WorldWideScience

Sample records for sympathetic skin response

  1. Sympathetic skin response evoked by laser skin stimulation

    OpenAIRE

    Rossi, P.; Truini, A.; Serrao, M.; Iannetti, G. D.; Parisi, L.; Pozzessere, G.; Cruccu, G.

    2002-01-01

    The objective of this study was to evoke sympathetic skin responses (SSRs) in healthy subjects using laser stimulation and to compare these responses with those induced by conventional electrical stimuli. Twenty healthy subjects were investigated. SSRs were obtained using electrical and laser stimuli delivered to the wrist controlateral to the recording site. The sympathetic sudomotor conduction velocity (SSFCV) was measured in 8 subjects by simultaneously recording the SSR from the hand and ...

  2. Sympathetic skin responses in patients with hyperthyroidism.

    Science.gov (United States)

    Gozke, E; Ozyurt, Z; Dortcan, N; Ore, O; Kocer, A; Ozer, E

    2007-01-01

    The aim of this study was to investigate the disorders of sympathetic nervous system in patients with hyperthyroidism using sympathetic skin response (SSR). Twenty-two newly diagnosed cases with hyperthyroidism were included in the study. The results were compared with those of 20 healthy controls. SSR was recorded with the contralateral electrical stimulation of the median nerve (of the upper extremities) and tibial nerve (of the lower extremities) with active electrodes placed on palms and soles and reference electrodes attached on the dorsal aspects of hands and feet. Ages of the cases with hyperthyroidism and controls ranged between 15-65 years (mean: 46.7 +/- 15.0 years) and 24-62 years (mean: 39.6 +/- 9.8 years) respectively (p > 0.05). In all the control subjects SSR could be obtained, while from the lower extremities of 4 cases with hyperthyroidism (18.0%) SSR could not be elicited. Mean SSR latencies of lower extremities were found significantly longer than control group (p nervous system involvement in cases with hyperthyroidism.

  3. Does transcutaneous nerve stimulation have effect on sympathetic skin response?

    Science.gov (United States)

    Okuyucu, E Esra; Turhanoğlu, Ayşe Dicle; Guntel, Murat; Yılmazer, Serkan; Savaş, Nazan; Mansuroğlu, Ayhan

    2018-01-01

    This study examined the effects of transcutaneous electrical nerve stimulation (TENS) on the sympathetic nerve system by sympathetic skin response test. Fifty-five healthy volunteers received either: (i) 30minutes TENS (25 participants) (ii) 30minutes sham TENS (30 participants) and SSR test was performed pre- and post-TENS. The mean values of latency and peak-to-peak amplitude of five consecutive SSRs were calculated. A significant amplitude difference was found between TENS and sham TENS group both in right and left hand (p=0.04, p=0.01, respectively). However there was no significant latancy difference between two groups (p>0.05 ). TENS has an inhibitory effect on elicited SNS responses when compared with sham TENS control group. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Sympathetic skin response and R-R interval variation in cases with rheumatoid arthritis.

    Science.gov (United States)

    Gozke, E; Erdogan, N; Akyuz, G; Turan, B; Akyuz, E; Us, O

    2003-03-01

    To investigate the autonomic nervus system involvement in cases with rheumatoid arthritis (RA) by assesing sympathetic skin response (SSR) and R-R interval variation (RRIV), 14 healthy women and 10 women with RA, all of them without clinic dysautonomies were examined. SSR's were recorded palmar surface of both hands and soles of both feet, after stimulating median and tibial nerves individually. RRIV's were assessed at rest and during six deep breathing in one minute with electrodes placed on dorsal surfaces of both hands. SSR could not be obtained from lower extremities of one case with RA. We could not find any significant difference between two groups in terms of SSR latencies. RRIV values obtained during deep breathing to those recorded at rest (D%/R%) was found to be significantly lower in RA cases than healthy controls. RRIV values increased with deep breathing in healthy subjects, while they decreased in 50% of the RA cases. We conclude that assessment of SSR and RRIV are valuble methods for revelation of subclinical autonomic involvement in cases with RA.

  5. The sympathetic skin response in diabetic neuropathy and its relationship to autonomic symptoms

    International Nuclear Information System (INIS)

    Al-Moallem, Mansour A.; Zaidan, Radwan M.; Alkali, Nura H.

    2008-01-01

    Objective was to examine the utility of the sympathetic skin response (SSR) as a measure of impaired autonomic function among diabetic patients in Saudi Arabia. In this case-control study, baseline SSR was obtained from 18 healthy subjects, followed by nerve conduction studies and SSR testing on a consecutive cohort of 50 diabetic patients with peripheral neuropathy. The SSR in diabetic patients was compared between those with autonomic neuropathy and those without autonomic neuropathy. This study was conducted at the King Khalid University Hospital, Riyadh, Saudi Arabia, from June 2006 to June 2007. The SSR was present in all healthy subjects and in 32 diabetic patients. Among 16 patients with autonomic neuropathy, the SSR was absent in 14 and present in 2, while 4 of 34 patients lacking evidence of autonomic neuropathy had absent SSR. Using Fisher's exact test, we found a strong association between absent SSR and autonomic neuropathy (p<0.001), however, not with age or duration of diabetes mellitus. As a diagnostic test of autonomic neuropathy, the SSR had a sensitivity of 87.5%, a specificity of 88.2%, a positive predictive value of 77.8%, and a negative predictive value of 93.7%. Absence of the SSR is a reliable indicator of autonomic neuropathy among patients with diabetes mellitus in Saudi Arabia. (author)

  6. Sympathetic skin response in multiple sclerosis: a meta-analysis of case-control studies.

    Science.gov (United States)

    Margaritella, Nicolò; Mendozzi, Laura; Garegnani, Massimo; Gilardi, Elisabetta; Nemni, Raffaello; Pugnetti, Luigi

    2018-01-01

    The usefulness of sympathetic skin responses (SSR) in multiple sclerosis (MS) has been advocated by several studies in the last 20 years; however, due to a great heterogeneity of findings, a comprehensive meta-analysis of case-control studies is in order to pinpoint consistencies and investigate the causes of discrepancies. We searched MEDLINE, EMBASE and Cochrane databases for case-control studies comparing SSR absence frequency and latency between patients with MS and healthy controls. Thirteen eligible studies including 415 MS patients and 331 healthy controls were identified. The pooled analysis showed that SSR can be always obtained in healthy controls while 34% of patients had absent SSRs in at least one limb (95% CI 22-47%; p studies (I 2  = 90.3%). Patients' age explained 22% of the overall variability and positive correlations were found with Expanded Disability Status Scale and disease duration. The pooled mean difference of SSR latency showed a significant increase in patients on both upper (193 ms; 95% CI 120-270 ms) and lower (350 ms; 95% CI 190-510 ms) extremities. We tested the discriminatory value of SSR latency thresholds defined as the 95% confidence interval (CI) upper bound of the healthy controls, and validated the results on a new dataset. The lower limb threshold of 1.964 s produces the best results in terms of sensitivity 0.86, specificity 0.67, positive predicted value 0.75 and negative predicted value 0.80. Despite a considerable heterogeneity of findings, there is evidence that SSR is a useful tool in MS.

  7. Modifications of the sympathetic skin response in workers chronically exposed to lead

    Directory of Open Access Journals (Sweden)

    D.B. Nora

    2007-01-01

    Full Text Available The long-term effects of low-level lead intoxication are not known. The sympathetic skin response (SSR was evaluated in a group of 60 former workers of a primary lead smelter, located in Santo Amaro, BA, Brazil. The individuals participating in the study were submitted to a clinical-epidemiological evaluation including questions related to potential risk factors for intoxication, complaints related to peripheral nervous system (PNS involvement, neurological clinical examination, and also to electromyography and nerve conduction studies and SSR evaluation. The sample consisted of 57 men and 3 women aged 34 to 69 years (mean ± SD: 46.8 ± 6.9. The neurophysiologic evaluation showed the presence of lumbosacral radiculopathy in one of the individuals (1.7%, axonal sensorimotor polyneuropathy in 2 (3.3%, and carpal tunnel syndrome in 6 (10%. SSR was abnormal or absent in 12 cases, representing 20% of the sample. More than half of the subjects (53.3% reported a history of acute abdominal pain requiring hospitalization during the period of work at the plant. A history of acute palsy of radial and peroneal nerves was reported by about 16.7 and 8.3% of the individuals, respectively. Mean SSR amplitude did not differ significantly between patients presenting or not the various characteristics in the current neurological situation, except for diaphoresis. The results suggest that chronic lead intoxication induces PNS damage, particularly affecting unmyelinated small fibers. Further systematic study is needed to more precisely define the role of lead in inducing PNS injury.

  8. Pain Processing and Vegetative Dysfunction in Fibromyalgia: A Study by Sympathetic Skin Response and Laser Evoked Potentials

    Directory of Open Access Journals (Sweden)

    Marina de Tommaso

    2017-01-01

    Full Text Available Background. A dysfunction of pain processing at central and peripheral levels was reported in fibromyalgia (FM. We aimed to correlate laser evoked potentials (LEPs, Sympathetic Skin Response (SSR, and clinical features in FM patients. Methods. Fifty FM patients and 30 age-matched controls underwent LEPs and SSR by the right hand and foot. The clinical evaluation included FM disability (FIQ and severity scores (WPI, anxiety (SAS and depression (SDS scales, and questionnaires for neuropathic pain (DN4. Results. The LEP P2 latency and amplitude and the SSR latency were increased in FM group. This latter feature was more evident in anxious patients. The LEPs habituation was reduced in FM patients and correlated to pain severity scores. In a significant number of patients (32% with higher DN4 and FIQ scores, SSR or LEP responses were absent. Conclusions. LEPs and SSR might contribute to clarifying the peripheral and central nervous system involvement in FM patients.

  9. A Study on the Effects of Sympathetic Skin Response Parameters in Diagnosis of Fibromyalgia Using Artificial Neural Networks.

    Science.gov (United States)

    Ozkan, Ozhan; Yildiz, Murat; Arslan, Evren; Yildiz, Sedat; Bilgin, Suleyman; Akkus, Selami; Koyuncuoglu, Hasan R; Koklukaya, Etem

    2016-03-01

    Fibromyalgia syndrome (FMS), usually observed commonly in females over age 30, is a rheumatic disease accompanied by extensive chronic pain. In the diagnosis of the disease non-objective psychological tests and physiological tests and laboratory test results are evaluated and clinical experiences stand out. However, these tests are insufficient in differentiating FMS with similar diseases that demonstrate symptoms of extensive pain. Thus, objective tests that would help the diagnosis are needed. This study analyzes the effect of sympathetic skin response (SSR) parameters on the auxiliary tests used in FMS diagnosis, the laboratory tests and physiological tests. The study was conducted in Suleyman Demirel University, Faculty of Medicine, Physical Medicine and Rehabilitation Clinic in Turkey with 60 patients diagnosed with FMS for the first time and a control group of 30 healthy individuals. In the study all participants underwent laboratory tests (blood tests), certain physiological tests (pulsation, skin temperature, respiration) and SSR measurements. The test data and SSR parameters obtained were classified using artificial neural network (ANN). Finally, in the ANN framework, where only laboratory and physiological test results were used as input, a simulation result of 96.51 % was obtained, which demonstrated diagnostic accuracy. This data, with the addition of SSR parameter values obtained increased to 97.67 %. This result including SSR parameters - meaning a higher diagnostic accuracy - demonstrated that SSR could be a new auxillary diagnostic method that could be used in the diagnosis of FMS.

  10. Developmental changes in autonomic responses are associated with future reward/punishment expectations: A study of sympathetic skin responses in the Markov decision task.

    Science.gov (United States)

    Hosaka, Hiromi; Aoyagi, Kakuro; Kaga, Yoshimi; Kanemura, Hideaki; Sugita, Kanji; Aihara, Masao

    2017-08-01

    Autonomic nervous system activity is recognized as a major component of emotional responses. Future reward/punishment expectations depend upon the process of decision making in the frontal lobe, which is considered to play an important role in executive function. The aim of this study was to investigate the relationship between autonomic responses and decision making during reinforcement tasks using sympathetic skin responses (SSR). Nine adult and 9 juvenile (mean age, 10.2years) volunteers were enrolled in this study. SSRs were measured during the Markov decision task (MDT), which is a reinforcement task. In this task, subjects must endure a small immediate loss to ultimately get a large reward. The subjects had to undergo three sets of tests and their scores in these tests were assessed and evaluated. All adults showed gradually increasing scores for the MDT from the first to third set. As the trial progressed from the first to second set in adults, SSR appearance ratios remarkably increased for both punishment and reward expectations. In comparison with adults, children showed decreasing scores from the first to second set. There were no significant inter-target differences in the SSR appearance ratio in the first and second set in children. In the third set, the SSR appearance ratio for reward expectations was higher than that in the neutral condition. In reinforcement tasks, such as MDT, autonomic responses play an important role in decision making. We assume that SSRs are elicited during efficient decision making tasks associated with future reward/punishment expectations, which demonstrates the importance of autonomic function. In contrast, in children around the age of 10years, the autonomic system does not react as an organized response specific to reward/punishment expectations. This suggests the immaturity of the future reward/punishment expectations process in children. Copyright © 2017 The Japanese Society of Child Neurology. Published by Elsevier B

  11. Investigating the Effect of Sympathetic Skin Response Parameters on the Psychological Test Scores in Patients with Fibromyalgia Syndrome by Using ANNS

    Directory of Open Access Journals (Sweden)

    Murat Yıldız

    2013-01-01

    Full Text Available In this study, psychological tests such as Visual Analogue Pain Scale, Verbal Pain Scale, Beck Depression Inventory, Beck Anxiety Inventory, Hamilton Depression Rating Scale and Hamilton Anxiety Scale were applied to the selected healthy subjects and patients with Fibromyalgia Syndrome (FMS in Suleyman Demirel University, Faculty of Medicine, Department of Physical Medicine and Rehabilitation and the scores were recorded. A measurement system was established in the same department of the university to measure the sympathetic skin response (SSR from the subjects. The SSR was measured and recorded. The parameters such as latency time, maximum amplitude and the elapsed time were calculated by using Matlab software from the recorded SSR data. SSR parameters were added to the scores and diagnosis accuracy percentages of the FMS calculated by using artificial neural networks (ANNs. Obtained results from the simulations showed that the specified parameters of the SSR and FMS were concerned and these parameters can be used as a diagnostic method in FMS.

  12. Renal sympathetic nerve, blood flow, and epithelial transport responses to thermal stress.

    Science.gov (United States)

    Wilson, Thad E

    2017-05-01

    Thermal stress is a profound sympathetic stress in humans; kidney responses involve altered renal sympathetic nerve activity (RSNA), renal blood flow, and renal epithelial transport. During mild cold stress, RSNA spectral power but not total activity is altered, renal blood flow is maintained or decreased, and epithelial transport is altered consistent with a sympathetic stress coupled with central volume loaded state. Hypothermia decreases RSNA, renal blood flow, and epithelial transport. During mild heat stress, RSNA is increased, renal blood flow is decreased, and epithelial transport is increased consistent with a sympathetic stress coupled with a central volume unloaded state. Hyperthermia extends these directional changes, until heat illness results. Because kidney responses are very difficult to study in humans in vivo, this review describes and qualitatively evaluates an in vivo human skin model of sympathetically regulated epithelial tissue compared to that of the nephron. This model utilizes skin responses to thermal stress, involving 1) increased skin sympathetic nerve activity (SSNA), decreased skin blood flow, and suppressed eccrine epithelial transport during cold stress; and 2) increased SSNA, skin blood flow, and eccrine epithelial transport during heat stress. This model appears to mimic aspects of the renal responses. Investigations of skin responses, which parallel certain renal responses, may aid understanding of epithelial-sympathetic nervous system interactions during cold and heat stress. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Changes in the Skin Conductance Monitor as an End Point for Sympathetic Nerve Blocks.

    Science.gov (United States)

    Gungor, Semih; Rana, Bhumika; Fields, Kara; Bae, James J; Mount, Lauren; Buschiazzo, Valeria; Storm, Hanne

    2017-11-01

    There is a lack of objective methods for determining the achievement of sympathetic block. This study validates the skin conductance monitor (SCM) as an end point indicator of successful sympathetic blockade as compared with traditional monitors. This interventional study included 13 patients undergoing 25 lumbar sympathetic blocks to compare time to indication of successful blockade between the SCM indices and traditional measures, clinically visible hyperemia, clinically visible engorgement of veins, subjective skin temperature difference, unilateral thermometry monitoring, bilateral comparative thermometry monitoring, and change in waveform amplitude in pulse oximetry plethysmography, within a 30-minute observation period. Differences in the SCM indices were studied pre- and postblock to validate the SCM. SCM showed substantially greater odds of indicating achievement of sympathetic block in the next moment (i.e., hazard rate) compared with all traditional measures (clinically visible hyperemia, clinically visible engorgement of veins, subjective temperature difference, unilateral thermometry monitoring, bilateral comparative thermometry monitoring, and change in waveform amplitude in pulse oximetry plethysmography; P ≤ 0.011). SCM indicated successful block for all (100%) procedures, while the traditional measures failed to indicate successful blocks in 16-84% of procedures. The SCM indices were significantly higher in preblock compared with postblock measurements (P SCM is a more reliable and rapid response indicator of a successful sympathetic blockade when compared with traditional monitors. © 2017 American Academy of Pain Medicine. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

  14. Assessment of left ventricular ejection force and sympathetic skin response in normotensive and hypertensive subjects: A double-blind observational comparative case–control study

    Directory of Open Access Journals (Sweden)

    Tarun Saxena

    2016-09-01

    Conclusion: Stage 1 hypertension is a stage of increased sympathetic activity, leading to increased LVEF and hypertension (resetting of baroreceptors; stage 2 hypertension is a stage of normal sympathetic activity, increased LVEF, increased SV, and hypertension (possibly a stage of shift of renal equilibrium curve/renal output curve and blood pressure to a newer level.

  15. Patterns of Sympathetic Responses Induced by Different Stress Tasks

    Science.gov (United States)

    Fechir, M; Schlereth, T; Purat, T; Kritzmann, S; Geber, C; Eberle, T; Gamer, M; Birklein, F

    2008-01-01

    Stress tasks are used to induce sympathetic nervous system (SNS) arousal. However, the efficacy and the patterns of SNS activation have not been systematically compared between different tasks. Therefore, we analyzed SNS activation during the following stress tasks: Presentation of negative, positive, and – as a control – neutral affective pictures, Color-Word interference test (CWT), mental arithmetic under time limit, singing a song aloud, and giving a spontaneous talk. We examined 11 healthy subjects and recorded the following SNS parameters: Activation of emotional sweating by quantitative sudometry, skin vasoconstriction by laser-Doppler flowmetry, heart rate by ECG, blood pressure by determination of pulse wave transit time (PWTT), and electromyographic (EMG) activity of the trapezius muscle. Moreover, subjective stress ratings were acquired for each task using a visual analog scale. All tasks were felt significantly stressful when compared to viewing neutral pictures. However, SNS activation was not reliable: Affective pictures did not induce a significant SNS response; singing, giving a talk and mental arithmetic selectively increased heart rate and emotional sweating. Only the CWT globally activated the SNS. Regarding all tasks, induction of emotional sweating, increase of heart rate and blood pressure significantly correlated with subjective stress ratings, in contrast to EMG and skin vasoconstriction. Our results show that the activation of the SNS widely varies depending on the stress task. Different stress tasks differently activate the SNS, which is an important finding when considering sympathetic reactions - in clinical situations and in research. PMID:19018304

  16. Sympathetic mediated vasomotion and skin capillary permeability in diabetic patients with peripheral neuropathy

    NARCIS (Netherlands)

    Lefrandt, JD; Hoeven, JH; Roon, AM; Smit, AJ; Hoogenberg, K

    Aims/hypothesis. A loss of sympathetic function could lead to changes in capillary fluid filtration in diabetic patients. We investigated whether a decreased sympathetically mediated vasomotion in the skin in diabetic patients with peripheral neuropathy is associated with an abnormal capillary

  17. Autonomic markers of emotional processing: skin sympathetic nerve activity in humans during exposure to emotionally charged images.

    Science.gov (United States)

    Brown, Rachael; James, Cheree; Henderson, Luke A; Macefield, Vaughan G

    2012-01-01

    The sympathetic innervation of the skin primarily subserves thermoregulation, but the system has also been commandeered as a means of expressing emotion. While it is known that the level of skin sympathetic nerve activity (SSNA) is affected by anxiety, the majority of emotional studies have utilized the galvanic skin response as a means of inferring increases in SSNA. The purpose of the present study was to characterize the changes in SSNA when showing subjects neutral or emotionally charged images from the International Affective Picture System (IAPS). SSNA was recorded via tungsten microelectrodes inserted into cutaneous fascicles of the common peroneal nerve in ten subjects. Neutral images, positively charged images (erotica) or negatively charged images (mutilation) were presented in blocks of fifteen images of a specific type, each block lasting 2 min. Images of erotica or mutilation were presented in a quasi-random fashion, each block following a block of neutral images. Both images of erotica or images of mutilation caused significant increases in SSNA, but the increases in SSNA were greater for mutilation. The increases in SSNA were often coupled with sweat release and cutaneous vasoconstriction; however, these markers were not always consistent with the SSNA increases. We conclude that SSNA, comprising cutaneous vasoconstrictor and sudomotor activity, increases with both positively charged and negatively charged emotional images. Measurement of SSNA provides a more comprehensive assessment of sympathetic outflow to the skin than does the use of sweat release alone as a marker of emotional processing.

  18. Measurement of model coefficients of skin sympathetic vasoconstriction

    International Nuclear Information System (INIS)

    Severens, Natascha M W; Van Marken Lichtenbelt, Wouter D; Frijns, Arjan J H; Kingma, Boris R M; De Mol, Bas A J M; Van Steenhoven, Anton A

    2010-01-01

    Many researchers have already attempted to model vasoconstriction responses, commonly using the mathematical representation proposed by Stolwijk (1971 NASA Contractor Report CR-1855 (Washington, DC: NASA)). Model makers based the parameter values in this formulation either on estimations or by attributing the difference between their passive models and measurement data fully to thermoregulation. These methods are very sensitive to errors. This study aims to present a reliable method for determining physiological values in the vasoconstriction formulation. An experimental protocol was developed that enabled us to derive the local proportional amplification coefficients of the toe, leg and arm and the transient vasoconstrictor tone. Ten subjects participated in a cooling experiment. During the experiment, core temperature, skin temperature, skin perfusion, forearm blood flow and heart rate variability were measured. The contributions to the normalized amplification coefficient for vasoconstriction of the toe, leg and arm were 84%, 11% and 5%, respectively. Comparison with relative values in the literature showed that the estimated values of Stolwijk and the values mentioned by Tanabe et al (2002 Energy Build. 34 637–46) were comparable with our measured values, but the values of Gordon (1974 The response of a human temperature regulatory system model in the cold PhD Thesis University of California, Santa Barbara) and Fiala et al (2001 Int. J. Biometeorol. 45 143159) differed significantly. With the help of regression analysis a relation was formulated between the error signal of the standardized core temperature and the vasoconstrictor tone. This relation was formulated in a general applicable way, which means that it can be used for situations where vasoconstriction thresholds are shifted, like under anesthesia or during motion sickness

  19. Sympathetic neural responses to smoking are age dependent

    Czech Academy of Sciences Publication Activity Database

    Hering, D.; Somers, V. K.; Kára, T.; Kucharska, W.; Jurák, Pavel; Bieniaszewski, L.; Narkiewicz, K.

    2006-01-01

    Roč. 24, č. 4 (2006), s. 691-695 ISSN 0263-6352 R&D Projects: GA ČR(CZ) GA102/05/0402 Institutional research plan: CEZ:AV0Z20650511 Keywords : sympathetic neural response * blood pressure * heart rate * smoking Subject RIV: FS - Medical Facilities ; Equipment Impact factor: 4.021, year: 2006

  20. Sympathetic, sensory, and nonneuronal contributions to the cutaneous vasoconstrictor response to local cooling.

    Science.gov (United States)

    Johnson, John M; Yen, Tony C; Zhao, Kun; Kosiba, Wojciech A

    2005-04-01

    Previous work indicates that sympathetic nerves participate in the vascular responses to direct cooling of the skin in humans. We evaluated this hypothesis further in a four-part series by measuring changes in cutaneous vascular conductance (CVC) from forearm skin locally cooled from 34 to 29 degrees C for 30 min. In part 1, bretylium tosylate reversed the initial vasoconstriction (-14 +/- 6.6% control CVC, first 5 min) to one of vasodilation (+19.7 +/- 7.7%) but did not affect the response at 30 min (-30.6 +/- 9% control, -38.9 +/- 6.9% bretylium; both P 0.05 between treatments). In part 2, yohimbine and propranolol (YP) also reversed the initial vasoconstriction (-14.3 +/- 4.2% control) to vasodilation (+26.3 +/- 12.1% YP), without a significant effect on the 30-min response (-26.7 +/- 6.1% YP, -43.2 +/- 6.5% control; both P 0.05 between sites). In part 3, the NPY Y1 receptor antagonist BIBP 3226 had no significant effect on either phase of vasoconstriction (P > 0.05 between sites both times). In part 4, sensory nerve blockade by anesthetic cream (Emla) also reversed the initial vasoconstriction (-20.1 +/- 6.4% control) to one of vasodilation (+213.4 +/- 87.0% Emla), whereas the final levels did not differ significantly (-37.7 +/- 10.1% control, -37.2 +/- 8.7% Emla; both P 0.05 between treatments). These results indicate that local cooling causes cold-sensitive afferents to activate sympathetic nerves to release norepinephrine, leading to a local cutaneous vasoconstriction that masks a nonneurogenic vasodilation. Later, a vasoconstriction develops with or without functional sensory or sympathetic nerves.

  1. Skin conductance at baseline and postheel lance reflects sympathetic activation in neonatal opiate withdrawal.

    Science.gov (United States)

    Oji-Mmuo, Christiana N; Michael, Eric J; McLatchy, Jacqueline; Lewis, Mary M; Becker, Julie E; Doheny, Kim Kopenhaver

    2016-03-01

    Skin conductance (SC) provides an objective measure of autonomic system regulation through sympathetic-mediated filling of sweat glands. This study aimed to test the utility of SC to detect sympathetic activation in neonatal abstinence syndrome (NAS). Fourteen term (mean, SE: 38.8 ± 0.35 weeks gestational age) neonates with chronic prenatal opiate exposure were enrolled. SC (peaks/seconds and mean of peaks) was measured at baseline, during heel lance/squeeze (HLS) and recovery from HLS at 24-48 (mean 38) hours of life prior to treatment for NAS. Blinded coders with established reliability assessed neonates using the Modified Finnegan Neonatal Scoring System (MFNSS). Nonparametric tests were used to determine group differences, phase differences from baseline to HLS and HLS to recovery, and associations between MFNSS and SC measures. Neonates that would later require morphine treatment for NAS (n = 6) had higher baseline SC mean of peaks than those that did not require treatment (n = 8) (p < 0.05). Moreover, there were unique phase differences between groups and SC positively correlated with MFNSS (p < 0.05). SC provides early identification of NAS severity. However, a larger sample is needed to determine sensitivity and specificity of SC for early identification of NAS and treatment effectiveness. ©2015 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

  2. Responses of sympathetic nervous system to cold exposure in vibration syndrome subjects and age-matched healthy controls.

    Science.gov (United States)

    Nakamoto, M

    1990-01-01

    Plasma norepinephrine and epinephrine in vibration syndrome subjects and age-matched healthy controls were measured for the purpose of estimating the responsibility of the sympathetic nervous system to cold exposure. In preliminary experiment, it was confirmed that cold air exposure of the whole body was more suitable than one-hand immersion in cold water. In the main experiment, 195 subjects were examined. Sixty-five subjects had vibration syndrome with vibration-induced white finger (VWF + group) and 65 subjects had vibration syndrome without VWF (VWF- group) and 65 controls had no symptoms (control group). In the three groups, plasma norepinephrine levels increased during cold air exposure of whole body at 7 degrees +/- 1.5 degrees C. Blood pressure increased and skin temperature decreased during cold exposure. Percent increase of norepinephrine in the VWF+ group was the highest while that in VWF- group followed and that in the control group was the lowest. This whole-body response of the sympathetic nervous system to cold conditions reflected the VWF which are characteristic symptoms of vibration syndrome. Excluding the effects of shivering and a cold feeling under cold conditions, it was confirmed that the sympathetic nervous system in vibration syndrome is activated more than in the controls. These results suggest that vibration exposure to hand and arm affects the sympathetic nervous system.

  3. Sympathetic Responses to Central Hypovolemia: New Insights from Microneurographic Recordings

    Science.gov (United States)

    2012-04-26

    Surgical Research, Fort Sam Houston, TX, USA 2 Department of Health and Kinesiology , The University of Texas at San Antonio, San Antonio, TX, USA Edited...suggested that this phenomenon may represent sympathetic baroreflex deafferentation (Cooke et al., 2009), as the fused bursts observed during intense ...Convertino, V. A. (2009). Muscle sympathetic nerve activity during intense lower body negative pressure to presyn- cope in humans. J. Physiol. (Lond

  4. Sympathetic nervous system activity measured by skin conductance quantifies the challenge of walking adaptability tasks after stroke.

    Science.gov (United States)

    Clark, David J; Chatterjee, Sudeshna A; McGuirk, Theresa E; Porges, Eric C; Fox, Emily J; Balasubramanian, Chitralakshmi K

    2018-02-01

    Walking adaptability tasks are challenging for people with motor impairments. The construct of perceived challenge is typically measured by self-report assessments, which are susceptible to subjective measurement error. The development of an objective physiologically-based measure of challenge may help to improve the ability to assess this important aspect of mobility function. The objective of this study to investigate the use of sympathetic nervous system (SNS) activity measured by skin conductance to gauge the physiological stress response to challenging walking adaptability tasks in people post-stroke. Thirty adults with chronic post-stroke hemiparesis performed a battery of seventeen walking adaptability tasks. SNS activity was measured by skin conductance from the palmar surface of each hand. The primary outcome variable was the percent change in skin conductance level (ΔSCL) between the baseline resting and walking phases of each task. Task difficulty was measured by performance speed and by physical therapist scoring of performance. Walking function and balance confidence were measured by preferred walking speed and the Activities-specific Balance Confidence Scale, respectively. There was a statistically significant negative association between ΔSCL and task performance speed and between ΔSCL and clinical score, indicating that tasks with greater SNS activity had slower performance speed and poorer clinical scores. ΔSCL was significantly greater for low functioning participants versus high functioning participants, particularly during the most challenging walking adaptability tasks. This study supports the use of SNS activity measured by skin conductance as a valuable approach for objectively quantifying the perceived challenge of walking adaptability tasks in people post-stroke. Published by Elsevier B.V.

  5. Diabetic and sympathetic influences on the water permeability barrier function of human skin as measured using transepidermal water loss: A case-control study.

    Science.gov (United States)

    Han, Seung Hoon; Park, Ji Woong

    2017-11-01

    The presence of long-standing hyperglycemic conditions has been suggested to lead to many skin problems associated with an impaired skin barrier function. However, the relationship between impaired skin barrier status and altered peripheral nervous system function has not yet been determined. The purpose of this study was to investigate the water evaporation rate as a measure of the permeability barrier function of diabetic skin and its relationship to diabetic sensorimotor polyneuropathy (DSPN) and peripheral autonomic neuropathy (PAN) using well-controlled confounding variables.This case-control study included 42 participants with chronic diabetes and 43 matched healthy controls. The diabetic group underwent a nerve conduction study and sympathetic skin response (SSR) test to confirm the presence of DSPN and PAN, respectively. Different skin regions were analyzed using the noninvasive Tewameter instrument (Courage + Khazaka Electronic GmbH, Cologne, Germany). The impacts of PAN, DSPN, age, and diabetes duration on the values of transepidermal water loss (TEWL) were each analyzed and compared between the groups.Regardless of the presence of DSPN or PAN, the TEWL values as measured on the distal extremities were significantly lower in the diabetic group than in the control group. In the diabetic group, participants with abnormal SSR test results showed decreased TEWL values in the finger, sole, and first toe, as compared with participants with normal SSR test results. In the control group, age showed a negative correlation with the TEWL values with respect to some measured regions. However, in the diabetic group, there was no significant correlation between either patient age or diabetes duration and TEWL values.The presence of a long-term hyperglycemic state can reduce the permeability barrier function of the skin, a phenomenon that might be related to the presence of an impaired peripheral sympathetic nervous system, rather than peripheral sensorimotor

  6. Vascular origin of vildagliptin-induced skin effects in Cynomolgus monkeys: pathomechanistic role of peripheral sympathetic system and neuropeptide Y.

    Science.gov (United States)

    Hoffmann, Peter; Bentley, Phil; Sahota, Pritam; Schoenfeld, Heidi; Martin, Lori; Longo, Linda; Spaet, Robert; Moulin, Pierre; Pantano, Serafino; Dubost, Valerie; Lapadula, Dan; Burkey, Bryan; Kaushik, Virendar; Zhou, Wei; Hayes, Michael; Flavahan, Nick; Chibout, Salah-Dine; Busch, Steve

    2014-06-01

    The purpose of this article is to characterize skin lesions in cynomolgus monkeys following vildagliptin (dipeptidyl peptidase-4 inhibitor) treatment. Oral vildagliptin administration caused dose-dependent and reversible blister formation, peeling and flaking skin, erosions, ulcerations, scabs, and sores involving the extremities at ≥5 mg/kg/day and necrosis of the tail and the pinnae at ≥80 mg/kg/day after 3 weeks of treatment. At the affected sites, the media and the endothelium of dermal arterioles showed hypertrophy/hyperplasia. Skin lesion formation was prevented by elevating ambient temperature. Vildagliptin treatment also produced an increase in blood pressure and heart rate likely via increased sympathetic tone. Following treatment with vildagliptin at 80 mg/kg/day, the recovery time after lowering the temperature in the feet of monkeys and inducing cold stress was prolonged. Ex vivo investigations showed that small digital arteries from skin biopsies of vildagliptin-treated monkeys exhibited an increase in neuropeptide Y-induced vasoconstriction. This finding correlated with a specific increase in NPY and in NPY1 receptors observed in the skin of vildagliptin-treated monkeys. Present data provide evidence that skin effects in monkeys are of vascular origin and that the effects on the NPY system in combination with increased peripheral sympathetic tone play an important pathomechanistic role in the pathogenesis of cutaneous toxicity. © 2014 by The Author(s).

  7. SYMPATHETIC NEURAL AND HEMODYNAMIC RESPONSES DURING COLD PRESSOR TEST IN ELDERLY BLACKS AND WHITES

    Science.gov (United States)

    Okada, Yoshiyuki; Jarvis, Sara S.; Best, Stuart A.; Edwards, Jeffrey G.; Hendrix, Joseph M.; Adams-Huet, Beverley; Vongpatanasin, Wanpen; Levine, Benjamin D.; Fu, Qi

    2016-01-01

    The sympathetic response during the cold pressor test (CPT) has been reported to be greater in young blacks than whites, especially in those with a family history of hypertension. Since blood pressure (BP) increases with age, we evaluated whether elderly blacks have greater sympathetic activation during CPT than age-matched whites. BP, heart rate (HR), cardiac output (Qc), and muscle sympathetic nerve activity (MSNA) were measured during supine baseline, 2-min CPT, and 3-min recovery in 47 elderly [68±7 (SD) yrs] volunteers (12 blacks, 35 whites). Baseline BP, HR, Qc, or MSNA did not differ between races. Systolic and diastolic BP (DBP) and HR increased during CPT (all P0.05). Qc increased during CPT and up to 30 sec of recovery in both groups, but was lower in blacks than whites. MSNA increased during CPT in both groups (both P<0.001); the increase in burst frequency was similar between groups, while the increase in total activity was smaller in blacks (P=0.030 for interaction). Peak change (Δ) in DBP was correlated with Δ total activity at 1 min into CPT in both blacks (r=0.78, P=0.003) and whites (r=0.43, P=0.009), while the slope was significantly greater in blacks (P=0.007). Thus, elderly blacks have smaller sympathetic and central hemodynamic (e.g., Qc) responses, but a greater pressor response for a given sympathetic activation during CPT than elderly whites. This response may stem from augmented sympathetic vascular transduction, greater sympathetic activation to other vascular bed(s), and/or enhanced non-adrenergically mediated vasoconstriction in elderly blacks. PMID:27021009

  8. Neural correlates of fear-induced sympathetic response associated with the peripheral temperature change rate.

    Science.gov (United States)

    Yoshihara, Kazufumi; Tanabe, Hiroki C; Kawamichi, Hiroaki; Koike, Takahiko; Yamazaki, Mika; Sudo, Nobuyuki; Sadato, Norihiro

    2016-07-01

    Activation of the sympathetic nervous system is essential for coping with environmental stressors such as fearful stimuli. Recent human imaging studies demonstrated that activity in some cortical regions, such as the anterior cingulate cortex (ACC) and anterior insula cortex (aIC), is related to sympathetic activity. However, little is known about the functional brain connectivity related to sympathetic response to fearful stimuli. The participants were 32 healthy, right-handed volunteers. Functional magnetic resonance imaging (fMRI) was used to examine brain activity when watching horror and control movies. Fingertip temperature was taken during the scanning as a measure of sympathetic response. The movies were watched a second time, and the degree of fear (9-point Likert-type scale) was evaluated every three seconds. The brain activity of the ACC, bilateral aIC, and bilateral anterior prefrontal cortex (aPFC) was correlated with the change rate of fingertip temperature, with or without fearful stimuli. Functional connectivity analysis revealed significantly greater positive functional connectivity between the amygdala and the ACC and between the amygdala and the aIC when watching the horror movie than when watching the control movie. Whole-brain psycho-physiological interaction (PPI) analysis revealed that the functional connectivity between the left amygdala and the ACC was modulated according to the fear rating. Our results indicate that the increased functional connectivity between the left amygdala and the ACC represents a sympathetic response to fearful stimuli. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  9. Voluntary activation of the sympathetic nervous system and attenuation of the innate immune response in humans

    NARCIS (Netherlands)

    Kox, M.; Eijk, L.T.G.J. van; Zwaag, J.; Wildenberg, J. van den; Sweep, F.C.; Hoeven, J.G. van der; Pickkers, P.

    2014-01-01

    Excessive or persistent proinflammatory cytokine production plays a central role in autoimmune diseases. Acute activation of the sympathetic nervous system attenuates the innate immune response. However, both the autonomic nervous system and innate immune system are regarded as systems that cannot

  10. Sympathetic responses during saline infusion into the veins of an occluded limb.

    Science.gov (United States)

    Cui, Jian; McQuillan, Patrick; Moradkhan, Raman; Pagana, Charles; Sinoway, Lawrence I

    2009-07-15

    Animal studies have shown that the increased intravenous pressure stimulates the group III and IV muscle afferent fibres, and in turn induce cardiovascular responses. However, this pathway of autonomic regulation has not been examined in humans. The aim of this study was to examine the hypothesis that infusion of saline into the venous circulation of an arterially occluded vascular bed evokes sympathetic activation in healthy individuals. Blood pressure, heart rate, and muscle sympathetic nerve activity (MSNA) responses were assessed in 19 young healthy subjects during local infusion of 40 ml saline into a forearm vein in the circulatory arrested condition. From baseline (11.8 +/- 1.2 bursts min(-1)), MSNA increased significantly during the saline infusion (22.5 +/- 2.6 bursts min(-1), P Blood pressure also increased significantly during the saline infusion. Three control trials were performed during separate visits. The results from the control trial show that the observed MSNA and blood pressure responses were not due to muscle ischaemia. The present data show that saline infusion into the venous circulation of an arterially occluded vascular bed induces sympathetic activation and an increase in blood pressure. We speculate that the infusion under such conditions stimulates the afferent endings near the vessels, and evokes the sympathetic activation.

  11. Influence of ventilation and hypocapnia on sympathetic nerve responses to hypoxia in normal humans.

    Science.gov (United States)

    Somers, V K; Mark, A L; Zavala, D C; Abboud, F M

    1989-11-01

    The sympathetic response to hypoxia depends on the interaction between chemoreceptor stimulation (CRS) and the associated hyperventilation. We studied this interaction by measuring sympathetic nerve activity (SNA) to muscle in 13 normal subjects, while breathing room air, 14% O2, 10% O2, and 10% O2 with added CO2 to maintain isocapnia. Minute ventilation (VE) and blood pressure (BP) increased significantly more during isocapnic hypoxia (IHO) than hypocapnic hypoxia (HHO). In contrast, SNA increased more during HHO [40 +/- 10% (SE)] than during IHO (25 +/- 19%, P less than 0.05). To determine the reason for the lesser increase in SNA with IHO, 11 subjects underwent voluntary apnea during HHO and IHO. Apnea potentiated the SNA responses to IHO more than to HHO. SNA responses to IHO were 17 +/- 7% during breathing and 173 +/- 47% during apnea whereas SNA responses to HHO were 35 +/- 8% during breathing and 126 +/- 28% during apnea. During ventilation, the sympathoexcitation of IHO (compared with HHO) is suppressed, possibly for two reasons: 1) because of the inhibitory influence of activation of pulmonary afferents as a result of a greater increase in VE, and 2) because of the inhibitory influence of baroreceptor activation due to a greater rise in BP. Thus in humans, the ventilatory response to chemoreceptor stimulation predominates and restrains the sympathetic response. The SNA response to chemoreceptor stimulation represents the net effect of the excitatory influence of the chemoreflex and the inhibitory influence of pulmonary afferents and baroreceptor afferents.

  12. Comparison of sympathetic nerve responses to neck and forearm isometric exercise

    Science.gov (United States)

    Steele, S. L. Jr; Ray, C. A.

    2000-01-01

    PURPOSE: Although the autonomic and cardiovascular responses to arm and leg exercise have been studied, the sympathetic adjustments to exercise of the neck have not. The purpose of the present study was twofold: 1) to determine sympathetic and cardiovascular responses to isometric contractions of the neck extensors and 2) to compare sympathetic and cardiovascular responses to isometric exercise of the neck and forearm. METHODS: Muscle sympathetic nerve activity (MSNA), mean arterial pressure (MAP), and heart rate were measured in nine healthy subjects while performing isometric neck extension (INE) and isometric handgrip (IHG) in the prone position. After a 3-min baseline period, subjects performed three intensities of INE for 2.5 min each: 1) unloaded (supporting head alone), 2) 10% maximal voluntary contraction (MVC), and 3) 30% MVC, then subjects performed two intensities (10% and 30% MVC) of IHG for 2.5 min. RESULTS: Supporting the head by itself did not significantly change any of the variables. During [NE, MAP significantly increased by 10 +/- 2 and 31 +/- 4 mm Hg and MSNA increased by 67 +/- 46 and 168 +/- 36 units/30 s for 10% and 30% MVC, respectively. IHG and INE evoked similar responses at 10% MVC, but IHG elicited higher peak MAP and MSNA at 30% MVC (37 +/- 7 mm Hg (P INE can elicit marked increases in MSNA and cardiovascular responses but that it evokes lower peak responses as compared to IHG. We speculate that possible differences in muscle fiber type composition, muscle mass, and/or muscle architecture of the neck and forearm are responsible for these differences in peak responses.

  13. Enhanced sympathetic arousal in response to FMRI scanning correlates with task induced activations and deactivations.

    Directory of Open Access Journals (Sweden)

    Markus Muehlhan

    Full Text Available It has been repeatedly shown that functional magnetic resonance imaging (fMRI triggers distress and neuroendocrine response systems. Prior studies have revealed that sympathetic arousal increases, particularly at the beginning of the examination. Against this background it appears likely that those stress reactions during the scanning procedure may influence task performance and neural correlates. However, the question how sympathetic arousal elicited by the scanning procedure itself may act as a potential confounder of fMRI data remains unresolved today. Thirty-seven scanner naive healthy subjects performed a simple cued target detection task. Levels of salivary alpha amylase (sAA, as a biomarker for sympathetic activity, were assessed in samples obtained at several time points during the lab visit. SAA increased two times, immediately prior to scanning and at the end of the scanning procedure. Neural activation related to motor preparation and timing as well as task performance was positively correlated with the first increase. Furthermore, the first sAA increase was associated with task induced deactivation (TID in frontal and parietal regions. However, these effects were restricted to the first part of the experiment. Consequently, this bias of scanner related sympathetic activation should be considered in future fMRI investigations. It is of particular importance for pharmacological investigations studying adrenergic agents and the comparison of groups with different stress vulnerabilities like patients and controls or adolescents and adults.

  14. Maternal overreactive sympathetic nervous system responses to repeated infant crying predicts risk for impulsive harsh discipline of infants.

    Science.gov (United States)

    Joosen, Katharina J; Mesman, Judi; Bakermans-Kranenburg, Marian J; van Ijzendoorn, Marinus H

    2013-11-01

    Physiological reactivity to repeated infant crying was examined as a predictor of risk for harsh discipline use with 12-month-olds in a longitudinal study with 48 low-income mother-infant dyads. Physiological reactivity was measured while mothers listened to three blocks of infant cry sounds in a standard cry paradigm when their infants were 3 months old. Signs of harsh discipline use were observed during two tasks during a home visit when the infants were 12 months old. Mothers showing signs of harsh discipline (n = 10) with their 12-month-olds were compared to mothers who did not (n = 38) on their sympathetic (skin conductance levels [SCL]) and parasympathetic (respiratory sinus arrhythmia) reactivity to the cry sounds. Results showed a significant interaction effect for sympathetic reactivity only. Mean SCL of harsh-risk mothers showed a significant different response pattern from baseline to crying and onward into the recovery, suggesting that mean SCL of mothers who showed signs of harsh discipline continued to rise across the repeated bouts of cry sounds while, after an initial increase, mean SCL level of the other mothers showed a steady decline. We suggest that harsh parenting is reflected in physiological overreactivity to negative infant signals and discuss our findings from a polyvagal perspective.

  15. Dissociation between neural and vascular responses to sympathetic stimulation : contribution of local adrenergic receptor function

    Science.gov (United States)

    Jacob, G.; Costa, F.; Shannon, J.; Robertson, D.; Biaggioni, I.

    2000-01-01

    Sympathetic activation produced by various stimuli, eg, mental stress or handgrip, evokes regional vascular responses that are often nonhomogeneous. This phenomenon is believed to be the consequence of the recruitment of differential central neural pathways or of a sympathetically mediated vasodilation. The purpose of this study was to determine whether a similar heterogeneous response occurs with cold pressor stimulation and to test the hypothesis that local differences in adrenergic receptor function could be in part responsible for this diversity. In 8 healthy subjects, local norepinephrine spillover and blood flow were measured in arms and legs at baseline and during sympathetic stimulation induced by baroreflex mechanisms (nitroprusside infusion) or cold pressor stimulation. At baseline, legs had higher vascular resistance (27+/-5 versus 17+/-2 U, P=0.05) despite lower norepinephrine spillover (0.28+/-0.04 versus 0.4+/-0.05 mg. min(-1). dL(-1), P=0.03). Norepinephrine spillover increased similarly in both arms and legs during nitroprusside infusion and cold pressor stimulation. On the other hand, during cold stimulation, vascular resistance increased in arms but not in legs (20+/-9% versus -7+/-4%, P=0.03). Increasing doses of isoproterenol and phenylephrine were infused intra-arterially in arms and legs to estimate beta-mediated vasodilation and alpha-induced vasoconstriction, respectively. beta-Mediated vasodilation was significantly lower in legs compared with arms. Thus, we report a dissociation between norepinephrine spillover and vascular responses to cold stress in lower limbs characterized by a paradoxical decrease in local resistance despite increases in sympathetic activity. The differences observed in adrenergic receptor responses cannot explain this phenomenon.

  16. Chewing-induced hypertension in afferent baroreflex failure: a sympathetic response?

    Science.gov (United States)

    Fuente Mora, Cristina; Norcliffe-Kaufmann, Lucy; Palma, Jose-Alberto; Kaufmann, Horacio

    2015-11-01

    What is the central question of this study? Our goal was to understand the autonomic responses to eating in patients with congenital afferent baroreflex failure, by documenting changes in blood pressure and heart rate with chewing, swallowing and stomach distension. What is the main finding and its importance? Patients born with lesions in the afferent baroreceptor pathways have an exaggerated pressor response to food intake. This appears to be a sympathetically mediated response, triggered by chewing, that occurs independently of swallowing or distension of the stomach. The chewing-induced pressor response may be useful as a counter-manoeuvre to prevent orthostatic hypotension in these patients. Familial dysautonomia (FD) is a rare genetic disease with extremely labile blood pressure resulting from baroreflex deafferentation. Patients have marked surges in sympathetic activity, frequently surrounding meals. We conducted an observational study to document the autonomic responses to eating in patients with FD and to determine whether sympathetic activation was caused by chewing, swallowing or stomach distension. Blood pressure and R-R intervals were measured continuously while chewing gum (n = 15), eating (n = 20) and distending the stomach by percutaneous endoscopic gastrostomy tube feeding (n = 9). Responses were compared with those of normal control subjects (n = 10) and of patients with efferent autonomic failure (n = 10) who have chronically impaired sympathetic outflow. In patients with FD, eating was associated with a marked but transient pressor response (P Chewing gum evoked a similar increase in blood pressure that was higher in patients with FD than in control subjects (P = 0.0001), but was absent in patients with autonomic failure. In patients with FD, distending the stomach by percutaneous endoscopic gastrostomy tube feeding failed to elicit a pressor response. The results provide indirect evidence that chewing triggers sympathetic

  17. Bed rest attenuates sympathetic and pressor responses to isometric exercise in antigravity leg muscles in humans.

    Science.gov (United States)

    Kamiya, Atsunori; Michikami, Daisaku; Shiozawa, Tomoki; Iwase, Satoshi; Hayano, Junichiro; Kawada, Toru; Sunagawa, Kenji; Mano, Tadaaki

    2004-05-01

    Although spaceflight and bed rest are known to cause muscular atrophy in the antigravity muscles of the legs, the changes in sympathetic and cardiovascular responses to exercises using the atrophied muscles remain unknown. We hypothesized that bed rest would augment sympathetic responses to isometric exercise using antigravity leg muscles in humans. Ten healthy male volunteers were subjected to 14-day 6 degrees head-down bed rest. Before and after bed rest, they performed isometric exercises using leg (plantar flexion) and forearm (handgrip) muscles, followed by 2-min postexercise muscle ischemia (PEMI) that continues to stimulate the muscle metaboreflex. These exercises were sustained to fatigue. We measured muscle sympathetic nerve activity (MSNA) in the contralateral resting leg by microneurography. In both pre- and post-bed-rest exercise tests, exercise intensities were set at 30 and 70% of the maximum voluntary force measured before bed rest. Bed rest attenuated the increase in MSNA in response to fatiguing plantar flexion by approximately 70% at both exercise intensities (both P antigravity leg muscles.

  18. Psychological Stress and the Cutaneous Immune Response: Roles of the HPA Axis and the Sympathetic Nervous System in Atopic Dermatitis and Psoriasis

    Directory of Open Access Journals (Sweden)

    Jessica M. F. Hall

    2012-01-01

    Full Text Available Psychological stress, an evolutionary adaptation to the fight-or-flight response, triggers a number of physiological responses that can be deleterious under some circumstances. Stress signals activate the hypothalamus-pituitary-adrenal (HPA axis and the sympathetic nervous system. Elements derived from those systems (e.g., cortisol, catecholamines and neuropeptides can impact the immune system and possible disease states. Skin provides a first line of defense against many environmental insults. A number of investigations have indicated that the skin is especially sensitive to psychological stress, and experimental evidence shows that the cutaneous innate and adaptive immune systems are affected by stressors. For example, psychological stress has been shown to reduce recovery time of the stratum corneum barrier after its removal (innate immunity and alters antigen presentation by epidermal Langerhans cells (adaptive immunity. Moreover, psychological stress may trigger or exacerbate immune mediated dermatological disorders. Understanding how the activity of the psyche-nervous -immune system axis impinges on skin diseases may facilitate coordinated treatment strategies between dermatologists and psychiatrists. Herein, we will review the roles of the HPA axis and the sympathetic nervous system on the cutaneous immune response. We will selectively highlight how the interplay between psychological stress and the immune system affects atopic dermatitis and psoriasis.

  19. Comparison of thermogenic sympathetic response to food intake between obese and non-obese young women.

    Science.gov (United States)

    Matsumoto, T; Miyawaki, C; Ue, H; Kanda, T; Yoshitake, Y; Moritani, T

    2001-02-01

    Sympathetic nervous system abnormality in humans is still a matter of debate. The present study was designed to examine diet-induced autonomic nervous system activity and metabolic change in obese and non-obese young women. Sixteen age- and height-matched obese and non-obese young women participated in this study. Sympathovagal activities were assessed by means of our newly developed spectral analysis procedure of heart-rate variability during the resting condition and after mixed-food ingestion (480 kcal). Energy expenditure was also measured under these two conditions. There was no significant difference in any of the parameters of the heart-rate variability between the obese group and control group during the resting condition. In the control group, both absolute values (221.5 +/- 54.5 vs. 363.8 +/- 43.7 ms2, p frequency component and global sympathetic nervous system index (1.46 +/- 0.19 vs. 3.26 +/- 0.61, p food ingestion compared with the values obtained after resting condition. However, no such sympathetic response was found in the obese group. Energy expenditure increased in the two groups after the meal, but the magnitude of the increase above the preprandial resting condition was significantly greater in the control group than in the obese group (11.2 +/- 2.3 vs. 6.7 +/- 0.8%, p food intake, which might be related to lowered capacity of thermogenesis and the state of obesity.

  20. Muscle afferent receptors engaged in augmented sympathetic responsiveness in peripheral artery disease

    Directory of Open Access Journals (Sweden)

    Jianhua eLi

    2012-07-01

    Full Text Available The exercise pressor reflex (EPR is a neural control mechanism responsible for the cardiovascular responses to exercise. As exercise is initiated, thin fiber muscle afferent nerves are activated by mechanical and metabolic stimuli arising in the contracting muscles. This leads to reflex increases in arterial blood pressure and heart rate primarily through activation of sympathetic nerve activity (SNA. Studies of humans and animals have indicated that the EPR is exaggerated in a number of cardiovascular diseases. For the last several years, studies have specifically employed a rodent model to examine the mechanisms at receptor and cellular levels by which responses of SNA and blood pressure to static exercise are heightened in peripheral artery disease (PAD, one of the most common cardiovascular disorders. A rat model of this disease has well been established. Specifically, femoral artery occlusion is used to study intermittent claudication that is observed in human PAD. The receptors on thin fiber muscle afferents that are engaged in this disease include transient receptor potential vanilloid type 1 (TRPV1, purinergic P2X and acid sensing ion channel (ASIC. The role played by nerve growth factor (NGF in regulating those sensory receptors in the processing of amplified EPR was also investigated. The purpose of this review is to focus on a theme namely that PAD accentuates autonomic reflex responses to exercise and further address regulatory mechanisms leading to abnormal sympathetic responsiveness. This review will present some of recent results in regard with several receptors in muscle sensory neurons in contribution to augmented autonomic reflex responses in PAD. Review of the findings from recent studies would lead to a better understanding in integrated processing of sympathetic nervous system in PAD.

  1. Vasovagal oscillations and vasovagal responses produced by the Vestibulo-Sympathetic Reflex in the rat

    Directory of Open Access Journals (Sweden)

    Sergei B. Yakushin

    2014-04-01

    Full Text Available Sinusoidal galvanic vestibular stimulation (sGVS induces oscillations in blood pressure (BP and heart rate (HR i.e., vasovagal oscillations, and decreases in BP and HR i.e., vasovagal responses, in isoflurane-anesthetized rats. We determined the characteristics of the vasovagal oscillations, assessed their role in the generation of vasovagal responses and determined whether they could be induced by monaural as well as by binaural sGVS and by oscillation in pitch. Wavelet analyses were used to determine the power distributions of the waveforms. Monaural and binaural sGVS and pitch generated vasovagal oscillations at the frequency and at twice the frequency of stimulation. Vasovagal oscillations and vasovagal responses were maximally induced at low stimulus frequencies (0.025-0.05 Hz. The oscillations were attenuated and the responses were rarely induced at higher stimulus frequencies. Vasovagal oscillations could occur without induction of vasovagal responses, but vasovagal responses were always associated with a vasovagal oscillation. We posit that the vasovagal oscillations originate in a low frequency band that, when appropriately activated by strong sympathetic stimulation, can generate vasovagal oscillations as a precursor for vasovagal responses and syncope. We further suggest that the activity responsible for the vasovagal oscillations arises in low frequency, otolith neurons with orientation vectors close to the vertical axis of the head. These neurons are likely to provide critical input to the Vestibulo-Sympathetic Reflex to increase BP and HR upon changes in head position relative to gravity, and to contribute to the production of vasovagal oscillations and vasovagal responses and syncope when the baroreflex is inactivated.

  2. Voluntary activation of the sympathetic nervous system and attenuation of the innate immune response in humans.

    Science.gov (United States)

    Kox, Matthijs; van Eijk, Lucas T; Zwaag, Jelle; van den Wildenberg, Joanne; Sweep, Fred C G J; van der Hoeven, Johannes G; Pickkers, Peter

    2014-05-20

    Excessive or persistent proinflammatory cytokine production plays a central role in autoimmune diseases. Acute activation of the sympathetic nervous system attenuates the innate immune response. However, both the autonomic nervous system and innate immune system are regarded as systems that cannot be voluntarily influenced. Herein, we evaluated the effects of a training program on the autonomic nervous system and innate immune response. Healthy volunteers were randomized to either the intervention (n = 12) or control group (n = 12). Subjects in the intervention group were trained for 10 d in meditation (third eye meditation), breathing techniques (i.a., cyclic hyperventilation followed by breath retention), and exposure to cold (i.a., immersions in ice cold water). The control group was not trained. Subsequently, all subjects underwent experimental endotoxemia (i.v. administration of 2 ng/kg Escherichia coli endotoxin). In the intervention group, practicing the learned techniques resulted in intermittent respiratory alkalosis and hypoxia resulting in profoundly increased plasma epinephrine levels. In the intervention group, plasma levels of the anti-inflammatory cytokine IL-10 increased more rapidly after endotoxin administration, correlated strongly with preceding epinephrine levels, and were higher. Levels of proinflammatory mediators TNF-α, IL-6, and IL-8 were lower in the intervention group and correlated negatively with IL-10 levels. Finally, flu-like symptoms were lower in the intervention group. In conclusion, we demonstrate that voluntary activation of the sympathetic nervous system results in epinephrine release and subsequent suppression of the innate immune response in humans in vivo. These results could have important implications for the treatment of conditions associated with excessive or persistent inflammation, such as autoimmune diseases.

  3. Sympathetic Vasoconstrictor Responsiveness of the Leg Vasculature During Experimental Endotoxemia and Hypoxia in Humans

    DEFF Research Database (Denmark)

    Brassard, Patrice; Zaar, Morten; Thaning, Pia

    2016-01-01

    . DESIGN: Prospective descriptive study. SETTING: Hospital research laboratory. SUBJECTS: Ten healthy young men (age [mean ± SD], 31 ± 8 yr; body weight, 83 ± 10 kg) participated in the study. INTERVENTIONS: Leg blood flow and mean arterial pressure were determined, whereas leg vascular conductance...... was calculated during 1) adenosine infusion (vasodilator control), 2) hypoxia (FIO2 = 10%), 3) endotoxemia, and 4) endotoxemia + hypoxia. Leg sympathetic vasoconstrictor responsiveness (reduction in leg vascular conductance) was evaluated by femoral artery tyramine infusion. MEASUREMENTS AND MAIN RESULTS......: Endotoxemia increased body temperature from 36.9 ± 0.4°C to 38.6 ± 0.5°C (p necrosis factor-α from 6 pg/mL (3-8 pg/mL) to 391 pg/mL (128-2258 pg/mL) (p

  4. Serotonin and Serotonin Transporters in the Adrenal Medulla: A Potential Hub for Modulation of the Sympathetic Stress Response.

    Science.gov (United States)

    Brindley, Rebecca L; Bauer, Mary Beth; Blakely, Randy D; Currie, Kevin P M

    2017-05-17

    Serotonin (5-HT) is an important neurotransmitter in the central nervous system where it modulates circuits involved in mood, cognition, movement, arousal, and autonomic function. The 5-HT transporter (SERT; SLC6A4) is a key regulator of 5-HT signaling, and genetic variations in SERT are associated with various disorders including depression, anxiety, and autism. This review focuses on the role of SERT in the sympathetic nervous system. Autonomic/sympathetic dysfunction is evident in patients with depression, anxiety, and other diseases linked to serotonergic signaling. Experimentally, loss of SERT function (SERT knockout mice or chronic pharmacological block) has been reported to augment the sympathetic stress response. Alterations to serotonergic signaling in the CNS and thus central drive to the peripheral sympathetic nervous system are presumed to underlie this augmentation. Although less widely recognized, SERT is robustly expressed in chromaffin cells of the adrenal medulla, the neuroendocrine arm of the sympathetic nervous system. Adrenal chromaffin cells do not synthesize 5-HT but accumulate small amounts by SERT-mediated uptake. Recent evidence demonstrated that 5-HT 1A receptors inhibit catecholamine secretion from adrenal chromaffin cells via an atypical mechanism that does not involve modulation of cellular excitability or voltage-gated Ca 2+ channels. This raises the possibility that the adrenal medulla is a previously unrecognized peripheral hub for serotonergic control of the sympathetic stress response. As a framework for future investigation, a model is proposed in which stress-evoked adrenal catecholamine secretion is fine-tuned by SERT-modulated autocrine 5-HT signaling.

  5. Regulators of human white adipose browning: evidence for sympathetic control and sexual dimorphic responses to sprint interval training.

    Directory of Open Access Journals (Sweden)

    Rebecca L Scalzo

    Full Text Available The conversion of white adipose to the highly thermogenic beige adipose tissue has been proposed as a potential strategy to counter the unfavorable consequences of obesity. Three regulators of this conversion have recently emerged but information regarding their control is limited, and contradictory. We present two studies examining the control of these regulators. Study 1: In 10 young men, the plasma concentrations of irisin and fibroblast growth factor 21 (FGF21 were determined prior to and during activation of the sympathetic nervous system via hypoxic gas breathing (FIO2 = 0.11. The measurements were performed twice, once with and once without prior/concurrent sympathetic inhibition via transdermal clonidine administration. FGF21 was unaffected by basal sympathetic inhibition (338±113 vs. 295±80 pg/mL; P = 0.43; mean±SE, but was increased during hypoxia mediated sympathetic activation (368±135; this response was abrogated (P = 0.035 with clonidine (269±93. Irisin was unaffected by sympathetic inhibition and/or hypoxia (P>0.21. Study 2: The plasma concentration of irisin and FGF21, and the skeletal muscle protein content of fibronectin type III domain containing 5 (FNDC5 was determined in 19 young adults prior to and following three weeks of sprint interval training (SIT. SIT decreased FGF21 (338±78 vs. 251±36; P = 0.046 but did not affect FNDC5 (P = 0.79. Irisin was decreased in males (127±18 vs. 90±23 ng/mL; P = 0.045 and increased in females (139±14 vs. 170±18. Collectively, these data suggest a potential regulatory role of acute sympathetic activation pertaining to the browning of white adipose; further, there appears to be a sexual dimorphic response of irisin to SIT.

  6. Chewing reduces sympathetic nervous response to stress and prevents poststress arrhythmias in rats.

    Science.gov (United States)

    Koizumi, So; Minamisawa, Susumu; Sasaguri, Kenichi; Onozuka, Minoru; Sato, Sadao; Ono, Yumie

    2011-10-01

    Reducing stress is important in preventing sudden death in patients with cardiovascular disease, as stressful events may cause autonomic imbalance and trigger fatal arrhythmias. Since chewing has been shown to inhibit stress-induced neuronal responses in the hypothalamus, we hypothesized that chewing could ameliorate stress-induced autonomic imbalance and prevent arrhythmias. To test this hypothesis, we analyzed changes in radiotelemetered electrocardiograms in rats that were allowed to chew a wooden stick during a 1-h period of immobilization stress. Chewing significantly reduced the occurrence of ventricular premature beats (VPBs) and complex ventricular ectopy after immobilization and prevented stress-induced prolongation of the QT interval of VPBs throughout the 10-h experimental period. It also prevented prolongation of the QRS complex and fluctuations in the QT interval in normal sinus rhythm beats preceding VPBs during both immobilization and in the poststress period. Fast Fourier transform-based spectral analysis of heart-rate variability further showed that chewing significantly inhibited the stress-induced increase in the power ratio of low-to-high frequency activity (LF/HF: a marker of sympathetic activity) during immobilization and in addition was associated with blunting of the stress-induced increase in plasma noradrenaline observed at the termination of immobilization. Similar suppressive effects on the occurrence of VPBs and the LF/HF were observed in rats that were administered the β-adrenergic blocker propranolol before immobilization. These results indicate that chewing can ameliorate sympathetic hyperactivity during stress and prevent poststress arrhythmias and suggest that chewing may provide a nonpharmacological and cost-effective treatment option for patients with a high risk of stress-induced fatal arrhythmia.

  7. Effect of sympathetic nerve block on acute inflammatory pain and hyperalgesia

    DEFF Research Database (Denmark)

    Pedersen, J L; Rung, G W; Kehlet, H

    1997-01-01

    BACKGROUND: Sympathetic nerve blocks relieve pain in certain chronic pain states, but the role of the sympathetic pathways in acute pain is unclear. Thus the authors wanted to determine whether a sympathetic block could reduce acute pain and hyperalgesia after a heat injury in healthy volunteers....... The duration and quality of blocks were evaluated by the sympatogalvanic skin response and skin temperature. Bilateral heat injuries were produced on the medial surfaces of the calves with a 50 x 25 mm thermode (47 degrees C, 7 min) 45 min after the blocks. Pain intensity induced by heat, pain thresholds...... between sympathetic block and placebo for pain or mechanical allodynia during injury, or pain thresholds, pain responses to heat, or areas of secondary hyperalgesia after the injury. The comparisons were done for the period when the block was effective. CONCLUSION: Sympathetic nerve block did not change...

  8. Ghrelin potentiates cardiac reactivity to stress by modulating sympathetic control and beta-adrenergic response.

    Science.gov (United States)

    Camargo-Silva, Gabriel; Turones, Larissa Córdova; da Cruz, Kellen Rosa; Gomes, Karina Pereira; Mendonça, Michelle Mendanha; Nunes, Allancer; de Jesus, Itamar Guedes; Colugnati, Diego Basile; Pansani, Aline Priscila; Pobbe, Roger Luis Henschel; Santos, Robson; Fontes, Marco Antônio Peliky; Guatimosim, Silvia; de Castro, Carlos Henrique; Ianzer, Danielle; Ferreira, Reginaldo Nassar; Xavier, Carlos Henrique

    2018-03-01

    Prior evidence indicates that ghrelin is involved in the integration of cardiovascular functions and behavioral responses. Ghrelin actions are mediated by the growth hormone secretagogue receptor subtype 1a (GHS-R1a), which is expressed in peripheral tissues and central areas involved in the control of cardiovascular responses to stress. In the present study, we assessed the role of ghrelin - GHS-R1a axis in the cardiovascular reactivity to acute emotional stress in rats. Ghrelin potentiated the tachycardia evoked by restraint and air jet stresses, which was reverted by GHS-R1a blockade. Evaluation of the autonomic balance revealed that the sympathetic branch modulates the ghrelin-evoked positive chronotropy. In isolated hearts, the perfusion with ghrelin potentiated the contractile responses caused by stimulation of the beta-adrenergic receptor, without altering the amplitude of the responses evoked by acetylcholine. Experiments in isolated cardiomyocytes revealed that ghrelin amplified the increases in calcium transient changes evoked by isoproterenol. Taken together, our results indicate that the Ghrelin-GHS-R1a axis potentiates the magnitude of stress-evoked tachycardia by modulating the autonomic nervous system and peripheral mechanisms, strongly relying on the activation of cardiac calcium transient and beta-adrenergic receptors. Copyright © 2018 Elsevier Inc. All rights reserved.

  9. Deferoxamine improves coronary vascular responses to sympathetic stimulation in patients with type 1 diabetes mellitus

    Energy Technology Data Exchange (ETDEWEB)

    Hattori, Naoya; Bengel, Frank M.; Nekolla, Stephan G.; Drzezga, Alexander E.; Schwaiger, Markus [Nuklearmedizinische Klinik und Poliklinik, Klinikum Rechts der Isar, Technischen Universitaet Muenchen (Germany); Schnell, Oliver; Rihl, Julian; Standl, Eberhard [Diabetes Research Center, Schwabing City Hospital, Munich (Germany)

    2002-07-01

    Effects of oxygen-derived free radicals are suggested to be a potential pathogenic factor for endothelial dysfunction. In this study we sought to evaluate the effect of hydroxyl radicals on the human coronary vascular bed in type I diabetes mellitus using positron emission tomography (PET). Thirteen patients with type 1 diabetes underwent PET using nitrogen-13 ammonia at rest and during sympathetic stimulation with the cold pressor test (CPT). The rest-stress study protocol was repeated twice (on different days) using pre-stress infusion of either saline as placebo or deferoxamine, an iron chelator which inhibits generation of hydroxyl radicals. At rest, global MBF was higher in diabetics than in normal controls (78.1{+-}17.5 vs 63.2{+-}14.9 mg 100 g{sup -1} min{sup -1}, P<0.05) and myocardial vascular resistance (MVR) showed a trend towards lower values (patients, 1.28{+-}0.35; controls, 1.55{+-}0.32, P=NS). CPT increased MBF in all controls while 7/13 diabetics responded normally. CPT decreased MVR in 10/13 controls but in only 4/13 diabetics. There was no significant difference in the duration of diabetes, HbA1c, daily insulin dose, body mass index, or lipid profiles between patients with and patients without abnormal MBF or MVR responses. Pre-stress infusion of deferoxamine normalized MBF response in all six patients, and MVR response in six of the nine patients. Another group consisting of seven patients underwent a rest-rest protocol after infusion of deferoxamine and saline to investigate the effect of deferoxamine on resting MBF. Deferoxamine did not change the resting MBF (deferoxamine, 81{+-}17 ml 100 g{sup -1} min{sup -1}; saline, 75{+-}19 ml 100 g{sup -1} min{sup -1}, P=NS) or MVR (deferoxamine, 1.0{+-}0.5 mmHg ml{sup -1} 100 g{sup -1} min{sup -1}; saline, 1.2{+-}0.6 mmHg ml{sup -1} 100 g{sup -1} min{sup -1}, P=NS). In conclusion, inhibition of hydroxyl radical formation using deferoxamine significantly improved the responses of coronary

  10. Rate of rise in diastolic blood pressure influences vascular sympathetic response to mental stress.

    Science.gov (United States)

    El Sayed, Khadigeh; Macefield, Vaughan G; Hissen, Sarah L; Joyner, Michael J; Taylor, Chloe E

    2016-12-15

    Research indicates that individuals may experience a rise (positive responders) or fall (negative responders) in muscle sympathetic nerve activity (MSNA) during mental stress. In this study, we examined the early blood pressure responses (including the peak, time of peak and rate of rise in blood pressure) to mental stress in positive and negative responders. Negative MSNA responders to mental stress exhibit a more rapid rise in diastolic pressure at the onset of the stressor, suggesting a baroreflex-mediated suppression of MSNA. In positive responders there is a more sluggish rise in blood pressure during mental stress, which appears to be MSNA-driven. This study suggests that whether MSNA has a role in the pressor response is dependent upon the reactivity of blood pressure early in the task. Research indicates that individuals may experience a rise (positive responders) or fall (negative responders) in muscle sympathetic nerve activity (MSNA) during mental stress. The aim was to examine the early blood pressure response to stress in positive and negative responders and thus its influence on the direction of change in MSNA. Blood pressure and MSNA were recorded continuously in 21 healthy young males during 2 min mental stressors (mental arithmetic, Stroop test) and physical stressors (cold pressor, handgrip exercise, post-exercise ischaemia). Participants were classified as negative or positive responders according to the direction of the mean change in MSNA during the stressor tasks. The peak changes, time of peak and rate of changes in blood pressure were compared between groups. During mental arithmetic negative responders experienced a significantly greater rate of rise in diastolic blood pressure in the first minute of the task (1.3 ± 0.5 mmHg s -1 ) compared with positive responders (0.4 ± 0.1 mmHg s -1 ; P = 0.03). Similar results were found for the Stroop test. Physical tasks elicited robust parallel increases in blood pressure and MSNA across

  11. [Relationship between sympathetic activity and response to treatment with atenolol in hypertensive patients. Investigation group of the study of efficiency and tolerance of atenolol in hypertensive patients with increase in the sympathetic activity].

    Science.gov (United States)

    de la Sierra, A

    1999-06-19

    Therapeutical response to antihypertensive treatment is poorly predicted by individual clinical or biochemical characteristics. Some preliminary data indicate that therapeutical response to atenolol might depend on physical and/or sympathetic activity. The aim of the present study was to evaluate the blood pressure response to atenolol depending on physical and sympathetic activity. One thousand one hundred forty hypertensive patients were treated with the beta adrenorecepetor blocker atenolol in an open fashion during 3 months. Before the beginning of the treatment, we evaluated current weekly physical activity (direct interview), as well as sympathetic activity (direct interview and baseline heart rate). Age or physical activity did not correlate with blood pressure response to atenolol. Conversely, hypertensive patients with symptoms suggesting sympathetic overactivity (three or more of the following symptoms: palpitations, anxiety, diaphoresis, headache, tremor or weakness; n = 456), showed a more pronounced decrease in systolic (27.7 [13.4] vs 25.8 [14.3] mmHg; p = 0.0226) and diastolic (17.6 [8.3] vs 15.5 [8.6] mmHg; p = 0.0001) blood pressures (SBP and DBP), with respect to the remaining hypertensive patients (n = 719). Moreover, we found a statistically significant correlation between blood pressure fall with atenolol and baseline heart rate (r = 0.107, P anxiety, emotional tension or sympathetic overactivity are associated with a more pronounced blood pressure fall to antihypertensive treatment with atenolol. These circumstances may play a role when choosing a new antihypertensive therapy.

  12. Racemic ketamine decreases muscle sympathetic activity but maintains the neural response to hypotensive challenges in humans

    NARCIS (Netherlands)

    Kienbaum, P.; Heuter, T.; Michel, M. C.; Peters, J.

    2000-01-01

    BACKGROUND: Cardiovascular stimulation and increased catecholamine plasma concentrations during ketamine anesthesia have been attributed to increased central sympathetic activity as well as catecholamine reuptake inhibition in various experimental models. However, direct recordings of efferent

  13. The Effects of Sympathetic Inhibition on Metabolic and Cardiopulmonary Responses to Exercise in Hypoxic Conditions.

    Science.gov (United States)

    Scalzo, Rebecca L; Peltonen, Garrett L; Binns, Scott E; Klochak, Anna L; Szallar, Steve E; Wood, Lacey M; Larson, Dennis G; Luckasen, Gary J; Irwin, David; Schroeder, Thies; Hamilton, Karyn L; Bell, Christopher

    2015-12-01

    Pre-exertion skeletal muscle glycogen content is an important physiological determinant of endurance exercise performance: low glycogen stores contribute to premature fatigue. In low-oxygen environments (hypoxia), the important contribution of carbohydrates to endurance performance is further enhanced as glucose and glycogen dependence is increased; however, the insulin sensitivity of healthy adult humans is decreased. In light of this insulin resistance, maintaining skeletal muscle glycogen in hypoxia becomes difficult, and subsequent endurance performance is impaired. Sympathetic inhibition promotes insulin sensitivity in hypoxia but may impair hypoxic exercise performance, in part due to suppression of cardiac output. Accordingly, we tested the hypothesis that hypoxic exercise performance after intravenous glucose feeding in a low-oxygen environment will be attenuated when feeding occurs during sympathetic inhibition. On 2 separate occasions, while breathing a hypoxic gas mixture, 10 healthy men received 1 hour of parenteral carbohydrate infusion (20% glucose solution in saline; 75 g), after which they performed stationary cycle ergometer exercise (~65% maximal oxygen uptake) until exhaustion. Forty-eight hours before 1 visit, chosen randomly, sympathetic inhibition via transdermal clonidine (0.2 mg/d) was initiated. The mean time to exhaustion after glucose feeding both with and without sympathetic inhibition was not different (22.7 ± 5.4 minutes vs 23.5 ± 5.1 minutes; P = .73). Sympathetic inhibition protects against hypoxia-mediated insulin resistance without influencing subsequent hypoxic endurance performance. Copyright © 2015 Wilderness Medical Society. Published by Elsevier Inc. All rights reserved.

