of volatile organic compounds (VOCs) and hazardous air pollutants (HAPs) • Legacy primers contain hexavalent chrome • Conventional powder coatings...coatings both in laboratory and field service evaluations • LTCPC allows environmental cost reductions through VOC/HAP elimination and hexavalent ... chrome reduction. • The LTCPC process greatly shortens the coating operation (LTCPC cures much more rapidly then conventional wet coatings) resulting in

Identification and Characterization of Citrus tristeza virus Isolates Breaking Resistance in Trifoliate Orange in California.

Science.gov (United States)

Yokomi, Raymond K; Selvaraj, Vijayanandraj; Maheshwari, Yogita; Saponari, Maria; Giampetruzzi, Annalisa; Chiumenti, Michela; Hajeri, Subhas

2017-07-01

Most Citrus tristeza virus (CTV) isolates in California are biologically mild and symptomless in commercial cultivars on CTV tolerant rootstocks. However, to better define California CTV isolates showing divergent serological and genetic profiles, selected isolates were subjected to deep sequencing of small RNAs. Full-length sequences were assembled, annotated and trifoliate orange resistance-breaking (RB) isolates of CTV were identified. Phylogenetic relationships based on their full genomes placed three isolates in the RB clade: CA-RB-115, CA-RB-AT25, and CA-RB-AT35. The latter two isolates were obtained by aphid transmission from Murcott and Dekopon trees, respectively, containing CTV mixtures. The California RB isolates were further distinguished into two subclades. Group I included CA-RB-115 and CA-RB-AT25 with 99% nucleotide sequence identity with RB type strain NZRB-G90; and group II included CA-RB-AT35 with 99 and 96% sequence identity with Taiwan Pumelo/SP/T1 and HA18-9, respectively. The RB phenotype was confirmed by detecting CTV replication in graft-inoculated Poncirus trifoliata and transmission from P. trifoliata to sweet orange. The California RB isolates induced mild symptoms compared with severe isolates in greenhouse indexing tests. Further examination of 570 CTV accessions, acquired from approximately 1960 and maintained in planta at the Central California Tristeza Eradication Agency, revealed 16 RB positive isolates based on partial p65 sequences. Six isolates collected from 1992 to 2011 from Tulare and Kern counties were CA-RB-115-like; and 10 isolates collected from 1968 to 2010 from Riverside, Fresno, and Kern counties were CA-RB-AT35-like. The presence of the RB genotype is relevant because P. trifoliata and its hybrids are the most popular rootstocks in California.

Stock indexing and Potato virus Y elimination from potato plants cultivated in vitro Indexação de matrizes e eliminação do Potato virus Y em plantas de batata cultivadas in vitro

Directory of Open Access Journals (Sweden)

Luciana Cordeiro Nascimento

2003-01-01

Full Text Available Potato cultivars (Solanum tuberosum L. have shown degeneration or run out caused by viruses after several cycles of propagation using seed tubers from commercial fields. This work reports the occurrence of single and mixed infections of four potato viruses in Paraíba-Brazil and presents a method for Potato virus Y (PVY elimination, by using thermo-and chemotherapies. Plants of potato cv. Baraka were tested by direct antigen coating ELISA. Antisera against PVY, Potato virus X (PVX, Potato virus S (PVS, and Potato leafroll virus (PLRV were used. Materials with positive reaction to PVY were treated for virus elimination. Single node cuttings (1.0 cm length were excised and inoculated in Murashige & Skoog (MS medium, supplemented with 1.0 mg L-1 of kinetin, 0.001 mg L-1 of naphthalene acetic acid (NAA and 0.1 mg L-1 of gibberellic acid (GA3. The thermotherapy at approximately 37ºC, during 30 and 40 days, resulted in 20.0 and 37.5% PVY elimination, respectively. Chemotherapy was undertaken with Ribavirin (RBV, 5-Azacytidine (AZA, and 3-Deazauridine (DZD. The RBV showed the highest rate of virus eradication, with 55.5% virus-free plants. Simultaneous thermo and chemotherapy had higher efficiency for the elimination of PVY, reaching rates of healthy plants of 83.3% with RBV, 70.0% with AZA, and 50.0% with DZD.Cultivares de batata (Solanum tuberosum L. têm mostrado degenerescência causada por vírus após ciclos sucessivos do uso de tubérculos de campos comerciais como material propagativo. Este trabalho verifica a ocorrência de infecção simples e mista de quatro vírus da batata na Paraíba e apresenta adequação da técnica de cultivo in vitro para obtenção de material livre de Potato virus Y (PVY, incluindo uso de microestacas, termo e quimioterapia. Plantas de batata do cv. Baraka foram submetidas à indexação sorológica pelo teste "direct antigen coating" ELISA. Utilizaram-se antissoros contra o PVY, Potato virus X (PVX, Potato virus

Genetic engineering and chemical conjugation of potato virus X.

Science.gov (United States)

Lee, Karin L; Uhde-Holzem, Kerstin; Fischer, Rainer; Commandeur, Ulrich; Steinmetz, Nicole F

2014-01-01

Here we report the genetic engineering and chemical modification of potato virus X (PVX) for the presentation of various peptides, proteins, and fluorescent dyes, or other chemical modifiers. Three different ways of genetic engineering are described and by these means, peptides are successfully expressed not only when the foot and mouth disease virus (FMDV) 2A sequence or a flexible glycine-serine linker is included, but also when the peptide is fused directly to the PVX coat protein. When larger proteins or unfavorable peptide sequences are presented, a partial fusion via the FMDV 2A sequence is preferable. When these PVX chimeras retain the ability to assemble into viral particles and are thus able to infect plants systemically, they can be utilized to inoculate susceptible plants for isolation of sufficient amounts of virus particles for subsequent chemical modification. Chemical modification is required for the display of nonbiological ligands such as fluorophores, polymers, and small drug compounds. We present three methods of chemical bioconjugation. For direct conjugation of small chemical modifiers to solvent exposed lysines, N-hydroxysuccinimide chemistry can be applied. Bio-orthogonal reactions such as copper-catalyzed azide-alkyne cycloaddition or hydrazone ligation are alternatives to achieve more efficient conjugation (e.g., when working with high molecular weight or insoluble ligands). Furthermore, hydrazone ligation offers an attractive route for the introduction of pH-cleavable cargos (e.g., therapeutic molecules).

Simultaneous detection of indicators of hepatitis virus exposure

International Nuclear Information System (INIS)

Ling, C.; Decker, R.A.; Overby, L.R.

1981-01-01

This invention discloses an improvement in solid phase immunoassay methods for the detection and determination of antigens and antibodies (markers) relating to hepatitis. The method for simultaneously detecting in a sample at least two different markers evidencing exposure to hepatitis virus comprises contacting the sample with a solid phase reagent which is coated with at least two different, non-complementary immunoreactants which are complementary to the unknown markers to be detected, then with a liquid reagent comprising at least two different hepatitis markers or immunoreactants, each selected to either react or compete with one of the unknown markers and each labeled with a detectably distinct tag. Examples described use 125 I. (author)

Metallic coating of microspheres

International Nuclear Information System (INIS)

Meyer, S.F.

1980-01-01

Extremely smooth, uniform metal coatings of micrometer thicknesses on microscopic glass spheres (microspheres) are often needed as targets for inertial confinement fusion (ICF) experiments. The first part of this paper reviews those methods used successfully to provide metal coated microspheres for ICF targets, including magnetron sputtering, electro- and electroless plating, and chemical vapor pyrolysis. The second part of this paper discusses some of the critical aspects of magnetron sputter coating of microspheres, including substrate requirements, the sticking of microspheres during coating (preventing a uniform coating), and the difficulties in growing the desired dense, smooth, uniform microstructure on continuously moving spherical substrates

Interactions between protein molecules and the virus removal membrane surface: Effects of immunoglobulin G adsorption and conformational changes on filter performance.

Science.gov (United States)

Hamamoto, Ryo; Ito, Hidemi; Hirohara, Makoto; Chang, Ryongsok; Hongo-Hirasaki, Tomoko; Hayashi, Tomohiro

2018-03-01

Membrane fouling commonly occurs in all filter types during virus filtration in protein-based biopharmaceutical manufacturing. Mechanisms of decline in virus filter performance due to membrane fouling were investigated using a cellulose-based virus filter as a model membrane. Filter performance was critically dependent on solution conditions; specifically, ionic strength. To understand the interaction between immunoglobulin G (IgG) and cellulose, sensors coated with cellulose were fabricated for surface plasmon resonance and quartz crystal microbalance with energy dissipation measurements. The primary cause of flux decline appeared to be irreversible IgG adsorption on the surface of the virus filter membrane. In particular, post-adsorption conformational changes in the IgG molecules promoted further irreversible IgG adsorption, a finding that could not be adequately explained by DLVO theory. Analyses of adsorption and desorption and conformational changes in IgG molecules on cellulose surfaces mimicking cellulose-based virus removal membranes provide an effective approach for identifying ways of optimizing solution conditions to maximize virus filter performance. © 2017 American Institute of Chemical Engineers Biotechnol. Prog., 34:379-386, 2018. © 2017 American Institute of Chemical Engineers.

Small angle scattering study of the structure and organization of RNA and protein in Brome Mosaic Virus (BMV)

Science.gov (United States)

Das, Narayan C.; Warren, Garfield T.; Cheng, Si; Kao, C. Cheng; Ni, Peng; Dragnea, Bogdan; Sokol, Paul E.

2012-02-01

Brome mosaic virus (BMV) is a small icosahedral of the alpha virus-like superfamily of RNA with a segmented positive-strand RNA genome and a mean diameter ˜ 268å that offers high levels of RNA synthesis and virus production in plants. BMV also tightly regulates the packaging of its four RNAs (RNA1 through RNA4) into three separate particles; RNA1 and RNA2 are encapsidated separately while one copy each of RNA3 and RNA4 are normally packaged together. Small angle neutron scattering (SANS) and small angle X-ray scattering (SAXS) were applied to study the size, shape and protein-RNA organization of BMV. D2O/H2O mixture was used to enhance contrast in SANS measurement. The radial distribution of BMV from the Fourier transform of scattering spectrum gives a clear indication of RNA packing, and distribution and their structure in the BMV. The result reveals that the virus is about 266 å in diameter and is composed of RNA inside the virion coated with a protein shell.

Host Cell Plasma Membrane Phosphatidylserine Regulates the Assembly and Budding of Ebola Virus.

Science.gov (United States)

Adu-Gyamfi, Emmanuel; Johnson, Kristen A; Fraser, Mark E; Scott, Jordan L; Soni, Smita P; Jones, Keaton R; Digman, Michelle A; Gratton, Enrico; Tessier, Charles R; Stahelin, Robert V

2015-09-01

Lipid-enveloped viruses replicate and bud from the host cell where they acquire their lipid coat. Ebola virus, which buds from the plasma membrane of the host cell, causes viral hemorrhagic fever and has a high fatality rate. To date, little has been known about how budding and egress of Ebola virus are mediated at the plasma membrane. We have found that the lipid phosphatidylserine (PS) regulates the assembly of Ebola virus matrix protein VP40. VP40 binds PS-containing membranes with nanomolar affinity, and binding of PS regulates VP40 localization and oligomerization on the plasma membrane inner leaflet. Further, alteration of PS levels in mammalian cells inhibits assembly and egress of VP40. Notably, interactions of VP40 with the plasma membrane induced exposure of PS on the outer leaflet of the plasma membrane at sites of egress, whereas PS is typically found only on the inner leaflet. Taking the data together, we present a model accounting for the role of plasma membrane PS in assembly of Ebola virus-like particles. The lipid-enveloped Ebola virus causes severe infection with a high mortality rate and currently lacks FDA-approved therapeutics or vaccines. Ebola virus harbors just seven genes in its genome, and there is a critical requirement for acquisition of its lipid envelope from the plasma membrane of the human cell that it infects during the replication process. There is, however, a dearth of information available on the required contents of this envelope for egress and subsequent attachment and entry. Here we demonstrate that plasma membrane phosphatidylserine is critical for Ebola virus budding from the host cell plasma membrane. This report, to our knowledge, is the first to highlight the role of lipids in human cell membranes in the Ebola virus replication cycle and draws a clear link between selective binding and transport of a lipid across the membrane of the human cell and use of that lipid for subsequent viral entry. Copyright © 2015, American

The genomic and biological characterization of Citrullus lanatus cryptic virus infecting watermelon in China.

Science.gov (United States)

Xin, Min; Cao, Mengji; Liu, Wenwen; Ren, Yingdang; Lu, Chuantao; Wang, Xifeng

2017-03-15

A dsRNA virus was detected in the watermelon (Citrullus lanatus) samples collected from Kaifeng, Henan province, China through the use of next generation sequencing of small RNAs. The complete genome of this virus is comprised of dsRNA-1 (1603nt) and dsRNA-2 (1466nt), both of which are single open reading frames and potentially encode a 54.2kDa RNA-dependent RNA polymerase (RdRp) and a 45.9kDa coat protein (CP), respectively. The RdRp and CP share the highest amino acid identities 85.3% and 75.4% with a previously reported Israeli strain Citrullus lanatus cryptic virus (CiLCV), respectively. Genome comparisons indicate that this virus is the same species with CiLCV, whereas the reported sequences of the Israeli strain of CiLCV are partial, and our newly identified sequences can represent the complete genome of CiLCV. Futhermore, phylogenetic tree analyses based on the RdRp sequences suggest that CiLCV is one member in the genus Deltapartitivirus, family Partitiviridae. In addition, field investigation and seed-borne bioassays show that CiLCV commonly occurs in many varieties and is transmitted though seeds at a very high rate. Copyright © 2017 Elsevier B.V. All rights reserved.

Adoption of the 2A Ribosomal Skip Principle to Tobacco Mosaic Virus for Peptide Display

Directory of Open Access Journals (Sweden)

Juliane Röder

2017-06-01

Full Text Available Plant viruses are suitable as building blocks for nanomaterials and nanoparticles because they are easy to modify and can be expressed and purified using plants or heterologous expression systems. Plant virus nanoparticles have been utilized for epitope presentation in vaccines, for drug delivery, as nanospheres and nanowires, and for biomedical imaging applications. Fluorescent protein fusions have been instrumental for the tagging of plant virus particles. The monomeric non-oxygen-dependent fluorescent protein iLOV can be used as an alternative to green fluorescent protein. In this study, the iLOV sequence was genetically fused either directly or via a glycine-serine linker to the C-terminus of the Tobacco mosaic virus (TMV coat protein (CP and also carried an N-terminal Foot-and-mouth disease virus (FMDV 2A sequence. Nicotiana benthamiana plants were inoculated with recombinant viral vectors and a systemic infection was achieved. The presence of iLOV fusion proteins and hybrid particles was confirmed by western blot analysis and transmission electron microscopy. Our data suggest that TMV-based vectors are suitable for the production of proteins at least as large as iLOV when combined with the FMDV 2A sequence. This approach allowed the simultaneous production of foreign proteins fused to the CP as well as free CP subunits.

