WorldWideScience

Sample records for survived lethal vaccinia

  1. Protection of Mice from Lethal Vaccinia Virus Infection by Vaccinia Virus Protein Subunits with a CpG Adjuvant

    Directory of Open Access Journals (Sweden)

    Sarah Reeman

    2017-12-01

    Full Text Available Smallpox vaccination carries a high risk of adverse events in recipients with a variety of contra-indications for live vaccines. Although alternative non-replicating vaccines have been described in the form of replication-deficient vaccine viruses, DNA vaccines, and subunit vaccines, these are less efficacious than replicating vaccines in animal models. DNA and subunit vaccines in particular have not been shown to give equivalent protection to the traditional replicating smallpox vaccine. We show here that combinations of the orthopoxvirus A27, A33, B5 and L1 proteins give differing levels of protection when administered in different combinations with different adjuvants. In particular, the combination of B5 and A27 proteins adjuvanted with CpG oligodeoxynucleotides (ODN gives a level of protection in mice that is equivalent to the Lister traditional vaccine in a lethal vaccinia virus challenge model.

  2. Vaccinia scars associated with better survival for adults. An observational study from Guinea-Bissau

    DEFF Research Database (Denmark)

    Aaby, Peter; Gustafson, Per; Roth, Adam Anders Edvin

    2006-01-01

    Live vaccines including BCG and measles may have non-targeted beneficial effects on childhood survival in areas with high mortality. The authors therefore undertook a survey of vaccinia scars to evaluate subsequent mortality.......Live vaccines including BCG and measles may have non-targeted beneficial effects on childhood survival in areas with high mortality. The authors therefore undertook a survey of vaccinia scars to evaluate subsequent mortality....

  3. The NYCBH vaccinia virus deleted for the innate immune evasion gene, E3L, protects rabbits against lethal challenge by rabbitpox virus

    Science.gov (United States)

    Denzler, Karen L; Rice, Amanda D; MacNeill, Amy L; Fukushima, Nobuko; Lindsey, Scott F; Wallace, Greg; Burrage, Andrew M; Smith, Andrew J; Manning, Brandi R; Swetnam, Daniele M; Gray, Stacey A; Moyer, RW; Jacobs, Bertram L

    2011-01-01

    Vaccinia virus deleted for the innate immune evasion gene, E3L, has been shown to be highly attenuated and yet induces a protective immune response against challenge by homologous virus in a mouse model. In this manuscript the NYCBH vaccinia virus vaccine strain was compared to NYCBH vaccinia virus deleted for E3L (NYCBHΔE3L) in a rabbitpox virus (RPV) challenge model. Upon scarification, both vaccines produced a desired skin lesion, although the lesion produced by NYCBHΔE3L was smaller. Both vaccines fully protected rabbits against lethal challenge by escalating doses of RPV, from 10 LD50 to 1,000 LD50. A single dose of NYCBHΔE3L protected rabbits from weight loss, fever, and clinical symptoms following the lowest dose challenge of 10 LD50, however it allowed a moderate level of RPV replication at the challenge site, some spread to external skin and mucosal surfaces, and increased numbers of secondary lesions as compared to vaccination with NYCBH. Alternately, two doses of NYCBHΔE3L fully protected rabbits from weight loss, fever, and clinical symptoms, following challenge with 100 to 1,000 LD50 RPV, and it prevented development of secondary lesions similar to protection seen with NYCBH. Finally, vaccination with either one or two doses of NYCBHΔE3L resulted in similar neutralizing antibody titers following RPV challenge as compared to titers obtained by vaccination with NYCBH. These results support the efficacy of the attenuated NYCBHΔE3L in protection against an orthologous poxvirus challenge. PMID:21840358

  4. Fasting protects mice from lethal DNA damage by promoting small intestinal epithelial stem cell survival.

    Science.gov (United States)

    Tinkum, Kelsey L; Stemler, Kristina M; White, Lynn S; Loza, Andrew J; Jeter-Jones, Sabrina; Michalski, Basia M; Kuzmicki, Catherine; Pless, Robert; Stappenbeck, Thaddeus S; Piwnica-Worms, David; Piwnica-Worms, Helen

    2015-12-22

    Short-term fasting protects mice from lethal doses of chemotherapy through undetermined mechanisms. Herein, we demonstrate that fasting preserves small intestinal (SI) architecture by maintaining SI stem cell viability and SI barrier function following exposure to high-dose etoposide. Nearly all SI stem cells were lost in fed mice, whereas fasting promoted sufficient SI stem cell survival to preserve SI integrity after etoposide treatment. Lineage tracing demonstrated that multiple SI stem cell populations, marked by Lgr5, Bmi1, or HopX expression, contributed to fasting-induced survival. DNA repair and DNA damage response genes were elevated in SI stem/progenitor cells of fasted etoposide-treated mice, which importantly correlated with faster resolution of DNA double-strand breaks and less apoptosis. Thus, fasting preserved SI stem cell viability as well as SI architecture and barrier function suggesting that fasting may reduce host toxicity in patients undergoing dose intensive chemotherapy.

  5. Chloroquine Improves Survival and Hematopoietic Recovery After Lethal Low-Dose-Rate Radiation

    Energy Technology Data Exchange (ETDEWEB)

    Lim Yiting [Department of Oncology, Sidney Kimmel Comprehensive Cancer Center, Johns Hopkins University School of Medicine, Baltimore, Maryland (United States); Hedayati, Mohammad; Merchant, Akil A.; Zhang Yonggang; Yu, Hsiang-Hsuan M. [Department of Radiation Oncology and Molecular Radiation Sciences, Sidney Kimmel Comprehensive Cancer Center, Johns Hopkins University School of Medicine, Baltimore, Maryland (United States); Kastan, Michael B. [Department of Oncology, St. Jude Children' s Research Hospital, Memphis, Tennessee (United States); Department of Pharmacology and Cancer Biology, Duke University School of Medicine, Durham, North Carolina (United States); Matsui, William, E-mail: matsuwi@jhmi.edu [Department of Oncology, Sidney Kimmel Comprehensive Cancer Center, Johns Hopkins University School of Medicine, Baltimore, Maryland (United States); DeWeese, Theodore L., E-mail: deweete@jhmi.edu [Department of Radiation Oncology and Molecular Radiation Sciences, Sidney Kimmel Comprehensive Cancer Center, Johns Hopkins University School of Medicine, Baltimore, Maryland (United States)

    2012-11-01

    Purpose: We have previously shown that the antimalarial agent chloroquine can abrogate the lethal cellular effects of low-dose-rate (LDR) radiation in vitro, most likely by activating the ataxia-telangiectasia mutated (ATM) protein. Here, we demonstrate that chloroquine treatment also protects against lethal doses of LDR radiation in vivo. Methods and Materials: C57BL/6 mice were irradiated with a total of 12.8 Gy delivered at 9.4 cGy/hour. ATM null mice from the same background were used to determine the influence of ATM. Chloroquine was administered by two intraperitoneal injections of 59.4 {mu}g per 17 g of body weight, 24 hours and 4 hours before irradiation. Bone marrow cells isolated from tibia, fibula, and vertebral bones were transplanted into lethally irradiated CD45 congenic recipient mice by retroorbital injection. Chimerism was assessed by flow cytometry. In vitro methylcellulose colony-forming assay of whole bone marrow cells and fluorescence activated cell sorting analysis of lineage depleted cells were used to assess the effect of chloroquine on progenitor cells. Results: Mice pretreated with chloroquine before radiation exhibited a significantly higher survival rate than did mice treated with radiation alone (80% vs. 31%, p = 0.0026). Chloroquine administration before radiation did not affect the survival of ATM null mice (p = 0.86). Chloroquine also had a significant effect on the early engraftment of bone marrow cells from the irradiated donor mice 6 weeks after transplantation (4.2% vs. 0.4%, p = 0.015). Conclusion: Chloroquine administration before radiation had a significant effect on the survival of normal but not ATM null mice, strongly suggesting that the in vivo effect, like the in vitro effect, is also ATM dependent. Chloroquine improved the early engraftment of bone marrow cells from LDR-irradiated mice, presumably by protecting the progenitor cells from radiation injury. Chloroquine thus could serve as a very useful drug for protection