  14. Inflammation in CRPS: role of the sympathetic supply.

    Science.gov (United States)

    Schlereth, Tanja; Drummond, Peter D; Birklein, Frank

    2014-05-01

    Acute Complex Regional Pain Syndrome (CRPS) is associated with signs of inflammation such as increased skin temperature, oedema, skin colour changes and pain. Pro-inflammatory cytokines (tumour necrosis factor-α (TNF-α), interleukin-2 (IL-2), IL-1beta, IL-6) are up-regulated, whereas anti-inflammatory cytokines (IL-4, IL-10) are diminished. Adaptive immunity seems to be involved in CRPS pathophysiology as many patients have autoantibodies directed against β2 adrenergic and muscarinic-2 receptors. In an animal tibial fracture model changes in the innate immune response such as up-regulation of keratinocytes are also found. Additionally, CRPS is accompanied by increased neurogenic inflammation which depends mainly on neuropeptides such as CGRP and Substance P. Besides inflammatory signs, sympathetic nervous system involvement in CRPS results in cool skin, increased sweating and sympathetically-maintained pain. The norepinephrine level is lower in the CRPS-affected than contralateral limb, but sympathetic sprouting and up-regulation of alpha-adrenoceptors may result in an adrenergic supersensitivity. The sympathetic nervous system and inflammation interact: norepinephrine influences the immune system and the production of cytokines. There is substantial evidence that this interaction contributes to the pathophysiology and clinical presentation of CRPS, but this interaction is not straightforward. How inflammation in CRPS might be exaggerated by sympathetic transmitters requires further elucidation. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Baroreflex dysfunction and augmented sympathetic nerve responses during mental stress in veterans with post-traumatic stress disorder.

    Science.gov (United States)

    Park, Jeanie; Marvar, Paul J; Liao, Peizhou; Kankam, Melanie L; Norrholm, Seth D; Downey, Ryan M; McCullough, S Ashley; Le, Ngoc-Anh; Rothbaum, Barbara O

    2017-07-15

    the groups. In PTSD vs. Controls, MSNA (+8.2 ± 1.0 vs. +1.2 ± 1.3 bursts min -1 , P PTSD vs. Controls, MSNA (+21.0 ± 2.6 vs. +6.7 ± 1.5 bursts min -1 , P PTSD group, sympathetic BRS (-1.2 ± 0.2 vs. -2.0 ± 0.3 burst incidence mmHg -1 , P = 0.026) and cardiovagal BRS (9.5 ± 1.4 vs. 23.6 ± 4.3 ms mmHg -1 , P = 0.008) were significantly blunted at rest. PTSD patients had significantly higher highly sensitive-C-reactive protein levels compared to Controls (2.1 ± 0.4 vs. 1.0 ± 0.3 mg L -1 , P = 0.047). Augmented SNS and haemodynamic responses to mental stress, blunted BRS and inflammation may contribute to an increased CV risk in PTSD. © 2017 The Authors. The Journal of Physiology © 2017 The Physiological Society.

  16. Abnormal Cardiovascular Sympathetic and Parasympathetic Responses to Physical and Emotional Stimuli in Depersonalization Disorder.

    Directory of Open Access Journals (Sweden)

    Andrew Paul Owens

    2015-03-01

    Full Text Available Depersonalization disorder (DPD is characterized by subjective unreality, disembodiment, emotional numbing and reduced psychogenic sympathoexcitation. 3 related experiments used physical and emotional challenges in 14 DPD participants and 16 controls to elucidate whether the cardiovascular sympathetic (SNS and parasympathetic (PNS nervous systems are implicated in DPD and if blunted DPD sympathoexcitation is peripherally or centrally mediated. Participants completed the Beck Anxiety Inventory (BAI, Dissociative Experience Scale (DES and Cambridge Depersonalization Scale (CDS. Study I recorded heart rate (HR and blood pressure (BP during 5mins supine baseline, 3mins handgrip (HG, 3mins cold pressor (CP and 5mins 60°head-up tilt (HUT. Study II recorded HR, BP and heart rate variability (HRV during 5mins HUT and unpleasant images. Study III examined HR and BP orienting responses (ORs to HUT and unpleasant, neutral and pleasant images. DPD BAI (p=0.0004, DES (p=.0002 and CDS (p=< 0.0001 scores were higher than controls. The DPD group produced diminished diastolic BP (DBP (p=0.045 increases to HG. Other indices were comparable between groups. DPD participants produced diminished systolic BP (SBP (p=0.003 and DBP (p=0.002 increases, but greater (p=0.004 HR increases to CP. In study II, DPD high frequency HRV (HF-HRV – indicating parasympathetic vagal activity - was reduced (p=0.029. In study III, DPD DBP was higher throughout the 5s duration of HUT/pseudorandom unpleasant image presentation (1s [p=0.002], 2s [p=0.033], 3s [p=0.001], 4s [p=0.009], 5s [p=0.029]. Study I’s BP pressor data supports previous findings of suppressed sympathoexcitatioin DPD. The greater HR increases to CP, decreased HF-HRV in study II, and increased DBP during unpleasant ORs in study III implicates the SNS and PNS in DPD pathophysiology. These studies suggest the cardiovascular autonomic dysregulation in DPD is likely to be centrally-mediated

  17. Sympathetic influence on the pupillary light response in three red-eared slider turtles (Trachemys scripta elegans).

    Science.gov (United States)

    Dearworth, James R; Cooper, Lori J

    2008-01-01

    We investigated the effects of phenylephrine and its combination with vecuronium bromide on the iris of turtles to determine if the pupillary light response is affected by sympathetic innervation. Three red-eared slider turtles, Trachemys scripta elegans. Diameters of light-adapted pupils were tracked before and after topical application of drugs to eyes. Phenylephrine was applied independently; in a second group of trials, vecuronium bromide was applied with phenylephrine. Rates of pupil dilation in response to drugs were quantified by fitting data with time constant (tau) equations. Phenylephrine dilated the pupil 24%, tau = 29 min. Combination of phenylephrine with vecuronium bromide increased the pupil size 35%, and dilation was more rapid, tau = 14 min. We also were able to predict these time constants by performing different mathematical operations with an equation developed from a prior study using only vecuronium bromide. When this equation was subtracted from the equation for eyes treated with both vecuronium bromide and phenylephrine, the difference gave the observed tau for phenylephrine; when added to phenylephrine, the sum closely matched the tau for eyes treated with vecuronium bromide and phenylephrine. Further, the tau for vecuronium bromide treated eyes was predicted by subtracting the equation for phenylephrine from that of eyes treated with both vecuronium bromide and phenylephrine. Our results suggest that sympathetic innervation interacts with the parasympathetic pathway to control the pupillary light response in turtles.

  18. Bradykinin Contributes to Sympathetic and Pressor Responses Evoked by Activation of Skeletal Muscle Afferents P2X in Heart Failure

    Directory of Open Access Journals (Sweden)

    Jihong Xing

    2016-11-01

    Full Text Available Background/Aims: Published data suggest that purinergic P2X receptors of muscle afferent nerves contribute to the enhanced sympathetic nervous activity (SNA and blood pressure (BP responses during static exercise in heart failure (HF. In this study, we examined engagement of bradykinin (BK in regulating responses of SNA and BP evoked by P2X stimulation in rats with HF. We further examined cellular mechanisms responsible for BK. We hypothesized that BK potentiates P2X currents of muscle dorsal root ganglion (DRG neurons, and this effect is greater in HF due to upregulation of BK kinin B2 and P2X3 receptor. As a result, BK amplifies muscle afferents P2X-mediated SNA and BP responses. Methods: Renal SNA and BP responses were recorded in control rats and rats with HF. Western Blot analysis and patch-clamp methods were employed to examine the receptor expression and function of DRG neurons involved in the effects of BK. Results: BK injected into the arterial blood supply of the hindlimb muscles heightened the reflex SNA and BP responses induced by P2X activation with α,β-methylene ATP to a greater degree in HF rats. In addition, HF upregulated the protein expression of kinin B2 and P2X3 in DRG and the prior application of BK increased the magnitude of α,β-methylene ATP-induced currents in muscle DRG neurons from HF rats. Conclusion: BK plays a facilitating role in modulating muscle afferent P2X-engaged reflex sympathetic and pressor responses. In HF, P2X responsivness is augmented due to increases in expression of kinin B2 and P2X3 receptors and P2X current activity.

  19. Sympathetic rhythms and nervous integration.

    Science.gov (United States)

    Gilbey, Michael P

    2007-04-01

    1. The present review focuses on some of the processes producing rhythms in sympathetic nerves influencing cardiovascular functions and considers their potential relevance to nervous integration. 2. Two mechanisms are considered that may account for rhythmic sympathetic discharges. First, neuronal elements of peripheral or central origin produce rhythmic activity by phasically exciting and/or inhibiting neurons within central sympathetic networks. Second, rhythms arise within central sympathetic networks. Evidence is considered that indicates the operation of both mechanisms; the first in muscle and the second in skin sympathetic vasoconstrictor networks. 3. Sympathetic activity to the rat tail, a model for the nervous control of skin circulation, is regulated by central networks involved in thermoregulation and those associated with fear and arousal. In an anaesthetized preparation, activity displays an apparently autonomous rhythm (T-rhythm; 0.4-1.2 Hz) and the level of activity can be manipulated by regulating core body temperature. This model has been used to study rhythm generation in central sympathetic networks and possible functional relevance. 4. A unique insight provided by the T rhythm, into possible physiological function(s) underlying rhythmic sympathetic discharges is that the activity of single sympathetic post-ganglionic neurons within a population innervating the same target can have different rhythm frequencies. Therefore, the graded and dynamic entrainment of the rhythms by inputs, such as central respiratory drive and/or lung inflation-related afferent activity, can produce graded and dynamic synchronization of sympathetic discharges. The degree of synchronization may influence the efficacy of transmission in a target chain of excitable cells. 5. The T-rhythm may be generated within the spinal cord because the intrathecal application of 5-hydroxytryptamine at the L1 level of the spinal cord of a rat spinalized at T10-T11 produces a T-like rhythm

  20. Skin bank development and critical incident response.

    Science.gov (United States)

    Hamilton, Kellie T; Herson, Marisa R

    2011-05-01

    The Donor Tissue Bank of Victoria (DTBV), situated in Melbourne, Australia developed a skin banking program in 1994. It remains Australia's only operational skin bank, processing cryopreserved human cadaveric skin for the treatment of burns. The demand for allograft skin in Australia has steadily increased since the development of the program. The bank has been involved in the provision of skin for a number of critical incidences or disasters both in Australia and overseas. Demand always exceeds supply, and in the absence of other local skin banks, the DTBV has needed to develop strategies to enable increased provision of allograft skin nationally.

  1. Reduced Sympathetic Response to Head-Up Tilt in Subjects with Mild Cognitive Impairment or Mild Alzheimer's Dementia

    Directory of Open Access Journals (Sweden)

    Marte Rognstad Mellingsæter

    2015-03-01

    Full Text Available Background: Hemodynamic control was compared in patients with mild cognitive impairment (MCI or mild Alzheimer's dementia (AD as well as in healthy elderly subjects. Methods: Noninvasive, continuous hemodynamic recordings were obtained from 14 patients and 48 controls during supine rest (tilt of 30 and 70°. Cardiac output, end-diastolic volume, total peripheral resistance, heart rate variability (HRV, systolic blood pressure variability (SBPV, and baroreceptor sensitivity were calculated. Results: At 70° tilt, the HRV indices differed significantly, with higher high-frequency (HF variability as well as lower low-frequency (LF variability and LF/HF ratios in the patients. The patients had significantly lower SBPV in the LF range at 30° tilt. Conclusions: The results indicate a poorer sympathetic response to orthostatic stress in MCI and mild AD.

  2. Autonomic skin responses in females with Fabry disease

    DEFF Research Database (Denmark)

    Møller, Anette Torvin; Bach, Flemming W.; Feldt-Rasmussen, Ulla

    2009-01-01

    Fabry disease is a genetic lysosomal disorder with dysfunction of the lysosomal enzyme alpha-galactosidase A causing accumulation of glycolipids in multiple organs including the nervous system and with neuropathy as a prominent manifestation. Neurological symptoms include pain and autonomic...... dysfunction. This study examined peripheral autonomic nerve function in 19 female patients with Fabry disease and 19 sex and age-matched controls by measuring (1) sweat production following acetylcholine challenge; (2) the sympathetically mediated vasoconstrictor responses to inspiratory gasp, stress...

  3. Asian women have attenuated sympathetic activation but enhanced renal–adrenal responses during pregnancy compared to Caucasian women

    Science.gov (United States)

    Okada, Yoshiyuki; Best, Stuart A; Jarvis, Sara S; Shibata, Shigeki; Parker, Rosemary S; Casey, Brian M; Levine, Benjamin D; Fu, Qi

    2015-01-01

    Abstract Asians have a lower prevalence of hypertensive disorders of pregnancy than Caucasians. Since sympathetic overactivity and dysregulation of the renal–adrenal system (e.g. low aldosterone levels) have been found in preeclamptic women, we hypothesized that Asians have lower muscle sympathetic nerve activity (MSNA) and greater aldosterone concentrations during normal pregnancy than Caucasians. In a prospective study, blood pressure (BP), heart rate (HR), and MSNA were measured during supine and upright tilt (30 deg and 60 deg for 5 min each) in 9 Asians (32 ± 1 years (mean ± SEM)) and 12 Caucasians (29 ± 1 years) during pre-, early (≤8 weeks of gestation) and late (32–36 weeks) pregnancy, and post-partum (6–10 weeks after delivery). Supine MSNA increased with pregnancy in both groups (P < 0.001); it was significantly lower in Asians than Caucasians (14 ± 3 vs. 23 ± 3 bursts min−1 and 16 ± 5 vs. 30 ± 3 bursts min−1 in early and late pregnancy, respectively; P = 0.023). BP decreased during early pregnancy (P < 0.001), but was restored during late pregnancy. HR increased during pregnancy (P < 0.001) with no racial difference (P = 0.758). MSNA increased during tilting and it was markedly lower in Asians than Caucasians in late pregnancy (31 ± 6 vs. 49 ± 3 bursts min−1 at 60 deg tilt; P = 0.003). Upright BP was lower in Asians, even in pre-pregnancy (P = 0.006), and this racial difference persisted during pregnancy. Direct renin and aldosterone increased during pregnancy (both P < 0.001); these hormones were greater in Asians (P = 0.086 and P = 0.014). Thus, Asians have less sympathetic activation but more upregulated renal–adrenal responses than Caucasians during pregnancy. These results may explain, at least in part, why Asian women are at low risk of hypertensive disorders in pregnancy. Key points Asian women have a lower prevalence of hypertensive disorders of pregnancy than Caucasian

  4. Whiplash evokes descending muscle recruitment and sympathetic responses characteristic of startle

    Science.gov (United States)

    Mang, Daniel WH; Siegmund, Gunter P; Blouin, Jean-Sébastien

    2014-01-01

    Whiplash injuries are the most common injuries following rear-end collisions. During a rear-end collision, the human muscle response consists of both a postural and a startle response that may exacerbate injury. However, most previous studies only assessed the presence of startle using data collected from the neck muscles and head/neck kinematics. The startle response also evokes a descending pattern of muscle recruitment and changes in autonomic activity. Here we examined the recruitment of axial and appendicular muscles along with autonomic responses to confirm whether these other features of a startle response were present during the first exposure to a whiplash perturbation. Ten subjects experienced a single whiplash perturbation while recording electromyography, electrocardiogram, and electrodermal responses. All subjects exhibited a descending pattern of muscle recruitment, and increasing heart rate and electrodermal responses following the collision. Our results provide further support that the startle response is a component of the response to whiplash collisions. PMID:24932015

  5. Cardiovascular and sympathetic responses to a mental stress task in young patients with hypertension and/or obesity.

    Science.gov (United States)

    Garafova, A; Penesova, A; Cizmarova, E; Marko, A; Vlcek, M; Jezova, D

    2014-01-01

    Present study was aimed to investigate sympathetic responses to mental stress with hypothesis that the presence of obesity in patients with hypertension has a modifying effect. Young male subjects, 8 with hypertension grade I, with BMI 25 kg/m(2) (HT), 10 with hypertension grade I, and BMI 30 kg/m(2) (HT OB), 14 healthy controls with BMI 30 kg/m(2) (OB), and 13 healthy controls with BMI 25 kg/m(2) (C) underwent the Stroop test. ECG was recorded continuously to evaluate heart rate variability (HRV). Blood pressure (BP) and catecholamine concentrations were measured at baseline, at the end of mental stress test and 15 min thereafter. Patients with HT demonstrated increased adrenaline concentrations and enhanced stress-induced noradrenaline release compared to that in healthy controls. In obese subjects, stress-induced increase of systolicBP was lower compared to lean individuals. Stress exposure induced a significant rise in the low frequency power component of HRV, however the increase was lower in the HT OB group compared to C. Obesity in patients with hypertension did not lead to a different reaction in comparison with lean hypertensive subjects. The present data demonstrate higher sympathoadrenal activity in early-stage of hypertension. Obesity is connected with higher resting systolicBP and modifies the HRV response to mental stress.

  6. Radiation response of skin in young and old rats

    Energy Technology Data Exchange (ETDEWEB)

    Hamlet, R.; Hopewell, J.W. (Churchill Hospital, Oxford (UK))

    1982-11-01

    The results of this investigation clearly demonstrate the different radiation skin response in rats of differing ages. The reasons for these differences cannot be clarified until cell kinetic studies have been completed. These results obtained for rodent skin would appear to be in disagreement with the available data for human skin (Rubin and Casarett 1968) where no marked age-related changes were reported. Also, in pig skin studies (Hopewell and Young 1982) there was no evidence of an age effect in the dermal vascular response in 3-12-month-old animals. This may be related to the different tissue being investigated or it may reflect important species differences. Whatever the reasons behind these observations, the different skin response to radiation in rats of 7, 14 and 52 weeks of age has clearly been demonstrated and should be borne in mind when extrapolating data with rodent skin to the clinical situation.

  7. The radiation response of skin in young and old rats

    International Nuclear Information System (INIS)

    Hamlet, R.; Hopewell, J.W.

    1982-01-01

    The results of this investigation clearly demonstrate the different radiation skin response in rats of differing ages. The reasons for these differences cannot be clarified until cell kinetic studies have been completed. These results obtained for rodent skin would appear to be in disagreement with the available data for human skin (Rubin and Casarett 1968) where no marked age-related changes were reported. Also, in pig skin studies (Hopewell and Young 1982) there was no evidence of an age effect in the dermal vascular response in 3-12-month-old animals. This may be related to the different tissue being investigated or it may reflect important species differences. Whatever the reasons behind these observations, the different skin response to radiation in rats of 7, 14 and 52 weeks of age has clearly been demonstrated and should be borne in mind when extrapolating data with rodent skin to the clinical situation. (author)

  8. The framing effect and skin conductance responses

    Directory of Open Access Journals (Sweden)

    Patrick eRing

    2015-08-01

    Full Text Available Individuals often rely on simple heuristics when they face complex choice situations under uncertainty. Traditionally, it has been proposed that cognitive processes are the main driver to evaluate different choice options and finally to reach a decision. Growing evidence, however, highlights a strong interrelation between judgment and decision-making (JDM on the one hand, and emotional processes on the other hand. This also seems to apply to judgmental heuristics, i.e. decision-processes that are typically considered to be fast and intuitive. In this study, participants are exposed to different probabilities of receiving an unpleasant electric shock. Information about electric shock probabilities is either positively or negatively framed. Integrated skin conductance responses (ISCRs while waiting for electric shock realization are used as an indicator for participants' emotional arousal. This measure is compared to objective probabilities. I find evidence for a relation between emotional body reactions measured by ISCRs and the framing effect. Under negative frames, participants show significantly higher ISCRs while waiting for an electric shock to be delivered than under positive frames. This result might contribute to a better understanding of the psychological processes underlying JDM. Further studies are necessary to reveal the causality underlying this finding, i.e. whether emotional processes influence JDM or vice versa.

  9. The framing effect and skin conductance responses.

    Science.gov (United States)

    Ring, Patrick

    2015-01-01

    Individuals often rely on simple heuristics when they face complex choice situations under uncertainty. Traditionally, it has been proposed that cognitive processes are the main driver to evaluate different choice options and to finally reach a decision. Growing evidence, however, highlights a strong interrelation between judgment and decision-making (JDM) on the one hand, and emotional processes on the other hand. This also seems to apply to judgmental heuristics, i.e., decision processes that are typically considered to be fast and intuitive. In this study, participants are exposed to different probabilities of receiving an unpleasant electric shock. Information about electric shock probabilities is either positively or negatively framed. Integrated skin conductance responses (ISCRs) while waiting for electric shock realization are used as an indicator for participants' emotional arousal. This measure is compared to objective probabilities. I find evidence for a relation between emotional body reactions measured by ISCRs and the framing effect. Under negative frames, participants show significantly higher ISCRs while waiting for an electric shock to be delivered than under positive frames. This result might contribute to a better understanding of the psychological processes underlying JDM. Further studies are necessary to reveal the causality underlying this finding, i.e., whether emotional processes influence JDM or vice versa.

  10. Alpha-Blocker Treatment Response in Men With Lower Urinary Tract Symptoms Based on Sympathetic Activity: Prospective, Multicenter, Open-Labeled, Observational Study

    Directory of Open Access Journals (Sweden)

    Sung Gon Park

    2015-06-01

    Full Text Available Purpose: In this study, we compared the treatment outcomes for an α-blocker between 2 groups of men, one with high sympathetic activity (HSA and another with low sympathetic activity (LSA or normal sympathetic activity. Methods: A total of 159 men (≥50 years of age with lower urinary tract symptoms resulting from benign prostatic hyperplasia were analyzed. We assigned patients to groups according to their sympathetic activity, which was evaluated by heart ratevariability measurements. HSA was defined as a low frequency/high frequency ratio greater than 1.6. All patients received 10mg of alfuzosin once a day for 12 weeks. The primary end point was a change in the total International Prostate SymptomScore (IPSS at 12 weeks from baseline. Results: Sixty-seven men were assigned to the HSA group and 92 men were assigned to the LSA group. The baseline characteristics were not significantly different between the 2 groups, and the response to alfuzosin was good in both groups. Themean total IPSS change was not different between the groups. Both groups were not significantly different with respect to the changes in maximal flow rate, IPSS voiding or storage symptom subscores, quality of life, and rates of adverse drug events. TheHSA group showed a similar willingness to continue treatment compared to the LSA group, although their treatment satisfaction rating was lower. Conclusions: The therapeutic effects of alfuzosin did not differ in regards to the differences in sympathetic activity, but treatment satisfaction ratings were lower in the HSA group.

  11. [Skin cell response after jellyfish sting].

    Science.gov (United States)

    Adamicová, Katarína; Výbohová, Desanka; Fetisovová, Želmíra; Nováková, Elena; Mellová, Yvetta

    2016-01-01

    Jellyfish burning is not commonly part of the professional finding in the central Europe health care laboratory. Holiday seaside tourism includes different and unusual presentations of diseases for our worklplaces. Sea water-sports and leisure is commonly connected with jellyfish burning and changes in the skin, that are not precisely described. Authors focused their research on detection of morphological and quantitative changes of some inflammatory cells in the skin biopsy of a 59-years-old woman ten days after a jellyfish stinging. Because of a comparison of findings the biopsy was performed in the skin with lesional and nonlesional skin. Both excisions of the skin were tested by imunohistochemical methods to detect CD68, CD163, CD30, CD4, CD3, CD8, CD20 a CD1a, to detect histiocytes, as well as several clones of lymphocytes and Langerhans cells (antigen presenting cells of skin), CD 117, toluidin blue and chloracetase esterase to detect mastocytes and neutrophils. Material was tested by immunofluorescent methods to detect IgA, IgM, IgG, C3, C4, albumin and fibrinogen. Representative view-fields were documented by microscope photocamera Leica DFC 420 C. Registered photos from both samples of the skin were processed by morphometrical analysis by the Vision Assistant software. A student t-test was used for statistical analysis of reached results. Mean values of individual found cells in the sample with lesion and without lesion were as follows: CD117 -2.64/0.37, CD68-6.86/1.63, CD163-3.13/2.23, CD30-1.36/0.02, CD4-3.51/0.32, CD8-8.22/0.50, CD3-10.69/0.66, CD20-0.56/0.66, CD1a-7.97/0.47 respectively. Generally mild elevation of eosinofils in lesional skin was detected. Increased values of tested cells seen in excision from lesional skin when compared with nonlesional ones were statistically significant in eight case at the level p = 0.033 to 0.001. A not statistically significant difference was found only in the group of CD163+ histiocytes. Authors detected numbers

  12. Control of the skin scarring response

    Directory of Open Access Journals (Sweden)

    Lydia M. Ferreira

    2009-09-01

    Full Text Available There comes a time when the understanding of the cutaneous healing process becomes essential due to the need for a precocious tissue repair to reduce the physical, social, and psychological morbidity. Advances in the knowledge on the control of interaction among cells, matrix and growth factors will provide more information on the Regenerative Medicine, an emerging area of research in medical bioengineering. However, considering the dynamism and complexity of the cutaneous healing response, it is fundamental to understand the control mechanism exerted by the interaction and synergism of both systems, cutaneous nervous and central nervous, via hypothalamus hypophysis-adrenal axis, a relevant subject, but hardly ever explored. The present study reviews the neuro-immune-endocrine physiology of the skin responsible for its multiple functions and the extreme disturbances of the healing process, like the excess and deficiency of the extracellular matrix deposition.Aproxima-se uma época na qual é fundamental a compreensão do processo cicatricial cutâneo frente à necessidade da restauração tecidual precoce, visando a diminuição das morbidades física, social e psicológica. O avanço no conhecimento acerca do controle das interações entre as células, a matriz e os fatores de crescimento dará maiores informações à Medicina Regenerativa, área de pesquisa emergente da bioengenharia médica. Entretanto, diante do dinamismo e complexidade da resposta cicatricial cutânea torna-se indispensável o entendimento do mecanismo de controle exercido pela interação e sinergismo do sistema nervoso cutâneo e o sistema nervoso central, via eixo hipotálamo-hipófise-adrenal, tema relevante, porém, pouco abordado. O presente estudo revisa a fisiologia neuro-imuno-endócrina da pele, responsável por suas múltiplas funções, e os distúrbios extremos do processocicatricial, como o excesso e deficiência de deposição da matriz extracelular.

  13. Comparison of skin responses from macroscopic and microscopic UV challenges

    Science.gov (United States)

    Seo, InSeok; Bargo, Paulo R.; Chu, Melissa; Ruvolo, Eduardo; Kollias, Nikiforos

    2011-03-01

    The minimal erythema dose induced by solar-simulated radiation is a useful measure of UV sensitivity of skin. Most skin phototests have been conducted by projecting a flat field of UV radiation onto the skin in an area greater than 15 cm × 15 cm with an increment of radiation doses. In this study, we investigated the responses of human skin to solar-simulated radiation of different field sizes. Twelve human subjects of skin phototype I-IV were exposed to solar-simulated radiation (SSR) on their upper inner arm or on their lower back with a series of doses in increments of 20% in order to determine the threshold dose to induce a minimal perceptible erythema response (MED). Each dose was delivered with a liquid light guide (8 mm diameter on the back or 6 mm on the upper inner arm) and with quartz optical fibers of 200 μm diameter. The resulting skin responses were evaluated visually and investigated with a reflectance confocal microscope and imaging. The erythema response to the microscopic challenge was always diffuse with no clear boundaries extending to several times the exposed site diameter at doses greater than 2 MED. The skin returned to normal appearance from the microscopic challenge after two weeks of exposure while change in appearance for the larger areas persisted for several weeks to months. This new modality of testing provides the possibility to study skin at the microscopic level with a rapid recovery following challenge.

  14. Rate dependency and role of nitric oxide in the vascular response to direct cooling in human skin.

    Science.gov (United States)

    Yamazaki, Fumio; Sone, Ryoko; Zhao, Kun; Alvarez, Guy E; Kosiba, Wojciech A; Johnson, John M

    2006-01-01

    Local cooling of nonglabrous skin without functional sympathetic nerves causes an initial vasodilation followed by vasoconstriction. To further characterize these responses to local cooling, we examined the importance of the rate of local cooling and the effect of nitric oxide synthase (NOS) inhibition in intact skin and in skin with vasoconstrictor function inhibited. Release of norepinephrine was blocked locally (iontophoresis) with bretylium tosylate (BT). Skin blood flow was monitored from the forearm by laser-Doppler flowmetry (LDF). Cutaneous vascular conductance (CVC) was calculated as the ratio of LDF to blood pressure. Local temperature was controlled over 6.3 cm2 around the sites of LDF measurement. Local cooling was applied at -0.33 or -4 degrees C/min. At -4 degrees C/min, CVC increased (P cooling (-4 degrees C/min) to 24 degrees C decreased (P cooling, CVC decreased at BT + saline sites relative to the precooling levels (P cooling, but not functional NOS, is an important determinant of the early non-adrenergic vasodilator response to local cooling and that functional NOS, adrenergic nerves, as well as other mechanisms play roles in vasoconstriction during prolonged local cooling of skin.

  15. Lower corticosteroid skin blanching response is associated with severe COPD.

    Directory of Open Access Journals (Sweden)

    Susan J M Hoonhorst

    Full Text Available Chronic obstructive pulmonary disease (COPD is characterized by chronic airflow limitation caused by ongoing inflammatory and remodeling processes of the airways and lung tissue. Inflammation can be targeted by corticosteroids. However, airway inflammation is generally less responsive to steroids in COPD than in asthma. The underlying mechanisms are yet unclear. This study aimed to assess whether skin corticosteroid insensitivity is associated with COPD and COPD severity using the corticosteroid skin blanching test.COPD patients GOLD stage I-IV (n = 27, 24, 22, and 16 respectively and healthy never-smokers and smokers (n = 28 and 56 respectively were included. Corticosteroid sensitivity was assessed by the corticosteroid skin blanching test. Budesonide was applied in 8 logarithmically increasing concentrations (0-100 μg/ml on subject's forearm. Assessment of blanching was performed after 7 hours using a 7-point scale (normal skin to intense blanching. All subjects performed spirometry and body plethysmography.Both GOLD III and GOLD IV COPD patients showed significantly lower skin blanching responses than healthy never-smokers and smokers, GOLD I, and GOLD II patients. Their area under the dose-response curve values of the skin blanching response were 586 and 243 vs. 1560, 1154, 1380, and 1309 respectively, p<0.05. Lower FEV1 levels and higher RV/TLC ratios were significantly associated with lower skin blanching responses (p = 0.001 and p = 0.004 respectively. GOLD stage I, II, III and IV patients had similar age and packyears.In this study, severe and very severe COPD patients had lower skin corticosteroid sensitivity than mild and moderate COPD patients and non-COPD controls with comparable age and packyears. Our findings together suggest that the reduced skin blanching response fits with a subgroup of COPD patients that has an early-onset COPD phenotype.

  16. Deceased donor skin allograft banking: Response and utilization

    Directory of Open Access Journals (Sweden)

    Gore Madhuri

    2010-10-01

    Full Text Available Background: In the absence of xenograft and biosynthetic skin substitutes, deceased donor skin allografts is a feasible option for saving life of patient with extensive burn injury in our country. Aims: The first deceased donor skin allograft bank in India became functional at Lokmanya Tilak Municipal (LTM medical college and hospital on 24 th April 2000. The response of Indian society to this new concept of skin donation after death and the pattern of utilization of banked allografts from 2000 to 2010 has been presented in this study. Settings and Design: This allograft skin bank was established by the department of surgery. The departments of surgery and microbiology share the responsibility of smooth functioning of the bank. Materials and Methods: The response in terms of number of donations and the profile of donors was analyzed from records. Pattern and outcome of allograft utilization was studied from specially designed forms. Results: During these ten years, 262 deceased donor skin allograft donations were received. The response showed significant improvement after counselling was extended to the community. Majority of the donors were above 70 years of age and procurement was done at home for most. Skin allografts from 249 donors were used for 165 patients in ten years. The outcome was encouraging with seven deaths in 151 recipients with burn injuries. Conclusions: Our experience shows that the Indian society is ready to accept the concept of skin donation after death. Use of skin allografts is life saving for large burns. We need to prepare guidelines for the establishment of more skin banks in the country.

  17. Neurotrophin responsiveness of sympathetic neurons is regulated by rapid mobilization of the p75 receptor to the cell surface through TrkA activation of Arf6.

    Science.gov (United States)

    Edward Hickman, F; Stanley, Emily M; Carter, Bruce D

    2018-05-22

    The p75 neurotrophin receptor (p75NTR) plays an integral role in patterning the sympathetic nervous system during development. Initially, p75NTR is expressed at low levels as sympathetic axons project toward their targets, which enables neurotrophin-3 (NT3) to activate TrkA receptors and promote growth. Upon reaching nerve growth factor (NGF) producing tissues, p75NTR is up regulated resulting in formation of TrkA-p75 complexes, which are high affinity binding sites selective for NGF, thereby blunting NT3 signaling. The level of p75NTR expressed on the neuron surface is instrumental in regulating trophic factor response; however, the mechanisms by which p75NTR expression is regulated are poorly understood. Here, we demonstrate a rapid, translation independent increase in surface expression of p75NTR in response to NGF in rat sympathetic neurons. p75NTR was mobilized to the neuron surface from GGA3-postitive vesicles through activation of the GTPase Arf6, which was stimulated by NGF, but not NT3 binding to TrkA. Arf6 activation required PI3 kinase activity and was prevented by an inhibitor of the cytohesin family of Arf6 GEFs. Overexpression of a constitutively active Arf6 mutant (Q67L) was sufficient to significantly increase surface expression of p75NTR even in the absence of NGF. Functionally, expression of active Arf6 markedly attenuated the ability of NT3 to promote neuronal survival and neurite outgrowth while the NGF response was unaltered. These data suggest that NGF activation of Arf6 through TrkA is critical for the increase in p75NTR surface expression that enables the switch in neurotrophin responsiveness during development in the sympathetic nervous system. SIGNIFICANCE STATEMENT p75NTR is instrumental in the regulation of neuronal survival and apoptosis during development and is also implicated as a contributor to aberrant neurodegeneration in numerous conditions. Therefore, a better understanding of the mechanisms that mediate p75NTR surface

  18. Response of Human Skin to Aesthetic Scarification

    Science.gov (United States)

    Gabriel, Vincent A.; McClellan, Elizabeth A.; Scheuermann, Richard H.

    2014-01-01

    This study was undertaken to investigate changes in RNA expression in previously healthy adult human skin following thermal injury induced by contact with hot metal that was undertaken as part of aesthetic scarification, a body modification practice. Subjects were recruited to have pre-injury skin and serial wound biopsies performed. 4 mm punch biopsies were taken prior to branding and 1 hour, 1 week, and 1, 2 and 3 months post injury. RNA was extracted and quality assured prior to the use of a whole-genome based bead array platform to describe expression changes in the samples using the pre-injury skin as a comparator. Analysis of the array data was performed using k-means clustering and a hypergeometric probability distribution without replacement and corrections for multiple comparisons were done. Confirmatory q-PCR was performed. Using a k of 10, several clusters of genes were shown to co-cluster together based on Gene Ontology classification with probabilities unlikely to occur by chance alone. OF particular interest were clusters relating to cell cycle, proteinaceous extracellular matrix and keratinization. Given the consistent expression changes at one week following injury in the cell cycle cluster, there is an opportunity to intervene early following burn injury to influence scar development. PMID:24582755

  19. Mechanical response of human female breast skin under uniaxial stretching.

    Science.gov (United States)

    Kumaraswamy, N; Khatam, Hamed; Reece, Gregory P; Fingeret, Michelle C; Markey, Mia K; Ravi-Chandar, Krishnaswamy

    2017-10-01

    Skin is a complex material covering the entire surface of the human body. Studying the mechanical properties of skin to calibrate a constitutive model is of great importance to many applications such as plastic or cosmetic surgery and treatment of skin-based diseases like decubitus ulcers. The main objective of the present study was to identify and calibrate an appropriate material constitutive model for skin and establish certain universal properties that are independent of patient-specific variability. We performed uniaxial tests performed on breast skin specimens freshly harvested during mastectomy. Two different constitutive models - one phenomenological and another microstructurally inspired - were used to interpret the mechanical responses observed in the experiments. Remarkably, we found that the model parameters that characterize dependence on previous maximum stretch (or preconditioning) exhibited specimen-independent universal behavior. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Characterizing human skin blood flow regulation in response to different local skin temperature perturbations

    NARCIS (Netherlands)

    Wu, Y.; Nieuwenhoff, M.D.; Huygen, Frank J.P.M.; van der Helm, F. C.T.; Niehof, S.P.; Schouten, A. C.

    2017-01-01

    Small nerve fibers regulate local skin blood flow in response to local thermal perturbations. Small nerve fiber function is difficult to assess with classical neurophysiological tests. In this study, a vasomotor response model in combination with a heating protocol was developed to quantitatively

  1. A DESIGN FRAMEWORK FOR HUMAN EMOTION RECOGNITION USING ELECTROCARDIOGRAM AND SKIN CONDUCTANCE RESPONSE SIGNALS

    Directory of Open Access Journals (Sweden)

    KHAIRUN NISA’ MINHAD

    2017-11-01

    Full Text Available Identification of human emotional state while driving a vehicle can help in understanding the human behaviour. Based on this identification, a response system can be developed in order to mitigate the impact that may be resulted from the behavioural changes. However, the adaptation of emotions to the environment at most scenarios is subjective to an individual’s perspective. Many factors, mainly cultural and geography, gender, age, life style and history, level of education and professional status, can affect the detection of human emotional affective states. This work investigated sympathetic responses toward human emotions defined by using electrocardiography (ECG and skin conductance response (SCR signals recorded simultaneously. This work aimed to recognize ECG and SCR patterns of the investigated emotions measured using selected sensor. A pilot study was conducted to evaluate the proposed framework. Initial results demonstrated the importance of suitability of the stimuli used to evoke the emotions and high opportunity for the ECG and SCR signals to be used in the automotive real-time emotion recognition systems.

  2. Relation between myocardial response to dobutamine stress and sympathetic nerve activation in patients with idiopathic dilated cardiomyopathy. A comparison of 123I-MIBG scintigraphic and echocardiographic data

    International Nuclear Information System (INIS)

    Naruse, Hitoshi; Arii, Tohru; Kondo, Tomohiro

    2000-01-01

    It is likely that a close association exists between findings obtained by two methods: dobutamine stress echocardiography and 123 I-MIBG scintigraphy. Both of these methods are associated with β-adrenergic receptor mechanisms. This study was conducted to demonstrate the relation between myocardial response to dobutamine stress and sympathetic nerve release of norepinephrine in the failing heart. In 12 patents with heart failure due to idiopathic dilated cardiomyopathy, the myocardial effects of dobutamine stress were evaluated by low-dose dobutamine stress echocardiography; and sympathetic nerve function was evaluated by scintigraphic imaging with iodine-123[ 123 I]meta-iodobenzylguanidine (MIBG), an analogue of norepinephrine. Echocardiography provided quantitative assessment of wall motion and left ventricular dilation; radiotracer studies with 123 I-MIBG provided quantitative assessment of the heart-to-mediastinum (H/M) uptake ratio and washout rate. Results showed that H/M correlated with baseline wall motion (r=0.682, p=0.0146), wall motion after dobutamine stress (r=0.758, p=0.0043), the change in wall motion (r=0.667, p=0.0178), and with left ventricular diastolic diameter (r=0.837, p=0.0007). In addition, the 123 I-MIBG washout rate correlated with baseline wall motion (r=0.608, p=0.0360), wall motion after dobutamine stress (r=0.703, p=0.0107), and with the change in wall motion (r=0.664, p=0.0185). Wall motion, especially in the myocardial response to dobutamine stress, is related to sympathetic nerve activity in heart failure. (author)

  3. Cardiac sympathetic afferent reflex response to intermedin microinjection into paraventricular nucleus is mediated by nitric oxide and γ-amino butyric acid in hypertensive rats.

    Science.gov (United States)

    Zhou, Hong; Sun, Hai-jian; Chang, Jin-rui; Ding, Lei; Gao, Qing; Tang, Chao-shu; Zhu, Guo-qing; Zhou, Ye-bo

    2014-10-01

    Intermedin (IMD) is a member of calcitonin/calcitonin gene-related peptide (CGRP) and involves in the regulation of cardiovascular function in both peripheral tissues and central nervous system (CNS). Paraventricular nucleus (PVN) of hypothalamus is an important site in the control of cardiac sympathetic afferent reflex (CSAR) which participates in sympathetic over-excitation of hypertension. The aim of this study is to investigate whether IMD in the PVN is involved in the inhibition of CSAR and its related mechanism in hypertension. Rats were subjected to two-kidney one-clip (2K1C) surgery to induce renovascular hypertension or sham-operation (Sham). Acute experiments were carried out four weeks later under anesthesia. The CSAR was evaluated with the renal sympathetic nerve activity (RSNA) and mean arterial pressure (MAP) responses to the epicardial application of capsaicin. The RSNA and MAP were recorded in sinoaortic-denervated, cervical-vagotomized and anesthetized rats. Bilateral PVN microinjection of IMD (25 pmol) caused greater decrease in the CSAR in 2K1C rats than in Sham rats, which was prevented by pretreatment with adrenomedullin (AM) receptor antagonist AM22-52, non-selective nitric oxide (NO) synthase (NOS) inhibitor L-NAME or γ-amino butyric acid (GABA)B receptor blocker CGP-35348. PVN pretreatment with CGRP receptor antagonist CGRP8-37 or GABA(A) receptor blocker gabazine had no significant effect on the CSAR response to IMD. AM22-52, L-NAME and CGP-35348 in the PVN could increase CSAR in Sham and 2K1C rats. These data indicate that IMD in the PVN inhibits CSAR via AM receptor, and both NO and GABA in the PVN involve in the effect of IMD on CSAR in Sham and renovascular hypertensive rats. © 2014 by the Society for Experimental Biology and Medicine.

  4. Oral warfarin intake affects skin inflammatory cytokine responses in rats.

    Science.gov (United States)

    Aleksandrov, Aleksandra Popov; Mirkov, Ivana; Zolotarevski, Lidija; Ninkov, Marina; Mileusnic, Dina; Kataranovski, Dragan; Kataranovski, Milena

    2017-09-01

    Warfarin is an anticoagulant used in prevention/prophylaxis of thromboembolism. Besides the effects on coagulation, non-hemorrhagic reactions have also been documented. Although cutaneous reactions were reported in some patients, the impact on skin immunity was not explored. In the present paper, the effect of 30-day oral warfarin intake on skin cytokine responses in rats was analyzed. Increased release of inflammatory cytokines (TNF, IL-1β and IL-10) was noted by skin explants from rats which received warfarin, but without effect on IL-6. No impact on epidermal cell cytokine secretion was seen, except a tendency of an increase of IL-6 response to stimulation with microbial product lipopolysaccharide (LPS). Topical application of contact allergen dinitrochlorobenzene (DNCB) resulted in slight (numerical solely) increase of TNF release by skin explants of warfarin-treated animals, while epidermal cells responded by increased secretion of all four cytokines examined. The data presented provide new information on the potential of oral warfarin to modulate skin innate immune activity. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Testing a linear time invariant model for skin conductance responses by intraneural recording and stimulation.

    Science.gov (United States)

    Gerster, Samuel; Namer, Barbara; Elam, Mikael; Bach, Dominik R

    2018-02-01

    Skin conductance responses (SCR) are increasingly analyzed with model-based approaches that assume a linear and time-invariant (LTI) mapping from sudomotor nerve (SN) activity to observed SCR. These LTI assumptions have previously been validated indirectly, by quantifying how much variance in SCR elicited by sensory stimulation is explained under an LTI model. This approach, however, collapses sources of variability in the nervous and effector organ systems. Here, we directly focus on the SN/SCR mapping by harnessing two invasive methods. In an intraneural recording experiment, we simultaneously track SN activity and SCR. This allows assessing the SN/SCR relationship but possibly suffers from interfering activity of non-SN sympathetic fibers. In an intraneural stimulation experiment under regional anesthesia, such influences are removed. In this stimulation experiment, about 95% of SCR variance is explained under LTI assumptions when stimulation frequency is below 0.6 Hz. At higher frequencies, nonlinearities occur. In the intraneural recording experiment, explained SCR variance is lower, possibly indicating interference from non-SN fibers, but higher than in our previous indirect tests. We conclude that LTI systems may not only be a useful approximation but in fact a rather accurate description of biophysical reality in the SN/SCR system, under conditions of low baseline activity and sporadic external stimuli. Intraneural stimulation under regional anesthesia is the most sensitive method to address this question. © 2017 The Authors. Psychophysiology published by Wiley Periodicals, Inc. on behalf of Society for Psychophysiological Research.

  6. Sympathetic vasoconstrictor nerve function in alcoholic neuropathy

    DEFF Research Database (Denmark)

    Jensen, K; Andersen, K; Smith, T

    1984-01-01

    (18% and 48% decrease respectively). However, in three patients with moderate neuropathy, and in one patient with no signs of neuropathy, this veno-arteriolar reflex was absent, indicating dysfunction of the peripheral sympathetic adrenergic nerve fibres. The three patients also showed a lesser degree......The peripheral sympathetic vasomotor nerve function was investigated in 18 male chronic alcoholics admitted for intellectual impairment or polyneuropathy. By means of the local 133Xenon washout technique, the sympathetic veno-arteriolar axon-reflex was studied. This normally is responsible for a 50...... comprise not only the peripheral sensory and motor nerve fibres, but also the thin pseudomotor and vasomotor nerves....

  7. Effects of skin-to-skin contact on autonomic pain responses in preterm infants.

    Science.gov (United States)

    Cong, Xiaomei; Cusson, Regina M; Walsh, Stephen; Hussain, Naveed; Ludington-Hoe, Susan M; Zhang, Di

    2012-07-01

    The purpose of this randomized crossover trial was to determine the effects on autonomic responses in preterm infants of longer Kangaroo Care (30 minutes, KC30) and shorter KC (15 minutes, KC15) before and throughout heel stick compared with incubator care (IC). Beat-to-beat heart rate (HR) and spectral power analysis of heart rate variability, low frequency power (LF), high frequency power (HF), and LF/HF ratio were measured in 26 infants. HR changes from Baseline to Heel Stick were significantly less in KC30 and KC15 than in IC, and more infants had HR decrease in IC than in 2 KC conditions. In IC, LF and HF significantly increased from Baseline to Heel Stick and dropped from Heel Stick to Recovery; in 2 KC conditions, no changes across study phases were found. During Heel Stick, LF and HF were significantly higher in IC than in KC30. In all 3 conditions, LF/HF ratio decreased from Baseline to Heel Stick and increased to Recovery; no differences were found between IC and two KC conditions. Both longer and shorter KC before and throughout heel stick can stabilize HR response in preterm infants, and longer KC significantly affected infants' sympathetic and parasympathetic responses during heel stick compared with incubator care. This study showed that KC has a significant effect on reducing autonomic pain responses in preterm infants. The findings support that KC is a safe and effective pain intervention in the neonatal intensive care unit. Copyright © 2012 American Pain Society. Published by Elsevier Inc. All rights reserved.

  8. Sensory and sympathetic correlates of heat pain sensitization and habituation in men and women.

    Science.gov (United States)

    Breimhorst, M; Hondrich, M; Rebhorn, C; May, A; Birklein, F

    2012-10-01

    Habituation and sensitization are important behavioural responses to repeated exposure to painful stimuli, but little is known about the factors determining sensory, affective and sympathetic habituation to repeated pain stimulation in men and women. Thirty volunteers (15 women) underwent a standardized heat pain paradigm spread over 8 consecutive days. At the beginning of the experiment, personality dimensions, coping strategies and pain catastrophizing thoughts were determined. Receiving a series of 10 blocks of six painful heat stimuli a day, participants rated pain intensity and unpleasantness. Skin conductance was recorded throughout the sessions. The results show similar habituation of both the sensory and affective dimensions of pain in men and women, although skin conductance did not undergo a significant decrease across the eight days. When focusing on single daily sessions, women showed pain sensitization but sympathetic habituation, while men showed pain sensitization but stable sympathetic activation. Our findings therefore indicate that the process of long-term habituation to painful heat stimuli is a common feature in both genders, whereas men and women might differently recruit their sympathetic nervous system for short-term pain processing. This study could potentially help to better evaluate gender-specific mechanisms in pain perception. © 2012 European Federation of International Association for the Study of Pain Chapters.

  9. Thermoregulatory responses to skin wetting during prolonged treadmill running.

    Science.gov (United States)

    Bassett, D R; Nagle, F J; Mookerjee, S; Darr, K C; Ng, A V; Voss, S G; Napp, J P

    1987-02-01

    We examined the physiological responses to skin wetting during a 120-min level treadmill run to assess whether skin wetting would reduce the dehydration and the increase in core temperature associated with prolonged exercise. Testing was conducted in an environmental chamber (T = 29.5 degrees C, wind velocity = 3 m X sec-1) under two different humidity conditions (33 or 66% relative humidity). Ten male subjects performed two runs in each humidity condition; one served as a control run. The other included spraying the body with 50 ml of water (T = 29.5 degrees C) every 10 min. Spraying had no effect on rectal temperature (Tre), heart rate, oxygen consumption, perceived exertion, sweat loss, or percent change in plasma volume in both the humid and the dry conditions. Spraying produced a significant reduction in mean skin temperature (Tsk), which increased the (Tre - Tsk) gradient. At the same time, overall skin conductance (K) was decreased, presumably as a result of cutaneous vasoconstriction due to the low Tsk. Since heat transfer from the body's core to the skin is expressed by the equation: heat transfer = K X (Tre - Tsk) the spraying had no effect on heat transfer away from the core, and Tre remained unchanged.

  10. Two-year stability of individual differences in (para)sympathetic and HPA-axis responses to public speaking in childhood and adolescence.

    Science.gov (United States)

    van den Bos, Esther; Westenberg, P Michiel

    2015-03-01

    Long-term stability of individual differences in stress responses has repeatedly been demonstrated in adults, but few studies have investigated the development of stability in adolescence. The present study was the first to investigate the stability of individual differences in heart rate, parasympathetic (RMSSD, pNN50, HF), sympathetic (LF/HF, SC), and HPA-axis (salivary cortisol) responses in a youth sample (8-19 years). Responses to public speaking were measured twice over 2 years. Stability was moderate for absolute responses and task delta responses of HR, RMSSD, pNN50, and HF. Stability was lower for SC and task delta responses of LF/HF and cortisol. Anticipation delta responses showed low stability for HR and cortisol. The latter was moderated by age or puberty, so that individual differences were more stable in more mature individuals. The results support the suggestion that stress responses may be reset during adolescence, but only for the HPA axis. © 2014 Society for Psychophysiological Research.

  11. The Sympathetic Release Test: A Test Used to Assess Thermoregulation and Autonomic Control of Blood Flow

    Science.gov (United States)

    Tansey, E. A.; Roe, S. M.; Johnson, C. J.

    2014-01-01

    When a subject is heated, the stimulation of temperature-sensitive nerve endings in the skin, and the raising of the central body temperature, results in the reflex release of sympathetic vasoconstrictor tone in the skin of the extremities, causing a measurable temperature increase at the site of release. In the sympathetic release test, the…

  12. Response of pig skin to fractionated radiation doses

    International Nuclear Information System (INIS)

    Wiernik, G.; Hopewell, J.W.; Patterson, T.J.S.; Young, C.M.A.; Foster, J.L.

    1977-01-01

    The individual components of a fractionated course of irradiation treatment have been considered separately. Methods of accurate measurement of individual parameters has brought to light different interpretations of the observations. Reasons are given for the necessity of having a radiobiological model which has a direct relevance to the clinical situation. Results are reported for fractionated regimes of irradiation in which the dose has been varied above and below normal tissue tolerance which has been equated with clinical skin necrosis. The components of the acute skin reaction, erythema, pigmentation and desquamation have been analysed separately and their contribution as a method of measurement assessed. Initially, the range of numerical scores attributed to erythema did not reach the scores attributed to necrosis but we now believe that radiation damage expressed as erythema can move directly into necrosis without passing through desquamation. Desquamation, on the other hand, only became a useful parameter at higher dose levels; it has also been shown to be a component associated with skin breakdown. Pigmentation showed no dose response at the dose levels employed in our experiments and it is our belief that this is due to this system being fully saturated under these circumstances. Measurement of the late radiation reaction in the skin has been considered in detail and our results have been expressed by comparing the relative lengths of irradiated and control fields in the same pig. From these findings iso-effect graphs have been constructed and time and fractionation factors have been derived. (author)

  13. Sympathetic arousal, but not disturbed executive functioning, mediates the impairment of cognitive flexibility under stress.

    Science.gov (United States)

    Marko, Martin; Riečanský, Igor

    2018-05-01

    Cognitive flexibility emerges from an interplay of multiple cognitive systems, of which lexical-semantic and executive are thought to be the most important. Yet this has not been addressed by previous studies demonstrating that such forms of flexible thought deteriorate under stress. Motivated by these shortcomings, the present study evaluated several candidate mechanisms implied to mediate the impairing effects of stress on flexible thinking. Fifty-seven healthy adults were randomly assigned to psychosocial stress or control condition while assessed for performance on cognitive flexibility, working memory capacity, semantic fluency, and self-reported cognitive interference. Stress response was indicated by changes in skin conductance, hearth rate, and state anxiety. Our analyses showed that acute stress impaired cognitive flexibility via a concomitant increase in sympathetic arousal, while this mediator was positively associated with semantic fluency. Stress also decreased working memory capacity, which was partially mediated by elevated cognitive interference, but neither of these two measures were associated with cognitive flexibility or sympathetic arousal. Following these findings, we conclude that acute stress impairs cognitive flexibility via sympathetic arousal that modulates lexical-semantic and associative processes. In particular, the results indicate that stress-level of sympathetic activation may restrict the accessibility and integration of remote associates and bias the response competition towards prepotent and dominant ideas. Importantly, our results indicate that stress-induced impairments of cognitive flexibility and executive functions are mediated by distinct neurocognitive mechanisms. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. NaCl and osmolarity produce different responses in organum vasculosum of the lamina terminalis neurons, sympathetic nerve activity and blood pressure.

    Science.gov (United States)

    Kinsman, Brian J; Browning, Kirsteen N; Stocker, Sean D

    2017-09-15

    Changes in extracellular osmolarity stimulate thirst and vasopressin secretion through a central osmoreceptor; however, central infusion of hypertonic NaCl produces a greater sympathoexcitatory and pressor response than infusion of hypertonic mannitol/sorbitol. Neurons in the organum vasculosum of the lamina terminalis (OVLT) sense changes in extracellular osmolarity and NaCl. In this study, we discovered that intracerebroventricular infusion or local OVLT injection of hypertonic NaCl increases lumbar sympathetic nerve activity, adrenal sympathetic nerve activity and arterial blood pressure whereas equi-osmotic mannitol/sorbitol did not alter any variable. In vitro whole-cell recordings demonstrate the majority of OVLT neurons are responsive to hypertonic NaCl or mannitol. However, hypertonic NaCl stimulates a greater increase in discharge frequency than equi-osmotic mannitol. Intracarotid or intracerebroventricular infusion of hypertonic NaCl evokes a greater increase in OVLT neuronal discharge frequency than equi-osmotic sorbitol. Collectively, these novel data suggest that subsets of OVLT neurons respond differently to hypertonic NaCl versus osmolarity and subsequently regulate body fluid homeostasis. These responses probably reflect distinct cellular mechanisms underlying NaCl- versus osmo-sensing. Systemic or central infusion of hypertonic NaCl and other osmolytes readily stimulate thirst and vasopressin secretion. In contrast, central infusion of hypertonic NaCl produces a greater increase in arterial blood pressure (ABP) than equi-osmotic mannitol/sorbitol. Although these responses depend on neurons in the organum vasculosum of the lamina terminalis (OVLT), these observations suggest OVLT neurons may sense or respond differently to hypertonic NaCl versus osmolarity. The purpose of this study was to test this hypothesis in Sprague-Dawley rats. First, intracerebroventricular (icv) infusion (5 μl/10 min) of 1.0 m NaCl produced a significantly greater

  15. Fibromyalgia: When Distress Becomes (Un)sympathetic Pain

    OpenAIRE

    Martinez-Lavin, Manuel

    2012-01-01

    Fibromyalgia is a painful stress-related disorder. A key issue in fibromyalgia research is to investigate how distress could be converted into pain. The sympathetic nervous system is the main element of the stress response system. In animal models, physical trauma, infection, or distressing noise can induce abnormal connections between the sympathetic nervous system and the nociceptive system. Dorsal root ganglia sodium channels facilitate this type of sympathetic pain. Similar mechanisms may...

  16. Influence of chemical peeling on the skin stress response system.

    Science.gov (United States)

    Kimura, Ayako; Kanazawa, Nobuo; Li, Hong-Jin; Yonei, Nozomi; Yamamoto, Yuki; Furukawa, Fukumi

    2012-07-01

    Skin stress response system (SSRS) involves corticotropin-releasing hormone (CRH) and proopiomelanocortin (POMC)-derived peptides, such as adrenocorticotropic hormone (ACTH), a-melanocyte-stimulating hormone (MSH) and b-endorphin that are locally generated in response to locally provided stressors or proinflammatory cytokines. This system would restrict tissue damage and restore local homoeostasis. Trichloroacetic acid (TCA) is one of the most widely used peeling agents and applied for cosmetic treatment of photodamaged skin. However, the biological mechanism responsible for TCA peeling has yet to be fully determined. While our investigation focused on the inflammation and wound healing pathways, in the recent study, we have examined involvement of the SSRS as the third pathway. Mostly depending on our findings that TCA peeling activates the SSRS by inducing the POMC expression of keratinocytes in the CRH-independent manner, together with the results reported by other researchers, we can say that the biological effect of POMC seems to be responsible for the TCA-induced epidermal SSRS activation. © 2012 John Wiley & Sons A/S.

  17. External light activates hair follicle stem cells through eyes via an ipRGC-SCN-sympathetic neural pathway.

    Science.gov (United States)

    Fan, Sabrina Mai-Yi; Chang, Yi-Ting; Chen, Chih-Lung; Wang, Wei-Hung; Pan, Ming-Kai; Chen, Wen-Pin; Huang, Wen-Yen; Xu, Zijian; Huang, Hai-En; Chen, Ting; Plikus, Maksim V; Chen, Shih-Kuo; Lin, Sung-Jan

    2018-06-29

    Changes in external light patterns can alter cell activities in peripheral tissues through slow entrainment of the central clock in suprachiasmatic nucleus (SCN). It remains unclear whether cells in otherwise photo-insensitive tissues can achieve rapid responses to changes in external light. Here we show that light stimulation of animals' eyes results in rapid activation of hair follicle stem cells with prominent hair regeneration. Mechanistically, light signals are interpreted by M1-type intrinsically photosensitive retinal ganglion cells (ipRGCs), which signal to the SCN via melanopsin. Subsequently, efferent sympathetic nerves are immediately activated. Increased norepinephrine release in skin promotes hedgehog signaling to activate hair follicle stem cells. Thus, external light can directly regulate tissue stem cells via an ipRGC-SCN autonomic nervous system circuit. Since activation of sympathetic nerves is not limited to skin, this circuit can also facilitate rapid adaptive responses to external light in other homeostatic tissues.

  18. Sympathetic arousal as a marker of chronicity in childhood stuttering.

    Science.gov (United States)

    Zengin-Bolatkale, Hatun; Conture, Edward G; Walden, Tedra A; Jones, Robin M

    2018-01-01

    This study investigated whether sympathetic activity during a stressful speaking task was an early marker for stuttering chronicity. Participants were 9 children with persisting stuttering, 23 children who recovered, and 17 children who do not stutter. Participants performed a stress-inducing picture-naming task and skin conductance was measured across three time points. Findings indicated that at the initial time point, children with persisting stuttering exhibited higher sympathetic arousal during the stressful speaking task than children whose stuttering recovered. Findings are taken to suggest that sympathetic activity may be an early marker of heightened risk for chronic stuttering.

  19. Response of Human Skin Equivalents to Sarcoptes scabiei

    Science.gov (United States)

    MORGAN, MARJORIE S.; ARLIAN, LARRY G.

    2010-01-01

    Studies have shown that molecules in an extract made from bodies of the ectoparasitic mite, Sarcoptes scabiei De Geer, modulate cytokine secretion from cultured human keratinocytes and fibroblasts. In vivo, in the parasitized skin, these cells interact with each other by contact and cytokine mediators and with the matrix in which they reside. Therefore, these cell types may function differently together than they do separately. In this study, we used a human skin equivalent (HSE) model to investigate the influence of cellular interactions between keratinocytes and fibroblasts when the cells were exposed to active/burrowing scabies mites, mite products, and mite extracts. The HSE consisted of an epidermis of stratified stratum corneum, living keratinocytes, and basal cells above a dermis of fibroblasts in a collagen matrix. HSEs were inoculated on the surface or in the culture medium, and their cytokine secretions on the skin surface and into the culture medium were determined by enzyme-linked immunosorbent assay. Active mites on the surface of the HSE induced secretion of cutaneous T cell-attracting chemokine, thymic stromal lymphopoietin, interleukin (IL)-1α, IL-1β, IL-1 receptor antagonist (IL-1ra), IL-6, IL-8, monocyte chemoattractant protein-1, granulocyte/macrophage colony-stimulating factor, and macrophage colony-stimulating factor. The main difference between HSEs and monocultured cells was that the HSEs produced the proinflammatory cytokines IL-1α and IL-1β and their competitive inhibitor IL-1ra, whereas very little of these mediators was previously found for cultured keratinocytes and fibroblasts. It is not clear how the balance between these cytokines influences the overall host response. However, IL-1ra may contribute to the depression of an early cutaneous inflammatory response to scabies in humans. These contrasting results illustrate that cell interactions are important in the host’s response to burrowing scabies mites. PMID:20939384

  20. Heterogeneous response of cardiac sympathetic function to cardiac resynchronization therapy in heart failure documented by 11[C]-hydroxy-ephedrine and PET/CT

    International Nuclear Information System (INIS)

    Capitanio, Selene; Nanni, Cristina; Marini, Cecilia; Bonfiglioli, Rachele; Martignani, Cristian; Dib, Bassam; Fuccio, Chiara; Boriani, Giuseppe; Picori, Lorena; Boschi, Stefano; Morbelli, Silvia

    2015-01-01

    Introduction: Cardiac resynchronization therapy (CRT) is an accepted treatment in patients with end-stage heart failure. PET permits the absolute quantification of global and regional homogeneity in cardiac sympathetic innervation. We evaluated the variation of cardiac adrenergic activity in patients with idiopathic heart failure (IHF) disease (NYHA III–IV) after CRT using 11 C-hydroxyephedrine (HED) PET/CT. Methods: Ten IHF patients (mean age = 68; range = 55–81; average left ventricular ejection fraction 26 ± 4%) implanted with a resynchronization device underwent three HED PET/CT studies: PET 1 one week after inactive device implantation; PET 2, one week after PET 1 under stimulated rhythm; PET 3, at 3 months under active CRT. A dedicated software (PMOD 3.4 version) was used to estimate global and regional cardiac uptake of HED through 17 segment polar maps. Results: At baseline, HED uptake was heterogeneously distributed throughout the left ventricle with a variation coefficient of 18 ± 5%. This variable markedly decreased after three months CRT (12 ± 5%, p < 0.01). Interestingly, subdividing the 170 myocardial segments (17 segments of each patient multiplied by the number of patients) into two groups, according to the median value of tracer uptake expressed as % of maximal myocardial uptake (76%), we observed a different behaviour depending on baseline innervation: HED uptake significantly increased only in segments with “impaired innervation” (SUV 2.61 ± 0.92 at PET1 and 3.05 ± 1.67 at three months, p < 0.01). Conclusion: As shown by HED PET/CT uptake and distribution, improvement in homogeneity of myocardial neuronal function reflected a selective improvement of tracer uptake in regions with more severe neuronal damage. Advances in Knowledge: These finding supported the presence of a myocardial regional variability in response of cardiac sympathetic system to CRT and a systemic response involving remote tissues with rich adrenergic innervation

  1. A study on the frictional response of reptilian shed skin

    International Nuclear Information System (INIS)

    Abdel-Aal, H A; Vargiolu, R; Zahouani, H; Mansori, M El

    2011-01-01

    Deterministic surfaces are constructs of which profile, topography and textures are integral to the function of the system they enclose. They are designed to yield a predetermined tribological response. Developing such entities relies on controlling the structure of the rubbing interface so that, not only the surface is of optimized topography, but also is able to self-adjust its tribological behaviour according to the evolution of sliding conditions. In seeking inspirations for such designs, many engineers are turning toward the biological world to study the construction and behaviour of bio-analogues, and to probe the role surface topography assumes in conditioning of frictional response. That is how a bio-analogue can self-adjust its tribological response to adapt to habitat constraints. From a tribological point of view, Squamate Reptiles, offer diverse examples where surface texturing, submicron and nano-scale features, achieves frictional regulation. In this paper, we study the frictional response of shed skin obtained from a snake (Python regius). The study employed a specially designed tribo-acoustic probe capable of measuring the coefficient of friction and detecting the acoustical behavior of the skin in vivo. The results confirm the anisotropy of the frictional response of snakes. The coefficient of friction depends on the direction of sliding: the value in forward motion is lower than that in the backward direction. Diagonal and side winding motion induces a different value of the friction coefficient. We discuss the origin of such a phenomenon in relation to surface texturing and study the energy constraints, implied by anisotropic friction, on the motion of the reptile.

  2. A study on the frictional response of reptilian shed skin

    Energy Technology Data Exchange (ETDEWEB)

    Abdel-Aal, H A [Arts et Metier ParisTech, Rue Saint Dominique BP 508, 51006 Chalons-en-Champagne (France); Vargiolu, R; Zahouani, H [Laboratoire de Tribology et Dynamique des Systemes, UMR CNRS 5513, ENI Saint Etienne - Ecole Centrale de Lyon -36 Avenue Guy de Collongue, 69131 Ecully cedex. France (France); Mansori, M El, E-mail: Hisham.abdel-aal@ensam.eu [Ecole Nationale Superieure d' Arts et Metiers, 2, cours des Arts et Metiers - 13617 Aix en Provence cedex 1 (France)

    2011-08-19

    Deterministic surfaces are constructs of which profile, topography and textures are integral to the function of the system they enclose. They are designed to yield a predetermined tribological response. Developing such entities relies on controlling the structure of the rubbing interface so that, not only the surface is of optimized topography, but also is able to self-adjust its tribological behaviour according to the evolution of sliding conditions. In seeking inspirations for such designs, many engineers are turning toward the biological world to study the construction and behaviour of bio-analogues, and to probe the role surface topography assumes in conditioning of frictional response. That is how a bio-analogue can self-adjust its tribological response to adapt to habitat constraints. From a tribological point of view, Squamate Reptiles, offer diverse examples where surface texturing, submicron and nano-scale features, achieves frictional regulation. In this paper, we study the frictional response of shed skin obtained from a snake (Python regius). The study employed a specially designed tribo-acoustic probe capable of measuring the coefficient of friction and detecting the acoustical behavior of the skin in vivo. The results confirm the anisotropy of the frictional response of snakes. The coefficient of friction depends on the direction of sliding: the value in forward motion is lower than that in the backward direction. Diagonal and side winding motion induces a different value of the friction coefficient. We discuss the origin of such a phenomenon in relation to surface texturing and study the energy constraints, implied by anisotropic friction, on the motion of the reptile.

  3. Dramatic response to nivolumab in xeroderma pigmentosum skin tumor.

    Science.gov (United States)

    Chambon, Fanny; Osdoit, Sophie; Bagny, Kelly; Moro, Anne; Nguyen, Jacqueline; Réguerre, Yves

    2018-02-01

    We report the case of a 6-year-old female with xeroderma pigmentosum (XP) who developed a nonoperable scalp tumor, treated with anti-programmed cell death protein 1 (anti-PD-1) therapy (nivolumab). She presented with a sarcomatoid carcinoma of the scalp with bone lysis as well as vascular and meningeal contact. Nivolumab was initiated because it has emerged as a promising immunotherapy. We observed a dramatic tumor response with excellent tolerance. However, while on nivolumab therapy she developed two large skin melanomas and several squamous cell carcinomas, which have been resected. These results demonstrate that cancer immunotherapy in patients with XP can be impressive but complex and warrants further investigation. © 2017 Wiley Periodicals, Inc.

  4. The choice of sensitive skin layer responsible for aftereffects of daily irradiation of the skin

    International Nuclear Information System (INIS)

    Keirim-Markus, I.B.

    1992-01-01

    The choice of sensitive human skin layer manifesting in delayed period after daily irradiation of the human skin (stochastic and determined effects) was evaluated. It was established that delayed aftereffects of daily radiation of the skin manifested as epidem damages. This layer of papilla derma of 10-15 mg/cm 2 thick situated at the great part of body surface, 15 mg/cm 2 on dorsal side of hands and 40 mg/cm 2 on palms and pillows of the fingers. Sensitive layer of skin dosimeter for a control of daily irradiation of people must have the same geometry

  5. Blood pressure response to catheter-based renal sympathetic denervation in severe resistant hypertension: data from the Greek Renal Denervation Registry.

    Science.gov (United States)

    Tsioufis, C; Ziakas, A; Dimitriadis, K; Davlouros, P; Marketou, M; Kasiakogias, A; Thomopoulos, C; Petroglou, D; Tsiachris, D; Doumas, M; Skalidis, E; Karvounis, C; Alexopoulos, D; Vardas, P; Kallikazaros, I; Stefanadis, C; Papademetriou, V; Tousoulis, D

    2017-05-01

    The efficacy of catheter-based renal sympathetic denervation (RDN) in terms of blood pressure (BP) reduction has been questioned, while "real-world" data from registries are needed. In this study, we report the complete set of 12-month data on office and ambulatory BP changes as well as the predictors for BP response to RDN from a national registry. In 4 Greek hospital centers, 79 patients with severe drug-resistant hypertension (age 59 ± 10 years, 53 males, body mass index 33 ± 5 kg/m 2 ; office BP and 24-h ambulatory BP were 176 ± 15/95 ± 13 and 155 ± 14/90 ± 12 mmHg, respectively, 4.4 ± 0.9 antihypertensive drugs) underwent RDN and were followed-up for 12 months in the Greek Renal Denervation Registry. Bilateral RDN was performed using percutaneous femoral approach and standardized techniques. Reduction in office systolic/diastolic BP at 6 and 12 months from baseline was -30/-12 and -29/-12 mmHg, while the reduction in 24-h ambulatory BP was -16/-9 and -15/-9 mmHg, respectively (p renal function and any new serious device or procedure-related adverse events. In our "real-world" multicenter national registry, the efficacy of renal denervation in reducing BP as well as safety is confirmed during a 12-month follow-up. Moreover, younger age, obesity, and higher levels of baseline systolic BP are independently related to better BP response to RDN.

  6. Sympathetic chain Schwannoma

    International Nuclear Information System (INIS)

    Al-Mashat, Faisal M.

    2009-01-01

    Schwannomas are rare, benign, slowly growing tumors arising from Schwann cells that line nerve sheaths. Schwannomas arising from the cervical sympathetic chain are extremely rare. Here, we report a case of a 70-year-old man who presented with only an asymptomatic neck mass. Physical examination revealed a left sided Horner syndrome and a neck mass with transmitted pulsation and anterior displacement of the carotid artery. Computed tomography (CT) showed a well-defined non-enhancing mass with vascular displacement. The nerve of origin of this encapsulated tumor was the sympathetic chain. The tumor was excised completely intact. The pathologic diagnosis was Schwannoma (Antoni type A and Antoni type B). The patient has been well and free of tumor recurrence for 14 months with persistence of asymptomatic left sided Horner syndrome. The clinical, radiological and pathological evaluations, therapy and postoperative complications of this tumor are discussed. (author)

  7. Calibration of thermoluminescence skin dosemeter response to beta emitters found in Ontario Hydro nuclear power stations

    International Nuclear Information System (INIS)

    Walsh, M.L.; Agnew, D.A.; Donnelly, K.E.

    1984-01-01

    The response of the Ontario Hydro Thermoluminescence Dosimetry System to beta radiation in nuclear power station environments was evaluated. Synthetic beta spectra were constructed, based on activity samples from heat transport systems and fuelling machine contamination smears at nuclear power stations. Using these spectra and dosemeter energy response functions, an overall response factor for the skin dosemeter relative to skin dose at 7 mg.cm -2 was calculated. This calculation was done assuming three specific geometries: (1) an infinite uniformly contaminated plane source at a distance of 33 cm (50 mg.cm -2 total shielding) from the receptor; (2) an infinite cloud surrounding the receptor; (3) a point source at 33 cm. Based on these calculations, a conservative response factor of 0.7 has been chosen. This provides an equation for skin dose assignment, i.e. Skin Dose = 1.4 x Skin Dosemeter Reading when the skin dosemeter is directly calibrated in mGy(gamma). (author)

  8. Do intensity ratings and skin conductance responses reliably discriminate between different stimulus intensities in experimentally induced pain?

    Science.gov (United States)

    Breimhorst, Markus; Sandrock, Stephan; Fechir, Marcel; Hausenblas, Nadine; Geber, Christian; Birklein, Frank

    2011-01-01

    The present study addresses the question whether pain-intensity ratings and skin conductance responses (SCRs) are able to detect different intensities of phasic painful stimuli and to determine the reliability of this discrimination. For this purpose, 42 healthy participants of both genders were assigned to either electrical, mechanical, or laser heat-pain stimulation (each n = 14). A whole range of single brief painful stimuli were delivered on the right volar forearm of the dominant hand in a randomized order. Pain-intensity ratings and SCRs were analyzed. Using generalizability theory, individual and gender differences were the main contributors to the variability of both intensity ratings and SCRs. Most importantly, we showed that pain-intensity ratings are a reliable measure for the discrimination of different pain stimulus intensities in the applied modalities. The reliability of SCR was adequate when mechanical and heat stimuli were tested but failed for the discrimination of electrical stimuli. Further studies are needed to reveal the reason for this lack of accuracy for SCRs when applying electrical pain stimuli. Our study could help researchers to better understand the relationship between pain and activation of the sympathetic nervous system. Pain researchers are furthermore encouraged to consider individual and gender differences when measuring pain intensity and the concomitant SCRs in experimental settings. Copyright © 2011 American Pain Society. Published by Elsevier Inc. All rights reserved.

  9. Skin Blood Perfusion and Cellular Response to Insertion of Insulin Pen Needles With Different Diameters

    DEFF Research Database (Denmark)

    Præstmark, Kezia Ann; Stallknecht, Bente Merete; Bo Jensen, Casper

    2014-01-01

    skin blood perfusion response around needle insertion sites. Three common sized pen needles of 28G, 30G, and 32G as well as hooked 32G needles, were inserted into the neck skin of pigs and then removed. Laser Speckle Contrast Analysis was used to measure skin blood perfusion for 20 minutes after...... blood perfusion recording and grouped according to needle type, skin blood perfusion response relates to needle diameter. The response was significantly higher after insertions with 28G and hooked 32G needles than with 30G (P ..., but there was a trend of an increased response with increasing needle diameter. Skin blood perfusion response to pen needle insertions rank according to needle diameter, and the tissue response caused by hooked 32G needles corresponds to that of 28G needles. The relation between needle diameter and trauma when...