Survey of Prunus necrotic ringspot virus in Rose and Its Variability in Rose and Prunus spp.

Science.gov (United States)

Moury, B; Cardin, L; Onesto, J P; Candresse, T; Poupet, A

2001-01-01

ABSTRACT A survey for viruses in rose propagated in Europe resulted in detection of only Prunus necrotic ringspot virus (PNRSV) among seven viruses screened. Four percent of cut-flower roses from different sources were infected with PNRSV. Progression of the disease under greenhouse conditions was very slow, which should make this virus easy to eradicate through sanitary selection. Comparison of the partial coat protein gene sequences for three representative rose isolates indicated that they do not form a distinct phylogenetic group and show close relations to Prunus spp. isolates. However, a comparison of the reactivity of monoclonal antibodies raised against these isolates showed that the most prevalent PNRSV serotype in rose was different from the most prevalent serotype in Prunus spp. All of the 27 rose isolates tested infected P. persica seedlings, whereas three of the four PNRSV isolates tested from Prunus spp. were poorly infectious in Rosa indica plants. These data suggest adaptation of PNRSV isolates from Prunus spp., but not from rose, to their host plants. The test methodologies developed here to evaluate PNRSV pathogenicity in Prunus spp. and rose could also help to screen for resistant genotypes.

Oxidation of iridium coating on rhenium coated graphite at elevated temperature in stagnated air

International Nuclear Information System (INIS)

Huang, Yongle; Bai, Shuxin; Zhang, Hong; Ye, Yicong

2015-01-01

Highlights: • Continuous and dense Ir coatings were prepared on graphite by electrodepostion. • The purification of the as-prepared Ir coating was higher than about 99.98%. • The Ir/Re/C specimen kept integrity without significant failures after oxidation. • The average oxidation rate of the Ir coating was about 0.219 mg/(cm 2 min). • Penetrating holes at gains boundaries resulted in the failure of the Ir coating. - Abstract: Continuous and dense iridium coatings were prepared on the rhenium coated graphite specimens by electrodeposition. The iridium/rhenium coated graphite (Ir/Re/C) specimens were oxidized at elevated temperatures in stagnated air for 3600 s. The purification of the as-prepared Ir coating was higher than about 99.98% with the main impurity elements Si, Al, Fe and Ru. After oxidation, the Ir/Re/C specimens kept integrity without significant failures and the average oxidation rate was about 0.219 mg/(cm 2 min). Pores were found at the grain boundaries and concentrated to penetrating holes with the growth of Ir grains, which resulted in disastrous failures of the Ir coating

Oxidation of iridium coating on rhenium coated graphite at elevated temperature in stagnated air

Energy Technology Data Exchange (ETDEWEB)

Huang, Yongle; Bai, Shuxin, E-mail: NUDT_MSE_501@163.com; Zhang, Hong; Ye, Yicong

2015-02-15

Highlights: • Continuous and dense Ir coatings were prepared on graphite by electrodepostion. • The purification of the as-prepared Ir coating was higher than about 99.98%. • The Ir/Re/C specimen kept integrity without significant failures after oxidation. • The average oxidation rate of the Ir coating was about 0.219 mg/(cm{sup 2} min). • Penetrating holes at gains boundaries resulted in the failure of the Ir coating. - Abstract: Continuous and dense iridium coatings were prepared on the rhenium coated graphite specimens by electrodeposition. The iridium/rhenium coated graphite (Ir/Re/C) specimens were oxidized at elevated temperatures in stagnated air for 3600 s. The purification of the as-prepared Ir coating was higher than about 99.98% with the main impurity elements Si, Al, Fe and Ru. After oxidation, the Ir/Re/C specimens kept integrity without significant failures and the average oxidation rate was about 0.219 mg/(cm{sup 2} min). Pores were found at the grain boundaries and concentrated to penetrating holes with the growth of Ir grains, which resulted in disastrous failures of the Ir coating.

Coatings and Tints of Spectacle Lenses

Directory of Open Access Journals (Sweden)

H. Zeki Büyükyıldız

2012-10-01

Full Text Available Spectacle lenses are made of mineral or organic (plastic materials. Various coatings and tints are applied to the spectacle lenses according to the characteristic of the lens material, and for the personal needs and cosmetic purpose. The coatings may be classified in seven groups: 1 Anti-reflection coatings, 2 Hard coatings, 3 Clean coat, 4 Mirror coatings, 5 Color tint coating (one of coloring processes, 6 Photochromic coating (one of photochromic processes, and 7 Anti-fog coatings. Anti-reflection coatings reduce unwanted reflections from the lens surfaces and increase light transmission. Hard coatings are applied for preventing the plastic lens surface from scratches and abrasion. Hard coatings are not required for the mineral lenses due to their hardness. Clean coat makes the lens surface smooth and hydrophobic. Thus, it prevents the adherence of dust, tarnish, and dirt particles on the lens surface. Mirror coatings are applied onto the sunglasses for cosmetic purpose. Color tinted and photochromic lenses are used for sun protection and absorption of the harmful UV radiations. Anti-fog coatings make the lens surface hydrophilic and prevent the coalescence of tiny water droplets on the lens surface that reduces light transmission. (Turk J Ophthalmol 2012; 42: 359-69

Design and Characterization of High-strength Bond Coats for Improved Thermal Barrier Coating Durability

Science.gov (United States)

Jorgensen, David John

High pressure turbine blades in gas turbine engines rely on thermal barrier coating (TBC) systems for protection from the harsh combustion environment. These coating systems consist of a ceramic topcoat for thermal protection, a thermally grown oxide (TGO) for oxidation passivation, and an intermetallic bond coat to provide compatibility between the substrate and ceramic over-layers while supplying aluminum to sustain Al2O 3 scale growth. As turbine engines are pushed to higher operating temperatures in pursuit of better thermal efficiency, the strength of industry-standard bond coats limits the lifetime of these coating systems. Bond coat creep deformation during thermal cycling leads to a failure mechanism termed rumpling. The interlayer thermal expansion differences, combined with TGO-imposed growth stresses, lead to the development of periodic undulations in the bond coat. The ceramic topcoat has low out-of-plane compliance and thus detaches and spalls from the substrate, resulting in a loss of thermal protection and subsequent degradation of mechanical properties. New creep resistant Ni3Al bond coats were designed with improved high-temperature strength to inhibit this type of premature failure at elevated temperatures. These coatings resist rumpling deformation while maintaining compatibility with the other layers in the system. Characterization methods are developed to quantify rumpling and assess the TGO-bond coat interface toughness of experimental systems. Cyclic oxidation experiments at 1163 °C show that the Ni3Al bond coats do not experience rumpling but have faster oxide growth rates and are quicker to spall TGO than the (Pt,Ni)Al benchmark. However, the Ni 3Al coatings outperformed the benchmark by over threefold in TBC system life due to a higher resistance to rumpling (mechanical degradation) while maintaining adequate oxidation passivation. The Ni3Al coatings eventually grow spinel NiAl2O4 on top of the protective Al2O3 layer, which leads to the

Characterization of Melon necrotic spot virus Occurring on Watermelon in Korea

Directory of Open Access Journals (Sweden)

Hae-Ryun Kwak

2015-12-01

Full Text Available Melon necrotic spot virus (MNSV was recently identified on watermelon (Citrullus vulgaris in Korea, displaying as large necrotic spots and vein necrosis on the leaves and stems. The average occurrence of MNSV on watermelon was found to be 30–65% in Hapcheon and Andong City, respectively. Four isolates of the virus (MNSV-HW, MNSV-AW, MNSV-YW, and MNSV-SW obtained from watermelon plants in different areas were non-pathogenic on ten general indicator plants, including Chenopodium quinoa, while they infected systemically six varieties of Cucurbitaceae. The virus particles purified by 10–40% sucrose density gradient centrifugation had a typical ultraviolet spectrum, with a minimum at 245 nm and a maximum at 260 nm. The morphology of the virus was spherical with a diameter of 28–30 nm. Virus particles were observed scattered throughout the cytoplasm of watermelon cells, but no crystals were detected. An ELISA was conducted using antiserum against MNSV-HW; the optimum concentrations of IgG and conjugated IgG for the assay were 1 μl/ml and a 1:8,000–1:10,000 dilutions, respectively. Antiserum against MNSV-HW could capture specifically both MNSV-MN from melon and MNSV-HW from watermelon by IC/RT-PCR, and they were effectively detected with the same specific primer to produce product of 1,172 bp. The dsRNA of MNSV-HW had the same profile (4.5, 1.8, and 1.6 kb as that of MNSV-MN from melon. The nucleotide sequence of the coat protein of MNSV-HW gave a different phylogenetic tree, having 17.2% difference in nucleotide sequence compared with MNSV isolates from melon.

A seroprevalence evaluation study of Hepatitis B virus, Hepatitis C virus and Herpes Simplex Virus - 2 among a special study group

Directory of Open Access Journals (Sweden)

Mangala Adisesh

2016-05-01

Full Text Available Viral STI are silent diseases. Most of them are symptomless, but have the potential to be transmitted to fetus and other sexual partners. Female sex workers, men who have sex with men are at high risk of getting STIs and individuals with certain STIs are at three to five-fold risk of getting HIV infection. Hence, the present study was carried out to know the seroprevalence of HBV, HCV and HSV-2 among our study group. A multi-centric cross sectional study was conducted. A total of 4062 serum samples were tested during the period January to December 2010. Serum samples were tested for HBsAg, anti-HCV and HSV-2 IgM using commercially available ELISA kits. Overall prevalence of HBV, HCV and HSV-2 were 2.8% (114/4062, 2% (84/4062 and 2.4% (96/4062 respectively. Most of the HBsAg positive cases were in the age-group of 20 to 25 years. We have observed that the positivity of all STIs studied was higher in transgender. Individuals infected with STIs are at the risk of contracting HIV, and co-infection with hepatitis can complicate the treatment for HIV. Screening of asymptomatic individuals will be helpful; prompt treatment of these STI will prevent ongoing transmissions as sex works are the critical core group.

Alfalfa virus S, a new species in the family Alphaflexiviridae.

Directory of Open Access Journals (Sweden)

Lev G Nemchinov

Full Text Available A new species of the family Alphaflexiviridae provisionally named alfalfa virus S (AVS was discovered in alfalfa samples originating from Sudan. A complete nucleotide sequence of the viral genome consisting of 8,349 nucleotides excluding the 3' poly(A tail was determined by high throughput sequencing (HTS on an Illumina platform. NCBI BLAST searches revealed that the virus shares the greatest degree of sequence identity with members of the family Alphaflexiviridae, genus Allexivirus. The AVS genome contains six computationally-predicted open reading frames (ORF encoding viral replication protein, triple gene block protein 1 (TGB1, TGB2, TGB3-like protein, unknown 38.4 kDa protein resembling serine-rich 40 kDa protein characteristic for allexiviruses, and coat protein (CP. AVS lacks a clear 3' proximal ORF that encodes a nucleic acid-binding protein typical for allexiviruses. The identity of the virus was confirmed by RT-PCR with primers derived from the HTS-generated sequence, dot blot hybridization with DIG-labeled virus-specific RNA probes, and Western blot analysis with antibodies produced against a peptide derived from the CP sequence. Transmission electron microscopic observations of the infected tissues showed the presence of filamentous particles similar to allexiviruses in their length and appearance. To the best of our knowledge, this is the first report on the identification of a putative allexivirus in alfalfa (Medicago sativa. The genome sequence of AVS has been deposited in NCBI GenBank on 03/02/2016 as accession № KY696659.

Nairobi sheep disease virus/Ganjam virus.

Science.gov (United States)

M D, Baron; B, Holzer

2015-08-01

Nairobi sheep disease virus (NSDV) is a tick-borne virus which causes a severe disease in sheep and goats, and has been responsible for several outbreaks of disease in East Africa. The virus is also found in the Indian subcontinent, where it is known as Ganjam virus. The virus only spreads through the feeding of competent infected ticks, and is therefore limited in its geographic distribution by the distribution of those ticks, Rhipicephalus appendiculata in Africa and Haemaphysalis intermedia in India. Animals bred in endemic areas do not normally develop disease, and the impact is therefore primarily on animals being moved for trade or breeding purposes. The disease caused by NSDV has similarities to several other ruminant diseases, and laboratory diagnosis is necessary for confirmation. There are published methods for diagnosis based on polymerase chain reaction, for virus growth in cell culture and for other simple diagnostic tests, though none has been commercialised. There is no established vaccine against NSDV, although cell-culture attenuated strains have been developed which show promise and could be put into field trials if it were deemed necessary. The virus is closely related to Crimean-Congo haemorrhagic fever virus, and studies on NSDV may therefore be useful in understanding this important human pathogen.

Characterization of New Isolates of Apricot vein clearing-associated virus and of a New Prunus-Infecting Virus: Evidence for Recombination as a Driving Force in Betaflexiviridae Evolution.

Directory of Open Access Journals (Sweden)

Armelle Marais

Full Text Available Double stranded RNAs from Prunus samples gathered from various surveys were analyzed by a deep-sequencing approach. Contig annotations revealed the presence of a potential new viral species in an Azerbaijani almond tree (Prunus amygdalus and its genome sequence was completed. Its genomic organization is similar to that of the recently described Apricot vein clearing associated virus (AVCaV for which two new isolates were also characterized, in a similar fashion, from two Japanese plums (Prunus salicina from a French germplasm collection. The amino acid identity values between the four proteins encoded by the genome of the new virus have identity levels with those of AVCaV which fall clearly outside the species demarcation criteria. The new virus should therefore be considered as a new species for which the name of Caucasus prunus virus (CPrV has been proposed. Phylogenetic relationships and nucleotide comparisons suggested that together with AVCaV, CPrV could define a new genus (proposed name: Prunevirus in the family Betaflexiviridae. A molecular test targeting both members of the new genus was developed, allowing the detection of additional AVCaV isolates, and therefore extending the known geographical distribution and the host range of AVCaV. Moreover, the phylogenetic trees reconstructed with the amino acid sequences of replicase, movement and coat proteins of representative Betaflexiviridae members suggest that Citrus leaf blotch virus (CLBV, type member of the genus Citrivirus may have evolved from a recombination event involving a Prunevirus, further highlighting the importance of recombination as a driving force in Betaflexiviridae evolution. The sequences reported in the present manuscript have been deposited in the GenBank database under accession numbers KM507061-KM504070.