  6. Syzygium jambolanum treatment improves survival in lethal sepsis induced in mice

    Directory of Open Access Journals (Sweden)

    Amaral Flávia MM

    2008-10-01

    Full Text Available Abstract Background The leaves and the fruits from Syzygium jambolanum DC.(Myrtaceae, a plant known in Brazil as sweet olive or 'jambolão', have been used by native people to treat infectious diseases, diabetes, and stomachache. Since the bactericidal activity of S. jambolanum has been confirmed in vitro, the aim of this work was to evaluate the effect of the prophylactic treatment with S. jambolanum on the in vivo polymicrobial infection induced by cecal ligation and puncture (CLP in mice. Methods C57Bl/6 mice were treated by the subcutaneous route with a hydroalcoholic extract from fresh leaves of S. jambolanum (HCE. After 6 h, a bacterial infection was induced in the peritoneum using the lethal CLP model. The mice were killed 12 h after the CLP induction to evaluate the cellular influx and local and systemic inflammatory mediators' production. Some animals were maintained alive to evaluate the survival rate. Results The prophylactic HCE treatment increased the mice survival, the neutrophil migration to infectious site, the spreading ability and the hydrogen peroxide release, but decreased the serum TNF and nitrite. Despite the increased migration and activation of peritoneal cells the HCE treatment did not decrease the number of CFU. The HCE treatment induced a significant decrease on the bone marrow cells number but did not alter the cell number of the spleen and lymph node. Conclusion We conclude that the treatment with S. jambolanum has a potent prophylactic anti-septic effect that is not associated to a direct microbicidal effect but it is associated to a recruitment of activated neutrophils to the infectious site and to a diminished systemic inflammatory response.

  7. Simulation and Validation of Cisco Lethal Conditions in Minnesota Lakes under Past and Future Climate Scenarios Using Constant Survival Limits

    Directory of Open Access Journals (Sweden)

    Liping Jiang

    2016-07-01

    Full Text Available Fish habitat in lakes is strongly constrained by water temperature (T and available dissolved oxygen (DO that are changed under climate warming. A one dimensional, dynamic water quality model MINLAKE2012 was used for T and DO simulation over 48 years. A fish habitat model FishHabitat2013 using simulated T and DO profiles as input was developed to determine lethal conditions of cisco Corgenous artedi in Minnesota lakes. Twenty-three lakes that had observations of cisco mortality or survival in the unusually warm summer of 2006 were used for model validation. The cisco habitat model used a lethal temperature of 22.1 °C and DO survival limit of 3 mg/L determined through model validation and sensitivity analysis. Cisco lethal conditions in 12 shallow, 16 medium-depth, and 30 deep virtual lakes were then simulated. Isopleths of total number of years with cisco kill and average cisco kill days for the years with kills under past (1961–2008 and future climate were generated to understand/extrapolate climate impacts on cisco in 620 Minnesota lakes. Shallow and medium-depth lakes are projected to not be good candidates for cisco refuge lakes, but deep lakes are possible cisco refuge lakes based on lethal condition projection under future warmer climate.

  8. Tityus serrulatus scorpion venom improves survival and lung inflammation in lethal sepsis induced by CLP in mice.

    Science.gov (United States)

    Maciel, Márcia C G; Fialho, Eder M S; Guerra, Rosane N M; Borges, Valéria M; Kwasniewski, Fábio H; Nascimento, Flávia R F

    2014-10-01

    Tityus serrulatus venom (Tsv) modifies the behavior of immune cells and induces the production of inflammatory and anti-inflammatory cytokines; such action may interfere with physiological or pathological states. Because sepsis is characterized as an inflammatory disorder, the aim of present study was to investigate the effect of a non-lethal dose of Tsv in mice submitted to a polymicrobial infection by cecal ligation and puncture (CLP) model. The parameters evaluated were survival index, cellularity on lymphoid organs, peritoneal cavity and brochoalveolar space, production of IL-10, IL-12, IL-6, TNF-α, IFN-γ and MCP-1, pulmonary inflammation and oxidative burst. The results demonstrated that in sharp contrast to CLP group in which sepsis was lethal in a 24 h period all mice pretreated with Tsv survived even 60 h after CLP. Lung inflammation, another hallmark of CLP group, was also dramatically down regulated in Tsv/CLP group. Despite pretreatment with Tsv did not reduce the inflammatory serum cytokines when compared to CLP group; there was an increase in IL-10. In conclusion, subcutaneous Tsv administration 6 h before CLP was able to control the harmful effects of sepsis (lethality and lung inflammation). We suggest that both systemic IL-10 and oxidative burst are involved in this effect. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Passive administration of monoclonal antibodies to Anthrolysin O prolong survival in mice lethally infected with Bacillus anthracis

    Directory of Open Access Journals (Sweden)

    Rest Richard F

    2008-09-01

    Full Text Available Abstract Background Bacillus anthracis has two major virulence factors: a tripartite toxin that produces lethal and edema toxins and a polyglutamic acid capsule. A recent report suggested that a toxin belonging to the cholesterol dependant cytolysin (CDC family, anthrolysin O (ALO was a new virulence factor for B. anthracis but subsequent studies have questioned its relevance in pathogenesis. In this study, we examined the immunogenicity of recombinant anthrolysin O (rALO in mice. Results BALB/c mice immunized with rALO and boosted after two weeks, produce sera with strong Ab responses with a predominance of IgG1 and IgG2a. Five hybridomas to rALO were recovered representing the IgM, IgG1, and IgG2b isotypes. Passive administration of 3 of the five monoclonal antibodies (mAbs to rALO prior to infection with lethal intravenous (i.v. B. anthracis Sterne strain infection in mice was associated with enhanced average survival and a greater likelihood of surviving infection. A combination of two mAbs to ALO was more effective than either mAb separately. One mAb (64F8 slowed the toxicity of rALO for J774.16 macrophage-like cells. Conclusion Our results suggest that ALO contributes to the virulence of B. anthracis Sterne strain in this infection model and that Ab response to ALO may contribute to protection in certain circumstances.

  10. Extended hypoxia in the alfalfa leafcutting bee, Megachile rotundata, increases survival but causes sub-lethal effects.

    Science.gov (United States)

    Abdelrahman, H; Rinehart, J P; Yocum, G D; Greenlee, K J; Helm, B R; Kemp, W P; Schulz, C H; Bowsher, J H

    2014-05-01

    Many insects are tolerant of hypoxic conditions, but survival may come at a cost to long-term health. The alfalfa leaf-cutting bee, Megachile rotundata, develops in brood cells inside natural cavities, and may be exposed to hypoxic conditions for extended periods of time. Whether M. rotundata is tolerant of hypoxia, and whether exposure results in sub-lethal effects, has never been investigated. Overwintering M. rotundata prepupae were exposed to 10%, 13%, 17%, 21% and 24% O2 for 11 months. Once adults emerged, five indicators of quality - emergence weight, body size, feeding activity, flight performance, and adult longevity, - were measured to determine whether adult bees that survived past exposure to hypoxia were competent pollinators. M. rotundata prepupae are tolerant of hypoxic condition and have higher survival rates in hypoxia, than in normoxia. Under hypoxia, adult emergence rates did not decrease over the 11 months of the experiment. In contrast, bees reared in normoxia had decreased emergence rates by 8 months, and were dead by 11 months. M. rotundata prepupae exposed to extended hypoxic conditions had similar emergence weight, head width, and cross-thorax distance compared to bees reared in standard 21% oxygen. Despite no significant morphological differences, hypoxia-exposed bees had lower feeding rates and shorter adult lifespans. Hypoxia may play a role in post-diapause physiology of M. rotundata, with prepupae showing better survival under hypoxic conditions. Extended exposure to hypoxia, while not fatal, causes sub-lethal effects in feeding rates and longevity in the adults, indicating that hypoxia tolerance comes at a cost. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  11. Progressive Vaccinia: Case Description and Laboratory-Guided Therapy With Vaccinia Immune Globulin, ST-246, and CMX001

    Science.gov (United States)

    Lederman, Edith R.; Davidson, Whitni; Groff, Harold L.; Smith, Scott K.; Warkentien, Tyler; Li, Yu; Wilkins, Kimberly A.; Karem, Kevin L.; Akondy, Rama S.; Ahmed, Rafi; Frace, Michael; Shieh, Wun-Ju; Zaki, Sherif; Hruby, Dennis E.; Painter, Wendy P.; Bergman, Kimberly L.; Cohen, Jeffrey I.; Damon, Inger K.