  10. Appreciating the image of God in all humanity: Towards a pastoral response to skin lightening as image enhancement to exit dark skin

    Directory of Open Access Journals (Sweden)

    Noah K. Tenai

    2016-05-01

    Full Text Available The practice of skin lightening is prevalent amongst dark-skinned people globally. Various current studies that map this practice and that seek motivations behind the practice are examined. It is observed that through shrewd marketing, dark-skinned people are offered a promise of a better quality of life, obtained by a lighter skin, through the use of skin lighteners. In spite of the severe health risks involved, the promise is ostensibly irresistible to some dark-skinned persons. A pastoral response is offered that affirms the full personhood and complete humanity of dark-skinned people as fully human and whole in their dark skins. Keywords: Skin lightening, Dark skin, Image of God

  11. Dose-response relationships and threshold levels in skin and respiratory allergy

    NARCIS (Netherlands)

    Arts, J.H.E.; Mommers, C.; Heer, C.de

    2006-01-01

    A literature study was performed to evaluate dose-response relationships and no-effect levels for sensitization and elicitation in skin- and respiratory allergy. With respect to the skin, dose-response relationships and no-effect levels were found for both intradermal and topical induction, as well

  12. Resting sympathetic activity is associated with the sympathetically mediated component of energy expenditure following a meal.

    Science.gov (United States)

    Limberg, Jacqueline K; Malterer, Katherine R; Matzek, Luke J; Levine, James A; Charkoudian, Nisha; Miles, John M; Joyner, Michael J; Curry, Timothy B

    2017-08-01

    Individuals with high plasma norepinephrine (NE) levels at rest have a smaller reduction in resting energy expenditure (REE) following β -adrenergic blockade. If this finding extends to the response to a meal, it could have important implications for the role of the sympathetic nervous system in energy balance and weight gain. We hypothesized high muscle sympathetic nerve activity (MSNA) would be associated with a low sympathetically mediated component of energy expenditure following a meal. Fourteen young, healthy adults completed two visits randomized to continuous saline (control) or intravenous propranolol to achieve systemic β -adrenergic blockade. Muscle sympathetic nerve activity and REE were measured (indirect calorimetry) followed by a liquid mixed meal (Ensure). Measures of energy expenditure continued every 30 min for 5 h after the meal and are reported as an area under the curve (AUC). Sympathetic support of energy expenditure was calculated as the difference between the AUC during saline and β -blockade (AUC P ropranolol -AUC S aline , β -REE) and as a percent (%) of control (AUC P ropranolol ÷AUC S aline  × 100). β -REE was associated with baseline sympathetic activity, such that individuals with high resting MSNA (bursts/100 heart beats) and plasma NE had the greatest sympathetically mediated component of energy expenditure following a meal (MSNA: β -REE R  =   -0.58, P =  0.03; %REE R  = -0.56, P =  0.04; NE: β -REE R  = -0.55, P  = 0.0535; %REE R  = -0.54, P  = 0.0552). Contrary to our hypothesis, high resting sympathetic activity is associated with a greater sympathetically mediated component of energy expenditure following a liquid meal. These findings may have implications for weight maintenance in individuals with varying resting sympathetic activity. © 2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.

  13. Reduced lymphoid response to skin allotransplants in cows with hepatic lipidosis.

    Science.gov (United States)

    Wentink, G H; van den Ingh, T S; Rutten, V P; Müller, K E; Wensing, T

    1999-04-01

    The immune responsiveness of cows with hepatic lipidosis (fatty liver) in comparison to control cows with a normal liver fat content was tested by applying skin allotransplants to the skin of the back of cows on day 3 after parturition. Immunoreactivity was determined by semiquantitative counting of the number of infiltrating lymphocytes in the recipient skin adjacent to the allotransplants during a period of 21 days. There were more invading lymphocytes in samples from control cows than there were in samples from cows with hepatic lipidosis. It was concluded that cows with hepatic lipidosis have a reduced lymphoid response to skin allotransplants.

  14. Skin

    International Nuclear Information System (INIS)

    Hunter, R.D.

    1985-01-01

    Malignant disease involving the skin represents a significant work load to the general radiotherapist and can involve interesting diagnostic and therapeutic decisions. Primary skin cancer is also relatively common and there is a need to provide an efficient service in which the first treatment is successful in the majority of patients. The reward for careful attention to technique is very considerable both in terms of clinical cancer control and functional results. Squamous cell carcinoma, basal cell carcinoma, and intra-epidermal carcinoma constitute the majority of the lesions dealt with clinically, but metastatic disease, lymphomas, and malignant melanomas are also referred regularly for opinions and may require radiotherapy. The general principle of the techniques of assessment and radiotherapeutic management to be described are equally applicable to any malignant skin tumour once the decision has been made to accept it for radiotherapy. Dosage and fractionation may have to be adjusted to allow for the nature of the disease process and the intent of the treatment

  15. Distribution of T Cells in Rainbow Trout (Oncorhynchus mykiss) Skin and Responsiveness to Viral Infection

    Science.gov (United States)

    Leal, Esther; Granja, Aitor G.; Zarza, Carlos; Tafalla, Carolina

    2016-01-01

    Although the skin constitutes the first line of defense against waterborne pathogens, there is a great lack of information regarding the skin associated lymphoid tissue (SALT) and whether immune components of the skin are homogeneously distributed through the surface of the fish is still unknown. In the current work, we have analyzed the transcription of several immune genes throughout different rainbow trout (Oncorhynchus mykiss) skin areas. We found that immunoglobulin and chemokine gene transcription levels were higher in a skin area close to the gills. Furthermore, this skin area as well as other anterior sections also transcribed significantly higher levels of many different immune genes related to T cell immunity such as T cell receptor α (TCRα), TCRγ, CD3, CD4, CD8, perforin, GATA3, Tbet, FoxP3, interferon γ (IFNγ), CD40L and Eomes in comparison to posterior skin sections. In agreement with these results, immunohistochemical analysis revealed that anterior skin areas had a higher concentration of CD3+ T cells and flow cytometry analysis confirmed that the percentage of CD8+ T lymphocytes was also higher in anterior skin sections. These results demonstrate for the first time that T cells are not homogeneously distributed throughout the teleost skin. Additionally, we studied the transcriptional regulation of these and additional T cell markers in response to a bath infection with viral hemorrhagic septicemia virus (VHSV). We found that VHSV regulated the transcription of several of these T cell markers in both the skin and the spleen; with some differences between anterior and posterior skin sections. Altogether, our results point to skin T cells as major players of teleost skin immunity in response to waterborne viral infections. PMID:26808410

  16. Characterization of the early local immune response to Ixodes ricinus tick bites in human skin.

    Science.gov (United States)

    Glatz, Martin; Means, Terry; Haas, Josef; Steere, Allen C; Müllegger, Robert R

    2017-03-01

    Little is known about the immunomodulation by tick saliva during a natural tick bite in human skin, the site of the tick-host interaction. We examined the expression of chemokines, cytokines and leucocyte markers on the mRNA levels and histopathologic changes in human skin biopsies of tick bites (n=37) compared to unaffected skin (n=9). Early tick-bite skin lesions (skin. With longer tick attachment (>24 hours), the numbers of innate immune cells and mediators (not significantly) declined, whereas the numbers of lymphocytes (not significantly) increased. Natural tick bites by Ixodes ricinus ticks initially elicit a strong local innate immune response in human skin. Beyond 24 hours of tick attachment, this response usually becomes less, perhaps because of immunomodulation by tick saliva. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. Effect of skin temperature on cutaneous vasodilator response to the β-adrenergic agonist isoproterenol

    OpenAIRE

    Hodges, Gary J.; Kellogg, Dean L.; Johnson, John M.

    2015-01-01

    The vascular response to local skin cooling is dependent in part on a cold-induced translocation of α2C-receptors and an increased α-adrenoreceptor function. To discover whether β-adrenergic function might contribute, we examined whether β-receptor sensitivity to the β-agonist isoproterenol was affected by local skin temperature. In seven healthy volunteers, skin blood flow was measured from the forearm by laser-Doppler flowmetry and blood pressure was measured by finger photoplethysmography....

  18. [Nerve growth factor and the physiology of pain: the relationships among interoception, sympathetic neurons and the emotional response indicated by the molecular pathophysiology of congenital insensitivity to pain with anhidrosis].

    Science.gov (United States)

    Indo, Yasuhiro

    2015-05-01

    Nerve growth factor (NGF) is a neurotrophic factor essential for the survival and maintenance of neurons. Congenital insensitivity to pain with anhidrosis (CIPA) is caused by loss-of-function mutations in NTRK1, which encodes a receptor tyrosine kinase, TrkA, for NGF. Mutations in NTRK1 cause the selective loss of NGF-dependent neurons, including both NGF-dependent primary afferents and sympathetic postganglionic neurons, in otherwise intact systems. The NGF-dependent primary afferents are thinly myelinated AΔ or unmyelinated C-fibers that are dependent on the NGF-TrkA system during development. NGF-dependent primary afferents are not only nociceptive neurons that transmit pain and temperature sensation, but also are polymodal receptors that play essential roles for interoception by monitoring various changes in the physiological status of all tissues in the body. In addition, they contribute to various inflammatory processes in acute, chronic and allergic inflammation. Together with sympathetic postganglionic neurons, they maintain the homeostasis of the body and emotional responses via interactions with the brain, immune and endocrine systems. Pain is closely related to emotions that accompany physical responses induced by systemic activation of the sympathetic nervous system. In contrast to a negative image of emotions in daily life, Antonio Damasio proposed the 'Somatic Marker Hypothesis', wherein emotions play critical roles in the decision-making and reasoning processes. According to this hypothesis, reciprocal communication between the brain and the body-proper are essential for emotional responses. Using the pathophysiology of CIPA as a foundation, this article suggests that NGF-dependent neurons constitute a part of the neuronal network required for homeostasis and emotional responses, and indicates that this network plays important roles in mediating the reciprocal communication between the brain and the body-proper.

  19. AMPUTATION AND REFLEX SYMPATHETIC DYSTROPHY

    NARCIS (Netherlands)

    GEERTZEN, JHB; EISMA, WH

    Reflex sympathetic dystrophy is a chronic pain syndrome characterized by chronic burning pain, restricted range of motion, oedema and vasolability. Patients are difficult to treat and the prognosis is very often poor. This report emphasizes that an amputation in case of a reflex sympathetic

  20. Mechanisms responsible for postmenopausal hypertension in a rat model: Roles of the renal sympathetic nervous system and the renin-angiotensin system.

    Science.gov (United States)

    Maranon, Rodrigo O; Reckelhoff, Jane F

    2016-02-01

    Hypertension in postmenopausal women is less well controlled than in age-matched men. The aging female SHR is a model of postmenopausal hypertension that is mediated in part by activation of the renin-angiotensin system (RAS) and by the renal sympathetic nervous system. In this study, the hypothesis was tested that renal denervation would lower the blood pressure in old female SHR and would attenuate the antihypertensive effects of AT1 receptor antagonism. Retired breeder female SHR were subjected to right uninephrectomy (UNX) and left renal denervation (RD) or UNX and sham, and 2 weeks later, baseline mean arterial pressure (MAP; radiotelemetry) was measured for 4 days, and then rats were treated with angiotensin (AT1) receptor antagonist, losartan (40 mg/kg/day po) for 6 days. Renal denervation reduced MAP in old females compared to sham (172 ± 6 vs. 193 ± 6 mm Hg; P renal sympathetic nervous system and the RAS have independent effects to control the blood pressure in old female SHR. Since the denervated rats treated with losartan remained hypertensive, the data also suggest that other mechanisms than the RAS and renal sympathetic nervous system contribute to the hypertension in old female SHR. The data also suggest that multiple mechanisms may mediate the elevated blood pressure in postmenopausal women. © 2016 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

  1. Effect of skin temperature on cutaneous vasodilator response to the β-adrenergic agonist isoproterenol.

    Science.gov (United States)

    Hodges, Gary J; Kellogg, Dean L; Johnson, John M

    2015-04-01

    The vascular response to local skin cooling is dependent in part on a cold-induced translocation of α2C-receptors and an increased α-adrenoreceptor function. To discover whether β-adrenergic function might contribute, we examined whether β-receptor sensitivity to the β-agonist isoproterenol was affected by local skin temperature. In seven healthy volunteers, skin blood flow was measured from the forearm by laser-Doppler flowmetry and blood pressure was measured by finger photoplethysmography. Data were expressed as cutaneous vascular conductance (CVC; laser-Doppler flux/mean arterial blood pressure). Pharmacological agents were administered via intradermal microdialysis. We prepared four skin sites: one site was maintained at a thermoneutral temperature of 34°C (32 ± 10%CVCmax) one site was heated to 39°C (38 ± 11%CVCmax); and two sites were cooled, one to 29°C (22 ± 7%CVCmax) and the other 24°C (16 ± 4%CVCmax). After 20 min at these temperatures to allow stabilization of skin blood flow, isoproterenol was perfused in concentrations of 10, 30, 100, and 300 μM. Each concentration was perfused for 15 min. Relative to the CVC responses to isoproterenol at the thermoneutral skin temperature (34°C) (+21 ± 10%max), low skin temperatures reduced (at 29°C) (+17 ± 6%max) or abolished (at 24°C) (+1 ± 5%max) the vasodilator response, and warm (39°C) skin temperatures enhanced the vasodilator response (+40 ± 9%max) to isoproterenol. These data indicate that β-adrenergic function was influenced by local skin temperature. This finding raises the possibility that a part of the vasoconstrictor response to direct skin cooling could include reduced background β-receptor mediated vasodilation. Copyright © 2015 the American Physiological Society.

  2. Intracranial Pressure Is a Determinant of Sympathetic Activity

    Directory of Open Access Journals (Sweden)

    Eric A. Schmidt

    2018-02-01

    Full Text Available Intracranial pressure (ICP is the pressure within the cranium. ICP rise compresses brain vessels and reduces cerebral blood delivery. Massive ICP rise leads to cerebral ischemia, but it is also known to produce hypertension, bradycardia and respiratory irregularities due to a sympatho-adrenal mechanism termed Cushing response. One still unresolved question is whether the Cushing response is a non-synaptic acute brainstem ischemic mechanism or part of a larger physiological reflex for arterial blood pressure control and homeostasis regulation. We hypothesize that changes in ICP modulates sympathetic activity. Thus, modest ICP increase and decrease were achieved in mice and patients with respectively intra-ventricular and lumbar fluid infusion. Sympathetic activity was gauged directly by microneurography, recording renal sympathetic nerve activity in mice and muscle sympathetic nerve activity in patients, and gauged indirectly in both species by heart-rate variability analysis. In mice (n = 15, renal sympathetic activity increased from 29.9 ± 4.0 bursts.s−1 (baseline ICP 6.6 ± 0.7 mmHg to 45.7 ± 6.4 bursts.s−1 (plateau ICP 38.6 ± 1.0 mmHg and decreased to 34.8 ± 5.6 bursts.s−1 (post-infusion ICP 9.1 ± 0.8 mmHg. In patients (n = 10, muscle sympathetic activity increased from 51.2 ± 2.5 bursts.min−1 (baseline ICP 8.3 ± 1.0 mmHg to 66.7 ± 2.9 bursts.min−1 (plateau ICP 25 ± 0.3 mmHg and decreased to 58.8 ± 2.6 bursts.min−1 (post-infusion ICP 14.8 ± 0.9 mmHg. In patients 7 mmHg ICP rise significantly increases sympathetic activity by 17%. Heart-rate variability analysis demonstrated a significant vagal withdrawal during the ICP rise, in accordance with the microneurography findings. Mice and human results are alike. We demonstrate in animal and human that ICP is a reversible determinant of efferent sympathetic outflow, even at relatively low ICP levels. ICP is a biophysical stress related to the forces within the brain. But ICP

  3. Temperament affects sympathetic nervous function in a normal population.

    Science.gov (United States)

    Kim, Bora; Lee, Jae-Hon; Kang, Eun-Ho; Yu, Bum-Hee

    2012-09-01

    Although specific temperaments have been known to be related to autonomic nervous function in some psychiatric disorders, there are few studies that have examined the relationship between temperaments and autonomic nervous function in a normal population. In this study, we examined the effect of temperament on the sympathetic nervous function in a normal population. Sixty eight healthy subjects participated in the present study. Temperament was assessed using the Korean version of the Cloninger Temperament and Character Inventory (TCI). Autonomic nervous function was determined by measuring skin temperature in a resting state, which was recorded for 5 minutes from the palmar surface of the left 5th digit using a thermistor secured with a Velcro® band. Pearson's correlation analysis and multiple linear regression were used to examine the relationship between temperament and skin temperature. A higher harm avoidance score was correlated with a lower skin temperature (i.e. an increased sympathetic tone; r=-0.343, p=0.004) whereas a higher persistence score was correlated with a higher skin temperature (r=0.433, p=0.001). Hierarchical linear regression analysis revealed that harm avoidance was able to predict the variance of skin temperature independently, with a variance of 7.1% after controlling for sex, blood pressure and state anxiety and persistence was the factor predicting the variance of skin temperature with a variance of 5.0%. These results suggest that high harm avoidance is related to an increased sympathetic nervous function whereas high persistence is related to decreased sympathetic nervous function in a normal population.

  4. p120-catenin mediates inflammatory responses in the skin

    DEFF Research Database (Denmark)

    Perez-Moreno, Mirna; Davis, Michael A; Wong, Ellen

    2006-01-01

    but no overt disruption in barrier function or intercellular adhesion. As the mice age, however, they display epidermal hyperplasia and chronic inflammation, typified by hair degeneration and loss of body fat. Using skin engraftments and anti-inflammatory drugs, we show that these features are not attributable...

  5. Effect of sympathetic activity on capsaicin-evoked pain, hyperalgesia, and vasodilatation.

    Science.gov (United States)

    Baron, R; Wasner, G; Borgstedt, R; Hastedt, E; Schulte, H; Binder, A; Kopper, F; Rowbotham, M; Levine, J D; Fields, H L

    1999-03-23

    Painful nerve and tissue injuries can be exacerbated by activity in sympathetic neurons. The mechanisms of sympathetically maintained pain (SMP) are unclear. To determine the effect of cutaneous sympathetic activity on pain induced by primary afferent C-nociceptor sensitization with capsaicin in humans. In healthy volunteers capsaicin was applied topically (n = 12) or injected into the forearm skin (n = 10) to induce spontaneous pain, dynamic and punctate mechanical hyperalgesia, and antidromic (axon reflex) vasodilatation (flare). Intensity of pain and hyperalgesia, axon reflex vasodilatation (laser Doppler), and flare size and area of hyperalgesia (planimetry) were assessed. The local skin temperature at the application and measurement sites was kept constant at 35 degrees C. In each individual the analyses were performed during the presence of high and low sympathetic skin activity induced by whole-body cooling and warming with a thermal suit. By this method sympathetic vasoconstrictor activity is modulated in the widest range that can be achieved physiologically. The degree of vasoconstrictor discharge was monitored by measuring skin blood flow (laser Doppler) and temperature (infrared thermometry) at the index finger. The intensity and spatial distribution of capsaicin-evoked spontaneous pain and dynamic and punctate mechanical hyperalgesia were identical during the presence of high and low sympathetic discharge. Antidromic vasodilatation and flare size were significantly diminished when sympathetic vasoconstrictor neurons were excited. Cutaneous sympathetic vasoconstrictor activity does not influence spontaneous pain and mechanical hyperalgesia after capsaicin-induced C-nociceptor sensitization. When using physiologic stimulation of sympathetic activity, the capsaicin model is not useful for elucidating mechanisms of SMP. In neuropathic pain states with SMP, different mechanisms may be present.

  6. Sympathetic Response and Outcomes Following Renal Denervation in Patients With Chronic Heart Failure: 12-Month Outcomes From the Symplicity HF Feasibility Study.

    Science.gov (United States)

    Hopper, Ingrid; Gronda, Edoardo; Hoppe, Uta C; Rundqvist, Bengt; Marwick, Thomas H; Shetty, Sharad; Hayward, Christopher; Lambert, Thomas; Hering, Dagmara; Esler, Murray; Schlaich, Markus; Walton, Antony; Airoldi, Flavio; Brandt, Mathias C; Cohen, Sidney A; Reiters, Pascalle; Krum, Henry

    2017-09-01

    Heart failure (HF) is associated with chronic sympathetic activation. Renal denervation (RDN) aims to reduce sympathetic activity by ablating the renal sympathetic nerves. We investigated the effect of RDN in patients with chronic HF and concurrent renal dysfunction in a prospective, multicenter, single-arm feasibility study. Thirty-nine patients with chronic systolic HF (left ventricular ejection fraction [LVEF] renal impairment (estimated glomerular filtration rate [eGFR; assessed with the use of the Modification of Diet in Renal Disease equation] renal artery occlusion that was possibly related to the denervation procedure. Statistically significant reductions in N-terminal pro-B-type natriuretic peptide (NT-proBNP; 1530 ± 1228 vs 1428 ± 1844 ng/mL; P = .006) and 120-minute glucose tolerance test (11.2 ± 5.1 vs 9.9 ± 3.6; P = .026) were seen at 12 months, but there was no significant change in LVEF (28 ± 9% vs 29 ± 11%; P= .536), 6-minute walk test (384 ± 96 vs 391 ± 97 m; P= .584), or eGFR (52.6 ± 15.3 vs 52.3 ± 18.5 mL • min -1  • 1.73 m -2 ; P= .700). RDN was associated with reductions in NT-proBNP and 120-minute glucose tolerance test in HF patients 12 months after RDN treatment. There was no deterioration in other indices of cardiac and renal function in this small feasibility study. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Fractionated laser resurfacing corrects the inappropriate UVB response in geriatric skin.

    Science.gov (United States)

    Spandau, Dan F; Lewis, Davina A; Somani, Ally-Khan; Travers, Jeffrey B

    2012-06-01

    Non-melanoma skin cancer is a disease primarily afflicting geriatric patients as evidenced by the fact that 80% of all non-melanoma skin cancers are diagnosed in patients over the age of 60 years. As such, geriatric skin responds to cancer-inducing UVB irradiation in a manner that allows the establishment of tumor cells. Currently, the only effective treatment for non-melanoma skin cancer is the removal of the tumors after they appear, indicating the need for a more cost-effective prophylactic therapy. Geriatric volunteers were treated with fractionated laser resurfacing therapy on either sun-protected (upper buttocks) or chronically sun-exposed (dorsal forearm) skin. Fractionated laser resurfacing therapy was shown to decrease the occurrence of senescent fibroblasts in geriatric dermis, increase the dermal expression of IGF-1, and correct the inappropriate UVB response observed in untreated geriatric skin. These responses to fractionated laser resurfacing were equal to the effects seen previously using the more aggressive wounding following dermabrasion. Furthermore, fractionated laser resurfacing was equally effective in both sun-protected and sun-exposed skin. The ability of fractionated laser resurfacing treatment to protect against the occurrence of UVB-damaged proliferating keratinocytes indicates the potential of fractionated laser resurfacing to reduce or prevent aging-associated non-melanoma skin cancer.

  8. Skin response to cobalt 60 irradiation and the consequences for matching the color of facial prostheses

    International Nuclear Information System (INIS)

    van Oort, R.P.; Vermey, J.; Ten Bosch, J.J.

    1984-01-01

    A radiotherapy treatment ( 60 Co) of cancer in the head and neck region causes side effects in the skin that postpone the facial prosthetic treatment. The increasing and fading erythema and pigmentation of the skin was investigated with the use of a subtractive colorimeter. This method was verified with photographs scored according to the Oxford scoring system. Fourteen patients were investigated during a period of 24 weeks. The mean colorimetric skin response showed a peak 6 weeks after the onset of irradiation. Six to 7 weeks later, there was no significant difference between the skin color before and after irradiation. At this time the dry desquamation of the skin is healed. From this viewpoint, the color matching procedure for a facial prosthesis may start not earlier than 15 weeks from the onset of irradiation. If a nonirradiated control field in the facial region is present, a color match for the facial prosthesis can be started just after the irradiation period

  9. SYMPATHETIC SOLAR FILAMENT ERUPTIONS

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Rui; Liu, Ying D.; Zimovets, Ivan; Hu, Huidong; Yang, Zhongwei [State Key Laboratory of Space Weather, National Space Science Center, Chinese Academy of Sciences, Beijing 100190 (China); Dai, Xinghua, E-mail: liuxying@spaceweather.ac.cn [Key Laboratory of Solar Activity, National Astronomical Observatories, Chinese Academy of Sciences, Beijing 100012 (China)

    2016-08-10

    The 2015 March 15 coronal mass ejection as one of the two that together drove the largest geomagnetic storm of solar cycle 24 so far was associated with sympathetic filament eruptions. We investigate the relations between the different filaments involved in the eruption. A surge-like small-scale filament motion is confirmed as the trigger that initiated the erupting filament with multi-wavelength observations and using a forced magnetic field extrapolation method. When the erupting filament moved to an open magnetic field region, it experienced an obvious acceleration process and was accompanied by a C-class flare and the rise of another larger filament that eventually failed to erupt. We measure the decay index of the background magnetic field, which presents a critical height of 118 Mm. Combining with a potential field source surface extrapolation method, we analyze the distributions of the large-scale magnetic field, which indicates that the open magnetic field region may provide a favorable condition for F2 rapid acceleration and have some relation with the largest solar storm. The comparison between the successful and failed filament eruptions suggests that the confining magnetic field plays an important role in the preconditions for an eruption.

  10. The effect of surface wave propagation on neural responses to vibration in primate glabrous skin.

    Directory of Open Access Journals (Sweden)

    Louise R Manfredi

    Full Text Available Because tactile perception relies on the response of large populations of receptors distributed across the skin, we seek to characterize how a mechanical deformation of the skin at one location affects the skin at another. To this end, we introduce a novel non-contact method to characterize the surface waves produced in the skin under a variety of stimulation conditions. Specifically, we deliver vibrations to the fingertip using a vibratory actuator and measure, using a laser Doppler vibrometer, the surface waves at different distances from the locus of stimulation. First, we show that a vibration applied to the fingertip travels at least the length of the finger and that the rate at which it decays is dependent on stimulus frequency. Furthermore, the resonant frequency of the skin matches the frequency at which a subpopulation of afferents, namely Pacinian afferents, is most sensitive. We show that this skin resonance can lead to a two-fold increase in the strength of the response of a simulated afferent population. Second, the rate at which vibrations propagate across the skin is dependent on the stimulus frequency and plateaus at 7 m/s. The resulting delay in neural activation across locations does not substantially blur the temporal patterning in simulated populations of afferents for frequencies less than 200 Hz, which has important implications about how vibratory frequency is encoded in the responses of somatosensory neurons. Third, we show that, despite the dependence of decay rate and propagation speed on frequency, the waveform of a complex vibration is well preserved as it travels across the skin. Our results suggest, then, that the propagation of surface waves promotes the encoding of spectrally complex vibrations as the entire neural population is exposed to essentially the same stimulus. We also discuss the implications of our results for biomechanical models of the skin.

  11. Effect of adjuvants on responses to skin immunization by microneedles coated with influenza subunit vaccine.

    Directory of Open Access Journals (Sweden)

    William C Weldon

    Full Text Available Recent studies have demonstrated the effectiveness of vaccine delivery to the skin by vaccine-coated microneedles; however there is little information on the effects of adjuvants using this approach for vaccination. Here we investigate the use of TLR ligands as adjuvants with skin-based delivery of influenza subunit vaccine. BALB/c mice received 1 µg of monovalent H1N1 subunit vaccine alone or with 1 µg of imiquimod or poly(I:C individually or in combination via coated microneedle patches inserted into the skin. Poly(I:C adjuvanted subunit influenza vaccine induced similar antigen-specific immune responses compared to vaccine alone when delivered to the skin by microneedles. However, imiquimod-adjuvanted vaccine elicited higher levels of serum IgG2a antibodies and increased hemagglutination inhibition titers compared to vaccine alone, suggesting enhanced induction of functional antibodies. In addition, imiquimod-adjuvanted vaccine induced a robust IFN-γ cellular response. These responses correlated with improved protection compared to influenza subunit vaccine alone, as well as reduced viral replication and production of pro-inflammatory cytokines in the lungs. The finding that microneedle delivery of imiquimod with influenza subunit vaccine induces improved immune responses compared to vaccine alone supports the use of TLR7 ligands as adjuvants for skin-based influenza vaccines.

  12. The relation between constitutional skin color and photosensitivity estimated from UV-induced erythema and pigmentation dose-response curves

    NARCIS (Netherlands)

    Westerhof, W.; Estevez-Uscanga, O.; Meens, J.; Kammeyer, A.; Durocq, M.; Cario, I.

    1990-01-01

    In 54 healthy volunteers we assessed predictors of sensitivity to ultraviolet (UV) light, including Fitzpatrick's sun reactive skin types and constitutional skin color, and compared these with one another and with responses of the skin to UV irradiation, as determined experimentally by a minimal

  13. Exposure to 4100K fluorescent light elicits sex specific transcriptional responses in Xiphophorus maculatus skin.

    Science.gov (United States)

    Boswell, William T; Boswell, Mikki; Walter, Dylan J; Navarro, Kaela L; Chang, Jordan; Lu, Yuan; Savage, Markita G; Shen, Jianjun; Walter, Ronald B

    2018-06-01

    It has been reported that exposure to artificial light may affect oxygen intake, heart rate, absorption of vitamins and minerals, and behavioral responses in humans. We have reported specific gene expression responses in the skin of Xiphophorus fish after exposure to ultraviolet light (UV), as well as, both broad spectrum and narrow waveband visible light. In regard to fluorescent light (FL), we have shown that male X. maculatus exposed to 4100K FL (i.e. "cool white") rapidly suppress transcription of many genes involved with DNA replication and repair, chromosomal segregation, and cell cycle progression in skin. We have also detailed sex specific transcriptional responses of Xiphophorus skin after exposure to UVB. However, investigation of gender differences in global gene expression response after exposure to 4100K FL has not been reported, despite common use of this FL source for residential, commercial, and animal facility illumination. Here, we compare RNA-Seq results analyzed to assess changes in the global transcription profiles of female and male X. maculatus skin in response to 4100K FL exposure. Our results suggest 4100K FL exposure incites a sex-biased genetic response including up-modulation of inflammation in females and down modulation of DNA repair/replication in males. In addition, we identify clusters of genes that become oppositely modulated in males and females after FL exposure that are principally involved in cell death and cell proliferation. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Synergistic application of cardiac sympathetic decentralization and comprehensive psychiatric treatment in the management of anxiety and electrical storm

    Directory of Open Access Journals (Sweden)

    Sahib S Khalsa

    2014-01-01

    Full Text Available We report here, for the first time, two cases demonstrating a synergistic application of bilateral cardiac sympathetic decentralization and multimodal psychiatric treatment for the assessment and management of anxiety following recurrent Implantable Cardioverter Defibrillator (ICD shocks. In a first case the combination of bilateral cardiac sympathetic decentralization (BCSD, cognitive behavioral psychotherapy and anxiolytic medication was sufficient to attenuate the patient’s symptoms and maladaptive behaviors, with a maintained benefit at 1 year. Among the more prominent subjective changes, we observed a decrease in aversive interoceptive sensations, particularly of the heartbeat following BCSD. The patient continued to experience cognitive threat appraisals on a frequent basis, although these were no longer incapacitating. In a second case, we report the effect of BCSD on autonomic tone and subjective state. In the post-lesion state we observed attenuated sympathetic responses to the valsalva maneuver, isometric handgrip and mental arithmetic stressor, including decreased systolic and diastolic blood pressure and decreased skin conductance. Collectively, these preliminary findings suggest that an integrative, multidisciplinary approach to treating anxiety disorders in the setting of ventricular arrhythmias and recurrent ICD shocks can result in sustained improvements in physical, psychological and functional status. These findings raise the possibility of a potential role for the stellate ganglion in the modulation of emotional experience and afferent transmission of interoceptive information to the central nervous system.

  15. Modulation of the androgenetic response in diverse skin cell types: the pilosebaceous unit

    International Nuclear Information System (INIS)

    Zurvarra, F.; Kerner, N.; Hagelin, K.

    2009-01-01

    Androgens play a central role in diverse morphogenetic processes of the skin. Hair growth and follicular cycle are regulated in part by androgens. Androgens also play a key function, together with other receptors such as the PPARs receptors family, on the proliferation and differentiation of the sebaceous gland that forms part of the pilosebaceous unit and influences hair growth and skin well-being. UV radiation may affect androgens regulation of skin homeostasis. Objectives: to study the modulation of androgenetic response related to UV radiation on the pilosebaceous unit, in two skin conditions: androgenetic alopecia and acne, both affecting skin and constituting major concerns for affected individuals. Methods: primary cultures of cells and established cell lines from the pilosebaceous unit: dermal papillae cells, keratinocytes and sebocytes. Analysis of lipid content, inflammatory response and proliferation of cells under the influence of androgens, PPARs ligands and UVR. Results: sebocytes primary cultures were obtained from human sebaceous glands. Proliferation and differentiation, as well as the expression of proinflammatory molecules (IL-1, TNF alpha, iNOs) and lipogenic enzymes (FASN) under androgens and UV treatment were assessed. The response to androgens under UV exposure was also analyzed in dermal papillae cells in culture. (authors)

  16. Effects of niacin restriction on sirtuin and PARP responses to photodamage in human skin.

    Directory of Open Access Journals (Sweden)

    Claudia A Benavente

    Full Text Available Sirtuins (SIRTs and poly(ADP-ribose polymerases (PARPs, NAD(+-dependent enzymes, link cellular energy status with responses to environmental stresses. Skin is frequently exposed to the DNA damaging effects of UV irradiation, a known etiology in skin cancer. Thus, understanding the defense mechanisms in response to UV, including the role of SIRTs and PARPs, may be important in developing skin cancer prevention strategies. Here, we report expression of the seven SIRT family members in human skin. SIRTs gene expressions are progressively upregulated in A431 epidermoid carcinoma cells (SIRTs1 and 3, actinic keratoses (SIRTs 2, 3, 5, 6, and 7 and squamous cell carcinoma (SIRTs 1-7. Photodamage induces dynamic changes in SIRT expression with upregulation of both SIRT1 and SIRT4 mRNAs. Specific losses of SIRT proteins occur early after photodamage followed by accumulation later, especially for SIRT4. Niacin restriction, which decreases NAD(+, the sirtuin substrate, results in an increase in acetylated proteins, upregulation of SIRTs 2 and 4, increased inherent DNA damage, alterations in SIRT responses to photodamage, abrogation of PARP activation following photodamage, and increased sensitivity to photodamage that is completely reversed by repleting niacin. These data support the hypothesis that SIRTs and PARPs play important roles in resistance to photodamage and identify specific SIRTs that respond to photodamage and may be targets for skin cancer prevention.

  17. Direct skin-to-skin vs. indirect touch modulates neural responses to stroking vs. tapping

    Science.gov (United States)

    Kress, Inge U; Minati, Ludovico; Ferraro, Stefania; Critchley, Hugo D

    2011-01-01

    It remains unclear whether direct inter-personal contact is processed differently from similar soft touch applied through inanimate objects. We performed a functional MRI (fMRI) experiment in healthy volunteers, whereby activity during gentle stroking or tapping was compared between stimuli delivered using the experimenter’s hand or a velvet stick. Stroking with a hand elicited larger responses than the other three conditions in the contralateral primary and secondary somatosensory areas and posterior insula. The observed effects likely originate from a combination of perceptual differences and cognitive and emotional correlates of contact with another person. This empirical observation indicates that to ensure ecological validity studies of affective touch processing should be performed with stimuli delivered with direct inter-personal contact rather than inanimate objects. PMID:21817928

  18. Parental overcontrol x OPRM1 genotype interaction predicts school-aged children's sympathetic nervous system activation in response to performance challenge.

    Science.gov (United States)

    Partington, Lindsey C; Borelli, Jessica L; Smiley, Patricia; Jarvik, Ella; Rasmussen, Hannah F; Seaman, Lauren C; Nurmi, Erika L

    2018-04-26

    Parental overcontrol (OC), the excessive regulation of a child's behavior, cognition, and emotion, is associated with the development of child anxiety. While studies have shown that genetic factors may increase sensitivity to stress, genetic vulnerability to parental OC has not been examined in anxiety etiology. A functional polymorphism in the mu opioid receptor OPRM1 (A118G, rs1799971) has been shown to impact stress reactivity. Using a community sample of children (N = 85, 9-12 years old), we examined the main and interactive effects of maternal OC and child OPRM1 genotype in predicting children's sympathetic nervous system reactivity during a performance stressor. Neither OC nor genotype predicted children's electrodermal activity (EDA); however, the interaction between OC and child genotype significantly predicted stress reactivity, as indexed by EDA, during the challenging task. Among children with the minor G-allele, higher maternal OC was associated with higher reactivity. In A homozygotes, maternal OC was not associated with EDA, suggesting a diathesis-stress pattern of gene x environment interaction. We discuss implications for anxiety etiology and intervention. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. Ethnic differences in objective and subjective skin irritation response: an international study.

    Science.gov (United States)

    Lee, E; Kim, S; Lee, J; Cho, S-A; Shin, K

    2014-08-01

    Due to global marketing in the cosmetics industry, it is important to assess ethnic population susceptibility when evaluating the safety of cosmetic products or chemicals. To investigate ethnic variations in skin irritation response to positive irritants. Clinical testing was performed in four countries on two ethnic groups - Asian and Caucasian. We performed patch tests on the subjects' back with 0.5% aqueous sodium lauryl sulfate (SLS) and 0.15% retinol prepared in 1,3-butylene glycol. Stinging tests were performed using 5% aqueous lactic acid and 0.001% (w/v) capsaicin prepared in 10% ethanol solution separately. The incidence of self-perceived skin sensitivity was similar in the two ethnic groups. However, the incidence of adverse skin reaction to cosmetics appeared significantly higher in Asian (33.0%) than in Caucasian subjects (11.3%). For standard positive irritants such as 0.5% aqueous SLS solution, Asian subjects showed significantly higher scores than Caucasian subjects. The incidence of positive reaction to the 0.15% retinol patch test tended to be higher in Asian than in Caucasian subjects. Our data also showed that neurosensitivity to 5% lactic acid and 0.001% capsaicin was higher in Asian than in Caucasian subjects. Although self-reported skin sensitivity does not appear to differ according to ethnicity, there are ethnic differences in objective and subjective skin irritation responses to several standard positive materials. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. Thermal Response of In Vivo Human Skin to Fractional Radiofrequency Microneedle Device

    Directory of Open Access Journals (Sweden)

    Woraphong Manuskiatti

    2016-01-01

    Full Text Available Background. Fractional radiofrequency microneedle system (FRMS is a novel fractional skin resurfacing system. Data on thermal response to this fractional resurfacing technique is limited. Objectives. To investigate histologic response of in vivo human skin to varying energy settings and pulse stacking of a FRMS in dark-skinned subjects. Methods. Two female volunteers who were scheduled for abdominoplasty received treatment with a FRMS with varying energy settings at 6 time periods including 3 months, 1 month, 1 week, 3 days, 1 day, and the time immediately before abdominoplasty. Biopsy specimens were analyzed using hematoxylin and eosin (H&E, Verhoeff-Van Gieson (VVG, colloidal iron, and Fontana-Masson stain. Immunohistochemical study was performed by using Heat Shock Protein 70 (HSP70 antibody and collagen III monoclonal antibody. Results. The average depth of radiofrequency thermal zone (RFTZ ranged from 100 to 300 μm, correlating with energy levels. Columns of cell necrosis and collagen denaturation followed by inflammatory response were initially demonstrated, with subsequent increasing of mucin at 1 and 3 months after treatment. Immunohistochemical study showed positive stain with HSP70. Conclusion. A single treatment with a FRMS using appropriate energy setting induces neocollagenesis. This wound healing response may serve as a mean to improve the appearance of photodamaged skin and atrophic scars.

  1. Media Research with a Galvanic Skin Response Biosensor: Some Kids Work Up a Sweat!

    Science.gov (United States)

    Clariana, Roy B.

    This study considers the galvanic skin response (GSR) of sixth-grade students (n=20) using print, video, and microcomputer segments. Subjects received all three media treatments, in randomized order. Data for analysis consisted of standardized test scores and GSR measures; a moderate positive relationship was shown between cumulative GSR and…

  2. Expectancy, False Galvanic Skin Response Feedback, and Systematic Desensitization in the Modification of Phobic Behavior

    Science.gov (United States)

    Lick, John

    1975-01-01

    This study compared systematic desensitization and two pseudotherapy manipulations with and without false galvanic skin response feedback after every session suggesting improvement in the modification of intense snake and spider fear. The results indicated no consistent differences between the three treatment groups. (Author)

  3. The articulo-cardiac sympathetic reflex in spinalized, anesthetized rats.

    Science.gov (United States)

    Nakayama, Tomohiro; Suzuki, Atsuko; Ito, Ryuzo

    2006-04-01

    Somatic afferent regulation of heart rate by noxious knee joint stimulation has been proven in anesthetized cats to be a reflex response whose reflex center is in the brain and whose efferent arc is a cardiac sympathetic nerve. In the present study we examined whether articular stimulation could influence heart rate by this efferent sympathetic pathway in spinalized rats. In central nervous system (CNS)-intact rats, noxious articular movement of either the knee or elbow joint resulted in an increase in cardiac sympathetic nerve activity and heart rate. However, although in acutely spinalized rats a noxious movement of the elbow joint resulted in a significant increase in cardiac sympathetic nerve activity and heart rate, a noxious movement of the knee joint had no such effect and resulted in only a marginal increase in heart rate. Because this marginal increase was abolished by adrenalectomy suggests that it was due to the release of adrenal catecholamines. In conclusion, the spinal cord appears to be capable of mediating, by way of cardiac sympathetic nerves, the propriospinally induced reflex increase in heart rate that follows noxious stimulation of the elbow joint, but not the knee joint.

  4. A synthetic peptide blocking TRPV1 activation inhibits UV-induced skin responses.

    Science.gov (United States)

    Kang, So Min; Han, Sangbum; Oh, Jang-Hee; Lee, Young Mee; Park, Chi-Hyun; Shin, Chang-Yup; Lee, Dong Hun; Chung, Jin Ho

    2017-10-01

    Transient receptor potential type 1 (TRPV1) can be activated by ultraviolet (UV) irradiation, and mediates UV-induced matrix metalloproteinase (MMP)-1 and proinflammatory cytokines in keratinocytes. Various chemicals and compounds targeting TRPV1 activation have been developed, but are not in clinical use mostly due to their safety issues. We aimed to develop a novel TRPV1-targeting peptide to inhibit UV-induced responses in human skin. We designed and generated a novel TRPV1 inhibitory peptide (TIP) which mimics the specific site in TRPV1 (aa 701-709: Gln-Arg-Ala-Ile-Thr-Ile-Leu-Asp-Thr, QRAITILDT), Thr 705 , and tested its efficacy of blocking UV-induced responses in HaCaT, mouse, and human skin. TIP effectively inhibited capsaicin-induced calcium influx and TRPV1 activation. Treatment of HaCaT with TIP prevented UV-induced increases of MMP-1 and pro-inflammatory cytokines such as interleukin (IL)-6 and tumor necrosis factor-α. In mouse skin in vivo, TIP inhibited UV-induced skin thickening and prevented UV-induced expression of MMP-13 and MMP-9. Moreover, TIP attenuated UV-induced erythema and the expression of MMP-1, MMP-2, IL-6, and IL-8 in human skin in vivo. The novel synthetic peptide targeting TRPV1 can ameliorate UV-induced skin responses in vitro and in vivo, providing a promising therapeutic approach against UV-induced inflammation and photoaging. Copyright © 2017 Japanese Society for Investigative Dermatology. Published by Elsevier B.V. All rights reserved.

  5. Skin conductance response to the pain of others predicts later costly helping.

    Directory of Open Access Journals (Sweden)

    Grit Hein

    Full Text Available People show autonomic responses when they empathize with the suffering of another person. However, little is known about how these autonomic changes are related to prosocial behavior. We measured skin conductance responses (SCRs and affect ratings in participants while either receiving painful stimulation themselves, or observing pain being inflicted on another person. In a later session, they could prevent the infliction of pain in the other by choosing to endure pain themselves. Our results show that the strength of empathy-related vicarious skin conductance responses predicts later costly helping. Moreover, the higher the match between SCR magnitudes during the observation of pain in others and SCR magnitude during self pain, the more likely a person is to engage in costly helping. We conclude that prosocial motivation is fostered by the strength of the vicarious autonomic response as well as its match with first-hand autonomic experience.

  6. Measurement of erythema and tanning responses in human skin using a tri-stimulus colorimeter.

    Science.gov (United States)

    Seitz, J C; Whitmore, C G

    1988-01-01

    A 'Minolta Tri-Stimulus Colorimeter II' was evaluated for obtaining objective measurements of early changes in erythema and tanning. The meter showed a subtle, continuous transition between the primary erythematous response and the delayed tanning of skin which was below the visual threshold for detection. Thereafter, the a* (redness) value of the meter showed a significant linear correlation with the dermatologist's perception of erythema while the b* (yellow) value showed a significant correlation with the perception of tanning. This capability of the tri-stimulus colorimeter to simultaneously evaluate the hue and saturation of skin color affords an improved opportunity to quantitate the transition from erythema to tanning without subjective bias.

  7. Sympathetic Blocks Provided Sustained Pain Relief in a Patient with Refractory Painful Diabetic Neuropathy

    Directory of Open Access Journals (Sweden)

    Jianguo Cheng

    2012-01-01

    Full Text Available The sympathetic nervous system has been implicated in pain associated with painful diabetic neuropathy. However, therapeutic intervention targeted at the sympathetic nervous system has not been established. We thus tested the hypothesis that sympathetic nerve blocks significantly reduce pain in a patient with painful diabetic neuropathy who has failed multiple pharmacological treatments. The diagnosis of small fiber sensory neuropathy was based on clinical presentations and confirmed by skin biopsies. A series of 9 lumbar sympathetic blocks over a 26-month period provided sustained pain relief in his legs. Additional thoracic paravertebral blocks further provided control of the pain in the trunk which can occasionally be seen in severe diabetic neuropathy cases, consequent to extensive involvement of the intercostal nerves. These blocks provided sustained and significant pain relief and improvement of quality of life over a period of more than two years. We thus provided the first clinical evidence supporting the notion that sympathetic nervous system plays a critical role in painful diabetic neuropathy and sympathetic blocks can be an effective management modality of painful diabetic neuropathy. We concluded that the sympathetic nervous system is a valuable therapeutic target of pharmacological and interventional modalities of treatments in painful diabetic neuropathy patients.

  8. Influence of hydration and experimental length scale on themechanical response of human skin in vivo, using optical coherence tomography

    NARCIS (Netherlands)

    Hendriks, F.M.; Brokken, D.; Oomens, C.W.J.; Baaijens, F.P.T.

    2004-01-01

    Human skin is a complex tissue consisting of different layers. To gain better insight into the mechanical behaviour of different skin layers, the mechanical response was studied with experiments of various length scales. Also, the influence of (superficial) hydration on the mechanical response is

  9. Caffeine ameliorates radiation-induced skin reactions in mice but does not influence tumour radiation response

    Energy Technology Data Exchange (ETDEWEB)

    Hebbar, S.A.; Mitra, A.K.; George, K.C.; Verma, N.C. [Radiation Biology Division, Bhabha Atomic Research Centre, Trombay, Mumbai (India)]. E-mail: ncverma@apsara.barc.ernet.in

    2002-03-01

    Intramuscular administration of caffeine at a dose of 80 mg kg{sup -1} body weight to the gastrocnemius muscles of Swiss mice 5 min prior to local irradiation (35 Gy) of the leg delayed the progression of radiation-induced skin reactions in such animals. While 90% epilation with reddening of the skin was noted in animals treated with radiation alone, animals pretreated with caffeine suffered only partial hair loss with slight reddening of the skin on the 16th and 20th days post-irradiation. Beyond the 28th day, damage scores in irradiated feet for both the groups were similar (score 3) and remained unchanged until the 32nd day and then decreased and disappeared completely in both treatment groups by the 40th day after irradiation. In addition, the effect of caffeine on the radiation response of a mouse fibrosarcoma was investigated. Results showed that intratumoral administration of caffeine at a dose of 80 mg kg{sup -1} body weight 5 min prior to local exposure of tumours to 10 Gy of {sup 60}Co {gamma}-rays did not influence the response of tumours to radiation. The present study thus showed that although caffeine ameliorated radiation-induced skin reactions in the mouse leg, it did not affect the tumour radiation response, indicating its potential application in cancer radiotherapy. (author)

  10. Enhanced immune responses by skin vaccination with influenza subunit vaccine in young hosts.

    Science.gov (United States)

    Koutsonanos, Dimitrios G; Esser, E Stein; McMaster, Sean R; Kalluri, Priya; Lee, Jeong-Woo; Prausnitz, Mark R; Skountzou, Ioanna; Denning, Timothy L; Kohlmeier, Jacob E; Compans, Richard W

    2015-09-08

    Skin has gained substantial attention as a vaccine target organ due to its immunological properties, which include a high density of professional antigen presenting cells (APCs). Previous studies have demonstrated the effectiveness of this vaccination route not only in animal models but also in adults. Young children represent a population group that is at high risk from influenza infection. As a result, this group could benefit significantly from influenza vaccine delivery approaches through the skin and the improved immune response it can induce. In this study, we compared the immune responses in young BALB/c mice upon skin delivery of influenza vaccine with vaccination by the conventional intramuscular route. Young mice that received 5 μg of H1N1 A/Ca/07/09 influenza subunit vaccine using MN demonstrated an improved serum antibody response (IgG1 and IgG2a) when compared to the young IM group, accompanied by higher numbers of influenza-specific antibody secreting cells (ASCs) in the bone marrow. In addition, we observed increased activation of follicular helper T cells and formation of germinal centers in the regional lymph nodes in the MN immunized group, rapid clearance of the virus from their lungs as well as complete survival, compared with partial protection observed in the IM-vaccinated group. Our results support the hypothesis that influenza vaccine delivery through the skin would be beneficial for protecting the high-risk young population from influenza infection. Copyright © 2015. Published by Elsevier Ltd.

  11. Dose-response models for the radiation-induction of skin tumours in mice

    International Nuclear Information System (INIS)

    Papworth, D.G.; Hulse, E.V.

    1983-01-01

    Extensive data on radiation-induced skin tumours in mice were examined using 8 models, all based on the concept that incidences of radiation-induced tumours depend on a combination of two radiation effects: a tumour induction process and the loss of reproductive integrity by the potential tumour cells. Models with and without a threshold were used, in spite of theoretical objections to threshold models. No model fitted well both the epidermal and the dermal tumour data and models which proved to be statistically satisfactory for some of the data were rejected for biological reasons. It is concluded that, for skin tumours, dose-response curves depending on a combination of cancer induction and loss of cellular reproductive integrity are distorted by some special, relatively radio-resistant, factor which we have previously postulated as being involved in radiation skin carcinogenesis. (author)

  12. Effects of methylglyoxal bis(guanylhydrazone) on tumour and skin responses to hyperthermia in mice

    International Nuclear Information System (INIS)

    Miyakoshi, J.; Oda, W.; Inagaki, C.; Hiraoka, M.; Takahashi, M.; Abe, M.

    1984-01-01

    Effects of methylglyoxal bis(guanylhydrazone) (MGBG) on tumour and skin responses to hyperthermia (42degC) were examined in C3H mice. MGBG (50 mg/kg) was administered intraperitoneally to mice 4 hours before hyperthermic treatment. The tumour (FM3A) growth time was elongated by an amount dependent on the exposure time of treatment at 42degC (60, 90 and 120 min). Pre-treatment of mice with MGBG (50 mg/kg, i.p.) apparently further lengthened the tumour growth time after treatment at 42degC. No significant damage of foot skin was caused by 42degC hyperthermia. Pre-treatment with MGBG did not make the foot skin susceptible to the heating. From these findings, it can be considered that MGBG or related less-toxic compounds may have a clinical advantage for the mild (42degC) hyperthermic treatment in cancer therapy. (author)

  13. Effects of methylglyoxal bis(guanylhydrazone) on tumour and skin responses to hyperthermia in mice

    Energy Technology Data Exchange (ETDEWEB)

    Miyakoshi, J.; Oda, W.; Inagaki, C. (Kyoto Coll. of Pharmacy (Japan)); Hiraoka, M.; Takahashi, M.; Abe, M. (Kyoto Univ. (Japan). Faculty of Medicine)

    1984-09-01

    Effects of methylglyoxal bis(guanylhydrazone) (MGBG) on tumour and skin responses to hyperthermia (42degC) were examined in C3H mice. MGBG (50 mg/kg) was administered intraperitoneally to mice 4 hours before hyperthermic treatment. The tumour (FM3A) growth time was elongated by an amount dependent on the exposure time of treatment at 42degC (60, 90 and 120 min). Pre-treatment of mice with MGBG (50 mg/kg, i.p.) apparently further lengthened the tumour growth time after treatment at 42degC. No significant damage of foot skin was caused by 42degC hyperthermia. Pre-treatment with MGBG did not make the foot skin susceptible to the heating. From these findings, it can be considered that MGBG or related less-toxic compounds may have a clinical advantage for the mild (42degC) hyperthermic treatment in cancer therapy.

  14. Tissue responses to fractional transient heating with sinusoidal heat flux condition on skin surface.

    Science.gov (United States)

    Ezzat, Magdy A; El-Bary, Alaa A; Al-Sowayan, Noorah S

    2016-10-01

    A fractional model of Bioheat equation for describing quantitatively the thermal responses of skin tissue under sinusoidal heat flux conditions on skin surface is given. Laplace transform technique is used to obtain the solution in a closed form. The resulting formulation is applied to one-dimensional application to investigate the temperature distribution in skin with instantaneous surface heating for different cases. According to the numerical results and its graphs, conclusion about the fractional bioheat transfer equation has been constructed. Sensitivity analysis is performed to explore the thermal effects of various control parameters on tissue temperature. The comparisons are made with the results obtained in the case of the absence of time-fractional order. © 2016 Japanese Society of Animal Science. © 2016 Japanese Society of Animal Science.

  15. Factitious lymphoedema as a psychiatric condition mimicking reflex sympathetic dystrophy: a case report

    Directory of Open Access Journals (Sweden)

    Nwaejike Nnamdi

    2008-06-01

    Full Text Available Abstract Introduction Reflex sympathetic dystrophy can result in severe disability with only one in five patients able to fully resume prior activities. Therefore, it is important to diagnose this condition early and begin appropriate treatment. Factitious lymphoedema can mimic reflex sympathetic dystrophy and is caused by self-inflicted tourniquets, blows to the arm or repeated skin irritation. Patients with factitious lymphoedema have an underlying psychiatric disorder but usually present to emergency or orthopaedics departments. Factitious lymphoedema can then be misdiagnosed as reflex sympathetic dystrophy. The treatment for factitious lymphoedema is dealing with the underlying psychiatric condition. Case presentation We share our experience of treating a 33-year-old man, who presented with factitious lymphoedema, initially diagnosed as reflex sympathetic dystrophy. Conclusion Awareness of this very similar differential diagnosis allows early appropriate treatment to be administered.

  16. Optimization of gelatine extraction from grass carp (Catenopharyngodon idella) fish skin by response surface methodology.

    Science.gov (United States)

    Kasankala, Ladislaus M; Xue, Yan; Weilong, Yao; Hong, Sun D; He, Qian

    2007-12-01

    To establish the optimum gelatine extraction conditions from grass carp fish skin, response surface methodology (RSM) was adopted in this study. The effects of concentration of HCl (%, A), pre-treatment time (h, B), extraction temperature ( degrees C, C) and extraction time (h, D) were studied. The responses were yield (%) and gel strength (g). A=1.19%, B=24 h, C=52.61 degrees C and D=5.12h were determined as the optimum conditions while the predicted responses were 19.83% yield and 267 g gel strength. Gelling and melting points were 19.5 degrees C and 26.8 degrees C, respectively. Moreover, grass carp gelatine showed high contents of imino acids (proline and hydroxyproline) 19.47%. RSM provided a powerful tool to optimize the extraction parameters and the results may be adapted for industrial extraction of gelatine from grass carp fish skins.

  17. Influence of trichloroacetic acid peeling on the skin stress response system.

    Science.gov (United States)

    Kimura, Ayako; Kanazawa, Nobuo; Li, Hong-Jin; Yonei, Nozomi; Yamamoto, Yuki; Furukawa, Fukumi

    2011-08-01

    Although trichloroacetic acid (TCA) peeling is widely applied for cosmetic treatment of photodamaged skin, the entire biological mechanisms have yet to be determined. The skin stress response system (SSRS) involves corticotropin-releasing hormone (CRH) and proopiomelanocortin (POMC) products that are locally-generated in response to locally-provided stressors or pro-inflammatory cytokines. This system would restrict tissue damage and restore local homeostasis. To determine the influence of TCA peeling on the SSRS in vitro and in vivo, expressions of POMC, melanocortin receptor 1 (MC1R), CRH and CRH receptor 1 (CRHR1) mRNA were examined by reverse transcription polymerase chain reaction in Pam212 murine keratinocytes, murine plantar and healthy human abdominal skin specimens after TCA treatment. In addition, their protein expressions as well as those of POMC-derived peptides were examined immunohistochemically. After TCA treatment, transient upregulation of POMC and MC1R mRNA expressions was observed in both murine and human skin, as well as in Pam212. Enhanced POMC protein, recovery of once-impaired MC1R protein, and no enhancement of POMC-derived peptide productions were revealed immunohistochemically in both murine and human epidermis. In contrast, neither expression levels of CRH and CRHR1 mRNA nor epidermal protein were enhanced after TCA application in murine and human skin, except for induction of human CRH mRNA expression. These results suggest that TCA activates the SSRS by inducing POMC and MC1R productions of keratinocytes in the CRH-independent manner, and that the biological effects of POMC itself are responsible for the TCA-induced epidermal SSRS activation. © 2010 Japanese Dermatological Association.

  18. Effect of skin barrier disruption on immune responses to topically applied cross-reacting material, CRM(197), of diphtheria toxin.

    Science.gov (United States)

    Godefroy, S; Peyre, M; Garcia, N; Muller, S; Sesardic, D; Partidos, C D

    2005-08-01

    The high accessibility of the skin and the presence of immunocompetent cells in the epidermis makes this surface an attractive route for needle-free administration of vaccines. However, the lining of the skin by the stratum corneum is a major obstacle to vaccine delivery. In this study we examined the effect of skin barrier disruption on the immune responses to the cross-reacting material CRM(197), a nontoxic mutant of diphtheria toxin (DTx) that is considered as a vaccine candidate. Application of CRM(197), together with cholera toxin (CT), onto the tape-stripped skin of mice elicited antibody responses that had anti-DTx neutralizing activity. Vaccine delivery onto mildly ablated skin or intact skin did not elicit any detectable anti-CRM(197) antibodies. Mice immunized with CRM(197) alone onto the tape-stripped skin mounted a vigorous antigen-specific proliferative response. In contrast, the induction of cellular immunity after CRM(197) deposition onto mildly ablated or intact skin was adjuvant dependent. Furthermore, epidermal cells were activated and underwent apoptosis that was more pronounced when the stratum corneum was removed by tape stripping. Overall, these findings highlight the potential for transcutaneous delivery of CRM(197) and establish a correlation between the degree of barrier disruption and levels of antigen-specific immune responses. Moreover, these results provide the first evidence that the development of a transcutaneous immunization strategy for diphtheria, based on simple and practical methods to disrupt the skin barrier, is feasible.

  19. Renal sympathetic denervation in hypertension.

    Science.gov (United States)

    Doumas, Michael; Faselis, Charles; Papademetriou, Vasilios

    2011-11-01

    Despite the abundance of antihypertensive drugs, resistant hypertension remains a major clinical problem. Recent technological advances render interventional management of resistant hypertension one of the hottest topics in the hypertension field. The aim of this review is to present the pathophysiologic background and the mechanisms mediating blood pressure reduction after renal sympathetic denervation, to analyze recent findings with this fascinating approach and to critically suggest future research directions. Catheter-based, ablation-induced renal sympathetic denervation was initially studied in 45 patients with resistant hypertension in a proof-of-concept study. Impressive blood pressure reductions of about 30/15  mmHg were achieved at 6 months, without serious complications. A second, controlled, randomized (but not blinded) study confirmed the results, verifying the efficacy and safety of the procedure. A recent report revealed the 2-year durability of blood pressure reduction. Data published so far indicate that ablation-induced renal denervation is a feasible, effective, and well tolerated interventional approach for the management of resistant hypertension. The groundbreaking studies of renal denervation in drug-resistant hypertension pave the way for further research in other disease conditions in which sympathetic overactivity seems to play a critical role. This initial wave of enthusiasm needs to be followed by rigorous investigation, for the proper identification of the potential and the limitations, indications, and contraindications of this approach.

  20. Immune sensitization to methylene diphenyl diisocyanate (MDI resulting from skin exposure: albumin as a carrier protein connecting skin exposure to subsequent respiratory responses

    Directory of Open Access Journals (Sweden)

    Redlich Carrie A

    2011-03-01

    Full Text Available Abstract Background Methylene diphenyl diisocyanate (MDI, a reactive chemical used for commercial polyurethane production, is a well-recognized cause of occupational asthma. The major focus of disease prevention efforts to date has been respiratory tract exposure; however, skin exposure may also be an important route for inducing immune sensitization, which may promote subsequent airway inflammatory responses. We developed a murine model to investigate pathogenic mechanisms by which MDI skin exposure might promote subsequent immune responses, including respiratory tract inflammation. Methods Mice exposed via the skin to varying doses (0.1-10% w/v of MDI diluted in acetone/olive oil were subsequently evaluated for MDI immune sensitization. Serum levels of MDI-specific IgG and IgE were measured by enzyme-linked immunosorbant assay (ELISA, while respiratory tract inflammation, induced by intranasal delivery of MDI-mouse albumin conjugates, was evaluated based on bronchoalveolar lavage (BAL. Autologous serum IgG from "skin only" exposed mice was used to detect and guide the purification/identification of skin proteins antigenically modified by MDI exposure in vivo. Results Skin exposure to MDI resulted in specific antibody production and promoted subsequent respiratory tract inflammation in animals challenged intranasally with MDI-mouse albumin conjugates. The degree of (secondary respiratory tract inflammation and eosinophilia depended upon the (primary skin exposure dose, and was maximal in mice exposed to 1% MDI, but paradoxically limited in mice receiving 10-fold higher doses (e.g. 10% MDI. The major antigenically-modified protein at the local MDI skin exposure site was identified as albumin, and demonstrated biophysical changes consistent with MDI conjugation. Conclusions MDI skin exposure can induce MDI-specific immune sensitivity and promote subsequent respiratory tract inflammatory responses and thus, may play an important role in MDI asthma

  1. Inflammatory Murine Skin Responses to UV-B Light Are Partially Dependent on Endothelin-1 and Mast Cells

    OpenAIRE

    Metz, Martin; Lammel, Verena; Gibbs, Bernhard F.; Maurer, Marcus

    2006-01-01

    Endothelin (ET-1) has been shown to crucially contribute to UV-induced skin responses such as tanning. To test whether ET-1 is also involved in early cutaneous reactions to UV, we assessed ET-1 skin levels in UV-irradiated mice. In correlation with the levels of UV-induced skin inflammation, ET-1 concentrations increased substantially and continually. Moreover, blocking of ET-1 receptors (ETA) resulted in significantly decreased cutaneous inflammation following UV irradiation. When we assesse...

  2. OPTIMIZATION AND CHARACTERIZATION OF 5-FLUOROURACIL TRANSETHOSOMES FOR SKIN CANCER THERAPY USING RESPONSE SURFACE METHODOLOGY.

    OpenAIRE

    Jessy Shaji; Rinki Bajaj.

    2018-01-01

    The purpose of the present study was to develop, optimize and characterize 5-Fluorouracil transethosomes for skin cancer targeting. 5- Fluorouracil transethosomes were prepared by cold method using phospholipon 90G as the lipid and sodium cholate as edge activator. The size reduction was done by probe sonication. Central composite design was used for optimization procedure with different concentration of phospholipon 90G and sodium cholate as independent variables. The response variables sele...

  3. Stratum corneum cytokines and skin irritation response to sodium lauryl sulfate.

    Science.gov (United States)

    De Jongh, Cindy M; Verberk, Maarten M; Withagen, Carien E T; Jacobs, John J L; Rustemeyer, Thomas; Kezic, Sanja

    2006-06-01

    Little is known about cytokines involved in chronic irritant contact dermatitis. Individual cytokine profiles might explain at least part of the differences in the individual response to irritation. Our objective was to investigate the relation between baseline stratum corneum (SC) cytokine levels and the skin response to a single and a repeated irritation test. This study also aimed to determine changes in SC cytokine levels after repeated irritation. Transepidermal water loss (TEWL) and erythema were measured in 20 volunteers after single 24-hr exposure to 1% sodium lauryl sulfate (SLS), and during and after repeated exposure to 0.1% SLS over a 3-week period. SC cytokine levels were measured from an unexposed skin site and from the repeatedly exposed site. Interleukin (IL)-1alpha decreased by 30% after repeated exposure, while IL-1RA increased 10-fold and IL-8 increased fourfold. Baseline IL-1RA and IL-8 values were predictors of TEWL and erythema after single exposure (r = 0.55-0.61). 6 subjects showed barrier recovery during repeated exposure. Baseline IL-1RA and IL-8 levels are likely to be indicators of higher skin irritability after single exposure to SLS. Barrier repair in some of the subjects might explain the lack of agreement between the TEWL response after single and repeated irritation.

  4. Posterior superior temporal sulcus responses predict perceived pleasantness of skin stroking

    Directory of Open Access Journals (Sweden)

    Monika Davidovic

    2016-09-01

    Full Text Available Love and affection is expressed through a range of physically intimate gestures, including caresses. Recent studies suggest that posterior temporal lobe areas typically associated with visual processing of social cues also respond to interpersonal touch. Here, we asked whether these areas are selective to caress-like skin stroking. We collected functional magnetic resonance imaging (fMRI data from 23 healthy participants and compared brain responses to skin stroking and vibration. We did not find any significant differences between stroking and vibration in the posterior temporal lobe; however, right posterior superior temporal sulcus (pSTS responses predicted healthy participant's perceived pleasantness of skin stroking, but not vibration. These findings link right pSTS responses to individual variability in perceived pleasantness of caress-like tactile stimuli. We speculate that the right pSTS may play a role in the translation of tactile stimuli into positively valenced, socially relevant interpersonal touch and that this system may be affected in disorders associated with impaired attachment.

  5. Skin response to X-irradiation in the guinea-pig

    Energy Technology Data Exchange (ETDEWEB)

    Berry, R J; Mole, R H; Barnes, D W.H. [Medical Research Council, Harwell (UK). Radiobiological Research Unit

    1976-12-01

    Skin reaction to X-irradiation has been studied in the albino quinea-pig; early response in limited-field irradiations of the flank was comparable to that commonly seen in rodents, swine and man, and was dose-dependent with a dynamic range from mild erythema to moist desquamation. The peak early skin reaction was seen between 14 and 21 days after irradiation, and declined before 30 days except at the highest doses used. Fractionation of the X-ray dose at 24 hours resulted in a 'sparing' of about 340 rad. Permanent partial epilation was detectable at doses in excess of 1400 rad, and complete epilation at 1 year occurred in 50 per cent of irradiated fields at 1740 rad. Twenty-four hour two-dose fractionation resulted in a 'sparing' of about 500 rad for epilation. Palpable dermal 'fibrosis' was detectable at 3 months after irradiation in fields given more than 2070 rad, and at 1 year after irradiation in fields given more than 1800 rad; 50 per cent of fields showed palpable 'fibrosis' at 1 year at 1930 rad. Unlike domestic swine and man, skin fields in the quinea-pig showed no dimensional contraction after X-ray doses which produced gross early skin damage.

  6. Skin Carotenoid Response to a High-Carotenoid Juice in Children: A Randomized Clinical Trial.

    Science.gov (United States)

    Aguilar, Sheryl S; Wengreen, Heidi J; Dew, Jeffrey

    2015-11-01

    Previous studies have shown an increase in serum carotenoid status among children when fed carotenoids. This study looked at the effect and dose-response of a known amount of carotenoid consumption on change in skin carotenoid status among children. Participants were children aged 5 to 17 years from Cache County, UT (n=58). Children were randomly assigned to one of three groups: high (n=18) or low (n=18) dose of a carotenoid-rich juice (2.75 mg carotenoids/30 mL juice), or placebo juice (n=22). Children were asked to drink an assigned dose of the juice (30 to 120 mL/day) based on the weight of the child and group assignment, every day for 8 weeks. Skin carotenoids were measured every 2 weeks by resonance Raman spectroscopy. Participants were asked to maintain their usual diet throughout the study. Usual diet was assessed using three averaged 24-hour recalls; diet constancy was measured using food frequency questionnaires administered at baseline, Week 4, and Week 8. Repeated measures analysis of variance was used to assess the group differences in skin carotenoid status over time. The high-dose and low-dose groups had mean±standard deviation increases in skin carotenoid status of 11,515±1,134 and 10,009±1,439 Raman intensity counts, respectively (both P values juice significantly increased skin carotenoid status over an 8-week period among children aged 5 to 17 years. The amount of carotenoids found in this amount of juice is equal to the amount found in approximately 23 to 92 g cooked carrots per day. Copyright © 2015 Academy of Nutrition and Dietetics. Published by Elsevier Inc. All rights reserved.

  7. Response of the skin of hamsters to fractionated irradiation with X rays or accelerated carbon ions

    International Nuclear Information System (INIS)

    Leith, J.T.; Powers-Risius, P.; Woodruff, K.H.; McDonald, M.; Howard, J.

    1981-01-01

    The ventral thoracic skin of hamsters was irradiated with either single, split (two fractions given in 24 hr), or multiple (five fractions given daily) exposures of X rays or accelerated carbon ions using a 4-cm spread Bragg peak. Animals were positioned in the heavy-ion beam so that the ventral thoracic skin surface was 1 cm distal to the proximal peak of the modified beam. Early skin reactions from 6 to 30 days postirradiation were assessed. Using the average skin reactions produced in this period, it was found that the relative biological effect (RBE) for single doses of carbon ions was about 1.6 (5-17 Gy per fraction), for two fractions about 1.8 (5-17 Gy perfraction), and for five fractions about 1.9 (2.4-7.2 Gy per fraction). The fractional amount of sublethal damage repaired after carbon ion irradiation was about 0.3 (at dose levels of 2.4-8.0 Gy per fraction) compared to a value of about 0.45 (at dose levels of 60-13.0 Gy per fraction) found for the fractionated X irradiations, indicting about a 33% decrease in the relative amount of sublethal damage repaired after carbon ion irradiation in this position in the spread Bragg curve. Also, data were interpreted using plots of the reciprocal total dose needed to produce a given level of skin damage versus the dose per fraction used in the multifraction experiments, and of the RBE versus dose per fraction obtained from a nonparametric analysis of the responses. These approaches allow estimation of RBE at dose levels relevant to the clinical situation. Also, estimation may be made of the maximum permissible RBE by using the zero dose intercept value from the linear reciprocal dose plot. With this approach, the RBE at a dose level of 2 Gy is about 2.5 and the maximum RBE value is about 2.7

  8. The Effects of Low Dose Irradiation on Inflammatory Response Proteins in a 3D Reconstituted Human Skin Tissue Model

    Energy Technology Data Exchange (ETDEWEB)

    Varnum, Susan M.; Springer, David L.; Chaffee, Mary E.; Lien, Katie A.; Webb-Robertson, Bobbie-Jo M.; Waters, Katrina M.; Sacksteder, Colette A.

    2012-12-01

    Skin responses to moderate and high doses of ionizing radiation include the induction of DNA repair, apoptosis, and stress response pathways. Additionally, numerous studies indicate that radiation exposure leads to inflammatory responses in skin cells and tissue. However, the inflammatory response of skin tissue to low dose radiation (<10 cGy) is poorly understood. In order to address this, we have utilized a reconstituted human skin tissue model (MatTek EpiDerm FT) and assessed changes in 23 cytokines twenty-four and forty eight hours following treatment of skin with either 3 or 10 cGy low-dose of radiation. Three cytokines, IFN-γ, IL-2, MIP-1α, were significantly altered in response to low dose radiation. In contrast, seven cytokines were significantly altered in response to a high radiation dose of 200 cGy (IL-2, IL-10, IL-13, IFN-γ, MIP-1α, TNF α, and VEGF) or the tumor promoter 12-O-tetradecanoylphorbol 13-acetate (G-CSF, GM-CSF, IL-1α, IL-8, MIP-1α, MIP-1β, RANTES). Additionally, radiation induced inflammation appears to have a distinct cytokine response relative to the non-radiation induced stressor, TPA. Overall, these results indicate that there are subtle changes in the inflammatory protein levels following exposure to low dose radiation and this response is a sub-set of what is seen following a high dose in a human skin tissue model.

  9. Responsiveness of the Spanish Version of the “Skin Cancer Index”

    Directory of Open Access Journals (Sweden)

    M. de Troya-Martín

    2016-01-01

    Full Text Available Background. Skin Cancer Index (SCI is a specific questionnaire measuring health related quality of life (HRQL in patients with cervicofacial non-melanoma skin cancer (CFNMSC. The original scale has recently been adapted and validated into Spanish. Objectives. Evaluate the responsiveness of the Spanish version of SCI. Methods. Patients with CFNMSC candidate for surgical treatment were administered the questionnaire at time of diagnostic (t0, 7 days after surgery (t1, and 5 months after surgery (t2. The scale and subscales scores (C1: social/appearance, C2: emotional were then evaluated. Differences between t0-t1, t1-t2, and t0-t2 were determined and a gender-and-age segmented analysis was performed. Results. 88 patients, 54.8% male, mean age 62.5 years, completed the study. Differences between t0-t1 and t1-t2 scores were statistically significant (p<0.05. The lowest values were found at time of diagnosis and postsurgery. Women and patients under 65 years showed the lowest values at the three times. Limitations. Concrete geographic and cultural area. Clinical and histological variables are not analysed. Conclusions. Our results confirm responsiveness of the Spanish version of the SCI. Further development of the instrument in Spanish-speaking countries and populations will make it possible to extend worldwide research and knowledge horizons on skin cancer.

  10. The effect of the moisture content of a local heat source on the blood flow response of the skin.

    Science.gov (United States)

    Petrofsky, Jerrold Scott; Bains, Gurinder; Raju, Chinna; Lohman, Everett; Berk, Lee; Prowse, Michelle; Gunda, Shashi; Madani, Piyush; Batt, Jennifer

    2009-09-01

    Numerous studies have examined the effect of local and global heating of the body on skin blood flow. However, the effect of the moisture content of the heat source on the skin blood flow response has not been examined. Thirty-three subjects, without diabetes or cardiovascular disease, between the ages of 22 and 32 were examined to determine the relationship between the effects of dry vs. moist heat applied for the same length of time and with the skin clamped at the same skin temperature on the blood flow response of the skin. The skin, heated with an infrared heat lamp (skin temperature monitored with a thermocouple) to 40 degrees C for 15 min, was either kept moist with wet towels or, in a separate experiment, kept dry with Drierite (a desiccant) between the towels to remove any moisture. Before and after heat exposure of the forearm, blood pressure, heart rate, skin moisture content, skin temperature, and skin blood flow were recorded. The results of the experiment showed that there was no change in skin moisture after 15 min exposure to dry heat at 40 degrees C. However, with moist heat, skin moisture increased by 43.7%, a significant increase (P heat, blood flow increased from the resting value by 282.3% whereas with moist heat, blood flow increased by 386% over rest, a significant increase over dry heat (P heat was a better heating modality than dry heat. The reason may be linked to moisture sensitivity in calcium channels in the vascular endothelial cell.