Hydroxyapatite/poly(epsilon-caprolactone) double coating on magnesium for enhanced corrosion resistance and coating flexibility.

Science.gov (United States)

Jo, Ji-Hoon; Li, Yuanlong; Kim, Sae-Mi; Kim, Hyoun-Ee; Koh, Young-Hag

2013-11-01

Hydroxyapatite was deposited on pure magnesium (Mg) with a flexible poly(ε-caprolactone) interlayer to reduce the corrosion rate of Mg and enhance coating flexibility. The poly(ε-caprolactone) interlayer was uniformly coated on Mg by a spraying method, followed by hydroxyapatite deposition on the poly(ε-caprolactone) using an aerosol deposition method. In scanning electron microscopy observations, inorganic/organic composite-like structure was observed between the hydroxyapatite and poly(ε-caprolactone) layers, resulting from the collisions of hydroxyapatite particles into the poly(ε-caprolactone) matrix at the initial stage of the aerosol deposition. The corrosion resistance of the coated Mg was examined using potentiodynamic polarization tests. The hydroxyapatite/poly(ε-caprolactone) double coating remarkably improved the corrosion resistance of Mg in Hank's solution. In the in vitro cell tests, the coated Mg showed better cell adhesion compared with the bare Mg due to the reduced corrosion rate and enhanced biocompatibility. The stability and flexibility of hydroxyapatite/poly(ε-caprolactone) double coating was investigated by scanning electron microscopy inspections after the coated Mg was deformed. The hydroxyapatite coating on the poly(ε-caprolactone) interlayer revealed enhanced coating stability and flexibility without cracking or delamination during bending and stretching compared with the hydroxyapatite single coating. These results demonstrated that the hydroxyapatite/poly(ε-caprolactone) double coating significantly improved the surface corrosion resistance of Mg and enhanced coating flexibility for use of Mg as a biodegradable implant.

Rapid Detection of Prunus Necrotic Ringspot Virus by Reverse Transcription-cross-priming Amplification Coupled with Nucleic Acid Test Strip Cassette.

Science.gov (United States)

Huo, Ya-Yun; Li, Gui-Fen; Qiu, Yan-Hong; Li, Wei-Min; Zhang, Yong-Jiang

2017-11-23

Prunus necrotic ringspot virus (PNRSV) is one of the most devastating viruses to Prunus spp. In this study, we developed a diagnostic system RT-CPA-NATSC, wherein reverse transcription-cross-priming amplification (RT-CPA) is coupled with nucleic acid test strip cassette (NATSC), a vertical flow (VF) visualization, for PNRSV detection. The RT-CPA-NATSC assay targets the encoding gene of the PNRSV coat protein with a limit of detection of 72 copies per reaction and no cross-reaction with the known Prunus pathogenic viruses and viroids, demonstrating high sensitivity and specificity. The reaction is performed on 60 °C and can be completed less than 90 min with the prepared template RNA. Field sample test confirmed the reliability of RT-CPA-NATSC, indicating the potential application of this simple and rapid detection method in routine test of PNRSV.

Coating and curing apparatus and methods

Science.gov (United States)

Brophy, Brenor L; Maghsoodi, Sina; Neyman, Patrick J; Gonsalves, Peter R; Hirsch, Jeffrey G; Yang, Yu S

2015-02-24

Disclosed are coating apparatus including flow coating and roll-coating that may be used for uniform sol-gel coating of substrates such as glass, solar panels, windows or part of an electronic display. Also disclosed are methods for substrate preparation, flow coating and roll coating. Lastly systems and methods for skin curing sol-gel coatings deposited onto the surface of glass substrates using a high temperature air-knife are disclosed.

Study of ion plating parameters, coating structure, and corrosion protection for aluminum coatings on uranium

International Nuclear Information System (INIS)

Egert, C.M.; Scott, D.G.

1987-01-01

A study of ion-plating parameters (primarily deposition rate and substrate bias voltage), coating structure, and the corrosion protection provided by aluminum coatings on uranium is presented. Ion plating at low temperatures yields a variety of aluminum coating structures on uranium. For example, aluminum coatings produced at high deposition rates and low substrate bias voltages are columnar with voids between columns, as expected for high-rate vapor deposition at low temperatures. On the other hand, low deposition rate and high bias voltage produce a modified coating with a dense, noncolumnar structure. These results are not in agreement with other studies that have found no relationship between deposition rate and coating structure in ion plating. This discrepancy is probably due to the high deposition rates used in these studies. An accelerated, water vapor corrosion test indicates that the columnar aluminum coatings provide some corrosion protection despite their porous nature; however, the dense noncolumnar coatings provide significantly greater protection. These results indicate that ion-plated aluminum coatings produced at low deposition rates and high substrate bias voltages creates dense coating structures that are most effective in protecting uranium from corrosion

Characterization of Hungarian isolates of zucchini yellow mosaic virus (ZYMV, potyvirus) transmitted by seeds of Cucurbita pepo var Styriaca.

Science.gov (United States)

Tóbiás, István; Palkovics, László

2003-04-01

Zucchini yellow mosaic virus (ZYMV) has emerged as an important pathogen of cucurbits within the last few years in Hungary. The Hungarian isolates show a high biological variability, have specific nucleotide and amino acid sequences in the N-terminal region of coat protein and form a distinct branch in the phylogenetic tree. The virus is spread very efficiently in the field by several aphid species in a non-persistent manner. It can be transmitted by seed in holl-less seeded oil pumpkin (Cucurbita pepo (L) var Styriaca), although at a very low rate. Three isolates from seed transmission assay experiments were chosen and their nucleotide sequences of coat proteins have been compared with the available CP sequences of ZYMV. According to the sequence analysis, the Hungarian isolates belong to the Central European branch in the phylogenetic tree and, together with the ZYMV isolates from Austria and Slovenia, share specific amino acids at positions 16, 17, 27 and 37 which are characteristic only to these isolates. The phylogenetic tree suggests the common origin of distantly distributed isolates which can be attributed to widespread seed transmission.

Application of Industrial XRF Coating Thickness Analyzer for Phosphate Coating Thickness on Steel

Directory of Open Access Journals (Sweden)

Aleksandr Sokolov

2018-03-01

Full Text Available The results of industrial application of an online X-ray fluorescence coating thickness analyzer for measuring the thickness of phosphate coatings on moving steel strips are considered in the article. The target range of coating thickness to be measured is from tens to hundreds of mg/m2 in a measurement time of 10 s. The measurement accuracy observed during long-duration factory acceptance test was 10–15%. The coating thickness analyzer consists of two XRF gauges, mounted above and below the steel strip and capable of moving across the moving strip system for their suspension and relocation and electronic control unit. Fully automated software was developed to automatically and continuously (24/7 control both gauges, scanning both sides of the steel strip, and develop and test methods for measuring new coatings. It allows performing offline storage and retrieval of the measurement results, remotely controlling the analyzer components and measurement modes from a control room. The developed XRF coating thickness analyzer can also be used for real-time measurement of other types of coatings, both metallic and non-metallic.

AntiReflection Coating D

International Nuclear Information System (INIS)

AIKEN, DANIEL J.

1999-01-01

Analytical expressions used to optimize AR coatings for single junction solar cells are extended for use in monolithic, series interconnected multi-junction solar cell AR coating design. The result is an analytical expression which relates the solar cell performance (through J(sub sc)) directly to the AR coating design through the device reflectance. It is also illustrated how AR coating design be used to provide an additional degree of freedom for current matching multi-junction devices

Neonicotinoid-Coated Zea mays Seeds Indirectly Affect Honeybee Performance and Pathogen Susceptibility in Field Trials.

Directory of Open Access Journals (Sweden)

Mohamed Alburaki

Full Text Available Thirty-two honeybee (Apis mellifera colonies were studied in order to detect and measure potential in vivo effects of neonicotinoid pesticides used in cornfields (Zea mays spp on honeybee health. Honeybee colonies were randomly split on four different agricultural cornfield areas located near Quebec City, Canada. Two locations contained cornfields treated with a seed-coated systemic neonicotinoid insecticide while the two others were organic cornfields used as control treatments. Hives were extensively monitored for their performance and health traits over a period of two years. Honeybee viruses (brood queen cell virus BQCV, deformed wing virus DWV, and Israeli acute paralysis virus IAPV and the brain specific expression of a biomarker of host physiological stress, the Acetylcholinesterase gene AChE, were investigated using RT-qPCR. Liquid chromatography-mass spectrometry (LC-MS was performed to detect pesticide residues in adult bees, honey, pollen, and corn flowers collected from the studied hives in each location. In addition, general hive conditions were assessed by monitoring colony weight and brood development. Neonicotinoids were only identified in corn flowers at low concentrations. However, honeybee colonies located in neonicotinoid treated cornfields expressed significantly higher pathogen infection than those located in untreated cornfields. AChE levels showed elevated levels among honeybees that collected corn pollen from treated fields. Positive correlations were recorded between pathogens and the treated locations. Our data suggests that neonicotinoids indirectly weaken honeybee health by inducing physiological stress and increasing pathogen loads.

Effect of Coating Parameters of the Buffer Layer on the Shape Ratio of TRISO-Coated Particles

International Nuclear Information System (INIS)

KIm, Weon Ju; Park, Jong Hoon; Park, Ji Yeon; Lee, Young Woo; Chang, Jong Hwa

2005-01-01

Fuel for high temperature gas-cooled reactors (HTGR's) consists of TRISO-coated particles. Fluidized bed chemical vapor deposition (FBCVD) has been applied to fabricate the TRISO-coated fuel particles. The TRISO particles consist of UO 2 microspheres coated with layers of porous pyrolytic carbon (PyC), inner dense PyC (IPyC), SiC, and outer dense PyC (OPyC). The porous PyC coating layer, called the buffer layer, attenuates fission recoils and provides void volume for gaseous fission products and carbon monoxide. The buffer layer, which has the highest coating rate among the coating layers, shows the largest variation of the coating thickness within a particle and a batch. This could be the most plausible source of an asphericity in the TRISO particles. The aspherical particles are expected to have an inferior fuel performance. Miller et al. have predicted that a larger stress is developed within the coating layers and thus the failure probability increases in the particles with high aspect ratios. Therefore, the shape of the TRISO-coated particles should be controlled properly and has been one of the important inspection items for the quality control of the fabrication process. In this paper, we investigated the effect of coating parameters of the buffer layer on the shape of the TRISO particles. The flow rate of coating gas and the coating temperature were varied to control the buffer layer. The asphericity of the TRISO-coated particles was evaluated for the various coating conditions of the buffer layer, but at constant coating parameters for the IPyC/SiC/OPyC layers

Superhydrophobic silica coating by dip coating method

International Nuclear Information System (INIS)

Mahadik, Satish A.; Parale, Vinayak; Vhatkara, Rajiv S.; Mahadik, Dinesh B.; Kavale, Mahendra S.; Wagh, Pratap B.; Gupta, Satish; Gurav, Jyoti

2013-01-01

Herein, we report a simple and low cost method for the fabrication of superhydrophobic coating surface on quartz substrates via sol-gel dip coating method at room temperature. Desired surface chemistry and texture growth for superhydrophobicity developed under double step sol–gel process at room temperature. The resultant superhydrophobic surfaces were characterized by Field-emission scanning electron microscopy (FE-SEM), Atomic force microscopy (AFM), water contact angle (WCA) measurement, differential thermal gravimetric analysis-differential thermal analysis (TGA-DTA) calorimetry and optical spectrometer. Coating shows the ultra high water contact angle about 168 ± 2° and water sliding angle 3 ± 1° and superoleophilic with petroleum oils. This approach allows a simple strategy for the fabrication process of superhydrophilic–superhydrophobic on same surfaces with high thermal stability of superhydrophobicity up to 560 °C. Thus, durability, special wettability and thermal stability of superhydrophobicity expand their application fields.

Complete nucleotide sequence and genome organization of a Chinese isolate of Tobacco vein distorting virus.

Science.gov (United States)

Mo, Xiao-han; Chen, Zheng-bin; Chen, Jian-ping

2010-12-01

Tobacco bushy top disease is caused by tobacco bushy top virus (TBTV, a member of the genus Umbravirus) which is dependent on tobacco vein-distorting virus (TVDV) to act as a helper virus encapsidating TBTV and enabling its transmission by aphids. Isometric virions from diseased tobacco plants were purified and disease symptoms were reproduced after experimental aphid transmission. The complete genome of TVDV was determined from cloned RT-PCR products derived from viral RNA. It was 5,920 nucleotides (nts) long and had the six major open reading frames (ORFs) typical of a member of the genus Polerovirus. Sequence comparisons showed that it differed significantly from any of the other species in the genus and this was confirmed by phylogenetic analyses of the RdRp and coat protein. SDS-PAGE analysis of purified virions gave two protein bands of about 26 and 59 kDa both of which reacted strongly in Western blots with antiserum produced to prokaryotically expressed TVDV CP showing that the two forms of the TVDV CP were the only protein components of the capsid.

RNA packaging of MRFV virus-like particles: The interplay between RNA pools and capsid coat protein

Science.gov (United States)

Virus-like particles (VLPs) can be produced through self-assembly of capsid protein (CP) into particles with discrete shapes and sizes and containing different types of RNA molecules. The general principle that governs particle assembly and RNA packaging is determined by unique interactions between ...

Maintenance of influenza virus infectivity on the surfaces of personal protective equipment and clothing used in healthcare settings.