    2012-01-01

    Progressive vaccinia (PV) is a rare but potentially lethal complication that develops in smallpox vaccine recipients with severely impaired cellular immunity. We describe a patient with PV who required treatment with vaccinia immune globulin and who received 2 investigational agents, ST-246 and CMX001. We describe the various molecular, pharmacokinetic, and immunologic studies that provided guidance to escalate and then successfully discontinue therapy. Despite development of resistance to ST-246 during treatment, the patient had resolution of PV. This case demonstrates the need for continued development of novel anti-orthopoxvirus pharmaceuticals and the importance of both intensive and timely clinical and laboratory support in management of PV. PMID:22904336

  12. Brazilian Vaccinia Viruses and Their Origins

    Centers for Disease Control (CDC) Podcasts

    2007-07-30

    Smallpox was eradicated more than 25 years ago, but live viruses used in vaccines may have survived to cause animal and human illness today. Dr. Inger Damon, Acting Branch Chief of the Poxvirus and Rabies Branch at CDC, discusses efforts to determine origins and spread of vaccinia viruses in Brazil.  Created: 7/30/2007 by Emerging Infectious Diseases.   Date Released: 7/30/2007.

  13. Role of Listeria monocytogenes sigma(B) in survival of lethal acidic conditions and in the acquired acid tolerance response.

    Science.gov (United States)

    Ferreira, Adriana; Sue, David; O'Byrne, Conor P; Boor, Kathryn J

    2003-05-01

    The food-borne pathogen Listeria monocytogenes can acquire enhanced resistance to lethal acid conditions through multiple mechanisms. We investigated contributions of the stress-responsive alternative sigma factor, sigma(B), which is encoded by sigB, to growth phase-dependent acid resistance (AR) and to the adaptive acid tolerance response in L. monocytogenes. At various points throughout growth, we compared the relative survival of L. monocytogenes wild-type and DeltasigB strains that had been exposed to either brain heart infusion (pH 2.5) or synthetic gastric fluid (pH 2.5) with and without prior acid adaptation. Under these conditions, survival of the DeltasigB strain was consistently lower than that of the wild-type strain throughout all phases of growth, ranging from 4 orders of magnitude less in mid-log phase to 2 orders of magnitude less in stationary phase. Survival of both DeltasigB and wild-type L. monocytogenes strains increased by 6 orders of magnitude upon entry into stationary phase, demonstrating that the L. monocytogenes growth phase-dependent AR mechanism is sigma(B) independent. sigma(B)-mediated contributions to acquired acid tolerance appear to be greatest in early logarithmic growth. Loss of a functional sigma(B) reduced the survival of L. monocytogenes at pH 2.5 to a greater extent in the presence of organic acid (100 mM acetic acid) than in the presence of inorganic acid alone (HCl), suggesting that L. monocytogenes protection against organic and inorganic acid may be mediated through different mechanisms. sigma(B) does not appear to contribute to pH(i) homeostasis through regulation of net proton movement across the cell membrane or by regulation of pH(i) buffering by the GAD system under the conditions examined in this study. In summary, a functional sigma(B) protein is necessary for full resistance of L. monocytogenes to lethal acid treatments.

  14. Composition of symbiotic bacteria predicts survival in Panamanian golden frogs infected with a lethal fungus.

    Science.gov (United States)

    Becker, Matthew H; Walke, Jenifer B; Cikanek, Shawna; Savage, Anna E; Mattheus, Nichole; Santiago, Celina N; Minbiole, Kevin P C; Harris, Reid N; Belden, Lisa K; Gratwicke, Brian

    2015-04-22

    Symbiotic microbes can dramatically impact host health and fitness, and recent research in a diversity of systems suggests that different symbiont community structures may result in distinct outcomes for the host. In amphibians, some symbiotic skin bacteria produce metabolites that inhibit the growth of Batrachochytrium dendrobatidis (Bd), a cutaneous fungal pathogen that has caused many amphibian population declines and extinctions. Treatment with beneficial bacteria (probiotics) prevents Bd infection in some amphibian species and creates optimism for conservation of species that are highly susceptible to chytridiomycosis, the disease caused by Bd. In a laboratory experiment, we used Bd-inhibitory bacteria from Bd-tolerant Panamanian amphibians in a probiotic development trial with Panamanian golden frogs, Atelopus zeteki, a species currently surviving only in captive assurance colonies. Approximately 30% of infected golden frogs survived Bd exposure by either clearing infection or maintaining low Bd loads, but this was not associated with probiotic treatment. Survival was instead related to initial composition of the skin bacterial community and metabolites present on the skin. These results suggest a strong link between the structure of these symbiotic microbial communities and amphibian host health in the face of Bd exposure and also suggest a new approach for developing amphibian probiotics. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  15. Lethal and Sublethal Toxicity Comparison of BFRs to Three Marine Planktonic Copepods: Effects on Survival, Metabolism and Ingestion.

    Directory of Open Access Journals (Sweden)

    Wenjing Gong

    Full Text Available The estuarine planktonic copepods have a wide geographical distribution and commendable tolerance to various kinds of contaminants. The primary aim of the present study was to contrast the impacts of model POPs (TBBPA and HBCD on three common estuarine planktonic copepods (Oithona similis, Acartia pacifica and Pseudodiaptomus inopinus and establish a protocol for the assessment of acute toxicity of marine organic pollutants. We first quantified the 96h-LC50 (0.566, 0.04 and 0.257 mg/L of TBBPA to the three subjects above respectively and 0.314 mg/L of HBCD to P. inopinus; all reported concentrations are nominal values. In the sub-lethal toxicity tests, it was turned out that the effects of copepods exposed to TBBPA could product different influences on the energy ingestion and metabolism. Different type of pollutions, meanwhile, could also bring varying degree effect on the target copepods. In general, the indicators (the rate of oxygen consumption, ammonia excretion, food ingestion and filtration in higher concentration groups showed marked significant difference compared with controls as well a dose-effect relationship. The study also extended the research on the joint toxicity of TBBPA and HBCD based on the survival rate of P.inopinus. Whether 1:1 concentration or 1:1 toxic level, the research showed synergy effect relative to single exposure conditions. The result indicated that current single ecological testing used for environmental protection activities may underestimate the risk for copepods. It was also demonstrated that short-term sub-lethal experiment could be a standard to evaluate the sensitivity of copepods to POPs.

  16. Vaccinia Virus Recombinants: Expression of VSV Genes and Protective Immunization of Mice and Cattle

    Science.gov (United States)

    Mackett, M.; Yilma, T.; Rose, J. K.; Moss, B.

    1985-01-01

    Vesicular stomatitis virus (VSV) causes a contagious disease of horses, cattle, and pigs. When DNA copies of messenger RNA's for the G or N proteins of VSV were linked to a vaccinia virus promoter and inserted into the vaccinia genome, the recombinants retained infectivity and synthesized VSV polypeptides. After intradermal vaccination with live recombinant virus expressing the G protein, mice produced VSV-neutralizing antibodies and were protected against lethal encephalitis upon intravenous challenge with VSV. In cattle, the degree of protection against intradermalingually injected VSV was correlated with the level of neutralizing antibody produced following vaccination.

  17. [Inclusion of prehospital mortality statistics in severe trauma registries: a study of the influence of inclusion on trauma lethality rates and survival prediction].