  11. Innervating sympathetic neurons regulate heart size and the timing of cardiomyocyte cell cycle withdrawal.

    Science.gov (United States)

    Kreipke, R E; Birren, S J

    2015-12-01

    Sympathetic drive to the heart is a key modulator of cardiac function and interactions between heart tissue and innervating sympathetic fibres are established early in development. Significant innervation takes place during postnatal heart development, a period when cardiomyocytes undergo a rapid transition from proliferative to hypertrophic growth. The question of whether these innervating sympathetic fibres play a role in regulating the modes of cardiomyocyte growth was investigated using 6-hydroxydopamine (6-OHDA) to abolish early sympathetic innervation of the heart. Postnatal chemical sympathectomy resulted in rats with smaller hearts, indicating that heart growth is regulated by innervating sympathetic fibres during the postnatal period. In vitro experiments showed that sympathetic interactions resulted in delays in markers of cardiomyocyte maturation, suggesting that changes in the timing of the transition from hyperplastic to hypertrophic growth of cardiomyocytes could underlie changes in heart size in the sympathectomized animals. There was also an increase in the expression of Meis1, which has been linked to cardiomyocyte cell cycle withdrawal, suggesting that sympathetic signalling suppresses cell cycle withdrawal. This signalling involves β-adrenergic activation, which was necessary for sympathetic regulation of cardiomyocyte proliferation and hypertrophy. The effect of β-adrenergic signalling on cardiomyocyte hypertrophy underwent a developmental transition. While young postnatal cardiomyocytes responded to isoproterenol (isoprenaline) with a decrease in cell size, mature cardiomyocytes showed an increase in cell size in response to the drug. Together, these results suggest that early sympathetic effects on proliferation modulate a key transition between proliferative and hypertrophic growth of the heart and contribute to the sympathetic regulation of adult heart size. © 2015 The Authors. The Journal of Physiology © 2015 The Physiological Society.

  12. Dynamic resistance training decreases sympathetic tone in hypertensive ovariectomized rats

    International Nuclear Information System (INIS)

    Shimojo, G.L.; Palma, R.K.; Brito, J.O.; Sanches, I.C.; Irigoyen, M.C.; De Angelis, K.

    2015-01-01

    The aim of this study was to investigate the effects of resistance exercise training on hemodynamics and cardiac autonomic control in ovariectomized spontaneously hypertensive rats. Female rats were divided into 4 groups: sedentary control (SC), sedentary hypertensive (SH), sedentary hypertensive ovariectomized (SHO), and resistance-trained hypertensive ovariectomized (RTHO). Resistance exercise training was performed on a vertical ladder (5 days/week, 8 weeks) at 40-60% maximal load. Direct arterial pressure was recorded. Vagal and sympathetic tones were measured by heart rate (HR) responses to methylatropine (3 mg/kg, iv) and propranolol (4 mg/kg, iv). Ovariectomy resulted in additional increases in blood pressure in hypertensive rats and was associated with decreased vagal tone. Resistance exercise trained rats had lower mean arterial pressure than untrained rats (RTHO: 159±2.2 vs SHO: 177±3.4 mmHg), as well as resting bradycardia (RTHO: 332±9.0 vs SHO: 356±5 bpm). Sympathetic tone was also lower in the trained group. Moreover, sympathetic tone was positively correlated with resting HR (r=0.7, P<0.05). The additional arterial pressure increase in hypertensive rats caused by ovarian hormone deprivation was attenuated by moderate-intensity dynamic resistance training. This benefit may be associated with resting bradycardia and reduced cardiac sympathetic tone after training, which suggests potential benefits of resistance exercise for the management of hypertension after ovarian hormone deprivation

  13. Dynamic resistance training decreases sympathetic tone in hypertensive ovariectomized rats

    Energy Technology Data Exchange (ETDEWEB)

    Shimojo, G.L.; Palma, R.K.; Brito, J.O.; Sanches, I.C. [Laboratório de Fisiologia Translacional, Programa de Ciências da Reabilitação, Universidade Nove de Julho, São Paulo, SP (Brazil); Irigoyen, M.C. [Instituto do Coração, Faculdade de Medicina, Universidade de São Paulo, São Paulo, SP (Brazil); De Angelis, K. [Laboratório de Fisiologia Translacional, Programa de Ciências da Reabilitação, Universidade Nove de Julho, São Paulo, SP (Brazil)

    2015-03-27

    The aim of this study was to investigate the effects of resistance exercise training on hemodynamics and cardiac autonomic control in ovariectomized spontaneously hypertensive rats. Female rats were divided into 4 groups: sedentary control (SC), sedentary hypertensive (SH), sedentary hypertensive ovariectomized (SHO), and resistance-trained hypertensive ovariectomized (RTHO). Resistance exercise training was performed on a vertical ladder (5 days/week, 8 weeks) at 40-60% maximal load. Direct arterial pressure was recorded. Vagal and sympathetic tones were measured by heart rate (HR) responses to methylatropine (3 mg/kg, iv) and propranolol (4 mg/kg, iv). Ovariectomy resulted in additional increases in blood pressure in hypertensive rats and was associated with decreased vagal tone. Resistance exercise trained rats had lower mean arterial pressure than untrained rats (RTHO: 159±2.2 vs SHO: 177±3.4 mmHg), as well as resting bradycardia (RTHO: 332±9.0 vs SHO: 356±5 bpm). Sympathetic tone was also lower in the trained group. Moreover, sympathetic tone was positively correlated with resting HR (r=0.7, P<0.05). The additional arterial pressure increase in hypertensive rats caused by ovarian hormone deprivation was attenuated by moderate-intensity dynamic resistance training. This benefit may be associated with resting bradycardia and reduced cardiac sympathetic tone after training, which suggests potential benefits of resistance exercise for the management of hypertension after ovarian hormone deprivation.

  14. Vestibular control of sympathetic activity. An otolith-sympathetic reflex in humans.

    Science.gov (United States)

    Kaufmann, H; Biaggioni, I; Voustianiouk, A; Diedrich, A; Costa, F; Clarke, R; Gizzi, M; Raphan, T; Cohen, B

    2002-04-01

    It has been proposed that a vestibular reflex originating in the otolith organs and other body graviceptors modulates sympathetic activity during changes in posture with regard to gravity. To test this hypothesis, we selectively stimulated otolith and body graviceptors sinusoidally along different head axes in the coronal plane with off-vertical axis rotation (OVAR) and recorded sympathetic efferent activity in the peroneal nerve (muscle sympathetic nerve activity, MSNA), blood pressure, heart rate, and respiratory rate. All parameters were entrained during OVAR at the frequency of rotation, with MSNA increasing in nose-up positions during forward linear acceleration and decreasing when nose-down. MSNA was correlated closely with blood pressure when subjects were within +/-90 degrees of nose-down positions with a delay of 1.4 s, the normal latency of baroreflex-driven changes in MSNA. Thus, in the nose-down position, MSNA was probably driven by baroreflex afferents. In contrast, when subjects were within +/-45 degrees of the nose-up position, i.e., when positive linear acceleration was maximal along the naso-ocipital axis, MSNA was closely related to gravitational acceleration at a latency of 0.4 s. This delay is too short for MSNA changes to be mediated by the baroreflex, but it is compatible with the delay of a response originating in the vestibular system. We postulate that a vestibulosympathetic reflex, probably originating mainly in the otolith organs, contributes to blood pressure maintenance during forward linear acceleration. Because of its short latency, this reflex may be one of the earliest mechanisms to sustain blood pressure upon standing.

  15. Chemical signals of fish skin for the attachment response of Acanthostomum brauni cercariae.

    Science.gov (United States)

    Haas, W; de Nuñez, M O

    1988-01-01

    The chemical signals of the skin surface of fish, which stimulate the attachment responses of Acanthostomum brauni cercariae, were identified by offering chemicals and fish-skin extracts in agarose substrates to the cercariae. Smaller molecules such as amino acids, fatty acids, monosaccharides, electrolytes, urea, and carbonate solutions did not stimulate attachments, but hyaluronic acid had some effects. Bovine submaxillary glycoproteins had a strong stimulating activity that disappeared after neuraminidase digestion. The stimulating components of the skin surface of fish were hydrophilic substances with molecular weights of more than 10,000. They were sensitive to neuraminidase digestion but not to hyaluronidase digestion and thus can be identified as glycoproteins. A. brauni cercariae respond only to the complete glycoprotein molecules and not to their monosaccharide components. The known attachment triggers of other cercariae are small molecules. Large glycoproteins as host signals for A. brauni cercariae may be an adaptation to muddy habitats, where various substances with low molecular weights may interfere with the host identification.

  16. Raman spectroscopy: in vivo quick response code of skin physiological status

    Science.gov (United States)

    Vyumvuhore, Raoul; Tfayli, Ali; Piot, Olivier; Le Guillou, Maud; Guichard, Nathalie; Manfait, Michel; Baillet-Guffroy, Arlette

    2014-11-01

    Dermatologists need to combine different clinically relevant characteristics for a better understanding of skin health. These characteristics are usually measured by different techniques, and some of them are highly time consuming. Therefore, a predicting model based on Raman spectroscopy and partial least square (PLS) regression was developed as a rapid multiparametric method. The Raman spectra collected from the five uppermost micrometers of 11 healthy volunteers were fitted to different skin characteristics measured by independent appropriate methods (transepidermal water loss, hydration, pH, relative amount of ceramides, fatty acids, and cholesterol). For each parameter, the obtained PLS model presented correlation coefficients higher than R2=0.9. This model enables us to obtain all the aforementioned parameters directly from the unique Raman signature. In addition to that, in-depth Raman analyses down to 20 μm showed different balances between partially bound water and unbound water with depth. In parallel, the increase of depth was followed by an unfolding process of the proteins. The combinations of all these information led to a multiparametric investigation, which better characterizes the skin status. Raman signal can thus be used as a quick response code (QR code). This could help dermatologic diagnosis of physiological variations and presents a possible extension to pathological characterization.

  17. Netrin-1 controls sympathetic arterial innervation.

    Science.gov (United States)

    Brunet, Isabelle; Gordon, Emma; Han, Jinah; Cristofaro, Brunella; Broqueres-You, Dong; Liu, Chun; Bouvrée, Karine; Zhang, Jiasheng; del Toro, Raquel; Mathivet, Thomas; Larrivée, Bruno; Jagu, Julia; Pibouin-Fragner, Laurence; Pardanaud, Luc; Machado, Maria J C; Kennedy, Timothy E; Zhuang, Zhen; Simons, Michael; Levy, Bernard I; Tessier-Lavigne, Marc; Grenz, Almut; Eltzschig, Holger; Eichmann, Anne

    2014-07-01

    Autonomic sympathetic nerves innervate peripheral resistance arteries, thereby regulating vascular tone and controlling blood supply to organs. Despite the fundamental importance of blood flow control, how sympathetic arterial innervation develops remains largely unknown. Here, we identified the axon guidance cue netrin-1 as an essential factor required for development of arterial innervation in mice. Netrin-1 was produced by arterial smooth muscle cells (SMCs) at the onset of innervation, and arterial innervation required the interaction of netrin-1 with its receptor, deleted in colorectal cancer (DCC), on sympathetic growth cones. Function-blocking approaches, including cell type-specific deletion of the genes encoding Ntn1 in SMCs and Dcc in sympathetic neurons, led to severe and selective reduction of sympathetic innervation and to defective vasoconstriction in resistance arteries. These findings indicate that netrin-1 and DCC are critical for the control of arterial innervation and blood flow regulation in peripheral organs.

  18. The nonlinear flexural response of a whole teleost fish: Contribution of scales and skin.

    Science.gov (United States)

    Szewciw, Lawrence; Zhu, Deju; Barthelat, Francois

    2017-12-01

    The scaled skin of fish is an intricate system that provides mechanical protection against hard and sharp puncture, while maintaining the high flexural compliance required for unhindered locomotion. This unusual combination of local hardness and global compliance makes fish skin an interesting model for bioinspired protective systems. In this work we investigate the flexural response of whole teleost fish, and how scales may affect global flexural stiffness. A bending moment is imposed on the entire body of a striped bass (Morone saxatilis). Imaging is used to measure local curvature, to generate moment-curvature curves as function of position along the entire axis of the fish. We find that the flexural stiffness is the highest in the thick middle portion of the fish, and lowest in the caudal and rostral ends. The flexural response is nonlinear, with an initial soft response followed by significant stiffening at larger flexural deformations. Low flexural stiffness at low curvatures promotes efficient swimming, while higher stiffness at high curvatures enables a possible tendon effect, where the mechanical energy at the end of a stroke is stored in the form of strain energy in the fish skin. To assess the contribution of the scales to stiffening we performed flexural tests with and without scales, following a careful protocol to take in account tissue degradation and the effects of temperature. Our findings suggest that scales do not substantially increase the whole body flexural stiffness of teleost fish over ranges of deformations which are typical of swimming and maneuvering. Teleost scales are thin and relatively flexible, so they can accommodate large flexural deformations. This finding is in contrast to the bulkier ganoid scales which were shown in previous reports to have a profound impact of global flexural deformations and swimming in fish like gar or Polypterus. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Differences in finger skin contact cooling response between an arterial occlusion and a vasodilated condition.

    Science.gov (United States)

    Jay, Ollie; Havenith, George

    2006-05-01

    To assess the presence and magnitude of the effect of skin blood flow on finger skin cooling on contact with cold objects against the background of circulatory disorder risks in occupational exposures, this study investigates the effect of zero vs. close-to-maximal hand blood flow on short-term (cooling response at a contact pressure that allows capillary perfusion of the distal pulp of the fingertip. Six male volunteers touched a block of aluminium with a finger contact force of 0.5 N at a temperature of -2 degrees C under a vasodilated and an occluded condition. Before both conditions, participants were required to exercise in a hot room for > or = 30 min for cutaneous vasodilation to occur (increase in rectal temperature of 1 degrees C). Under the vasodilated condition, forearm blood flow rate rose as high as 16.8 ml.100 ml(-1).min(-1). Under the occluded condition, the arm was exsanguinated, after which a blood pressure cuff was secured on the wrist inducing arterial occlusion. Contact temperature of the finger pad during the subsequent cold contact exposure was measured. No significant difference was found between the starting skin temperatures for the two blood flow conditions, but a distinct difference in shape of the contact cooling curve was apparent between the two blood flow conditions, with Newtonian cooling observed under the occluded condition, whereas a rewarming of the finger skin toward the end of the exposure occurred for the vasodilated condition. Blood flow was found to significantly increase contact temperature from 40 s onward (P cooling during a vasodilated state.

  20. Staphylococcus aureus α-toxin modulates skin host response to viral infection.

    Science.gov (United States)

    Bin, Lianghua; Kim, Byung Eui; Brauweiler, Anne; Goleva, Elena; Streib, Joanne; Ji, Yinduo; Schlievert, Patrick M; Leung, Donald Y M

    2012-09-01

    Patients with atopic dermatitis (AD) with a history of eczema herpeticum have increased staphylococcal colonization and infections. However, whether Staphylococcus aureus alters the outcome of skin viral infection has not been determined. We investigated whether S aureus toxins modulated host response to herpes simplex virus (HSV) 1 and vaccinia virus (VV) infections in normal human keratinocytes (NHKs) and in murine infection models. NHKs were treated with S aureus toxins before incubation of viruses. BALB/c mice were inoculated with S aureus 2 days before VV scarification. Viral loads of HSV-1 and VV were evaluated by using real-time PCR, a viral plaque-forming assay, and immunofluorescence staining. Small interfering RNA duplexes were used to knockdown the gene expression of the cellular receptor of α-toxin, a disintegrin and metalloprotease 10 (ADAM10). ADAM10 protein and α-toxin heptamers were detected by using Western blot assays. We demonstrate that sublytic staphylococcal α-toxin increases viral loads of HSV-1 and VV in NHKs. Furthermore, we demonstrate in vivo that the VV load is significantly greater (P skin inoculated with an α-toxin-producing S aureus strain compared with murine skin inoculated with the isogenic α-toxin-deleted strain. The viral enhancing effect of α-toxin is mediated by ADAM10 and is associated with its pore-forming property. Moreover, we demonstrate that α-toxin promotes viral entry in NHKs. The current study introduces the novel concept that staphylococcal α-toxin promotes viral skin infection and provides a mechanism by which S aureus infection might predispose the host toward disseminated viral infections. Copyright © 2012 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

  1. Effect of 3-Day Bed Rest on the Basal Sympathetic Activity and Responsiveness of this System to Physiological Stimuli In Athletes and Sedentary Subjects

    Science.gov (United States)

    Smorawinski, Jerzy; Adrian, Jacek; Kaciuba-Uscilko, Hanna; Nazar, Krystyna; Greenleaf, John E.; Dalton, P. Bonnie (Technical Monitor)

    2002-01-01

    The aims of this study were: (1) to examine the effect of three days of bed rest (BR) on basal plasma epinephrine [E] and norepinephrine [NE] and the catecholamine responses to various physiological stimuli, and (2) to find out whether previous physical activity modifies effects of BR. In the first series, 29 young men (11 sedentary students, 8 endurance and 10 strength trained athletes) were submitted to oral glucose tolerance test in supine position and to active orthostatic test before and after 3 days of BR. Plasma [E] and [NE] were measured after overnight fast (basal condition), at 60, 120 and 180 min after glucose ingestion (70 a), and at the 8th min of unsupported standing. In the second series, other 22 subjects (12 sedentary students, 10 endurance and 10 strength trained athletes) were submitted to 2 min cold pressor test (CPT) and exercise. Plasma E and NE were determined in the supine position after overnight fast and at 60th and 120th s of hand cooling. Then, after breakfast followed by 2-3 hour sitting, the subjects performed cycle ergometer exercise with workload increasing until volitional exhaustion. Plasma [E] and [NE] were determined at the end of each load. Plasma catecholamines were determined made radioenzymatically. After BR, basal plasma [NE] was decreased in endurance and strength athletes (psedentary subjects. In neither group BR affected the basal [E]. Responses of both catecholamines to glucose load were diminished after BR in all three groups (pwork intensity after than before BR (p<0.05).

  2. Differential Gene Expression in Primary Human Skin Keratinocytes and Fibroblasts in Response to Ionizing Radiation

    Science.gov (United States)

    Warters, Raymond L.; Packard, Ann T.; Kramer, Gwen F.; Gaffney, David K.; Moos, Philip J.

    2009-01-01

    Although skin is usually exposed during human exposures to ionizing radiation, there have been no thorough examinations of the transcriptional response of skin fibroblasts and keratinocytes to radiation. The transcriptional response of quiescent primary fibroblasts and keratinocytes exposed to from 10 cGy to 5 Gy and collected 4 h after treatment was examined. RNA was isolated and examined by microarray analysis for changes in the levels of gene expression. Exposure to ionizing radiation altered the expression of 279 genes across both cell types. Changes in RNA expression could be arranged into three main categories: (1) changes in keratinocytes but not in fibroblasts, (2) changes in fibroblasts but not in keratinocytes, and (3) changes in both. All of these changes were primarily of p53 target genes. Similar radiation-induced changes were induced in immortalized fibroblasts or keratinocytes. In separate experiments, protein was collected and analyzed by Western blotting for expression of proteins observed in microarray experiments to be overexpressed at the mRNA level. Both Q-PCR and Western blot analysis experiments validated these transcription changes. Our results are consistent with changes in the expression of p53 target genes as indicating the magnitude of cell responses to ionizing radiation. PMID:19580510

  3. Postural vascular response in human skin: passive and active reactions to alteration of transmural pressure.

    Science.gov (United States)

    Jepsen, H; Gaehtgens, P

    1993-09-01

    Laser-Doppler (LD) fluxmetry was performed in the palmar finger skin of healthy subjects to study the mechanisms contributing to the postural vascular response. Local transmural pressure in the skin blood vessels of the region studied was altered for 1 min in two experimental series either by passive movement of the arm to different vertical hand positions relative to heart level or by application of external pressure (-120-180 mmHg) to the finger. Heart and respiratory rate, arterial blood pressure, and LD flux in the contralateral finger (kept at heart level) were measured. The measurements suggest a compound reaction of local (myogenic) and systemic (neurogenic) mechanisms: the local regulatory component appears as a graded active vascular response elicited by passive vessel distension or compression. A systemic component, associated with a single deep inspiration, is frequently observed during the actual movement of the arm. In addition, prolonged holding of the test hand in a given vertical position also elicits a delayed vascular response in the control hand at heart level, which may be generated by volume receptors in the intrathoracic low-pressure system.

  4. Skin-Resident T Cells Drive Dermal Dendritic Cell Migration in Response to Tissue Self-Antigen.

    Science.gov (United States)

    Ali, Niwa; Zirak, Bahar; Truong, Hong-An; Maurano, Megan M; Gratz, Iris K; Abbas, Abul K; Rosenblum, Michael D

    2018-05-01

    Migratory dendritic cell (DC) subsets deliver tissue Ags to draining lymph nodes (DLNs) to either initiate or inhibit T cell-mediated immune responses. The signals mediating DC migration in response to tissue self-antigen are largely unknown. Using a mouse model of inducible skin-specific self-antigen expression, we demonstrate that CD103 + dermal DCs (DDCs) rapidly migrate from skin to skin DLN (SDLNs) within the first 48 h after Ag expression. This window of time was characterized by the preferential activation of tissue-resident Ag-specific effector T cells (Teffs), with no concurrent activation of Ag-specific Teffs in SDLNs. Using genetic deletion and adoptive transfer approaches, we show that activation of skin-resident Teffs is required to drive CD103 + DDC migration in response to tissue self-antigen and this Batf3-dependent DC population is necessary to mount a fulminant autoimmune response in skin. Conversely, activation of Ag-specific Teffs in SDLNs played no role in DDC migration. Our studies reveal a crucial role for skin-resident T cell-derived signals, originating at the site of self-antigen expression, to drive DDC migration during the elicitation phase of an autoimmune response. Copyright © 2018 by The American Association of Immunologists, Inc.

  5. Increased sympathetic tone in forearm subcutaneous tissue in primary hypothyroidism

    DEFF Research Database (Denmark)

    Vagn Nielsen, H; Hasselström, K; Feldt-Rasmussen, U

    1987-01-01

    vasoconstriction normally seen after lowering the forearm 40 cm below heart level was absent since SBF only decreased by 4% (+/- 7%, P greater than 0.1) during these conditions. In head-up vertical position we noticed a diminished baroreceptor response as SBF at heart level was reduced by 11% (+/- 7%, P greater...... than 0.1) compared to supine position. After proximal local anaesthesia SBF increased by 351% (+/- 81%, P less than 0.01) and disclosed a normal vasoconstrictor response as SBF was reduced by 53% (+/- 5%, P less than 0.01) during arm lowering. Five of the treated patients were restudied.......02)). In conclusion sympathetic vasoconstrictor activity in adipose tissue is markedly increased in primary hypothyroidism. Sympathetic tone and arterial pressure are reduced during treatment....

  6. Sympathetic network drive during water deprivation does not increase respiratory or cardiac rhythmic sympathetic nerve activity.

    Science.gov (United States)

    Holbein, Walter W; Toney, Glenn M

    2013-06-15

    Effects of water deprivation on rhythmic bursting of sympathetic nerve activity (SNA) were investigated in anesthetized, bilaterally vagotomized, euhydrated (control) and 48-h water-deprived (WD) rats (n = 8/group). Control and WD rats had similar baseline values of mean arterial pressure, heart rate, end-tidal CO2, and central respiratory drive. Although integrated splanchnic SNA (sSNA) was greater in WD rats than controls (P analysis of respiratory rhythmic bursting of sSNA revealed that inspiratory rhythmic burst amplitude was actually smaller (P analysis revealed that water deprivation had no effect on either the amplitude or periodicity of the cardiac rhythmic oscillation of sSNA. Collectively, these data indicate that the increase of sSNA produced by water deprivation is not attributable to either increased respiratory or cardiac rhythmic burst discharge. Thus the sympathetic network response to acute water deprivation appears to differ from that of chronic sympathoexcitation in neurogenic forms of arterial hypertension, where increased respiratory rhythmic bursting of SNA and baroreflex adaptations have been reported.

  7. Fibroblast radiosensitivity versus acute and late normal skin responses in patients treated for breast cancer

    International Nuclear Information System (INIS)

    Brock, William A.; Tucker, Susan L.; Geara, Fady B.; Wike, Jennifer; Peters, Lester J.; Turesson, Ingela; Nyman, Jan

    1995-01-01

    Purpose/Objective: To determine if the radiosensitivity of normal human skin fibroblasts, measured in early passage cultures, is significantly correlated with the degree of acute or late normal skin damage in patients treated for breast cancer with radiotherapy. Methods and Materials: In the 1970s, a series of breast cancer patients was treated at the Department of Oncology in Gothenburg, Sweden with postoperative irradiation to the parasternal region. Patients were treated bilaterally using different fractionation schedules and doses to the right and left fields. Peak acute reactions were scored on a six-point scale, and skin erythema was measured by reflectance spectrophotometry. Telangiectasia was graded over time on a six-point scale. In April 1992, two small skin biopsies were obtained from 22 patients in two treatment groups (i.e., four dose-fractionation schedules) and, using either delayed or immediate plating, fibroblast radiosensitivity was measured in early passage cultures by clonogenic survival, after high and low dose-rate irradiations. Survival at 2.0 Gy (SF2) was calculated from complete survival curves. Results: To test assay reproducibility, SF2 values derived from paired biopsies of the same patient (12 cases) were compared. A reasonably good correlation (p = 0.075) was obtained for SF2s determined by high dose-rate irradiations with immediate plating, but not for delayed plating or low dose-rate treatments. The median coefficient of variation in the replicate SF2s after high dose-rate treatment and immediate plating was 13%, suggesting that the poor correlation in paired SF2 values is due to the magnitude of the uncertainty in SF2 relative to the overall spread in SF2 values between patients (CV = 28%). Individual SF2 values and averaged values from patients with data from two biopsies were compared with the acute and late clinical reactions. A significant negative correlation was found between SF2 and relative clinical response, but only when

  8. 575 Photoaging Attenuates Skin Test Response to Histamine More Than Natural Aging

    OpenAIRE

    King, Monroe James; Fitzhugh, David; Lockey, Richard F.

    2012-01-01

    Background Clinical experience suggests that skin test reactivity is often decreased in photo-exposed skin versus sun-protected skin in older individuals. The current study was designed to address whether photoaging or natural aging of skin causes a greater diminution in skin test reponse. Methods Prick-puncture skin tests to histamine were performed on sun-exposed and sun-protected areas in younger (n = 61, age 20–50) and older (n = 63, age 60–87) adult volunteers who were recruited for skin...

  9. Somatosympathetic vasoconstrictor reflexes in human spinal cord injury: responses to innocuous and noxious sensory stimulation below lesion

    Directory of Open Access Journals (Sweden)

    Vaughan G Macefield

    2012-06-01

    Full Text Available It is known that the sudden increases in blood pressure associated with autonomic dysreflexia in people with spinal cord injury (SCI is due to a spinally-mediated reflex activation of sympathetic vasoconstrictor neurones supplying skeletal muscle and the gut. Apart from visceral inputs, such as those originating from a distended bladder, there is a prevailing opinion that autonomic dysreflexia can be triggered by noxious stimulation below the lesion. However, do noxious inputs really cause an increase in blood pressure in SCI? Using microelectrodes inserted into a peripheral nerve to record sympathetic nerve activity we had previously shown that selective stimulation of small-diameter afferents in muscle or skin, induced by bolus injection of hypertonic saline into the tibialis anterior muscle or the overlying skin, evokes a sustained increase in muscle sympathetic nerve activity and blood pressure and a transient increase in skin sympathetic nerve activity and decrease in skin blood flow. We postulated that these sympathetic responses would be exaggerated in SCI, with a purely noxious stimulus causing long-lasting increases in blood pressure and long-lasting decreases in skin blood flow. Surprisingly, though, we found that intramuscular or subcutaneous injection of hypertonic saline into the leg caused negligible changes in these parameters. Conversely, weak electrical stimulation over the abdominal wall, which in able-bodied subjects is not painful and activates large-diameter cutaneous afferents, caused a marked increase in blood pressure in SCI but not in able-bodied subjects. This suggests that it is activation of large-diameter somatic afferents, not small-diameter afferents, that triggers increases in sympathetic outflow in SCI. Whether the responses to activation of large-diameter afferents reflect plastic changes in the spinal cord in SCI is unknown.

  10. Cooling reduces the cutaneous afferent firing response to vibratory stimuli in glabrous skin of the human foot sole.

    Science.gov (United States)

    Lowrey, Catherine R; Strzalkowski, Nicholas D J; Bent, Leah R

    2013-02-01

    Skin on the foot sole plays an important role in postural control. Cooling the skin of the foot is often used to induce anesthesia to determine the role of skin in motor and balance control. The effect of cooling on the four classes of mechanoreceptor in the skin is largely unknown, and thus the aim of the present study was to characterize the effects of cooling on individual skin receptors in the foot sole. Such insight will better isolate individual receptor contributions to balance control. Using microneurography, we recorded 39 single nerve afferents innervating mechanoreceptors in the skin of the foot sole in humans. Afferents were identified as fast-adapting (FA) or slowly adapting (SA) type I or II (FA I n = 16, FA II n = 7, SA I n = 6, SA II n = 11). Receptor response to vibration was compared before and after cooling of the receptive field (2-20 min). Overall, firing response was abolished in 30% of all receptors, and this was equally distributed across receptor type (P = 0.69). Longer cooling times were more likely to reduce firing response below 50% of baseline; however, some afferent responses were abolished with shorter cooling times (2-5 min). Skin temperature was not a reliable indicator of the level of receptor activation and often became uncoupled from receptor response levels, suggesting caution in the use of this parameter as an indicator of anesthesia. When cooled, receptors preferentially coded lower frequencies in response to vibration. In response to a sustained indentation, SA receptors responded more like FA receptors, primarily coding "on-off" events.

  11. Syk/Src Pathway-Targeted Inhibition of Skin Inflammatory Responses by Carnosic Acid

    Directory of Open Access Journals (Sweden)

    Jueun Oh

    2012-01-01

    Full Text Available Carnosic acid (CA is a diterpene compound exhibiting antioxidative, anticancer, anti-angiogenic, anti-inflammatory, anti-metabolic disorder, and hepatoprotective and neuroprotective activities. In this study, the effect of CA on various skin inflammatory responses and its inhibitory mechanism were examined. CA strongly suppressed the production of IL-6, IL-8, and MCP-1 from keratinocyte HaCaT cells stimulated with sodium lauryl sulfate (SLS and retinoic acid (RA. In addition, CA blocked the release of nitric oxide (NO, tumor necrosis factor (TNF-α, and prostaglandin E2 (PGE2 from RAW264.7 cells activated by the toll-like receptor (TLR-2 ligands, Gram-positive bacterium-derived peptidoglycan (PGN and pam3CSK, and the TLR4 ligand, Gram-negative bacterium-derived lipopolysaccharide (LPS. CA arrested the growth of dermatitis-inducing Gram-positive and Gram-negative microorganisms such Propionibacterium acnes, Pseudomonas aeruginosa, and Staphylococcus aureus. CA also blocked the nuclear translocation of nuclear factor (NF-κB and its upstream signaling including Syk/Src, phosphoinositide 3-kinase (PI3K, Akt, inhibitor of κBα (IκBα kinase (IKK, and IκBα for NF-κB activation. Kinase assays revealed that Syk could be direct enzymatic target of CA in its anti-inflammatory action. Therefore, our data strongly suggest the potential of CA as an anti-inflammatory drug against skin inflammatory responses with Src/NF-κB inhibitory properties.

  12. Optimisation of gelatin extraction from Unicorn leatherjacket (Aluterus monoceros) skin waste: response surface approach.

    Science.gov (United States)

    Hanjabam, Mandakini Devi; Kannaiyan, Sathish Kumar; Kamei, Gaihiamngam; Jakhar, Jitender Kumar; Chouksey, Mithlesh Kumar; Gudipati, Venkateshwarlu

    2015-02-01

    Physical properties of gelatin extracted from Unicorn leatherjacket (Aluterus monoceros) skin, which is generated as a waste from fish processing industries, were optimised using Response Surface Methodology (RSM). A Box-Behnken design was used to study the combined effects of three independent variables, namely phosphoric acid (H3PO4) concentration (0.15-0.25 M), extraction temperature (40-50 °C) and extraction time (4-12 h) on different responses like yield, gel strength and melting point of gelatin. The optimum conditions derived by RSM for the yield (10.58%) were 0.2 M H3PO4 for 9.01 h of extraction time and hot water extraction of 45.83 °C. The maximum achieved gel strength and melting point was 138.54 g and 22.61 °C respectively. Extraction time was found to be most influencing variable and had a positive coefficient on yield and negative coefficient on gel strength and melting point. The results indicated that Unicorn leatherjacket skins can be a source of gelatin having mild gel strength and melting point.

  13. Laser speckle contrast imaging of skin blood perfusion responses induced by laser coagulation

    Energy Technology Data Exchange (ETDEWEB)

    Ogami, M; Kulkarni, R; Wang, H; Reif, R; Wang, R K [University of Washington, Department of Bioengineering, Seattle, Washington 98195 (United States)

    2014-08-31

    We report application of laser speckle contrast imaging (LSCI), i.e., a fast imaging technique utilising backscattered light to distinguish such moving objects as red blood cells from such stationary objects as surrounding tissue, to localise skin injury. This imaging technique provides detailed information about the acute perfusion response after a blood vessel is occluded. In this study, a mouse ear model is used and pulsed laser coagulation serves as the method of occlusion. We have found that the downstream blood vessels lacked blood flow due to occlusion at the target site immediately after injury. Relative flow changes in nearby collaterals and anastomotic vessels have been approximated based on differences in intensity in the nearby collaterals and anastomoses. We have also estimated the density of the affected downstream vessels. Laser speckle contrast imaging is shown to be used for highresolution and fast-speed imaging for the skin microvasculature. It also allows direct visualisation of the blood perfusion response to injury, which may provide novel insights to the field of cutaneous wound healing. (laser biophotonics)

  14. Laser speckle contrast imaging of skin blood perfusion responses induced by laser coagulation

    Science.gov (United States)

    Ogami, M.; Kulkarni, R.; Wang, H.; Reif, R.; Wang, R. K.

    2014-08-01

    We report application of laser speckle contrast imaging (LSCI), i.e., a fast imaging technique utilising backscattered light to distinguish such moving objects as red blood cells from such stationary objects as surrounding tissue, to localise skin injury. This imaging technique provides detailed information about the acute perfusion response after a blood vessel is occluded. In this study, a mouse ear model is used and pulsed laser coagulation serves as the method of occlusion. We have found that the downstream blood vessels lacked blood flow due to occlusion at the target site immediately after injury. Relative flow changes in nearby collaterals and anastomotic vessels have been approximated based on differences in intensity in the nearby collaterals and anastomoses. We have also estimated the density of the affected downstream vessels. Laser speckle contrast imaging is shown to be used for highresolution and fast-speed imaging for the skin microvasculature. It also allows direct visualisation of the blood perfusion response to injury, which may provide novel insights to the field of cutaneous wound healing.

  15. Impact of Age and Insulin-Like Growth Factor-1 on DNA Damage Responses in UV-Irradiated Human Skin.

    Science.gov (United States)

    Kemp, Michael G; Spandau, Dan F; Travers, Jeffrey B

    2017-02-26

    The growing incidence of non-melanoma skin cancer (NMSC) necessitates a thorough understanding of its primary risk factors, which include exposure to ultraviolet (UV) wavelengths of sunlight and age. Whereas UV radiation (UVR) has long been known to generate photoproducts in genomic DNA that promote genetic mutations that drive skin carcinogenesis, the mechanism by which age contributes to disease pathogenesis is less understood and has not been sufficiently studied. In this review, we highlight studies that have considered age as a variable in examining DNA damage responses in UV-irradiated skin and then discuss emerging evidence that the reduced production of insulin-like growth factor-1 (IGF-1) by senescent fibroblasts in the dermis of geriatric skin creates an environment that negatively impacts how epidermal keratinocytes respond to UVR-induced DNA damage. In particular, recent data suggest that two principle components of the cellular response to DNA damage, including nucleotide excision repair and DNA damage checkpoint signaling, are both partially defective in keratinocytes with inactive IGF-1 receptors. Overcoming these tumor-promoting conditions in aged skin may therefore provide a way to lower aging-associated skin cancer risk, and thus we will consider how dermal wounding and related clinical interventions may work to rejuvenate the skin, re-activate IGF-1 signaling, and prevent the initiation of NMSC.

  16. Impact of Age and Insulin-Like Growth Factor-1 on DNA Damage Responses in UV-Irradiated Human Skin

    Directory of Open Access Journals (Sweden)

    Michael G. Kemp

    2017-02-01

    Full Text Available The growing incidence of non-melanoma skin cancer (NMSC necessitates a thorough understanding of its primary risk factors, which include exposure to ultraviolet (UV wavelengths of sunlight and age. Whereas UV radiation (UVR has long been known to generate photoproducts in genomic DNA that promote genetic mutations that drive skin carcinogenesis, the mechanism by which age contributes to disease pathogenesis is less understood and has not been sufficiently studied. In this review, we highlight studies that have considered age as a variable in examining DNA damage responses in UV-irradiated skin and then discuss emerging evidence that the reduced production of insulin-like growth factor-1 (IGF-1 by senescent fibroblasts in the dermis of geriatric skin creates an environment that negatively impacts how epidermal keratinocytes respond to UVR-induced DNA damage. In particular, recent data suggest that two principle components of the cellular response to DNA damage, including nucleotide excision repair and DNA damage checkpoint signaling, are both partially defective in keratinocytes with inactive IGF-1 receptors. Overcoming these tumor-promoting conditions in aged skin may therefore provide a way to lower aging-associated skin cancer risk, and thus we will consider how dermal wounding and related clinical interventions may work to rejuvenate the skin, re-activate IGF-1 signaling, and prevent the initiation of NMSC.

  17. Epidermal Rac1 regulates the DNA damage response and protects from UV-light-induced keratinocyte apoptosis and skin carcinogenesis

    Science.gov (United States)

    Deshmukh, Jayesh; Pofahl, Ruth; Haase, Ingo

    2017-01-01

    Non-melanoma skin cancer (NMSC) is the most common type of cancer. Increased expression and activity of Rac1, a small Rho GTPase, has been shown previously in NMSC and other human cancers; suggesting that Rac1 may function as an oncogene in skin. DMBA/TPA skin carcinogenesis studies in mice have shown that Rac1 is required for chemically induced skin papilloma formation. However, UVB radiation by the sun, which causes DNA damage, is the most relevant cause for NMSC. A potential role of Rac1 in UV-light-induced skin carcinogenesis has not been investigated so far. To investigate this, we irradiated mice with epidermal Rac1 deficiency (Rac1-EKO) and their controls using a well-established protocol for long-term UV-irradiation. Most of the Rac1-EKO mice developed severe skin erosions upon long-term UV-irradiation, unlike their controls. These skin erosions in Rac1-EKO mice healed subsequently. Surprisingly, we observed development of squamous cell carcinomas (SCCs) within the UV-irradiation fields. This shows that the presence of Rac1 in the epidermis protects from UV-light-induced skin carcinogenesis. Short-term UV-irradiation experiments revealed increased UV-light-induced apoptosis of Rac1-deficient epidermal keratinocytes in vitro as well as in vivo. Further investigations using cyclobutane pyrimidine dimer photolyase transgenic mice revealed that the observed increase in UV-light-induced keratinocyte apoptosis in Rac1-EKO mice is DNA damage dependent and correlates with caspase-8 activation. Furthermore, Rac1-deficient keratinocytes showed reduced levels of p53, γ-H2AX and p-Chk1 suggesting an attenuated DNA damage response upon UV-irradiation. Taken together, our data provide direct evidence for a protective role of Rac1 in UV-light-induced skin carcinogenesis and keratinocyte apoptosis probably through regulating mechanisms of the DNA damage response and repair pathways. PMID:28277539

  18. Epidermal Rac1 regulates the DNA damage response and protects from UV-light-induced keratinocyte apoptosis and skin carcinogenesis.

    Science.gov (United States)

    Deshmukh, Jayesh; Pofahl, Ruth; Haase, Ingo

    2017-03-09

    Non-melanoma skin cancer (NMSC) is the most common type of cancer. Increased expression and activity of Rac1, a small Rho GTPase, has been shown previously in NMSC and other human cancers; suggesting that Rac1 may function as an oncogene in skin. DMBA/TPA skin carcinogenesis studies in mice have shown that Rac1 is required for chemically induced skin papilloma formation. However, UVB radiation by the sun, which causes DNA damage, is the most relevant cause for NMSC. A potential role of Rac1 in UV-light-induced skin carcinogenesis has not been investigated so far. To investigate this, we irradiated mice with epidermal Rac1 deficiency (Rac1-EKO) and their controls using a well-established protocol for long-term UV-irradiation. Most of the Rac1-EKO mice developed severe skin erosions upon long-term UV-irradiation, unlike their controls. These skin erosions in Rac1-EKO mice healed subsequently. Surprisingly, we observed development of squamous cell carcinomas (SCCs) within the UV-irradiation fields. This shows that the presence of Rac1 in the epidermis protects from UV-light-induced skin carcinogenesis. Short-term UV-irradiation experiments revealed increased UV-light-induced apoptosis of Rac1-deficient epidermal keratinocytes in vitro as well as in vivo. Further investigations using cyclobutane pyrimidine dimer photolyase transgenic mice revealed that the observed increase in UV-light-induced keratinocyte apoptosis in Rac1-EKO mice is DNA damage dependent and correlates with caspase-8 activation. Furthermore, Rac1-deficient keratinocytes showed reduced levels of p53, γ-H2AX and p-Chk1 suggesting an attenuated DNA damage response upon UV-irradiation. Taken together, our data provide direct evidence for a protective role of Rac1 in UV-light-induced skin carcinogenesis and keratinocyte apoptosis probably through regulating mechanisms of the DNA damage response and repair pathways.

  19. Fibroblast radiosensitivity versus acute and late normal skin responses in patients treated for breast cancer

    International Nuclear Information System (INIS)

    Brock, W.A.; Wike, J.; Tucker, S.L.

    1995-01-01

    To determine if the radiosensitivity of normal human skin fibroblasts, measured in early passage cultures, is significantly correlated with the degree of acute or late normal skin damage in patients treated for breast cancer with radiotherapy. To test assay reproducibility, SF2 values derived from paired biopsies of the same patient (12 cases) were compared. A reasonably good correlation (p = 0.075) was obtained for SF2s determined by high dose-rate irradiations with immediated plating, but not for delayed plating or low dose-rate treatments. The median coefficient of variation in the replicate SF2s after high dose-rate treatment and immediate plating was 13%, suggesting that the poor correlation in paired SF2 values is due to the magnitude of the uncertainty in SF2 relative to the overall spread in SF2 values between patients (CV = 28%). Individual SF2 values and averaged values from patients with data from two biopsies were compared with the acute and late clinical reactions. A significant negative correlation was found between SF2 and relative clinical response, but only when averaged high dose-rate SF2 values and telangiectasia scores were compared. There was no significant correlation between average SF2 values and acute responses or between individual SF2 measurements and either the acute or late clinical response. The results of this study suggest that the degree of late telangiectasia is at least partially dependent upon the intrinsic cellular radiosensitivity of normal fibroblasts, but the relationship is not clear cut. Multiple replicate assays are necessary to obtain reliable estimates of fibroblast SF2 values using current techniques. 20 refs., 3 figs., 3 tabs

  20. Modeling the Mechanical Response of In Vivo Human Skin Under a Rich Set of Deformations

    KAUST Repository

    Flynn, Cormac

    2011-03-11

    Determining the mechanical properties of an individual\\'s skin is important in the fields of pathology, biomedical device design, and plastic surgery. To address this need, we present a finite element model that simulates the skin of the anterior forearm and posterior upper arm under a rich set of three-dimensional deformations. We investigated the suitability of the Ogden and Tong and Fung strain energy functions along with a quasi-linear viscoelastic law. Using non-linear optimization techniques, we found material parameters and in vivo pre-stresses for different volunteers. The model simulated the experiments with errors-of-fit ranging from 13.7 to 21.5%. Pre-stresses ranging from 28 to 92 kPa were estimated. We show that using only in-plane experimental data in the parameter optimization results in a poor prediction of the out-of-plane response. The identifiability of the model parameters, which are evaluated using different determinability criteria, improves by increasing the number of deformation orientations in the experiments. © 2011 Biomedical Engineering Society.

  1. Assessing the sensitivity of human skin hyperspectral responses to increasing anemia severity levels

    Science.gov (United States)

    Baranoski, Gladimir V. G.; Dey, Ankita; Chen, Tenn F.

    2015-09-01

    Anemia is a prevalent medical condition that seriously affects millions of people all over the world. In many regions, not only its initial detection but also its monitoring are hindered by limited access to laboratory facilities. This situation has motivated the development of a wide range of optical devices and procedures to assist physicians in these tasks. Although noticeable progress has been achieved in this area, the search for reliable, low-cost, and risk-free solutions still continues, and the strengthening of the knowledge base about this disorder and its effects is essential for the success of these initiatives. We contribute to these efforts by closely examining the sensitivity of human skin hyperspectral responses (within and outside the visible region of the light spectrum) to reduced hemoglobin concentrations associated with increasing anemia severity levels. This investigation, which involves skin specimens with distinct biophysical and morphological characteristics, is supported by controlled in silico experiments performed using a predictive light transport model and measured data reported in the biomedical literature. We also propose a noninvasive procedure to be employed in the monitoring of this condition at the point-of-care.

  2. Imaging immune response of skin mast cells in vivo with two-photon microscopy

    Science.gov (United States)

    Li, Chunqiang; Pastila, Riikka K.; Lin, Charles P.

    2012-02-01

    Intravital multiphoton microscopy has provided insightful information of the dynamic process of immune cells in vivo. However, the use of exogenous labeling agents limits its applications. There is no method to perform functional imaging of mast cells, a population of innate tissue-resident immune cells. Mast cells are widely recognized as the effector cells in allergy. Recently their roles as immunoregulatory cells in certain innate and adaptive immune responses are being actively investigated. Here we report in vivo mouse skin mast cells imaging with two-photon microscopy using endogenous tryptophan as the fluorophore. We studied the following processes. 1) Mast cells degranulation, the first step in the mast cell activation process in which the granules are released into peripheral tissue to trigger downstream reactions. 2) Mast cell reconstitution, a procedure commonly used to study mast cells functioning by comparing the data from wild type mice, mast cell-deficient mice, and mast-cell deficient mice reconstituted with bone marrow-derived mast cells (BMMCs). Imaging the BMMCs engraftment in tissue reveals the mast cells development and the efficiency of BMMCs reconstitution. We observed the reconstitution process for 6 weeks in the ear skin of mast cell-deficient Kit wsh/ w-sh mice by two-photon imaging. Our finding is the first instance of imaging mast cells in vivo with endogenous contrast.

  3. Modeling the Mechanical Response of In Vivo Human Skin Under a Rich Set of Deformations

    KAUST Repository

    Flynn, Cormac; Taberner, Andrew; Nielsen, Poul

    2011-01-01

    Determining the mechanical properties of an individual's skin is important in the fields of pathology, biomedical device design, and plastic surgery. To address this need, we present a finite element model that simulates the skin of the anterior

  4. A rare subset of skin-tropic regulatory T cells expressing Il10/Gzmb inhibits the cutaneous immune response.

    Science.gov (United States)

    Ikebuchi, Ryoyo; Teraguchi, Shunsuke; Vandenbon, Alexis; Honda, Tetsuya; Shand, Francis H W; Nakanishi, Yasutaka; Watanabe, Takeshi; Tomura, Michio

    2016-10-19

    Foxp3 + regulatory T cells (Tregs) migrating from the skin to the draining lymph node (dLN) have a strong immunosuppressive effect on the cutaneous immune response. However, the subpopulations responsible for their inhibitory function remain unclear. We investigated single-cell gene expression heterogeneity in Tregs from the dLN of inflamed skin in a contact hypersensitivity model. The immunosuppressive genes Ctla4 and Tgfb1 were expressed in the majority of Tregs. Although Il10-expressing Tregs were rare, unexpectedly, the majority of Il10-expressing Tregs co-expressed Gzmb and displayed Th1-skewing. Single-cell profiling revealed that CD43 + CCR5 + Tregs represented the main subset within the Il10/Gzmb-expressing cell population in the dLN. Moreover, CD43 + CCR5 + CXCR3 - Tregs expressed skin-tropic chemokine receptors, were preferentially retained in inflamed skin and downregulated the cutaneous immune response. The identification of a rare Treg subset co-expressing multiple immunosuppressive molecules and having tissue-remaining capacity offers a novel strategy for the control of skin inflammatory responses.

  5. Are We Afraid of Different Categories of Stimuli in Identical Ways? Evidence from Skin Conductance Responses

    Science.gov (United States)

    Yang, Jiongjiong

    2013-01-01

    Studies have shown that emotional pictures attract more attention than neutral pictures, and pictures of living stimuli have similar advantage in driving attention (vs. nonliving). However, factors of emotion, category and picture context are usually mixed so that whether living and nonliving categories elicit different skin conductance (SC) responses, in both conscious and unconscious conditions, remains to be clarified. In this study, participants were presented with negative and neutral pictures denoting different living and nonliving concepts in conscious (Experiments 1 and 2) and unconscious conditions (40ms, Experiment 3) when their SC responses were measured. The picture context was manipulated in Experiments 2 and 3 as half including human-related information. In three experiments, the emotional levels of different categories were matched in different and identical cohorts of participants. The results showed that living pictures in a negative, high-arousing dimension elicited stronger SC responses than nonliving pictures. When nonhuman animals and inanimate objects were compared, the increased SC responses to animals was obtained only for negative pictures without human contexts in the conscious condition, but regardless of human context in the unconscious condition. These results suggested that contextual information and level of conscious awareness are important to modulate the animate advantage in emotional processing. PMID:24039879

  6. Histamine response and local cooling in the human skin: involvement of H1- and H2-receptors.

    Science.gov (United States)

    Grossmann, M; Jamieson, M J; Kirch, W

    1999-08-01

    Histamine may contribute locally to cutaneous blood flow control under normal and pathologic conditions. The objective of this study was to observe the influence of skin temperature on histamine vasodilation, and the roles of H1-and H2-receptors using novel noninvasive methods. Eleven healthy subjects received, double-blind, single doses of the H1-receptor antagonist cetirizine (10 mg), cetirizine (10 mg) plus the H2-receptor antagonist cimetidine (400 mg), or placebo on separate occasions. Histamine was dosed cumulatively by iontophoresis to the forearm skin at 34 degrees C and 14 degrees C. Laser-Doppler flux (LDF) was measured at the same sites using customised probeholder/iontophoretic chambers with Peltier cooling elements. Finger mean arterial pressure (MAP) was measured and cutaneous vascular conductance calculated as LDF/MAP. Histamine vasodilation was reduced in cold skin. Cetirizine shifted the histamine dose-response at both temperatures: statistically significantly at 14 degrees C only. Combined H1- and H2-receptor antagonism shifted the response significantly at both temperatures. H1- and H2-receptors mediate histamine-induced skin vasodilation. The sensitivity of these receptors, particularly the H1- receptor, is attenuated at low skin temperature. Whether the reduced effect in cold skin represents specific receptor or postreceptor desensitization, or nonspecific attenuation of cutaneous vasodilation remains to be elucidated.

  7. The response of previously irradiated mouse skin to heat alone or combined with irradiation: influence of thermotolerance

    International Nuclear Information System (INIS)

    Wondergem, J.; Haveman, J.

    1983-01-01

    The effect of previous x-irradiation on the response to hyperthermia (44 0 C), x-irradiation, and irradiation combined with hyperthermia (43 0 C or 44 0 C) was studied in mouse foot skin. Irradiation of mice feet 90 days before, with 20 Gy, increased the subsequent response to heat alone, or combined with irradiation, as well as to irradiation alone. It had little effect on the thermal enhancement ratios for both acute and late skin reactions. Memory of the previous irradiation treatment could be masked when the temperature of the subsequent heat treatment alone, or combined with irradiation, was 44 0 C. Priming heat treatment induced resistance to a subsequent heat treatment and to a subsequent combined irradiation-heat treatment in normal as well as previously irradiated skin. When late skin reaction was considered, a larger 'memory' of the previous irradiation treatment was always evident, compared to acute skin reaction: the 'remembered' dose in the late skin reaction was about twice the 'remembered' dose in the acute reaction. (U.K.)

  8. Detecting electroporation by assessing the time constants in the exponential response of human skin to voltage controlled impulse electrical stimulation.

    Science.gov (United States)

    Bîrlea, Sinziana I; Corley, Gavin J; Bîrlea, Nicolae M; Breen, Paul P; Quondamatteo, Fabio; OLaighin, Gearóid

    2009-01-01

    We propose a new method for extracting the electrical properties of human skin based on the time constant analysis of its exponential response to impulse stimulation. As a result of this analysis an adjacent finding has arisen. We have found that stratum corneum electroporation can be detected using this analysis method. We have observed that a one time-constant model is appropriate for describing the electrical properties of human skin at low amplitude applied voltages (30V). Higher voltage amplitudes (>30V) have been proven to create pores in the skin's stratum corneum which offer a new, lower resistance, pathway for the passage of current through the skin. Our data shows that when pores are formed in the stratum corneum they can be detected, in-vivo, due to the fact that a second time constant describes current flow through them.

  9. Analysis of skin conductance response during evaluation of preferences for cosmetic products

    Science.gov (United States)

    Ohira, Hideki; Hirao, Naoyasu

    2015-01-01

    We analyzed skin conductance response (SCR) as a psychophysiological index to evaluate affective aspects of consumer preferences for cosmetic products. To examine the test-retest reliability of association between preferences and SCR, we asked 33 female volunteers to complete two experimental sessions approximately 1 year apart. The participants indicated their preferences in a typical paired comparison task by choosing the better option from a combination of two products among four products. We measured anticipatory SCR prior to expressions of the preferences. We found that the mean amplitude of the SCR elicited by the preferred products was significantly larger than that elicited by the non-preferred products. The participants' preferences and corresponding SCR patterns were well preserved at the second session 1 year later. Our results supported cumulating findings that SCR is a useful index of consumer preferences that has future potential, both in laboratory and marketing settings. PMID:25709593

  10. The response of mouse skin to multiple small doses of radiation

    International Nuclear Information System (INIS)

    Denekamp, J.; Harris, S.R.

    1975-01-01

    The response of mouse skin has been tested by irradiating the foot of albino mice and scoring erythema and desquamation during the following month. Multiple small doses of 150, 250 and 350 rad have been given 'daily', and the test dose necessary to achieve a given reaction has been determined one day after the last small fraction. This test dose has been compared with the single dose necessary to produce the same reaction level in previously untreated mice, in order to determine the ratio of the slopes of the dose-response curve at low and high doses: Slope ratio = (single dose - test dose)/total fractionated priming dose. In three separate experiments the slope ratio decreased as the dose per fraction was reduced from 350 to 150 rad. This conflicts with the data of Dutreix et al, who found a constant slope ratio over this dose range. The present data are compared with those obtained by Denekamp using 4, 9 and 14 fractions of 300 rad and by Douglas et al, using the same experimental technique, over the dose range 45 to 200 rad/fraction. In addition, the results from multifraction experiments in which equal dose increments were administered until the requisite skin reaction was achieved are also analysed in terms of their slope ratio (Fowler et al. Douglas et al). When all these results are plotted it is impossible to be sure whether the slope ratio is decreasing over the range 300 to 45 rad per fraction, although it seems likely. Most of the values at low doses lie in the range 0.15 to 0.25, indicating that at low doses the radiation is only 15 to 25% as effective per rad in causing cell death as at higher doses. (author)

  11. Paroxysmal sympathetic hyperactivity: An entity to keep in mind.

    Science.gov (United States)

    Godoy, D A; Panhke, P; Guerrero Suarez, P D; Murillo-Cabezas, F

    2017-12-15

    Paroxysmal sympathetic hyperactivity (PSH) is a potentially life-threatening neurological emergency secondary to multiple acute acquired brain injuries. It is clinically characterized by the cyclic and simultaneous appearance of signs and symptoms secondary to exacerbated sympathetic discharge. The diagnosis is based on the clinical findings, and high alert rates are required. No widely available and validated homogeneous diagnostic criteria have been established to date. There have been recent consensus attempts to shed light on this obscure phenomenon. Its physiopathology is complex and has not been fully clarified. However, the excitation-inhibition model is the theory that best explains the different aspects of this condition, including the response to treatment with the available drugs. The key therapeutic references are the early recognition of the disorder, avoiding secondary injuries and the triggering of paroxysms. Once sympathetic crises occur, they must peremptorily aborted and prevented. of the later the syndrome is recognized, the poorer the patient outcome. Copyright © 2017 Elsevier España, S.L.U. y SEMICYUC. All rights reserved.

  12. Central vs. peripheral neuraxial sympathetic control of porcine ventricular electrophysiology

    Science.gov (United States)

    Yamakawa, Kentaro; Howard-Quijano, Kimberly; Zhou, Wei; Rajendran, Pradeep; Yagishita, Daigo; Vaseghi, Marmar; Ajijola, Olujimi A.; Armour, J. Andrew; Shivkumar, Kalyanam; Ardell, Jeffrey L.

    2015-01-01

    Sympathoexcitation is associated with ventricular arrhythmogenesis. The aim of this study was to determine the role of thoracic dorsal root afferent neural inputs to the spinal cord in modulating ventricular sympathetic control of normal heart electrophysiology. We hypothesize that dorsal root afferent input tonically modulates basal and evoked efferent sympathetic control of the heart. A 56-electrode sock placed on the epicardial ventricle in anesthetized Yorkshire pigs (n = 17) recorded electrophysiological function, as well as activation recovery interval (ARI) and dispersion in ARI, at baseline conditions and during stellate ganglion electrical stimulation. Measures were compared between intact states and sequential unilateral T1–T4 dorsal root transection (DRTx), ipsilateral ventral root transection (VRTx), and contralateral dorsal and ventral root transections (DVRTx). Left or right DRTx decreased global basal ARI [Lt.DRTx: 369 ± 12 to 319 ± 13 ms (P < 0.01) and Rt.DRTx: 388 ± 19 to 356 ± 15 ms (P < 0.01)]. Subsequent unilateral VRTx followed by contralateral DRx+VRTx induced no further change. In intact states, left and right stellate ganglion stimulation shortened ARIs (6 ± 2% vs. 17 ± 3%), while increasing dispersion (+139% vs. +88%). There was no difference in magnitude of ARI or dispersion change with stellate stimulation following spinal root transections. Interruption of thoracic spinal afferent signaling results in enhanced basal cardiac sympathoexcitability without diminishing the sympathetic response to stellate ganglion stimulation. This suggests spinal dorsal root transection releases spinal cord-mediated tonic inhibitory control of efferent sympathetic tone, while maintaining intrathoracic cardiocentric neural networks. PMID:26661096

  13. Comparison of blood volume pulse and skin conductance responses to mental and affective stimuli at different anatomical sites

    International Nuclear Information System (INIS)

    Kushki, Azadeh; Fairley, Jillian; Merja, Satyam; King, Gillian; Chau, Tom

    2011-01-01

    Measurements of blood volume pulse (BVP) and skin conductance are commonly used as indications of psychological arousal in affective computing and human–machine interfaces. To date, palmar surfaces remain the primary site for these measurements. Placement of sensors on palmar surfaces, however, is undesirable when recordings are fraught with motion and pressure artifacts. These artifacts are frequent when the human participant has involuntary movements as in hyperkinetic cerebral palsy. This motivates the use of alternative measurement sites. The present study examined the correlation between measurements of blood volume pulse and skin conductance obtained from three different sites on the body (fingers, toes and ear for BVP; fingers, toes and arch of the foot for skin conductance) in response to cognitive and affective stimuli. The results of this pilot study indicated significant inter-site correlation among signal features derived from different sites, with the exception of BVP amplitude, the number of electrodermal reactions and the slope of the electrodermal activity response. We attribute these differences in part to inter-site discrepancies in local skin conditions, such as skin temperature. Despite these differences, significant changes from baseline were present in the responses to the cognitive and affective stimuli at non-palmar sites, suggesting that these sites may provide viable signal measurements for use in affective computing and human–machine interface applications

  14. Sympathetic neural modulation of the immune system

    International Nuclear Information System (INIS)

    Madden, K.S.

    1989-01-01

    One route by which the central nervous system communicates with lymphoid organs in the periphery is through the sympathetic nervous system (SNS). To study SNS regulation of immune activity in vivo, selective removal of peripheral noradrenergic nerve fibers was achieved by administration of the neurotoxic drug, 6-hydroxydopamine (6-OHDA), to adult mice. To assess SNS influence on lymphocyte proliferation in vitro, uptake of 125 iododeoxyuridine ( 125 IUdR), a DNA precursor, was measured following 6-OHDA treatment. Sympathectomy prior to epicutaneous immunization with TNCB did not alter draining lymph nodes (LN) cell proliferation, whereas 6-OHDA treatment before footpad immunization with KLH reduced DNA synthesis in popliteal LN by 50%. In mice which were not deliberately immunized, sympathectomy stimulated 125 IUdR uptake inguinal and axillary LN, spleen, and bone marrow. In vitro, these LN and spleen cells exhibited decreased proliferation responses to the T cell mitogen, concanavalin A (Con A), whereas lipopolysaccharide (LPS)-stimulated IgG secretion was enhanced. Studies examining 51 Cr-labeled lymphocyte trafficking to LN suggested that altered cell migration may play a part in sympathectomy-induced changes in LN cell function

  15. Eppur Si Muove: The dynamic nature of physiological control of renal blood flow by the renal sympathetic nerves.

    Science.gov (United States)

    Schiller, Alicia M; Pellegrino, Peter Ricci; Zucker, Irving H

    2017-05-01

    Tubuloglomerular feedback and the myogenic response are widely appreciated as important regulators of renal blood flow, but the role of the sympathetic nervous system in physiological renal blood flow control remains controversial. Where classic studies using static measures of renal blood flow failed, dynamic approaches have succeeded in demonstrating sympathetic control of renal blood flow under normal physiological conditions. This review focuses on transfer function analysis of renal pressure-flow, which leverages the physical relationship between blood pressure and flow to assess the underlying vascular control mechanisms. Studies using this approach indicate that the renal nerves are important in the rapid regulation of the renal vasculature. Animals with intact renal innervation show a sympathetic signature in the frequency range associated with sympathetic vasomotion that is eliminated by renal denervation. In conscious rabbits, this sympathetic signature exerts vasoconstrictive, baroreflex control of renal vascular conductance, matching well with the rhythmic, baroreflex-influenced control of renal sympathetic nerve activity and complementing findings from other studies employing dynamic approaches to study renal sympathetic vascular control. In this light, classic studies reporting that nerve stimulation and renal denervation do not affect static measures of renal blood flow provide evidence for the strength of renal autoregulation rather than evidence against physiological renal sympathetic control of renal blood flow. Thus, alongside tubuloglomerular feedback and the myogenic response, renal sympathetic outflow should be considered an important physiological regulator of renal blood flow. Clinically, renal sympathetic vasomotion may be important for solving the problems facing the field of therapeutic renal denervation. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Measurement of the force–displacement response of in vivo human skin under a rich set of deformations

    KAUST Repository

    Flynn, Cormac

    2011-06-01

    The non-linear, anisotropic, and viscoelastic properties of human skin vary according to location on the body, age, and individual. The measurement of skin\\'s mechanical properties is important in several fields including medicine, cosmetics, and forensics. In this study, a novel force-sensitive micro-robot applied a rich set of three-dimensional deformations to the skin surface of different areas of the arms of 20 volunteers. The force-displacement response of each area in different directions was measured. All tested areas exhibited a non-linear, viscoelastic, and anisotropic force-displacement response. There was a wide quantitative variation in the stiffness of the response. For the right anterior forearm, the ratio of the maximum probe reaction force to maximum probe displacement ranged from 0.44Nmm-1 to 1.45Nmm-1. All volunteers exhibited similar qualitative anisotropic characteristics. For the anterior right forearm, the stiffest force-displacement response was when the probe displaced along the longitudinal axis of the forearm. The response of the anterior left forearm was stiffest in a direction 20° to the longitudinal axis of the forearm. The posterior upper arm was stiffest in a direction 90° to the longitudinal axis of the arm. The averaged posterior upper arm response was less stiff than the averaged anterior forearm response. The maximum probe force at 1.3mm probe displacement was 0.69N for the posterior upper arm and 1.1N for the right anterior forearm. The average energy loss during the loading-unloading cycle ranged from 11.9% to 34.2%. This data will be very useful for studying the non-linear, anisotropic, and viscoelastic behaviour of skin and also for generating material parameters for appropriate constitutive models. © 2011 IPEM.

  17. Skin Conductance Responses and Neural Activations During Fear Conditioning and Extinction Recall Across Anxiety Disorders.

    Science.gov (United States)

    Marin, Marie-France; Zsido, Rachel G; Song, Huijin; Lasko, Natasha B; Killgore, William D S; Rauch, Scott L; Simon, Naomi M; Milad, Mohammed R

    2017-06-01

    The fear conditioning and extinction neurocircuitry has been extensively studied in healthy and clinical populations, with a particular focus on posttraumatic stress disorder. Despite significant overlap of symptoms between posttraumatic stress disorder and anxiety disorders, the latter has received less attention. Given that dysregulated fear levels characterize anxiety disorders, examining the neural correlates of fear and extinction learning may shed light on the pathogenesis of underlying anxiety disorders. To investigate the psychophysiological and neural correlates of fear conditioning and extinction recall in anxiety disorders and to document how these features differ as a function of multiple diagnoses or anxiety severity. This investigation was a cross-sectional, case-control, functional magnetic resonance imaging study at an academic medical center. Participants were healthy controls and individuals with at least 1 of the following anxiety disorders: generalized anxiety disorder, social anxiety disorder, specific phobia, and panic disorder. The study dates were between March 2013 and May 2015. Two-day fear conditioning and extinction paradigm. Skin conductance responses, blood oxygenation level-dependent responses, trait anxiety scores from the State Trait Anxiety Inventory-Trait Form, and functional connectivity. This study included 21 healthy controls (10 women) and 61 individuals with anxiety disorders (36 women). P values reported for the neuroimaging results are all familywise error corrected. Skin conductance responses during extinction recall did not differ between individuals with anxiety disorders and healthy controls (ηp2 = 0.001, P = .79), where ηp2 is partial eta squared. The anxiety group had lower activation of the ventromedial prefrontal cortex (vmPFC) during extinction recall (ηp2 = 0.178, P = .02). A similar hypoactive pattern was found during early conditioning (ηp2 = 0.106, P = .009). The vmPFC hypoactivation

  18. Associations between Language Development and Skin Conductance Responses to Faces and Eye Gaze in Children with Autism Spectrum Disorder

    Science.gov (United States)

    Stagg, Steven D.; Davis, Robert; Heaton, Pamela

    2013-01-01

    Attention to social stimuli is associated with language development, and arousal is associated with the increased viewing of stimuli. We investigated whether skin conductance responses (SCRs) are associated with language development in autism spectrum disorder (ASD): a population that shows abnormalities in both attention to others and language…

  19. The response of previously irradiated mouse skin to heat alone or combined with irradiation: influence of thermotolerance

    NARCIS (Netherlands)

    Wondergem, J.; Haveman, J.

    1983-01-01

    The skin of the mouse foot was used to study the effects of previous irradiation on the response to hyperthermia (44 degrees C), to irradiation, or to irradiation combined with hyperthermia (43 degrees C or 44 degrees C). Hyperthermia was applied by immersing the mouse foot into a hot waterbath and

  20. Spitting Image: Tick Saliva Assists the Causative Agent of Lyme Disease in Evading Host Skin's Innate Immune Response

    NARCIS (Netherlands)

    Hovius, Joppe W. R.

    2009-01-01

    Lyme disease is caused by the spirochete Borrelia burgdorferi and is transmitted through ticks. Inhibition of host skin's innate immune response might be instrumental to both tick feeding and B. burgdorferi transmission. The article by Marchal et al. describes how tick saliva suppresses B.

  1. Characterization of guinea pig T cell responses elicited after EP-assisted delivery of DNA vaccines to the skin.

    Science.gov (United States)

    Schultheis, Katherine; Schaefer, Hubert; Yung, Bryan S; Oh, Janet; Muthumani, Karuppiah; Humeau, Laurent; Broderick, Kate E; Smith, Trevor R F

    2017-01-03

    The skin is an ideal target tissue for vaccine delivery for a number of reasons. It is highly accessible, and most importantly, enriched in professional antigen presenting cells. Possessing strong similarities to human skin physiology and displaying a defined epidermis, the guinea pig is an appropriate model to study epidermal delivery of vaccine. However, whilst we have characterized the humoral responses in the guinea pig associated with skin vaccine protocols we have yet to investigate the T cell responses. In response to this inadequacy, we developed an IFN-γ ELISpot assay to characterize the cellular immune response in the peripheral blood of guinea pigs. Using a nucleoprotein (NP) influenza pDNA vaccination regimen, we characterized host T cell responses. After delivery of the DNA vaccine to the guinea pig epidermis we detected robust and rapid T cell responses. The levels of IFN-γ spot-forming units averaged approximately 5000 per million cells after two immunizations. These responses were broad in that multiple regions across the NP antigen elicited a T cell response. Interestingly, we identified a number of NP immunodominant T cell epitopes to be conserved across an outbred guinea pig population, a phenomenon which was also observed after immunization with a RSV DNA vaccine. We believe this data enhances our understanding of the cellular immune response elicited to a vaccine in guinea pigs, and globally, will advance the use of this model for vaccine development, especially those targeting skin as a delivery site. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  2. Fractionated laser resurfacing corrects the inappropriate UVB response in geriatric skin

    OpenAIRE

    Spandau, Dan F; Lewis, Davina A.; Somani, Ally-Khan; Travers, Jeffrey B.

    2012-01-01

    Non-melanoma skin cancer is a disease primarily afflicting geriatric patients as evidenced by the fact that 80% of all non-melanoma skin cancers are diagnosed in patients over the age of 60 years. As such, geriatric skin responds to cancer-inducing UVB irradiation in a manner that allows the establishment of tumor cells. Currently, the only effective treatment for non-melanoma skin cancer is the removal of the tumors after they appear, indicating the need for a more cost-effective prophylacti...

  3. Brain Circuitry Supporting Multi-Organ Autonomic Outflow in Response to Nausea.

    Science.gov (United States)

    Sclocco, Roberta; Kim, Jieun; Garcia, Ronald G; Sheehan, James D; Beissner, Florian; Bianchi, Anna M; Cerutti, Sergio; Kuo, Braden; Barbieri, Riccardo; Napadow, Vitaly

    2016-02-01

    While autonomic outflow is an important co-factor of nausea physiology, central control of this outflow is poorly understood. We evaluated sympathetic (skin conductance level) and cardiovagal (high-frequency heart rate variability) modulation, collected synchronously with functional MRI (fMRI) data during nauseogenic visual stimulation aimed to induce vection in susceptible individuals. Autonomic data guided analysis of neuroimaging data, using a stimulus-based (analysis windows set by visual stimulation protocol) and percept-based (windows set by subjects' ratings) approach. Increased sympathetic and decreased parasympathetic modulation was associated with robust and anti-correlated brain activity in response to nausea. Specifically, greater autonomic response was associated with reduced fMRI signal in brain regions such as the insula, suggesting an inhibitory relationship with premotor brainstem nuclei. Interestingly, some sympathetic/parasympathetic specificity was noted. Activity in default mode network and visual motion areas was anti-correlated with parasympathetic outflow at peak nausea. In contrast, lateral prefrontal cortical activity was anti-correlated with sympathetic outflow during recovery, soon after cessation of nauseogenic stimulation. These results suggest divergent central autonomic control for sympathetic and parasympathetic response to nausea. Autonomic outflow and the central autonomic network underlying ANS response to nausea may be an important determinant of overall nausea intensity and, ultimately, a potential therapeutic target. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  4. Dynamic interaction between the heart and its sympathetic innervation following T5 spinal cord transection.

    Science.gov (United States)

    Lujan, Heidi L; Janbaih, Hussein; DiCarlo, Stephen E

    2012-10-15

    Midthoracic spinal cord injury (SCI) is associated with enhanced sympathetic support of heart rate as well as myocardial damage related to calcium overload. The myocardial damage may elicit an enhanced sympathetic support of contractility to maintain ventricular function. In contrast, the level of inotropic drive may be reduced to match the lower afterload that results from the injury-induced reduction in arterial pressure. Accordingly, the inotropic response to midthoracic SCI may be increased or decreased but has not been investigated and therefore remains unknown. Furthermore, the altered ventricular function may be associated with anatomical changes in cardiac sympathetic innervation. To determine the inotropic drive following midthoracic SCI, a telemetry device was used for repeated measurements of left ventricular (LV) function, with and without beta-adrenergic receptor blockade, in rats before and after midthoracic SCI or sham SCI. In addition, NGF content (ELISA) and dendritic arborization (cholera toxin B immunohistochemistry and Sholl analysis) of cardiac-projecting sympathetic postganglionic neurons in the stellate ganglia were determined. Midthoracic SCI was associated with an enhanced sympathetic support of heart rate, dP/dt(+), and dP/dt(-). Importantly, cardiac function was lower following blockade of the sympathetic nervous system in rats with midthoracic SCI compared with sham-operated rats. Finally, these functional neuroplastic changes were associated with an increased NGF content and structural neuroplasticity within the stellate ganglia. Results document impaired LV function with codirectional changes in chronotropic and inotropic responses following midthoracic SCI. These functional changes were associated with a dynamic interaction between the heart and its sympathetic innervation.

  5. Control of sympathetic vasomotor tone by catecholaminergic C1 neurones of the rostral ventrolateral medulla oblongata

    Science.gov (United States)

    Marina, Nephtali; Abdala, Ana P.L.; Korsak, Alla; Simms, Annabel E.; Allen, Andrew M.; Paton, Julian F.R.; Gourine, Alexander V.

    2011-01-01

    Aims Increased sympathetic tone in obstructive sleep apnoea results from recurrent episodes of systemic hypoxia and hypercapnia and might be an important contributor to the development of cardiovascular disease. In this study, we re-evaluated the role of a specific population of sympathoexcitatory catecholaminergic C1 neurones of the rostral ventrolateral medulla oblongata in the control of sympathetic vasomotor tone, arterial blood pressure, and hypercapnia-evoked sympathetic and cardiovascular responses. Methods and results In anaesthetized rats in vivo and perfused rat working heart brainstem preparations in situ, C1 neurones were acutely silenced by application of the insect peptide allatostatin following cell-specific targeting with a lentiviral vector to express the inhibitory Drosophila allatostatin receptor. In anaesthetized rats with denervated peripheral chemoreceptors, acute inhibition of 50% of the C1 neuronal population resulted in ∼50% reduction in renal sympathetic nerve activity and a profound fall in arterial blood pressure (by ∼25 mmHg). However, under these conditions systemic hypercapnia still evoked vigorous sympathetic activation and the slopes of the CO2-evoked sympathoexcitatory and cardiovascular responses were not affected by inhibition of C1 neurones. Inhibition of C1 neurones in situ resulted in a reversible fall in perfusion pressure and the amplitude of respiratory-related bursts of thoracic sympathetic nerve activity. Conclusion These data confirm a fundamental physiological role of medullary catecholaminergic C1 neurones in maintaining resting sympathetic vasomotor tone and arterial blood pressure. However, C1 neurones do not appear to mediate sympathoexcitation evoked by central actions of CO2. PMID:21543384

  6. Recurrent postoperative CRPS I in patients with abnormal preoperative sympathetic function.

    Science.gov (United States)

    Ackerman, William E; Ahmad, Mahmood

    2008-02-01

    A complex regional pain syndrome of an extremity that has previously resolved can recur after repeat surgery at the same anatomic site. Complex regional pain syndrome is described as a disease of the autonomic nervous system. The purpose of this study was to evaluate preoperative and postoperative sympathetic function and the recurrence of complex regional pain syndrome type I (CRPS I) in patients after repeat carpal tunnel surgery. Thirty-four patients who developed CRPS I after initial carpal tunnel releases and required repeat open carpal tunnel surgeries were studied. Laser Doppler imaging (LDI) was used to assess preoperative sympathetic function 5-7 days prior to surgery and to assess postoperative sympathetic function 19-22 days after surgery or 20-22 days after resolution of the CRPS I. Sympathetic nervous system function was prospectively examined by testing reflex-evoked vasoconstrictor responses to sympathetic stimuli recorded with LDI of both hands. Patients were assigned to 1 of 2 groups based on LDI responses to sympathetic provocation. Group I (11 of 34) patients had abnormal preoperative LDI studies in the hands that had prior surgeries, whereas group II (23 of 34) patients had normal LDI studies. Each patient in this study had open repeat carpal tunnel surgery. In group I, 8 of 11 patients had recurrent CRPS I, whereas in group II, 3 of 23 patients had recurrent CRPS I. All of the recurrent CRPS I patients were successfully treated with sympathetic blockade, occupational therapy, and pharmacologic modalities. Repeat LDI after recurrent CRPS I resolution was abnormal in 8 of 8 group I patients and in 1 of 3 group II patients. CRPS I can recur after repeat hand surgery. Our study results may, however, identify those individuals who may readily benefit from perioperative therapies. Prognostic I.