Science.gov (United States)

Sakaguchi, Hiroko; Wada, Koji; Kajioka, Jitsuo; Watanabe, Mayumi; Nakano, Ryuichi; Hirose, Tatsuko; Ohta, Hiroshi; Aizawa, Yoshiharu

2010-11-01

The maintenance of infectivity of influenza viruses on the surfaces of personal protective equipment and clothing is an important factor in terms of controlling viral cross-infection in the environment and preventing contact infection. The aim of this study was to determine if laboratory-grown influenza A (H1N1) virus maintained infectivity on the surfaces of personal protective equipment and clothing used in healthcare settings. Influenza A virus (0.5 mL) was deposited on the surface of a rubber glove, an N95 particulate respirator, a surgical mask made of non-woven fabric, a gown made of Dupont Tyvek, a coated wooden desk, and stainless steel. Each sample was left for 1, 8, and 24 h, and hemagglutination (HA) and 50% tissue culture infective dose (TCID(50))/mL were measured. The HA titer of this influenza A virus did not decrease in any of the materials tested even after 24 h. The infectivity of influenza A virus measured by TCID(50) was maintained for 8 h on the surface of all materials, with the exception of the rubber glove for which virus infectivity was maintained for 24 h. Our results indicate that the replacement/renewal of personal protective equipment and clothing by healthcare professionals in cases of exposure to secretions and droplets containing viruses spread by patients is an appropriate procedure to prevent cross-infection.

DIAGNOSTICS OF VIRUS PHYTOPATHOGENS FRUIT TREE PLUM POX VIRUS, PRUNUS NECROTIC RINGSPOT VIRUS AND PRUNUS DWARF VIRUS BY BIOLOGICAL AND MOLECULAR DIAGNOSTICS

Directory of Open Access Journals (Sweden)

Július Rozák

2013-02-01

Full Text Available The aim of this study was to determine the incidence of viral phytopathogen Plum pox virus, Prunus necrotic ringspot virus and Prunus dwarf virus in selected localities of Slovakia and diagnose them using a molecular and biological methods. Forty samples of fruit trees of the genus Prunus, twenty samples from intensive plantings and twenty samples from wild subject were analysed. Biological diagnostic by using biological indicators Prunus persica cv. GF 305, Prunus serrulata cv. Schirofugen and molecular diagnostic by mRT-PCR were applied. Five samples with Plum pox virus were infected. The two samples positive for Prunus necrotic ringspot virus and one sample for Prunus dwarf virus were confirmed. The two samples were found to be infected with two viruses Prunus necrotic ringspot virus and Prunus dwarf virus. This work focuses on two techniques, their application to the diagnosis of stone fruit viruses and their routinely used for sanitary and certification programmes.

Mimicking Retention and Transport of Rotavirus and Adenovirus in Sand Media Using DNA-labeled, Protein-coated Silica Nanoparticles

Science.gov (United States)

Pang, Liping; Farkas, Kata; Bennett, Grant; Varsani, Arvind; Easingwood, Richard; Tilley, Richard; Nowostawska, Urszula; Lin, Susan

2014-05-01

Rotavirus (RoV) and adenovirus (AdV) are important viral pathogens for the risk analysis of drinking water. Despite this, little is known about their retention and transport behaviors in porous media (e.g. sand filtered used for water treatment and groundwater aquifers due to a lack of representative surrogates. In this study, we developed RoV and AdV surrogates by covalently coating 70-nm sized silica nanoparticles with specific proteins and a DNA marker for sensitive detection. Filtration experiments using beach sand columns demonstrated the similarity of the surrogates' concentrations, attachment, and filtration efficiencies to the target viruses. The surrogates showed the same magnitude of concentration reduction as the viruses. Conversely, MS2 phage (a traditional virus model) over predicted concentrations of AdV and RoV by 1- and 2-orders of magnitude, respectively. The surrogates remained stable in size, surface charge and DNA concentration for at least one year. They can be easily and rapidly detected at concentrations down to one particle per PCR reaction and are readily detectable in natural waters and even in effluent. With up-scaling validation in pilot trials, the surrogates can be a useful cost-effective new tool for studying virus retention and transport in porous media, e.g. for assessing filter efficiency in water and wastewater treatment, tracking virus migration in groundwater after effluent land disposal, and establishing safe setback distances for groundwater protection.

New temperable solar coatings: Tempsol

Science.gov (United States)

Demiryont, Hulya

2001-11-01

This paper deals with the large area deposition and coating properties of the thermo-stable (temperable/bendable) solar coating material, CuO, and some new optical coating systems comprising CuO films for architectural and automotive/transportation applications. The CuO solar coating is combined with other coating layers, for example, an anti-reflection film, a reflection film, a coloration coating layer, etc., which are also thermo-stable. The film systems are developed at the research laboratory by D.C. Magnetron reactive sputtering process. The new developed technologies then transferred to the production line. Product performances are compared before and after heat treatment of the coating systems. Performance tables and other physical properties, including optical parameters, mechanical and environmental stability, storage properties, etc., are also presented for this new product series.

Analytical Modeling of Hard-Coating Cantilever Composite Plate considering the Material Nonlinearity of Hard Coating

Directory of Open Access Journals (Sweden)

Wei Sun

2015-01-01

Full Text Available Due to the material nonlinearity of hard coating, the coated structure produces the nonlinear dynamical behaviors of variable stiffness and damping, which make the modeling of hard-coating composite structure become a challenging task. In this study, the polynomial was adopted to characterize this material nonlinearity and an analytical modeling method was developed for the hard-coating composite plate. Firstly, to relate the hard-coating material parameters obtained by test and the analytical model, the expression of equivalent strain of composite plate was derived. Then, the analytical model of hard-coating composite plate was created by energy method considering the material nonlinearity of hard coating. Next, using the Newton-Raphson method to solve the vibration response and resonant frequencies of composite plate and a specific calculation procedure was also proposed. Finally, a cantilever plate coated with MgO + Al2O3 hard coating was chosen as study case; the vibration response and resonant frequencies of composite plate were calculated using the proposed method. The calculation results were compared with the experiment and general linear calculation, and the correctness of the created model was verified. The study shows the proposed method can still maintain an acceptable precision when the material nonlinearity of hard coating is stronger.

Fabrication and characterization of SiC and ZrC composite coating on TRISO coated particle

Energy Technology Data Exchange (ETDEWEB)

Lee, H. G.; Lee, S. H.; Kim, D. J.; Park, J. Y.; Kim, W. J. [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

2016-10-15

SiC coating is widely suggested as structural materials for nuclear application due to its excellent high irradiation resistance properties and high temperature mechanical properties. SiC coating on TRistructural-ISOtropic (TRISO) coated fuel particles plays an important role as a protective layer from radioactive fission gas and a mechanical structural layer. TRISO coating layer was deposited on a spherical particle by a FBCVD method. The ZrO{sub 2} spherical particles were used as a simulant kernel. TRISO coating layers consisting of a porous buffer layer, an inner PyC layer were sequentially deposited before depositing SiC or ZrC coating layer. In order investigate the phase of each composite coating layer, Raman analysis was conducted. SiC, ZrC coating and SiC/ZrC composite coating on spherical particle were successfully deposited via FBCVD method by adjusting source gas flow rate. In the SiC and ZrC composite coating, SiC phase and ZrC phase were observed by XRD and SEM analysis. In the condition of 100 sccm of ZrCl{sub 4}, 25 sccm of CH{sub 4}, and 30 sccm of MTS, only two phases of SiC and ZrC were observed and two phases are located with clean grain boundary.

Novel rod-shaped viruses isolated from garlic, Allium sativum, possessing a unique genome organization.

Science.gov (United States)

Sumi, S; Tsuneyoshi, T; Furutani, H

1993-09-01

Rod-shaped flexuous viruses were partially purified from garlic plants (Allium sativum) showing typical mosaic symptoms. The genome was shown to be composed of RNA with a poly(A) tail of an estimated size of 10 kb as shown by denaturing agarose gel electrophoresis. We constructed cDNA libraries and screened four independent clones, which were designated GV-A, GV-B, GV-C and GV-D, using Northern and Southern blot hybridization. Nucleotide sequence determination of the cDNAs, two of which correspond to nearly one-third of the virus genomic RNA, shows that all of these viruses possess an identical genomic structure and that also at least four proteins are encoded in the viral cDNA, their M(r)s being estimated to be 15K, 27K, 40K and 11K. The 15K open reading frame (ORF) encodes the core-like sequence of a zinc finger protein preceded by a cluster of basic amino acid residues. The 27K ORF probably encodes the viral coat protein (CP), based on both the existence of some conserved sequences observed in many other rod-shaped or flexuous virus CPs and an overall amino acid sequence similarity to potexvirus and carlavirus CPs. The 11K ORF shows significant amino acid sequence similarities to the corresponding 12K proteins of the potexviruses and carlaviruses. On the other hand, the 40K ORF product does not resemble any other plant virus gene products reported so far. The genomic organization in the 3' region of the garlic viruses resembles, but clearly differs from, that of carlaviruses. Phylogenetic analysis based upon the amino acid sequence of the viral capsid protein also indicates that the garlic viruses have a unique and distinct domain different from those of the potexvirus and carlavirus groups. The results suggest that the garlic viruses described here belong to an unclassified and new virus group closely related to the carlaviruses.

Strawberry crinkle virus, a Cytorhabdovirus needing more attention from virologists.

Science.gov (United States)

Posthuma, K I; Adams, A N; Hong, Y

2000-11-01

Summary Taxonomic relationship: A member of nonsegmented, negative-sense, single-stranded RNA viruses of the genus Cytorhabdovirus (type member: Lettuce necrotic yellows virus), family Rhabdoviridae, order Mononegavirales. Members of the family Rhabdoviridae can infect vertebrates, invertebrates and plants. Physical properties: Virions are bacilliform, 74-88 nm in diameter and 163-383 nm in length with surface projections probably composed of trimers of the glycoprotein G, occurring in the cytoplasm in either the coated or the uncoated form (Fig. 1). The nucleocapsid is enclosed in a host-derived envelope. Within the virion, the SCV genome consists of a single negative-sense single-stranded RNA molecule of approximately 13 kb. Viral proteins: The SCV genome encodes at least five proteins: the nucleocapsid (N) protein (45 kDa), the matrix (M) protein (77 kDa), the nonstructural protein [Ns, 55 kDa, also known as phosphoprotein (P)], the glycoprotein (G, 23 kDa) and the large (L) protein. Hosts: The natural host range of SCV is limited to species of the genus Fragaria L. Experimental hosts include Physalis pubescens L., P. floridana Rydb., Nicotiana occidentalis, N. glutinosa L. and N. clevelandi Gray. SCV also replicates in its insect vectors Chaetosiphon fragaefolii Cockerell and C. jacobi Hille Ris Lamberts. When injected as purified virus, SCV replicates in aphids Hyperomyzus lactucae (L.), Macrosiphon euphorbiae Thomas, Myzus ornatus Laing, Megoura viciae Buckton, and Acyrthosiphoa pisum (Harris).

METHOD OF PROTECTIVELY COATING URANIUM

Science.gov (United States)

Eubank, L.D.; Boller, E.R.

1959-02-01

A method is described for protectively coating uranium with zine comprising cleaning the U for coating by pickling in concentrated HNO/sub 3/, dipping the cleaned U into a bath of molten zinc between 430 to 600 C and containing less than 0 01% each of Fe and Pb, and withdrawing and cooling to solidify the coating. The zinccoated uranium may be given a; econd coating with another metal niore resistant to the corrosive influences particularly concerned. A coating of Pb containing small proportions of Ag or Sn, or Al containing small proportions of Si may be applied over the zinc coatings by dipping in molten baths of these metals.

Development of Zn-Al-Cu coatings by hot dip coated technology: preparation and characterization

International Nuclear Information System (INIS)

Cervantes, J.; Barba, A.; Hernandez, M. A.; Salas, J.; Espinoza, J. L.; Denova, C.; Torres-Villasenor, G.; Conde, A.; Covelo, A.; Valdez, R.

2013-01-01

In the present study, research concerning Zn-Al-Cu coatings on low carbon steels has been conducted in order to characterize different properties obtained by a hot-dip coated process. The results include preparation procedure as well as the processing parameters of the coatings. The obtained coatings were subjected to a cold rolling process followed by an anneal heat treatment at different temperatures and under different time conditions. The structural characteristics of coatings have been investigated by optical and electron microscopy. The mechanical properties were obtained by using micro-hardness testing, deep drawing and wear tests whereas chemical analyses were carried out using the SEM/EDAX microprobe. The corrosion properties were achieved by using a salt spray fog chamber and potentiodynamic tests in a saline solution. The coatings are resistant to corrosion and wear in the presence of sodium chloride, therefore, the coatings could be an attractive alternative for application in coastal areas, and adequate wear adhesive resistance. (Author)

Phylogeny of geminivirus coat protein sequences and digital PCR aid in identifying Spissistilus festinus (Say) as a vector of Grapevine red blotch-associated virus

Science.gov (United States)

Grapevine red blotch-associated virus (GRBaV) is a newly identified virus of grapevines, and a putative member of a new genus within the family Geminiviridae. This virus is associated with red blotch disease that was first reported in California in 2008. It affects the profitability of vineyards by ...

Silica coatings on clarithromycin.

Science.gov (United States)

Bele, Marjan; Dmitrasinovic, Dorde; Planinsek, Odon; Salobir, Mateja; Srcic, Stane; Gaberscek, Miran; Jamnik, Janko

2005-03-03

Pre-crystallized clarithromycin (6-O-methylerythromycin A) particles were coated with silica from the tetraethyl orthosilicate (TEOS)-ethanol-aqueous ammonia system. The coatings had a typical thickness of 100-150 nm and presented about 15 wt.% of the silica-drug composite material. The properties of the coatings depended on reactant concentration, temperature and mixing rate and, in particular, on the presence of a cationic surfactant (cetylpyridinium chloride). In the presence of cetylpyridinium chloride the silica coatings slightly decreased the rate of pure clarithromycin dissolution.

Zinc phosphate conversion coatings

Science.gov (United States)

Sugama, Toshifumi

1997-01-01

Zinc phosphate conversion coatings for producing metals which exhibit enhanced corrosion prevention characteristics are prepared by the addition of a transition-metal-compound promoter comprising a manganese, iron, cobalt, nickel, or copper compound and an electrolyte such as polyacrylic acid, polymethacrylic acid, polyitaconic acid and poly-L-glutamic acid to a phosphating solution. These coatings are further improved by the incorporation of Fe ions. Thermal treatment of zinc phosphate coatings to generate .alpha.-phase anhydrous zinc phosphate improves the corrosion prevention qualities of the resulting coated metal.