    Science.gov (United States)

    Fortún Moral, Mariano; Ali Ali, Bismil; Montes Fernández, Luisa M; Rey Pecharroman, José Miguel; Teijeira Álvarez, Rafael; Belzunegui Otano, Tomás

    2016-06-01

    To compare the frequency and characteristics of prehospital and hospital deaths and assess whether injury severity and age can predict mortality when prehospital deaths are included or excluded from total mortality. Descriptive analysis of a retrospective cohort of 918 patients with multiple injuries attended by emergency medical services in Navarre, Spain, in 2010-2013. We analyzed prehospital and hospital deaths by cause of injuries and developed and compared the precision of logistic regression models to predict mortality. Most deaths occurred before arrival at a hospital. Three quarters of prehospital deaths occurred in patients under the age of 65 years. When prehospital deaths were included in the analysis, the lethality rate after traffic accidents rose from 16% to 42%; lethality from firearm injuries rose from 13% to 70%. When the model using the new injury severity score and age as independent variables was asked to predict survival with and without data for deaths at the scene or during transfer to a hospital, the model's performance differed only slightly. Most deaths from injuries occur before patients reach a hospital. The main characteristics of prehospital and hospital deaths differ. Including data for prehospital deaths in regression models does not change survival prediction based on injury severity and age.

  18. Mouse survival motor neuron alleles that mimic SMN2 splicing and are inducible rescue embryonic lethality early in development but not late.

    Directory of Open Access Journals (Sweden)

    Suzan M Hammond

    Full Text Available Spinal muscular atrophy (SMA is caused by low survival motor neuron (SMN levels and patients represent a clinical spectrum due primarily to varying copies of the survival motor neuron-2 (SMN2 gene. Patient and animals studies show that disease severity is abrogated as SMN levels increase. Since therapies currently being pursued target the induction of SMN, it will be important to understand the dosage, timing and cellular requirements of SMN for disease etiology and potential therapeutic intervention. This requires new mouse models that can induce SMN temporally and/or spatially. Here we describe the generation of two hypomorphic Smn alleles, Smn(C-T-Neo and Smn(2B-Neo. These alleles mimic SMN2 exon 7 splicing, titre Smn levels and are inducible. They were specifically designed so that up to three independent lines of mice could be generated, herein we describe two. In a homozygous state each allele results in embryonic lethality. Analysis of these mutants indicates that greater than 5% of Smn protein is required for normal development. The severe hypomorphic nature of these alleles is caused by inclusion of a loxP-flanked neomycin gene selection cassette in Smn intron 7, which can be removed with Cre recombinase. In vitro and in vivo experiments demonstrate these as inducible Smn alleles. When combined with an inducible Cre mouse, embryonic lethality caused by low Smn levels can be rescued early in gestation but not late. This provides direct genetic evidence that a therapeutic window for SMN inductive therapies may exist. Importantly, these lines fill a void for inducible Smn alleles. They also provide a base from which to generate a large repertoire of SMA models of varying disease severities when combined with other Smn alleles or SMN2-containing mice.

  19. Modulation of Acetylation: Creating a Pro-survival and Anti-Inflammatory Phenotype in Lethal Hemorrhagic and Septic Shock

    Science.gov (United States)

    2011-01-01

    28, no. 1, pp. 11–21, 2003. [65] G. Schwartzbauer and J. Robbins, “The tumor suppressor gene PTEN can regulate cardiac hypertrophy and survival...hemorrhage) and reperfusion (during resuscitation) [38]. Focusing on the cellular pathophysiology of hemor- rhagic shock, our laboratory has explored the...activity in many cell types including cardiomyocytes, cardiac fibroblast, vascular smooth muscle cells (VSMCs), endothelial cells and hepa- tocytes [41

  20. Effect of intestinal microflora on the survival time of mice exposed to lethal whole-body. gamma. irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Onoue, M.; Uchida, K.; Yokokura, T.; Takahashi, T.; Mutai, M.

    1981-11-01

    The effect of intestinal microflora on the survival time of mice exposed to 2-kR whole-body ..gamma.. irradiation was studied using germfree, monoassociated, and conventionalized ICR mice. The germfree mice were monoassociated with 1 of 11 bacterial strains, which were isolated from the fresh feces of conventional mice, 2 weeks prior to irradiation. All mice died within 3 weeks after irradiation. Monoassociation with Fusobacterium sp., Streptococcus faecalis, Escherichia coli, or Pseudomonas sp. significantly reduced the mean survival time compared to that of germfree mice. In contrast, monoassociation with Clostridium sp., Bifidobacterium pseudolongum, or Lactobacillus acidophilus significantly prolonged the mean survival time compared to that of germfree mice. This suggests that the latter organisms may perform some activity to protect the mice from radiation injury. In this histopathological autopsy examination, the main lesions were hypocellularity in hematopoietic organs and hemorrhage in various organs. Neither karyorrhexis nor desquamation of intestinal mucosal cells was observed in any mice. From these observations, it is suggested that the death of these mice was related to hematopoietic damage. Bacterial invasion into various organs was observed in conventionalized and Pseudomonas-, E. coli-, or S. faecalis-monoassociated mice but not in Clostridium-, B. pseudolongum-, L. acidophilus-, or Fusobacterium-monoassociated mice.

  1. Efficacy and Safety of Doubly-Regulated Vaccinia Virus in a Mouse Xenograft Model of Multiple Myeloma

    Directory of Open Access Journals (Sweden)

    Muneyoshi Futami

    2017-09-01

    Full Text Available Multiple myeloma is a malignancy of plasma cells of the bone marrow. Although the prognosis is variable, no curative therapy has been defined. Vaccinia virus infects cancer cells and kills such cells in a variety of ways. These include direct infection, triggering of immunomediated cell death, and vascular collapse. The potential of the vaccinia virus as an anti-tumor therapy has attracted the attention of oncologists. Interestingly, our preliminary experiments revealed that myeloma cells were particularly susceptible to vaccinia virus. To exploit this susceptibility and to render vaccinia more myeloma specific, we generated thymidine-kinase-deleted microRNA (miRNA-regulated vaccinia viruses in which the essential viral gene B5R was regulated by miRNAs of normal human cells. Of the miRNAs examined, let-7a was found to be the most reliable in terms of regulating viral transmission. Exposure to unregulated vaccinia virus killed myeloma-transplanted severe combined immunodeficiency (SCID mice; the animals succumbed to viral toxicity. In contrast, the thymidine-kinase-deleted let-7a-regulated virus remained localized within myeloma cells, triggering tumor regression and improving overall survival. In conclusion, a thymidine-kinase-deleted let-7a-regulated vaccinia virus was safe and effective for mice, warranting clinical trials in humans.

  2. Does small-volume resuscitation with crystalloids or colloids influence hemostasis and survival of rabbits subjected to lethal uncontrolled hemorrhage?