  7. The effect of salmeterol and salbutamol on mediator release and skin responses in immediate and late phase allergic cutaneous reactions

    DEFF Research Database (Denmark)

    Petersen, Lars Jelstrup; Skov, P S

    1999-01-01

    on clinical and biochemical EAR and LPR in human skin. METHODS: Measurement of wheal and flare reactions to allergen, codeine, and histamine, and LPR (induration) to allergen. Assessment of histamine and prostaglandin D2 (PGD2) release by microdialysis technique in EAR, and measurement of mediators in LPR......, myeloperoxidase, or eosinophil cationic protein in LPR. CONCLUSIONS: Salmeterol and salbutamol inhibited allergen-induced skin responses, and reduced mediator release in EAR but not LPR. In general, the anti-inflammatory effects of salmeterol did not differ from those induced by salbutamol....

  8. Safety and skin delayed-type hypersensitivity response in vervet monkeys immunized with Leishmania donovani sonicate antigen delivered with adjuvants

    OpenAIRE

    Mutiso,Joshua M.; Macharia,John C.; Taracha,Evans; Wafula,Kellern; Rikoi,Hitler; Gicheru,Michael M.

    2012-01-01

    In this study, we report on the safety and skin delayed-type hypersensitivity (DTH), responses of the Leishmania donovani whole cell sonicate antigen delivered in conjunction with alum-BCG (AlBCG), Montanide ISA 720 (MISA) or Monophosphoryl lipid A (MPLA) in groups of vervet monkeys. Following three intradermal injections of the inoculums on days 0, 28 and 42, safety and DTH responses were assessed. Preliminary tumor necrosis factor alpha (TNF-α) and interferon gamma (IFN-γ) levels ...

  9. Protein Kinases and Transcription Factors Activation in Response to UV-Radiation of Skin: Implications for Carcinogenesis

    OpenAIRE

    Laurence A. Marchat; Elena Aréchaga Ocampo; Mavil López Casamichana; Carlos Pérez-Plasencia; César López-Camarillo; Elizbeth Álvarez-Sánchez

    2011-01-01

    Solar ultraviolet (UV) radiation is an important environmental factor that leads to immune suppression, inflammation, photoaging, and skin carcinogenesis. Here, we reviewed the specific signal transduction pathways and transcription factors involved in the cellular response to UV-irradiation. Increasing experimental data supporting a role for p38, MAPK, JNK, ERK1/2, and ATM kinases in the response network to UV exposure is discussed. We also reviewed the participation of NF-?B, AP-1, and NRF2...

  10. Sympathetic vasoconstriction takes an unexpected pannexin detour

    DEFF Research Database (Denmark)

    Schak Nielsen, Morten

    2015-01-01

    Sympathetic vasoconstriction plays an important role in the control of blood pressure and the distribution of blood flow. In this issue of Science Signaling, Billaud et al. show that sympathetic vasoconstriction occurs through a complex scheme involving the activation of large-pore pannexin 1...... channels and the subsequent release of adenosine triphosphate that promotes contraction in an autocrine and paracrine manner. This elaborate mechanism may function as a point of intercept for other signaling pathways-for example, in relation to the phenomenon "functional sympatholysis," in which exercise...... abrogates sympathetic vasoconstriction in skeletal muscle. Because pannexin 1 channels are inhibited by nitric oxide, they may function as a switch to turn off adrenergic signaling in skeletal muscle during exercise....

  11. Polyphenols, Antioxidants and the Sympathetic Nervous System.

    Science.gov (United States)

    Bruno, Rosa Maria; Ghiadoni, Lorenzo

    2018-01-01

    A high dietary intake of polyphenols has been associated with a reduced cardiovascular mortality, due to their antioxidant properties. However, growing evidence suggests that counteracting oxidative stress in cardiovascular disease might also reduce sympathetic nervous system overactivity. This article reviews the most commonly used techniques to measure sympathetic activity in humans; the role of sympathetic activation in the pathophysiology of cardiovascular diseases; current evidence demonstrating that oxidative stress is involved in the regulation of sympathetic activity and how antioxidants and polyphenols might counteract sympathetic overactivity, particularly focusing on preliminary data from human studies. The main mechanisms by which polyphenols are cardioprotective are related to the improvement of vascular function and their anti-atherogenic effect. Furthermore, a blood pressure-lowering effect was consistently demonstrated in randomized controlled trials in humans, when the effect of flavonoid-rich foods, such as tea and chocolate, was tested. More recent studies suggest that inhibition of sympathetic overactivity might be one of the mechanisms by which these substances exert their cardioprotective effects. Indeed, an increased adrenergic traffic to the vasculature is a major mechanism of disease in a number of cardiovascular and extra-cardiac diseases, including hypertension, obesity, metabolic syndrome and heart failure. A considerable body of evidence, mostly from experimental studies, support the hypothesis that reactive oxygen species might exert sympathoexcitatory effects both at the central and at the peripheral level. Accordingly, supplementation with antioxidants might reduce adrenergic overdrive to the vasculature and blunt cardiovascular reactivity to stress. While supplementation with "classical" antioxidants such as ROS-scavengers has many limitations, increasing the intake of polyphenol-rich foods seems to be a promising novel therapeutic

  12. Synergistic skin heat shock protein expression in response to combined laser treatment with a diode laser and ablative fractional lasers.

    Science.gov (United States)

    Paasch, Uwe; Sonja, Grunewald; Haedersdal, Merete

    2014-06-01

    Diode laser-based skin heating has been shown to minimise scars by interfering with wound healing responses through the induction of heat shock proteins (HSP). HSP are also induced after ablative fractional laser (AFXL) wound healing. AFXL itself is highly recommended for scar treatment. Therefore, the sequential combination of both modalities may produce superior outcomes. The aim of this study was to examine the pretreatment effects of a diode laser before AFXL on wound healing responses in terms of HSP up-regulation in an in vitro model. Immediate responses and responses on days 1, 3 or 6 post-procedure were studied in an in vitro porcine skin model (n = 240). Untreated samples served as control. Immunohistochemical investigation (Hsp70) was performed in all untreated controls, diode laser-, AFXL-, and in diode laser + AFXL-treated samples. Hsp70 was shown to be up-regulated by all interventions between days 1 and 6 after interventions. The largest effect was caused by the combination of a diode laser and an AFXL procedure. Diode laser exposure induces a skin HSP response that can be further enhanced by sequential AFXL treatment. Clinical studies are necessary to investigate the dose response of HSP on scar formation and refine suitable laser exposure settings.

  13. Dermal damage promoted by repeated low-level UV-A1 exposure despite tanning response in human skin.

    Science.gov (United States)

    Wang, Frank; Smith, Noah R; Tran, Bao Anh Patrick; Kang, Sewon; Voorhees, John J; Fisher, Gary J

    2014-04-01

    exposures did not suppress type I procollagen expression. A limited number of low-dose UV-A1 exposures, as commonly experienced in daily life, potentially promotes photoaging by affecting breakdown, rather than synthesis, of collagen. Progressive skin darkening in response to repeated low-dose UV-A1 exposures in lightly pigmented individuals does not prevent UV-A1-induced collagenolytic changes. Therefore, for optimal protection against skin damage, sunscreen formulations should filter all UV wavelengths, including UV-A1 irradiation.

  14. Effects of husbandry conditions on the skin colour and stress response of red porgy, Pagrus pagrus

    NARCIS (Netherlands)

    Salm, A.L. van der; Martinez, M.; Flik, G.; Wendelaar Bonga, S.E.

    2004-01-01

    Red porgy, Pagrus pagrus, is a potential candidate for aquaculture. However, darkening of the body occurs after capture of wild fish and during fanning of cultured animals. In fish, skin pigmentation is hormonally controlled and the main hormone involved in skin darkening,

  15. Inhibition of ultraviolet irradiation response of human skin by topical phlogostatic compounds

    International Nuclear Information System (INIS)

    Weirich, E.G.; Lutz, U.C.

    1977-01-01

    By adaption of the model of UV dermatitis in human skin a test procedure has been developed which facilitates realistic assessment of topical contra-inflammatory activity of steroidal as well as non-steroidal compounds. Sixt typical skin drug agents were tested according to their reaction inhibition effect. (orig./MG) [de

  16. Measurement of the force–displacement response of in vivo human skin under a rich set of deformations

    KAUST Repository

    Flynn, Cormac; Taberner, Andrew; Nielsen, Poul

    2011-01-01

    The non-linear, anisotropic, and viscoelastic properties of human skin vary according to location on the body, age, and individual. The measurement of skin's mechanical properties is important in several fields including medicine, cosmetics, and forensics. In this study, a novel force-sensitive micro-robot applied a rich set of three-dimensional deformations to the skin surface of different areas of the arms of 20 volunteers. The force-displacement response of each area in different directions was measured. All tested areas exhibited a non-linear, viscoelastic, and anisotropic force-displacement response. There was a wide quantitative variation in the stiffness of the response. For the right anterior forearm, the ratio of the maximum probe reaction force to maximum probe displacement ranged from 0.44Nmm-1 to 1.45Nmm-1. All volunteers exhibited similar qualitative anisotropic characteristics. For the anterior right forearm, the stiffest force-displacement response was when the probe displaced along the longitudinal axis of the forearm. The response of the anterior left forearm was stiffest in a direction 20° to the longitudinal axis of the forearm. The posterior upper arm was stiffest in a direction 90° to the longitudinal axis of the arm. The averaged posterior upper arm response was less stiff than the averaged anterior forearm response. The maximum probe force at 1.3mm probe displacement was 0.69N for the posterior upper arm and 1.1N for the right anterior forearm. The average energy loss during the loading-unloading cycle ranged from 11.9% to 34.2%. This data will be very useful for studying the non-linear, anisotropic, and viscoelastic behaviour of skin and also for generating material parameters for appropriate constitutive models. © 2011 IPEM.

  17. Facial skin blood flow responses during exposures to emotionally charged movies.

    Science.gov (United States)

    Matsukawa, Kanji; Endo, Kana; Ishii, Kei; Ito, Momoka; Liang, Nan

    2018-03-01

    The changes in regional facial skin blood flow and vascular conductance have been assessed for the first time with noninvasive two-dimensional laser speckle flowmetry during audiovisually elicited emotional challenges for 2 min (comedy, landscape, and horror movie) in 12 subjects. Limb skin blood flow and vascular conductance and systemic cardiovascular variables were simultaneously measured. The extents of pleasantness and consciousness for each emotional stimulus were estimated by the subjective rating from -5 (the most unpleasant; the most unconscious) to +5 (the most pleasant; the most conscious). Facial skin blood flow and vascular conductance, especially in the lips, decreased during viewing of comedy and horror movies, whereas they did not change during viewing of a landscape movie. The decreases in facial skin blood flow and vascular conductance were the greatest with the comedy movie. The changes in lip, cheek, and chin skin blood flow negatively correlated (P < 0.05) with the subjective ratings of pleasantness and consciousness. The changes in lip skin vascular conductance negatively correlated (P < 0.05) with the subjective rating of pleasantness, while the changes in infraorbital, subnasal, and chin skin vascular conductance negatively correlated (P < 0.05) with the subjective rating of consciousness. However, none of the changes in limb skin blood flow and vascular conductance and systemic hemodynamics correlated with the subjective ratings. The mental arithmetic task did not alter facial and limb skin blood flows, although the task influenced systemic cardiovascular variables. These findings suggest that the more emotional status becomes pleasant or conscious, the more neurally mediated vasoconstriction may occur in facial skin blood vessels.

  18. Clinical features, fungal load, coinfections, histological skin changes, and itraconazole treatment response of cats with sporotrichosis caused by Sporothrix brasiliensis.

    Science.gov (United States)

    de Souza, Elaine Waite; Borba, Cintia de Moraes; Pereira, Sandro Antonio; Gremião, Isabella Dib Ferreira; Langohr, Ingeborg Maria; Oliveira, Manoel Marques Evangelista; de Oliveira, Raquel de Vasconcellos Carvalhaes; da Cunha, Camila Rocha; Zancopé-Oliveira, Rosely Maria; de Miranda, Luisa Helena Monteiro; Menezes, Rodrigo Caldas

    2018-06-13

    Zoonotic sporotrichosis caused by the fungus Sporothrix brasiliensis is usually severe in cats. This study investigated the associations between clinical features, fungal load, coinfections, histological skin changes, and response to itraconazole in cats with sporotrichosis caused by S. brasiliensis. Fifty-two cats with skin lesions and a definitive diagnosis of sporotrichosis were treated with itraconazole for a maximum period of 36 weeks. The animals were submitted to clinical examination and two subsequent collections of samples from the same skin lesion for fungal diagnosis and histopathology, as well as serology for feline immunodeficiency (FIV) and leukaemia (FeLV) viruses. Thirty-seven (71%) cats were clinically cured. Nasal mucosa lesions and respiratory signs were associated with treatment failure. Cats coinfected with FIV/FeLV (n = 12) had a lower neutrophil count in the lesion. A high fungal load in skin lesions was linked to young age and treatment failure, as well as to a longer time of wound healing, poorly formed granulomas and fewer neutrophils, macrophages and lymphocytes in these lesions. These results indicate that itraconazole is effective, but nasal mucosal involvement, respiratory signs and high fungal loads in skin lesions are predictors of treatment failure that will assist in the development of better treatment protocols for cats.

  19. The Response of the Ocean Thermal Skin Layer to Variations in Incident Infrared Radiation

    Science.gov (United States)

    Wong, Elizabeth W.; Minnett, Peter J.

    2018-04-01

    Ocean warming trends are observed and coincide with the increase in concentrations of greenhouse gases in the atmosphere resulting from human activities. At the ocean surface, most of the incoming infrared (IR) radiation is absorbed within the top micrometers of the ocean's surface where the thermal skin layer (TSL) exists. Thus, the incident IR radiation does not directly heat the upper few meters of the ocean. This paper investigates the physical mechanism between the absorption of IR radiation and its effect on heat transfer at the air-sea boundary. The hypothesis is that given the heat lost through the air-sea interface is controlled by the TSL, the TSL adjusts in response to variations in incident IR radiation to maintain the surface heat loss. This modulates the flow of heat from below and hence controls upper ocean heat content. This hypothesis is tested using the increase in incoming longwave radiation from clouds and analyzing vertical temperature profiles in the TSL retrieved from sea-surface emission spectra. The additional energy from the absorption of increasing IR radiation adjusts the curvature of the TSL such that the upward conduction of heat from the bulk of the ocean into the TSL is reduced. The additional energy absorbed within the TSL supports more of the surface heat loss. Thus, more heat beneath the TSL is retained leading to the observed increase in upper ocean heat content.

  20. Isolation of fish skin and bone gelatin from tilapia (Oreochromis niloticus): Response surface approach

    Science.gov (United States)

    Arpi, N.; Fahrizal; Novita, M.

    2018-03-01

    In this study, gelatin from fish collagen, as one of halal sources, was extracted from tilapia (Oreochromis niloticus) skin and bone, by using Response Surface Methodology to optimize gelatin extraction conditions. Concentrations of alkaline NaOH and acid HCl, in the pretreatment process, and temperatures in extraction process were chosen as independent variables, while dependent variables were yield, gel strength, and emulsion activity index (EAI). The result of investigation showed that lower NaOH pretreatment concentrations provided proper pH extraction conditions which combine with higher extraction temperatures resulted in high gelatin yield. However, gelatin emulsion activity index increased proportionally to the decreased in NaOH concentrations and extraction temperatures. No significant effect of the three independent variables on the gelatin gel strength. RSM optimization process resulted in optimum gelatin extraction process conditions using alkaline NaOH concentration of 0.77 N, acid HCl of 0.59 N, and extraction temperature of 66.80 °C. The optimal solution formula had optimization targets of 94.38%.

  1. Skin microvascular and metabolic response to pressure relief maneuvers in people with spinal cord injury

    Science.gov (United States)

    Ramella-Roman, Jessica C.; Le, Du V. N.; Ghassemi, Pejhman; Nguyen, Thu A.; Lichy, Alison; Groah, Suzanne

    2013-02-01

    Clinician's recommendations on wheelchair pressure reliefs in the context of the high prevalence of pressure ulcers that occur in people with spinal cord injury is not supported by strong experimental evidence. Some data indicates that altered tissue perfusion and oxygenation occurring under pressure loads, such as during sitting, induce various pathophysiologic changes that may lead to pressure ulcers. Pressure causes a cascade of responses, including initial tissue hypoxia, which leads to ischemia, vascular leakage, tissue acidification, compensatory angiogenesis, thrombosis, and hyperemia, all of which may lead to tissue damage. We have developed an advanced skin sensor that allows measurement of oxygenation in addition to perfusion, and can be safely used during sitting. The sensor consists of a set of fiber optics probes, spectroscopic and Laser Doppler techniques that are used to obtain parameters of interest. The overriding goal of this project is to develop the evidence base for clinical recommendations on pressure reliefs. In this paper we will illustrate the experimental apparatus as well as some preliminary results of a small clinical trial conducted at the National Rehabilitation Hospital.

  2. Optical spectroscopy of radiotherapy and photodynamic therapy responses in normal rat skin shows vascular breakdown products

    Science.gov (United States)

    Teles de Andrade, Cintia; Nogueira, Marcelo S.; Kanick, Stephen C.; Marra, Kayla; Gunn, Jason; Andreozzi, Jacqueline; Samkoe, Kimberley S.; Kurachi, Cristina; Pogue, Brian W.

    2016-03-01

    Photodynamic therapy (PDT) and radiotherapy are non-systemic cancer treatment options with different mechanisms of damage. So combining these techniques has been shown to have some synergy, and can mitigate their limitations such as low PDT light penetration or radiotherapy side effects. The present study monitored the induced tissue changes after PDT, radiotherapy, and a combination protocol in normal rat skin, using an optical spectroscopy system to track the observed biophysical changes. The Wistar rats were treated with one of the protocols: PDT followed by radiotherapy, PDT, radiotherapy and radiotherapy followed by PDT. Reflectance spectra were collected in order to observe the effects of these combined therapies, especially targeting vascular response. From the reflectance, information about oxygen saturation, met-hemoglobin and bilirubin concentration, blood volume fraction (BVF) and vessel radius were extracted from model fitting of the spectra. The rats were monitored for 24 hours after treatment. Results showed that there was no significant variation in the vessel size or BVF after the treatments. However, the PDT caused a significant increase in the met-hemoglobin and bilirubin concentrations, indicating an important blood breakdown. These results may provide an important clue on how the damage establishment takes place, helping to understand the effect of the combination of those techniques in order to verify the existence of a known synergistic effect.

  3. Sympathetic, Metabolic Adaptations, and Oxidative Stress in Autism Spectrum Disorders: How Far From Physiology?

    Directory of Open Access Journals (Sweden)

    Antonietta Messina

    2018-03-01

    Full Text Available Autism spectrum disorders (ASD is a complex and multifaceted neurobehavioral syndrome with no specific cause still identified, despite the worldwide increasing (prevalence for 1,000 children from 6.7 to 14.6, between 2000 and 2012. Many biological and instrumental markers have been suggested as potential predictive factors for the precocious diagnosis during infancy and/or pediatric age. Many studies reported structural and functional abnormalities in the autonomic system in subjects with ASD. Sleep problems in ASD are a prominent feature, having an impact on the social interaction of the patient. Considering the role of orexins (A and B in wake-sleep circadian rhythm, we could speculate that ASD subjects may present a dysregulation in orexinergic neurotransmission. Conversely, oxidative stress is implicated in the pathophysiology of many neurological disorders. Nonetheless, little is known about the linkage between oxidative stress and the occurrence or the progress of autism and autonomic functioning; some markers, such as heart rate (HR, heart rate variability (HRV, body temperature, and galvanic skin response (GSR, may be altered in the patient with this so complex disorder. In the present paper, we analyzed an autism case report, focusing on the rule of the sympathetic activity with the aim to suggest that it may be considered an important tool in ASD evaluation. The results of this case confirm our hypothesis even if further studies needed.

  4. Effect of heat-killed Lactobacillus brevis SBC8803 on cutaneous arterial sympathetic nerve activity, cutaneous blood flow and transepidermal water loss in rats.

    Science.gov (United States)

    Horii, Y; Kaneda, H; Fujisaki, Y; Fuyuki, R; Nakakita, Y; Shigyo, T; Nagai, K

    2014-05-01

    To evaluate the efficacy of the effects of heat-killed Lactobacillus brevis SBC8803 (HK-SBC8803) on the standard physiological markers of skin health of cutaneous arterial sympathetic nerve activity (CASNA), cutaneous blood flow and transepidermal water loss (TEWL) and to determine whether SBC8803 targets serotonin 5-HT3 receptors in rats. A set of three experiments were conducted to examine the effects of SBC8803 on CASNA, cutaneous blood flow and TEWL using Wistar and hairless rats. Two additional experiments further attempted to determine whether HK-SBC8803 was targeting the serotonin 5-HT3 receptors by pretreatment with the 5-HT3 antagonist granisetron. Administration of HK-SBC8803 in the first three experiments caused marked inhibition of CASNA and significant elevation of cutaneous blood flow under urethane anaesthesia as well as significant decrease in TEWL on the dorsal skin of conscious hairless rats. Pretreatment with granisetron decreased the effects of HK-SBC8803 on CASNA and cutaneous blood flow. These findings suggest that HK-SBC8803 reduces CASNA, increases cutaneous blood flow and decreases TEWL and that 5-HT3 receptors may be involved in CASNA and cutaneous blood flow responses. HK-SBC8803 could be a useful substance in the treatment/prevention of skin problems, specifically chapped or dry skin. © 2014 The Society for Applied Microbiology.

  5. Assessment of Skin Pathological Responses in the Yellowfin Seabream (Acanthopagrus latus under the Aeromonas hydrophila Exposure

    Directory of Open Access Journals (Sweden)

    Fatemeh Azadbakht

    2018-01-01

    Full Text Available Background: Bacterial diseases in cultured fish are considered the main problem to aquaculture system. Skin is the structure that covers the body in fish. Skin histopatological alterations were used to assess the effects of Aeromonas hydrophila exposure on the yellowfin seabream Acanthopagrus latus(. Methods: In this regard, 90 A. latus were exposed to sublethal concentrations of A. hydrophila (103,106 CFU/ml for 3 weeks. Results: Some more severe alternations found in the skin of fish exposed. The most frequent histopathological changes detected in the skin including hyperplasia of epidermis, hypertrophy and hyperplasia of the mucosal cells and dermis edema. Some more severe alternations found in the skin of fish exposed to higher level of A. hydrophila (106 CFU/ml included telangiectasia of dermis layer. In addition, according to the results of histometrical studies in treated fish compared to control group showed that thickness of epidermis and dermis layers were increased significantly (P<0.05. Conclusion: A. hydrophila can cause major histophatological changes in the skin of A. latus. In addition, histopathological changes of the skin provide helpful information about the environmental conditions and as particular biomarkers may provide imminent into evaluating the general health and stress status of fish.

  6. TARGETED STELLATE DECENTRALIZATION: IMPLICATIONS FOR SYMPATHETIC CONTROL OF VENTRICULAR ELECTROPHYSIOLOGY

    Science.gov (United States)

    Buckley, Una; Yamakawa, Kentaro; Takamiya, Tatsuo; Armour, J. Andrew; Shivkumar, Kalyanam; Ardell, Jeffrey L.

    2015-01-01

    Background Selective, bilateral cervicothoracic sympathectomy has proven to be effective for managing ventricular arrhythmias in the setting of structural heart disease. The procedure currently employed removes the caudal portions of both stellate ganglia, along with thoracic chain ganglia down to T4 ganglia. Objective To define the relative contributions of T1-T2 and the T3-T4 paravertebral ganglia in modulating ventricular electrical function. Methods In anesthetized vagotomised porcine subjects (n=8), the heart was exposed via sternotomy along with right and left paravertebral sympathetic ganglia to the T4 level. A 56-electrode epicardial sock was placed over both ventricles to assess epicardial activation recovery intervals (ARI) in response to individually stimulating right and left stellate vs T3 paravertebral ganglia. Responses to T3 stimuli were repeated following surgical removal of the caudal portions of stellate ganglia and T2 bilaterally. Results In intact preparations, stellate ganglion vs T3 stimuli (4Hz, 4ms duration) were titrated to produce equivalent decreases in global ventricular ARIs (right-side 85±6 vs 55±10 ms; left-side 24±3 vs 17±7 ms). Threshold of stimulus intensity applied to T3 ganglia to achieve threshold was 3 times that of T1 threshold. ARIs in unstimulated states were unaffected by bilateral stellate-T2 ganglion removal. Following acute decentralization, T3 stimulation failed to change ARIs. Conclusion Preganglionic sympathetic efferents arising from the T1-T4 spinal cord that project to the heart transit through stellate ganglia via the paravertebral chain. T1-T2 surgical excision is thus sufficient to functionally interrupt central control of peripheral sympathetic efferent activity. PMID:26282244

  7. Direct quantitative comparison of molecular responses in photodamaged human skin to fractionated and fully ablative carbon dioxide laser resurfacing.

    Science.gov (United States)

    Orringer, Jeffrey S; Sachs, Dana L; Shao, Yuan; Hammerberg, Craig; Cui, Yilei; Voorhees, John J; Fisher, Gary J

    2012-10-01

    Fractionated ablative laser resurfacing has become a widely used treatment modality. Its clinical results are often found to approach those of traditional fully ablative laser resurfacing. To directly compare the molecular changes that result from fractionated and fully ablative carbon dioxide (CO(2)) laser resurfacing in photodamaged human skin. Photodamaged skin of 34 adult volunteers was focally treated at distinct sites with a fully ablative CO(2) laser and a fractionated CO(2) laser. Serial skin samples were obtained at baseline and several time points after treatment. Real-time reverse transcriptase polymerase chain reaction technology and immunohistochemistry were used to quantify molecular responses to each type of laser treatment. Fully ablative and fractionated CO(2) laser resurfacing induced significant dermal remodeling and collagen induction. After a single treatment, fractionated ablative laser resurfacing resulted in collagen induction that was approximately 40% to 50% as pronounced as that induced by fully ablative laser resurfacing. The fundamental cutaneous responses that result from fully ablative and fractionated carbon dioxide laser resurfacing are similar but differ in magnitude and duration, with the fully ablative procedure inducing relatively greater changes including more pronounced collagen induction. However, the molecular data reported here provide substantial support for fractionated ablative resurfacing as an effective treatment modality for improving skin texture. © 2012 by the American Society for Dermatologic Surgery, Inc. Published by Wiley Periodicals, Inc.

  8. Pain increases during sympathetic arousal in patients with complex regional pain syndrome.

    Science.gov (United States)

    Drummond, P D; Finch, P M; Skipworth, S; Blockey, P

    2001-10-09

    To investigate the effect of sympathetic arousal on pain and vasomotor responses in healthy control subjects and patients with complex regional pain syndrome (CRPS), and to determine whether pain increases in patients with particular symptoms. In experiments 1 and 2, capsaicin was applied to the forearm of 24 healthy subjects to induce thermal hyperalgesia. Vascular responses were monitored and subjects rated thermal hyperalgesia before and after being startled (experiment 1), and before, during, and after mental arithmetic, breath holding, forehead cooling, the Valsalva maneuver, and a cold pressor test in experiment 2. In a third experiment, sensitivity to heat, cold, and mechanical stimulation was investigated in 61 patients with CRPS. Pain ratings and vascular and electrodermal responses were recorded after patients were startled and during forehead cooling. In experiment 1, thermal hyperalgesia decreased in healthy control subjects after they were startled, and digital blood vessels constricted symmetrically. In experiment 2, thermal hyperalgesia decreased during and after other forms of sympathetic arousal. However, in experiment 3, ratings of clinical pain increased during forehead cooling or after being startled in over 70% of patients with CRPS. Pain increased most consistently during forehead cooling in patients with cold allodynia or punctate allodynia. Digital blood vessels constricted more intensely on the symptomatic than the nonsymptomatic side in patients with CRPS during sympathetic arousal. Normal inhibitory influences on pain during sympathetic arousal are compromised in the majority of patients with CRPS. The augmented vasoconstrictor response in the symptomatic limb during sympathetic arousal is consistent with adrenergic supersensitivity. An adrenergic sensitivity in nociceptive afferents might contribute to pain and hyperalgesia during sympathetic arousal in certain patients with CRPS.

  9. Response-surface models for deterministic effects of localized irradiation of the skin by discrete β/γ -emitting sources

    International Nuclear Information System (INIS)

    Scott, B.R.

    1995-01-01

    Individuals who work at nuclear reactor facilities can be at risk for deterministic effects in the skin from exposure to discrete Β- and γ-emitting (ΒγE) sources (e.g., ΒγE hot particles) on the skin or clothing. Deterministic effects are non-cancer effects that have a threshold and increase in severity as dose increases (e.g., ulcer in skin). Hot ΒγE particles are 60 Co- or nuclear fuel-derived particles with diameters > 10 μm and < 3 mm and contain at least 3.7 kBq (0.1 μCi) of radioactivity. For such ΒγE sources on the skin, it is the beta component of the dose that is most important. To develop exposure limitation systems that adequately control exposure of workers to discrete ΒγE sources, models are needed for systems that adequately control exposure of workers to discrete ΒγE sources, models are needed for evaluating the risk of deterministic effects of localized Β irradiation of the skin. The purpose of this study was to develop dose-rate and irradiated-area dependent, response-surface models for evaluating risks of significant deterministic effects of localized irradiation of the skin by discrete ΒγE sources and to use modeling results to recommend approaches to limiting occupational exposure to such sources. The significance of the research results as follows: (1) response-surface models are now available for evaluating the risk of specific deterministic effects of localized irradiation of the skin; (2) modeling results have been used to recommend approaches to limiting occupational exposure of workers to Β radiation from ΒγE sources on the skin or on clothing; and (3) the generic irradiated-volume, weighting-factor approach to limiting exposure can be applied to other organs including the eye, the ear, and organs of the respiratory or gastrointestinal tract and can be used for both deterministic and stochastic effects

  10. Response-surface models for deterministic effects of localized irradiation of the skin by discrete {beta}/{gamma} -emitting sources

    Energy Technology Data Exchange (ETDEWEB)

    Scott, B.R.

    1995-12-01

    Individuals who work at nuclear reactor facilities can be at risk for deterministic effects in the skin from exposure to discrete {Beta}- and {gamma}-emitting ({Beta}{gamma}E) sources (e.g., {Beta}{gamma}E hot particles) on the skin or clothing. Deterministic effects are non-cancer effects that have a threshold and increase in severity as dose increases (e.g., ulcer in skin). Hot {Beta}{gamma}E particles are {sup 60}Co- or nuclear fuel-derived particles with diameters > 10 {mu}m and < 3 mm and contain at least 3.7 kBq (0.1 {mu}Ci) of radioactivity. For such {Beta}{gamma}E sources on the skin, it is the beta component of the dose that is most important. To develop exposure limitation systems that adequately control exposure of workers to discrete {Beta}{gamma}E sources, models are needed for systems that adequately control exposure of workers to discrete {Beta}{gamma}E sources, models are needed for evaluating the risk of deterministic effects of localized {Beta} irradiation of the skin. The purpose of this study was to develop dose-rate and irradiated-area dependent, response-surface models for evaluating risks of significant deterministic effects of localized irradiation of the skin by discrete {Beta}{gamma}E sources and to use modeling results to recommend approaches to limiting occupational exposure to such sources. The significance of the research results as follows: (1) response-surface models are now available for evaluating the risk of specific deterministic effects of localized irradiation of the skin; (2) modeling results have been used to recommend approaches to limiting occupational exposure of workers to {Beta} radiation from {Beta}{gamma}E sources on the skin or on clothing; and (3) the generic irradiated-volume, weighting-factor approach to limiting exposure can be applied to other organs including the eye, the ear, and organs of the respiratory or gastrointestinal tract and can be used for both deterministic and stochastic effects.

  11. Sympathetic Nerve Injury in Thyroid Cancer

    Directory of Open Access Journals (Sweden)

    Evangelos Diamantis

    2018-04-01

    Full Text Available The double innervation of the thyroid comes from the sympathetic and parasympathetic nervous system. Injury rates during surgery are at 30% but can be minimized by upwardly preparing the thyroid vessels at the level of thyroid capsule. Several factors have been accused of increasing the risk of injury including age and tumor size. Our aim was to investigate of there is indeed any possible correlations between these factors and a possible increase in injury rates following thyroidectomy. Seven studies were included in the meta-analysis. Statistical correlation was observed for a positive relationship between injury of the sympathetic nerve and thyroid malignancy surgery (p < 0.001; I2 = 74% No statistical correlations were observed for a negative or positive relationship between injury of the sympathetic nerve and tumor size. There was also no statistically significant value observed for the correlation of the patients’ age with the risk of sympathetic nerve injury (p = 0.388. Lack of significant correlation reported could be due to the small number of studies and great heterogeneity between them.

  12. Literary ethnographic writing as sympathetic experiment

    DEFF Research Database (Denmark)

    Dalsgaard, Anne Line

    perhaps only implicitly) of research. But we have no direct access to the subjective world of others and can only inhabit their point of view by way of imagination. Writing literary ethnographic text is one way, I will argue, of experimenting with such sympathetic imagination. By putting together observed...

  13. Renal Sympathetic Denervation: Hibernation or Resurrection?

    Science.gov (United States)

    Papademetriou, Vasilios; Doumas, Michael; Tsioufis, Costas

    The most current versions of renal sympathetic denervation have been invented as minimally invasive approaches for the management of drug-resistant hypertension. The anatomy, physiology and pathophysiology of renal sympathetic innervation provide a strong background supporting an important role of the renal nerves in the regulation of blood pressure (BP) and volume. In addition, historical data with surgical sympathectomy and experimental data with surgical renal denervation indicate a beneficial effect on BP levels. Early clinical studies with transcatheter radiofrequency ablation demonstrated impressive BP reduction, accompanied by beneficial effects in target organ damage and other disease conditions characterized by sympathetic overactivity. However, the failure of the SYMPLICITY 3 trial to meet its primary efficacy end point raised a lot of concerns and put the field of renal denervation into hibernation. This review aims to translate basic research into clinical practice by presenting the anatomical and physiological basis for renal sympathetic denervation, critically discussing the past and present knowledge in this field, where we stand now, and also speculating about the future of the intervention and potential directions for research. © 2016 S. Karger AG, Basel.

  14. Estrogens and aging skin

    OpenAIRE

    Thornton, M. Julie

    2013-01-01

    Estrogen deficiency following menopause results in atrophic skin changes and acceleration of skin aging. Estrogens significantly modulate skin physiology, targeting keratinocytes, fibroblasts, melanocytes, hair follicles and sebaceous glands, and improve angiogenesis, wound healing and immune responses. Estrogen insufficiency decreases defense against oxidative stress; skin becomes thinner with less collagen, decreased elasticity, increased wrinkling, increased dryness and reduced vascularity...

  15. Skin barrier response to occlusion of healthy and irritated skin: differences in trans-epidermal water loss, erythema and stratum corneum lipids

    DEFF Research Database (Denmark)

    Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars

    2010-01-01

    Occlusion of the skin is a risk factor for development of irritant contact dermatitis. Occlusion may, however, have a positive effect on skin healing. No consensus on the effect of occlusion has been reached.......Occlusion of the skin is a risk factor for development of irritant contact dermatitis. Occlusion may, however, have a positive effect on skin healing. No consensus on the effect of occlusion has been reached....

  16. Sympathetic activation during early pregnancy in humans

    Science.gov (United States)

    Jarvis, Sara S; Shibata, Shigeki; Bivens, Tiffany B; Okada, Yoshiyuki; Casey, Brian M; Levine, Benjamin D; Fu, Qi

    2012-01-01

    Sympathetic activity has been reported to increase in normotensive pregnant women, and to be even greater in women with gestational hypertension and preeclampsia at term. Whether sympathetic overactivity develops early during pregnancy, remaining high throughout gestation, or whether it only occurs at term providing the substrate for hypertensive disorders is unknown. We tested the hypothesis that sympathetic activation occurs early during pregnancy in humans. Eleven healthy women (29 ± 3 (SD) years) without prior hypertensive pregnancies were tested during the mid-luteal phase (PRE) and early pregnancy (EARLY; 6.2 ± 1.2 weeks of gestation). Muscle sympathetic nerve activity (MSNA) and haemodynamics were measured supine, at 30 deg and 60 deg upright tilt for 5 min each. Blood samples were drawn for catecholamines, direct renin, and aldosterone. MSNA was significantly greater during EARLY than PRE (supine: 25 ± 8 vs. 14 ± 8 bursts min−1, 60 deg tilt: 49 ± 14 vs. 40 ± 10 bursts min−1; main effect, P < 0.05). Resting diastolic pressure trended lower (P = 0.09), heart rate was similar, total peripheral resistance decreased (2172 ± 364 vs. 2543 ± 352 dyne s cm−5; P < 0.05), sympathetic vascular transduction was blunted (0.10 ± 0.05 vs. 0.36 ± 0.47 units a.u.−1 min−1; P < 0.01), and both renin (supine: 27.9 ± 6.2 vs. 14.2 ± 8.7 pg ml−1, P < 0.01) and aldosterone (supine: 16.7 ± 14.1 vs. 7.7 ± 6.8 ng ml−1, P = 0.05) were higher during EARLY than PRE. These results suggest that sympathetic activation is a common characteristic of early pregnancy in humans despite reduced diastolic pressure and total peripheral resistance. These observations challenge conventional thinking about blood pressure regulation during pregnancy, showing marked sympathetic activation occurring within the first few weeks of conception, and may provide the substrate for pregnancy induced cardiovascular complications. PMID:22687610

  17. Comparison of human skin opto-thermal response to near-infrared and visible laser irradiations: a theoretical investigation

    Energy Technology Data Exchange (ETDEWEB)

    Dai Tianhong [Department of Bioengineering, Rice University, Houston, TX 77251 (United States); Pikkula, Brian M [Department of Bioengineering, Rice University, Houston, TX 77251 (United States); Wang, Lihong V [Department of Biomedical Engineering, Texas A and M University, College Station, TX 77843 (United States); Anvari, Bahman [Department of Bioengineering, Rice University, Houston, TX 77251 (United States)

    2004-11-07

    Near-infrared wavelengths are absorbed less by epidermal melanin, and penetrate deeper into human skin dermis and blood than visible wavelengths. Therefore, laser irradiation using near-infrared wavelengths may improve the therapeutic outcome of cutaneous hyper-vascular malformations in moderately to heavily pigmented skin patients and those with large-sized blood vessels or blood vessels extending deeply into the skin. A mathematical model composed of a Monte Carlo algorithm to estimate the distribution of absorbed light, numerical solution of a bio-heat diffusion equation to calculate the transient temperature distribution, and a damage integral based on an empirical Arrhenius relationship to quantify the tissue damage was utilized to investigate the opto-thermal response of human skin to near-infrared and visible laser irradiations in conjunction with cryogen spray cooling. In addition, the thermal effects of a single continuous laser pulse and micropulse-composed laser pulse profiles were compared. Simulation results indicated that a 940 nm wavelength induces improved therapeutic outcome compared with a 585 and 595 nm wavelengths for the treatment of patients with large-sized blood vessels and moderately to heavily pigmented skin. On the other hand, a 585 nm wavelength shows the best efficacy in treating small-sized blood vessels, as characterized by the largest laser-induced blood vessel damage depth compared with 595 and 940 nm wavelengths. Dermal blood content has a considerable effect on the threshold incident dosage for epidermal damage, while the effect of blood vessel size is minimal. For the same macropulse duration and incident dosage, a micropulse-composed pulse profile results in higher peak temperature at the basal layer of skin epidermis than an ideal single continuous pulse profile.

  18. Visible Light Induces Melanogenesis in Human Skin through a Photoadaptive Response

    Science.gov (United States)

    Randhawa, Manpreet; Seo, InSeok; Liebel, Frank; Southall, Michael D.; Kollias, Nikiforos; Ruvolo, Eduardo

    2015-01-01

    Visible light (400–700 nm) lies outside of the spectral range of what photobiologists define as deleterious radiation and as a result few studies have studied the effects of visible light range of wavelengths on skin. This oversight is important considering that during outdoors activities skin is exposed to the full solar spectrum, including visible light, and to multiple exposures at different times and doses. Although the contribution of the UV component of sunlight to skin damage has been established, few studies have examined the effects of non-UV solar radiation on skin physiology in terms of inflammation, and limited information is available regarding the role of visible light on pigmentation. The purpose of this study was to determine the effect of visible light on the pro-pigmentation pathways and melanin formation in skin. Exposure to visible light in ex-vivo and clinical studies demonstrated an induction of pigmentation in skin by visible light. Results showed that a single exposure to visible light induced very little pigmentation whereas multiple exposures with visible light resulted in darker and sustained pigmentation. These findings have potential implications on the management of photo-aggravated pigmentary disorders, the proper use of sunscreens, and the treatment of depigmented lesions. PMID:26121474

  19. Visible Light Induces Melanogenesis in Human Skin through a Photoadaptive Response.

    Science.gov (United States)

    Randhawa, Manpreet; Seo, InSeok; Liebel, Frank; Southall, Michael D; Kollias, Nikiforos; Ruvolo, Eduardo

    2015-01-01

    Visible light (400-700 nm) lies outside of the spectral range of what photobiologists define as deleterious radiation and as a result few studies have studied the effects of visible light range of wavelengths on skin. This oversight is important considering that during outdoors activities skin is exposed to the full solar spectrum, including visible light, and to multiple exposures at different times and doses. Although the contribution of the UV component of sunlight to skin damage has been established, few studies have examined the effects of non-UV solar radiation on skin physiology in terms of inflammation, and limited information is available regarding the role of visible light on pigmentation. The purpose of this study was to determine the effect of visible light on the pro-pigmentation pathways and melanin formation in skin. Exposure to visible light in ex-vivo and clinical studies demonstrated an induction of pigmentation in skin by visible light. Results showed that a single exposure to visible light induced very little pigmentation whereas multiple exposures with visible light resulted in darker and sustained pigmentation. These findings have potential implications on the management of photo-aggravated pigmentary disorders, the proper use of sunscreens, and the treatment of depigmented lesions.

  20. Visible Light Induces Melanogenesis in Human Skin through a Photoadaptive Response.

    Directory of Open Access Journals (Sweden)

    Manpreet Randhawa

    Full Text Available Visible light (400-700 nm lies outside of the spectral range of what photobiologists define as deleterious radiation and as a result few studies have studied the effects of visible light range of wavelengths on skin. This oversight is important considering that during outdoors activities skin is exposed to the full solar spectrum, including visible light, and to multiple exposures at different times and doses. Although the contribution of the UV component of sunlight to skin damage has been established, few studies have examined the effects of non-UV solar radiation on skin physiology in terms of inflammation, and limited information is available regarding the role of visible light on pigmentation. The purpose of this study was to determine the effect of visible light on the pro-pigmentation pathways and melanin formation in skin. Exposure to visible light in ex-vivo and clinical studies demonstrated an induction of pigmentation in skin by visible light. Results showed that a single exposure to visible light induced very little pigmentation whereas multiple exposures with visible light resulted in darker and sustained pigmentation. These findings have potential implications on the management of photo-aggravated pigmentary disorders, the proper use of sunscreens, and the treatment of depigmented lesions.

  1. Effects of renal sympathetic denervation on cardiac sympathetic activity and function in patients with therapy resistant hypertension

    NARCIS (Netherlands)

    van Brussel, Peter M.; Eeftinck Schattenkerk, Daan W.; Dobrowolski, Linn C.; de Winter, Robbert J.; Reekers, Jim A.; Verberne, Hein J.; Vogt, Liffert; van den Born, Bert-Jan H.

    2016-01-01

    Renal sympathetic denervation (RSD) is currently being investigated in multiple studies of sympathetically driven cardiovascular diseases such as heart failure and arrhythmias. Our aim was to assess systemic and cardiac sympatholytic effects of RSD by the measurement of cardiac sympathetic activity

  2. Recruitment pattern of sympathetic muscle neurons during premature ventricular contractions in heart failure patients and controls.

    Science.gov (United States)

    Maslov, Petra Zubin; Breskovic, Toni; Brewer, Danielle N; Shoemaker, J Kevin; Dujic, Zeljko

    2012-12-01

    Premature ventricular contractions (PVC) elicit larger bursts of multiunit muscle sympathetic nerve activity (MSNA), reflecting the ability to increase postganglionic axonal recruitment. We tested the hypothesis that chronic heart failure (CHF) limits the ability to recruit postganglionic sympathetic neurons as a response to PVC due to the excessive sympathetic activation in these patients. Sympathetic neurograms of sufficient signal-to-noise ratio were obtained from six CHF patients and from six similarly aged control individuals. Action potentials (APs) were extracted from the multiunit sympathetic neurograms during sinus rhythm bursts and during the post-PVC bursts. These APs were classified on the basis of the frequency per second, the content per burst, and the peak-to-peak amplitude, which formed the basis of binning the APs into active clusters. Compared with controls, CHF had higher APs per burst and higher number of active clusters per sinus rhythm burst (P < 0.05). Compared with sinus rhythm bursts, both groups increased AP frequency and the number of active clusters in the post-PVC burst (P < 0.05). However, compared with controls, the increase in burst integral, AP frequency, and APs per burst during the post-PVC burst was less in CHF patients. Nonetheless, the PVC-induced increase in active clusters per burst was similar between the groups. Thus, these CHF patients retained the ability to recruit larger APs but had a diminished ability to increase overall AP content.

  3. Alterations of sympathetic nerve fibers in avascular necrosis of femoral head.

    Science.gov (United States)

    Li, Deqiang; Liu, Peilai; Zhang, Yuankai; Li, Ming

    2015-01-01

    Avascular necrosis of the femoral head (ANFH) was mainly due to alterations of bone vascularity. And noradrenaline (NA), as the neurotransmitter of the sympathetic nervous system (SNS), leads to the vasoconstriction by activating its α-Receptor. This study was to explore the nerve fiber density of the femoral head in the rabbit model of ANFH. Twenty New Zealand white rabbits were used in this study. The rabbit model of ANFH was established by the injection of methylprednisolone acetate. The nerve fiber density and distribution in the femoral head was determined using an Olympus BH2 microscope. Significant fewer sympathetic nerve fibers was found in the ANFH intertrochanteric bone samples (P = 0.036) with osteonecrosis. The number of sympathetic nerve fibers was compared between the two groups. And less sympathetic nerve fibers were found in later stage ANFH samples in comparison with those of early stages. ANFH might be preceded by an inflammatory reaction, and an inflammatory response might lead to arthritic changes in tissue samples, which in turn reduces the number of sympathetic nerve fibers.

  4. Skin graft

    Science.gov (United States)

    Skin transplant; Skin autografting; FTSG; STSG; Split thickness skin graft; Full thickness skin graft ... donor site. Most people who are having a skin graft have a split-thickness skin graft. This takes ...

  5. P2-28: An Amplification of Feedback from Facial Muscles Strengthened Sympathetic Activations to Emotional Facial Cues

    Directory of Open Access Journals (Sweden)

    Younbyoung Chae

    2012-10-01

    Full Text Available The facial feedback hypothesis suggests that feedback from cutaneous and muscular afferents influences our emotions during the control of facial expressions. Enhanced facial expressiveness is correlated with an increase in autonomic arousal, and self-reported emotional experience, while limited facial expression attenuates these responses. The present study was aimed at investigating the difference in emotional response in imitated versus observed facial expressions. For this, we measured the facial electromyogram of the corrugator muscle as well as the skin conductance response (SCR while participants were either imitating or simply observing emotional facial expressions. We found that participants produced significantly greater facial electromyogram activation during imitations compared to observations of angry faces. Similarly, they exhibited significantly greater SCR during imitations to angry faces compared to observations. An amplification of feedback from face muscles during imitation strengthened sympathetic activation to negative emotional cues. These findings suggest that manipulations of muscular feedback could modulate the bodily expression of emotion and perhaps also the emotional response itself.

  6. Force sensor in simulated skin and neural model mimic tactile SAI afferent spiking response to ramp and hold stimuli.

    Science.gov (United States)

    Kim, Elmer K; Wellnitz, Scott A; Bourdon, Sarah M; Lumpkin, Ellen A; Gerling, Gregory J

    2012-07-23

    The next generation of prosthetic limbs will restore sensory feedback to the nervous system by mimicking how skin mechanoreceptors, innervated by afferents, produce trains of action potentials in response to compressive stimuli. Prior work has addressed building sensors within skin substitutes for robotics, modeling skin mechanics and neural dynamics of mechanotransduction, and predicting response timing of action potentials for vibration. The effort here is unique because it accounts for skin elasticity by measuring force within simulated skin, utilizes few free model parameters for parsimony, and separates parameter fitting and model validation. Additionally, the ramp-and-hold, sustained stimuli used in this work capture the essential features of the everyday task of contacting and holding an object. This systems integration effort computationally replicates the neural firing behavior for a slowly adapting type I (SAI) afferent in its temporally varying response to both intensity and rate of indentation force by combining a physical force sensor, housed in a skin-like substrate, with a mathematical model of neuronal spiking, the leaky integrate-and-fire. Comparison experiments were then conducted using ramp-and-hold stimuli on both the spiking-sensor model and mouse SAI afferents. The model parameters were iteratively fit against recorded SAI interspike intervals (ISI) before validating the model to assess its performance. Model-predicted spike firing compares favorably with that observed for single SAI afferents. As indentation magnitude increases (1.2, 1.3, to 1.4 mm), mean ISI decreases from 98.81 ± 24.73, 54.52 ± 6.94, to 41.11 ± 6.11 ms. Moreover, as rate of ramp-up increases, ISI during ramp-up decreases from 21.85 ± 5.33, 19.98 ± 3.10, to 15.42 ± 2.41 ms. Considering first spikes, the predicted latencies exhibited a decreasing trend as stimulus rate increased, as is observed in afferent recordings. Finally, the SAI afferent's characteristic response

  7. Carotid body (Thermoreceptors, sympathetic neural activation, and cardiometabolic disease

    Directory of Open Access Journals (Sweden)

    Rodrigo Iturriaga

    Full Text Available The carotid body (CB is the main peripheral chemoreceptor that senses the arterial PO2, PCO2 and pH. In response to hypoxemia, hypercapnia and acidosis, carotid chemosensory discharge elicits reflex respiratory, autonomic and cardiovascular adjustments. The classical construct considers the CB as the main peripheral oxygen sensor, triggering reflex physiological responses to acute hypoxemia and facilitating the ventilatory acclimation to chronic hypoxemia at high altitude. However, a growing body of experimental evidence supports the novel concept that an abnormally enhanced CB chemosensory input to the brainstem contributes to overactivation of the sympathetic nervous system, and consequent pathology. Indeed, the CB has been implicated in several diseases associated with increases in central sympathetic outflow. These include hypertension, heart failure, sleep apnea, chronic obstructive pulmonary disease and metabolic syndrome. Indeed, ablation of the CB has been proposed for the treatment of severe and resistant hypertension in humans. In this review, we will analyze and discuss new evidence supporting an important role for the CB chemoreceptor in the progression of autonomic and cardiorespiratory alterations induced by heart failure, obstructive sleep apnea, chronic obstructive pulmonary disease and metabolic syndrome.

  8. The effect of starting or stopping skin cooling on the thermoregulatory responses during leg exercise in humans.

    Science.gov (United States)

    Demachi, K; Yoshida, T; Kume, M; Tsuneoka, H

    2012-07-01

    To assess the effects of starting or stopping leg cooling on the thermoregulatory responses during exercise, 60 min of cycling exercise at 30% of maximal oxygen uptake was performed under 4 conditions using tube trouser perfused with water at 10 °C; no leg cooling (NC), starting of leg cooling after 30 min of exercise (delayed cooling, DC), continuous leg cooling (CC), and stopping of continuous leg cooling after 30 min of exercise (SC) at an environmental temperature of 28.5 °C. During exercise under the DC conditions, an instantaneous increase in the esophageal temperature (Tes), a suppression of the cutaneous vascular conductance at the forearm (%CVC), and a decrease in the mean skin temperature (Tsk) were observed after leg cooling. The total sweat loss (Δm sw,tot) was lower under the DC than the NC condition. In the SC study, however, the Tes remained constant, while the %CVC increased gradually after leg cooling was stopped, and the Δm sw,tot was greater than that under the CC condition. These results suggest that during exercise, rapid skin cooling of the leg may cause an increase in core temperature, while also enhancing thermal stress. However, stopping skin cooling did not significantly affect the core temperature long-term, because the skin blood flow and sweat rate subsequently increased. © Georg Thieme Verlag KG Stuttgart · New York.

  9. Histologic analyses on the response of the skin to 1,927-nm fractional thulium fiber laser treatment.

    Science.gov (United States)

    Kwon, In Ho; Bae, Youin; Yeo, Un-Cheol; Lee, Jin Yong; Kwon, Hyuck Hoon; Choi, Young Hee; Park, Gyeong-Hun

    2018-02-01

    The histologic responses to varied parameters of 1,927-nm fractional thulium fiber laser treatment have not yet been sufficiently elucidated. This study sought to evaluate histologic changes immediately after 1,927-nm fractional thulium fiber laser session at various parameters. The dorsal skin of Yucatan mini-pig was treated with 1,927-nm fractional thulium fiber laser at varied parameters, with or without skin drying. The immediate histologic changes were evaluated to determine the effects of varying laser parameters on the width and the depth of treated zones. The increase in the level of pulse energy widened the area of epidermal changes in the low power level, but increased the dermal penetration depth in the high power level. As the pulse energy level increased, the increase in the power level under the given pulse energy level more evidently made dermal penetration deeper and the treatment area smaller. Skin drying did not show significant effects on epidermal changes, but evidently increased the depth of dermal denaturation under both high and low levels of pulse energy. These results may provide important information to establish treatment parameters of the 1,927-nm fractional thulium fiber laser for various skin conditions.

  10. Change in sympathetic nerve firing pattern associated with dietary weight loss in the metabolic syndrome

    Directory of Open Access Journals (Sweden)

    Elisabeth Annie Lambert

    2011-08-01

    Full Text Available Sympathetic activation in subjects with the metabolic syndrome (MS plays a role in the pathogenesis of cardiovascular disease development. Diet-induced weight loss decreases sympathetic outflow. However the mechanisms that account for sympathetic inhibition are not known. We sought to provide a detailed description of the sympathetic response to diet by analyzing the firing behavior of single-unit sympathetic nerve fibres. Fourteen subjects (57±2 years, 9 men, 5 females fulfilling ATP III criteria for the MS underwent a 3-month low calorie diet. Metabolic profile, hemodynamic parameters and multi-unit and single unit muscle sympathetic nerve activity (MSNA, microneurography were assessed prior to and at the end of the diet. Patients’ weight dropped from 96±4 to 88±3 kg (P<0.001. This was associated with a decrease in systolic and diastolic blood pressure (-12 ±3 and -5±2 mmHg, P<0.05, and in heart rate (-7±2 bpm, P<0.01 and an improvement in all metabolic parameters (fasting glucose: -0.302.1±0.118 mmol/l, total cholesterol: -0.564±0.164 mmol/l, triglycerides: -0.414±0.137 mmol/l, P<0.05. Multi-unit MSNA decreased from 68±4 to 59±5 bursts per 100 heartbeats (P<0.05. Single-unit MSNA indicated that the firing rate of individual vasoconstrictor fibres decreased from 59±10 to 32±4 spikes per 100 heart beats (P<0.05. The probability of firing decreased from 34±5 to 23±3 % of heartbeats (P<0.05, and the incidence of multiple firing decreased from 14±4 to 6±1 % of heartbeats (P<0.05. Cardiac and sympathetic baroreflex function were significantly improved (cardiac slope: 6.57±0.69 to 9.57±1.20 msec.mmHg-1; sympathetic slope: -3.86±0.34 to -5.05±0.47 bursts per 100 heartbeats.mmHg-1 P<0.05 for both. Hypocaloric diet decreased sympathetic activity and improved hemodynamic and metabolic parameters. The sympathoinhibition associated with weight loss involves marked changes, not only in the rate but also in the firing pattern of

  11. Sympathetic reflex control of blood flow in human peripheral tissues

    DEFF Research Database (Denmark)

    Henriksen, O

    1991-01-01

    Sympathetic vasoconstrictor reflexes are essential for the maintenance of arterial blood pressure in upright position. It has been generally believed that supraspinal sympathetic vasoconstrictor reflexes elicited by changes in baroreceptor activity play an important role. Recent studies on human...... sympathetic vasoconstrictor reflexes are blocked. Blood flow has been measure by the local 133Xe-technique. The results indicate the presence of spinal as well as supraspinal sympathetic vasoconstrictor reflexes to human peripheral tissues. Especially is emphasized the presence of a local sympathetic veno...... skeletal muscle, cutaneous and subcutaneous tissues of the limbs indicate that the situation is more complex. Measurements have been carried out during acute as well as chronic sympathetic denervation. Spinal sympathetic reflex mechanisms have been evaluated in tetraplegic patients, where supraspinal...

  12. Quantitative Methods for Measuring Repair Rates and Innate-Immune Cell Responses in Wounded Mouse Skin.

    Science.gov (United States)

    Li, Zhi; Gothard, Elizabeth; Coles, Mark C; Ambler, Carrie A

    2018-01-01

    In skin wounds, innate-immune cells clear up tissue debris and microbial contamination, and also secrete cytokines and other growth factors that impact repair process such as re-epithelialization and wound closure. After injury, there is a rapid influx and efflux of immune cells at wound sites, yet the function of each innate cell population in skin repair is still under investigation. Flow cytometry is a valuable research tool for detecting and quantifying immune cells; however, in mouse back skin, the difficulty in extracting immune cells from small area of skin due to tissue complexity has made cytometric analysis an underutilized tool. In this paper, we provide detailed methods on the digestion of lesion-specific skin without disrupting antigen expression followed by multiplex cell staining that allows for identification of seven innate-immune populations, including rare subsets such as group-3 innate lymphoid cells (ILC3s), by flow-cytometry analysis. Furthermore, when studying the functions of immune cells to tissue repair an important metric to monitor is size of the wound opening. Normal wounds close steadily albeit at non-linear rates, while slow or stalled wound closure can indicate an underlying problem with the repair process. Calliper measurements are difficult and time-consuming to obtain and can require repeated sedation of experimental animals. We provide advanced methods for measuring of wound openness; digital 3D image capture and semi-automated image processing that allows for unbiased, reliable measurements that can be taken repeatedly over time.

  13. Benefits of plasma rich in growth factors (PRGF) in skin photodamage: clinical response and histological assessment.

    Science.gov (United States)

    Díaz-Ley, B; Cuevast, J; Alonso-Castro, L; Calvo, M I; Ríos-Buceta, L; Orive, G; Anitua, E; Jaén, P

    2015-01-01

    Skin ageing is characterized by small and fine wrinkles, roughness, laxity, and pigmentation as a result of epidermal thinning, collagen degradation, dermal atrophy, and fewer fibroblasts. Plasma rich in growth factors (PRGF) is an autologous plasma preparation enriched in proteins obtained from patient's own blood aimed at accelerating tissue repair and regeneration. To evaluate the benefits of PRGF in skin photodamage, 10 healthy volunteers were treated with three consecutive intradermal injections of PRGF in the facial area. Clinical outcomes and histological analysis were performed. A statistically significant increase in the epidermis and papillary dermis thickness was seen after PRGF treatment (p PRGF treatment, a reduction of the average area fraction of solar elastosis was observed in patients with clinical and histological signs of skin photodamage (p PRGF use was 0.75 (9/12) for the group of patients with signs of skin photodamage. Intradermal PRGF infiltration appears to be an effective treatment for the photodamaged skin. © 2015 Wiley Periodicals, Inc.

  14. Skin denervation and its clinical significance in late-stage chronic kidney disease.

    Science.gov (United States)

    Chao, Chi-Chao; Wu, Vin-Cent; Tan, Chun-Hsiang; Wang, Yi-Mei; Tseng, Ming-Tsung; Wu, Pei-Chen; Lin, Yea-Huey; Lin, Whei-Min; Wu, Kwan-Dun; Hsieh, Sung-Tsang

    2011-02-01

    To investigate the skin innervation and its clinical significance in late-stage chronic kidney disease (CKD). Case series. National Taiwan University Hospital, Taipei, Taiwan. Forty consecutive nondiabetic patients with late-stage CKD (14 female and 26 male; mean [SD] age, 60.7 [12.3] years), including 2 cases with stage 3 CKD, 6 with stage 4 CKD, and 32 with stage 5 CKD, ie, end-stage kidney disease. Clinical evaluation of neurological deficits, nerve conduction study, autonomic function tests, and a 3-mm-diameter skin biopsy specimen taken from the distal leg. Quantitation of epidermal innervation, parameters of nerve conduction study, R-R interval variability, and sympathetic skin response. Clinically, 21 patients (52.5%) were symptomatic with paresthesia over the limbs or autonomic symptoms. The intraepidermal nerve fiber (IENF) density was markedly reduced in patients with CKD compared with age- and sex-matched controls (mean [SD], 2.8 [2.0] vs 8.6 [2.8] fibers/mm; P Skin denervation was observed in 27 patients (67.5%). Fifteen patients (37.5%) had abnormalities on nerve conduction studies, and 29 patients (72.5%) had abnormal results on autonomic function tests. By analysis with multiple regression models, the IENF density was negatively correlated with the duration of renal disease (P = .02). Additionally, the R-R interval variability at rest was linearly correlated with the IENF density (P = .02) and the absence of sympathetic skin responses at the soles was associated with reduced IENF density (P = .03). Small-fiber sensory and autonomic neuropathies constitute the major form of neuropathy in late-stage CKD. Furthermore, skin denervation was associated with the duration of renal disease.

  15. A model-based approach for the evaluation of vagal and sympathetic activities in a newborn lamb.

    Science.gov (United States)

    Le Rolle, Virginie; Ojeda, David; Beuchée, Alain; Praud, Jean-Paul; Pladys, Patrick; Hernández, Alfredo I

    2013-01-01

    This paper proposes a baroreflex model and a recursive identification method to estimate the time-varying vagal and sympathetic contributions to heart rate variability during autonomic maneuvers. The baroreflex model includes baroreceptors, cardiovascular control center, parasympathetic and sympathetic pathways. The gains of the global afferent sympathetic and vagal pathways are identified recursively. The method has been validated on data from newborn lambs, which have been acquired during the application of an autonomic maneuver, without medication and under beta-blockers. Results show a close match between experimental and simulated signals under both conditions. The vagal and sympathetic contributions have been simulated and, as expected, it is possible to observe different baroreflex responses under beta-blockers compared to baseline conditions.

  16. Immune and biochemical responses in skin differ between bovine hosts genetically susceptible and resistant to the cattle tick Rhipicephalus microplus.

    Science.gov (United States)

    Franzin, Alessandra Mara; Maruyama, Sandra Regina; Garcia, Gustavo Rocha; Oliveira, Rosane Pereira; Ribeiro, José Marcos Chaves; Bishop, Richard; Maia, Antônio Augusto Mendes; Moré, Daniela Dantas; Ferreira, Beatriz Rossetti; Santos, Isabel Kinney Ferreira de Miranda

    2017-01-31

    Ticks attach to and penetrate their hosts' skin and inactivate multiple components of host responses in order to acquire a blood meal. Infestation loads with the cattle tick, Rhipicephalus microplus, are heritable: some breeds carry high loads of reproductively successful ticks, whereas in others, few ticks feed and reproduce efficiently. In order to elucidate the mechanisms that result in the different outcomes of infestations with cattle ticks, we examined global gene expression and inflammation induced by tick bites in skins from one resistant and one susceptible breed of cattle that underwent primary infestations with larvae and nymphs of R. microplus. We also examined the expression profiles of genes encoding secreted tick proteins that mediate parasitism in larvae and nymphs feeding on these breeds. Functional analyses of differentially expressed genes in the skin suggest that allergic contact-like dermatitis develops with ensuing production of IL-6, CXCL-8 and CCL-2 and is sustained by HMGB1, ISG15 and PKR, leading to expression of pro-inflammatory chemokines and cytokines that recruit granulocytes and T lymphocytes. Importantly, this response is delayed in susceptible hosts. Histopathological analyses of infested skins showed inflammatory reactions surrounding tick cement cones that enable attachment in both breeds, but in genetically tick-resistant bovines they destabilized the cone. The transcription data provided insights into tick-mediated activation of basophils, which have previously been shown to be a key to host resistance in model systems. Skin from tick-susceptible bovines expressed more transcripts encoding enzymes that detoxify tissues. Interestingly, these enzymes also produce volatile odoriferous compounds and, accordingly, skin rubbings from tick-susceptible bovines attracted significantly more tick larvae than rubbings from resistant hosts. Moreover, transcripts encoding secreted modulatory molecules by the tick were significantly more

  17. EXERCISE-INDUCED SYMPATHETIC FFA MOBILIZATION IN VMH-LESIONED RATS IS NORMALIZED BY FASTING

    NARCIS (Netherlands)

    Balkan, B.; Dijk, G. van; Strubbe, J.H.; Bruggink, J.E.; Steffens, A.B.

    This study investigates whether reduced sympathetic responses during physical exercise in ventromedial hypothalamus (VMH)-lesioned obese rats are the direct result of damage to hypothalamic circuits or a secondary effect of the altered metabolism in obesity. Obese, VMH-lesioned rats and lean

  18. Multiple helminth infection of the skin causes lymphocyte hypo-responsiveness mediated by Th2 conditioning of dermal myeloid cells.

    Directory of Open Access Journals (Sweden)

    Peter C Cook

    2011-03-01

    Full Text Available Infection of the mammalian host by schistosome larvae occurs via the skin, although nothing is known about the development of immune responses to multiple exposures of schistosome larvae, and/or their excretory/secretory (E/S products. Here, we show that multiple (4x exposures, prior to the onset of egg laying by adult worms, modulate the skin immune response and induce CD4(+ cell hypo-responsiveness in the draining lymph node, and even modulate the formation of hepatic egg-induced granulomas. Compared to mice exposed to a single infection (1x, dermal cells from multiply infected mice (4x, were less able to support lymph node cell proliferation. Analysis of dermal cells showed that the most abundant in 4x mice were eosinophils (F4/80(+MHC-II(-, but they did not impact the ability of antigen presenting cells (APC to support lymphocyte proliferation to parasite antigen in vitro. However, two other cell populations from the dermal site of infection appear to have a critical role. The first comprises arginase-1(+, Ym-1(+ alternatively activated macrophage-like cells, and the second are functionally compromised MHC-II(hi cells. Through the administration of exogenous IL-12 to multiply infected mice, we show that these suppressive myeloid cell phenotypes form as a consequence of events in the skin, most notably an enrichment of IL-4 and IL-13, likely resulting from an influx of RELMα-expressing eosinophils. We further illustrate that the development of these suppressive dermal cells is dependent upon IL-4Rα signalling. The development of immune hypo-responsiveness to schistosome larvae and their effect on the subsequent response to the immunopathogenic egg is important in appreciating how immune responses to helminth infections are modulated by repeated exposure to the infective early stages of development.

  19. Biochemical response of skin-coated citrus fruits irradiated for preservation

    International Nuclear Information System (INIS)

    Ahmed, E.S.

    1977-01-01

    Orange fruits (citrus Sinensis) Kind Egyptian Balady variety, were irradiated for 100, 200 and 400 Krad γ-ray doses in combination with sodium orthophenylphenate, 0.0025% incorporated in wax coatings as preirradiation treatment. The data revealed the utility of combined treatment to control postharvest decay in citrus fruits. 100 Krad extend shelflife of skin-coated fruits by 15 weeks without significant losses in Vitamin C, reducing sugars, or free amino acids and without storage disorders. Unirradiated non skin-coated and unirradiated skin-coated had a shelf-life of 7, and 10 weeks, respectively, under the same experimental storage conditions (14-20 C and R.H. 65-75%)

  20. The response of mouse skin to re-irradiation with x-rays or fast neutrons

    International Nuclear Information System (INIS)

    Tsukiyama, Iwao; Egawa, Sunao; Kumazawa, Akiyoshi; Iino, Yuu.

    1986-01-01

    Effects of neutrons and x-rays on mouse skin which had been previously irradiated with x-rays were investigated. Two tattoo marks were placed in the hairless legs of mice at intervals of 15 mm. The legs were exposed to various doses of x-ray and neutrons to determine the relative biological effectiveness (RBE) using the contraction of the skin as an index. The RBE was 0.93 - 1.73. The legs of the mice were preexposed to 25 Gy of x-ray, and exposed 4 months later. The contraction of the skin began earlier than after the first irradiation. RBE was 2.18 - 2.47. This RBE was higher than that in untreated mice. These results suggest that previously irradiated normal tissues are much more sensitive to neutrons than to x-rays. (author)

  1. The response of mouse skin and lung to fractionated x-rays

    International Nuclear Information System (INIS)

    Field, S.B.; Hornsey, S.

    1975-01-01

    The relationship between total dose and number of fractions has been investigated for damage to lung and skin in mice. Single doses and various numbers of fractions have been given and the results are analysed in two ways: (i) by comparing the fractionated treatment with a single dose. With this approach, and assuming that the observed damage to lung and skin is the result of cell killing, it is estimated that the ratio of initial to final slope of the cell survival curve is about 7:1; (ii) by measuring the additional dose required when the number of fractions is doubled. These results are roughly fitted by a single-hit times multitarget survival-curve model, with the ratio of slopes about 3:1. It is concluded from this discrepancy that the two-component model is an inadequate description of the survival curve for the cells of either skin or lung. (author)

  2. Exogenous melatonin administration modifies cutaneous vasoconstrictor response to whole body skin cooling in humans.

    Science.gov (United States)

    Aoki, Ken; Zhao, Kun; Yamazaki, Fumio; Sone, Ryoko; Alvarez, Guy E; Kosiba, Wojciech A; Johnson, John M

    2008-03-01

    Humans and other diurnal species experience a fall in internal temperature (T(int)) at night, accompanied by increased melatonin and altered thermoregulatory control of skin blood flow (SkBF). Also, exogenous melatonin induces a fall in T(int), an increase in distal skin temperatures and altered control of the cutaneous active vasodilator system, suggesting an effect of melatonin on the control of SkBF. To test whether exogenous melatonin also affects the more tonically active vasoconstrictor system in glabrous and nonglabrous skin during cooling, healthy males (n = 9) underwent afternoon sessions of whole body skin temperature (T(sk)) cooling (water-perfused suits) after oral melatonin (Mel; 3 mg) or placebo (Cont). Cutaneous vascular conductance (CVC) was calculated from SkBF (laser Doppler flowmetry) and non-invasive blood pressure. Baseline T(int) was lower in Mel than in Cont (P forearm CVC was first significantly reduced at T(sk) of 34.33 +/- 0.01 degrees C (P forearm CVC in Mel was significantly less than in Cont at T(sk) of 32.66 +/- 0.01 degrees C and lower (P < 0.05). In Mel, palmar CVC was significantly higher than in Cont above T(sk) of 33.33 +/- 0.01 degrees C, but not below. Thus exogenous melatonin blunts reflex vasoconstriction in nonglabrous skin and shifts vasoconstrictor system control to lower T(int). It provokes vasodilation in glabrous skin but does not suppress the sensitivity to falling T(sk). These findings suggest that by affecting the vasoconstrictor system, melatonin has a causal role in the nocturnal changes in body temperature and its control.

  3. Modeling slug tests in unconfined aquifers with both oscillatory and overdamped responses, and with low-K and high-K skin effects

    Science.gov (United States)

    Thoma, M. J.; Malama, B.; Barrash, W.; Bohling, G.; Butler, J. J.

    2009-12-01

    We extend the models for slug tests developed by Hyder et al. (1994) and Butler and Zhan (2004) to obtain a single general model for slug tests in unconfined aquifers in partially penetrating wells with a near-well disturbed zone (skin). The full range of responses, oscillatory to overdamped, is considered since both types of responses are common in wells in unconsolidated coarse fluvial aquifers, and others. The general semi-analytical solution allows for skin and formation storage as well as anisotropy in skin and formation hydraulic conductivity (K). The water table is treated as a fixed head boundary so the solution is applicable for wells screened below the water table. The model is validated by comparison with other models and by matching field data from unconfined fluvial aquifers at sites in Nebraska (MSEA) and Idaho (BHRS). We examine the effects of varying skin K and skin thickness to simulate the impact of a near-well disturbed zone that is lower (damage) or higher (filter pack) K than the formation. Results indicate that, for a given set of measured behavior at an example test zone, minor progressive decreases in estimated formation K occur with increases in assumed skin K, and moderate increases in estimated formation K occur with decreases in assumed skin K. Major increases (orders of magnitude) in estimated formation K occur with increased thickness of low-K skin. The importance of incorporating a finite-thickness representation of the skin, rather than the conventional infinitely thin representation, is also addressed.

  4. Early and late radiation response of human skin following chronic exposure of the hands

    International Nuclear Information System (INIS)

    Lenz, U.; Arndt, D.; Thormann, T.

    1979-01-01

    Clinical examinations on 45 radiation workers with chronical low-level exposures to their hands revealed that accumulated doses in the range of 15 to 30 Sv (1500 to 3000 rem) may already produce macroscopically unconspicuous early alterations of the vessel system within the corium as well as epidermal hyperplasia. Therefore, the annual permissible dose equivalent of 0.75 Sv (75 rem) recommended by ICRP for the skin of the extremities appears unjustifiably high and should be reduced to 0.30 Sv (30 rem), the limit valid for the remaining areas of skin. (author)

  5. Dose response evaluation of gene expression profiles in the skin of K6/ODC mice exposed to sodium arsenite

    International Nuclear Information System (INIS)

    Ahlborn, Gene J.; Nelson, Gail M.; Ward, William O.; Knapp, Geremy; Allen, James W.; Ouyang Ming; Roop, Barbara C.; Chen Yan; O'Brien, Thomas; Kitchin, Kirk T.; Delker, Don A.