Error Analysis of Ceramographic Sample Preparation for Coating Thickness Measurement of Coated Fuel Particles

International Nuclear Information System (INIS)

Liu Xiaoxue; Li Ziqiang; Zhao Hongsheng; Zhang Kaihong; Tang Chunhe

2014-01-01

The thicknesses of four coatings of HTR coated fuel particle are very important parameters. It is indispensable to control the thickness of four coatings of coated fuel particles for the safety of HTR. A measurement method, ceramographic sample-microanalysis method, to analyze the thickness of coatings was developed. During the process of ceramographic sample-microanalysis, there are two main errors, including ceramographic sample preparation error and thickness measurement error. With the development of microscopic techniques, thickness measurement error can be easily controlled to meet the design requirements. While, due to the coated particles are spherical particles of different diameters ranged from 850 to 1000μm, the sample preparation process will introduce an error. And this error is different from one sample to another. It’s also different from one particle to another in the same sample. In this article, the error of the ceramographic sample preparation was calculated and analyzed. Results show that the error introduced by sample preparation is minor. The minor error of sample preparation guarantees the high accuracy of the mentioned method, which indicates this method is a proper method to measure the thickness of four coatings of coated particles. (author)

A dual response surface optimization methodology for achieving uniform coating thickness in powder coating process

Directory of Open Access Journals (Sweden)

Boby John

2015-09-01

Full Text Available The powder coating is an economic, technologically superior and environment friendly painting technique compared with other conventional painting methods. However large variation in coating thickness can reduce the attractiveness of powder coated products. The coating thickness variation can also adversely affect the surface appearance and corrosion resistivity of the product. This can eventually lead to customer dissatisfaction and loss of market share. In this paper, the author discusses a dual response surface optimization methodology to minimize the thickness variation around the target value of powder coated industrial enclosures. The industrial enclosures are cabinets used for mounting the electrical and electronic equipment. The proposed methodology consists of establishing the relationship between the coating thickness & the powder coating process parameters and developing models for the mean and variance of coating thickness. Then the powder coating process is optimized by minimizing the standard deviation of coating thickness subject to the constraint that the thickness mean would be very close to the target. The study resulted in achieving a coating thickness mean of 80.0199 microns for industrial enclosures, which is very close to the target value of 80 microns. A comparison of the results of the proposed approach with that of existing methodologies showed that the suggested method is equally good or even better than the existing methodologies. The result of the study is also validated with a new batch of industrial enclosures.

Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay.

Directory of Open Access Journals (Sweden)

Yong Huang

Full Text Available Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus and PCV2 (DNA virus from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29% and TGEV (11.7% preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility.

Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay

Science.gov (United States)

Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen

2015-01-01

Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility. PMID:26544710

Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay.

Science.gov (United States)

Huang, Yong; Xing, Na; Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen

2015-01-01

Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility.

Development of antimicrobial coating by later-by-layer dip coating of chlorhexidine-loaded micelles.

Science.gov (United States)

Tambunlertchai, Supreeda; Srisang, Siriwan; Nasongkla, Norased

2017-06-01

Layer-by-layer (LbL) dip coating, accompanying with the use of micelle structure, allows hydrophobic molecules to be coated on medical devices' surface via hydrogen bonding interaction. In addition, micelle structure also allows control release of encapsulated compound. In this research, we investigated methods to coat and maximize the amount of chlorhexidine (CHX) on silicone surface through LbL dip coating method utilizing hydrogen bonding interaction between PEG on micelle corona and PAA. The number of coated cycles was varied in the process and 90 coating cycles provided the maximum amount of CHX loaded onto the surface. In addition, pre-coating the surface with PAA enhanced the amount of coated CHX by 20%. Scanning electron microscope (SEM) and Fourier Transform Infrared Spectroscopy (FTIR) were used to validate and characterize the coating. For control release aspect, the coated film tended to disrupt at physiological condition; hence chemical crosslinking was performed to minimize the disruption and maximize the release time. Chemical crosslinking at pH 2.5 and 4.5 were performed in the process. It was found that chemical crosslinking could help extend the release period up to 18 days. This was significantly longer when compared to the non-crosslinking silicone tube that could only prolong the release for 5 days. In addition, chemical crosslinking at pH 2.5 gave higher and better initial burst release, release period and antimicrobial properties than that of pH 4.5 or the normal used pH for chemical crosslinking process.

Hydroxyapatite coatings for biomedical applications

CERN Document Server

Zhang, Sam

2013-01-01

Hydroxyapatite coatings are of great importance in the biological and biomedical coatings fields, especially in the current era of nanotechnology and bioapplications. With a bonelike structure that promotes osseointegration, hydroxyapatite coating can be applied to otherwise bioinactive implants to make their surface bioactive, thus achieving faster healing and recovery. In addition to applications in orthopedic and dental implants, this coating can also be used in drug delivery. Hydroxyapatite Coatings for Biomedical Applications explores developments in the processing and property characteri

Effects of the mutation of selected genes of cotton leaf curl Kokhran virus on infectivity, symptoms and the maintenance of cotton leaf curl Multan betasatellite

NARCIS (Netherlands)

Iqbal, Z.; Sattar, M.N.; Kvarnheden, A.; Mansoor, S.; Briddon, R.W.

2012-01-01

Cotton leaf curl Kokhran virus (CLCuKoV) is a cotton-infecting monopartite begomovirus (family Geminiviridae). The effects of mutation of the coat protein (CP), V2, C2 and C4 genes of CLCuKoV on infectivity and symptoms in Nicotiana benthamiana were investigated. Each mutation introduced a premature

PIT Coating Requirements Analysis

International Nuclear Information System (INIS)

MINTEER, D.J.

2000-01-01

This study identifies the applicable requirements for procurement and installation of a coating intended for tank farm valve and pump pit interior surfaces. These requirements are intended to be incorporated into project specification documents and design media. This study also evaluates previously recommended coatings and identifies requirement-compliant coating products

PIT Coating Requirements Analysis

Energy Technology Data Exchange (ETDEWEB)

MINTEER, D.J.

2000-10-20

This study identifies the applicable requirements for procurement and installation of a coating intended for tank farm valve and pump pit interior surfaces. These requirements are intended to be incorporated into project specification documents and design media. This study also evaluates previously recommended coatings and identifies requirement-compliant coating products.

The effect of microstructure at interface between coating and substrate on damping capacity of coating systems

International Nuclear Information System (INIS)

Wang, Xueqin; Pei, Yanling; Ma, Yue

2013-01-01

Samples with various interface microstructures between the coating and the substrate were designed and fabricated in this paper. Dynamic mechanical thermal analyzer (DMTA) was utilized to investigate the dynamic mechanical properties of the samples and scanning electron microscopy (SEM) was used to observe the interface microstructure between the substrate and coating. The effect of the interface microstructure on damping was studied, and results indicated that the larger the coating/substrate interface thickness was and the more interface defects were, the higher interface system damping was. When the micro-hardness ratio of substrate to coating was increased, the damping of coating system was enhanced. The effect of the APS and EB-PVD coating on damping capacity was investigated. There was a dramatic increase in the damping value of the APS coating when the strain was higher than 20 ppm, while the damping amplitude effect of the EB-PVD coating was not so obvious, which could mainly be caused by the different energy dissipation mechanisms of the two coatings.

Multilayer oxidation resistant coating for SiC coated carbon/carbon composites at high temperature

International Nuclear Information System (INIS)

Li Hejun; Jiao Gengsheng; Li Kezhi; Wang Chuang

2008-01-01

To prevent carbon/carbon (C/C) composites from oxidation, a multilayer coating based on molybdenum disilicide and titanium disilicide was formed using a two-step pack cementation technique in argon atmosphere. XRD and SEM analysis showed that the internal coating was a bond SiC layer that acts as a buffer layer, and that the external multilayer coating formed in the two-step pack cementation was composed of two MoSi 2 -TiSi 2 -SiC layers. This coating, which is characterized by excellent thermal shock resistance, could effectively protect the composites from exposure to an oxidizing atmosphere at 1773 K for 79 h. The oxidation of the coated C/C composites was primarily due to the reaction of C/C matrix and oxygen diffusing through the penetrable cracks in the coating

Oncogenic Viruses and Breast Cancer: Mouse Mammary Tumor Virus (MMTV, Bovine Leukemia Virus (BLV, Human Papilloma Virus (HPV, and Epstein–Barr Virus (EBV

Directory of Open Access Journals (Sweden)

James S. Lawson

2018-01-01

Full Text Available BackgroundAlthough the risk factors for breast cancer are well established, namely female gender, early menarche and late menopause plus the protective influence of early pregnancy, the underlying causes of breast cancer remain unknown. The development of substantial recent evidence indicates that a handful of viruses may have a role in breast cancer. These viruses are mouse mammary tumor virus (MMTV, bovine leukemia virus (BLV, human papilloma viruses (HPVs, and Epstein–Barr virus (EBV-also known as human herpes virus type 4. Each of these viruses has documented oncogenic potential. The aim of this review is to inform the scientific and general community about this recent evidence.The evidenceMMTV and human breast cancer—the evidence is detailed and comprehensive but cannot be regarded as conclusive. BLV and human breast cancer—the evidence is limited. However, in view of the emerging information about BLV in human breast cancer, it is prudent to encourage the elimination of BLV in cattle, particularly in the dairy industry. HPVs and breast cancer—the evidence is substantial but not conclusive. The availability of effective preventive vaccines is a major advantage and their use should be encouraged. EBV and breast cancer—the evidence is also substantial but not conclusive. Currently, there are no practical means of either prevention or treatment. Although there is evidence of genetic predisposition, and cancer in general is a culmination of events, there is no evidence that inherited genetic traits are causal.ConclusionThe influence of oncogenic viruses is currently the major plausible hypothesis for a direct cause of human breast cancer.

Oncogenic Viruses and Breast Cancer: Mouse Mammary Tumor Virus (MMTV), Bovine Leukemia Virus (BLV), Human Papilloma Virus (HPV), and Epstein-Barr Virus (EBV).

Science.gov (United States)

Lawson, James S; Salmons, Brian; Glenn, Wendy K

2018-01-01

Although the risk factors for breast cancer are well established, namely female gender, early menarche and late menopause plus the protective influence of early pregnancy, the underlying causes of breast cancer remain unknown. The development of substantial recent evidence indicates that a handful of viruses may have a role in breast cancer. These viruses are mouse mammary tumor virus (MMTV), bovine leukemia virus (BLV), human papilloma viruses (HPVs), and Epstein-Barr virus (EBV-also known as human herpes virus type 4). Each of these viruses has documented oncogenic potential. The aim of this review is to inform the scientific and general community about this recent evidence. MMTV and human breast cancer-the evidence is detailed and comprehensive but cannot be regarded as conclusive. BLV and human breast cancer-the evidence is limited. However, in view of the emerging information about BLV in human breast cancer, it is prudent to encourage the elimination of BLV in cattle, particularly in the dairy industry. HPVs and breast cancer-the evidence is substantial but not conclusive. The availability of effective preventive vaccines is a major advantage and their use should be encouraged. EBV and breast cancer-the evidence is also substantial but not conclusive. Currently, there are no practical means of either prevention or treatment. Although there is evidence of genetic predisposition, and cancer in general is a culmination of events, there is no evidence that inherited genetic traits are causal. The influence of oncogenic viruses is currently the major plausible hypothesis for a direct cause of human breast cancer.

Coating of substrates

International Nuclear Information System (INIS)

Cairns, J.A.; Nelson, R.L.; Woodhead, J.L.

1979-01-01

The process is concerned with providing substrates with coatings obtainable from sols, for example to protect the substrate (such as in nuclear reactors or hydrocarbon cracking plant) or to provide a carrier for catalytically active material. Hitherto, coatings obtained from sols have had a high porosity and high surface area so that they have not been entirely satisfactory for the above applications. In the process described, dense, low-porosity coatings are provided by contacting the substrate with a sol of refractory material (e.g. CeO 2 or SiO 2 ) convertible to a gel of density at least 40% of the theoretical density of the refractory material, and converting the sol to the gel. Optionally, the gel may be converted to a ceramic coating by firing. (author)

Fuel particle coating data

International Nuclear Information System (INIS)

Hollabaugh, C.M.; Wagner, P.; Wahman, L.A.; White, R.W.

1977-01-01

Development of coating on nuclear fuel particles for the High-Temperature Fuels Technology program at the Los Alamos Scientific Laboratory included process studies for low-density porous and high-density isotropic carbon coats, and for ZrC and ''alloy'' C/ZrC coats. This report documents the data generated by these studies

Functional Plasma-Deposited Coatings

Directory of Open Access Journals (Sweden)

Mykhaylo Pashechko

2017-12-01

Full Text Available The paper focuses on the problem of low adhesion of plasma sprayed coatings to the substrate. The subsequent laser treatment modes and their influence on the coating-substrate interface were studied. This allows to decrease the level of metstability of the coating, thus decreasing its hardness down to 11-12 GPa on the surface and to about 9 GPa on depth of 400 µm. The redistribution of alloying elements through solid and liquid diffusion improves mechanical properties and rises the adhesion up to 450 MPa after remelting and up to 90-110 MPa after laser-aided thermal cycling. At he same time, remelting of coating helps to decrease its porosity down to 1%. Obtained complex of properties also allows to improve wear resistance of coatings and to decrease friction factor.

Self-Healing anticorrosive coatings

DEFF Research Database (Denmark)

Nesterova, Tatyana

%. The number is lower than anticipated and needs to be confirmed. Finally, a 3-D model, based on Monte-Carlo simulations, has been developed for prediction of healing efficiency of a microcapsule-based anticorrosive coating. Two kinds of cracks were considered: cracks accommodated within the bulk coating...... associated with development and testing of this type of coating. A laboratory investigation, to identify the most suitable method for production of mechanically stable (filled with industrially relevant core materials) and forming a free-flowing powder upon drying microcapsules, has been performed. Four...... reduces the intensity of crack formation (both in number and length) compared to filler-containing coatings and prevents the coating from flaking upon damage. Based on specular gloss measurements, a preliminary critical pigment (microcapsule) concentration (CPVC) value was estimated to about 30 vol...

The interfacial chemistry of metallized, oxide coated, and nanocomposite coated polymer films

Energy Technology Data Exchange (ETDEWEB)

Barker, C.P. [Durham Univ. (United Kingdom). Dept. of Chemistry; Kochem, K.H. [HOECHST Aktiengesellschaft, Werk Kalle/Albert, Geschaftsbereich H, Rheingaustrasse 190-196, D-65174 Wiesbaden (Germany); Revell, K.M. [CAMVAC (Europe) Ltd., Burrell Way, Thetford, Norfolk IP24 3QY (United Kingdom); Kelly, R.S.A. [CAMVAC (Europe) Ltd., Burrell Way, Thetford, Norfolk IP24 3QY (United Kingdom); Badyal, J.P.S. [Durham Univ. (United Kingdom). Dept. of Chemistry

1995-02-15

Aluminium, aluminium oxide, and aluminium/aluminium oxide nanocomposite coated polymer substrates have been characterized by X-ray photoelectron spectroscopy, transmission electron microscopy, argon ion sputter depth profiling, and gas permeation measurements. A comparison of the similarities and differences between these coatings has provided a detailed insight into the physicochemical origins of gas barrier associated with metallized plastics. Keywords: Aluminium; Aluminium oxide; Coatings; X-ray photoelectron spectroscopy ((orig.))