    Science.gov (United States)

    Kheirabadi, Bijan Shams; Miranda, Nahir; Terrazas, Irasema B; Gonzales, Mary D; Grimm, Rose C; Dubick, Michael A

    2017-01-01

    Prehospital, small-volume resuscitation of combat casualties with a synthetic colloid (6% hydroxyethyl starch [HES] 670/0.75) has been recommended when blood or blood components are unavailable. We studied hemostatic effects of a newer synthetic colloid (6% HES, 130/0.4) compared with either a natural colloid (albumin) or to crystalloids in an uncontrolled hemorrhage model. Spontaneously breathing New Zealand white rabbits (3.4 ± 0.1 kg) were anesthetized, instrumented, and subjected to a splenic injury with uncontrolled bleeding. Fifteen minutes after injury, rabbits were in shock (mean arterial pressure [MAP] = 26 ± 1.3 mm Hg, and received colloids (6% HES, 130/0.4 or 5% albumin at 15 mL/kg), or crystalloids (normal saline at 30 mL/kg or 5% hypertonic saline at 7.5 mL/kg) for resuscitation in two intravenous bolus injections (15 minutes apart) to raise their MAP to 65 mm Hg, n = 9/group. Animals were monitored for 2.5 hours or until death, and blood losses were measured. Blood samples were analyzed for arterial blood gas, complete blood count, and coagulation measures. There were no differences among groups in baseline measures and initial hemorrhage volume (11.9 ± 0.6 mL/kg) at 15 minutes postinjury. Twenty minutes after fluid resuscitation (1 hour postinjury), MAP was higher, shock indices were lower, and blood pH was higher in colloids versus. crystalloids groups (p colloid produced the largest hemodilution (54% decrease in hematocrit, p < 0.05 vs. hypertonic saline). Activated partial thromboplastin time increased approximately 35% above baseline in all groups except in 6% HES 130/0.4 group in which it doubled. Clot strength was reduced (15%) only in the 6% HES 130/0.4 group. 6% HES 130/0.4 resuscitation produced the largest blood loss and 33% survival rate that was not different than the crystalloid groups. Albumin produced the best hemostatic and survival outcomes (78%). Small-volume resuscitation with crystalloids appeared inadequate to treat

  3. Corynebacterium diphtheriae putative tellurite-resistance protein (CDCE8392_0813 contributes to the intracellular survival in human epithelial cells and lethality of Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Louisy Sanches dos Santos

    2015-08-01

    Full Text Available Corynebacterium diphtheriae, the aetiologic agent of diphtheria, also represents a global medical challenge because of the existence of invasive strains as causative agents of systemic infections. Although tellurite (TeO32- is toxic to most microorganisms, TeO32--resistant bacteria, including C. diphtheriae, exist in nature. The presence of TeO32--resistance (TeR determinants in pathogenic bacteria might provide selective advantages in the natural environment. In the present study, we investigated the role of the putative TeR determinant (CDCE8392_813gene in the virulence attributes of diphtheria bacilli. The disruption of CDCE8392_0813 gene expression in the LDCIC-L1 mutant increased susceptibility to TeO32- and reactive oxygen species (hydrogen peroxide, but not to other antimicrobial agents. The LDCIC-L1 mutant also showed a decrease in both the lethality of Caenorhabditis elegansand the survival inside of human epithelial cells compared to wild-type strain. Conversely, the haemagglutinating activity and adherence to and formation of biofilms on different abiotic surfaces were not regulated through the CDCE8392_0813 gene. In conclusion, the CDCE8392_813 gene contributes to the TeR and pathogenic potential of C. diphtheriae.

  4. Human alpha-lactalbumin made lethal to tumor cells (HAMLET) kills human glioblastoma cells in brain xenografts by an apoptosis-like mechanism and prolongs survival.

    Science.gov (United States)

    Fischer, Walter; Gustafsson, Lotta; Mossberg, Ann-Kristin; Gronli, Janne; Mork, Sverre; Bjerkvig, Rolf; Svanborg, Catharina

    2004-03-15

    Malignant brain tumors present a major therapeutic challenge because no selective or efficient treatment is available. Here, we demonstrate that intratumoral administration of human alpha-lactalbumin made lethal to tumor cells (HAMLET) prolongs survival in a human glioblastoma (GBM) xenograft model, by selective induction of tumor cell apoptosis. HAMLET is a protein-lipid complex that is formed from alpha-lactalbumin when the protein changes its tertiary conformation and binds oleic acid as a cofactor. HAMLET induces apoptosis in a wide range of tumor cells in vitro, but the therapeutic effect in vivo has not been examined. In this study, invasively growing human GBM tumors were established in nude rats (Han:rnu/rnu Rowett, n = 20) by transplantation of human GBM biopsy spheroids. After 7 days, HAMLET was administered by intracerebral convection-enhanced delivery for 24 h into the tumor area; and alpha-lactalbumin, the native, folded variant of the same protein, was used as a control. HAMLET reduced the intracranial tumor volume and delayed the onset of pressure symptoms in the tumor-bearing rats. After 8 weeks, all alpha-lactalbumin-treated rats had developed pressure symptoms, but the HAMLET-treated rats remained asymptomatic. Magnetic resonance imaging scans revealed large differences in tumor volume (456 versus 63 mm(3)). HAMLET caused apoptosis in vivo in the tumor but not in adjacent intact brain tissue or in nontransformed human astrocytes, and no toxic side effects were observed. The results identify HAMLET as a new candidate in cancer therapy and suggest that HAMLET should be additionally explored as a novel approach to controlling GBM progression.

  5. Analysis of vaccinia virus temperature-sensitive I7L mutants reveals two potential functional domains

    Directory of Open Access Journals (Sweden)

    Byrd Chelsea M

    2006-08-01

    Full Text Available Abstract As an approach to initiating a structure-function analysis of the vaccinia virus I7L core protein proteinase, a collection of conditional-lethal mutants in which the mutation had been mapped to the I7L locus were subjected to genomic sequencing and phenotypic analyses. Mutations in six vaccinia virus I7L temperature sensitive mutants fall into two groups: changes at three positions at the N-terminal end between amino acids 29 and 37 and two different substitutions at amino acid 344, near the catalytic domain. Regardless of the position of the mutation, mutants at the non-permissive temperature failed to cleave core protein precursors and had their development arrested prior to core condensation. Thus it appears that the two clusters of mutations may affect two different functional domains required for proteinase activity.

  6. Sorologia e sobrevivência do vírus do amarelo letal do mamoeiro Serology and surviving characteristics of Papaya lethal yellowing virus

    Directory of Open Access Journals (Sweden)

    Ana Lúcia Lopes do Nascimento

    2010-09-01

    Full Text Available O vírus do amarelo letal do mamoeiro (Papaya lethal yellowing virus, PLYV é responsável por uma das principais doenças do mamoeiro (Carica papaya no Nordeste brasileiro. O PLYV pode ser transmitido através do solo, água, instrumento de corte e mãos contaminadas. A presente pesquisa teve como objetivo estudar as características biológicas, sorológicas e físicas de um isolado do vírus e avaliar sua sobrevivência em tecido seco infetado. O PLYV foi detectado por "Enzyme linked immunosorbent assay" (ELISA indireto e isolado em mudas de mamoeiro, através da inoculação mecânica. A sobrevivência do PLYV em folhas e raízes secas de mamoeiro infetado foi avaliada por sorologia e inoculação em plantas sadias. A presença do vírus foi detectada em folhas e raízes de mamoeiro secas, indicando que o vírus pode permanecer ativo em restos de cultura por até 120 dias. A purificação do PLYV permitiu a obtenção de 309.5 mg de vírus/kg de folha e o anti-soro obtido mostrou-se altamente específico, com títulos de 1:128 em dupla difusão em Agar e 1:1.024.000 em Elisa indireto. Estudos das propriedades físicas do PLYV em mamoeiro revelaram um ponto de inativação térmica (PIT em torno de 80 ºC, um ponto máximo de diluição (PMD de ac. 10-6 e uma longevidade in vitro (LIV acima de 50 dias.The Papaya lethal yellowing virus (PLYV is responsible for one of the most important disease of papaya (Carica papaya in the Northeast of Brazil. The PLYV can be transmitted through the soil, irrigation water, agriculture tools and contaminated hands. The present research had the objective to characterize biologically, serologically and physically a PLYV isolate and evaluates how long it survives in infected dried tissues. The PLYV was identified by indirect enzyme linked immunoabsorbent assay (ELISA, isolated in young papaya plants by mechanical inoculations and maintained at green house conditions for virus purification. Approximately 309.5 mg

  7. Evaluating the orthopoxvirus type I interferon-binding molecule as a vaccine target in the vaccinia virus intranasal murine challenge model.