    2008-01-01

    Chronic drinking water exposure to inorganic arsenic and its metabolites increases tumor frequency in the skin of K6/ODC transgenic mice. To identify potential biomarkers and modes of action for this skin tumorigenicity, we characterized gene expression profiles from analysis of K6/ODC mice administered 0, 0.05, 0.25, 1.0 and 10 ppm sodium arsenite in their drinking water for 4 weeks. Following exposure, total RNA was isolated from mouse skin and processed to biotin-labeled cRNA for microarray analyses. Skin gene expression was analyzed with Affymetrix Mouse Genome 430A 2.0 GeneChips (registered) , and pathway analysis was conducted with DAVID (NIH), Ingenuity (registered) Systems and MetaCore's GeneGo. Differential expression of several key genes was verified through qPCR. Only the highest dose (10 ppm) resulted in significantly altered KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways, including MAPK, regulation of actin cytoskeleton, Wnt, Jak-Stat, Tight junction, Toll-like, phosphatidylinositol and insulin signaling pathways. Approximately 20 genes exhibited a dose response, including several genes known to be associated with carcinogenesis or tumor progression including cyclin D1, CLIC4, Ephrin A1, STAT3 and DNA methyltransferase 3a. Although transcription changes in all identified genes have not previously been linked to arsenic carcinogenesis, their association with carcinogenesis in other systems suggests that these genes may play a role in the early stages of arsenic-induced skin carcinogenesis and can be considered potential biomarkers

  6. Developmental and Metabolic Plasticity of White-Skinned Grape Berries in Response to Botrytis cinerea during Noble Rot1[OPEN

    Science.gov (United States)

    Collins, Thomas S.; Vicente, Ariel R.; Doyle, Carolyn L.; Ye, Zirou; Allen, Greg; Heymann, Hildegarde

    2015-01-01

    Noble rot results from exceptional infections of ripe grape (Vitis vinifera) berries by Botrytis cinerea. Unlike bunch rot, noble rot promotes favorable changes in grape berries and the accumulation of secondary metabolites that enhance wine grape composition. Noble rot-infected berries of cv Sémillon, a white-skinned variety, were collected over 3 years from a commercial vineyard at the same time that fruit were harvested for botrytized wine production. Using an integrated transcriptomics and metabolomics approach, we demonstrate that noble rot alters the metabolism of cv Sémillon berries by inducing biotic and abiotic stress responses as well as ripening processes. During noble rot, B. cinerea induced the expression of key regulators of ripening-associated pathways, some of which are distinctive to the normal ripening of red-skinned cultivars. Enhancement of phenylpropanoid metabolism, characterized by a restricted flux in white-skinned berries, was a common outcome of noble rot and red-skinned berry ripening. Transcript and metabolite analyses together with enzymatic assays determined that the biosynthesis of anthocyanins is a consistent hallmark of noble rot in cv Sémillon berries. The biosynthesis of terpenes and fatty acid aroma precursors also increased during noble rot. We finally characterized the impact of noble rot in botrytized wines. Altogether, the results of this work demonstrated that noble rot causes a major reprogramming of berry development and metabolism. This desirable interaction between a fruit and a fungus stimulates pathways otherwise inactive in white-skinned berries, leading to a greater accumulation of compounds involved in the unique flavor and aroma of botrytized wines. PMID:26450706

  7. IN SITU IMMUNE RESPONSE EVALUATION VIA IMMUNOHISTOCHEMISTRY IN SKIN BIOPSIES FROM PATIENTS AFFECTED BY AUTOIMMUNE BLISTERING DISEASES

    Directory of Open Access Journals (Sweden)

    Ana Maria Abreu Velez

    2013-11-01

    Full Text Available Introduction: The in situ immune response in skin biopsies from patients affected by autoimmune skin blistering diseases (ABD is not well characterized. Aim: Our investigation attempts to immunophenotype cells in lesional skin in several ABD, utilizing immunohistochemistry (ICH. Methods: We tested by IHC for CD4, CD8, CD19, CD20, CD45, CD56/NCAM, PAX-5, granzyme B, myeloperoxidase, neutrophil elastase, LAT and ZAP-70 in patients affected by ABD. We tested 30 patients with endemic pemphigus foliaceus (EPF, 15 controls from the EPF endemic area, and 15 biopsies from healthy controls from the USA. We also tested archival biopsies from patients with selected ABD, including 30 patients with bullous pemphigoid, 20 with pemphigus vulgaris, 8 with pemphigus foliaceus and 14 with dermatitis herpetiformis. Results: We found a predominantly CD8 positive/CD45 positive T cell infiltrate in all ABD. Our skin biopsies demonstrated consistently positive staining for myeloperoxidase, but negative staining for neutrophil elastase. Most ABD biopsies displayed negative staining for CD4 and B cell markers; natural killer cell markers were also rarely seen. ZAP-70 and LAT were frequently detected. In El Bagre-EPF, a significant fragmentation of T cells in lesional skin was noted, as well as autoreactivity to lymph nodes. Conclusions: The documented T cell and myeloperoxidase staining are indicative of the role of T lymphocytes and neutrophils in lesional biopsies in patients with ABD, in addition to previously documented deposition of B cells, immunoglobulins and complement in situ. In El Bagre-EPF, T cells could also target lymph nodes; however, further studies are needed to confirm this possibility.

  8. The Response of the Ocean Thermal Skin Layer to Air-Sea Surface Heat Fluxes

    Science.gov (United States)

    Wong, Elizabeth Wing-See

    There is much evidence that the ocean is heating as a result of an increase in concentrations of greenhouse gases (GHGs) in the atmosphere from human activities. GHGs absorb infrared radiation and re-emit infrared radiation back to the ocean's surface which is subsequently absorbed. However, the incoming infrared radiation is absorbed within the top micrometers of the ocean's surface which is where the thermal skin layer exists. Thus the incident infrared radiation does not directly heat the upper few meters of the ocean. We are therefore motivated to investigate the physical mechanism between the absorption of infrared radiation and its effect on heat transfer at the air-sea boundary. The hypothesis is that since heat lost through the air-sea interface is controlled by the thermal skin layer, which is directly influenced by the absorption and emission of infrared radiation, the heat flow through the thermal skin layer adjusts to maintain the surface heat loss, assuming the surface heat loss does not vary, and thus modulates the upper ocean heat content. This hypothesis is investigated through utilizing clouds to represent an increase in incoming longwave radiation and analyzing retrieved thermal skin layer vertical temperature profiles from a shipboard infrared spectrometer from two research cruises. The data are limited to night-time, no precipitation and low winds of less than 2 m/s to remove effects of solar radiation, wind-driven shear and possibilities of thermal skin layer disruption. The results show independence of the turbulent fluxes and emitted radiation on the incident radiative fluxes which rules out the immediate release of heat from the absorption of the cloud infrared irradiance back into the atmosphere through processes such as evaporation and increase infrared emission. Furthermore, independence was confirmed between the incoming and outgoing radiative flux which implies the heat sink for upward flowing heat at the air-sea interface is more

  9. [Effects of self-foot reflexology on stress, fatigue, skin temperature and immune response in female undergraduate students].

    Science.gov (United States)

    Lee, Young-Mee

    2011-02-01

    The purpose of this study was to evaluate the effects of self-foot reflexology on stress (perceived stress, urine cortisol level, and serum cortisol level), fatigue, skin temperature and immune response in female undergraduate students. The research design was a nonequivalent control group pretest-post test design. Participants were 60 university students: 30 in the experiment group and 30 in the control group. The period of this study was from April to June 2010. The program was performed for 1 hr a session, three times a week for 6 weeks. The data were analyzed using the SPSS/WIN 17.0 program. The results showed that self-foot reflexology was effective in reducing perceived stress and fatigue, and raised skin temperature in female undergraduate students. But cortisol levels and immune response were not statistically significant different. The results of this study indicate that self-foot reflexology is an effective nursing intervention in reducing perceived stress and fatigue and, in improving skin temperature. Therefore, it is recommended that this be used in clinical practice as an effective nursing intervention for in female undergraduate students.

  10. Safety and skin delayed-type hypersensitivity response in vervet monkeys immunized with Leishmania donovani sonicate antigen delivered with adjuvants

    Directory of Open Access Journals (Sweden)

    Joshua M. Mutiso

    2012-02-01

    Full Text Available In this study, we report on the safety and skin delayed-type hypersensitivity (DTH, responses of the Leishmania donovani whole cell sonicate antigen delivered in conjunction with alum-BCG (AlBCG, Montanide ISA 720 (MISA or Monophosphoryl lipid A (MPLA in groups of vervet monkeys. Following three intradermal injections of the inoculums on days 0, 28 and 42, safety and DTH responses were assessed. Preliminary tumor necrosis factor alpha (TNF-α and interferon gamma (IFN-γ levels were also measured and these were compared with DTH. Only those animals immunized with alum-BCG reacted adversely to the inoculum by producing ulcerative erythematous skin indurations. Non-parametric analysis of variance followed by a post-test showed significantly higher DTH responses in the MISA+Ag group compared with other immunized groups (p < 0.001. The MPLA+Ag group indicated significantly lower DTH responses to the sonicate antigen compared with the AlBCG+Ag group. There was a significant correlation between the DTH and cytokine responses (p < 0.0001. Based on this study we conclude that Leishmania donovani sonicate antigen containing MISA 720 is safe and is associated with a strong DTH reaction following immunization.

  11. Extracellular Matrix Modulates Morphology, Growth, Oxidative Stress Response and Functionality of Human Skin Fibroblasts during Aging In Vitro

    DEFF Research Database (Denmark)

    Jørgensen, Peter; Rattan, Suresh

    2014-01-01

    recent observations indicate that replicative lifespan, senescence and functionality of cells in vitro can be significantly affected by the quality of the extra cellular matrix (ECM). Following up on those reports, here we show that using the ECM prepared from early passage young cells, partial...... rejuvenation of serially passaged human facial skin fibroblasts was possible in pre-senescent middle-aged cells, but not in fully senescent late passage cells. ECM from young cells improved the appearance, viability, stress tolerance and wound healing ability of skin fibroblasts. Furthermore, young ECM...... modulated the oxidative stress response transcription factor Nrf-2 and its downstream effector haem-oxygenase (HO-1), possibly through the amelioration of the environmental stress induced by the plastic surface of the culturing flasks. Therefore, it is important to consider the role of ECM in modulating...

  12. Acute sex hormone suppression reduces skeletal muscle sympathetic nerve activity.

    Science.gov (United States)

    Day, Danielle S; Gozansky, Wendolyn S; Bell, Christopher; Kohrt, Wendy M

    2011-10-01

    Comparisons of sympathetic nervous system activity (SNA) between young and older women have produced equivocal results, in part due to inadequate control for potential differences in sex hormone concentrations, age, and body composition. The aim of the present study was to determine the effect of a short-term reduction in sex hormones on tonic skeletal muscle sympathetic nerve activity (MSNA), an indirect measure of whole body SNA, using an experimental model of sex hormone deficiency in young women. We also assessed the independent effects of estradiol and progesterone add-back therapy on MSNA. MSNA was measured in 9 women (30±2 years; mean±SE) on three separate occasions: during the mid-luteal menstrual cycle phase, on the fifth day of gonadotropin-releasing hormone antagonist (GnRHant) administration, and after 5 days add-back of either estradiol (n=4) or progesterone (n=3) during continued GnRHant administration. In response to GnRHant, there were significant reductions in serum estradiol and progesterone (both psuppression attenuates MSNA and that this may be related to the suppression of progesterone rather than estradiol.

  13. Skin Conductance Response in ICU patients with various stressors: a case series

    NARCIS (Netherlands)

    Tjan, D.H.T.; Schellaars, R.; Volders, J.; Weda, J.; Johnson, M.T.; Lubberding, M.; Dijk, E.O.; Ouwerkerk, M.; Van Zanten, A.R.H.

    2012-01-01

    Measuring stress levels in the ICU is not well defined and lacks reliable and valid methods of detection. ICU patients experience different kinds of stress like pain, dyspnoea, anxiety and general discomfort. Skin conductance has recently been shown to be a promising physiological indicator of pain

  14. Augmentation of skin response by exposure to a combination of allergens and irritants - a review

    DEFF Research Database (Denmark)

    Pedersen, Line Kynemund; Johansen, Jeanne Duus; Held, Elisabeth

    2004-01-01

    Clinical experimental studies on contact dermatitis (CD) often evaluate the effect of one allergen or one irritant at a time. In real life, the skin is often exposed to more allergens, more irritants or allergens and irritants in combination. This combined exposure may potentially influence irrit...

  15. Surface Lipids as Multifunctional Mediators of Skin Responses to Environmental Stimuli

    Directory of Open Access Journals (Sweden)

    Chiara De Luca

    2010-01-01

    Full Text Available Skin surface lipid (SSL film is a mixture of sebum and keratinocyte membrane lipids, protecting skin from environment. Its composition is unique for the high percentage of long chain fatty acids, and of the polyterpenoid squalene, absent in other human tissues, and in non-human Primates sebum. Here, the still incomplete body of information on SSL as mediators of external chemical, physical, and microbial signals and stressors is revised, focusing on the central event of the continuous oxidative modification induced by the metabolic activity of residential and pathological microbial flora, natural or iatrogenic UV irradiation, exposure to chemicals and cosmetics. Once alpha-tocopherol and ubiquinol-10 antioxidant defences of SSL are overcome, oxidation of squalene and cholesterol gives rise to reactive by-products penetrating deeper into skin layers, to mediate local defensive inflammatory, photo-protective, immune reactions or, at higher concentrations, inducing local but also systemic immune depression, ultimately implicating skin cancerogenesis. Qualitative modifications of SSL represent a pathogenetic sign of diagnostic value in dermatological disorders involving altered sebum production, like pytiriasis versicolor, acne, atopic or seborrheic dermatitis, as well as photo-aging. Achievements of nutriceutical interventions aimed at restoring normal SSL composition and homeostasis are discussed, as feasible therapeutic goals and major means of photo-protection.

  16. Diabetic cardiac autonomic dysfunction. Parasympathetic versus sympathetic

    International Nuclear Information System (INIS)

    Uehara, Akihiko; Kurata, Chinori; Sugi, Toshihiko; Mikami, Tadashi; Shouda, Sakae

    1999-01-01

    Diabetic cardiac autonomic dysfunction often causes lethal arrhythmia and sudden cardiac death. 123 I-Metaiodobenzylguanidine (MIBG) can evaluate cardiac sympathetic dysfunction, and analysis of heart rate variability (HRV) can reflect cardiac parasympathetic activity. We examined whether cardiac parasympathetic dysfunction assessed by HRV may correlate with sympathetic dysfunction assessed by MIBG in diabetic patients. In 24-hour electrocardiography, we analyzed 4 HRV parameters: high-frequency power (HF), HF in the early morning (EMHF), rMSSD and pNN50. MIBG planar images and SPECT were obtained 15 minutes (early) and 150 minutes (late) after injection and the heart washout rate was calculated. The defect score in 9 left ventricular regions was scored on a 4 point scale (0=normal - 3=severe defect). In 20 selected diabetic patients without congestive heart failure, coronary artery disease and renal failure, parasympathetic HRV parameters had a negative correlation with the sum of defect scores (DS) in the late images (R=-0.47 to -0.59, p<0.05) and some parameters had a negative correlation with the washout rate (R=-0.50 to -0.55, p<0.05). In a total of 64 diabetic patients also, these parameters had a negative correlation with late DS (R=-0.28 to -0.35, p<0.05) and early DS (R=-0.27 to -0.32, p<0.05). The progress of diabetic cardiac parasympathetic dysfunction may parallel the sympathetic one. (author)

  17. Early life stress sensitizes the renal and systemic sympathetic system in rats.

    Science.gov (United States)

    Loria, Analia S; Brands, Michael W; Pollock, David M; Pollock, Jennifer S

    2013-08-01

    We hypothesized that maternal separation (MS), an early life stress model, induces a sensitization of the sympathetic system. To test this hypothesis, we evaluated the renal and systemic sympathetic system in 12- to 14-wk-old male control or MS rats with the following parameters: 1) effect of renal denervation on conscious renal filtration capacity, 2) norepinephrine (NE) content in key organs involved in blood pressure control, and 3) acute systemic pressor responses to adrenergic stimulation or ganglion blockade. MS was performed by separating pups from their mothers for 3 h/day from day 2 to 14; controls were nonhandled littermates. Glomerular filtration rate (GFR) was examined in renal denervated (DnX; within 2 wk) or sham rats using I¹²⁵-iothalamate plasma clearance. MS-DnX rats showed significantly increased GFR compared with MS-SHAM rats (3.8 ± 0.4 vs. 2.4 ± 0.2 ml/min, respectively, P renal nerves regulate GFR in MS rats. NE content was significantly increased in organ tissues from MS rats (P renal and systemic sympathetic system. Conscious MS rats displayed a significantly greater increase in mean arterial pressure (MAP) in response to NE (2 μg/kg ip) and a greater reduction in MAP in response to mecamylamine (2 mg/kg ip, P renal and systemic sympathetic system ultimately impairing blood pressure regulation.

  18. Skin Permeation Enhancers and their Effects on Narcotic Transdermal Drug Delivery Systems through Response Surface Experimental Design

    Directory of Open Access Journals (Sweden)

    A. Moghimi

    2014-02-01

    Full Text Available Drug delivery through skin is often obstructed by low permeability of skin towards most drugs; however, such problem would be solved by application of skin penetration enhancers in the formulations. In the present study, a drug in adhesive patch with buprenorphine as active ingredient was prepared. Drug-in-adhesive transdermal drug delivery systems with different chemical penetration enhancers were designed. For this purpose a response-surface experimental design was used. Response surface methodology based on a three-level, three-variable Box–Behnken design was used to evaluate the interactive effects of dependent variables such as: the rate of skin permeation and adhesion properties including peel strength and tack value. The parameters such as drug release and adhesion were used as independent variables. Levulinic acid, lauryl alcohol and Tween 80 were used as penetration enhancers. In order to prepare samples, buprenorphine with constant concentration was incorporated into acrylic pressure sensitive adhesive with carboxylic functionality and this mixture was added to chemical penetration enhancer with different concentrations. The results show that the cumulative amount of drug release in presence of Tween 80 is 462.9 ± 0.006 μg so it is higher than cumulative amount of drug release in presence of levulinic acid (357.9 ± 0.005 μg and lauryl alcohol (269.5 ± 0.001 μg. Results of adhesion properties such as peel strength and tack reveal that using levulinic acid and lauryl alcohol will increase peel strength while Tween 80 will decrease it. Besides, the results show that all these permeation enhancers have increased tack values.

  19. Quantitative Methods for Measuring Repair Rates and Innate-Immune Cell Responses in Wounded Mouse Skin

    Directory of Open Access Journals (Sweden)

    Zhi Li

    2018-02-01

    Full Text Available In skin wounds, innate-immune cells clear up tissue debris and microbial contamination, and also secrete cytokines and other growth factors that impact repair process such as re-epithelialization and wound closure. After injury, there is a rapid influx and efflux of immune cells at wound sites, yet the function of each innate cell population in skin repair is still under investigation. Flow cytometry is a valuable research tool for detecting and quantifying immune cells; however, in mouse back skin, the difficulty in extracting immune cells from small area of skin due to tissue complexity has made cytometric analysis an underutilized tool. In this paper, we provide detailed methods on the digestion of lesion-specific skin without disrupting antigen expression followed by multiplex cell staining that allows for identification of seven innate-immune populations, including rare subsets such as group-3 innate lymphoid cells (ILC3s, by flow-cytometry analysis. Furthermore, when studying the functions of immune cells to tissue repair an important metric to monitor is size of the wound opening. Normal wounds close steadily albeit at non-linear rates, while slow or stalled wound closure can indicate an underlying problem with the repair process. Calliper measurements are difficult and time-consuming to obtain and can require repeated sedation of experimental animals. We provide advanced methods for measuring of wound openness; digital 3D image capture and semi-automated image processing that allows for unbiased, reliable measurements that can be taken repeatedly over time.

  20. Sympathetic nerve-derived ATP regulates renal medullary blood flow via vasa recta pericytes

    Directory of Open Access Journals (Sweden)

    Scott S Wildman

    2013-10-01

    Full Text Available Pericyte cells are now known to be a novel locus of blood flow control, being able to regulate capillary diameter via their unique morphology and expression of contractile proteins. We have previously shown that exogenous ATP causes constriction of vasa recta via renal pericytes, acting at a variety of membrane bound P2 receptors on descending vasa recta, and therefore may be able to regulate medullary blood flow (MBF. Regulation of MBF is essential for appropriate urine concentration and providing essential oxygen and nutrients to this region of high, and variable, metabolic demand. Various sources of endogenous ATP have been proposed, including from epithelial, endothelial and red blood cells in response to stimuli such as mechanical stimulation, local acidosis, hypoxia, and exposure to various hormones. Extensive sympathetic innervation of the nephron has previously been shown, however the innervation reported has focused around the proximal and distal tubules, and ascending loop of Henle. We hypothesise that sympathetic nerves are an additional source of ATP acting at renal pericytes and therefore regulate MBF. Using a rat live kidney slice model in combination with video imaging and confocal microscopy techniques we firstly show sympathetic nerves in close proximity to vasa recta pericytes in both the outer and inner medulla. Secondly, we demonstrate pharmacological stimulation of sympathetic nerves in situ (by tyramine evokes pericyte-mediated vasoconstriction of vasa recta capillaries; inhibited by the application of the P2 receptor antagonist suramin. Lastly, tyramine-evoked vasoconstriction of vasa recta by pericytes is significantly less than ATP-evoked vasoconstriction. Sympathetic innervation may provide an additional level of functional regulation in the renal medulla that is highly localized. It now needs to be determined under which physiological/pathophysiological circumstances that sympathetic innervation of renal pericytes is

  1. Physiological Responses to Thermal Stress and Exercise

    Science.gov (United States)

    Iyota, Hiroyuki; Ohya, Akira; Yamagata, Junko; Suzuki, Takashi; Miyagawa, Toshiaki; Kawabata, Takashi

    The simple and noninvasive measuring methods of bioinstrumentation in humans is required for optimization of air conditioning and management of thermal environments, taking into consideration the individual specificity of the human body as well as the stress conditions affecting each. Changes in human blood circulation were induced with environmental factors such as heat, cold, exercise, mental stress, and so on. In this study, the physiological responses of human body to heat stress and exercise were investigated in the initial phase of the developmental research. We measured the body core and skin temperatures, skin blood flow, and pulse wave as the indices of the adaptation of the cardiovascular system. A laser Doppler skin blood flowmetry using an optical-sensor with a small portable data logger was employed for the measurement. These results reveal the heat-stress and exercise-induced circulatory responses, which are under the control of the sympathetic nerve system. Furthermore, it was suggested that the activity of the sympathetic nervous system could be evaluated from the signals of the pulse wave included in the signals derived from skin blood flow by means of heart rate variability assessments and detecting peak heights of velocity-plethysmogram.

  2. The acute effects of alpha and beta irradiation of mouse skin and the factors affecting the response

    International Nuclear Information System (INIS)

    Needham, S.G.; Coggle, J.E.

    1991-01-01

    Several problems regarding acute effects of alpha and beta irradiation were investigated in order to clarify protection problems of localised doses to the skin. A study into the acute biological effects of different energy beta emitters and the effects of energy and area on the response showed direct relationships between these criteria for a range of different acute responses with different time courses. Three different types of acute response were found and these are described as 'moist desquamation', 'acute ulceration' and 'acute epidermal necrosis'. An unexpected finding was that the lower energy beta emitter 170 Tm was as efficient at inducing scab formation as the higher energy 90 Sr sources for the same area of exposure. Experiments using 2x4 cm 2 exposures to 224 Cm alpha particles showed that the response to this poorly penetrating radiation was minimal after doses as high as 180 Gy measured at 10 μm into the skin. In comparison, large area exposure to 170 Tm produced areas of prolonged scabbing after doses up to 100 Gy. However, the intensity of the reaction varied between strains. (author)

  3. The response of human skin commensal bacteria as a reflection of UV radiation: UV-B decreases porphyrin production.

    Directory of Open Access Journals (Sweden)

    Yanhan Wang

    Full Text Available Recent global radiation fears reflect the urgent need for a new modality that can simply determine if people are in a radiation risk of developing cancer and other illnesses. Ultraviolet (UV radiation has been thought to be the major risk factor for most skin cancers. Although various biomarkers derived from the responses of human cells have been revealed, detection of these biomarkers is cumbersome, probably requires taking live human tissues, and varies significantly depending on human immune status. Here we hypothesize that the reaction of Propionibacterium acnes (P. acnes, a human resident skin commensal, to UV radiation can serve as early surrogate markers for radiation risk because the bacteria are immediately responsive to radiation. In addition, the bacteria can be readily accessible and exposed to the same field of radiation as human body. To test our hypothesis, P. acnes was exposed to UV-B radiation. The production of porphyrins in P. acnes was significantly reduced with increasing doses of UV-B. The porphyrin reduction can be detected in both P. acnes and human skin bacterial isolates. Exposure of UV-B to P. acnes- inoculated mice led to a significant decrease in porphyrin production in a single colony of P. acnes and simultaneously induced the formation of cyclobutane pyrimidine dimers (CPD in the epidermal layers of mouse skin. Mass spectrometric analysis via a linear trap quadrupole (LTQ-Orbitrap XL showed that five peptides including an internal peptide (THLPTGIVVSCQNER of a peptide chain release factor 2 (RF2 were oxidized by UV-B. Seven peptides including three internal peptides of 60 kDa chaperonin 1 were de-oxidized by UV-B. When compared to UV-B, gamma radiation also decreased the porphyrin production of P. acnes in a dose-dependent manner, but induced a different signature of protein oxidation/de-oxidation. We highlight that uncovering response of skin microbiome to radiation will facilitate the development of pre

  4. The response of human skin commensal bacteria as a reflection of UV radiation: UV-B decreases porphyrin production.

    Science.gov (United States)

    Wang, Yanhan; Zhu, Wenhong; Shu, Muya; Jiang, Yong; Gallo, Richard L; Liu, Yu-Tsueng; Huang, Chun-Ming

    2012-01-01

    Recent global radiation fears reflect the urgent need for a new modality that can simply determine if people are in a radiation risk of developing cancer and other illnesses. Ultraviolet (UV) radiation has been thought to be the major risk factor for most skin cancers. Although various biomarkers derived from the responses of human cells have been revealed, detection of these biomarkers is cumbersome, probably requires taking live human tissues, and varies significantly depending on human immune status. Here we hypothesize that the reaction of Propionibacterium acnes (P. acnes), a human resident skin commensal, to UV radiation can serve as early surrogate markers for radiation risk because the bacteria are immediately responsive to radiation. In addition, the bacteria can be readily accessible and exposed to the same field of radiation as human body. To test our hypothesis, P. acnes was exposed to UV-B radiation. The production of porphyrins in P. acnes was significantly reduced with increasing doses of UV-B. The porphyrin reduction can be detected in both P. acnes and human skin bacterial isolates. Exposure of UV-B to P. acnes- inoculated mice led to a significant decrease in porphyrin production in a single colony of P. acnes and simultaneously induced the formation of cyclobutane pyrimidine dimers (CPD) in the epidermal layers of mouse skin. Mass spectrometric analysis via a linear trap quadrupole (LTQ)-Orbitrap XL showed that five peptides including an internal peptide (THLPTGIVVSCQNER) of a peptide chain release factor 2 (RF2) were oxidized by UV-B. Seven peptides including three internal peptides of 60 kDa chaperonin 1 were de-oxidized by UV-B. When compared to UV-B, gamma radiation also decreased the porphyrin production of P. acnes in a dose-dependent manner, but induced a different signature of protein oxidation/de-oxidation. We highlight that uncovering response of skin microbiome to radiation will facilitate the development of pre-symptomatic diagnosis

  5. Skin barrier response to occlusion of healthy and irritated skin: Differences in trans-epidermal water loss, erythema and stratum corneum lipids

    DEFF Research Database (Denmark)

    Jungersted, J.M.; Høgh, Julie Kaae; Hellgren, Lars

    2010-01-01

    been damaged by either sodium lauryl sulfate (SLS) or tape stripping, respectively, was determined and compared with that of to non-occluded pre-damaged skin. Skin barrier function was assessed by measurements of trans-epidermal water loss (TEWL) and erythema. In study A, stratum corneum lipids were...

  6. Skin Diseases: Skin Health and Skin Diseases

    Science.gov (United States)

    Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Skin Health and Skin Diseases Past Issues / Fall 2008 Table of Contents ... acne to wrinkles Did you know that your skin is the largest organ of your body? It ...

  7. Cold-induced vasoconstriction at forearm and hand skin sites: the effect of age.

    Science.gov (United States)

    Kingma, B R M; Frijns, A J H; Saris, W H M; van Steenhoven, A A; van Marken Lichtenbelt, W D

    2010-07-01

    During mild cold exposure, elderly are at risk of hypothermia. In humans, glabrous skin at the hands is well adapted as a heat exchanger. Evidence exists that elderly show equal vasoconstriction due to local cooling at the ventral forearm, yet no age effects on vasoconstriction at hand skin have been studied. Here, we tested the hypotheses that at hand sites (a) elderly show equal vasoconstriction due to local cooling and (b) elderly show reduced response to noradrenergic stimuli. Skin perfusion and mean arterial pressure were measured in 16 young adults (Y: 18-28 years) and 16 elderly (E: 68-78 years). To study the effect of local vasoconstriction mechanisms local sympathetic nerve terminals were blocked by bretylium (BR). Baseline local skin temperature was clamped at 33 degrees C. Next, local temperature was reduced to 24 degrees C. After 15 min of local cooling, noradrenaline (NA) was administered to study the effect of neural vasoconstriction mechanisms. No significant age effect was observed in vasoconstriction due to local cooling at BR sites. After NA, vasoconstriction at the forearm showed a significant age effect; however, no significant age effect was found at the hand sites. [Change in CVC (% from baseline): Forearm Y: -76 +/- 3 vs. E: -60 +/- 5 (P forearm, elderly did not show a blunted response to local cooling and noradrenaline at hand skin sites. This indicates that at hand skin the noradrenergic mechanism of vasoconstriction is maintained with age.

  8. Fluoxetine ameliorates atopic dermatitis-like skin lesions in BALB/c mice through reducing psychological stress and inflammatory response

    Directory of Open Access Journals (Sweden)

    Yanxi Li

    2016-09-01

    Full Text Available Atopic dermatitis (AD is a common chronic inflammatory skin disorder, and patients with AD suffer from severe psychological stress, which markedly increases the prevalence rate of depression and anxiety disorders in later life. Fluoxetine, a selective serotonin reuptake inhibitor, has recently been reported to exert anti-inflammatory and immunosuppressive effects. However, it is unclear whether fluoxetine is effective in the treatment of AD through reducing psychological stress and inflammatory reaction. Here, we reported that a BALB/c mouse model of AD was induced by application of 2,4‑dinitrochlorobenzene (DNCB onto hairless dorsal skin. Chronic fluoxetine treatment (10 mg/kg per day, i.p. significantly attenuated AD-like symptoms, as reflected by a dramatic decrease in scratching bouts, as well as a decrease in anxiety- and depressive-like behaviors. Furthermore, these behavioral changes were accompanied by a significant decrease in epidermal thickness, the number of mast cells in skin tissue, mRNA levels of interleukin-4 (IL-4 and IL-13 in the spleen, as well as serum immunoglobulin E (IgE in the DNCB-treated mice by treatment with fluoxetine. Taken together, these results indicate that fluoxetine may suppress psychological stress and inflammatory response during AD development, and subsequently ameliorate AD symptoms, suggesting that fluoxetine may be a potential therapeutic agent against AD in clinic.

  9. Transdermal glyceryl trinitrate (nitroglycerin in healthy persons: acute effects on skin temperature and hemodynamic orthostatic response

    Directory of Open Access Journals (Sweden)

    Eva Maria Augusta Boeckh Haebisch

    Full Text Available In order to find an explanation for individual reactions to transdermal glyceryl trinitrate (GTN we studied the skin temperature and hemodynamic reactions in 63 healthy persons. The data were obtained before and after the application of GTN and Glycerin (GL placebo patches, during one hour. The skin temperature was measured on both forearms, the local (left sided and systemic (right sided reaction on GTN was related to the skin fold and the calculated body fat content. The bilateral rise of skin temperature and its duration was higher and longer in obese than in lean persons mainly in obese women. The UV induced thermo and the later photothermoreaction (Erythema was reduced on the left forearm after the application of GTN and GL patches. The observed hemodynamic GTN effect confirmed known postural reactions, such as decreased arterial pressure (ΔmAP = -2.9%, increased heart rate (ΔHR = +7,4% and QTc prolongation (ΔQTc = +4,9% in upright position. An adverse drug effect with increased mean blood pressure (ΔmAP = +12% and increased heart rate (ΔHR = + 10.4% mainly in supine position was observed in 11 % of the participants, but only in men. Such a reaction was already described by Murell, 1879. Individual GTN effects were analyzed and related to habits and family history. In male smokers and in persons with hypertensive and diabetic close relatives, the hypotensive GTN effect was accentuated in supine position. In the upright position the group with hypertensives in the family presented a moderate hypotensive reaction without secondary tachycardia and the smokers presented only a slightly increased heart rate. Our observations suggest that individual reactions to transdermal glyceryl trinitrate (GTN with its active component nitric oxide (NO depends on physiological conditions, related to endogenous vasoactive substances, mainly the interaction with EDRF (the endogenous NO and the activity of the Renin-Angiotensin System.

  10. From membrane to skin: aqueous permeation control through light-responsive amphiphilic polymer co-networks

    Czech Academy of Sciences Publication Activity Database

    Schöller, K.; Küpfer, S.; Baumann, L.; Hoyer, P.M.; de Courten, D.; Rossi, R.M.; Vetushka, Aliaksi; Wolf, M.; Bruns, N.; Scherer, L.J.

    2014-01-01

    Roč. 24, č. 33 (2014), s. 5194-5201 ISSN 1616-301X R&D Projects: GA ČR GB14-37427G; GA MŠk(CZ) LM2011026 Institutional support: RVO:68378271 Keywords : transdermal drug-delivery * porcine ear skin * in-vitro * surface modification Subject RIV: JI - Composite Materials Impact factor: 11.805, year: 2014

  11. Renal sympathetic denervation attenuates hypertension and vascular remodeling in renovascular hypertensive rats.

    Science.gov (United States)

    Li, Peng; Huang, Pei-Pei; Yang, Yun; Liu, Chi; Lu, Yan; Wang, Fang; Sun, Wei; Kong, Xiang-Qing

    2017-01-01

    Li P, Huang P, Yang Y, Liu C, Lu Y, Wang F, Sun W, Kong X. Renal sympathetic denervation attenuates hypertension and vascular remodeling in renovascular hypertensive rats. J Appl Physiol 122: 121-129, 2017. First published October 14, 2016; doi:10.1152/japplphysiol.01019.2015-Sympathetic activity is enhanced in patients with essential or secondary hypertension, as well as in various hypertensive animal models. Therapeutic targeting of sympathetic activation is considered an effective antihypertensive strategy. We hypothesized that renal sympathetic denervation (RSD) attenuates hypertension and improves vascular remodeling and renal disease in the 2-kidney, 1-clip (2K1C) rat model. Rats underwent 2K1C modeling or sham surgery; then rats underwent RSD or sham surgery 4 wk later, thus resulting in four groups (normotensive-sham, normotensive-RSD, 2K1C-sham, and 2K1C-RSD). Norepinephrine was measured by ELISA. Echocardiography was used to assess heart function. Fibrosis and apoptosis were assessed by Masson and TUNEL staining. Changes in mean arterial blood pressure in response to hexamethonium and plasma norepinephrine levels were used to evaluate basal sympathetic nerve activity. The 2K1C modeling success rate was 86.8%. RSD reversed the elevated systolic blood pressure induced by 2K1C, but had no effect on body weight. Compared with rats in the 2K1C-sham group, rats in the 2K1C-RSD group showed lower left ventricular mass/body weight ratio, interventricular septal thickness in diastole, left ventricular end-systolic diameter, and left ventricular posterior wall thickness in systole, whereas fractional shortening and ejection fraction were higher. Right kidney apoptosis and left kidney hypertrophy were not changed by RSD. Arterial fibrosis was lower in animals in the 2K1C-RSD group compared with those in the 2K1C-sham group. RSD reduced plasma norepinephrine and basal sympathetic activity in rats in the 2K1C-RSD group compared with rats in the 2K1C-sham group. These

  12. Chronic renin inhibition lowers blood pressure and reduces upright muscle sympathetic nerve activity in hypertensive seniors

    Science.gov (United States)

    Okada, Yoshiyuki; Jarvis, Sara S; Best, Stuart A; Bivens, Tiffany B; Adams-Huet, Beverley; Levine, Benjamin D; Fu, Qi

    2013-01-01

    Cardiovascular risk remains high in patients with hypertension even with adequate blood pressure (BP) control. One possible mechanism may be sympathetic activation via the baroreflex. We tested the hypothesis that chronic inhibition of renin reduces BP without sympathetic activation, but diuresis augments sympathetic activity in elderly hypertensives. Fourteen patients with stage-I hypertension (66 ± 5 (SD) years) were treated with a direct renin inhibitor, aliskiren (n= 7), or a diuretic, hydrochlorothiazide (n= 7), for 6 months. Muscle sympathetic nerve activity (MSNA), BP, direct renin and aldosterone were measured during supine and a graded head-up tilt (HUT; 5 min 30° and 20 min 60°), before and after treatment. Sympathetic baroreflex sensitivity (BRS) was assessed. Both groups had similar BP reductions after treatment (all P < 0.01), while MSNA responses were different between hydrochlorothiazide and aliskiren (P= 0.006 pre/post × drug). Both supine and upright MSNA became greater after hydrochlorothiazide treatment (supine, 72 ± 18 post vs. 64 ± 15 bursts (100 beats)−1 pre; 60° HUT, 83 ± 10 vs. 78 ± 13 bursts (100 beats)−1; P= 0.002). After aliskiren treatment, supine MSNA remained unchanged (69 ± 13 vs. 64 ± 8 bursts (100 beats)−1), but upright MSNA was lower (74 ± 15 vs. 85 ± 10 bursts (100 beats)−1; P= 0.012 for pre/post × posture). Direct renin was greater after both treatments (both P < 0.05), while upright aldosterone was greater after hydrochlorothiazide only (P= 0.002). The change in upright MSNA by the treatment was correlated with the change of aldosterone (r= 0.74, P= 0.002). Upright sympathetic BRS remained unchanged after either treatment. Thus, chronic renin inhibition may reduce upright MSNA through suppressed renin activity, while diuresis may evoke sympathetic activation via the upregulated renin–angiotensin–aldosterone system, without changing intrinsic sympathetic baroreflex function in elderly hypertensive

  13. Responses to hyperthermia. Optimizing heat dissipation by convection and evaporation: Neural control of skin blood flow and sweating in humans.

    Science.gov (United States)

    Smith, Caroline J; Johnson, John M

    2016-04-01

    Under normothermic, resting conditions, humans dissipate heat from the body at a rate approximately equal to heat production. Small discrepancies between heat production and heat elimination would, over time, lead to significant changes in heat storage and body temperature. When heat production or environmental temperature is high the challenge of maintaining heat balance is much greater. This matching of heat elimination with heat production is a function of the skin circulation facilitating heat transport to the body surface and sweating, enabling evaporative heat loss. These processes are manifestations of the autonomic control of cutaneous vasomotor and sudomotor functions and form the basis of this review. We focus on these systems in the responses to hyperthermia. In particular, the cutaneous vascular responses to heat stress and the current understanding of the neurovascular mechanisms involved. The available research regarding cutaneous active vasodilation and vasoconstriction is highlighted, with emphasis on active vasodilation as a major responder to heat stress. Involvement of the vasoconstrictor and active vasodilator controls of the skin circulation in the context of heat stress and nonthermoregulatory reflexes (blood pressure, exercise) are also considered. Autonomic involvement in the cutaneous vascular responses to direct heating and cooling of the skin are also discussed. We examine the autonomic control of sweating, including cholinergic and noncholinergic mechanisms, the local control of sweating, thermoregulatory and nonthermoregulatory reflex control and the possible relationship between sudomotor and cutaneous vasodilator function. Finally, we comment on the clinical relevance of these control schemes in conditions of autonomic dysfunction. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Comparison of thermal and hemodynamic responses in skin and muscles to heating with electric and magnetic field

    Directory of Open Access Journals (Sweden)

    Karmen Glažar

    2015-06-01

    Full Text Available 12.00 Introduction: It has been shown that sufficient amount of energy provided by electromagnetic diathermy induces the increase of skin temperature and underlying tissues. However, scarce information is available on the differences in responses initiated by various techniques of diathermy. The goal of the present study was to compare thermal and hemodynamic responses of the skin and underlying muscles of the forearm to diathermy applied with electric (EF or magnetic field (MF. Methods: Eleven healthy volunteers participated in the study. On two separate occasions, they randomly received 20-minut diathermy with EF or with MF. Skin and tympanic temperature, and heart rate were measured. Further, kinetics of muscle oxyhemoglobin and deoxyhemoglobin kinetics were obtained. Thermal perception and thermal comfort were noted through the application of EF and MF. Results: The skin temperature increased similarly during the administration of EF and MF, by ~ 8.0 ± 1.3°C on both occasions. The thermal perception was more intense during the application of EF. Accordingly, the thermal comfort during the application of EF was perceived as less comfortable as compared with MF. During MF the increase in minute muscle blood flow and oxygen consumption was for ~ 42 % higher compared to the heating with EF. Conclusion: Although the increase in skin temperature was similar between EF and MF, the application of diathermy with MF was perceived more comfortable by the participants. Furthermore, the increase in minute muscle blood flow and oxygen consumption was higher in MF compared with EF. Thus, when muscle is the target tissue for physical therapy, a diathermy with magnetic field is the technique of choice. Normal 0 21 false false false SL X-NONE X-NONE /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Navadna tabela"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso

  15. Assessment of skin barrier function and biochemical changes of ex vivo human skin in response to physical and chemical barrier disruption.

    Science.gov (United States)

    Döge, Nadine; Avetisyan, Araks; Hadam, Sabrina; Pfannes, Eva Katharina Barbosa; Rancan, Fiorenza; Blume-Peytavi, Ulrike; Vogt, Annika

    2017-07-01

    Topical dermatotherapy is intended to be used on diseased skin. Novel drug delivery systems even address differences between intact and diseased skin underlining the need for pre-clinical assessment of different states of barrier disruption. Herein, we studied how short-term incubation in culture media compared to incubation in humidified chambers affects human skin barrier function and viability. On both models we assessed different types and intensities of physical and chemical barrier disruption methods with regard to structural integrity, biophysical parameters and cytokine levels. Tissue degeneration and proliferative activity limited the use of tissue cultures to 48h. Viability is better preserved in cultured tissue. Tape-stripping (50×TS) and 4h sodium lauryl sulfate (SLS) pre-treatment were identified as highly reproducible and effective procedures for barrier disruption. Transepidermal water loss (TEWL) values reproducibly increased with the intensity of disruption while sebum content and skin surface pH were of limited value. Interleukin (IL)-6/8 and various chemokines and proteases were increased in tape-stripped skin which was more pronounced in SLS-treated skin tissue extracts. Thus, albeit limited to 48h, cultured full-thickness skin maintained several barrier characteristics and responded to different intensities of barrier disruption. Potentially, these models can be used to assess pre-clinically the efficacy and penetration of anti-inflammatory compounds. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Analysis and Modeling of the Galvanic Skin Response Spontaneous Component in the context of Intelligent Biofeedback Systems Development

    Science.gov (United States)

    Unakafov, A.

    2009-01-01

    The paper presents an approach to galvanic skin response (GSR) spontaneous component analysis and modeling. In the study a classification of biofeedback training methods is given, importance of intelligent methods development is shown. The INTENS method, which is perspective for intellectualization, is presented. An important problem of biofeedback training method intellectualization - estimation of the GSR spontaneous component - is solved in the main part of the work. Its main characteristics are described; results of GSR spontaneous component modeling are shown. Results of small research of an optimum material for GSR probes are presented.

  17. Renal sympathetic denervation for resistant hypertension.

    Science.gov (United States)

    Froeschl, Michael; Hadziomerovic, Adnan; Ruzicka, Marcel

    2013-05-01

    Resistant hypertension is an increasingly prevalent health problem associated with important adverse cardiovascular outcomes. The pathophysiology that underlies this condition involves increased function of both the sympathetic nervous system and the renin-angiotensin II-aldosterone system. A crucial link between these 2 systems is the web of sympathetic fibres that course within the adventitia of the renal arteries. These nerves can be targeted by applying radiofrequency energy from the lumen of the renal arteries to renal artery walls (percutaneous renal sympathetic denervation [RSD]), an approach that has attracted great interest. This paper critically reviews the evidence supporting the use of RSD. Small studies suggest that RSD can produce dramatic blood pressure reductions: In the randomized Symplicity HTN-2 trial of 106 patients, the mean fall in blood pressure at 6 months in patients who received the treatment was 32/12 mm Hg. However, there are limitations to the evidence for RSD in the treatment of resistant hypertension. These include the small number of patients studied; the lack of any placebo-controlled evidence; the fact that blood pressure outcomes were based on office assessments, as opposed to 24-hour ambulatory monitoring; the lack of longer-term efficacy data; and the lack of long-term safety data. Some of these concerns are being addressed in the ongoing Renal Denervation in Patients With Uncontrolled Hypertension (Symplicity HTN-3) trial. The first percutaneous RSD system was approved by Health Canada in the spring of 2012. But until more and better-quality data are available, this procedure should generally be reserved for those patients whose resistant hypertension is truly uncontrolled. Copyright © 2013 Canadian Cardiovascular Society. Published by Elsevier Inc. All rights reserved.

  18. Differential immune response of congenic mice to ultraviolet-treated major histocompatibility complex class II-incompatible skin grafts

    International Nuclear Information System (INIS)

    Vermeer, B.J.; Santerse, B.; Van De Kerckhove, B.A.; Schothorst, A.A.; Claas, F.H.

    1988-01-01

    The influence of ultraviolet (UVB) irradiation on the survival of H-2 class II-disparate skin grafts was studied in congenic mouse strains. Isolated skin was UVB irradiated in vitro at a dose of 40 mJ/cm 2 from both sides to remove Ia immunogenicity. Immediately after irradiation the skin was transplanted onto the flank of allogeneic mice. When B10.AQR grafts were transplanted onto B10.T(6R) recipients, a significant prolongation of the survival time was observed, while 50% of the UVB-treated grafts were not rejected at all. However, in the opposite direction--i.e., B10.T(6R) grafts onto B10.AQR recipients, no significant prolongation of the survival was observed. To test whether this effect was due to a difference in susceptibility of the donor skin to UVB irradiation or to a different immune response in the recipients, (B10.T(6R) x B10.AQR) grafts were transplanted onto the parent strains. Similar results were obtained, in that UVB-treated grafts did not show a prolonged survival in B10.AQR recipients, whereas a significant prolongation (50% of the grafts survived more than 100 days) was observed in B10.T(6R) recipients. UVB-treated (B10.T(6R) x B10.AQR)F1 grafts were also transplanted onto (B10.T(6R) x C57B1/10)F1, (B10.AQR x C57B1/10)F1, (B10.T(6R) x Balb/c)F1 and (B10.AQR x Balb/c)F1 recipients--but in none of these combinations was a prolonged survival time observed. These data suggest that, in contrast to all in vitro experiments, the abrogation of the immune response by UVB treatment of the stimulator cells is, in vivo, not a general phenomenon. The genetic constitution of the responder mice seems to play an important role in determining whether or not an immune response takes place

  19. "Head versus heart": Effect of monetary frames on expression of sympathetic magical concerns

    OpenAIRE

    Paul Rozin; Heidi Grant; Stephanie Weinberg; Scott Parker

    2007-01-01

    Most American respondents give ``irrational,'' magical responses in a variety of situations that exemplify the sympathetic magical laws of similarity and contagion. In most of these cases, respondents are aware that their responses (usually rejections, as of fudge crafted to look like dog feces, or a food touched by a sterilized, dead cockroach) are not ``scientifically'' justified, but they are willing to avow them. We interpret this, in some sense, as ``heart over head.'' We report in this ...

  20. Implicit Recognition of Familiar and Unfamiliar Faces in Schizophrenia: A Study of the Skin Conductance Response in Familiarity Disorders

    Directory of Open Access Journals (Sweden)

    Aurely Ameller

    2017-09-01

    Full Text Available ObjectiveFamiliarity is a subjective sensation that contributes to person recognition. This process is described as an emotion-based memory-trace of previous meetings and could be disrupted in schizophrenia. Consequently, familiarity disorders could be involved in the impaired social interactions observed in patients with schizophrenia. Previous studies have primarily focused on famous people recognition. Our aim was to identify underlying features, such as emotional disturbances, that may contribute to familiarity disorders in schizophrenia. We hypothesize that patients with familiarity disorders will exhibit a lack of familiarity that could be detected by a flattened skin conductance response (SCR.MethodThe SCR was recorded to test the hypothesis that emotional reactivity disturbances occur in patients with schizophrenia during the categorization of specific familiar, famous and unknown faces as male or female. Forty-eight subjects were divided into the following 3 matched groups with 16 subjects per group: control subjects, schizophrenic people with familiarity disorder, and schizophrenic people without familiarity disorders.ResultsEmotional arousal is reflected by the skin conductance measures. The control subjects and the patients without familiarity disorders experienced a differential emotional response to the specific familiar faces compared with that to the unknown faces. Nevertheless, overall, the schizophrenic patients without familiarity disorders showed a weaker response across conditions compared with the control subjects. In contrast, the patients with familiarity disorders did not show any significant differences in their emotional response to the faces, regardless of the condition.ConclusionOnly patients with familiarity disorders fail to exhibit a difference in emotional response between familiar and non-familiar faces. These patients likely emotionally process familiar faces similarly to unknown faces. Hence, the lower

  1. In vitro assessment of skin irritation potential of surfactant-based formulations by using a 3-D skin reconstructed tissue model and cytokine response.

    Science.gov (United States)

    Walters, Russel M; Gandolfi, Lisa; Mack, M Catherine; Fevola, Michael; Martin, Katharine; Hamilton, Mathew T; Hilberer, Allison; Barnes, Nicole; Wilt, Nathan; Nash, Jennifer R; Raabe, Hans A; Costin, Gertrude-Emilia

    2016-12-01

    The personal care industry is focused on developing safe, more efficacious, and increasingly milder products, that are routinely undergoing preclinical and clinical testing before becoming available for consumer use on skin. In vitro systems based on skin reconstructed equivalents are now established for the preclinical assessment of product irritation potential and as alternative testing methods to the classic Draize rabbit skin irritation test. We have used the 3-D EpiDerm™ model system to evaluate tissue viability and primary cytokine interleukin-1α release as a way to evaluate the potential dermal irritation of 224 non-ionic, amphoteric and/or anionic surfactant-containing formulations, or individual raw materials. As part of our testing programme, two representative benchmark materials with known clinical skin irritation potential were qualified through repeated testing, for use as references for the skin irritation evaluation of formulations containing new surfactant ingredients. We have established a correlation between the in vitro screening approach and clinical testing, and are continually expanding our database to enhance this correlation. This testing programme integrates the efforts of global manufacturers of personal care products that focus on the development of increasingly milder formulations to be applied to the skin, without the use of animal testing. 2016 FRAME.

  2. Comparison of Tuberculin Skin Test result and interferon gamma response to human PPD in BCG scar positive and negative children.

    Science.gov (United States)

    Sayyahfar, Shirin; Karimi, Abdollah; Fahimzad, Alireza; Shamshiri, Ahmad Reza

    2014-03-01

    The aim of this study is to compare Tuberculin Skin Test (TST) result and interferon gamma response to human PPD (purified protein derivative), in scar positive and scar negative BCG-vaccinated children. Between August 2007 and May 2008 a total of 236 children aged 1-168 months (mean 21 months) admitted to Mofid Children's Hospital, Tehran, Iran, were enrolled in a cross-sectional study. Each patient was examined for BCG vaccine scar and tested with TST and human PPD-based Interferon Gamma Release Assay (IGRA). Two hundred and twenty one cases out of 236 (44% female, 1-168 months, mean age 21 months) were scar positive of whom 95% TST result was negative. Human PPD-based IGRA was positive in 110 (49.8%), negative in 85 (38.4 %) and indeterminate in 26 (11.8%) of scar positive patients. Fifteen children (40% female, 1-156 months; mean age 42 months) were scar negative. All the scar negative cases were TST negative. Human PPD-based IGRA was positive in 10 (66.7%), negative in 4 (26.7%) and indeterminate in 1 (6.7%) of scar negative patients. Immune responsiveness to human PPD antigens in scar positive and negative children may not correspond with results of the Tuberculin Skin Test. Copyright © 2013 Ministry of Health, Saudi Arabia. Published by Elsevier Ltd. All rights reserved.

  3. Effects of CO2 laser irradiation on the wettability and human skin fibroblast cell response of magnesia partially stabilised zirconia

    International Nuclear Information System (INIS)

    Hao, L.; Lawrence, J.

    2003-01-01

    Human skin fibroblast cells in vitro responses on the surface of a bioinert zirconia ceramic partially stabilised with magnesia partially stabilised zirconia (MgO-PSZ) bioinert ceramic before and after CO 2 laser treatment were investigated to find the interrelationship between the cell adhesion, wettability and laser parameters. Contact angle, θ, measurements of a set of test liquids were a clear indication that surface treatment of the MgO-PSZ with a CO 2 laser brought about a reduction in θ, indicating that the wettability of the MgO-PSZ had been enhanced. A relationship was found between the wettability and the microstructure of the MgO-PSZ surface and laser processing parameters. It was subsequently deduced that the factors active in causing the observed modification in the wettability of the MgO-PSZ were the increases in the surface O 2 content and the polar component of the surface energy, γ sv p , the latter resulting from surface melting and resolidification. Moreover, the investigation into the human skin fibroblast cell response revealed that the CO 2 laser treatment of the MgO-PSZ had resulted in a surface favourable for cell adhesion, as the extent of cell attachment and adhesion on the MgO-PSZ surface was enhanced depending on laser parameters. Such an improvement in cell adhesion, which could be greatly beneficial to developing enhanced bonding at the tissue and implant interface, was influenced by the surface properties of the modified MgO-PSZ, particular wettability

  4. Heterogeneous response to X-ray and ultraviolet light irradiations of cultured skin fibroblasts in two families with Gardner's Syndrome

    International Nuclear Information System (INIS)

    Kinsella, T.J.; Little, J.B.; Nove, J.; Weichselbaum, R.R.; Li, F.P.; Meyer, R.J.; Marchetto, D.J.; Patterson, W.B.

    1982-01-01

    A heterogeneous response to X-ray and far UV (254 nm) light irradiations was found in cultured skin fibroblast lines from 2 separate families with Gardner's syndrome. When compared to 2 normal control cultures and cultures from 2 patients with nonfamilial colon cancer, cultures from 4 clinically affected members of family 1 showed increased sensitivity to the lethal effects of both X-ray and UV light irradiations. These cells also showed a delayed pattern of X-ray potentially lethal damage repair (PLDR) and absent UV PLDR. In contrast, cultures from 3 members of family 2 (2 of whom were clinically affected) showed a normal response of survival and PLDR to both X-ray and UV light irradiations. Thus increased sensitivity of cultured skin fibroblasts to X-ray and UV light irradiations was not a consistent in vitro finding in patients with Gardner's syndrome. However, in families with Gardner's syndrome who demonstrate in vitro radiosensitivity, additional studies are needed to assess the usefulness of these techniques in detecting affected individuals prior to the development of colon carcinoma and other manifestations

  5. Adolescent sympathetic activity and salivary C-reactive protein: The effects of parental behavior.

    Science.gov (United States)

    Nelson, Benjamin W; Byrne, Michelle L; Simmons, Julian G; Whittle, Sarah; Schwartz, Orli S; Reynolds, Eric C; O'Brien-Simpson, Neil M; Sheeber, Lisa; Allen, Nicholas B

    2017-10-01

    This study utilized a novel multisystem approach to investigate the effect of observed parental behavior on the relationship between biological mechanisms associated with disease processes (i.e., autonomic physiology and immune response) among their adolescent children. Thirty-three adolescents (23 males), aged 11-13, and their parents participated in a laboratory session in which adolescents provided baseline measures of autonomic (sympathetic) activity, and adolescents and 1 parent participated in a laboratory based dyadic conflict resolution interaction task. This included 3 male parent/male adolescent dyads, 20 female parent/male adolescent dyads, 3 male parent/female adolescent dyads, and 7 female parent/female adolescent dyads. Approximately 3 years later, adolescents provided a salivary measure of C-Reactive Protein (sCRP) to index inflammation. Analyses revealed a positive association between sympathetic activity and sCRP, as well as a moderating role of positive parental behavior in this relationship, such that the association between sympathetic activity and sCRP was greater among adolescents whose parents displayed shorter duration of positive affect. Overall findings indicate parental behavior may influence the association between adolescent sympathetic activity and inflammatory processes. These findings have important implications for understanding the impact of psychosocial factors on biological mechanisms of disease. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  6. Mechanisms of sympathetic activation and blood pressure elevation by intermittent hypoxia.

    Science.gov (United States)

    Prabhakar, Nanduri R; Kumar, Ganesh K

    2010-11-30

    Sleep disordered breathing with recurrent apneas is one of the most frequently encountered breathing disorder in adult humans and preterm infants. Recurrent apnea patients exhibit several co-morbidities including hypertension and persistent sympathetic activation. Intermittent hypoxia (IH) resulting from apneas appears to be the primary stimulus for evoking autonomic changes. The purpose of this article is to briefly review the effects of IH on chemo- and baro-reflexes and circulating vasoactive hormones and their contribution to sympathetic activation and blood pressures. Sleep apnea patients and IH-treated rodents exhibit exaggerated arterial chemo-reflex. Studies on rodent models demonstrated that IH leads to hyperactive carotid body response to hypoxia. On the other hand, baro-reflex function is attenuated in patients with sleep apnea and in IH-treated rodents. Circulating vasoactive hormone levels are elevated in sleep apnea patients and in rodent models of IH. Thus, persistent sympathetic activation and hypertension associated with sleep apneas seems to be due to a combination of altered chemo- and baro-reflexes resulting in sympathetic activation and action of elevated circulating levels of vasoactive hormones on vasculature. Copyright © 2010 Elsevier B.V. All rights reserved.

  7. Localization of sclerotic-type chronic graft-vs-host disease to sites of skin injury: potential insight into the mechanism of isomorphic and isotopic responses.

    Science.gov (United States)

    Martires, Kathryn J; Baird, Kristin; Citrin, Deborah E; Hakim, Fran T; Pavletic, Steven Z; Cowen, Edward W

    2011-09-01

    The mechanisms responsible for the variable manifestations of chronic cutaneous graft-vs-host disease (cGVHD) are poorly understood. Localization of sclerotic-type chronic graft-vs-host disease to sites of skin injury (isomorphic and isotopic responses), a recognized phenomenon in morphea, suggests a potential common pathway between cGVHD and other sclerotic skin conditions. Four cases of sclerotic-type cGVHD developed at the site of disparate skin injuries (ionizing radiotherapy, repeated needle sticks, central catheter site, and varicella-zoster virus infection). We review the spectrum of previously reported cases of sclerotic and nonsclerotic cGVHD relating to external forces on the skin. Localization of sclerotic-type cGVHD may occur after many types of skin injury, including UV and ionizing radiotherapy, needle sticks, viral infection, and pressure or friction. Recognition of this phenomenon may be helpful for the early diagnosis of sclerotic disease. Recent insights into the immunological consequences of minor skin injury may provide important clues to the underlying pathogenesis of cGVHD-mediated skin disease.

  8. Transmission potential, skin inflammatory response, and parasitism of symptomatic and asymptomatic dogs with visceral leishmaniasis

    Directory of Open Access Journals (Sweden)

    Goto H

    2008-11-01

    Full Text Available Abstract Background Visceral leishmaniasis in Brazil is caused by the protozoan Leishmania (Leishmania chagasi and it is transmitted by sandfly of the genus Lutzomyia. Dogs are an important domestic reservoir, and control of the transmission of visceral leishmaniasis (VL to humans includes the elimination of infected dogs. However, though dogs are considered to be an important element in the transmission cycle of Leishmania, the identification of infected dogs representing an immediate risk for transmission has not been properly evaluated. Since it is not possible to treat infected dogs, they are sacrificed when a diagnosis of VL is established, a measure that is difficult to accomplish in highly endemic areas. In such areas, parameters that allow for easy identification of reservoirs that represents an immediate risk for transmission is of great importance for the control of VL transmission. In this study we aimed to identify clinical parameters, reinforced by pathological parameters that characterize dogs with potential to transmit the parasite to the vector. Results The major clinical manifestations of visceral leishmaniasis in dogs from an endemic area were onicogriphosis, skin lesions, conjunctivitis, lymphadenopathy, and weight loss. The transmission potential of these dogs was assessed by xenodiagnosis using Lutzomyia longipalpis. Six of nine symptomatic dogs were infective to Lutzomyia longipalpis while none of the five asymptomatic dogs were infective to the sandfly. Leishmania amastigotes were present in the skin of all clinically symptomatic dogs, but absent in asymptomatic dogs. Higher parasite loads were observed in the ear and ungueal region, and lower in abdomen. The inflammatory infiltrate was more intense in the ears and ungueal regions of both symptomatic and asymptomatic dogs. In clinically affected dogs in which few or none Leishmania amastigotes were observed, the inflammatory infiltrate was constituted mainly of lymphocytes

  9. Skin-transmitted pathogens and the heebie jeebies: evidence for a subclass of disgust stimuli that evoke a qualitatively unique emotional response.

    Science.gov (United States)

    Blake, Khandis R; Yih, Jennifer; Zhao, Kun; Sung, Billy; Harmon-Jones, Cindy

    2017-09-01

    Skin-transmitted pathogens have threatened humans since ancient times. We investigated whether skin-transmitted pathogens were a subclass of disgust stimuli that evoked an emotional response that was related to, but distinct from, disgust and fear. We labelled this response "the heebie jeebies". In Study 1, coding of 76 participants' experiences of disgust, fear, and the heebie jeebies showed that the heebie jeebies was elicited by unique stimuli which produced skin-crawling sensations and an urge to protect the skin. In Experiment 2,350 participants' responses to skin-transmitted pathogen, fear-inducing, and disgust-inducing vignettes showed that the vignettes elicited sensations and urges which loaded onto heebie jeebies, fear, and disgust factors, respectively. Experiment 3 largely replicated findings from Experiment 2 using video stimuli (178 participants). Results are consistent with the notion that skin-transmitted pathogens are a subclass of disgust stimuli which motivate behaviours that are functionally consistent with disgust yet qualitatively distinct.

  10. Renal sympathetic denervation: MDCT evaluation of the renal arteries.

    LENUS (Irish Health Repository)

    Hutchinson, Barry D

    2013-08-01

    Percutaneous transluminal renal sympathetic denervation is a new treatment of refractory systemic hypertension. The purpose of this study was to assess the clinical utility of MDCT to evaluate the anatomic configuration of the renal arteries in the context of renal sympathetic denervation.

  11. The Effect of Sympathetic Antagonists on the Antidepressant Action ...

    African Journals Online (AJOL)

    Alprazolam is an anti-anxiety drug shown to be effective in the treatment of depression. In this study, the effect of sympathetic receptor antagonists on alprazolam–induced antidepressant action was studied using a mouse model of forced swimming behavioral despair. The interaction of three sympathetic receptor ...

  12. Altered differential control of sympathetic outflow following sedentary conditions: Role of subregional neuroplasticity in the RVLM

    Directory of Open Access Journals (Sweden)

    Madhan Subramanian

    2016-07-01

    Full Text Available Despite the classically held belief of an all-or-none activation of the sympathetic nervous system, differential responses in sympathetic nerve activity (SNA can occur acutely at varying magnitudes and in opposing directions. Sympathetic nerves also appear to contribute differentially to various disease states including hypertension and heart failure. Previously we have reported that sedentary conditions enhanced responses of splanchnic SNA (SSNA but not lumbar SNA (LSNA to activation of the rostral ventrolateral medulla (RVLM in rats. Bulbospinal RVLM neurons from sedentary rats also exhibit increased dendritic branching in rostral regions of the RVLM. We hypothesized that regionally specific structural neuroplasticity would manifest as enhanced SSNA but not LSNA following activation of the rostral RVLM. To test this hypothesis, groups of physically active (10-12 weeks on running wheels or sedentary, male Sprague-Dawley rats were instrumented to record mean arterial pressure, LSNA and SSNA under Inactin anesthesia and during microinjections of glutamate (30 nl, 10 mM into multiple sites within the RVLM. Sedentary conditions enhanced SSNA but not LSNA responses and SSNA responses were enhanced at more central and rostral sites. Results suggest that enhanced SSNA responses in rostral RVLM coincide with enhanced dendritic branching in rostral RVLM observed previously. Identifying structural and functional neuroplasticity in specific populations of RVLM neurons may help identify new treatments for cardiovascular diseases, known to be more prevalent in sedentary individuals.

  13. Sympathetic neurons are a powerful driver of myocyte function in cardiovascular disease.

    Science.gov (United States)

    Larsen, Hege E; Lefkimmiatis, Konstantinos; Paterson, David J

    2016-12-14

    Many therapeutic interventions in disease states of heightened cardiac sympathetic activity are targeted to the myocytes. However, emerging clinical data highlights a dominant role in disease progression by the neurons themselves. Here we describe a novel experimental model of the peripheral neuro-cardiac axis to study the neuron's ability to drive a myocyte cAMP phenotype. We employed a co-culture of neonatal ventricular myocytes and sympathetic stellate neurons from normal (WKY) and pro-hypertensive (SHR) rats that are sympathetically hyper-responsive and measured nicotine evoked cAMP responses in the myocytes using a fourth generation FRET cAMP sensor. We demonstrated the dominant role of neurons in driving the myocyte ß-adrenergic phenotype, where SHR cultures elicited heightened myocyte cAMP responses during neural activation. Moreover, cross-culturing healthy neurons onto diseased myocytes rescued the diseased cAMP response of the myocyte. Conversely, healthy myocytes developed a diseased cAMP response if diseased neurons were introduced. Our results provide evidence for a dominant role played by the neuron in driving the adrenergic phenotype seen in cardiovascular disease. We also highlight the potential of using healthy neurons to turn down the gain of neurotransmission, akin to a smart pre-synaptic ß-blocker.

  14. Adaptive technique for matching the spectral response in skin lesions' images

    International Nuclear Information System (INIS)

    Pavlova, P; Borisova, E; Avramov, L; Pavlova, E

    2015-01-01

    The suggested technique is a subsequent stage for data obtaining from diffuse reflectance spectra and images of diseased tissue with a final aim of skin cancer diagnostics. Our previous work allows us to extract patterns for some types of skin cancer, as a ratio between spectra, obtained from healthy and diseased tissue in the range of 380 – 780 nm region. The authenticity of the patterns depends on the tested point into the area of lesion, and the resulting diagnose could also be fixed with some probability. In this work, two adaptations are implemented to localize pixels of the image lesion, where the reflectance spectrum corresponds to pattern. First adapts the standard to the personal patient and second – translates the spectrum white point basis to the relative white point of the image. Since the reflectance spectra and the image pixels are regarding to different white points, a correction of the compared colours is needed. The latest is done using a standard method for chromatic adaptation. The technique follows the steps below: –Calculation the colorimetric XYZ parameters for the initial white point, fixed by reflectance spectrum from healthy tissue; –Calculation the XYZ parameters for the distant white point on the base of image of nondiseased tissue; –Transformation the XYZ parameters for the test-spectrum by obtained matrix; –Finding the RGB values of the XYZ parameters for the test-spectrum according sRGB; Finally, the pixels of the lesion's image, corresponding to colour from the test-spectrum and particular diagnostic pattern are marked with a specific colour

  15. Your Skin

    Science.gov (United States)

    ... Safe Videos for Educators Search English Español Your Skin KidsHealth / For Kids / Your Skin What's in this ... body) are really dead skin cells. Bye-Bye Skin Cells These old cells are tough and strong, ...

  16. Sympathetic block by metal clips may be a reversible operation

    DEFF Research Database (Denmark)

    Thomsen, Lars L; Mikkelsen, Rasmus T; Derejko, Miroslawa

    2014-01-01

    , but the question of reversibility remains controversial. Two recent experimental studies found severe histological signs of nerve damage 4-6 weeks after clip removal, but they only used conventional histopathological staining methods. METHODS: Thoracoscopic clipping of the sympathetic trunk was performed in adult...... the sympathetic chain vary tremendously. Most surgeons transect or resect the sympathetic chain, but application of a metal clip that blocks transmission of nerve impulses in the sympathetic chain is used increasingly worldwide. This approach offers potential reversibility if patients regret surgery...... suggests in theory that application of metal clips to the sympathetic chain is a reversible procedure if only the observation period is prolonged. Further studies with longer periods between application and removal as well as investigations of nerve conduction should be encouraged, because we do not know...

  17. Differential Toxicities of Intraneurally Injected Mercuric Chloride for Sympathetic and Somatic Motor Fibers: An Ultrastructural Study

    Directory of Open Access Journals (Sweden)

    Shih-Jung Cheng

    2011-02-01

    Conclusion: This study demonstrated an undue susceptibility of sympathetic fibers to mercury intoxication. The mechanisms that underlie the selective reaction of sympathetic fibers to mercury warrant further investigation.

  18. Skin rash in patients treated with neoadjuvant erlotinib (Tarceva in resectable non-small cell lung cancer: Predictor for tumor response and survival?

    Directory of Open Access Journals (Sweden)

    Van Gool MH

    2017-08-01

    Full Text Available Background: Skin rash during treatment with epidermal growth factor receptor (EGFR-tyrosine kinase inhibitors (TKI has been reported to be predictive for response and survival in patients with advanced non-small cell lung cancer (NSCLC. The aim of this analysis was to evaluate whether skin rash during treatment (as a biomarker in a preoperative setting was related to response and survival. Methods: This study was designed as an open-label phase II trial (also known as M06NEL. Patients received preoperative erlotinib (Tarceva 150 mg once daily for 3 weeks. Skin toxicity during treatment was analysed in relation to metabolic and histopathological response, overall survival (OS and progression-free survival (PFS. Results: In total 59 patients (25 male, 34 female were eligible for analysis. In 39 patients (66% skin toxicity occurred. According to National Cancer Institute Common Toxicity Criteria (NCICTC, Grade 1 toxicity was seen in 15 patients (25%, Grade 2 in 19 patients (32% and Grade 3 in five patients (8%. None of the patients showed skin toxicity Grade 4 and 5. The median follow up was 74 months. Thirty-six patients (61% were alive at time of analysis. Twenty-seven patients (46% showed disease progression during follow up. Hazard ratios (HR indicated lower risk of death (HR = 0.66, 95%CI: 0.29 - 1.50 and progression (HR = 0.64, 0.30 - 1.36, although in this small group results were not significant. Skin rash did not adequately predict response. Conclusions: In this neoadjuvant setting with limited treatment time in patients with early stage NSCLC, skin rash was not associated with response and survival and cannot be used as an early biomarker.

  19. Cultivar Diversity of Grape Skin Polyphenol Composition and Changes in Response to Drought Investigated by LC-MS Based Metabolomics

    Directory of Open Access Journals (Sweden)

    Lucie Pinasseau

    2017-10-01

    Full Text Available Phenolic compounds represent a large family of plant secondary metabolites, essential for the quality of grape and wine and playing a major role in plant defense against biotic and abiotic stresses. Phenolic composition is genetically driven and greatly affected by environmental factors, including water stress. A major challenge for breeding of grapevine cultivars adapted to climate change and with high potential for wine-making is to dissect the complex plant metabolic response involved in adaptation mechanisms. A targeted metabolomics approach based on ultra high-performance liquid chromatography coupled to triple quadrupole mass spectrometry (UHPLC-QqQ-MS analysis in the Multiple Reaction Monitoring (MRM mode has been developed for high throughput profiling of the phenolic composition of grape skins. This method enables rapid, selective, and sensitive quantification of 96 phenolic compounds (anthocyanins, phenolic acids, stilbenoids, flavonols, dihydroflavonols, flavan-3-ol monomers, and oligomers…, and of the constitutive units of proanthocyanidins (i.e., condensed tannins, giving access to detailed polyphenol composition. It was applied on the skins of mature grape berries from a core-collection of 279 Vitis vinifera cultivars grown with or without watering to assess the genetic variation for polyphenol composition and its modulation by irrigation, in two successive vintages (2014–2015. Distribution of berry weights and δ13C values showed that non irrigated vines were subjected to a marked water stress in 2014 and to a very limited one in 2015. Metabolomics analysis of the polyphenol composition and chemometrics analysis of this data demonstrated an influence of water stress on the biosynthesis of different polyphenol classes and cultivar differences in metabolic response to water deficit. Correlation networks gave insight on the relationships between the different polyphenol metabolites and related biosynthetic pathways. They also

  20. Slow and deep respiration suppresses steady-state sympathetic nerve activity in patients with chronic heart failure: from modeling to clinical application.

    Science.gov (United States)

    Harada, Daisuke; Asanoi, Hidetsugu; Takagawa, Junya; Ishise, Hisanari; Ueno, Hiroshi; Oda, Yoshitaka; Goso, Yukiko; Joho, Shuji; Inoue, Hiroshi

    2014-10-15

    Influences of slow and deep respiration on steady-state sympathetic nerve activity remain controversial in humans and could vary depending on disease conditions and basal sympathetic nerve activity. To elucidate the respiratory modulation of steady-state sympathetic nerve activity, we modeled the dynamic nature of the relationship between lung inflation and muscle sympathetic nerve activity (MSNA) in 11 heart failure patients with exaggerated sympathetic outflow at rest. An autoregressive exogenous input model was utilized to simulate entire responses of MSNA to variable respiratory patterns. In another 18 patients, we determined the influence of increasing tidal volume and slowing respiratory frequency on MSNA; 10 patients underwent a 15-min device-guided slow respiration and the remaining 8 had no respiratory modification. The model predicted that a 1-liter, step increase of lung volume decreased MSNA dynamically; its nadir (-33 ± 22%) occurred at 2.4 s; and steady-state decrease (-15 ± 5%), at 6 s. Actually, in patients with the device-guided slow and deep respiration, respiratory frequency effectively fell from 16.4 ± 3.9 to 6.7 ± 2.8/min (P state MSNA was decreased by 31% (P state MSNA. Thus slow and deep respiration suppresses steady-state sympathetic nerve activity in patients with high levels of resting sympathetic tone as in heart failure. Copyright © 2014 the American Physiological Society.

  1. Skin-safe photothermal therapy enabled by responsive release of acid-activated membrane-disruptive polymer from polydopamine nanoparticle upon very low laser irradiation.

    Science.gov (United States)

    Zhu, Rui; Gao, Feng; Piao, Ji-Gang; Yang, Lihua

    2017-07-25

    How to ablate tumor without damaging skin is a challenge for photothermal therapy. We, herein, report skin-safe photothermal cancer therapy provided by the responsive release of acid-activated hemolytic polymer (aHLP) from the photothermal polydopamine (PDA) nanoparticle upon irradiation at very low dosage. Upon skin-permissible irradiation (via an 850 nm laser irradiation at the power density of 0.4 W cm -2 ), the nanoparticle aHLP-PDA generates sufficient localized-heat to bring about mild hyperthermia treatment and consequently, responsively sheds off the aHLP polymer from its PDA nanocore; this leads to selective cytotoxicity to cancer cells under the acidic conditions of the extracellular microenvironment of tumor. As a result, our aHLP-PDA nanoparticle upon irradiation at a low dosage effectively inhibits tumor growth without damaging skin, as demonstrated using animal models. Effective in mitigating the otherwise inevitable skin damage in tumor photothermal therapy, the nanosystem reported herein offers an efficient pathway towards skin-safe photothermal therapy.

  2. A comparison between 133Xenon washout technique and Laser Doppler flowmetry in the measurement of local vasoconstrictor effects on the microcirculation in subcutaneous tissue and skin

    DEFF Research Database (Denmark)

    Kastrup, J; Bülow, J; Lassen, N A

    1987-01-01

    Changes in skin blood flow measured by Laser Doppler flowmetry and changes in subcutaneous blood flow measured by 133Xenon washout technique were compared during activation of the local sympathetic mediated veno-arteriolar vasoconstrictor reflex by lowering the area of investigation below heart...... forearm, and on the calf with preserved sympathetic nerve supply. The Laser Doppler method registered a 23% reduction in skin blood flow during lowering of the extremities independently of the sympathetic nerve supply to the skin. The 133Xenon method recorded a 44% decrease in blood flow in innervated...... level. The measurements were performed in tissue with and without sympathetic innervation. In five subjects, who all had been cervically sympathectomized for manual hyperhidrosis, the Laser Doppler and 133Xenon blood flow measurements were performed simultaneously on the sympathetically denervated...

  3. Reflex sympathetic dystrophy syndrome: MR imaging study

    International Nuclear Information System (INIS)

    Masciocchi, C.; Fascetti, E.; Bonanni, G.; Calvisi, V.; Buoni, C.; Passariello, R.

    1987-01-01

    Reflex sympathetic dystrophy syndrome (RSDS) is characterized by pain, swelling, and limitation of motion. The etiology and pathophysiology mechanism have not yet been identified. We considered eight patients with clinical signs of RSDS, in five cases located at the knee joint and in three cases in the hip. In all cases conventional radiography and radionuclide bone scanning were performed before MR imaging. Conventional radiography was negative in three cases while scintigraphy demonstrated the lesion in all patients. MR imaging showed an area of low intensity signal on T1-weighted scans and an increased signal intensity on T2-weighted images. This area is located at the bone marrow and its regular and homogeneous. This specific finding on MR images is due to reflect edema by hyperemia of the bone marrow. The MR imaging diagnosis was confirmed on clinical and radiological follow-up. MR imaging can have a role in the differential diagnosis when other studies are nondiagnostic or nonspecific for RSDS

  4. Sympathetic cooling of nanospheres with cold atoms

    Science.gov (United States)

    Montoya, Cris; Witherspoon, Apryl; Ranjit, Gambhir; Casey, Kirsten; Kitching, John; Geraci, Andrew

    2016-05-01

    Ground state cooling of mesoscopic mechanical structures could enable new hybrid quantum systems where mechanical oscillators act as transducers. Such systems could provide coupling between photons, spins and charges via phonons. It has recently been shown theoretically that optically trapped dielectric nanospheres could reach the ground state via sympathetic cooling with trapped cold atoms. This technique can be beneficial in cases where cryogenic operation of the oscillator is not practical. We describe experimental advances towards coupling an optically levitated dielectric nanosphere to a gas of cold Rubidium atoms. The sphere and the cold atoms are in separate vacuum chambers and are coupled using a one-dimensional optical lattice. This work is partially supported by NSF, Grant Nos. PHY-1205994,PHY-1506431.