Oxidation Behavior of FeCrAl -coated Zirconium Cladding prepared by Laser Coating

Energy Technology Data Exchange (ETDEWEB)

Kim, Il-Hyun; Kim, Hyun-Gil; Choi, Byung-Kwan; Park, Jeong-Yong; Koo, Yang-Hyun; Kim, Jin-Seon [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

2015-05-15

From the recent research trends, the ATF cladding concepts for enhanced accident tolerance are divided as follows: Mo-Zr cladding to increase the high temperature strength, cladding coating to increase the high temperature oxidation resistance, FeCrAl alloy and SiC/SiCf material to increase the oxidation resistance and strength at high temperature. To commercialize the ATF cladding concepts, various factors are considered, such as safety under normal and accident conditions, economy for the fuel cycle, and developing development challenges, and schedule. From the proposed concepts, it is known that the cladding coating, FeCrAl alloy, and Zr-Mo claddings are considered as a near/mid-term application, whereas the SiC material is considered as a long-term application. Among them, the benefit of cladding coating on Zr-based alloys is the fuel cycle economy regarding the manufacturing, neutron cross section, and high tritium permeation characteristics. However, the challenge of cladding coating on Zr-based alloys is the lower oxidation resistance and mechanical strength at high-temperature than other concepts. Another important point is the adhesion property between the Zr-based alloy and coating materials. A laser coating method supplied with FeCrAl powders was developed to decrease the high-temperature oxidation rate in a steam environment through a systematic study for various coating parameters, and a FeCrAl-coated Zircaloy-4 cladding tube of 100 mm in length to the axial direction can be successfully manufactured.

Coatings for laser fusion

International Nuclear Information System (INIS)

Lowdermilk, W.H.

1981-01-01

Optical coatings are used in lasers systems for fusion research to control beam propagation and reduce surface reflection losses. The performance of coatings is important in the design, reliability, energy output, and cost of the laser systems. Significant developments in coating technology are required for future lasers for fusion research and eventual power reactors

Characterization of the complete genome of euonymus yellow vein associated virus, a distinct member of the genus Potexvirus, family Alphaflexiviridae, isolated from Euonymus bungeanus Maxim in Liaoning, Northern China.

Science.gov (United States)

Yang, Caixia; Han, Tong; Fu, Jingjing; Liao, Yiming; Chen, Sha

2018-02-01

In August 2016, a yellow vein disease was observed on leaves of Euonymus bungeanus Maxim (Euonymus, Celastraceae) in Liaoning, China. Virions measuring 750 × 13 nm were observed in a sample from the diseased plant. A potexvirus was detected in the sample by small-RNA deep sequencing analysis and recovered by traditional cloning. The genome of this potexvirus consists of 7,279 nucleotides, excluding the poly(A) tail at the 3' end, and contains five open reading frames (ORFs). Based on the nucleotide and amino acid sequences of the coat protein gene, the virus shared the highest sequence similarity with white clover mosaic virus (WCMV, X16636) (40.1%) and clover yellow mosaic virus (ClYMV, D00485) (37.1%). Phylogenetic analysis showed that the virus clustered with potexviruses and is most closely related to strawberry mild yellow edge virus. These results indicate that this virus is a distinct member of the genus Potexvirus, for which the name euonymus yellow vein associated virus (EuYVAV) is proposed. To our knowledge, this is the first report of a potexvirus on E. bungeanus.

Evolutionary relationship of alfalfa mosaic virus with cucumber mosaic virus and brome mosaic virus

OpenAIRE

Savithri, HS; Murthy, MRN

1983-01-01

The amino acid sequences of the non-structural protein (molecular weight 35,000; 3a protein) from three plant viruses - cucumber mosaic, brome mosaic and alfalfa mosaic have been systematically compared using the partial genomic sequences for these three viruses already available. The 3a protein of cucumber mosaic virus has an amino acid sequence homology of 33.7% with the corresponding protein of brome mosaic virus. A similar protein from alfalfa mosaic virus has a homology of 18.2% and 14.2...

Protective Coatings

Science.gov (United States)

1980-01-01

General Magnaplate Corporation's pharmaceutical machine is used in the industry for high speed pressing of pills and capsules. Machine is automatic system for molding glycerine suppositories. These machines are typical of many types of drug production and packaging equipment whose metal parts are treated with space spinoff coatings that promote general machine efficiency and contribute to compliance with stringent federal sanitation codes for pharmaceutical manufacture. Collectively known as "synergistic" coatings, these dry lubricants are bonded to a variety of metals to form an extremely hard slippery surface with long lasting self lubrication. The coatings offer multiple advantages; they cannot chip, peel or be rubbed off. They protect machine parts from corrosion and wear longer, lowering maintenance cost and reduce undesired heat caused by power-robbing friction.

Adhesive strength of hydroxyl apatite(HA coating and biomechanics behavior of HA-coated prosthesis:an experimental study

Directory of Open Access Journals (Sweden)

Tian-yang ZHANG

2011-05-01

Full Text Available Objective To explore the influence of adhesive strength of hydroxyapatite(HA coating on the post-implantation stability of HA-coated prosthesis.Methods The adhesive strength and biomechanics behavior of HA coating were studied by histopathological observation,material parameters and biomechanical testing,the titanium(Ti-coated prosthesis was employed as control.Results Scratch test showed that the adhesive strength of HA coating was significantly lower than that of Ti coating(P < 0.01.Histopathological examination and bone morphometry showed that,at the early stage of prosthesis implantation,the bony growth around HA-coated prosthesis was significantly higher than that around Ti-coated prosthesis(P < 0.01,but the ultimate shear strength of HA-coated prosthesis was much lower than that of Ti-coated prosthesis(P < 0.01.After the push-out test with prosthesis,histopathological observation showed that there were accumulations of clump-and strip-like granular residues on the surface of bones that newly grew around the HA-coated prosthesis,and surface energy-dispersive X-ray spectroscopy(EDX analysis also confirmed that the shear stress induced HA decohesion from the substrate of prosthesis.Conclusions Although HA coating showed a satisfactory effect on early bone formation and prosthetic stability,due to the deficiencies of adhesive strength,the early stability of prosthesis may be gradually destroyed by the shear loads of human body and coating degradation.

Pepo aphid-borne yellows virus: a new species in the genus Polerovirus.

Science.gov (United States)

Ibaba, Jacques D; Laing, Mark D; Gubba, Augustine

2017-02-01

Pepo aphid-borne yellows virus (PABYV) has been proposed as a putative representative of a new species in the genus Polerovirus in the family Luteoviridae. The genomes of two South African (SA) isolates of cucurbit-infecting PABYV were described in this record. Total RNA, extracted from a pattypan (Cucurbita pepo L.) and a baby marrow (C. pepo L.) leaf samples, was subjected to next-generation sequencing (NGS) on the HiSeq Illumina platform. Sanger sequencing was subsequently used to authenticate the integrity of PABYV's genome generated from de novo assembly of the NGS data. PABYV genome of SA isolates consists of 5813 nucleotides and displays an organisation typical of poleroviruses. Genome sequence comparisons of the SA PABYV isolates to other poleroviruses support the classification of PABYV as a new species in the genus Polerovirus. Recombination analyses showed that PABYV and Cucurbit aphid-borne yellows virus (CABYV) shared the same ancestor for the genome part situated between breaking points. Phylogenetic analyses of the RNA-dependent RNA polymerase and the coat protein genes showed that SA PABYV isolates shared distant relationship with CABYV and Suakwa aphid-borne yellows virus. Based on our results, we propose that PABYV is a distinct species in the genus Polerovirus.

Studies on soft centered coated snacks.

Science.gov (United States)

Pavithra, A S; Chetana, Ramakrishna; Babylatha, R; Archana, S N; Bhat, K K

2013-04-01

Roasted groundnut seeds, amaranth and dates pulp formed the center filling which was coated with sugar, breadings, desiccated coconut and roasted Bengalgram flour (BGF) to get 4 coated snacks. Physicochemical characteristics, microbiological profile, sorption behaviour and sensory quality of 4 coated snacks were determined. Centre filling to coating ratio of the products were in the range of 3:2-7:1, the product having BGF coating had the thinnest coating. Center filling had soft texture and the moisture content was 10.2-16.2% coating had lower moisture content (4.4-8.6%) except for Bengal gram coating, which had 11.1% moisture. Sugar coated snack has lowest fat (11.6%) and protein (7.2%) contents. Desiccated coconut coated snack has highest fat (25.4%) and Bengal gram flour coated snack had highest protein content (15.4%). Sorption studies showed that the coated snack had critical moisture content of 11.2-13.5%. The products were moisture sensitive and hence require packaging in films having higher moisture barrier property. In freshly prepared snacks coliforms, yeast and mold were absent. Mesophillic aerobes count did not show significant change during 90 days of storage at 27 °C and 37 °C. Sensory analysis showed that products had a unique texture due to combined effect of fairly hard coating and soft center. Flavour and overall quality of all the products were rated as very good.

Rapidly curable electrically conductive clear coatings

Energy Technology Data Exchange (ETDEWEB)

Bowman, Mark P.; Anderson, Lawrence G.; Post, Gordon L.

2018-01-16

Rapidly curable electrically conductive clear coatings are applied to substrates. The electrically conductive clear coating includes to clear layer having a resinous binder with ultrafine non-stoichiometric tungsten oxide particles dispersed therein. The clear coating may be rapidly cured by subjecting the coating to infrared radiation that heats the tungsten oxide particles and surrounding resinous binder. Localized heating increases the temperature of the coating to thereby thermally cure the coating, while avoiding unwanted heating of the underlying substrate.

The Importance of the KR-Rich Region of the Coat Protein of Ourmia melon virus for Host Specificity, Tissue Tropism, and Interference With Antiviral Defense.

Science.gov (United States)

Rossi, Marika; Vallino, Marta; Abbà, Simona; Ciuffo, Marina; Balestrini, Raffaella; Genre, Andrea; Turina, Massimo

2015-01-01

The N-terminal region of the Ourmia melon virus (OuMV) coat protein (CP) contains a short lysine/arginine-rich (KR) region. By alanine scanning mutagenesis, we showed that the KR region influences pathogenicity and virulence of OuMV without altering viral particle assembly. A mutant, called OuMV6710, with three basic residue substitutions in the KR region, was impaired in the ability to maintain the initial systemic infection in Nicotiana benthamiana and to infect both cucumber and melon plants systemically. The integrity of this protein region was also crucial for encapsidation of viral genomic RNA; in fact, certain mutations within the KR region partially compromised the RNA encapsidation efficiency of the CP. In Arabidopsis thaliana Col-0, OuMV6710 was impaired in particle accumulation; however, this phenotype was abolished in dcl2/dcl4 and dcl2/dcl3/dcl4 Arabidopsis mutants defective for antiviral silencing. Moreover, in contrast to CPwt, in situ immunolocalization experiments indicated that CP6710 accumulates efficiently in the spongy mesophyll tissue of infected N. benthamiana and A. thaliana leaves but only occasionally infects palisade tissues. These results provided strong evidence of a crucial role for OuMV CP during viral infection and highlighted the relevance of the KR region in determining tissue tropism, host range, pathogenicity, and RNA affinity, which may be all correlated with a possible CP silencing-suppression activity.

Spin coated versus dip coated electrochromic tungsten oxide films: Structure, morphology, optical and electrochemical properties

International Nuclear Information System (INIS)

Deepa, M.; Saxena, T.K.; Singh, D.P.; Sood, K.N.; Agnihotry, S.A.

2006-01-01

A sol-gel derived acetylated peroxotungstic acid sol encompassing 4 wt.% of oxalic acid dihydrate (OAD) has been employed for the deposition of tungsten oxide (WO 3 ) films by spin coating and dip coating techniques, in view of smart window applications. The morphological and structural evolution of the as-deposited spin and dip coated films as a function of annealing temperature (250 and 500 o C) has been examined and compared by Fourier transform infrared (FT-IR) spectroscopy, scanning electron microscopy (SEM) and X-ray diffraction (XRD). A conspicuous feature of the dip coated film (annealed at 250 o C) is that its electrochromic and electrochemical properties ameliorate with cycling without degradation in contrast to the spin coated film for which these properties deteriorate under repetitive cycling. A comparative study of spin and dip coated nanostructured thin films (annealed at 250 o C) revealed a superior performance for the cycled dip coated film in terms of higher transmission modulation and coloration efficiency in solar and photopic regions, faster switching speed, higher electrochemical activity as well as charge storage capacity. While the dip coated film could endure 2500 color-bleach cycles, the spin coated film could sustain only a 1000 cycles. The better cycling stability of the dip coated film which is a repercussion of a balance between optimal water content, porosity and grain size hints at its potential for electrochromic window applications

Adhesive strength of hydroxyl apatite(HA) coating and biomechanics behavior of HA-coated prosthesis:an experimental study

OpenAIRE

Tian-yang ZHANG; Yong-hong DUAN; Shu ZHU; Jin-yu ZHU; Qing-sheng ZHU

2011-01-01

Objective To explore the influence of adhesive strength of hydroxyapatite(HA) coating on the post-implantation stability of HA-coated prosthesis.Methods The adhesive strength and biomechanics behavior of HA coating were studied by histopathological observation,material parameters and biomechanical testing,the titanium(Ti)-coated prosthesis was employed as control.Results Scratch test showed that the adhesive strength of HA coating was significantly lower than that of Ti coating(P < 0.01).Hist...