    Science.gov (United States)

    Golden, Joseph W; Hooper, Jay W

    2010-11-01

    The biological threat imposed by orthopoxviruses warrants the development of safe and effective vaccines. We developed a candidate orthopoxvirus DNA-based vaccine, termed 4pox, which targets four viral structural components, A33, B5, A27, and L1. While this vaccine protects mice and nonhuman primates from lethal infections, we are interested in further enhancing its potency. One approach to enhance potency is to include additional orthopoxvirus immunogens. Here, we investigated whether vaccination with the vaccinia virus (VACV) interferon (IFN)-binding molecule (IBM) could protect BALB/c mice against lethal VACV challenge. We found that vaccination with this molecule failed to significantly protect mice from VACV when delivered alone. IBM modestly augmented protection when delivered together with the 4pox vaccine. All animals receiving the 4pox vaccine plus IBM lived, whereas only 70% of those receiving a single dose of 4pox vaccine survived. Mapping studies using truncated mutants revealed that vaccine-generated antibodies spanned the immunoglobulin superfamily domains 1 and 2 and, to a lesser extent, 3 of the IBM. These antibodies inhibited IBM cell binding and IFN neutralization activity, indicating that they were functionally active. This study shows that DNA vaccination with the VACV IBM results in a robust immune response but that this response does not significantly enhance protection in a high-dose challenge model.

  8. Vaccinia viruses isolated from cutaneous disease in horses are highly virulent for rabbits.

    Science.gov (United States)

    Felipetto Cargnelutti, Juliana; Schmidt, Candice; Masuda, Eduardo Kenji; Braum, Lisiane Danusa; Weiblen, Rudi; Furtado Flores, Eduardo

    2012-03-01

    Two genotypically distinct Vaccinia viruses (VACV), named P1V and P2V, were isolated from an outbreak of cutaneous disease in horses in Southern Brazil. We herein investigated the susceptibility of rabbits, a proposed animal model, to P1V and P2V infection. Groups of weanling rabbits were inoculated intranasally (IN) with P1V or P2V at low (10(2.5) TCID50), medium (10(4.5)TCID50), or high titer (10(6.5)TCID50). Rabbits inoculated with medium and high titers shed virus in nasal secretions and developed serous to hemorrhagic nasal discharge and severe respiratory distress, followed by progressive apathy and high lethality. Clinical signs appeared around days 3-6 post-inoculation (pi) and lasted up to the day of death or euthanasia (around days 5-10). Virus shedding and clinical signs were less frequent in rabbits inoculated with low virus titers. Viremia was detected in all groups, with different frequencies. Viral DNA was detected in the feces of a few animals inoculated with P1V and P2V, low titer, and with P2V at high titer. Gross necropsy findings and histological examination showed diffuse interstitial fibrousing pneumonia with necrosuppurative bronchopneumonia and intestinal liquid content. Neutralizing antibodies were detected in all inoculated animals surviving beyond day 9 pi. These results show that rabbits are highly susceptible to VACV isolated from horses, and develop severe respiratory and systemic disease upon IN inoculation. Thus, rabbits may be used to study selected aspects of VACV infection and disease. Copyright © 2011 Elsevier Ltd. All rights reserved.

  9. Low-resolution structure of vaccinia virus DNA replication machinery.

    Science.gov (United States)

    Sèle, Céleste; Gabel, Frank; Gutsche, Irina; Ivanov, Ivan; Burmeister, Wim P; Iseni, Frédéric; Tarbouriech, Nicolas

    2013-02-01

    Smallpox caused by the poxvirus variola virus is a highly lethal disease that marked human history and was eradicated in 1979 thanks to a worldwide mass vaccination campaign. This virus remains a significant threat for public health due to its potential use as a bioterrorism agent and requires further development of antiviral drugs. The viral genome replication machinery appears to be an ideal target, although very little is known about its structure. Vaccinia virus is the prototypic virus of the Orthopoxvirus genus and shares more than 97% amino acid sequence identity with variola virus. Here we studied four essential viral proteins of the replication machinery: the DNA polymerase E9, the processivity factor A20, the uracil-DNA glycosylase D4, and the helicase-primase D5. We present the recombinant expression and biochemical and biophysical characterizations of these proteins and the complexes they form. We show that the A20D4 polymerase cofactor binds to E9 with high affinity, leading to the formation of the A20D4E9 holoenzyme. Small-angle X-ray scattering yielded envelopes for E9, A20D4, and A20D4E9. They showed the elongated shape of the A20D4 cofactor, leading to a 150-Å separation between the polymerase active site of E9 and the DNA-binding site of D4. Electron microscopy showed a 6-fold rotational symmetry of the helicase-primase D5, as observed for other SF3 helicases. These results favor a rolling-circle mechanism of vaccinia virus genome replication similar to the one suggested for tailed bacteriophages.

  10. Identification and preliminary characterization of vaccinia virus (Dryvax) antigens recognized by vaccinia immune globulin

    National Research Council Canada - National Science Library

    Jones-Trower, Agnes; Garcia, Alonzo; Meseda, Clement A; He, Yong; Weiss, Carol; Kumar, Arunima; Weir, Jerry P; Merchlinsky, Michael

    2005-01-01

    Using vaccinia immune globulin (VIG), a high-titer antibody preparation from immunized subjects, we demonstrate that the humoral immune response in humans is directed against numerous antigens in the Dryvax vaccine strain...

  11. Effects of sub lethal concentration of Chloramin T on growth, survival, haematocrit and some blood biochemical parameters in common carp fry (Cyprinus carpio)

    OpenAIRE

    Mohamad R. Imanpoor; Ahmad Reza Ahmadi; Milad Kabir

    2011-01-01

    This study was done in Gorgan University of Agricultural Sciences and Natural Resources, in 2009, during 8 weeks to survey effects of different concentrations of Chloramin T on fry common carp (Cyprinus carpio (Linnaeus, 1758)). According to the pre experiment data, lethal concentration, the lowest observed effect concentration, maximum allowable toxicant concentration and No Observed Effect Concentration of Chloramin T (Halamid) in common carp (C. carpio) fry were respectively 40.9, 27.1, 4....

  12. Oncolytic and immunologic cancer therapy with GM-CSF-armed vaccinia virus of Tian Tan strain Guang9.

    Science.gov (United States)

    Deng, Lili; Fan, Jun; Guo, Mingming; Huang, Biao

    2016-03-28

    Targeted oncolytic vaccinia viruses are being developed as a novel strategy in cancer therapy. Arming vaccinia viruses with immunostimulatory cytokines can enhance antitumor efficacy. Such engineered oncolytic viruses, like JX-594, a Wyeth strain vaccinia virus modified with human granulocyte-macrophage colony-stimulating factor (GM-CSF), have shown promising results and have proceeded rapidly in clinical trials. However, the oncolytic potential of the Chinese vaccine strain Tian Tan (VTT) has not been explored. In this study, we constructed a targeted oncolytic vaccinia virus of Tian Tan strain Guang9 (VG9) expressing murine GM-CSF (VG9-GMCSF) and evaluated the antitumor effect of this recombinant vaccinia virus in a murine melanoma model. In vitro, viral replication and cytotoxicity of VG9-GMCSF was as potent as VG9; in vivo, VG9-GMCSF significantly inhibited the growth of subcutaneously implanted melanoma tumors, prolonged the survival of tumor-bearing mice, and produced an antitumor cytotoxic response. Such antitumor effect may be due to the lytic nature of virus as well as the stimulation of immune activity by GM-CSF production. Our results indicate that VG9-GMCSF induces strong tumoricidal activity, providing a potential therapeutic strategy for combating cancer. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  13. Lack of efficacy of aurintricarboxylic acid and ethacrynic acid against vaccinia virus respiratory infections in mice.