  5. Cardiac sympathetic neuronal imaging using PET

    International Nuclear Information System (INIS)

    Lautamaeki, Riikka; Tipre, Dnyanesh; Bengel, Frank M.

    2007-01-01

    Balance of the autonomic nervous system is essential for adequate cardiac performance, and alterations seem to play a key role in the development and progression of various cardiac diseases. PET imaging of the cardiac autonomic nervous system has advanced extensively in recent years, and multiple pre- and postsynaptic tracers have been introduced. The high spatial and temporal resolution of PET enables noninvasive quantification of neurophysiologic processes at the tissue level. Ligands for catecholamine receptors, along with radiolabeled catecholamines and catecholamine analogs, have been applied to determine involvement of sympathetic dysinnervation at different stages of heart diseases such as ischemia, heart failure, and arrhythmia. This review summarizes the recent findings in neurocardiological PET imaging. Experimental studies with several radioligands and clinical findings in cardiac dysautonomias are discussed. (orig.)

  6. Complete Electric Dipole Response in 120Sn and 208Pb and Implications for Neutron Skin and Symmetry Energy

    Directory of Open Access Journals (Sweden)

    von Neumann-Cosel Peter

    2015-01-01

    Full Text Available Polarized proton scattering at energies of a few 100 MeV and extreme forward angles including 0° has been established as a new tool to extract the complete E1 response in nuclei up to excitation energies of about 20 MeV. A case study of 208Pb demonstrates excellent agreement with other electromagnetic probes. From the information on the B(E1 strength one can derive the electric dipole dipole polarizability, which is strongly correlated to the neutron skin and to parameters of the symmetry energy. Recently, we have extracted the polarizability of 120Sn with a comparable precision. The combination of both results further constrains the symmetry energy parameters and presents a challenge for mean-field models, since the relativistic and many Skyrme parameterizations cannot reproduce both experimental results simultaneously.

  7. Differential gene expression profiling of mouse skin after sulfur mustard exposure: Extended time response and inhibitor effect

    International Nuclear Information System (INIS)

    Gerecke, Donald R.; Chen Minjun; Isukapalli, Sastry S.; Gordon, Marion K.; Chang, Y.-C.; Tong Weida; Androulakis, Ioannis P.; Georgopoulos, Panos G.

    2009-01-01

    Sulfur mustard (HD, SM), is a chemical warfare agent that within hours causes extensive blistering at the dermal-epidermal junction of skin. To better understand the progression of SM-induced blistering, gene expression profiling for mouse skin was performed after a single high dose of SM exposure. Punch biopsies of mouse ears were collected at both early and late time periods following SM exposure (previous studies only considered early time periods). The biopsies were examined for pathological disturbances and the samples further assayed for gene expression profiling using the Affymetrix microarray analysis system. Principal component analysis and hierarchical cluster analysis of the differently expressed genes, performed with ArrayTrack showed clear separation of the various groups. Pathway analysis employing the KEGG library and Ingenuity Pathway Analysis (IPA) indicated that cytokine-cytokine receptor interaction, cell adhesion molecules (CAMs), and hematopoietic cell lineage are common pathways affected at different time points. Gene ontology analysis identified the most significantly altered biological processes as the immune response, inflammatory response, and chemotaxis; these findings are consistent with other reported results for shorter time periods. Selected genes were chosen for RT-PCR verification and showed correlations in the general trends for the microarrays. Interleukin 1 beta was checked for biological analysis to confirm the presence of protein correlated to the corresponding microarray data. The impact of a matrix metalloproteinase inhibitor, MMP-2/MMP-9 inhibitor I, against SM exposure was assessed. These results can help in understanding the molecular mechanism of SM-induced blistering, as well as to test the efficacy of different inhibitors

  8. Renal sympathetic nerve ablation for treatment-resistant hypertension

    Science.gov (United States)

    Krum, Henry; Schlaich, Markus; Sobotka, Paul

    2013-01-01

    Hypertension is a major risk factor for increased cardiovascular events with accelerated sympathetic nerve activity implicated in the pathogenesis and progression of disease. Blood pressure is not adequately controlled in many patients, despite the availability of effective pharmacotherapy. Novel procedure- as well as device-based strategies, such as percutaneous renal sympathetic nerve denervation, have been developed to improve blood pressure in these refractory patients. Renal sympathetic denervation not only reduces blood pressure but also renal as well as systemic sympathetic nerve activity in such patients. The reduction in blood pressure appears to be sustained over 3 years after the procedure, which suggests absence of re-innervation of renal sympathetic nerves. Safety appears to be adequate. This approach may also have potential in other disorders associated with enhanced sympathetic nerve activity such as congestive heart failure, chronic kidney disease and metabolic syndrome. This review will focus on the current status of percutaneous renal sympathetic nerve denervation, clinical efficacy and safety outcomes and prospects beyond refractory hypertension. PMID:23819768

  9. Liver afferents contribute to water drinking-induced sympathetic activation in human subjects: a clinical trial.

    Directory of Open Access Journals (Sweden)

    Marcus May

    Full Text Available Water drinking acutely increases sympathetic activity in human subjects. In animals, the response appears to be mediated through transient receptor potential channel TRPV4 activation on osmosensitive hepatic spinal afferents, described as osmopressor response. We hypothesized that hepatic denervation attenuates water drinking-induced sympathetic activation. We studied 20 liver transplant recipients (44±2.6 years, 1.2±0.1 years post transplant as model of hepatic denervation and 20 kidney transplant recipients (43±2.6 years, 0.8±0.1 years post transplant as immunosuppressive drug matched control group. Before and after 500 ml water ingestion, we obtained venous blood samples for catecholamine analysis. We also monitored brachial and finger blood pressure, ECG, and thoracic bioimpedance. Plasma norepinephrine concentration had changed by 0.01±0.07 nmol/l in liver and by 0.21±0.07 nmol/l in kidney transplant recipients (p<0.05 between groups after 30-40 minutes of water drinking. While blood pressure and systemic vascular resistance increased in both groups, the responses tended to be attenuated in liver transplant recipients. Our findings support the idea that osmosensitive hepatic afferents are involved in water drinking-induced sympathetic activation in human subjects.ClinicalTrials.gov NCT01237431.

  10. Liver Afferents Contribute to Water Drinking-Induced Sympathetic Activation in Human Subjects: A Clinical Trial

    Science.gov (United States)

    May, Marcus; Gueler, Faikah; Barg-Hock, Hannelore; Heiringhoff, Karl-Heinz; Engeli, Stefan; Heusser, Karsten; Diedrich, André; Brandt, André; Strassburg, Christian P.; Tank, Jens; Sweep, Fred C. G. J.; Jordan, Jens

    2011-01-01

    Water drinking acutely increases sympathetic activity in human subjects. In animals, the response appears to be mediated through transient receptor potential channel TRPV4 activation on osmosensitive hepatic spinal afferents, described as osmopressor response. We hypothesized that hepatic denervation attenuates water drinking-induced sympathetic activation. We studied 20 liver transplant recipients (44±2.6 years, 1.2±0.1 years post transplant) as model of hepatic denervation and 20 kidney transplant recipients (43±2.6 years, 0.8±0.1 years post transplant) as immunosuppressive drug matched control group. Before and after 500 ml water ingestion, we obtained venous blood samples for catecholamine analysis. We also monitored brachial and finger blood pressure, ECG, and thoracic bioimpedance. Plasma norepinephrine concentration had changed by 0.01±0.07 nmol/l in liver and by 0.21±0.07 nmol/l in kidney transplant recipients (pwater drinking. While blood pressure and systemic vascular resistance increased in both groups, the responses tended to be attenuated in liver transplant recipients. Our findings support the idea that osmosensitive hepatic afferents are involved in water drinking-induced sympathetic activation in human subjects. Trial Registration ClinicalTrials.gov NCT01237431 PMID:22016786

  11. Psychological stress exerts an adjuvant effect on skin dendritic cell functions in vivo.

    Science.gov (United States)

    Saint-Mezard, Pierre; Chavagnac, Cyril; Bosset, Sophie; Ionescu, Marius; Peyron, Eric; Kaiserlian, Dominique; Nicolas, Jean-Francois; Bérard, Frédéric

    2003-10-15

    Psychological stress affects the pathophysiology of infectious, inflammatory, and autoimmune diseases. However, the mechanisms by which stress could modulate immune responses in vivo are poorly understood. In this study, we report that application of a psychological stress before immunization exerts an adjuvant effect on dendritic cell (DC), resulting in increased primary and memory Ag-specific T cell immune responses. Acute stress dramatically enhanced the skin delayed-type hypersensitivity reaction to haptens, which is mediated by CD8(+) CTLs. This effect was due to increased migration of skin DCs, resulting in augmented CD8(+) T cell priming in draining lymph nodes and enhanced recruitment of CD8(+) T cell effectors in the skin upon challenge. This adjuvant effect of stress was mediated by norepinephrine (NE), but not corticosteroids, as demonstrated by normalization of the skin delayed-type hypersensitivity reaction and DC migratory properties following selective depletion of NE. These results suggest that release of NE by sympathetic nerve termini during a psychological stress exerts an adjuvant effect on DC by promoting enhanced migration to lymph nodes, resulting in increased Ag-specific T cell responses. Our findings may open new ways in the treatment of inflammatory diseases, e.g., psoriasis, allergic contact dermatitis, and atopic dermatitis.

  12. Selective CD28 Antagonist Blunts Memory Immune Responses and Promotes Long-Term Control of Skin Inflammation in Nonhuman Primates.

    Science.gov (United States)

    Poirier, Nicolas; Chevalier, Melanie; Mary, Caroline; Hervouet, Jeremy; Minault, David; Baker, Paul; Ville, Simon; Le Bas-Bernardet, Stephanie; Dilek, Nahzli; Belarif, Lyssia; Cassagnau, Elisabeth; Scobie, Linda; Blancho, Gilles; Vanhove, Bernard

    2016-01-01

    Novel therapies that specifically target activation and expansion of pathogenic immune cell subsets responsible for autoimmune attacks are needed to confer long-term remission. Pathogenic cells in autoimmunity include memory T lymphocytes that are long-lived and present rapid recall effector functions with reduced activation requirements. Whereas the CD28 costimulation pathway predominantly controls priming of naive T cells and hence generation of adaptive memory cells, the roles of CD28 costimulation on established memory T lymphocytes and the recall of memory responses remain controversial. In contrast to CD80/86 antagonists (CTLA4-Ig), selective CD28 antagonists blunt T cell costimulation while sparing CTLA-4 and PD-L1-dependent coinhibitory signals. Using a new selective CD28 antagonist, we showed that Ag-specific reactivation of human memory T lymphocytes was prevented. Selective CD28 blockade controlled both cellular and humoral memory recall in nonhuman primates and induced long-term Ag-specific unresponsiveness in a memory T cell-mediated inflammatory skin model. No modification of memory T lymphocytes subsets or numbers was observed in the periphery, and importantly no significant reactivation of quiescent viruses was noticed. These findings indicate that pathogenic memory T cell responses are controlled by both CD28 and CTLA-4/PD-L1 cosignals in vivo and that selectively targeting CD28 would help to promote remission of autoimmune diseases and control chronic inflammation. Copyright © 2015 by The American Association of Immunologists, Inc.

  13. Problem gamblers are hyposensitive to wins: an analysis of skin conductance responses during actual gambling on electronic gaming machines.

    Science.gov (United States)

    Lole, Lisa; Gonsalvez, Craig J; Barry, Robert J; Blaszczynski, Alex

    2014-06-01

    Physiological arousal is purportedly a key determinant in the development and maintenance of gambling behaviors, with problem gambling conceptualized in terms of abnormal autonomic responses. Theoretical conceptualizations of problem gambling are discordant regarding the nature of deficit in this disorder; some accounts posit that problem gamblers are hypersensitive to reward, and others that they are hyposensitive to reward and/or punishment. Previous research examining phasic electrodermal responses in gamblers has been limited to laboratory settings, and reactions to real gaming situations need to be examined. Skin conductance responses (SCRs) to losses, wins, and losses disguised as wins (LDWs) were recorded from 15 problem gamblers (PGs) and 15 nonproblem gamblers (NPGs) while they wagered their own money during electronic gaming machine play. PGs demonstrated significantly reduced SCRs to reward. SCRs to losses and LDWs did not differ for either PGs or NPGs. This hyposensitivity to wins may reflect abnormalities in incentive processing, and may represent a potential biological marker for problem gambling. Copyright © 2014 Society for Psychophysiological Research.

  14. Effects of the α-adrenoceptor antagonists phentolamine, phenoxybenzamine, and Idazoxan on sympathetic blood flow control in the periodontal ligament of the cat

    International Nuclear Information System (INIS)

    Edwall, B.; Gazelius, B.

    1988-01-01

    Blood flow changes in the periodontal ligament (PDL) were measured indirectly by monitoring the local clearance of 125 I - during electric sympathetic nerve stimulation or close intra-arterial infusions of either noradrenaline (NA) or adrenaline (ADR) before and after administration of phentolamine (PA), phenoxybenzamine (PBZ) or Idazoxan (RX). At the doses used in the present study, PA was the only antagonist that significantly reduced the blood flow decrease seen on activation of sympathetic fibers, although PBZ also reduced this response. Idazoxan, however, did not induce the consistent effect on blood flow decreases seen on sympathetic activation. All three α-adrenoceptor antagonists almost abolished the effects of exogenously administered NA and ADR. The results suggest the presence of functional post-junctional adrenoceptors of both the α 1 and α 2 subtypes in the sympathetic regulation of the blood flow in the PDL of the cat. A component of the response elicited by electrical sympathetic stimulation appeared to be resistant to α-adrenoceptor blockade. Administration of guanethidine (which inhibits further release of NA and neuropeptide Y) after PA abolished this residual sympathetic response

  15. Glutamate and GABA in vestibulo-sympathetic pathway neurons

    Directory of Open Access Journals (Sweden)

    Gay R Holstein

    2016-02-01

    Full Text Available The vestibulo-sympathetic reflex actively modulates blood pressure during changes in posture. This reflex allows humans to stand up and quadrupeds to rear or climb without a precipitous decline in cerebral perfusion. The vestibulo-sympathetic reflex pathway conveys signals from the vestibular end organs to the caudal vestibular nuclei. These cells, in turn, project to pre-sympathetic neurons in the rostral and caudal ventrolateral medulla (RVLM and CVLM, respectively. The present study assessed glutamate- and GABA-related immunofluorescence associated with central vestibular neurons of the vestibulo-sympathetic reflex pathway in rats. Retrograde FluoroGold tract tracing was used to label vestibular neurons with projections to RVLM or CVLM, and sinusoidal galvanic vestibular stimulation was employed to activate these pathways. Central vestibular neurons of the vestibulo-sympathetic reflex were identified by co-localization of FluoroGold and cFos protein, which accumulates in some vestibular neurons following galvanic stimulation. Triple-label immunofluorescence was used to co-localize glutamate- or GABA- labeling in the identified vestibulo-sympathetic reflex pathway neurons. Most activated projection neurons displayed intense glutamate immunofluorescence, suggestive of glutamatergic neurotransmission. To support this, anterograde tracer was injected into the caudal vestibular nuclei. Vestibular axons and terminals in RVLM and CVLM co-localized the anterograde tracer and vesicular glutamate transporter-2 signals. Other retrogradely-labeled cFos-positive neurons displayed intense GABA immunofluorescence. Vestibulo-sympathetic reflex pathway neurons of both phenotypes were present in the caudal medial and spinal vestibular nuclei, and projected to both RVLM and CVLM. As a group, however, triple-labeled vestibular cells with intense glutamate immunofluorescence were located more rostrally in the vestibular nuclei than the GABAergic neurons. Only the

  16. Renal hemodynamic effects of activation of specific renal sympathetic nerve fiber groups.

    Science.gov (United States)

    DiBona, G F; Sawin, L L

    1999-02-01

    To examine the effect of activation of a unique population of renal sympathetic nerve fibers on renal blood flow (RBF) dynamics, anesthetized rats were instrumented with a renal sympathetic nerve activity (RSNA) recording electrode and an electromagnetic flow probe on the ipsilateral renal artery. Peripheral thermal receptor stimulation (external heat) was used to activate a unique population of renal sympathetic nerve fibers and to increase total RSNA. Total RSNA was reflexly increased to the same degree with somatic receptor stimulation (tail compression). Arterial pressure and heart rate were increased by both stimuli. Total RSNA was increased to the same degree by both stimuli but external heat produced a greater renal vasoconstrictor response than tail compression. Whereas both stimuli increased spectral density power of RSNA at both cardiac and respiratory frequencies, modulation of RBF variability by fluctuations of RSNA was small at these frequencies, with values for the normalized transfer gain being approximately 0.1 at >0.5 Hz. During tail compression coherent oscillations of RSNA and RBF were found at 0.3-0.4 Hz with normalized transfer gain of 0.33 +/- 0.02. During external heat coherent oscillations of RSNA and RBF were found at both 0.2 and 0.3-0.4 Hz with normalized transfer gains of 0. 63 +/- 0.05 at 0.2 Hz and 0.53 +/- 0.04 to 0.36 +/- 0.02 at 0.3-0.4 Hz. Renal denervation eliminated the oscillations in RBF at both 0.2 and 0.3-0.4 Hz. These findings indicate that despite similar increases in total RSNA, external heat results in a greater renal vasoconstrictor response than tail compression due to the activation of a unique population of renal sympathetic nerve fibers with different frequency-response characteristics of the renal vasculature.

  17. Stratum corneum cytokines and skin irritation response to sodium lauryl sulfate

    NARCIS (Netherlands)

    de Jongh, Cindy M.; Verberk, Maarten M.; Withagen, Carien E. T.; Jacobs, John J. L.; Rustemeyer, Thomas; Kezic, Sanja

    2006-01-01

    Little is known about cytokines involved in chronic irritant contact dermatitis. Individual cytokine profiles might explain at least part of the differences in the individual response to irritation. Our objective was to investigate the relation between baseline stratum corneum (SC) cytokine levels

  18. Influence of a detergent on skin response to methyldibromo glutaronitrile in sensitized individuals

    DEFF Research Database (Denmark)

    Pedersen, Line Kynemund; Haslund, Pia; Johansen, Jeanne Duus

    2004-01-01

    The present study was undertaken to evaluate the combined effect of the preservative methyldibromo glutaronitrile (MDBGN) and sodium lauryl sulfate (SLS) on the elicitation response of allergic contact dermatitis. 20 volunteers with contact allergy to MDBGN were patch tested with 5 concentrations...

  19. Actively Perceiving and Responsive Soft Robots Enabled by Self-Powered, Highly Extensible, and Highly Sensitive Triboelectric Proximity- and Pressure-Sensing Skins.

    Science.gov (United States)

    Lai, Ying-Chih; Deng, Jianan; Liu, Ruiyuan; Hsiao, Yung-Chi; Zhang, Steven L; Peng, Wenbo; Wu, Hsing-Mei; Wang, Xingfu; Wang, Zhong Lin

    2018-06-04

    Robots that can move, feel, and respond like organisms will bring revolutionary impact to today's technologies. Soft robots with organism-like adaptive bodies have shown great potential in vast robot-human and robot-environment applications. Developing skin-like sensory devices allows them to naturally sense and interact with environment. Also, it would be better if the capabilities to feel can be active, like real skin. However, challenges in the complicated structures, incompatible moduli, poor stretchability and sensitivity, large driving voltage, and power dissipation hinder applicability of conventional technologies. Here, various actively perceivable and responsive soft robots are enabled by self-powered active triboelectric robotic skins (tribo-skins) that simultaneously possess excellent stretchability and excellent sensitivity in the low-pressure regime. The tribo-skins can actively sense proximity, contact, and pressure to external stimuli via self-generating electricity. The driving energy comes from a natural triboelectrification effect involving the cooperation of contact electrification and electrostatic induction. The perfect integration of the tribo-skins and soft actuators enables soft robots to perform various actively sensing and interactive tasks including actively perceiving their muscle motions, working states, textile's dampness, and even subtle human physiological signals. Moreover, the self-generating signals can drive optoelectronic devices for visual communication and be processed for diverse sophisticated uses. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Response of mouse skin to tattooing: use of SKH-1 mice as a surrogate model for human tattooing

    International Nuclear Information System (INIS)

    Gopee, Neera V.; Cui, Yanyan; Olson, Greg; Warbritton, Alan R.; Miller, Barbara J.; Couch, Letha H.; Wamer, Wayne G.; Howard, Paul C.

    2005-01-01

    Tattooing is a popular cosmetic practice involving more than 45 million US citizens. Since the toxicology of tattoo inks and pigments used to formulate tattoo inks has not been reported, we studied the immunological impact of tattooing and determined recovery time from this trauma. SKH-1 hairless mice were tattooed using commercial tattoo inks or suspensions of titanium dioxide, cadmium sulfide, or iron oxide, and sacrificed at 0.5, 1, 3, 4, 7, or 14 days post-tattooing. Histological evaluation revealed dermal hemorrhage at 0.5 and 1 day. Acute inflammation and epidermal necrosis were initiated at 0.5 day decreasing in incidence by day 14. Dermal necrosis and epidermal hyperplasia were prominent by day 3, reducing in severity by day 14. Chronic active inflammation persisted in all tattooed mice from day 3 to 14 post-tattooing. Inguinal and axillary lymph nodes were pigmented, the inguinal being most reactive as evidenced by lymphoid hyperplasia and polymorphonuclear infiltration. Cutaneous nuclear protein concentrations of nuclear factor-kappa B were elevated between 0.5 and 4 days. Inflammatory and proliferative biomarkers, cyclooxygenase-1, cyclooxygenase-2, and ornithine decarboxylase protein levels were elevated between 0.5 and 4 days in the skin and decreased to control levels by day 14. Interleukin-1 beta and interleukin-10 were elevated in the lymph nodes but suppressed in the tattooed skin, with maximal suppression occurring between days 0.5 and 4. These data demonstrate that mice substantially recover from the tattooing insult by 14 days, leaving behind pigment in the dermis and the regional lymph nodes. The response seen in mice is similar to acute injury seen in humans, suggesting that the murine model might be a suitable surrogate for investigating the toxicological and phototoxicological properties of ingredients used in tattooing

  1. Possible relationships between the early inflammatory response and subsequent fibrosis in rat skin after irradiation

    International Nuclear Information System (INIS)

    Ullrich, R.L.

    1975-01-01

    The possible mechanistic relationships between the early inflammatory response and subsequent fibrosis seen after radiation exposure was studied in rats were given single x ray doses of either 2000 or 5000 rads to standardized fields of the inner thigh. The results suggest that two mechanisms are responsible for the radiation-induced increase in extravasation rate and vascular injury seen early after irradiation. First, direct cytocidal damage of the endothelium; and second, chemically mediated, possibly complement dependent mechanisms. Indirect histological evidence suggests a correlation between the PMN infiltrate and the indirect vascular damage. In addition, one may conclude from these data that both direct and indirect damage to the vasculature play a role in influencing the subsequent late radiation-induced fibrosis; and a decrease in the indirect damage may allow the maintenance of a supportive vasculature at lower doses or allow the reestablishment of a vascular bed in the case of higher doses. (U.S.)

  2. Assessment of the respiratory metabolism in the skin from transcutaneous measurements of pO2 and pCO2: potential for non-invasive monitoring of response to tuberculin skin testing.

    Science.gov (United States)

    Abbot, N C; Spence, V A; Swanson-Beck, J; Carnochan, F M; Gibbs, J H; Lowe, J G

    1990-03-01

    A method is described for non-invasive transcutaneous (tc) measurement of tissue respiratory gas tensions in the skin on the forearm for study of delayed hypersensitivity reactions in man. Steady state values for tcpO2 and tcpCO2 were measured, and the skin respiratory rate (oxygen consumption) and the tissue pH were estimated from the changes in tcpO2 and tcpCO2 observed after interruption of the arterial circulation by cuff occlusion for 4 minutes. The extent of within-experiment and between subject variation in the steady-state measurements was not great (coefficient of variation 10%): tcpCO2.ss (steady state) was higher in men and tcpO2.ss was higher in women, but the extent of these sex differences was also small. Reference ranges have been established for tc measurements and calculated indices of tissue respiration in the undisturbed forearm skin of normal volunteers, against which the changes induced by tuberculin testing can be assessed. Severe changes, indicative of profound hypoxia and acidosis, are seen in intense delayed hypersensitivity reactions. Similar, but less severe changes were seen at the site of skin tests on BCG-vaccinated subjects who were 'negative' by conventional criteria of measurement of dermal induration and they became greatly exaggerated after successful re-vaccination. Intradermal injection of saline did not induce hypoxia or local acidosis. These new methods are very sensitive indicators of the tissue response in the DHS reaction.

  3. Skin immunization by microneedle patch overcomes statin-induced suppression of immune responses to influenza vaccine.

    Science.gov (United States)

    Vassilieva, Elena V; Wang, Shelly; Li, Song; Prausnitz, Mark R; Compans, Richard W

    2017-12-19

    Recent studies indicated that in elderly individuals, statin therapy is associated with a reduced response to influenza vaccination. The present study was designed to determine effects on the immune response to influenza vaccination induced by statin administration in a mouse model, and investigate potential approaches to improve the outcome of vaccination on the background of statin therapy. We fed middle aged BALB/c mice a high fat "western" diet (WD) alone or supplemented with atorvastatin (AT) for 14 weeks, and control mice were fed with the regular rodent diet. Mice were immunized with a single dose of subunit A/Brisbane/59/07 (H1N1) vaccine, either systemically or with dissolving microneedle patches (MNPs). We observed that a greater age-dependent decline in the hemagglutinin inhibition titers occurred in systemically-immunized mice than in MNP- immunized mice. AT dampened the antibody response in the animals vaccinated by either route of vaccine delivery. However, the MNP-vaccinated AT-treated animals had ~20 times higher total antibody levels to the influenza vaccine than the systemically vaccinated group one month postvaccination. We propose that microneedle vaccination against influenza provides an approach to ameliorate the immunosuppressive effect of statin therapy observed with systemic immunization.

  4. Deep tissue injury in development of pressure ulcers: a decrease of inflammasome activation and changes in human skin morphology in response to aging and mechanical load.

    Directory of Open Access Journals (Sweden)

    Olivera Stojadinovic

    Full Text Available Molecular mechanisms leading to pressure ulcer development are scarce in spite of high mortality of patients. Development of pressure ulcers that is initially observed as deep tissue injury is multifactorial. We postulate that biomechanical forces and inflammasome activation, together with ischemia and aging, may play a role in pressure ulcer development. To test this we used a newly-developed bio-mechanical model in which ischemic young and aged human skin was subjected to a constant physiological compressive stress (load of 300 kPa (determined by pressure plate analyses of a person in a reclining position for 0.5-4 hours. Collagen orientation was assessed using polarized light, whereas inflammasome proteins were quantified by immunoblotting. Loaded skin showed marked changes in morphology and NLRP3 inflammasome protein expression. Sub-epidermal separations and altered orientation of collagen fibers were observed in aged skin at earlier time points. Aged skin showed significant decreases in the levels of NLRP3 inflammasome proteins. Loading did not alter NLRP3 inflammasome proteins expression in aged skin, whereas it significantly increased their levels in young skin. We conclude that aging contributes to rapid morphological changes and decrease in inflammasome proteins in response to tissue damage, suggesting that a decline in the innate inflammatory response in elderly skin could contribute to pressure ulcer pathogenesis. Observed morphological changes suggest that tissue damage upon loading may not be entirely preventable. Furthermore, newly developed model described here may be very useful in understanding the mechanisms of deep tissue injury that may lead towards development of pressure ulcers.

  5. Inflammatory response, parasite load and AgNOR expression in ear skin of symptomatic and asymptomatic Leishmania (Leishmania chagasi infected dogs

    Directory of Open Access Journals (Sweden)

    Verçosa BLA

    2011-01-01

    Full Text Available The skin has an important role in the transmission of visceral leishmaniasis (VL as the infection pathway in dogs. To better characterize the inflammatory response of intact skin in VL, sixty infected dogs (30 symptomatic and 30 asymptomatic and six non-infected controls were studied. Diagnosis of visceral leishmaniasis was confirmed by RIFI and ELISA; direct visualization of the parasite in bone marrow aspirate; imprints of popliteal lymph nodes, spleen, liver and skin; culture in NNN-phase liquid Schneider's medium; and PCR (performed only in the ear skin. Amastigote forms of the parasite in intact skin were found only in symptomatic dogs. Inflammatory infiltrates were observed in all groups, varying from intense and/or moderate in symptomatic to discrete and/or negligible in asymptomatic and control animals. Parasite load was associated with the intensity of the inflammatory response and with clinical manifestations in canine visceral leishmaniasis. AgNOr as active transcription markers were expressed in inflammatory cells and within apoptotic bodies in all groups, including controls, with no statistical difference. Therefore, cell activation and transcription do occur in both symptomatic and asymptomatic canine visceral leishmaniasis and may result in more necrosis and inflammation or in apoptosis and less symptoms, depending on the parasite load.

  6. 5-HT receptors as novel targets for optimizing pigmentary responses in dorsal skin melanophores of frog, Hoplobatrachus tigerinus

    Science.gov (United States)

    Ali, Sharique A; Salim, Saima; Sahni, Tarandeep; Peter, Jaya; Ali, Ayesha S

    2012-01-01

    BACKGROUND AND PURPOSE Biochemical identification of 5-HT has revealed similar projection patterns across vertebrates. In CNS, 5-HT regulates major physiological functions but its peripheral functions are still emerging. The pharmacology of 5-HT is mediated by a diverse range of receptors that trigger different responses. Interestingly, 5-HT receptors have been detected in pigment cells indicating their role in skin pigmentation. Hence, we investigated the role of this monoaminergic system in amphibian pigment cells, melanophores, to further our understanding of its role in pigmentation biology together with its evolutionary significance. EXPERIMENTAL APPROACH Pharmacological profiling of 5-HT receptors was achieved using potent/selective agonists and antagonists. In vitro responses of melanophores were examined by Mean Melanophores Size Index assay. The melanophores of lower vertebrates are highly sensitive to external stimuli. The immediate cellular responses to drugs were defined in terms of pigment translocation within the cells. KEY RESULTS 5-HT exerted strong concentration-dependent pigment dispersion at threshold dose of 1 × 10−6 g·mL−1. Specific 5-HT1 and 5-HT2 receptor agonists, sumatriptan and myristicin. also induced dose-dependent dispersion. Yohimbine and metergoline synergistically antagonized sumatriptan-mediated dispersion, whereas trazodone partially blocked myristicin-induced dispersion. Conversely, 5-HT3 and 5-HT4 receptor agonists, 1 (3 chlorophenyl) biguanide (1,3 CPB) and 5-methoxytryptamine (5-MT), caused a dose-dependent pigment aggregation. The aggregatory effect of 1,3 CPB was completely blocked by ondansetron, whereas L-lysine partially blocked the effect of 5-MT. CONCLUSIONS AND IMPLICATIONS The results suggest that 5-HT-induced physiological effects are mediated via distinct classes of receptors, which possibly participate in the modulation of pigmentary responses in amphibian. PMID:21880033

  7. Endogenous salivary α-amylase does not interact with skin conductance response during fear extinction in posttraumatic stress disorder.

    Science.gov (United States)

    Zuj, Daniel V; Palmer, Matthew A; Malhi, Gin S; Bryant, Richard A; Felmingham, Kim L

    2018-04-01

    Posttraumatic Stress Disorder (PTSD) is associated with elevated noradrenergic signaling, which has an impact on emotional learning and memory. Fear extinction is thought to underlie the processes of exposure therapy, however the relationship between noradrenaline and extinction in PTSD is unclear. Participants with PTSD (n = 21), trauma-exposure without PTSD (TC; n = 36), and non-trauma-exposed controls (NTC; n = 27) completed a fear conditioning and extinction paradigm, and conditioned fear was indexed by skin conductance response (SCR). Salivary α-amylase (sAA) collected at baseline and immediately post-fear acquisition was used as an index of noradrenaline, and we examined whether sAA in response to fear acquisition was a moderator between fear extinction and PTSD symptoms. While there was a significant increase in sAA from baseline to post-fear acquisition, this was not modulated by group. Compared to TC and NTC, the PTSD group displayed a slower decline in SCRs during early extinction, which generalized across stimulus type, and was not moderated by sAA. These findings suggest that the relationship between fear extinction and PTSD symptoms does not change as a function of sAA levels; however previous research suggests other processes of fear learning may be associated with noradrenergic activity in PTSD. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.

  8. The insular cortex: relationship to skin conductance responses to facial expression of emotion in temporal lobe epilepsy.

    Science.gov (United States)

    Banks, Sarah J; Bellerose, Jenny; Douglas, Danielle; Jones-Gotman, Marilyn

    2014-03-01

    The insula plays an important role both in emotion processing and in the generation of epileptic seizures. In the current study we examined thickness of insular cortices and bilateral skin conductance responses (SCR) in healthy subjects in addition to a small number of patients with temporal lobe epilepsy. SCR measures arousal and is used to assess non-conscious responses to emotional stimuli. We used two emotion tasks, one explicitly about emotion and the other implicit. The explicit task required judgments about emotions being expressed in photographs of faces, while the implicit one required judgments about the age of the people in the photographs. Patients and healthy differed in labeling neutral faces, but not other emotions. They also differed in their SCR to emotions, though the profile depended on which hand the recordings were from. Finally, we found relationships between the thickness of the insula and SCR to each task: in the healthy group the thickness of the left insula was related to SCR to the emotion-labeling task; in the patient group it was between the thickness of the right insula and SCR in the age-labeling task. These patterns were evident only for the right hand recordings, thus underscoring the importance of bilateral recordings.

  9. Arsenic transformation predisposes human skin keratinocytes to UV-induced DNA damage yet enhances their survival apparently by diminishing oxidant response

    International Nuclear Information System (INIS)

    Sun Yang; Kojima, Chikara; Chignell, Colin; Mason, Ronald; Waalkes, Michael P.

    2011-01-01

    Inorganic arsenic and UV, both human skin carcinogens, may act together as skin co-carcinogens. We find human skin keratinocytes (HaCaT cells) are malignantly transformed by low-level arsenite (100 nM, 30 weeks; termed As-TM cells) and with transformation concurrently undergo full adaptation to arsenic toxicity involving reduced apoptosis and oxidative stress response to high arsenite concentrations. Oxidative DNA damage (ODD) is a possible mechanism in arsenic carcinogenesis and a hallmark of UV-induced skin cancer. In the current work, inorganic arsenite exposure (100 nM) did not induce ODD during the 30 weeks required for malignant transformation. Although acute UV-treatment (UVA, 25 J/cm 2 ) increased ODD in passage-matched control cells, once transformed by arsenic to As-TM cells, acute UV actually further increased ODD (> 50%). Despite enhanced ODD, As-TM cells were resistant to UV-induced apoptosis. The response of apoptotic factors and oxidative stress genes was strongly mitigated in As-TM cells after UV exposure including increased Bcl2/Bax ratio and reduced Caspase-3, Nrf2, and Keap1 expression. Several Nrf2-related genes (HO-1, GCLs, SOD) showed diminished responses in As-TM cells after UV exposure consistent with reduced oxidant stress response. UV-exposed As-TM cells showed increased expression of cyclin D1 (proliferation gene) and decreased p16 (tumor suppressor). UV exposure enhanced the malignant phenotype of As-TM cells. Thus, the co-carcinogenicity between UV and arsenic in skin cancer might involve adaptation to chronic arsenic exposure generally mitigating the oxidative stress response, allowing apoptotic by-pass after UV and enhanced cell survival even in the face of increased UV-induced oxidative stress and increased ODD. - Highlights: → Arsenic transformation adapted to UV-induced apoptosis. → Arsenic transformation diminished oxidant response. → Arsenic transformation enhanced UV-induced DNA damage.

  10. Prefrontal oxygenation correlates to the responses in facial skin blood flows during exposure to pleasantly charged movie

    OpenAIRE

    Matsukawa, Kanji; Endo, Kana; Asahara, Ryota; Yoshikawa, Miho; Kusunoki, Shinya; Ishida, Tomoko

    2017-01-01

    Abstract Our laboratory reported that facial skin blood flow may serve as a sensitive tool to assess an emotional status. Cerebral neural correlates during emotional interventions should be sought in relation to the changes in facial skin blood flow. To test the hypothesis that prefrontal activity has positive relation to the changes in facial skin blood flow during emotionally charged stimulation, we examined the dynamic changes in prefrontal oxygenation (with near‐infrared spectroscopy) and...

  11. Loss of Sympathetic Nerves in Spleens from Patients with End Stage Sepsis

    Directory of Open Access Journals (Sweden)

    Donald B. Hoover

    2017-12-01

    Full Text Available The spleen is an important site for central regulation of immune function by noradrenergic sympathetic nerves, but little is known about this major region of neuroimmune communication in humans. Experimental studies using animal models have established that sympathetic innervation of the spleen is essential for cholinergic anti-inflammatory responses evoked by vagal nerve stimulation, and clinical studies are evaluating this approach for treating inflammatory diseases. Most data on sympathetic nerves in spleen derive from rodent studies, and this work has established that remodeling of sympathetic innervation can occur during inflammation. However, little is known about the effects of sepsis on spleen innervation. Our primary goals were to (i localize noradrenergic nerves in human spleen by immunohistochemistry for tyrosine hydroxylase (TH, a specific noradrenergic marker, (ii determine if nerves occur in close apposition to leukocytes, and (iii determine if splenic sympathetic innervation is altered in patients who died from end stage sepsis. Staining for vesicular acetylcholine transporter (VAChT was done to screen for cholinergic nerves. Archived paraffin tissue blocks were used. Control samples were obtained from trauma patients or patients who died after hemorrhagic stroke. TH + nerves were associated with arteries and arterioles in all control spleens, occurring in bundles or as nerve fibers. Individual TH + nerve fibers entered the perivascular region where some appeared in close apposition to leukocytes. In marked contrast, spleens from half of the septic patients lacked TH + nerves fibers and the average abundance of TH + nerves for the septic group was only 16% of that for the control group (control: 0.272 ± 0.060% area, n = 6; sepsis: 0.043 ± 0.026% area, n = 8; P < 0.005. All spleens lacked cholinergic innervation. Our results provide definitive evidence for the distribution of noradrenergic

  12. Revision on Renal Sympathetic Ablation in the Treatment of Resistant Hypertension.

    Science.gov (United States)

    Saraiva, Ana Filipa

    2016-01-01

    be treated first. Several studies have demonstrated the efficacy and safety both in resistant hypertension as in other co-morbidities. However, there is no marker to evaluate the effectiveness of this technique, neither a robust predictor of a stronger response in certain patients. Additionally there are several factors that seem to influence various parameters related to this technique. Therefore there is a need for additional studies to consolidate the data existing on the renal sympathetic denervation.

  13. Skin Conditions

    Science.gov (United States)

    Your skin is your body's largest organ. It covers and protects your body. Your skin Holds body fluids in, preventing dehydration Keeps harmful ... it Anything that irritates, clogs, or inflames your skin can cause symptoms such as redness, swelling, burning, ...

  14. Possible relationships between the early inflammatory response and subsequent fibrosis in rat skin after irradiation

    International Nuclear Information System (INIS)

    Ullrich, R.L.

    1975-01-01

    This study was designed to examine possible mechanistic relationships between the early inflammatory response and the subsequent fibrosis seen after radiation exposure. Anesthetized Rochester ex-Wistar rats were given single x-ray doses of either 2000 or 5000 rads to standardized fields of the inner thigh. The data suggest that two mechanisms are responsible for the radiation-induced increase in extravasation rate and vascular injury seen early after irradiation. First, direct cytocidal damage of the endothelium; and second, chemically mediated, possibly complement dependent mechanisms. Indirect histological evidence suggests a correlation between the PMN infiltrate and the indirect vascular damage. In addition, one may conclude from these data that (1) both direct and indirect damage to the vasculature play a role in influencing the subsequent late radiation-induced fibrosis; and (2) a decrease in the indirect damage may allow the maintenance of a supportive vasculature at lower doses or allow the reestablishment of a vascular bed in the case of higher doses

  15. Assessment of cardiac sympathetic nerve integrity with positron emission tomography

    International Nuclear Information System (INIS)

    Raffel, David M.; Wieland, Donald M.

    2001-01-01

    The autonomic nervous system plays a critical role in the regulation of cardiac function. Abnormalities of cardiac innervation have been implicated in the pathophysiology of many heart diseases, including sudden cardiac death and congestive heart failure. In an effort to provide clinicians with the ability to regionally map cardiac innervation, several radiotracers for imaging cardiac sympathetic neurons have been developed. This paper reviews the development of neuronal imaging agents and discusses their emerging role in the noninvasive assessment of cardiac sympathetic innervation

  16. Schwanomma From Cervical Sympathetic Chain Ganglion – A Rare Presentation

    Science.gov (United States)

    Asma, A. Affee

    2015-01-01

    Schwanommas arising from cervical sympathetic chain are tumours that are rare in occurrence. These lesions are usually difficult to differentiate from a vagal schwanomma and a carotid body tumour during the initial workup. In this report, a rarely seen huge cervical sympathetic chain schwanomma case with partial Horner’s syndrome is being presented in detail, which to our known knowledge, is one of the few cases reported in literature. PMID:26557566

  17. Imbalance between sympathetic and sensory innervation in peritoneal endometriosis.

    Science.gov (United States)

    Arnold, Julia; Barcena de Arellano, Maria L; Rüster, Carola; Vercellino, Giuseppe F; Chiantera, Vito; Schneider, Achim; Mechsner, Sylvia

    2012-01-01

    To investigate possible mechanisms of pain pathophysiology in patients with peritoneal endometriosis, a clinical study on sensory and sympathetic nerve fibre sprouting in endometriosis was performed. Peritoneal lesions (n=40) and healthy peritoneum (n=12) were immunostained and analysed with anti-protein gene product 9.5 (PGP 9.5), anti-substance P (SP) and anti-tyrosine hydroxylase (TH), specific markers for intact nerve fibres, sensory nerve fibres and sympathetic nerve fibres, respectively, to identify the ratio of sympathetic and sensory nerve fibres. In addition, immune cell infiltrates in peritoneal endometriotic lesions were analysed and the nerve growth factor (NGF) and interleukin (IL)-1β expression was correlate with the nerve fibre density. Peritoneal fluids from patients with endometriosis (n=40) and without endometriosis (n=20) were used for the in vitro neuronal growth assay. Cultured chicken dorsal root ganglia (DRG) and sympathetic ganglia were stained with anti-growth associated protein 43 (anti-GAP 43), anti-SP and anti-TH. We could detect an increased sensory and decreased sympathetic nerve fibres density in peritoneal lesions compared to healthy peritoneum. Peritoneal fluids of patients with endometriosis compared to patients without endometriosis induced an increased sprouting of sensory neurites from DRG and decreased neurite outgrowth from sympathetic ganglia. In conclusion, this study demonstrates an imbalance between sympathetic and sensory nerve fibres in peritoneal endometriosis, as well as an altered modulation of peritoneal fluids from patients with endometriosis on sympathetic and sensory innervation which might directly be involved in the maintenance of inflammation and pain. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. Schwanomma From Cervical Sympathetic Chain Ganglion - A Rare Presentation.

    Science.gov (United States)

    Asma, A Affee; Kannah, E

    2015-10-01

    Schwanommas arising from cervical sympathetic chain are tumours that are rare in occurrence. These lesions are usually difficult to differentiate from a vagal schwanomma and a carotid body tumour during the initial workup. In this report, a rarely seen huge cervical sympathetic chain schwanomma case with partial Horner's syndrome is being presented in detail, which to our known knowledge, is one of the few cases reported in literature.

  19. Use of Galvanic Skin Responses, Salivary Biomarkers, and Self-reports to Assess Undergraduate Student Performance During a Laboratory Exam Activity

    Science.gov (United States)

    Villanueva, Idalis; Valladares, Maria; Goodridge, Wade

    2016-01-01

    Typically, self-reports are used in educational research to assess student response and performance to a classroom activity. Yet, addition of biological and physiological measures such as salivary biomarkers and galvanic skin responses are rarely included, limiting the wealth of information that can be obtained to better understand student performance. A laboratory protocol to study undergraduate students' responses to classroom events (e.g., exams) is presented. Participants were asked to complete a representative exam for their degree. Before and after the laboratory exam session, students completed an academic achievement emotions self-report and an interview that paralleled these questions when participants wore a galvanic skin sensor and salivary biomarkers were collected. Data collected from the three methods resulted in greater depth of information about students' performance when compared to the self-report. The work can expand educational research capabilities through more comprehensive methods for obtaining nearer to real-time student responses to an examination activity. PMID:26891278

  20. Skin abscess

    Science.gov (United States)

    Abscess - skin; Cutaneous abscess; Subcutaneous abscess; MRSA - abscess; Staph infection - abscess ... Skin abscesses are common and affect people of all ages. They occur when an infection causes pus ...

  1. Bone mineral density in reflex sympathetic dystrophy

    International Nuclear Information System (INIS)

    Saghaphi, M.; Azarian, A.

    2002-01-01

    Objectives: Reflex Sympathetic Dystrophy (RSD) is a complex of symptoms that produce pain burning sensation, swelling, tenderness, autonomic and physical dysfunction in joint areas, particularly distal of a limb. Osteopenia or osteoporosis is an important finding that is produced gradually in involved limb. Three phase bone can scan help to diagnosis of RSD. The disease may be bilateral but is mostly unilateral. As it is believed that bone densitometry will show osteopenia more accurate than plain comparative radiographs of the involved limbs, we investigated in patients with RSD. Methods: During last three years, 8 patients with RSD were admitted. Bone mineral density was measured for 5 patients by DEXA method. The patients were 3 males and 2 females with age range of 20 to 48 years (mean 32 years). The involved areas were ankle and foot in 4, and wrist and hand in one patient. Results: Mean Bone Mineral Content (BMC) of 4 involved lower limbs were 475 +-73 grams comparing with 516+-72 grams of uninvolved limbs (p t h patient was not significant. conclusion: comparative bone mineral density in patients with RSD of the lower limbs contributes to more accurate diagnosis than plain radiographs

  2. Subcutaneous L-tyrosine elicits cutaneous analgesia in response to local skin pinprick in rats.

    Science.gov (United States)

    Hung, Ching-Hsia; Chiu, Chong-Chi; Liu, Kuo-Sheng; Chen, Yu-Wen; Wang, Jhi-Joung

    2015-10-15

    The purpose of the study was to estimate the ability of L-tyrosine to induce cutaneous analgesia and to investigate the interaction between L-tyrosine and the local anesthetic lidocaine. After subcutaneously injecting the rats with L-tyrosine and lidocaine in a dose-dependent manner, cutaneous analgesia (by blocking the cutaneous trunci muscle reflex-CTMR) was evaluated in response to the local pinprick. The drug-drug interaction was analyzed by using an isobolographic method. We showed that both L-tyrosine and lidocaine produced dose-dependent cutaneous analgesia. On the 50% effective dose (ED50) basis, the rank of drug potency was lidocaine (5.09 [4.88-5.38] μmol)>L-tyrosine (39.1 [36.5-41.8] μmol) (Ptyrosine lasted longer than that caused by lidocaine (Ptyrosine exhibited an additive effect on infiltrative cutaneous analgesia. Our pre-clinical study demonstrated that L-tyrosine elicits the local/cutaneous analgesia, and the interaction between L-tyrosine and lidocaine is additive. L-tyrosine has a lower potency but much greater duration of cutaneous analgesia than lidocaine. Adding L-tyrosine to lidocaine preparations showed greater duration of cutaneous analgesia compared with lidocaine alone. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Real-time gene expression analysis in carp (Cyprinus carpio) skin: inflammatory responses to injury mimicking infection with ectoparasites

    NARCIS (Netherlands)

    Gonzalez, S.F.; Huising, M.O.; Stakauska, R.; Forlenza, M.; Verburg-van Kemenade, B.M.L.; Buchmann, K.; Nielsen, M.E.; Wiegertjes, G.F.

    2007-01-01

    We studied a predictive model of gene expression induced by mechanical injury of fish skin, to resolve the confounding effects on the immune system induced by injury and skin parasite-specific molecules. We applied real time quantitative PCR (RQ-PCR) to measure the expression of the pro-inflammatory

  4. Real-time gene expression analysis in carp (Cyprinus carpio L.) skin: Inflammatory responses to injury mimicking infection with ectoparasites

    NARCIS (Netherlands)

    Gonzalez, S.F.; Huising, M.O.; Stakauskas, R.; Forlenza, M.; Verburg-van Kemenade, B.M.L.; Buchmann, K.; Nielsen, M.E.; Wiegertjes, G.F.

    2007-01-01

    We studied a predictive model of gene expression induced by mechanical injury of fish skin, to resolve the confounding effects on the immune system induced by injury and skin parasite-specific molecules. We applied real time quantitative PCR (RQ-PCR) to measure the expression of the pro-inflammatory

  5. Experimental research and observation of the skin response of mice with a second-degree scald during irradiation by a CO2 laser

    Science.gov (United States)

    Wang, Yunxia; Wu, Shulian; Li, Zhifang; Xu, Xiaohui; Li, Hui

    2014-05-01

    Second-degree scalding is a common dermatological injury. Inappropriate treatment methods in clinical practice always produce scarring, and can lead to skin cancer and other complications in the longer term. In this study optical coherence tomography (OCT) combined with a skin detector was used to monitor the response of second-degree scalded skin tissue irradiated by a CO2 laser. The process of treatment of second-degree scalding was systematically studied from the perspective of tissue optics. The OCT signal intensity was stronger within the whole recovery period in the experimental group undergoing CO2 laser treatment, and the attenuation coefficient (μt) returned to its original value in a shorter time. The results help us to understand tissue injury in a second-degree scald and may help improve the standard treatment.

  6. The Role of AKT/mTOR Pathway in Stress Response to UV-Irradiation: Implication in Skin Carcinogenesis by Regulation of Apoptosis, Autophagy and Senescence

    Science.gov (United States)

    Strozyk, Elwira; Kulms, Dagmar

    2013-01-01

    Induction of DNA damage by UVB and UVA radiation may generate mutations and genomic instability leading to carcinogenesis. Therefore, skin cells being repeatedly exposed to ultraviolet (UV) light have acquired multilayered protective mechanisms to avoid malignant transformation. Besides extensive DNA repair mechanisms, the damaged skin cells can be eliminated by induction of apoptosis, which is mediated through the action of tumor suppressor p53. In order to prevent the excessive loss of skin cells and to maintain the skin barrier function, apoptotic pathways are counteracted by anti-apoptotic signaling including the AKT/mTOR pathway. However, AKT/mTOR not only prevents cell death, but is also active in cell cycle transition and hyper-proliferation, thereby also counteracting p53. In turn, AKT/mTOR is tuned down by the negative regulators being controlled by the p53. This inhibition of AKT/mTOR, in combination with transactivation of damage-regulated autophagy modulators, guides the p53-mediated elimination of damaged cellular components by autophagic clearance. Alternatively, p53 irreversibly blocks cell cycle progression to prevent AKT/mTOR-driven proliferation, thereby inducing premature senescence. Conclusively, AKT/mTOR via an extensive cross talk with p53 influences the UV response in the skin with no black and white scenario deciding over death or survival. PMID:23887651

  7. Water bath hyperthermia is a simple therapy for psoriasis and also stimulates skin tanning in response to sunlight

    Energy Technology Data Exchange (ETDEWEB)

    Boreham, D.R.; Gasmann, H.C.; Mitchel, R.E.J

    1994-07-01

    An eight week trial, involving superficial hyperthermia delivered biweekly via simple water bath immersion, was tested for its ability to clear mild to moderate psoriatic lesions. Seven patients were treated and three cases rapidly improved. In the remaining patients, the treatment frequency was increased to alternate days; two cases improved significantly, one patient showed a partial response, and the fourth had no visible change (this was the only patient taking concurrent drug therapy - etretinate). In addition to resolving psoriatic lesions, water bath hyperthermia also reduced edema (swelling) and relieved pruritus (itching) in all patients, both during the treatment period and for up to several months after lesions had returned. Lesion reappearance occurred within one to three months after the last heat treatment. We retreated one patient and produced a second complete remission. These results indicate that simple repetitive water bath hyperthermia alone is effective in the treatment of psoriatic lesions in heatable locations. An unexpected side effect was enhanced melanin content (tanning) in all areas where hyperthermia treated skin was exposed to sunlight. (author)

  8. Optically-tracked handheld fluorescence imaging platform for monitoring skin response in the management of soft tissue sarcoma

    Science.gov (United States)

    Chamma, Emilie; Qiu, Jimmy; Lindvere-Teene, Liis; Blackmore, Kristina M.; Majeed, Safa; Weersink, Robert; Dickie, Colleen I.; Griffin, Anthony M.; Wunder, Jay S.; Ferguson, Peter C.; DaCosta, Ralph S.

    2015-07-01

    Standard clinical management of extremity soft tissue sarcomas includes surgery with radiation therapy. Wound complications (WCs) arising from treatment may occur due to bacterial infection and tissue breakdown. The ability to detect changes in these parameters during treatment may lead to earlier interventions that mitigate WCs. We describe the use of a new system composed of an autofluorescence imaging device and an optical three-dimensional tracking system to detect and coregister the presence of bacteria with radiation doses. The imaging device visualized erythema using white light and detected bacterial autofluorescence using 405-nm excitation light. Its position was tracked relative to the patient using IR reflective spheres and registration to the computed tomography coordinates. Image coregistration software was developed to spatially overlay radiation treatment plans and dose distributions on the white light and autofluorescence images of the surgical site. We describe the technology, its use in the operating room, and standard operating procedures, as well as demonstrate technical feasibility and safety intraoperatively. This new clinical tool may help identify patients at greater risk of developing WCs and investigate correlations between radiation dose, skin response, and changes in bacterial load as biomarkers associated with WCs.

  9. Electric dipole response of {sup 208}Pb from proton inelastic scattering: Constraints on neutron skin thickness and symmetry energy

    Energy Technology Data Exchange (ETDEWEB)

    Tamii, A. [Research Center for Nuclear Physics, Ibaraki (Japan); Neumann-Cosel, P. von; Poltoratska, I. [Technische Universitaet Darmstadt, Institut fuer Kernphysik, Darmstadt (Germany)

    2014-02-15

    The electric dipole (E1) response of {sup 208}Pb has been precisely determined by measuring Coulomb excitation induced by proton scattering at very forward angles. The electric dipole polarizability, defined as inverse energy-weighted sum rule of the E1 strength, has been extracted as α{sub D} = 20.1 ± 0.6 fm{sup 3}. The data can be used to constrain the neutron skin thickness of {sup 208}Pb to Δr{sub np} = 0.165 ± (0.009){sub expt} ± (0.013){sub theor} ± (0.021){sub est} fm, where the subscript ''expt'' refers to the experimental uncertainty, ''theor'' to the theoretical confidence band and ''est'' to the uncertainty associated with the estimation of the symmetry energy at the saturation density. In addition, a constraint band has been extracted in the plane of the symmetry energy (J and its slope parameter L) at the saturation density. (orig.)

  10. Inorganic phosphate inhibits sympathetic neurotransmission in canine saphenous veins

    International Nuclear Information System (INIS)

    Edoute, Y.; Vanhoutte, P.M.; Shepherd, J.T.

    1987-01-01

    Inorganic phosphate has been proposed as the initiator of metabolic vasodilatation in active skeletal muscle. The present study was primarily designed to determine if this substance has an inhibitory effect on adrenergic neurotransmission. Rings of canine saphenous veins were suspended for isometric tension recording in organ chambers. A comparison was made of the ability of inorganic phosphate (3 to 14 mM) to relax rings contracted to the same degree by electrical stimulation, exogenous norepinephrine, and prostaglandin F/sub 2α/. The relaxation during electrical stimulation was significantly greater at all concentrations of phosphate. In strips of saphenous veins previously incubated with [ 3 H]norepinephrine, the depression of the contractile response caused by phosphate during electrical stimulated was accompanied by a significant reduction in the overflow of labeled neurotransmitter. Thus inorganic phosphate inhibits sympathetic neurotransmission and hence may have a key role in the sympatholysis in the active skeletal muscles during exercise. By contrast, in this preparation, it has a modest direct relaxing action on the vascular smooth muscle

  11. Skin Cancer.

    Science.gov (United States)

    Linares, Miguel A; Zakaria, Alan; Nizran, Parminder

    2015-12-01

    Skin cancer accounts for most malignancies across the globe. They are primarily divided into melanoma and nonmelanoma skin malignancies. Nonmelanoma skin cancer includes basal cell carcinoma and squamous cell carcinoma. Fair skin and chronic ultraviolet B exposure are the most important risk factors. Primary prevention is achieved by avoiding sun exposure and tanning beds. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Electroencephalographic, Heart Rate, and Galvanic Skin Response Assessment for an Advertising Perception Study: Application to Antismoking Public Service Announcements.

    Science.gov (United States)

    Cartocci, Giulia; Caratù, Myriam; Modica, Enrica; Maglione, Anton Giulio; Rossi, Dario; Cherubino, Patrizia; Babiloni, Fabio

    2017-08-28

    The evaluation of advertising, products, and packaging is traditionally performed through methods based on self-reports and focus groups, but these approaches often appear poorly accurate in scientific terms. Neuroscience is increasingly applied to the investigation of the neurophysiological bases of the perception of and reaction to commercial stimuli to support traditional marketing methods. In this context, a particular sector or marketing is represented by public service announcements (PSAs). The objective of this protocol is to apply electroencephalography (EEG) and autonomic signal analysis to study responses to selected antismoking PSAs. Two EEG indices were employed: the frontal alpha band EEG asymmetry (the Approach Withdrawal (AW) index) and the frontal theta (effort index). Furthermore, the autonomic Emotional Index (EI) was calculated, as derived from the Galvanic Skin Response (GSR) and Heart Rate (HR) signals. The present protocol describes a series of operational and computational steps required to properly estimate, through the aforementioned indices, the emotional and cerebral reaction of a group of subjects towards a selected number of antismoking PSAs. In particular, a campaign characterized by a symbolic communication style (classified as "awarded" on the basis of the prizes received by specialized committees) obtained the highest approach values, as estimated by the AW index. A spot and an image belonging to the same PSA campaign based on the "fear arousing appeal" and with a narrative/experiential communication style (classified as "effective" on the basis of the economical/health-related improvements promoted) reported the lowest and highest effort values, respectively. This is probably due to the complexity of the storytelling (spot) and to the immediateness of the image (a lady who underwent a tracheotomy). Finally, the same "effective" campaign showed the highest EI values, possibly because of the empathy induced by the testimonial and the

  13. Randomized placebo-controlled trial of sucrose analgesia on neonatal skin blood flow and pain response during heel lance.

    Science.gov (United States)

    Tutag Lehr, Victoria; Cortez, Josef; Grever, William; Cepeda, Eugene; Thomas, Ron; Aranda, Jacob V

    2015-05-01

    To evaluate the effect of oral sucrose on skin blood flow (SBF; perfusion units; PU) measured by Laser Doppler Imager (LDI) in term newborns and pain response (Neonatal Infant Pain Scale score; NIPS score) during heel lance; (2) determine SBF changes during heel lance; and (3) the relationship between SBF and NIPS. Term infants ≤7 days old (n=56) undergoing routine heel lance were randomized to pretreatment with 2.0 mL oral 24% sucrose (n=29) or sterile water (n=27) in a double-blinded, placebo-controlled trial. SBF was assessed by LDI scans and NIPS scores at 10 minutes before lance, immediately after lancing, and 5 minutes after blood extraction. Mean SBF and median NIPS scores were compared between groups using General Linear Model or Kruskal-Wallis. Regressions examined the relationship between SBF immediately after heel lance and NIPS score. Mean SBF and median NIPS scores immediately after heel lance were lower in sucrose-treated infants (167.9±15.5 vs. 205.4±16.0 PU, P=0.09; NIPS 1 [interquartile range 0 to 4] vs. NIPS 3 [interquartile range 0 to 6], P=0.02), although no significant difference in mean SBF. During heel lance NIPS score was predictive of SBF. An increase of 1 in NIPS score was associated with 11 PU increase in SBF (R=0.21; P=0.09) for sucrose, and 16 PU increase for placebo-treated infants (R=0.20; P=0.014). Increased SBF assessed by LDI is a pain response among term neonates after routine heel lance, which was not completely attenuated by oral sucrose administration. Increased SBF is associated with NIPS scores. Sucrose analgesic efficacy evidenced by decreased NIPS scores for the sucrose group. Association of SBF with NIPS scores suggests that LDI is potentially useful for assessing newborn procedural pain.

  14. Non-thermal near-infrared exposure photobiomodulates cellular responses to ionizing radiation in human full thickness skin models.

    Science.gov (United States)

    König, Anke; Zöller, Nadja; Kippenberger, Stefan; Bernd, August; Kaufmann, Roland; Layer, Paul G; Heselich, Anja

    2018-01-01

    Ionizing and near-infrared radiation are both part of the therapeutic spectrum in cancer treatment. During cancer therapy ionizing radiation is typically used for non-invasive reduction of malignant tissue, while near-infrared photobiomodulation is utilized in palliative medical approaches, e.g. for pain reduction or impairment of wound healing. Furthermore, near-infrared is part of the solar wavelength spectrum. A combined exposure of these two irradiation qualities - either intentionally during medical treatment or unintentionally due to solar exposure - is therefore presumable for cancer patients. Several studies in different model organisms and cell cultures show a strong impact of near-infrared pretreatment on ionizing radiation-induced stress response. To investigate the risks of non-thermal near-infrared (NIR) pretreatment in patients, a human in vitro full thickness skin models (FTSM) was evaluated for radiation research. FTSM were pretreated with therapy-relevant doses of NIR followed by X-radiation, and then examined for DNA-double-strand break (DSB) repair, cell proliferation and apoptosis. Double-treated FTSM revealed a clear influence of NIR on X-radiation-induced stress responses in cells in their typical tissue environment. Furthermore, over a 24h time period, double-treated FTSM presented a significant persistence of DSBs, as compared to samples exclusively irradiated by X-rays. In addition, NIR pretreatment inhibited apoptosis induction of integrated fibroblasts, and counteracted the radiation-induced proliferation inhibition of basal keratinocytes. Our work suggests that cancer patients treated with X-rays should be prevented from uncontrolled NIR irradiation. On the other hand, controlled double-treatment could provide an alternative therapy approach, exposing the patient to less radiation. Copyright © 2017. Published by Elsevier B.V.

  15. Early skin-to-skin contact after cesarean section: A randomized clinical pilot study.

    Directory of Open Access Journals (Sweden)

    Martina Kollmann

    Full Text Available Early bonding by skin-to-skin contact (SSC has been demonstrated to be beneficial for mothers and newborns following vaginal delivery. The aim of this study was to investigate the impact of intraoperative bonding (early SSC after cesarean section on neonatal adaptation, maternal pain and stress response.This prospective, randomized-controlled pilot study was performed at a single academic tertiary hospital (Department of Obstetrics and Gynecology, Medical University of Graz, Austria between September 2013 and January 2014. Women were randomly assigned to intraoperative ("early" SCC (n = 17 versus postoperative ("late" SCC (n = 18. Main variables investigated were neonatal transition (Apgar score, arterial oxygen saturation, heart rate and temperature, maternal pain perception and both maternal and neonatal stress response by measuring the stress biomarkers salivary free cortisol and salivary alpha amylase.There was no evidence for differences in parameters reflecting neonatal transition or stress response between the 'Early SSC Group' and the 'Late SSC Group'. Maternal salivary cortisol and alpha-amylase levels as well as maternal wellbeing and pain did not differ between the groups. However, the rise of maternal salivary alpha-amylase directly after delivery was higher in the 'Early SSC Group' compared to the 'Late SSC Group' (p = 0.004.This study did not reveal significant risks for the newborn in terms of neonatal transition when early SSC is applied in the operating room. Maternal condition and stress marker levels did not differ either, although the rise of maternal salivary alpha-amylase directly after delivery was higher in the 'Early SSC Group' compared to the 'Late SSC Group', which may indicate a stressor sign due to intensive activation of the sympathetic-adreno-medullary-system. This needs to be further evaluated in a larger prospective randomized trial.ClinicalTrials.gov NCT01894880.

  16. Skin tightening.

    Science.gov (United States)

    Woolery-Lloyd, Heather; Kammer, Jenna N

    2011-01-01

    Skin tightening describes the treatment of skin laxity via radiofrequency (RF), ultrasound, or light-based devices. Skin laxity on the face is manifested by progressive loss of skin elasticity, loosening of the connective tissue framework, and deepening of skin folds. This results in prominence of submandibular and submental tissues. Genetic factors (chronological aging) and extrinsic factors (ultraviolet radiation) both contribute to skin laxity. There are many RF, ultrasound, and light-based devices directed at treating skin laxity. All of these devices target and heat the dermis to induce collagen contraction. Heating of the dermis causes collagen denaturation and immediate collagen contraction in addition to long-term collagen remodeling. Via RF, light, or ultrasound, these skin tightening devices deliver heat to the dermis to create new collagen and induce skin tightening. This chapter will provide an overview of the various skin tightening devices. Copyright © 2011 S. Karger AG, Basel.

  17. Exposure to a high-fat diet during development alters leptin and ghrelin sensitivity and elevates renal sympathetic nerve activity and arterial pressure in rabbits.

    Science.gov (United States)

    Prior, Larissa J; Davern, Pamela J; Burke, Sandra L; Lim, Kyungjoon; Armitage, James A; Head, Geoffrey A

    2014-02-01

    Exposure to maternal obesity or a maternal diet rich in fat during development may have adverse outcomes in offspring, such as the development of obesity and hypertension. The present study examined the effect of a maternal high-fat diet (m-HFD) on offspring blood pressure and renal sympathetic nerve activity, responses to stress, and sensitivity to central administration of leptin and ghrelin. Offspring of New Zealand white rabbits fed a 13% HFD were slightly heavier than offspring from mothers fed a 4% maternal normal fat diet (Pfat pad mass (P=0.015). Mean arterial pressure, heart rate, and renal sympathetic nerve activity at 4 months of age were 7%, 7%, and 24% greater, respectively (Pfat diet rabbits, and the renal sympathetic nerve activity response to airjet stress was enhanced in the m-HFD group. m-HFD offspring had markedly elevated pressor and renal sympathetic nerve activity responses to intracerebroventricular leptin (5-100 µg) and enhanced sympathetic responses to intracerebroventricular ghrelin (1-5 nmol). In contrast, there was resistance to the anorexic effects of intracerebroventricular leptin and less neuronal activation as detected by Fos immunohistochemistry in the arcuate (-57%; Pfat diet rabbits. We conclude that offspring from mothers consuming an HFD exhibit an adverse cardiovascular profile in adulthood because of altered central hypothalamic sensitivity to leptin and ghrelin.

  18. Direct conscious telemetry recordings demonstrate increased renal sympathetic nerve activity in rats with chronic kidney disease

    Directory of Open Access Journals (Sweden)

    Ibrahim M Salman

    2015-08-01

    Full Text Available Chronic kidney disease (CKD is associated with sympathetic hyperactivity and impaired blood pressure control reflex responses, yet direct evidence demonstrating these features of autonomic dysfunction in conscious animals is still lacking. Here we measured renal sympathetic nerve activity (RSNA and mean arterial pressure (MAP using telemetry-based recordings in a rat model of CKD, the Lewis Polycystic Kidney (LPK rat, and assessed responses to chemoreflex activation and acute stress. Male LPK and Lewis control animals (total n=16 were instrumented for telemetric recording of RSNA and MAP. At 12–13 weeks-of-age, resting RSNA and MAP, sympathetic and haemodynamic responses to both peripheral (hypoxia: 10% O2 and central chemoreflex (hypercapnia: 7% CO2 activation and acute stress (open-field exposure, were measured. As indicators of renal function, urinary protein (UPro and creatinine (Ucr levels were assessed. LPK rats had higher resting RSNA (1.2±0.1 vs. 0.6±0.1 µV, p<0.05 and MAP (151±8 vs. 97±2 mmHg, p<0.05 compared to Lewis. MAP was negatively correlated with Ucr (r=-0.80, p=0.002 and positively correlated with RSNA (r=0.66, p=0.014, with multiple linear regression modeling indicating the strongest correlation was with Ucr. RSNA and MAP responses to activation of the central chemoreflex and open-field stress were reduced in the LPK relative to the Lewis (all p<0.05. This is the first description of dual conscious telemetry recording of RSNA and MAP in a genetic rodent model of CKD. Elevated RSNA is likely a key contributor to the marked hypertension in this model, while attenuated RSNA and MAP responses to central chemoreflex activation and acute stress in the LPK indicate possible deficits in the neural processing of autonomic outflows evoked by these sympathoexcitatory pathways.

  19. Response of pig skin to single doses of irradiation from strontium-90 sources of differing surface area

    Energy Technology Data Exchange (ETDEWEB)

    Hopewell, J.W.; Hamlet, R.; Peel, D. (Churchill Hospital, Oxford (UK). Research Inst.)

    1985-08-01

    In the present investigations the effects of irradiation of pig skin with 22.5 and 40 mm diameter /sup 90/Sr plaques are compared. In addition to comparing peak epithelial reactions, comparisons were also made as to the healing times for comparable peak skin reactions for each field size. The ED/sub 50/ values (dose to produce moist desquamation in 50% of the skin fields) 26.5 +- 1.5 Gy for the 22.5 diameter field was not significantly different from that obtained for the larger 40 mm diameter source (ED/sub 50/ 29.0 +- 1.5 Gy).

  20. The response of pig skin to single doses of irradiation from strontium-90 sources of differing surface area

    International Nuclear Information System (INIS)

    Hopewell, J.W.; Hamlet, R.; Peel, D.

    1985-01-01

    In the present investigations the effects of irradiation of pig skin with 22.5 and 40 mm diameter 90 Sr plaques are compared. In addition to comparing peak epithelial reactions, comparisons were also made as to the healing times for comparable peak skin reactions for each field size. The ED 50 values (dose to produce moist desquamation in 50% of the skin fields) 26.5+-1.5 Gy for the 22.5 diameter field was not significantly different from that obtained for the larger 40 mm diameter source (ED 50 29.0+-1.5 Gy). (U.K.)

  1. A novel interaction between sympathetic overactivity and aberrant regulation of renin by miR-181a in BPH/2J genetically hypertensive mice.

    Science.gov (United States)

    Jackson, Kristy L; Marques, Francine Z; Watson, Anna M D; Palma-Rigo, Kesia; Nguyen-Huu, Thu-Phuc; Morris, Brian J; Charchar, Fadi J; Davern, Pamela J; Head, Geoffrey A

    2013-10-01

    Genetically hypertensive mice (BPH/2J) are hypertensive because of an exaggerated contribution of the sympathetic nervous system to blood pressure. We hypothesize that an additional contribution to elevated blood pressure is via sympathetically mediated activation of the intrarenal renin-angiotensin system. Our aim was to determine the contribution of the renin-angiotensin system and sympathetic nervous system to hypertension in BPH/2J mice. BPH/2J and normotensive BPN/3J mice were preimplanted with radiotelemetry devices to measure blood pressure. Depressor responses to ganglion blocker pentolinium (5 mg/kg i.p.) in mice pretreated with the angiotensin-converting enzyme inhibitor enalaprilat (1.5 mg/kg i.p.) revealed a 2-fold greater sympathetic contribution to blood pressure in BPH/2J mice during the active and inactive period. However, the depressor response to enalaprilat was 4-fold greater in BPH/2J compared with BPN/3J mice, but only during the active period (P=0.01). This was associated with 1.6-fold higher renal renin messenger RNA (mRNA; P=0.02) and 0.8-fold lower abundance of micro-RNA-181a (P=0.03), identified previously as regulating human renin mRNA. Renin mRNA levels correlated positively with depressor responses to pentolinium (r=0.99; P=0.001), and BPH/2J mice had greater renal sympathetic innervation density as identified by tyrosine hydroxylase staining of cortical tubules. Although there is a major sympathetic contribution to hypertension in BPH/2J mice, the renin-angiotensin system also contributes, doing so to a greater extent during the active period and less during the inactive period. This is the opposite of the normal renin-angiotensin system circadian pattern. We suggest that renal hyperinnervation and enhanced sympathetically induced renin synthesis mediated by lower micro-RNA-181a contributes to hypertension in BPH/2J mice.

  2. Skin barrier function

    DEFF Research Database (Denmark)

    2016-01-01

    Renowned experts present the latest knowledge Although a very fragile structure, the skin barrier is probably one of the most important organs of the body. Inward/out it is responsible for body integrity and outward/in for keeping microbes, chemicals, and allergens from penetrating the skin. Since...... the role of barrier integrity in atopic dermatitis and the relationship to filaggrin mutations was discovered a decade ago, research focus has been on the skin barrier, and numerous new publications have become available. This book is an interdisciplinary update offering a wide range of information...... on the subject. It covers new basic research on skin markers, including results on filaggrin and on methods for the assessment of the barrier function. Biological variation and aspects of skin barrier function restoration are discussed as well. Further sections are dedicated to clinical implications of skin...

  3. Effects of age and mild cognitive impairment on the pain response system.

    Science.gov (United States)

    Kunz, Miriam; Mylius, Veit; Schepelmann, Karsten; Lautenbacher, Stefan

    2009-01-01

    Both age and dementia have been shown to have an effect on nociception and pain processing. The question arises whether mild cognitive impairment (MCI), which is thought to be a transitional stage between normal ageing and dementia, is also associated with alterations in pain processing. The aim of the present study was to answer this question by investigating the impact of age and MCI on the pain response system. Forty young subjects, 45 cognitively unimpaired elderly subjects and 42 subjects with MCI were investigated by use of an experimental multi-method approach. The subjects were tested for their subjective (pain ratings), motor (RIII reflex), facial (Facial Action Coding System) and their autonomic (sympathetic skin response and evoked heart rate response) responses to noxious electrical stimulation of the nervus suralis. We found significant group differences in the autonomic responses to noxious stimulation. The sympathetic skin response amplitude was significantly reduced in the cognitively unimpaired elderly subjects compared to younger subjects and to an even greater degree in subjects with MCI. The evoked heart rate response was reduced to a similar degree in both groups of aged subjects. Regression analyses within the two groups of the elderly subjects revealed that age and, in the MCI group, cognitive status were significant predictors of the decrease in autonomic responsiveness to noxious stimulation. Except for the autonomic parameters, no other pain parameter differed between the three groups. The pain response system appeared to be quite unaltered in MCI patients compared to cognitively unimpaired individuals of the same age. Only the sympathetic responsiveness qualified as an indicator of early aging effects as well as of pathophysiology associated with MCI, which both seemed to affect the pain system independently from each other.

  4. Oral fibroblasts produce more HGF and KGF than skin fibroblasts in response to co-culture with keratinocytes

    DEFF Research Database (Denmark)

    Grøn, Birgitte; Stoltze, Kaj; Andersson, Anders

    2002-01-01

    The production of hepatocyte growth factor (HGF) and keratinocyte growth factor (KGF) in subepithelial fibroblasts from buccal mucosa, periodontal ligament, and skin was determined after co-culture with keratinocytes. The purpose was to detect differences between the fibroblast subpopulations...... days by ELISA. When cultured on polystyrene, the constitutive level of KGF and HGF in periodontal fibroblasts was higher than the level in buccal and skin fibroblasts. In the presence of keratinocytes, all three types of fibroblasts in general increased their HGF and KGF production 2-3 times. When...... cells were maintained in collagen, the level of HGF and KGF was decreased mainly in skin cultures. However, in oral fibroblasts, induction after stimulation was at a similar level in collagen compared to on polystyrene. Skin fibroblasts maintained in collagen produced almost no HGF whether...