Tomato bushy stunt virus and DI RNAs as a model for studying mechanisms of RNA virus replication, pathogenicity and recombination. Final technical report for 1994--1997

Energy Technology Data Exchange (ETDEWEB)

Morris, T.J. [Univ. of Nebraska, Lincoln, NE (United States). School of Biological Sciences; Jackson, A.O. [Univ. of California, Berkeley, CA (United States). Dept. of Plant Biology

1997-12-31

Tomato bushy stunt virus (TBSV) is a small icosahedral virus with a very broad host-range. The symptoms of systemic infection range from mild mosaic to severe necrosis that often results in death. The genome of TBSV is composed of a single plus stranded RNA molecule with five genes. Two 5 inch genes are translated from the viral RNA, and the remaining three are translated from two subgenomic RNAs. Prior to the DOE supported studies, TBSV gene function had been assigned solely on the basis of sequence similarity with other virus genes of known function. The two 5 inch proximal genes (p33 and p92) were thought to be involved in viral replication, the middle gene encoded the capsid protein (p41), but no clear function was assigned to two nested 3 inch genes (p19 and p22), although it was suggested that at least one could be involved in movement. This research has determined the roles of each of the viral genes in the infection process, and the authors have obtained considerable genetic information pertinent to the contributions of the coat protein and the nested genes to the disease phenotypes observed in several host plants. They have also identified another genetic element with a short open reading frame in the 3 inch-noncoding region of the genome that provides a host-dependent replication function.

A thiophene-modified screen printed electrode for detection of dengue virus NS1 protein.

Science.gov (United States)

Silva, M M S; Dias, A C M S; Cordeiro, M T; Marques, E; Goulart, M O F; Dutra, R F

2014-10-01

A thiophene-modified screen printed electrode (SPE) for detection of the Dengue virus non-structural protein 1 (NS1), an important marker for acute phase diagnosis, is described. A sulfur-containing heterocyclic compound, the thiophene was incorporated to a carbon ink to prepare reproducible screen printed electrodes. After cured, the thiophene SPE was coated by gold nanoparticles conjugated to Protein A to form a nanostrutured surface. The Anti-NS1 antibodies immobilized via their Fc portions via Protein A, leaving their antigen specific sites free circumventing the problem of a random antibodies immobilization. Amperometric responses to the NS1 protein of dengue virus were obtained by cyclic voltammetries performed in presence of ferrocyanide/ferricyanide as redox probe. The calibration curve of immunosensor showed a linear response from 0.04 µg mL(-1) to 0.6 µg mL(-1) of NS1 with a good linear correlation (r=0.991, pink enhanced the electroanalytical properties of the SPEs, increasing their reproducibility and sensitivity. This point-of-care testing represents a great potential for use in epidemic situations, facilitating the early diagnosis in acute phase of dengue virus. Copyright © 2014 Elsevier B.V. All rights reserved.

Inorganic nanoparticles for transfection of mammalian cells and removal of viruses from aqueous solutions.

Science.gov (United States)

Link, Nils; Brunner, Tobias J; Dreesen, Imke A J; Stark, Wendelin J; Fussenegger, Martin

2007-12-01

Owing to their small size, synthetic nanoparticles show unprecedented biophysical and biochemical properties which may foster novel advances in life-science research. Using flame-spray synthesis technology we have produced non-coated aluminum-, calcium-, cerium-, and zirconium-derived inorganic metal oxide nanoparticles which not only exhibit high affinity for nucleic acids, but can sequester such compounds from aqueous solution. This non-covalent DNA-binding capacity was successfully used to transiently transfect a variety of mammalian cells including human, reaching transfection efficiencies which compared favorably with classic calcium phosphate precipitation (CaP) procedures and lipofection. In this straightforward protocol, transfection was enabled by simply mixing nanoparticles with DNA in solution prior to addition to the target cell population. Transiently transfected cells showed higher production levels of the human secreted glycoprotein SEAP compared to isogenic populations transfected with established technologies. Inorganic metal oxide nanoparticles also showed a high binding capacity to human-pathogenic viruses including adenovirus, adeno-associated virus and human immunodeficiency virus type 1 and were able to clear these pathogens from aqueous solutions. The DNA transfection and viral clearance capacities of inorganic metal oxide nanoparticles may provide cost-effective biopharmaceutical manufacturing and water treatment in developing countries.

Effect of Layer-Graded Bond Coats on Edge Stress Concentration and Oxidation Behavior of Thermal Barrier Coatings

Science.gov (United States)

Zhu, Dongming; Ghosn, Louis J.; Miller, Robert A.

1998-01-01

Thermal barrier coating (TBC) durability is closely related to design, processing and microstructure of the coating Z, tn systems. Two important issues that must be considered during the design of a thermal barrier coating are thermal expansion and modulus mismatch between the substrate and the ceramic layer, and substrate oxidation. In many cases, both of these issues may be best addressed through the selection of an appropriate bond coat system. In this study, a low thermal expansion and layer-graded bond coat system, that consists of plasma-sprayed FeCoNiCrAl and FeCrAlY coatings, and a high velocity oxyfuel (HVOF) sprayed FeCrAlY coating, is developed to minimize the thermal stresses and provide oxidation resistance. The thermal expansion and oxidation behavior of the coating system are also characterized, and the strain isolation effect of the bond coat system is analyzed using the finite element method (FEM). Experiments and finite element results show that the layer-graded bond coat system possesses lower interfacial stresses. better strain isolation and excellent oxidation resistance. thus significantly improving the coating performance and durability.

A novel coating strategy towards improving interfacial adhesion strength of Cu–Sn alloy coated steel with vulcanized rubber

International Nuclear Information System (INIS)

Banerjee, Atanu; Dutta, Monojit; Bysakh, Sandip; Bhowmick, Anil K.; Laha, Tapas

2014-01-01

Highlights: • We propose a double layer Cu–Sn alloy coating strategy on steel to improve adhesion. • Uniform coating with adequate penetration inside micro-roughness was observed. • XPS and GDOES study revealed improved substrate surface coverage by coating. • TEM investigation confirmed compact, uniform and micro-porosity free interface. • Peel test with vulcanized rubber confirmed improved adhesion with cohesive fracture. - Abstract: A comparative assessment in terms of uniformity, coating coverage and coating deposition mechanism has been carried out for two different types of Cu–Sn coatings on steel substrate with varying Sn composition (2–6.5 wt%) deposited via immersion technique, viz. (i) single layer Cu–Sn coating and (ii) double layer coating consisting of a thin Cu strike layer followed by a Cu–Sn layer. Coating morphology, surface coverage, coating-substrate interface, and coating composition at surface and along the depth were studied using laser confocal microscope (OLS), scanning electron microscope (SEM) coupled with energy dispersive spectroscope (EDS), glow discharge optical emission spectroscopy (GDOES), X-ray photoelectron spectroscopy (XPS) and cross-sectional transmission electron microscopy (TEM). Quantitative depth profiling using GDOES and surface compositional analysis via XPS suggested improvement in surface coverage in the case of double layer coatings. SEM-EDS and TEM analysis confirmed that the coating deposition was more uniform with sufficient coating penetration inside the deep roughness troughs resulting in compact and micro-porosity free interface for this type of coatings. Better adhesion strength with less variation in peel force and cohesive mode of fracture within the rubber was observed for the double layer coated samples during the peel test carried out on coated steel samples vulcanized with rubber. On the other hand, the single layer coated samples showed large variation in peel force with adhesive�

A novel coating strategy towards improving interfacial adhesion strength of Cu–Sn alloy coated steel with vulcanized rubber

Energy Technology Data Exchange (ETDEWEB)

Banerjee, Atanu [Tata Steel, Jamshedpur 831001 (India); Department of Metallurgical and Materials Engineering, Indian Institute of Technology, Kharagpur 721302 (India); Dutta, Monojit [Tata Steel, Jamshedpur 831001 (India); Bysakh, Sandip [Central Glass and Ceramic Research Institute, Kolkata 700032 (India); Bhowmick, Anil K. [Rubber Technology Center, Indian Institute of Technology, Kharagpur 721302 (India); Laha, Tapas, E-mail: laha@metal.iitkgp.ernet.in [Department of Metallurgical and Materials Engineering, Indian Institute of Technology, Kharagpur 721302 (India)

2014-09-15

Highlights: • We propose a double layer Cu–Sn alloy coating strategy on steel to improve adhesion. • Uniform coating with adequate penetration inside micro-roughness was observed. • XPS and GDOES study revealed improved substrate surface coverage by coating. • TEM investigation confirmed compact, uniform and micro-porosity free interface. • Peel test with vulcanized rubber confirmed improved adhesion with cohesive fracture. - Abstract: A comparative assessment in terms of uniformity, coating coverage and coating deposition mechanism has been carried out for two different types of Cu–Sn coatings on steel substrate with varying Sn composition (2–6.5 wt%) deposited via immersion technique, viz. (i) single layer Cu–Sn coating and (ii) double layer coating consisting of a thin Cu strike layer followed by a Cu–Sn layer. Coating morphology, surface coverage, coating-substrate interface, and coating composition at surface and along the depth were studied using laser confocal microscope (OLS), scanning electron microscope (SEM) coupled with energy dispersive spectroscope (EDS), glow discharge optical emission spectroscopy (GDOES), X-ray photoelectron spectroscopy (XPS) and cross-sectional transmission electron microscopy (TEM). Quantitative depth profiling using GDOES and surface compositional analysis via XPS suggested improvement in surface coverage in the case of double layer coatings. SEM-EDS and TEM analysis confirmed that the coating deposition was more uniform with sufficient coating penetration inside the deep roughness troughs resulting in compact and micro-porosity free interface for this type of coatings. Better adhesion strength with less variation in peel force and cohesive mode of fracture within the rubber was observed for the double layer coated samples during the peel test carried out on coated steel samples vulcanized with rubber. On the other hand, the single layer coated samples showed large variation in peel force with adhesive�

Radiation curable coating compositions

International Nuclear Information System (INIS)

Jenkinson, R.D.; Carder, C.H.

1979-01-01

The present invention provides a low-toxicity diluent component for radiation curable coating compositions that contain an acrylyl or methacryly oligomer or resin component such as an acrylyl urethane oligomer. The low-toxicity diluent component of this invention is chosen from the group consisting of tetraethlorthosilicate and tetraethoxyethylorthosilicate. When the diluent component is used as described, benefits in addition to viscosity reduction, may be realized. Application characteristics of the uncured coatings composition, such as flowability, leveling, and smoothness are notably improved. Upon curing by exposure to actinic radiation, the coating composition forms a solid, non-tacky surface free of pits, fissures or other irregularities. While there is no readily apparent reactive mechanism by which the orthosilicate becomes chemically bonded to the cured coating, the presence of silicon in the cured coating has been confirmed by scanning electron microscopy. 12 drawing

Article Including Environmental Barrier Coating System

Science.gov (United States)

Lee, Kang N. (Inventor)

2015-01-01

An enhanced environmental barrier coating for a silicon containing substrate. The enhanced barrier coating may include a bond coat doped with at least one of an alkali metal oxide and an alkali earth metal oxide. The enhanced barrier coating may include a composite mullite bond coat including BSAS and another distinct second phase oxide applied over said surface.

Fluorine Based Superhydrophobic Coatings

Directory of Open Access Journals (Sweden)

Jean-Denis Brassard

2012-05-01

Full Text Available Superhydrophobic coatings, inspired by nature, are an emerging technology. These water repellent coatings can be used as solutions for corrosion, biofouling and even water and air drag reduction applications. In this work, synthesis of monodispersive silica nanoparticles of ~120 nm diameter has been realized via Stöber process and further functionalized using fluoroalkylsilane (FAS-17 molecules to incorporate the fluorinated groups with the silica nanoparticles in an ethanolic solution. The synthesized fluorinated silica nanoparticles have been spin coated on flat aluminum alloy, silicon and glass substrates. Functionalization of silica nanoparticles with fluorinated groups has been confirmed by Fourier Transform Infrared spectroscopy (FTIR by showing the presence of C-F and Si-O-Si bonds. The water contact angles and surface roughness increase with the number of spin-coated thin films layers. The critical size of ~119 nm renders aluminum surface superhydrophobic with three layers of coating using as-prepared nanoparticle suspended solution. On the other hand, seven layers are required for a 50 vol.% diluted solution to achieve superhydrophobicity. In both the cases, water contact angles were more than 150°, contact angle hysteresis was less than 2° having a critical roughness value of ~0.700 µm. The fluorinated silica nanoparticle coated surfaces are also transparent and can be used as paint additives to obtain transparent coatings.

Effect of salivary pH on diametral tensile strength of glass ionomer cement coated with coating agent

Science.gov (United States)

Farahdillah; Triaminingsih, S.; Eriwati, Y. K.

2017-08-01

The aim of this study was to analyze the effect of salivary pH to diametral tensile strength of glass ionomer cement (GIC) coated with a coating agent. GIC specimens coated with varnish and nano-filled coating agent were stored in artificial saliva at pH values of 4.5, 5.5, and 7 for 24 h at 37°C, then the diametral tensile strength was tested by universal testing machine. Results showed that there was no significant difference in the diametral tensile strength of the GIC coated with varnish and nano-filled coating agent with decreasing of salivary pH (p salivary pH does not affect the diametral tensile strength of GIC coated by varnish or nano-filled coating agent

Overlay metallic-cermet alloy coating systems

International Nuclear Information System (INIS)

Gedwill, M.A.; Glasgow, T.K.; Levine, S.R.

1982-01-01

A substrate, such as a turbine blade, vane, or the like, which is subjected to high temperature use is coated with a base coating of an oxide dispersed, metallic alloy (cermet). A top coating of an oxidation, hot corrosion, erosion resistant alloy of nickel, cobalt, or iron is then deposited on the base coating. A heat treatment is used to improve the bonding. The base coating serves as an inhibitor to interdiffusion between the protective top coating and the substrate. Otherwise, the protective top coating would rapidly interact detrimentally with the substrate and degrade by spalling of the protective oxides formed on the outer surface at elevated temperatures

Overlay metallic-cermet alloy coating systems

Science.gov (United States)

Gedwill, M. A.; Levine, S. R.; Glasgow, T. K. (Inventor)

1984-01-01

A substrate, such as a turbine blade, vane, or the like, which is subjected to high temperature use is coated with a base coating of an oxide dispersed, metallic alloy (cermet). A top coating of an oxidation, hot corrosion, erosion resistant alloy of nickel, cobalt, or iron is then deposited on the base coating. A heat treatment is used to improve the bonding. The base coating serves as an inhibitor to interdiffusion between the protective top coating and the substrate. Otherwise, the protective top coating would rapidly interact detrimentally with the substrate and degrade by spalling of the protective oxides formed on the outer surface at elevated temperatures.

Transparent conducting sol-gel ATO coatings for display applications by an improved dip coating technique

International Nuclear Information System (INIS)

Guzman, G.; Dahmani, B.; Puetz, J.; Aegerter, M.A.