    Science.gov (United States)

    Smee, Donald F; Hurst, Brett L; Wong, Min-Hui

    2010-04-14

    Aurintricarboxylic acid (ATA) and ethacrynic acid (ECA) have been reported to exhibit antiviral activity against vaccinia virus infections in cell culture by inhibiting early and late gene transcription, respectively. The purpose of this work was to determine if these inhibitors would effectively treat vaccinia virus infections in mice, which has not previously been studied. ECA was investigated by cell culture plaque reduction assay for the inhibition of cowpox and vaccinia virus infections to clarify issues regarding its potency and selectivity. Mice infected intranasally with vaccinia virus were treated by intraperitoneal route twice daily for 5 days with ATA (10 and 30 mg/kg/day) and ECA (15 and 30 mg/kg/day) or once daily for 2 days with cidofovir (100 mg/kg/day). ECA caused 50% inhibition of virus plaque formation at 20-79 muM in four cultured cell lines, with 50% cytotoxicity at 84-173 muM, giving low (1.3-4.2) selectivity index values. Preliminary toxicity tests in uninfected mice indicated that ATA and ECA were both overtly toxic at 100 mg/kg/day. No protection from mortality was afforded by treatment of vaccinia virus infections with ATA or ECA, but 100% survival was achieved in the cidofovir group. ATA- and ECA-treated mice died significantly sooner than placebo-treated animals, indicating that these compounds exacerbated the infection. Both ATA and ECA lack antiviral potency and selectivity in cell culture. The compounds were ineffective in treating mice at intraperitoneal doses of

  14. Effect of the deletion of genes encoding proteins of the extracellular virion form of vaccinia virus on vaccine immunogenicity and protective effectiveness in the mouse model.

    Directory of Open Access Journals (Sweden)

    Clement A Meseda

    Full Text Available Antibodies to both infectious forms of vaccinia virus, the mature virion (MV and the enveloped virion (EV, as well as cell-mediated immune response appear to be important for protection against smallpox. EV virus particles, although more labile and less numerous than MV, are important for dissemination and spread of virus in infected hosts and thus important in virus pathogenesis. The importance of the EV A33 and B5 proteins for vaccine induced immunity and protection in a murine intranasal challenge model was evaluated by deletion of both the A33R and B5R genes in a vaccine-derived strain of vaccinia virus. Deletion of either A33R or B5R resulted in viruses with a small plaque phenotype and reduced virus yields, as reported previously, whereas deletion of both EV protein-encoding genes resulted in a virus that formed small infection foci that were detectable and quantifiable only by immunostaining and an even more dramatic decrease in total virus yield in cell culture. Deletion of B5R, either as a single gene knockout or in the double EV gene knockout virus, resulted in a loss of EV neutralizing activity, but all EV gene knockout viruses still induced a robust neutralizing activity against the vaccinia MV form of the virus. The effect of elimination of A33 and/or B5 on the protection afforded by vaccination was evaluated by intranasal challenge with a lethal dose of either vaccinia virus WR or IHD-J, a strain of vaccinia virus that produces relatively higher amounts of EV virus. The results from multiple experiments, using a range of vaccination doses and virus challenge doses, and using mortality, morbidity, and virus dissemination as endpoints, indicate that the absence of A33 and B5 have little effect on the ability of a vaccinia vaccine virus to provide protection against a lethal intranasal challenge in a mouse model.

  15. Lethal and sublethal effects of methoxyphenozide on the development, survival and reproduction of the fall armyworm, Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae)

    Energy Technology Data Exchange (ETDEWEB)

    Zarate, N.; Diaz, O. [Universidad Autonoma de San Luis Potosi (Mexico). Facultad de Agronomia; Martinez, A.M.; Figueroa, J.I.; Pineda, S., E-mail: spineda_us@yahoo.co [Universidad Michoacana de San Nicolas de Hidalgo, Tarimbaro, Michoacan (Mexico). Inst. de Investigaciones Agropecuarias y Forestales; Schneider, M.I. [National Council of Scientific and Technical Research (CEPAVE/CCT/CONICET), La Plata (Argentina). Centro de Estudios Parasitologicos y de Vectores. Centro Cientifico Tecnologico; Smagghe, G. [Ghent University, Ghent (Belgium). Faculty of Bioscience Engineering. Lab of Agrozoology; Vinuela, E.; Budia, F. [Escuela Tecnica Superior de Ingenieros Agronomos, Madrid (Spain). Escuela Tecnica Superior de Ingenieros Agronomos. Proteccion de Cultivos

    2011-01-15

    The lethal and sublethal effects of the ecdysone agonist methoxyphenozide on the fall armyworm, Spodoptera frugiperda (J. E. Smith), were investigated by feeding a methoxyphenozide-treated diet to fifth instars until pupation in doses corresponding to the LC{sub 10} and LC{sub 25} for the compound. Larval mortality reached 8% and 26% in the low and high concentration groups, respectively, on the seventh day of the experiment. A progressive larval mortality of 12% for the LC{sub 10} and 60% for the LC{sub 25} was observed before pupation. Treated larvae exhibited lower pupal weights, higher pupal mortality, presence of deformed pupae, and more deformed adults than untreated larvae. The incorporation of methoxyfenozide into the diet had a significant effect on the timing of larval development. The development period for males and females was about seven days longer than the controls for both concentrations tested. In contrast, the compound affected neither pupae nor adult longevity. Finally, S. frugiperda adults that resulted from fifth instars treated with methoxyfenozide were not affected in their mean cumulative number of eggs laid per female (fecundity), nor percentages of eggs hatched (fertility), or the sex ratio. Our results suggest that the combination of lethal and sublethal effects of methoxyfenozide may have important implications for the population dynamics of the fall armyworm. (author)

  16. Development of eczema vaccinatum in atopic mouse models and efficacy of MVA vaccination against lethal poxviral infection.

    Directory of Open Access Journals (Sweden)

    Jarmila Knitlova

    Full Text Available Smallpox vaccine based on live, replicating vaccinia virus (VACV is associated with several potentially serious and deadly complications. Consequently, a new generation of vaccine based on non-replicating Modified vaccinia virus Ankara (MVA has been under clinical development. MVA seems to induce good immune responses in blood tests, but it is impossible to test its efficacy in vivo in human. One of the serious complications of the replicating vaccine is eczema vaccinatum (EV occurring in individuals with atopic dermatitis (AD, thus excluding them from all preventive vaccination schemes. In this study, we first characterized and compared development of eczema vaccinatum in different mouse strains. Nc/Nga, Balb/c and C57Bl/6J mice were epicutaneously sensitized with ovalbumin (OVA or saline control to induce signs of atopic dermatitis and subsequently trans-dermally (t.d. immunized with VACV strain Western Reserve (WR. Large primary lesions occurred in both mock- and OVA-sensitized Nc/Nga mice, while they remained small in Balb/c and C57Bl/6J mice. Satellite lesions developed in both mock- and OVA-sensitized Nc/Nga and in OVA-sensitized Balb/c mice with the rate 40-50%. Presence of mastocytes and eosinophils was the highest in Nc/Nga mice. Consequently, we have chosen Nc/Nga mice as a model of AD/EV and tested efficacy of MVA and Dryvax vaccinations against a lethal intra-nasal (i.n. challenge with WR, the surrogate of smallpox. Inoculation of MVA intra-muscularly (i.m. or t.d. resulted in no lesions, while inoculation of Dryvax t.d. yielded large primary and many satellite lesions similar to WR. Eighty three and 92% of mice vaccinated with a single dose of MVA i.m. or t.d., respectively, survived a lethal i.n. challenge with WR without any serious illness, while all Dryvax-vaccinated animals survived. This is the first formal prove of protective immunity against a lethal poxvirus challenge induced by vaccination with MVA in an atopic organism.