  5. Emergence time and skin melanin spot patterns do not correlate with growth performance, social competitive ability or stress response in farmed rainbow trout

    DEFF Research Database (Denmark)

    Gesto, Manuel; Skov, Peter Vilhelm; Jokumsen, Alfred

    2017-01-01

    dissimilarities in the acute stress responses, emergence fraction displayed no correlation with growth rates, or the ability to compete for feed. Within the whole group of fish utilized in the experiments, no relationship between skinmelanin spot pattern and growth performance, stress response intensity......, or competitive ability was found. Altogether, the differences in physiological traits related to emergence time were not as strong as those found in earlier studies. It is hypothesized, that the origin and degree of domestication of the fish might be partly responsible for this. The predictive value of skin...... spots or emergence time to infer the fish stress coping style in farmed fish is also discussed...

  6. Sympathetic Innervation Promotes Arterial Fate by Enhancing Endothelial ERK Activity.

    Science.gov (United States)

    Pardanaud, Luc; Pibouin-Fragner, Laurence; Dubrac, Alexandre; Mathivet, Thomas; English, Isabel; Brunet, Isabelle; Simons, Michael; Eichmann, Anne

    2016-08-19

    Arterial endothelial cells are morphologically, functionally, and molecularly distinct from those found in veins and lymphatic vessels. How arterial fate is acquired during development and maintained in adult vessels is incompletely understood. We set out to identify factors that promote arterial endothelial cell fate in vivo. We developed a functional assay, allowing us to monitor and manipulate arterial fate in vivo, using arteries isolated from quails that are grafted into the coelom of chick embryos. Endothelial cells migrate out from the grafted artery, and their colonization of host arteries and veins is quantified. Here we show that sympathetic innervation promotes arterial endothelial cell fate in vivo. Removal of sympathetic nerves decreases arterial fate and leads to colonization of veins, whereas exposure to sympathetic nerves or norepinephrine imposes arterial fate. Mechanistically, sympathetic nerves increase endothelial ERK (extracellular signal-regulated kinase) activity via adrenergic α1 and α2 receptors. These findings show that sympathetic innervation promotes arterial endothelial fate and may lead to novel approaches to improve arterialization in human disease. © 2016 American Heart Association, Inc.

  7. Prefrontal oxygenation correlates to the responses in facial skin blood flows during exposure to pleasantly charged movie.

    Science.gov (United States)

    Matsukawa, Kanji; Endo, Kana; Asahara, Ryota; Yoshikawa, Miho; Kusunoki, Shinya; Ishida, Tomoko

    2017-11-01

    Our laboratory reported that facial skin blood flow may serve as a sensitive tool to assess an emotional status. Cerebral neural correlates during emotional interventions should be sought in relation to the changes in facial skin blood flow. To test the hypothesis that prefrontal activity has positive relation to the changes in facial skin blood flow during emotionally charged stimulation, we examined the dynamic changes in prefrontal oxygenation (with near-infrared spectroscopy) and facial skin blood flows (with two-dimensional laser speckle and Doppler flowmetry) during emotionally charged audiovisual challenges for 2 min (by viewing comedy, landscape, and horror movie) in 14 subjects. Hand skin blood flow and systemic hemodynamics were simultaneously measured. The extents of pleasantness and consciousness for each emotional stimulus were estimated by subjective rating from -5 (the most unpleasant; the most unconscious) to +5 (the most pleasant; the most conscious). Positively charged emotional stimulation (comedy) simultaneously decreased ( P  horror) or neutral (landscape) emotional stimulation did not alter or slightly decreased them. Any of hand skin blood flow and systemic cardiovascular variables did not change significantly during positively charged emotional stimulation. The changes in prefrontal oxygenation had a highly positive correlation with the changes in facial skin blood flow without altering perfusion pressure, and they were inversely correlated with the subjective rating of pleasantness. The reduction in prefrontal oxygenation during positively charged emotional stimulation suggests a decrease in prefrontal neural activity, which may in turn elicit neurally mediated vasoconstriction of facial skin blood vessels. © 2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.

  8. Effects of galvanic skin response feedback on user experience in gaze-controlled gaming: A pilot study.

    Science.gov (United States)

    Larradet, Fanny; Barresi, Giacinto; Mattos, Leonardo S

    2017-07-01

    Eye-tracking (ET) is one of the most intuitive solutions for enabling people with severe motor impairments to control devices. Nevertheless, even such an effective assistive solution can detrimentally affect user experience during demanding tasks because of, for instance, the user's mental workload - using gaze-based controls for an extensive period of time can generate fatigue and cause frustration. Thus, it is necessary to design novel solutions for ET contexts able to improve the user experience, with particular attention to its aspects related to workload. In this paper, a pilot study evaluates the effects of a relaxation biofeedback system on the user experience in the context of a gaze-controlled task that is mentally and temporally demanding: ET-based gaming. Different aspects of the subjects' experience were investigated under two conditions of a gaze-controlled game. In the Biofeedback group (BF), the user triggered a command by means of voluntary relaxation, monitored through Galvanic Skin Response (GSR) and represented by visual feedback. In the No Biofeedback group (NBF), the same feedback was timed according to the average frequency of commands in BF. After the experiment, each subject filled out a user experience questionnaire. The results showed a general appreciation for BF, with a significant between-group difference in the perceived session time duration, with the latter being shorter for subjects in BF than for the ones in NBF. This result implies a lower mental workload for BF than for NBF subjects. Other results point toward a potential role of user's engagement in the improvement of user experience in BF. Such an effect highlights the value of relaxation biofeedback for improving the user experience in a demanding gaze-controlled task.

  9. Peptidergic modulation of efferent sympathetic neurons in intrathoracic ganglia regulating the canine heart.

    Science.gov (United States)

    Armour, J A

    1989-05-01

    when stimulated. Following the intravenous administration of naloxone, the positive inotropic cardiac responses induced by efferent preganglionic sympathetic axonal stimulation were enhanced minimally in control states and significantly following hexamethonium administration. Thus, it appears that enkephalins are involved in the modulation of intrathoracic ganglion neurons regulating the heart, perhaps via modification of beta-adrenergic receptors. Taken together these data indicate that substance P, vasoactive intestinal peptide, neuropeptide Y, or enkephalins modify intrathoracic ganglionic neurons which are involved in efferent sympathetic cardiac regulation.

  10. Vascular Mural Cells Promote Noradrenergic Differentiation of Embryonic Sympathetic Neurons

    Directory of Open Access Journals (Sweden)

    Vitor Fortuna

    2015-06-01

    Full Text Available The sympathetic nervous system controls smooth muscle tone and heart rate in the cardiovascular system. Postganglionic sympathetic neurons (SNs develop in close proximity to the dorsal aorta (DA and innervate visceral smooth muscle targets. Here, we use the zebrafish embryo to ask whether the DA is required for SN development. We show that noradrenergic (NA differentiation of SN precursors temporally coincides with vascular mural cell (VMC recruitment to the DA and vascular maturation. Blocking vascular maturation inhibits VMC recruitment and blocks NA differentiation of SN precursors. Inhibition of platelet-derived growth factor receptor (PDGFR signaling prevents VMC differentiation and also blocks NA differentiation of SN precursors. NA differentiation is normal in cloche mutants that are devoid of endothelial cells but have VMCs. Thus, PDGFR-mediated mural cell recruitment mediates neurovascular interactions between the aorta and sympathetic precursors and promotes their noradrenergic differentiation.

  11. Vascular Mural Cells Promote Noradrenergic Differentiation of Embryonic Sympathetic Neurons.

    Science.gov (United States)

    Fortuna, Vitor; Pardanaud, Luc; Brunet, Isabelle; Ola, Roxana; Ristori, Emma; Santoro, Massimo M; Nicoli, Stefania; Eichmann, Anne

    2015-06-23

    The sympathetic nervous system controls smooth muscle tone and heart rate in the cardiovascular system. Postganglionic sympathetic neurons (SNs) develop in close proximity to the dorsal aorta (DA) and innervate visceral smooth muscle targets. Here, we use the zebrafish embryo to ask whether the DA is required for SN development. We show that noradrenergic (NA) differentiation of SN precursors temporally coincides with vascular mural cell (VMC) recruitment to the DA and vascular maturation. Blocking vascular maturation inhibits VMC recruitment and blocks NA differentiation of SN precursors. Inhibition of platelet-derived growth factor receptor (PDGFR) signaling prevents VMC differentiation and also blocks NA differentiation of SN precursors. NA differentiation is normal in cloche mutants that are devoid of endothelial cells but have VMCs. Thus, PDGFR-mediated mural cell recruitment mediates neurovascular interactions between the aorta and sympathetic precursors and promotes their noradrenergic differentiation. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  12. Fine-Needle Aspiration Biopsy of the Lymph Node: A Novel Tool for the Monitoring of Immune Responses after Skin Antigen Delivery.

    Science.gov (United States)

    Tatovic, Danijela; Young, Philippa; Kochba, Efrat; Levin, Yotam; Wong, F Susan; Dayan, Colin M

    2015-07-01

    Assessment of immune responses in lymph nodes (LNs) is routine in animals, but rarely done in humans. We have applied minimally invasive ultrasound-guided fine-needle aspiration of the LN to a before-and-after study of the immune response to intradermally delivered Ag in healthy volunteers (n = 25). By comparison with PBMCs from the same individual, LN cells (LNCs) were characterized by reduced numbers of effector memory cells, especially CD8(+) TEMRA cells (3.37 ± 1.93 in LNCs versus 22.53 ± 7.65 in PBMCs; p = 0.01) and a marked increased in CD69 expression (27.67 ± 7.49 versus 3.49 ± 2.62%, LNCs and PBMCs, respectively; p < 0.0001). At baseline, there was a striking absence of IFN-γ ELISPOT responses to recall Ags (purified protein derivative, Tetanus toxoid, or flu/EBV/CMV viral mix) in LN, despite strong responses in the peripheral blood. However, 48 h after tuberculin purified protein derivative administration in the ipsilateral forearm resulting in a positive skin reaction, a clear increase in IFN-γ ELISPOT counts was seen in the draining LN but not in PBMCs. This response was lost by 5 d. These data suggest that the low levels of effector memory cells in the LN may explain the low background of baseline ELISPOT responses in LNs as compared with PBMCs, and the appearance of a response after 48 h is likely to represent migration of effector memory cells from the skin to the LN. Hence, it appears that the combination of intradermal Ag administration and draining LN sampling can be used as a sensitive method to probe the effector memory T cell repertoire in the skin. Copyright © 2015 by The American Association of Immunologists, Inc.

  13. Role of sympathetic nervous system and neuropeptides in obesity hypertension

    Directory of Open Access Journals (Sweden)

    J.E. Hall

    2000-06-01

    Full Text Available Obesity is the most common cause of human essential hypertension in most industrialized countries. Although the precise mechanisms of obesity hypertension are not fully understood, considerable evidence suggests that excess renal sodium reabsorption and a hypertensive shift of pressure natriuresis play a major role. Sympathetic activation appears to mediate at least part of the obesity-induced sodium retention and hypertension since adrenergic blockade or renal denervation markedly attenuates these changes. Recent observations suggest that leptin and its multiple interactions with neuropeptides in the hypothalamus may link excess weight gain with increased sympathetic activity. Leptin is produced mainly in adipocytes and is believed to regulate energy balance by acting on the hypothalamus to reduce food intake and to increase energy expenditure via sympathetic activation. Short-term administration of leptin into the cerebral ventricles increases renal sympathetic activity, and long-term leptin infusion at rates that mimic plasma concentrations found in obesity raises arterial pressure and heart rate via adrenergic activation in non-obese rodents. Transgenic mice overexpressing leptin also develop hypertension. Acute studies suggest that the renal sympathetic effects of leptin may depend on interactions with other neurochemical pathways in the hypothalamus, including the melanocortin-4 receptor (MC4-R. However, the role of this pathway in mediating the long-term effects of leptin on blood pressure is unclear. Also, it is uncertain whether there is resistance to the chronic renal sympathetic and blood pressure effects of leptin in obese subjects. In addition, leptin also has other cardiovascular and renal actions, such as stimulation of nitric oxide formation and improvement of insulin sensitivity, which may tend to reduce blood pressure in some conditions. Although the role of these mechanisms in human obesity has not been elucidated, this

  14. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Shterzer, Naama; Heyman, Dariya; Shapiro, Beny; Yaniv, Abraham; Jackman, Anna [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Serour, Francis [Department of Pediatric Surgery, The E. Wolfson Medical Center, Holon (Israel); Chaouat, Malka [Laboratory of Experimental Surgery, Hadassah University Hospital, Ein Karem, Jerusalem (Israel); Gonen, Pinhas [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Tommasino, Massimo [International Agency for Research on Cancer, World Health Organization, Lyon (France); Sherman, Levana [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel)

    2014-11-15

    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis. - Highlights: • Primary keratinocytes were used to evaluate transforming and carcinogenic abilities of cutaneous HPVs. • E6E7 of cancer associated β HPV types transform primary human keratinocytes. • E6 proteins of cancer and wart associated HPVs inhibit UVB induced cell death. • E6s of cancer and wart associated HPVs attenuate UVB induced proliferation arrest. • E6s of cancer and wart associated HPVs attenuate UVB induced apoptosis signaling.

  15. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes

    International Nuclear Information System (INIS)

    Shterzer, Naama; Heyman, Dariya; Shapiro, Beny; Yaniv, Abraham; Jackman, Anna; Serour, Francis; Chaouat, Malka; Gonen, Pinhas; Tommasino, Massimo; Sherman, Levana

    2014-01-01

    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis. - Highlights: • Primary keratinocytes were used to evaluate transforming and carcinogenic abilities of cutaneous HPVs. • E6E7 of cancer associated β HPV types transform primary human keratinocytes. • E6 proteins of cancer and wart associated HPVs inhibit UVB induced cell death. • E6s of cancer and wart associated HPVs attenuate UVB induced proliferation arrest. • E6s of cancer and wart associated HPVs attenuate UVB induced apoptosis signaling

  16. Endovascular ultrasound for renal sympathetic denervation in patients with therapy-resistant hypertension not responding to radiofrequency renal sympathetic denervation.

    Science.gov (United States)

    Stiermaier, Thomas; Okon, Thomas; Fengler, Karl; Mueller, Ulrike; Hoellriegel, Robert; Schuler, Gerhard; Desch, Steffen; Lurz, Philipp

    2016-06-12

    Recent studies have reported a considerable number of non-responders after renal sympathetic de-nervation (RSD) with radiofrequency technology. Here we report our results of repeat RSD using ultrasound in these patients. A cohort study was performed in patients who underwent ultrasound RSD after non-response to RSD with radiofrequency. Non-response was defined as mean daytime systolic blood pressure ≥140 mmHg and/or a reduction of ≤10 mmHg in ambulatory blood pressure measurement (ABPM) ≥6 months after radiofrequency denervation. ABPM was recorded at baseline, post radiofrequency RSD as well as at three and six months post ultrasound RSD. A total of 24 non-responders underwent retreatment with the ultrasound device at a mean 15.3±8.2 months after radiofrequency RSD. Ultrasound RSD was performed successfully in all patients without severe adverse events. Mean daytime systolic blood pressure changed from 161.7±14.6 mmHg at baseline to 158.5±9.5 mmHg post radiofrequency RSD and to 150.5±10.4 mmHg and 151.6±11.0 mmHg at three and six months, respectively, post ultrasound RSD (pmeasures analysis of variance). The main results of post hoc testing were as follows: baseline versus post radiofrequency RSD, p=0.83; baseline versus three months post ultrasound RSD, p=0.01; and baseline versus six months post ultrasound RSD, p=0.04. Ultrasound RSD appears to be safe and an effective therapeutic approach in patients not responding to previous RSD with radiofrequency technology.

  17. Skin Complications

    Science.gov (United States)

    ... Text Size: A A A Listen En Español Skin Complications Diabetes can affect every part of the ... lipoidica diabeticorum, diabetic blisters, and eruptive xanthomatosis. General Skin Conditions Bacterial Infections Several kinds of bacterial infections ...

  18. Cryotherapy - skin

    Science.gov (United States)

    Cryosurgery - skin; Warts - freezing; Warts - cryotherapy; Actinic keratosis - cryotherapy; Solar keratosis - cryotherapy ... may be used to: Remove warts Destroy precancerous skin lesions (actinic keratoses or solar keratoses) In rare ...

  19. Skin Cancer

    Science.gov (United States)

    Skin cancer is the most common form of cancer in the United States. The two most common types ... face, neck, hands, and arms. Another type of skin cancer, melanoma, is more dangerous but less common. Anyone ...

  20. Sagging Skin

    Science.gov (United States)

    ... turkey neck,” this occurs as skin loses its elasticity and in cases where individuals have lost a ... technique or procedure is appropriate for my skin type? Did the doctor show me before-and-after ...

  1. Skin Biopsy

    Science.gov (United States)

    ... Development Infections Diseases & Conditions Pregnancy & Baby Nutrition & Fitness Emotions & Behavior School & Family Life First Aid & Safety Doctors & ... like these: skin rashes or conditions, such as eczema or psoriasis skin infections, such as staph diseases, ...

  2. Skin Graft

    OpenAIRE

    Shimizu, Ruka; Kishi, Kazuo

    2012-01-01

    Skin graft is one of the most indispensable techniques in plastic surgery and dermatology. Skin grafts are used in a variety of clinical situations, such as traumatic wounds, defects after oncologic resection, burn reconstruction, scar contracture release, congenital skin deficiencies, hair restoration, vitiligo, and nipple-areola reconstruction. Skin grafts are generally avoided in the management of more complex wounds. Conditions with deep spaces and exposed bones normally require the use o...

  3. Skin Aging

    Science.gov (United States)

    Your skin changes as you age. You might notice wrinkles, age spots and dryness. Your skin also becomes thinner and loses fat, making it ... heal, too. Sunlight is a major cause of skin aging. You can protect yourself by staying out ...

  4. A new organellar complex in rat sympathetic neurons.

    Directory of Open Access Journals (Sweden)

    Matt S Ramer

    Full Text Available Membranous compartments of neurons such as axons, dendrites and modified primary cilia are defining features of neuronal phenotype. This is unlike organelles deep to the plasma membrane, which are for the most part generic and not related directly to morphological, neurochemical or functional specializations. However, here we use multi-label immunohistochemistry combined with confocal and electron microscopy to identify a very large (approximately 6 microns in diameter, entirely intracellular neuronal organelle which occurs singly in a ubiquitous but neurochemically distinct and morphologically simple subset of sympathetic ganglion neurons. Although usually toroidal, it also occurs as twists or rods depending on its intracellular position: tori are most often perinuclear whereas rods are often found in axons. These 'loukoumasomes' (doughnut-like bodies bind a monoclonal antibody raised against beta-III-tubulin (SDL.3D10, although their inability to bind other beta-III-tubulin monoclonal antibodies indicate that the responsible antigen is not known. Position-morphology relationships within neurons and their expression of non-muscle heavy chain myosin suggest a dynamic structure. They associate with nematosomes, enigmatic nucleolus-like organelles present in many neural and non-neural tissues, which we now show to be composed of filamentous actin. Loukoumasomes also separately interact with mother centrioles forming the basal body of primary cilia. They express gamma tubulin, a microtubule nucleator which localizes to non-neuronal centrosomes, and cenexin, a mother centriole-associated protein required for ciliogenesis. These data reveal a hitherto undescribed organelle, and depict it as an intracellular transport machine, shuttling material between the primary cilium, the nematosome, and the axon.

  5. HIF2A and IGF2 Expression Correlates in Human Neuroblastoma Cells and Normal Immature Sympathetic Neuroblasts

    Directory of Open Access Journals (Sweden)

    Sofie Mohlin

    2013-03-01

    Full Text Available During normal sympathetic nervous system (SNS development, cells of the ganglionic lineage can malignantly transform and develop into the childhood tumor neuroblastoma. Hypoxia-inducible transcription factors (HIFs mediate cellular responses during normal development and are central in the adaptation to oxygen shortage. HIFs are also implicated in the progression of several cancer forms, and high HIF-2α expression correlates with disseminated disease and poor outcome in neuroblastoma. During normal SNS development, HIF2A is transiently expressed in neuroblasts and chromaffin cells. SNS cells can, during development, be distinguished by distinct gene expression patterns, and insulin-like growth factor 2 (IGF2 is a marker of sympathetic chromaffin cells, whereas sympathetic neuroblasts lack IGF2 expression. Despite the neuronal derivation of neuroblastomas, we show that neuroblastoma cell lines and specimens express IGF2 and that expression of HIF2A and IGF2 correlates, with the strongest correlation in high-stage tumors. In neuroblastoma, both IGF2 and HIF2A are hypoxia-driven and knocking down IGF2 at hypoxia resulted in downregulated HIF2A levels. HIF-2α and IGF2 were strongly expressed in subsets of immature neuroblastoma cells, suggesting that these two genes could be co-expressed also at early stages of SNS development. We show that IGF2 is indeed expressed in sympathetic chain ganglia at embryonic week 6.5, a developmental stage when HIF-2α is present. These findings provide a rationale for the unexpected IGF2 expression in neuroblastomas and might suggest that IGF2 and HIF2A positive neuroblastoma cells are arrested at an embryonic differentiation stage corresponding to the stage when sympathetic chain ganglia begins to coalesce.

  6. Anti-Inflammation Activities of Mycosporine-Like Amino Acids (MAAs) in Response to UV Radiation Suggest Potential Anti-Skin Aging Activity

    Science.gov (United States)

    Suh, Sung-Suk; Hwang, Jinik; Park, Mirye; Seo, Hyo Hyun; Kim, Hyoung-Shik; Lee, Jeong Hun; Moh, Sang Hyun; Lee, Taek-Kyun

    2014-01-01

    Certain photosynthetic marine organisms have evolved mechanisms to counteract UV-radiation by synthesizing UV-absorbing compounds, such as mycosporine-like amino acids (MAAs). In this study, MAAs were separated from the extracts of marine green alga Chlamydomonas hedleyi using HPLC and were identified as porphyra-334, shinorine, and mycosporine-glycine (mycosporine-Gly), based on their retention times and maximum absorption wavelengths. Furthermore, their structures were confirmed by triple quadrupole MS/MS. Their roles as UV-absorbing compounds were investigated in the human fibroblast cell line HaCaT by analyzing the expression levels of genes associated with antioxidant activity, inflammation, and skin aging in response to UV irradiation. The mycosporine-Gly extract, but not the other MAAs, had strong antioxidant activity in the 2,2-diphenyl-1-picryhydrazyl (DPPH) assay. Furthermore, treatment with mycosporine-Gly resulted in a significant decrease in COX-2 mRNA levels, which are typically increased in response to inflammation in the skin, in a concentration-dependent manner. Additionally, in the presence of MAAs, the UV-suppressed genes, procollagen C proteinase enhancer (PCOLCE) and elastin, which are related to skin aging, had increased expression levels equal to those in UV-mock treated cells. Interestingly, the increased expression of involucrin after UV exposure was suppressed by treatment with the MAAs mycosporine-Gly and shinorine, but not porphyra-334. This is the first report investigating the biological activities of microalgae-derived MAAs in human cells. PMID:25317535

  7. A new function for ATP: activating cardiac sympathetic afferents during myocardial ischemia.

    Science.gov (United States)

    Fu, Liang-Wu; Longhurst, John C

    2010-12-01

    Myocardial ischemia activates cardiac sympathetic afferents leading to chest pain and reflex cardiovascular responses. Brief myocardial ischemia leads to ATP release in the interstitial space. Furthermore, exogenous ATP and α,β-methylene ATP (α,β-meATP), a P2X receptor agonist, stimulate cutaneous group III and IV sensory nerve fibers. The present study tested the hypothesis that endogenous ATP excites cardiac afferents during ischemia through activation of P2 receptors. Nerve activity of single unit cardiac sympathetic afferents was recorded from the left sympathetic chain or rami communicates (T(2)-T(5)) in anesthetized cats. Single fields of 45 afferents (conduction velocities = 0.25-4.92 m/s) were identified in the left ventricle with a stimulating electrode. Five minutes of myocardial ischemia stimulated 39 of 45 cardiac afferents (8 Aδ, 37 C fibers). Epicardial application of ATP (1-4 μmol) stimulated six ischemically sensitive cardiac afferents in a dose-dependent manner. Additionally, epicardial ATP (2 μmol), ADP (2 μmol), a P2Y agonist, and α,β-meATP (0.5 μmol) significantly activated eight other ischemically sensitive afferents. Third, pyridoxal phosphate-6-azophenyl-2',4'-disulfonic acid, a P2 receptor antagonist, abolished the responses of six afferents to epicardial ATP (2 μmol) and attenuated the ischemia-related increase in activity of seven other afferents by 37%. In the absence of P2 receptor blockade, cardiac afferents responded consistently to repeated application of ATP (n = 6) and to recurrent myocardial ischemia (n = 6). Finally, six ischemia-insensitive cardiac spinal afferents did not respond to epicardial ATP (2-4 μmol), although these afferents did respond to epicardial bradykinin. Taken together, these data indicate that, during ischemia, endogenously released ATP activates ischemia-sensitive, but not ischemia-insensitive, cardiac spinal afferents through stimulation of P2 receptors likely located on the cardiac sensory

  8. Adaptation of the dermal collagen structure of human skin and scar tissue in response to stretch: An experimental study

    NARCIS (Netherlands)

    Verhaegen, Pauline D.; Schouten, Hennie J.; Tigchelaar-Gutter, Wikky; van Marle, Jan; van Noorden, Cornelis J.; Middelkoop, Esther; van Zuijlen, Paul P.

    2012-01-01

    Surgeons are often faced with large defects that are difficult to close. Stretching adjacent skin can facilitate wound closure. In clinical practice, intraoperative stretching is performed in a cyclical or continuous fashion. However, exact mechanisms of tissue adaptation to stretch remain unclear.

  9. The static friction response of non-glabrous skin as a function of surface energy and environmental conditions

    NARCIS (Netherlands)

    Klaassen, Michel; de Vries, Erik G.; Masen, Marc Arthur

    2017-01-01

    The (local) environmental conditions have a significant effect on the interaction between skin and products. Plasticisation of the stratum corneum occurs at high humidity, causing this layer to soften and change its surface free energy. In this work we study the effects of the micro-climate on the

  10. Pet measurements of presynaptic sympathetic nerve terminals in the heart

    International Nuclear Information System (INIS)

    Schwaiger, M.; Hutchins, G.D.; Wieland, D.M.

    1991-01-01

    [ 18 F]Metaraminol (FMR) and [ 11 C]hydroxyephedrine (HED) are catecholamine analogues that have been developed at the University of Michigan for the noninvasive characterization of the sympathetic nervous system of the heart using positron emission tomography (PET). Pharmacological studies employing neurotoxins and uptake inhibitors have demonstrated that both FMR and HED specifically trace the uptake and storage of catecholamines in sympathetic nerve terminals with little nonspecific tracer accumulation. These compounds exhibit excellent qualitative imaging characteristics with heart-to-blood ratios exceeding 6:1 as early as 15 min after intravenous injection in both animals (HED and FMR) and humans (HED). Tracer kinetic modeling techniques have been employed for the quantitative assessment of neuronal catecholamine uptake and storage. Indices of neuronal function, such as the volume of tracer distribution derived from the kinetic models, have been employed in preliminary human studies. Comparison of the tissue distribution volume of HED between normal (control subjects) and denervated (recent transplant patients) cardiac tissue demonstrates a dynamic range of approximately 5:1. This distribution volume is reduced by 60% from normal in patients with dilated cardiomyopathy, indicating dysfunction of the sympathetic system. These results show that HED used in combination with PET provides a sophisticated quantitative approach for studying the sympathetic nervous system of the normal and diseased human heart

  11. Positron emission tomographic imaging of cardiac sympathetic innervation and function

    International Nuclear Information System (INIS)

    Goldstein, D.S.; Chang, P.C.; Eisenhofer, G.; Miletich, R.; Finn, R.; Bacher, J.; Kirk, K.L.; Bacharach, S.; Kopin, I.J.

    1990-01-01

    Sites of uptake, storage, and metabolism of [ 18 F]fluorodopamine and excretion of [ 18 F]fluorodopamine and its metabolites were visualized using positron emission tomographic (PET) scanning after intravenous injection of the tracer into anesthetized dogs. Radioactivity was concentrated in the renal pelvis, heart, liver, spleen, salivary glands, and gall bladder. Uptake of 18F by the heart resulted in striking delineation of the left ventricular myocardium. Pretreatment with desipramine markedly decreased cardiac positron emission, consistent with dependence of the heart on neuronal uptake (uptake-1) for removal of circulating catecholamines. In reserpinized animals, cardiac positron emission was absent within 30 minutes after injection of [ 18 F]-6-fluorodopamine, demonstrating that the emission in untreated animals was from radioactive labeling of the sympathetic storage vesicles. Decreased positron emission from denervated salivary glands confirmed that the tracer was concentrated in sympathetic neurons. Radioactivity in the gall bladder and urinary system depicted the hepatic and renal excretion of the tracer and its metabolites. Administration of tyramine or nitroprusside increased and ganglionic blockade with trimethaphan decreased the rate of loss of myocardial radioactivity. The results show that PET scanning after administration of [ 18 F]fluorodopamine can be used to visualize sites of sympathetic innervation, follow the metabolism and renal and hepatic excretion of catecholamines, and examine cardiac sympathetic function

  12. The sympathetic innervation of the heart: Important new insights.

    Science.gov (United States)

    Coote, J H; Chauhan, R A

    2016-08-01

    Autonomic control of the heart has a significant influence over development of life threatening arrhythmias that can lead to sudden cardiac death. Sympathetic activity is known to be upregulated during these conditions and hence the sympathetic nerves present a target for treatment. However, a better understanding of the anatomy and physiology of cardiac sympathetic nerves is required for the progression of clinical interventions. This review explores the organization of the cardiac sympathetic nerves, from the preganglionic origin to the postganglionic innervations, and provides an overview of literature surrounding anti-arrhythmic therapies including thoracic sympathectomy and dorsal spinal cord stimulation. Several features of the innervation are clear. The cardiac nerves differentially supply the nodal and myocardial tissue of the heart and are dependent on activity generated in spinal neurones in the upper thoracic cord which project to synapse with ganglion cells in the stellate complex on each side. Networks of spinal interneurones determine the pattern of activity. Groups of spinal neurones selectively target specific regions of the heart but whether they exhibit a functional selectivity has still to be elucidated. Electrical or ischemic signals can lead to remodeling of nerves in the heart or ganglia. Surgical and electrical methods are proving to be clinically beneficial in reducing atrial and ventricular arrhythmias, heart failure and severe cardiac pain. This is a rapidly developing area and we need more basic understanding of how these methods work to ensure safety and reduction of side effects. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Sympathetic Overactivity in Chronic Kidney Disease: Consequences and Mechanisms

    Directory of Open Access Journals (Sweden)

    Jasdeep Kaur

    2017-08-01

    Full Text Available The incidence of chronic kidney disease (CKD is increasing worldwide, with more than 26 million people suffering from CKD in the United States alone. More patients with CKD die of cardiovascular complications than progress to dialysis. Over 80% of CKD patients have hypertension, which is associated with increased risk of cardiovascular morbidity and mortality. Another common, perhaps underappreciated, feature of CKD is an overactive sympathetic nervous system. This elevation in sympathetic nerve activity (SNA not only contributes to hypertension but also plays a detrimental role in the progression of CKD independent of any increase in blood pressure. Indeed, high SNA is associated with poor prognosis and increased cardiovascular morbidity and mortality independent of its effect on blood pressure. This brief review will discuss some of the consequences of sympathetic overactivity and highlight some of the potential pathways contributing to chronically elevated SNA in CKD. Mechanisms leading to chronic sympathoexcitation in CKD are complex, multifactorial and to date, not completely understood. Identification of the mechanisms and/or signals leading to sympathetic overactivity in CKD are crucial for development of effective therapeutic targets to reduce the increased cardiovascular risk in this patient group.

  14. Sympathetic Wigner-function tomography of a dark trapped ion

    DEFF Research Database (Denmark)

    Mirkhalaf, Safoura; Mølmer, Klaus

    2012-01-01

    A protocol is provided to reconstruct the Wigner function for the motional state of a trapped ion via fluorescence detection on another ion in the same trap. This “sympathetic tomography” of a dark ion without optical transitions suitable for state measurements is based on the mapping of its...

  15. Reflex sympathetic dystrophy/complex regional pain syndrome, type 1

    African Journals Online (AJOL)

    Enrique

    with MRI every 3 months and the bone marrow oedema disappeared after 6 months. Introduction ... SA JOURNAL OF RADIOLOGY • August 2004. Reflex sympathetic dystrophy/complex regional pain syndrome, type 1 ... may be either trauma of external origin or iatrogenic, post surgery. In some patients particularly children ...

  16. The clinical value of cardiac sympathetic imaging in heart failure

    DEFF Research Database (Denmark)

    Christensen, Thomas Emil; Kjaer, Andreas; Hasbak, Philip

    2014-01-01

    The autonomic nervous system plays an important role in the pathology of heart failure. The single-photon emission computed tomography tracer iodine-123-metaiodobenzylguanidine ((123) I-MIBG) can be used to investigate the activity of the predominant neurotransmitter of the sympathetic nervous...

  17. Baroreflex control of sympathetic activity in experimental hypertension

    Directory of Open Access Journals (Sweden)

    M.C.C. Irigoyen

    1998-09-01

    Full Text Available The arterial baroreceptor reflex system is one of the most powerful and rapidly acting mechanisms for controlling arterial pressure. The purpose of the present review is to discuss data relating sympathetic activity to the baroreflex control of arterial pressure in two different experimental models: neurogenic hypertension by sinoaortic denervation (SAD and high-renin hypertension by total aortic ligation between the renal arteries in the rat. SAD depresses baroreflex regulation of renal sympathetic activity in both the acute and chronic phases. However, increased sympathetic activity (100% was found only in the acute phase of sinoaortic denervation. In the chronic phase of SAD average discharge normalized but the pattern of discharges was different from that found in controls. High-renin hypertensive rats showed overactivity of the renin angiotensin system and a great depression of the baroreflexes, comparable to the depression observed in chronic sinoaortic denervated rats. However, there were no differences in the average tonic sympathetic activity or changes in the pattern of discharges in high-renin rats. We suggest that the difference in the pattern of discharges may contribute to the increase in arterial pressure lability observed in chronic sinoaortic denervated rats.

  18. The Power of an Infant's Smile: Maternal Physiological Responses to Infant Emotional Expressions.

    Directory of Open Access Journals (Sweden)

    Sanae Mizugaki

    Full Text Available Infant emotional expressions, such as distress cries, evoke maternal physiological reactions. Most of which involve accelerated sympathetic nervous activity. Comparatively little is known about effects of positive infant expressions, such as happy smiles, on maternal physiological responses. This study investigated how physiological and psychological maternal states change in response to infants' emotional expressions. Thirty first-time mothers viewed films of their own 6- to 7-month-old infants' affective behavior. Each observed a video of a distress cry followed by a video showing one of two expressions (randomly assigned: a happy smiling face (smile condition or a calm neutral face (neutral condition. Both before and after the session, participants completed a self-report inventory assessing their emotional states. The results of the self-report inventory revealed no effects of exposure to the infant videos. However, the mothers in the smile condition, but not in the neutral condition, showed deceleration of skin conductance. These findings demonstrate that the mothers who observed their infants smiling showed decreased sympathetic activity. We propose that an infant's positive emotional expression may affect the branch of the maternal stress-response system that modulates the homeostatic balance of the sympathetic and parasympathetic nervous systems.

  19. Stimulation of Host Bone Marrow Stromal Cells by Sympathetic Nerves Promotes Breast Cancer Bone Metastasis in Mice

    OpenAIRE

    Campbell, J. Preston; Karolak, Matthew R.; Ma, Yun; Perrien, Daniel S.; Masood-Campbell, S. Kathryn; Penner, Niki L.; Munoz, Steve A.; Zijlstra, Andries; Yang, Xiangli; Sterling, Julie A.; Elefteriou, Florent

    2012-01-01

    Bone and lung metastases are responsible for the majority of deaths in patients with breast cancer. Following treatment of the primary cancer, emotional and psychosocial factors within this population precipitate time to recurrence and death, however the underlying mechanism(s) remain unclear. Using a mouse model of bone metastasis, we provide experimental evidence that activation of the sympathetic nervous system, which is one of many pathophysiological consequences of severe stress and depr...

  20. Effects of locus coeruleus stimulation on the responses of SI neurons of the rat to controlled natural and electrical stimulation of the skin.

    Science.gov (United States)

    Snow, P J; Andre, P; Pompeiano, O

    1999-02-01

    1. The effects of microstimulation of the locus coeruleus (LC) region on the spontaneous discharge and the response of SI neurons to natural and electrical stimulation of the skin have been investigated in 26 urethane anesthetized Sprague-Dawley rats. In particular, one or two air puffs, 5-10 msec in duration, 1-2 psi, usually separated by an interval of 40 msec, were applied on the hairy skin of the wrist or the forepaw at the presentation rate of 1/sec. For units unresponsive to air puffs, similar presentation of low intensity electrical stimuli (0.2-5.0 V, 0.2-0.4 msec pulses) were applied through two needles inserted on the most effective area of the skin. Both natural and electrical stimulations of the skin were applied under control conditions, as well as 50 msec after a 250 msec train of 0.3 msec pulses at 40 Hz. 20-30 microA applied stereotaxically to the LC complex through a tungsten microelectrode. 2. Not all cortical units exhibited spontaneous discharge. Most of the units, however, which were spontaneously active, were inhibited by electrical stimulation of the LC complex, while the remaining ones were excited. The sites of stimulation, which included either the LC proper or the locus subcoeruleus, were identified following both anatomical and physiological criteria. 3. SI neurons recorded at sites between 400 and 950 microns below the surface of the cortex, thus being most likely granule cells of layers III and IV, responded to cutaneous stimuli with spikes which occurred with a latency of 20-30 msec in response to single air puffs and a latency of 15-20 msec in response to single electrical pulses to the skin. In both instances the response to the second stimulus applied at the interstimulus interval of 40 msec was markedly reduced or abolished due to postexcitatory inhibition following the response to the first stimulus (in-field inhibition). In contrast, units particularly located at or below 1000 microns from the cortical surface, which were of

  1. Clinical evaluation of carbon-11-phenylephrine: MAO-sensitive marker of cardiac sympathetic neurons.

    Science.gov (United States)

    Raffel, D M; Corbett, J R; del Rosario, R B; Gildersleeve, D L; Chiao, P C; Schwaiger, M; Wieland, D M

    1996-12-01

    The sympathomimetic drug phenylephrine recently has been labeled with 11C for use in PET studies of cardiac sympathetic innervation. Previous reports using isolated perfused rat heart models indicate that phenylephrine is metabolized by intraneuronal monoamine oxidase (MAO). This report compares the imaging characteristics, neuronal selectivity and kinetics of (-)-[11C]phenylephrine (PHEN) to the structurally similar but MAO-resistant analog (-)-[11C]-meta-hydroxyephedrine (HED), an established heart neuronal marker. Fourteen healthy volunteers were studied with PET and PHEN. Ten had paired studies with HED; four of the 10 were scanned a second time with each tracer after oral administration of desipramine, a selective neuronal transport blocker. Hemodynamic and electrocardiographic responses were monitored. Blood levels of intact radiotracer and radiolabeled metabolites were determined from venous blood samples taken during the PET study. Myocardial retention indices for both tracers were calculated. No hemodynamic or electrocardiographic effects were observed with either tracer. PHEN showed reduced myocardial retention at 50 min compared to HED; however, image quality and uniformity of distribution were comparable. PHEN cleared from myocardium with a mean half-time of 59 +/- 5 min, while myocardial levels of HED remained constant. PHEN metabolites appeared in the blood approximately three times faster than HED metabolites. Desipramine pretreatment markedly reduced (> 60%) myocardial retention of both PHEN and HED. PHEN provides PET images of human heart comparable in quality and uniformity to HED. Like HED, PHEN localizes in the sympathetic nerves of the heart. However, the more rapid efflux of PHEN, that is likely mediated by MAO, may provide information on the functional status of cardiac sympathetic neurons unobtainable with HED.

  2. Coping with dehydration: sympathetic activation and regulation of glutamatergic transmission in the hypothalamic PVN

    Science.gov (United States)

    Bardgett, Megan E.; Chen, Qing-Hui; Guo, Qing; Calderon, Alfredo S.; Andrade, Mary Ann

    2014-01-01

    Autonomic and endocrine profiles of chronic hypertension and heart failure resemble those of acute dehydration. Importantly, all of these conditions are associated with exaggerated sympathetic nerve activity (SNA) driven by glutamatergic activation of the hypothalamic paraventricular nucleus (PVN). Here, studies sought to gain insight into mechanisms of disease by determining the role of PVN ionotropic glutamate receptors in supporting SNA and mean arterial pressure (MAP) during dehydration and by elucidating mechanisms regulating receptor activity. Blockade of PVN N-methyl-d-aspartate (NMDA) receptors reduced (P dehydrated (DH) (48 h water deprivation) rats, but had no effect in euhydrated (EH) controls. Blockade of PVN α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors had no effect in either group. NMDA in PVN caused dose-dependent increases of renal SNA and MAP in both groups, but the maximum agonist evoked response (Emax) of the renal SNA response was greater (P dehydration increases excitatory NMDA receptor tone in PVN. Reduced glial-mediated glutamate uptake was identified as a key contributing factor. Defective glutamate uptake in PVN could therefore be an important, but as yet unexplored, mechanism driving sympathetic hyperactivity in chronic cardiovascular diseases. PMID:24671240

  3. Influence of laser wavelength on the thermal responses of port wine stain lesions in light, moderate and heavy pigmented skin

    International Nuclear Information System (INIS)

    Li, D.; Chen, B.; Wu, W.J.; Ying, Z.X.

    2017-01-01

    Highlights: • Laser surgery for port wine stain (PWS) was studied by local non-equilibrium theory. • Wavelength selection in laser surgery under various skin pigmentation was explored. • High pigmented skin prefers to 585 nm rather then 595 nm. • Dual-wavelength laser (585/595 + 1064 nm) has better clinic effect than single one. • Deep buried blood vessels can be damaged by 595/1064 nm dual-wavelength laser. - Abstract: Pulsed dye laser (PDL) in visible band (e.g. 585 or 595 nm) together with cryogen spray cooling has become the golden standard for treatment of vascular malformation such as port wine stain (PWS). However, due to the limited energy penetration depth of the PDL, deeply buried blood vessels are likely to survive from the laser irradiation. Nd:YAG laser in near infrared (1064 nm) has great potential in the laser treatment of PWS due to its deeper penetration depth. In this study, the influence of laser wavelength in treating PWS lesions with various melanin concentrations in epidermis was theoretically investigated by a two-temperature model following the local thermal non-equilibrium theory of porous media. The results showed that deeply buried blood vessels can be coagulated by dual-wavelength laser combing 585 or 595 nm with 1064 nm laser. Furthermore, the therapeutic results by dual-wavelength laser were highly related to the melanin concentration in epidermis. In the light and moderate pigmented skin, the 595/1064 nm dual-wavelength laser showed better treatment effect in treating PWS with deeply-buried blood vessels than of 585/1064 nm dual-wavelength laser. For a high pigmented skin, the 585/1064 nm dual-wavelength laser showed better treatment effect than 595/1064 nm dual-wavelength laser.

  4. Regulatory T Cells in Chronic Graft-Versus-Host Disease After Extracorporeal Photopheresis: Correlation With Skin and Global Organ Responses, and Ability to Taper Steroids.

    Science.gov (United States)

    Denney, Helen A; Whittle, Robert J; Lai, Jennifer; Jacques, Richard M; Taylor, Peter C

    2017-01-01

    Induction of immune tolerance by an increase in regulatory T (Treg) cells after extracorporeal photopheresis (ECP) is thought to contribute to how ECP exerts its therapeutic effect in patients with chronic graft-versus-host disease (cGvHD). We investigated whether percentages and absolute counts of Treg cells changed post-ECP, and examined correlation with response. Absolute counts and % of CD4+ T cells and Treg cells (CD4 + CD25 + FOXP3 + CD127dim/-) were evaluated using flow cytometry in 32 patients with cGvHD treated by ECP for a minimum of 3 months, and up to 12 months. CD4+ or Treg cells at baseline to 12 months post-ECP were compared with changes in skin disease scores or global organ involvement, or the ability to taper steroids, at 14, 28, and 56 weeks. Regulatory T cells % increased significantly above any overall changes in CD4+ % at 6, 9, and 12 months post-ECP. There was no statistically significant association between Treg cells and skin or steroid response, whereas a larger increase in CD4+ count from baseline to 1 to 3 months corresponded to increased odds of being able to reduce steroid dose by 50% or greater at 14 weeks. Skin and global organ responders at 28 weeks had higher median Treg cell counts 3 months post-ECP than nonresponders, as did steroid responders at 56 weeks who were 12 months post-ECP. Regulatory T cell counts and % varied greatly among cGvHD patients, and the increase post-ECP was not significant until 6 months. No clear correlation was found between Treg cells and clinical improvement, suggesting that increases in Treg cell numbers and/or proportions are not driving the mechanism leading to a response after ECP.

  5. Continuous Thoracic Sympathetic Ganglion Block in Complex Regional Pain Syndrome Patients with Spinal Cord Stimulation Implantation

    Directory of Open Access Journals (Sweden)

    EungDon Kim

    2016-01-01

    Full Text Available The sympathetic block is widely used for treating neuropathic pain such as complex regional pain syndrome (CRPS. However, single sympathetic block often provides only short-term effect. Moreover, frequent procedures for sympathetic block may increase the risk of complications. The use of epidural route may be limited by concern of infection in case of previous implantation of the spinal cord stimulation (SCS. In contrast, a continuous sympathetic block can be administered without such concerns. The continuous thoracic sympathetic block (TSGB has been used to treat the ischemic disease and other neuropathic conditions such as postherpetic neuralgia. We administered continuous thoracic sympathetic block using catheter in CRPS patients who underwent SCS implantations and achieved desirable outcomes. We believe a continuous sympathetic block is a considerable option before performing neurolysis or radiofrequency rhizotomy and even after SCS implantation.

  6. Sympathetic Innervation during Development Is Necessary for Pancreatic Islet Architecture and Functional Maturation

    Directory of Open Access Journals (Sweden)

    Philip Borden

    2013-07-01

    Full Text Available Sympathetic neurons depend on target-derived neurotrophic cues to control their survival and growth. However, whether sympathetic innervation contributes reciprocally to the development of target tissues is less clear. Here, we report that sympathetic innervation is necessary for the formation of the pancreatic islets of Langerhans and for their functional maturation. Genetic or pharmacological ablation of sympathetic innervation during development resulted in altered islet architecture, reduced insulin secretion, and impaired glucose tolerance in mice. Similar defects were observed with pharmacological blockade of β-adrenergic signaling. Conversely, the administration of a β-adrenergic agonist restored islet morphology and glucose tolerance in deinnervated animals. Furthermore, in neuron-islet cocultures, sympathetic neurons promoted islet cell migration in a β-adrenergic-dependent manner. This study reveals that islet architecture requires extrinsic inductive cues from neighboring tissues such as sympathetic nerves and suggests that early perturbations in sympathetic innervation might underlie metabolic disorders.

  7. Oral l-tyrosine supplementation augments the vasoconstriction response to whole-body cooling in older adults.

    Science.gov (United States)

    Lang, James A; Smaller, Kevin A

    2017-07-01

    What is the central question of this study? Ageing is associated with altered sympathetic responses to stress, which are explained in part by reduced noradrenergic function. The impact of supplementation with oral l-tyrosine, the amino acid precursor for catecholamine synthesis, on the effector responses to cold and exercise stress has yet to be examined. What is the main finding and its importance? Oral l-tyrosine ingestion augmented the sympathetically mediated vasoconstriction response to cold exposure in aged skin. This suggests that l-tyrosine supplementation might improve thermoregulatory function in older adults. l-Tyrosine is the primary substrate for noradrenaline biosynthesis within sympathetic axon terminals. In stressful conditions requiring increased catecholamine production, the axonal l-tyrosine concentration may limit the full expression of the sympathetic effector response and this may be particularly evident in older adults. We hypothesize that oral l-tyrosine supplementation will increase the sympathetic response to whole-body cooling and muscle metaboreflex activation. In a randomized, double-blind design, 11 young (Y = 24 ± 1 years) and 11 older participants (O = 68 ± 4 years) ingested either 150 mg kg -1 of l-tyrosine or placebo before commencing 30 min of whole-body cooling to induce a gradual decline in skin temperature from 34 to 30.5°C. Laser Doppler flux (LDF) was measured at the ventral forearm, and cutaneous vascular conductance (CVC) was calculated as CVC = LDF/mean arterial pressure and expressed as a percentage change from baseline (%ΔCVC). Two minutes of static hand-grip exercise (35% maximal voluntary contraction) followed by 3 min of postexercise ischaemia were implemented before and toward the end of the cooling bout. l-Tyrosine supplementation did not affect blood pressure or heart rate responses to exercise or postexercise ischaemia. However, the blunted vasoconstriction response to whole-body cooling in

  8. Nonlinear dynamics of skin blood flow response to mechanical and thermal stresses in the plantar foot of diabetics with peripheral neuropathy.

    Science.gov (United States)

    Liao, Fuyuan; Jan, Yih-Kuen

    2017-01-01

    Diabetic foot ulcers (DFU) are a major complication in diabetics. Impaired microvascular reactivity is a major contributor to the development of DFU and has been traditionally quantified by time-domain or frequency-domain measures of skin blood flow (SBF). These measures, however, are unable to characterize the changes of nonlinear dynamics of SBF associated with diabetes and peripheral neuropathy. The objective of this study was to investigate altered nonlinear dynamics of skin blood flow in the plantar foot of diabetics with peripheral neuropathy. 18 type 2 diabetics with peripheral neuropathy and 8 healthy controls were recruited. SBF at the first metatarsal head in response to a loading pressure of 300 mmHg and a local heating was measured using laser Doppler flowmetry. A sample entropy approach was used to quantify the degree of regularity of SBF. Our results showed that the regularity degree of SBF in the diabetic foot underwent only small changes during post-occlusive reactive hyperemia and thermally induced biphasic response compared to non-diabetics. SBF of the diabetic foot has higher degree of irregularity during reactive hyperemia because of attenuated myogenic activity, and demonstrated higher regularity during the biphasic response largely due to significantly enhanced cardiac activities. This study suggests that the regularity degree of SBF at the first metatarsal head could be used to assess impaired microvascular reactivity and thus may be used to assess the risk for DFU in diabetics with peripheralneuropathy.

  9. The differential response of the skin in young and old rats to a combination of X-rays and 'wet' or 'dry' hyperthermia

    International Nuclear Information System (INIS)

    Hamlet, R.; Hopewell, J.W.

    1986-01-01

    Hind feet of group of female rats aged 7, 14 and 52 weeks were X-irradiated at 20, 25 or 30 Gy. Hyperthermia (42.5 0 C for 1 h) was carried out immediately following irradiation using either 'wet' or 'dry' heat, by immersion in water or fluorocarbon liquid. Results demonstrated that 'wet' heat produced a consistently greater enhancement of the irradiation damage than 'dry'. The thermal enhancement ratio for irradiation plus 'wet' heat was approximately 1.5 and for irradiation plus 'dry' heat 1.17 to 1.39. Immersion of the feet in fluorocarbon liquid at 37 0 C did not significantly modify the irradiation response of the skin. The lower thermal enhancement ratios obtained using immersion in fluorocarbon liquid at 42.5 0 C are close to those obtained in large animal studies and similar to the limited amount of data from clinical studies where microwave or ultrasound heating techniques were used. It has been demonstrated that there are large age-related differences in the response of the rat foot skin to irradiation alone. It has also been shown, using rats of the same age, that the response to irradiation plus hyperthermia was less age dependent. (author)

  10. Differential response of the skin in young and old rats to a combination of X-rays and 'wet' or 'dry' hyperthermia

    Energy Technology Data Exchange (ETDEWEB)

    Hamlet, R.; Hopewell, J.W.

    1986-11-01

    Hind feet of group of female rats aged 7, 14 and 52 weeks were X-irradiated at 20, 25 or 30 Gy. Hyperthermia (42.5/sup 0/C for 1 h) was carried out immediately following irradiation using either 'wet' or 'dry' heat, by immersion in water or fluorocarbon liquid. Results demonstrated that 'wet' heat produced a consistently greater enhancement of the irradiation damage than 'dry'. The thermal enhancement ratio for irradiation plus 'wet' heat was approximately 1.5 and for irradiation plus 'dry' heat 1.17 to 1.39. Immersion of the feet in fluorocarbon liquid at 37/sup 0/C did not significantly modify the irradiation response of the skin. The lower thermal enhancement ratios obtained using immersion in fluorocarbon liquid at 42.5/sup 0/C are close to those obtained in large animal studies and similar to the limited amount of data from clinical studies where microwave or ultrasound heating techniques were used. It has been demonstrated that there are large age-related differences in the response of the rat foot skin to irradiation alone. It has also been shown, using rats of the same age, that the response to irradiation plus hyperthermia was less age dependent.

  11. Extraction of gelatin from salmon (Salmo salar) fish skin using trypsin-aided process: optimization by Plackett-Burman and response surface methodological approaches.

    Science.gov (United States)

    Fan, HuiYin; Dumont, Marie-Josée; Simpson, Benjamin K

    2017-11-01

    Gelatin from salmon ( Salmo salar ) skin with high molecular weight protein chains ( α -chains) was extracted using trypsin-aided process. Response surface methodology was used to optimise the extraction parameters. Yield, hydroxyproline content and protein electrophoretic profile via sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis of gelatin were used as responses in the optimization study. The optimum conditions were determined as: trypsin concentration at 1.49 U/g; extraction temperature at 45 °C; and extraction time at 6 h 16 min. This response surface optimized model was significant and produced an experimental value (202.04 ± 8.64%) in good agreement with the predicted value (204.19%). Twofold higher yields of gelatin with high molecular weight protein chains were achieved in the optimized process with trypsin treatment when compared to the process without trypsin.

  12. The role of variants from the innate immune system genes in tuberculosis and skin test response in a Native American population.

    Science.gov (United States)

    Lindenau, Juliana D; Salzano, Francisco M; Hurtado, Ana M; Hill, Kim R; Hutz, Mara H

    2016-10-01

    Native American populations show higher tuberculosis (TB) mortality and infectivity rates than non-Native populations. Variants in the innate immune system seem to have an important role on TB susceptibility. The role of some innate immune system variants in TB susceptibility and/or skin test response (PPD) were investigated in the Aché, a Native American population. Complement receptor 1 and toll like receptor 9 variants were associated with anergy to PPD and protection to TB, respectively. These findings demonstrate an important role of the innate immune system variants in TB susceptibility. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  13. Sympathetic- and Parasympathetic-Linked Cardiac Function and Prediction of Externalizing Behavior, Emotion Regulation, and Prosocial Behavior among Preschoolers Treated for ADHD

    Science.gov (United States)

    Beauchaine, Theodore P.; Gatzke-Kopp, Lisa; Neuhaus, Emily; Chipman, Jane; Reid, M. Jamila; Webster-Stratton, Carolyn

    2013-01-01

    Objective: To evaluate measures of cardiac activity and reactivity as prospective biomarkers of treatment response to an empirically supported behavioral intervention for attention-deficit/hyperactivity disorder (ADHD). Method: Cardiac preejection period (PEP), an index of sympathetic-linked cardiac activity, and respiratory sinus arrhythmia…

  14. Dry Skin Relief

    Science.gov (United States)

    ... on a budget Skin care products Skin care secrets Skin lighteners Skin of color Summer skin problems ... condition, such as eczema. Additional related information Dermatologists' top tips for relieving dry skin FIND A DERMATOLOGIST ...

  15. Impaired Memory Retrieval Correlates with Individual Differences in Cortisol Response but Not Autonomic Response

    Science.gov (United States)

    Tranel, Daniel; Adolphs, Ralph; Buchanan, Tony W.

    2006-01-01

    Stress can enhance or impair memory performance. Both cortisol release and sympathetic nervous system responses have been implicated in these differential effects. Here we investigated how memory retrieval might be affected by stress-induced cortisol release, independently of sympathetic nervous system stress responses. Thirty-two healthy…

  16. Skin cancer

    International Nuclear Information System (INIS)

    Yamada, Michiko

    1992-01-01

    This chapter reviews the development of skin cancer associated with radiation, focusing on the knowledge of A-bomb radiation-induced skin cancer. Since the discovery of X radiation in 1895, acute and chronic radiation dermatitis has been the first matter of concern. Then, in 1902, skin cancer found among radiological personnel has posed a social problem. In earlier study determining the relationship between skin cancer and A-bomb radiation, there is no increase in the incidence of either skin cancer or precancerous condition during the first 20 years after A-bombing. More recent studies have showed that there is a significant correlation between the incidence of skin cancer and distance from the hypocenter; and the incidence of skin cancer is found to be remarkably increased since 1975 in the group exposed at ≤2,000 m. Excess relative risk is 2.2 at one Gy dose. The incidence of skin cancer is also found to be extremely increased with aging. Relative risk is high in younger A-bomb survivors at the time of exposure. Histologically, basal cell carcinoma is more senstitive to ionizing radiation than squamous cell carcinoma. (N.K.)

  17. Sex differences in the modulation of vasomotor sympathetic outflow during static handgrip exercise in healthy young humans

    Science.gov (United States)

    Jarvis, Sara S.; VanGundy, Tiffany B.; Galbreath, M. Melyn; Shibata, Shigeki; Okazaki, Kazunobu; Reelick, Miriam F.; Levine, Benjamin D.

    2011-01-01

    Sex differences in sympathetic neural control during static exercise in humans are few and the findings are inconsistent. We hypothesized women would have an attenuated vasomotor sympathetic response to static exercise, which would be further reduced during the high sex hormone [midluteal (ML)] vs. the low hormone phase [early follicular (EF)]. We measured heart rate (HR), blood pressure (BP), and muscle sympathetic nerve activity (MSNA) in 11 women and 10 men during a cold pressor test (CPT) and static handgrip to fatigue with 2 min of postexercise circulatory arrest (PECA). HR increased during handgrip, reached its peak at fatigue, and was comparable between sexes. BP increased during handgrip and PECA where men had larger increases from baseline. Mean ± SD MSNA burst frequency (BF) during handgrip and PECA was lower in women (EF, P < 0.05), as was ΔMSNA-BF smaller (main effect, both P < 0.01). ΔTotal activity was higher in men at fatigue (EF: 632 ± 418 vs. ML: 598 ± 342 vs. men: 1,025 ± 416 a.u./min, P < 0.001 for EF and ML vs. men) and during PECA (EF: 354 ± 321 vs. ML: 341 ± 199 vs. men: 599 ± 327 a.u./min, P < 0.05 for EF and ML vs. men). During CPT, HR and MSNA responses were similar between sexes and hormone phases, confirming that central integration and the sympathetic efferent pathway was comparable between the sexes and across hormone phases. Women demonstrated a blunted metaboreflex, unaffected by sex hormones, which may be due to differences in muscle mass or fiber type and, therefore, metabolic stimulation of group IV afferents. PMID:21508291

  18. Simulating sympathetic detonation using the hydrodynamic models and constitutive equations

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Bo Hoon; Kim, Min Sung; Yoh, Jack J. [Dept. of Mechanical and Aerospace Engineering, Seoul National University, Seoul (Korea, Republic of); Sun, Tae Boo [Hanwha Corporation Defense Rand D Center, Daejeon (Korea, Republic of)

    2016-12-15

    A Sympathetic detonation (SD) is a detonation of an explosive charge by a nearby explosion. Most of times it is unintended while the impact of blast fragments or strong shock waves from the initiating donor explosive is the cause of SD. We investigate the SD of a cylindrical explosive charge (64 % RDX, 20 % Al, 16 % HTPB) contained in a steel casing. The constitutive relations for high explosive are obtained from a thermo-chemical code that provides the size effect data without the rate stick data typically used for building the rate law and equation of state. A full size SD test of eight pallet-packaged artillery shells is performed that provides the pressure data while the hydrodynamic model with proper constitutive relations for reactive materials and the fragmentation model for steel casing is conducted to replicate the experimental findings. The work presents a novel effort to accurately model and reproduce the sympathetic detonation event with a reduced experimental effort.

  19. Experiencing Physical Pain Leads to More Sympathetic Moral Judgments

    Science.gov (United States)

    Xiao, Qianguo; Zhu, Yi; Luo, Wen-bo

    2015-01-01

    Previous studies have shown that observing another’s pain can evoke other-oriented emotions, which instigate empathic concern for another’s needs. It is not clear whether experiencing first-hand physical pain may also evoke other-oriented emotion and thus influence people’s moral judgment. Based on the embodied simulation literature and neuroimaging evidence, the present research tested the idea that participants who experienced physical pain would be more sympathetic in their moral judgments. Study 1 showed that ice-induced physical pain facilitated higher self-assessments of empathy, which motivated participants to be more sympathetic in their moral judgments. Study 2 confirmed findings in study 1 and also showed that State Perspective Taking subscale of the State Empathy Scale mediated the effects of physical pain on moral judgment. These results provide support for embodied view of morality and for the view that pain can serve a positive psychosocial function. PMID:26465603

  20. The biophysics of renal sympathetic denervation using radiofrequency energy.

    Science.gov (United States)

    Patel, Hitesh C; Dhillon, Paramdeep S; Mahfoud, Felix; Lindsay, Alistair C; Hayward, Carl; Ernst, Sabine; Lyon, Alexander R; Rosen, Stuart D; di Mario, Carlo

    2014-05-01

    Renal sympathetic denervation is currently performed in the treatment of resistant hypertension by interventionists who otherwise do not typically use radiofrequency (RF) energy ablation in their clinical practice. Adequate RF lesion formation is dependent upon good electrode-tissue contact, power delivery, electrode-tissue interface temperature, target-tissue impedance and the size of the catheter's active electrode. There is significant interplay between these variables and hence an appreciation of the biophysical determinants of RF lesion formation is required to provide effective and safe clinical care to our patients. In this review article, we summarize the biophysics of RF ablation and explain why and how complications of renal sympathetic denervation may occur and discuss methods to minimise them.

  1. Menstrual cycle and skin reactivity

    DEFF Research Database (Denmark)

    Agner, T; Damm, P; Skouby, S O

    1991-01-01

    The hypothesis was tested that a cyclic variation exists in skin reactivity to irritant stimuli. Twenty-nine healthy women with regular menstrual cycles were challenged with sodium lauryl sulfate as an irritant patch test at day 1 and at days 9 through 11 of the menstrual cycle. The skin response...... to the applied irritant stimulus was evaluated by visual scoring and also quantified by measurements of transepidermal water loss, edema formation, and blood flow in the skin. The skin response to challenge with sodium lauryl sulfate was found to be significantly stronger at day 1 than at days 9 through 11...

  2. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  3. Anti-Inflammation Activities of Mycosporine-Like Amino Acids (MAAs in Response to UV Radiation Suggest Potential Anti-Skin Aging Activity

    Directory of Open Access Journals (Sweden)

    Sung-Suk Suh

    2014-10-01

    Full Text Available Certain photosynthetic marine organisms have evolved mechanisms to counteract UV-radiation by synthesizing UV-absorbing compounds, such as mycosporine-like amino acids (MAAs. In this study, MAAs were separated from the extracts of marine green alga Chlamydomonas hedleyi using HPLC and were identified as porphyra-334, shinorine, and mycosporine-glycine (mycosporine-Gly, based on their retention times and maximum absorption wavelengths. Furthermore, their structures were confirmed by triple quadrupole MS/MS. Their roles as UV-absorbing compounds were investigated in the human fibroblast cell line HaCaT by analyzing the expression levels of genes associated with antioxidant activity, inflammation, and skin aging in response to UV irradiation. The mycosporine-Gly extract, but not the other MAAs, had strong antioxidant activity in the 2,2-diphenyl-1-picryhydrazyl (DPPH assay. Furthermore, treatment with mycosporine-Gly resulted in a significant decrease in COX-2 mRNA levels, which are typically increased in response to inflammation in the skin, in a concentration-dependent manner. Additionally, in the presence of MAAs, the UV-suppressed genes, procollagen C proteinase enhancer (PCOLCE and elastin, which are related to skin aging, had increased expression levels equal to those in UV-mock treated cells. Interestingly, the increased expression of involucrin after UV exposure was suppressed by treatment with the MAAs mycosporine-Gly and shinorine, but not porphyra-334. This is the first report investigating the biological activities of microalgae-derived MAAs in human cells.

  4. Skin conductance biofeedback training in adults with drug-resistant temporal lobe epilepsy and stress-triggered seizures: a proof-of-concept study.

    Science.gov (United States)

    Micoulaud-Franchi, Jean-Arthur; Kotwas, Iliana; Lanteaume, Laura; Berthet, Christelle; Bastien, Mireille; Vion-Dury, Jean; McGonigal, Aileen; Bartolomei, Fabrice

    2014-12-01

    The present proof-of-concept study investigated the feasibility of skin conductance biofeedback training in reducing seizures in adults with drug-resistant temporal lobe epilepsy (TLE), whose seizures are triggered by stress. Skin conductance biofeedback aims to increase levels of peripheral sympathetic arousal in order to reduce cortical excitability. This might seem somewhat counterintuitive, since such autonomic arousal may also be associated with increased stress and anxiety. Thus, this sought to verify that patients with TLE and stress-triggered seizures are not worsened in terms of stress, anxiety, and negative emotional response to this nonpharmacological treatment. Eleven patients with drug-resistant TLE with seizures triggered by stress were treated with 12 sessions of biofeedback. Patients did not worsen on cognitive evaluation of attentional biases towards negative emotional stimuli (P>.05) or on psychometric evaluation with state anxiety inventory (P = .059); in addition, a significant improvement was found in the Negative Affect Schedule (P = .014) and in the Beck Depression Inventory (P = .009). Biofeedback training significantly reduced seizure frequency with a mean reduction of -48.61% (SD = 27.79) (P = .005). There was a correlation between the mean change in skin conductance activity over the biofeedback treatment and the reduction of seizure frequency (r(11) = .62, P = .042). Thus, the skin conductance biofeedback used in the present study, which teaches patients to achieve an increased level of peripheral sympathetic arousal, was a well-tolerated nonpharmacological treatment. Further, well-controlled studies are needed to confirm the therapeutic value of this nonpharmacological treatment in reducing seizures in adults with drug-resistant TLE with seizures triggered by stress. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Temperament Affects Sympathetic Nervous Function in a Normal Population

    OpenAIRE

    Kim, Bora; Lee, Jae-Hon; Kang, Eun-Ho; Yu, Bum-Hee

    2012-01-01

    Objective Although specific temperaments have been known to be related to autonomic nervous function in some psychiatric disorders, there are few studies that have examined the relationship between temperaments and autonomic nervous function in a normal population. In this study, we examined the effect of temperament on the sympathetic nervous function in a normal population. Methods Sixty eight healthy subjects participated in the present study. Temperament was assessed using the Korean vers...

  6. Cardiorespiratory Coupling: Common Rhythms in Cardiac, Sympathetic, and Respiratory Activities

    Science.gov (United States)

    Dick, Thomas E.; Hsieh, Yee-Hsee; Dhingra, Rishi R.; Baekey, David M.; Galán, Roberto F.; Wehrwein, Erica; Morris, Kendall F.

    2014-01-01

    Cardiorespiratory coupling is an encompassing term describing more than the well-recognized influences of respiration on heart rate and blood pressure. Our data indicate that cardiorespiratory coupling reflects a reciprocal interaction between autonomic and respiratory control systems, and the cardiovascular system modulates the ventilatory pattern as well. For example, cardioventilatory coupling refers to the influence of heart beats and arterial pulse pressure on respiration and is the tendency for the next inspiration to start at a preferred latency after the last heart beat in expiration. Multiple complementary, well-described mechanisms mediate respiration’s influence on cardiovascular function, whereas mechanisms mediating the cardiovascular system’s influence on respiration may only be through the baroreceptors but are just being identified. Our review will describe a differential effect of conditioning rats with either chronic intermittent or sustained hypoxia on sympathetic nerve activity but also on ventilatory pattern variability. Both intermittent and sustained hypoxia increase sympathetic nerve activity after 2 weeks but affect sympatho-respiratory coupling differentially. Intermittent hypoxia enhances sympatho-respiratory coupling, which is associated with low variability in the ventilatory pattern. In contrast, after constant hypobaric hypoxia, 1-to-1 coupling between bursts of sympathetic and phrenic nerve activity is replaced by 2-to-3 coupling. This change in coupling pattern is associated with increased variability of the ventilatory pattern. After baro-denervating hypobaric hypoxic-conditioned rats, splanchnic sympathetic nerve activity becomes tonic (distinct bursts are absent) with decreases during phrenic nerve bursts and ventilatory pattern becomes regular. Thus, conditioning rats to either intermittent or sustained hypoxia accentuates the reciprocal nature of cardiorespiratory coupling. Finally, identifying a compelling physiologic

  7. Rats with steroid-induced polycystic ovaries develop hypertension and increased sympathetic nervous system activity

    Directory of Open Access Journals (Sweden)

    Ploj Karolina

    2005-09-01

    Full Text Available Abstract Background Polycystic ovary syndrome (PCOS is a complex endocrine and metabolic disorder associated with ovulatory dysfunction, abdominal obesity, hyperandrogenism, hypertension, and insulin resistance. Methods Our objectives in this study were (1 to estimate sympathetic-adrenal medullary (SAM activity by measuring mean systolic blood pressure (MSAP in rats with estradiol valerate (EV-induced PCO; (2 to estimate alpha1a and alpha2a adrenoceptor expression in a brain area thought to mediate central effects on MSAP regulation and in the adrenal medulla; (3 to assess hypothalamic-pituitary-adrenal (HPA axis regulation by measuring adrenocorticotropic hormone (ACTH and corticosterone (CORT levels in response to novel-environment stress; and (4 to measure abdominal obesity, sex steroids, and insulin sensitivity. Results The PCO rats had significantly higher MSAP than controls, higher levels of alpha1a adrenoceptor mRNA in the hypothalamic paraventricular nucleus (PVN, and lower levels of alpha2a adrenoceptor mRNA in the PVN and adrenal medulla. After exposure to stress, PCO rats had higher ACTH and CORT levels. Plasma testosterone concentrations were lower in PCO rats, and no differences in insulin sensitivity or in the weight of intraabdominal fat depots were found. Conclusion Thus, rats with EV-induced PCO develop hypertension and increased sympathetic and HPA-axis activity without reduced insulin sensitivity, obesity, or hyperandrogenism. These findings may have implications for mechanisms underlying hypertension in PCOS.

  8. Reactive oxygen species in the paraventricular nucleus of the hypothalamus alter sympathetic activity during metabolic syndrome.

    Directory of Open Access Journals (Sweden)

    JOSIANE CAMPOS CRUZ

    2015-12-01

    Full Text Available The paraventricular nucleus of the hypothalamus (PVN contains heterogeneous populations of neurons involved in autonomic and neuroendocrine regulation. The PVN plays an important role in the sympathoexcitatory response to increasing circulating levels of angiotensin II (Ang-II, which activates AT1 receptors in the circumventricular organs (OCVs, mainly in the subfornical organ (SFO. Circulating Ang-II induces a de novo synthesis of Ang-II in SFO neurons projecting to pre-autonomic PVN neurons. Activation of AT1 receptors induces intracellular increases in reactive oxygen species (ROS, leading to increases in sympathetic nerve activity (SNA. Chronic sympathetic nerve activation promotes a series of metabolic disorders that characterizes the metabolic syndrome (MetS: dyslipidemia, hyperinsulinemia, glucose intolerance, hyperleptinemia and elevated plasma hormone levels, such as noradrenaline, glucocorticoids, leptin, insulin and Ang-II. This review will discuss the contribution of our laboratory and others regarding the sympathoexcitation caused by peripheral Ang-II-induced reactive oxygen species along the subfornical organ and paraventricular nucleus of the hypothalamus. We hypothesize that this mechanism could be involved in metabolic disorders underlying MetS.

  9. Sympathetic cooling of ions in a hybrid atom ion trap

    Energy Technology Data Exchange (ETDEWEB)

    Hoeltkemeier, Bastian

    2016-10-27

    In this thesis the dynamics of a trapped ion immersed in a spatially localized buffer gas is investigated. For a homogeneous buffer gas, the ion's energy distribution reaches a stable equilibrium only if the mass of the buffer gas atoms is below a critical value. This limitation can be overcome by using multipole traps in combination and/or a spatially confined buffer gas. Using a generalized model for elastic collisions of the ion with the buffer gas atoms, the ion's energy distribution is numerically determined for arbitrary buffer gas distributions and trap parameters. Three regimes characterized by the respective analytic form of the ion's equilibrium energy distribution are found. One of these is a novel regime at large atom-to-ion mass ratios where the final ion temperature can tuned by adiabatically decreasing the spatial extension of the buffer gas and the effective ion trap depth (forced sympathetic cooling). The second part of the thesis presents a hybrid atom ion trap designed for sympathetic cooling of hydroxide anions. In this hybrid trap the anions are immersed in a cloud of laser cooled rubidium atoms. The translational and rovibrational temperatures of the anions is probed by photodetachment tomography and spectroscopy which shows the first ever indication of sympathetic cooling of anions by laser cooled atoms.

  10. Delayed-type hypersensitivity skin test responses to PPD and other antigens among BCG-vaccinated HIV-1-infected and healthy children and adolescents.

    Science.gov (United States)

    Costa, Natalia Moriya Xavierda; Albuquerque, Maly de; Lins, Janaína Bacelar Acioli; Alvares-Junior, João Teixeira; Stefani, Mariane Martins de Araújo

    2011-10-01

    Among HIV-1-infected patients, CD4+ T cell counts are well-established markers of cell-mediated immunity. Delayed-type hypersensitivity (DTH) skin tests can be used to evaluate in vivo cell-mediated immunity to common antigens. DTH responses to tuberculin purified protein derivative (PPD), sporotrichin, trichophytin, candidin and streptokinase/streptodornase antigens were assessed. Thirty-six HIV-1-infected children/adolescents and 56 age- and sex-matched HIV-1/HIV-2-seronegative participants were tested. All participants had a BCG scar. Fisher's exact test was used to evaluate significant differences between groups (pPPD positivity prevailed among healthy participants (40/56, 71.4%). PPD reactivity in the HIV-1-positive group was 8.3% (pPPD induration was 2.5mm (range: 2-5mm) in the HIV-1 group and 6.0 mm among healthy participants (range: 3-15 mm). There was no correlation between PPD positivity and age. No correlation between CD4+ T cell counts and DTH reactivity was observed among HIV-1-infected patients. DTH skin test responses, including PPD reactivity, were significantly lower among HIV-1-infected participants compared to healthy controls, which likely reflects advanced disease and T cell depletion.

  11. Detection of pathogenic bacteria in skin lesions of patients with chiclero's ulcer: reluctant response to antimonial treatment

    Directory of Open Access Journals (Sweden)

    Isaac-Márquez Angélica Patricia

    2003-01-01

    Full Text Available We investigated the bacterial flora present in skin lesions of patients with chiclero's ulcer from the Yucatan peninsula of Mexico using conventional culture methods (11 patients, and an immunocolorimetric detection of pathogenic Streptococcus pyogenes (15 patients. Prevalence of bacteria isolated by culture methods was 90.9% (10/11. We cultured, from chiclero's ulcers (60%, pathogenic bacterial such as Staphylococcus aureus (20%, S. pyogenes (1.6%, Pseudomonas aeruginosa (1.6%, Morganella morganii (1.6%, and opportunist pathogenic bacteria such as Klebsiella spp. (20.0%, Enterobacter spp. (20%, and Enterococcus spp. (20%. We also cultured coagulase-negative staphylococci in 40% (4/10 of the remaining patients. Micrococcus spp. and coagulase-negative staphylococci constituted the bacterial genuses more frequently isolated in the normal