2006-01-01

Transparent conducting coatings of sol-gel ATO (antimony-doped tin oxide) were used to improve surface smoothness of commercial sputter-deposited ITO (indium tin oxide) coatings for application as display electrodes. In order to overcome the deteriorating evaporation-cooling during dip coating, the coating solution was heated moderately to 25 deg. C thus providing the substrate with the required heat. This way, the surface roughness of the ITO could be reduced with an only 45 nm thick ATO coating to R pv = 3.8 nm (R a = 0.4 nm) compared to 31 nm (3.8 nm) for the ITO substrate. Another benefit of such additional coating is the possibility to tailor surface properties of the electrodes in wide ranges. This was used to increase the work function of the ITO substrate from initially 4.3-4.6 eV to about 4.8-5.2 eV by the ATO coating

Non-infected penile prosthesis cultures during revision surgery; comparison between antibiotic coated and non - coated devices

Directory of Open Access Journals (Sweden)

Seyfettin Ciftci

Full Text Available ABSTRACT Introduction: Aim of this study is to investigate bacterial growth on non-infected devices and compare antibiotic-coated and non-coated implants. Materials and methods: The charts of 71 patients who underwent revision surgeries for penile prosthesis between 1995 and 2013 were reviewed. Of those, 31 devices were antibiotic-coated prostheses, while 40 of the implants were non-coated. Swab cultures were routinely obtained from corporal, pump or reservoir site during the operation. If a bacterial biofilm was determined on the prosthesis, it was also cultured. Results: A total of 5 different organisms were cultured from 18 patients. Of them, 4 devices were antibiotic-coated and the other 14 were non-coated devices. Staphylococcus epidermidis was the most common organism, while Staphylococcus hominis, beta hemolitic streptococcus, Escherichia coli and Proteus mirabilis were also cultured. All patients who had positive cultures were treated with appropriate antibiotics for four weeks postoperatively. Median follow-up time was 41 months, ranging between 8 and 82 months. One prosthesis (non-coated became clinically infected in the follow-up period with a totally different organism. Culture positivity rates of antibiotic-coated and non-coated devices were 13% and 35% respectively and the result was significant (p=0.00254. Conclusions: Positive bacterial cultures are present on non-infected penile prostheses at revision surgeries in some of the patients. Antibiotic coated prostheses have much less positive cultures than non-coated devices.

On the interfacial degradation mechanisms of thermal barrier coating systems: Effects of bond coat composition

Energy Technology Data Exchange (ETDEWEB)

Wu, R.T., E-mail: WU.Rudder@nims.go.jp [International Center for Young Scientists, National Institute for Materials Science, 1-2-1 Sengen, Tsukuba City, Ibaraki (Japan); Wang, X.; Atkinson, A. [Department of Materials, Imperial College London, Prince Consort Road, London SW7 2BP (United Kingdom)

2010-10-15

Thermal barrier coating (TBC) systems based on an electron beam physical vapour deposited, yttria-stabilized zirconia (YSZ) top coat and a substrate material of CMSX-4 superalloy were identically prepared to systematically study the behaviour of different bond coats. The three bond coat systems investigated included two {beta}-structured Pt-Al types and a {gamma}-{gamma}' type produced by Pt diffusion without aluminizing. Progressive evolution of stress in the thermally grown aluminium oxide (TGO) upon thermal cycling, and its relief by plastic deformation and fracture, were studied using luminescence spectroscopy. The TBCs with the LT Pt-Al bond coat failed by a rumpling mechanism that generated isolated cracks at the interface between the TGO and the YSZ. This reduced adhesion at this interface and the TBC delaminated when it could no longer resist the release of the stored elastic energy of the YSZ, which stiffened with time due to sintering. In contrast, the TBCs with Pt diffusion bond coats did not rumple, and the adhesion of interfaces in the coating did not obviously degrade. It is shown that the different failure mechanisms are strongly associated with differences in the high-temperature mechanical properties of the bond coats.

How PE tape performs under concrete coating

International Nuclear Information System (INIS)

Dritt, H.J.

1984-01-01

The program objectives were to evaluate the performance of polyethylene tape plant coating and fusion bonded epoxy powder systems with particular respect to the following: 1. Concrete coating application procedures; 2. The shear resistance during laying and retrieving operations of the coating at the various interfaces (a) Pipe and anti-corrosion coating; (b) Anti-corrosion coating and outerwrap; (c) Overlap areas of the anti-corrosion and outerwrap layers; (d) Between concrete and the various corrosion coatings during laying and retrieving operations. 3. Resistance to damage of the coating as a consequence of cracking or slippage of the concrete weight coating. 4. Ability of various coatings to withstand the damage during concrete application by both impact and compression methods; 5. Evaluation of tape and shrink sleeve joint coatings at the cut-back area as well as performance of tape under hot asphalt coating

Thermal shock behavior of platinum aluminide bond coat/electron beam-physical vapor deposited thermal barrier coatings

Energy Technology Data Exchange (ETDEWEB)

Xu, Zhenhua, E-mail: zhxuciac@163.com [Beijing Institute of Aeronautical Materials, Department 5, P.O. Box 81-5, Beijing 100095 (China); Dai, Jianwei [Beijing Institute of Aeronautical Materials, Department 5, P.O. Box 81-5, Beijing 100095 (China); Niu, Jing [Shenyang Liming Aero-engine (Group) Corporation Ltd., Institute of Metallurgical Technology, Technical Center, Shengyang 110043 (China); Li, Na; Huang, Guanghong; He, Limin [Beijing Institute of Aeronautical Materials, Department 5, P.O. Box 81-5, Beijing 100095 (China)

2014-12-25

Highlights: • TBCs of (Ni, Pt)Al bond coat with grit blasting process and YSZ ceramic coating. • Grain boundary ridges are the sites for spallation damage initiation in TBCs. • Ridges removed, cavities formation appeared and the damage initiation deteriorated. • Damage initiation and progression at interface lead to a buckling failure. - Abstract: Thermal barrier coating systems (TBCs) including of chemical vapor deposited (Ni, Pt)Al bond coat with grit blasting process and electron beam physical vapor deposited Y{sub 2}O{sub 3}-stabilized-ZrO{sub 2} (YSZ) ceramic coating were investigated. The phase structures, surface and cross-sectional morphologies, thermal shock behaviors and residual stresses of the coatings were studied in detail. Grain boundary ridges still remain on the surface of bond coat prior to the deposition of the ceramic coating, which are shown to be the major sites for spallation damage initiation in TBCs. When these ridges are mostly removed, they appear some of cavities formation and then the damage initiation mode is deteriorated. Damage initiation and progression occurs at the bond coat to thermally grown oxide (TGO) interface leading to a buckling failure behavior. A buckle failure once started may be arrested when it runs into a region of high bond coat to TGO interface toughness. Thus, complete failure requires further loss in toughness of the bond coat to TGO interface during cooling. The suppressed cavities formation, the removed ridges at the grain boundaries, the relative high TGO to bond coat interface toughness, the uniform growth behavior of TGO thickening and the lower of the residual stress are the primary factors for prolonging the lifetime of TBCs.

Development of Bioactive Ceramic Coating on Titanium Alloy substrate for Biomedical Application Using Dip Coating Method

Science.gov (United States)

Asmawi, R.; Ibrahim, M. H. I.; Amin, A. M.; Mustafa, N.; Noranai, Z.

2017-08-01

Bioactive apatite, such as hydroxyapatite ceramic (HA), [Ca10(PO4)6(OH)2] has been extensively investigated for biomedical applications due to its excellent biocompatibility and tissue bioactivity properties. Its bioactivity provides direct bonding to the bone tissue. Because of its similarity in chemical composition to the inorganic matrix of bone, HA is widely used as implant materials for bone. Unfortunately, because of its poor mechanical properties,. this bioactive material is not suitable for load bearing applications. In this study, by the assistance of dip-coating technique, HA coatings were deposited on titanium alloy substrates by employing hydrothermal derived HA powder. The produced coatings then were oven-dried at 130°C for 1 hour and calcined at various temperature over the range of 200-800°C for 1 hour. XRD measurement showed that HA was the only phase present in the coatings. However coatings calcined at 800°C comprised a mixture of HA and tri-calcium phosphate (TCP). FTIR measurement showed the existence of hydroxyl, phosphate, and carbonate bands. PO4 - band became sharper and narrower with the increased of calcination temperature. FESEM observation showed that the coating is polycrystalline with individual particles of nano to submicron size and has an average particle size of 35 nm. The thickness of the coating are direcly propotional with the viscosity of coating slurry. It was shown that the more viscous coating slurry would produce a thicker ceramic coating. Mechanical properties of the coating were measured in term of adhesion strength using a Micro Materials Nano Test microscratch testing machine. The result revealed that the coating had a good adhesion to the titanium alloy substrate.

Graphene: corrosion-inhibiting coating.

Science.gov (United States)

Prasai, Dhiraj; Tuberquia, Juan Carlos; Harl, Robert R; Jennings, G Kane; Rogers, Bridget R; Bolotin, Kirill I

2012-02-28

We report the use of atomically thin layers of graphene as a protective coating that inhibits corrosion of underlying metals. Here, we employ electrochemical methods to study the corrosion inhibition of copper and nickel by either growing graphene on these metals, or by mechanically transferring multilayer graphene onto them. Cyclic voltammetry measurements reveal that the graphene coating effectively suppresses metal oxidation and oxygen reduction. Electrochemical impedance spectroscopy measurements suggest that while graphene itself is not damaged, the metal under it is corroded at cracks in the graphene film. Finally, we use Tafel analysis to quantify the corrosion rates of samples with and without graphene coatings. These results indicate that copper films coated with graphene grown via chemical vapor deposition are corroded 7 times slower in an aerated Na(2)SO(4) solution as compared to the corrosion rate of bare copper. Tafel analysis reveals that nickel with a multilayer graphene film grown on it corrodes 20 times slower while nickel surfaces coated with four layers of mechanically transferred graphene corrode 4 times slower than bare nickel. These findings establish graphene as the thinnest known corrosion-protecting coating.

Biocompatibility of Niobium Coatings

Directory of Open Access Journals (Sweden)

René Olivares-Navarrete

2011-09-01

Full Text Available Niobium coatings deposited by magnetron sputtering were evaluated as a possible surface modification for stainless steel (SS substrates in biomedical implants. The Nb coatings were deposited on 15 mm diameter stainless steel substrates having an average surface roughness of 2 mm. To evaluate the biocompatibility of the coatings three different in vitro tests, using human alveolar bone derived cells, were performed: cellular adhesion, proliferation and viability. Stainless steel substrates and tissue culture plastic were also studied, in order to give comparative information. No toxic response was observed for any of the surfaces, indicating that the Nb coatings act as a biocompatible, bioinert material. Cell morphology was also studied by immune-fluorescence and the results confirmed the healthy state of the cells on the Nb surface. X-ray diffraction analysis of the coating shows that the film is polycrystalline with a body centered cubic structure. The surface composition and corrosion resistance of both the substrate and the Nb coating were also studied by X-ray photoelectron spectroscopy and potentiodynamic tests. Water contact angle measurements showed that the Nb surface is more hydrophobic than the SS substrate.

Coating thickness measuring device

International Nuclear Information System (INIS)

Joffe, B.B.; Sawyer, B.E.; Spongr, J.J.

1984-01-01

A device especially adapted for measuring the thickness of coatings on small, complexly-shaped parts, such as, for example, electronic connectors, electronic contacts, or the like. The device includes a source of beta radiation and a radiation detector whereby backscatter of the radiation from the coated part can be detected and the thickness of the coating ascertained. The radiation source and detector are positioned in overlying relationship to the coated part and a microscope is provided to accurately position the device with respect to the part. Means are provided to control the rate of descent of the radiation source and radiation detector from its suspended position to its operating position and the resulting impact it makes with the coated part to thereby promote uniformity of readings from operator to operator, and also to avoid excessive impact with the part, thereby improving accuracy of measurement and eliminating damage to the parts

Electrostatic coating technologies for food processing.

Science.gov (United States)

Barringer, Sheryl A; Sumonsiri, Nutsuda

2015-01-01

The application of electrostatics in both powder and liquid coating can improve the quality of food, such as its appearance, aroma, taste, and shelf life. Coatings can be found most commonly in the snack food industry, as well as in confectionery, bakery, meat and cheese processing. In electrostatic powder coating, the most important factors influencing coating quality are powder particle size, density, flowability, charge, and resistivity, as well as the surface properties and characteristics of the target. The most important factors during electrostatic liquid coating, also known as electrohydrodynamic coating, include applied voltage and electrical resistivity and viscosity of the liquid. A good understanding of these factors is needed for the design of optimal coating systems for food processing.

Comparative analysis of chrysanthemum transcriptome in response to three RNA viruses: Cucumber mosaic virus, Tomato spotted wilt virus and Potato virus X.

Science.gov (United States)

Choi, Hoseong; Jo, Yeonhwa; Lian, Sen; Jo, Kyoung-Min; Chu, Hyosub; Yoon, Ju-Yeon; Choi, Seung-Kook; Kim, Kook-Hyung; Cho, Won Kyong

2015-06-01

The chrysanthemum is one of popular flowers in the world and a host for several viruses. So far, molecular interaction studies between the chrysanthemum and viruses are limited. In this study, we carried out a transcriptome analysis of chrysanthemum in response to three different viruses including Cucumber mosaic virus (CMV), Tomato spotted wilt virus (TSWV) and Potato virus X (PVX). A chrysanthemum 135K microarray derived from expressed sequence tags was successfully applied for the expression profiles of the chrysanthemum at early stage of virus infection. Finally, we identified a total of 125, 70 and 124 differentially expressed genes (DEGs) for CMV, TSWV and PVX, respectively. Many DEGs were virus specific; however, 33 DEGs were commonly regulated by three viruses. Gene ontology (GO) enrichment analysis identified a total of 132 GO terms, and of them, six GO terms related stress response and MCM complex were commonly identified for three viruses. Several genes functioning in stress response such as chitin response and ethylene mediated signaling pathway were up-regulated indicating their involvement in establishment of host immune system. In particular, TSWV infection significantly down-regulated genes related to DNA metabolic process including DNA replication, chromatin organization, histone modification and cytokinesis, and they are mostly targeted to nucleosome and MCM complex. Taken together, our comparative transcriptome analysis revealed several genes related to hormone mediated viral stress response and DNA modification. The identified chrysanthemums genes could be good candidates for further functional study associated with resistant to various plant viruses.