  17. Susceptibility of Vaccinia Virus to Chemical Disinfectants

    Science.gov (United States)

    de Oliveira, Tércia Moreira Ludolfo; Rehfeld, Izabelle Silva; Coelho Guedes, Maria Isabel Maldonado; Ferreira, Jaqueline Maria Siqueira; Kroon, Erna Geessien; Lobato, Zélia Inês Portela

    2011-01-01

    Vaccinia virus (VACV) is the cause of bovine vaccinia (BV), an emerging zoonotic disease that affects dairy cows and milkers. Some chemical disinfectants have been used on farms affected by BV to disinfect cow teats and milkers' hands. To date, there is no information about the efficacy of disinfectants against VACV. Therefore, this study aimed to assess the virucidal activity of some active disinfectants commonly used in the field. Sodium hypochlorite, quaternary ammonium combined with chlorhexidine, and quaternary ammonium combined with glutaraldehyde were effective in inactivating the virus at all concentrations tested. Iodine and quaternary ammonium as the only active component were partially effective. The presence of bovine feces as organic matter and light decreased the effectiveness of sodium hypochlorite. These results show that an appropriated disinfection and asepsis of teats and hands may be helpful in the control and prevention of BV and other infections with VACV. PMID:21734141

  18. Vaccinia virus as an expression vector.

    Science.gov (United States)

    Talavera, A; Rodriguez, J M

    1992-01-01

    Vaccinia virus (Vv) is a member of the genus Orthopoxvirus, one of seven genera included in the family Poxviridae. Most of these viruses infect vertebrates (Orthopoxvirus, Avipoxvirus, Capripoxvirus, Leporipoxvirus, Suipoxvirus, and Parapoxvirus), but one genus, Entomopoxvirus, infects insects. It is interesting to note that the Fibroma and Mixoma viruses of the leporipoxvirus genus cause tumors in their hosts (rabbits), these being the only tumorigenic viruses in the family (1,2).

  19. Combined prime-boost vaccination against tick-borne encephalitis (TBE using a recombinant vaccinia virus and a bacterial plasmid both expressing TBE virus non-structural NS1 protein

    Directory of Open Access Journals (Sweden)

    Zakharova LG

    2005-08-01

    Full Text Available Abstract Background Heterologous prime-boost immunization protocols using different gene expression systems have proven to be successful tools in protecting against various diseases in experimental animal models. The main reason for using this approach is to exploit the ability of expression cassettes to prime or boost the immune system in different ways during vaccination procedures. The purpose of the project was to study the ability of recombinant vaccinia virus (VV and bacterial plasmid, both carrying the NS1 gene from tick-borne encephalitis (TBE virus under the control of different promoters, to protect mice against lethal challenge using a heterologous prime-boost vaccination protocol. Results The heterologous prime-boost vaccination protocol, using a VV recombinant and bacterial plasmid, both containing the NS1 TBE virus protein gene under the control of different promoters, achieved a high level of protection in mice against lethal challenge with a highly pathogenic TBE virus strain. No signs of pronounced TBE infection were detected in the surviving animals. Conclusion Heterologous prime-boost vaccination protocols using recombinant VV and bacterial plasmids could be used for the development of flavivirus vaccines.

  20. Survival

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — These data provide information on the survival of California red-legged frogs in a unique ecosystem to better conserve this threatened species while restoring...

  1. Innate immune response of human plasmacytoid dendritic cells to poxvirus infection is subverted by vaccinia E3 via its Z-DNA/RNA binding domain.

    Directory of Open Access Journals (Sweden)

    Hua Cao

    Full Text Available Plasmacytoid dendritic cells (pDCs play important roles in antiviral innate immunity by producing type I interferon (IFN. In this study, we assess the immune responses of primary human pDCs to two poxviruses, vaccinia and myxoma virus. Vaccinia, an orthopoxvirus, was used for immunization against smallpox, a contagious human disease with high mortality. Myxoma virus, a Leporipoxvirus, causes lethal disease in rabbits, but is non-pathogenic in humans. We report that myxoma virus infection of human pDCs induces IFN-α and TNF production, whereas vaccinia infection does not. Co-infection of pDCs with myxoma virus plus vaccinia blocks myxoma induction effects. We find that heat-inactivated vaccinia (Heat-VAC; by incubating the virus at 55°C for 1 h gains the ability to induce IFN-α and TNF in primary human pDCs. Induction of IFN-α in pDCs by myxoma virus or Heat-VAC is blocked by chloroquine, which inhibits endosomal acidification required for TLR7/9 signaling, and by inhibitors of cellular kinases PI3K and Akt. Using purified pDCs from genetic knockout mice, we demonstrate that Heat-VAC-induced type I IFN production in pDCs requires the endosomal RNA sensor TLR7 and its adaptor MyD88, transcription factor IRF7 and the type I IFN feedback loop mediated by IFNAR1. These results indicate that (i vaccinia virus, but not myxoma virus, expresses inhibitor(s of the poxvirus sensing pathway(s in pDCs; and (ii Heat-VAC infection fails to produce inhibitor(s but rather produces novel activator(s, likely viral RNA transcripts that are sensed by the TLR7/MyD88 pathway. Using vaccinia gene deletion mutants, we show that the Z-DNA/RNA binding domain at the N-terminus of the vaccinia immunomodulatory E3 protein is an antagonist of the innate immune response of human pDCs to poxvirus infection and TLR agonists. The myxoma virus ortholog of vaccinia E3 (M029 lacks the N-terminal Z-DNA/RNA binding domain, which might contribute to the immunostimulating

  2. Innate Immune Response of Human Plasmacytoid Dendritic Cells to Poxvirus Infection Is Subverted by Vaccinia E3 via Its Z-DNA/RNA Binding Domain

    Science.gov (United States)

    Dai, Peihong; Wang, Weiyi; Li, Hao; Yuan, Jianda; Wang, Fangjin; Fang, Chee-Mun; Pitha, Paula M; Liu, Jia; Condit, Richard C; McFadden, Grant; Merghoub, Taha; Houghton, Alan N; Young, James W; Shuman, Stewart; Deng, Liang

    2012-01-01

    Plasmacytoid dendritic cells (pDCs) play important roles in antiviral innate immunity by producing type I interferon (IFN). In this study, we assess the immune responses of primary human pDCs to two poxviruses, vaccinia and myxoma virus. Vaccinia, an orthopoxvirus, was used for immunization against smallpox, a contagious human disease with high mortality. Myxoma virus, a Leporipoxvirus, causes lethal disease in rabbits, but is non-pathogenic in humans. We report that myxoma virus infection of human pDCs induces IFN-α and TNF production, whereas vaccinia infection does not. Co-infection of pDCs with myxoma virus plus vaccinia blocks myxoma induction effects. We find that heat-inactivated vaccinia (Heat-VAC; by incubating the virus at 55°C for 1 h) gains the ability to induce IFN-α and TNF in primary human pDCs. Induction of IFN-α in pDCs by myxoma virus or Heat-VAC is blocked by chloroquine, which inhibits endosomal acidification required for TLR7/9 signaling, and by inhibitors of cellular kinases PI3K and Akt. Using purified pDCs from genetic knockout mice, we demonstrate that Heat-VAC-induced type I IFN production in pDCs requires the endosomal RNA sensor TLR7 and its adaptor MyD88, transcription factor IRF7 and the type I IFN feedback loop mediated by IFNAR1. These results indicate that (i) vaccinia virus, but not myxoma virus, expresses inhibitor(s) of the poxvirus sensing pathway(s) in pDCs; and (ii) Heat-VAC infection fails to produce inhibitor(s) but rather produces novel activator(s), likely viral RNA transcripts that are sensed by the TLR7/MyD88 pathway. Using vaccinia gene deletion mutants, we show that the Z-DNA/RNA binding domain at the N-terminus of the vaccinia immunomodulatory E3 protein is an antagonist of the innate immune response of human pDCs to poxvirus infection and TLR agonists. The myxoma virus ortholog of vaccinia E3 (M029) lacks the N-terminal Z-DNA/RNA binding domain, which might contribute to the immunostimulating properties of

  3. Survival and Predictive Factors of Lethality in Hemodyalisis: D/I Polymorphism of The Angiotensin I-Converting Enzyme and of the Angiotensinogen M235T Genes

    Energy Technology Data Exchange (ETDEWEB)

    Alves, Mauro, E-mail: malves@cardiol.br; Silva, Nelson Albuquerque de Souza e; Salis, Lucia Helena Alvares; Pereira, Basilio de Bragança; Godoy, Paulo Henrique; Nascimento, Emília Matos do [Universidade Federal do Rio de Janeiro, Rio de Janeiro, RJ (Brazil); Oliveira, Jose Mario Franco [Universidade Federal Fluminense, Niterói, RJ (Brazil)

    2014-09-15

    End-stage kidney disease patients continue to have markedly increased cardiovascular disease morbidity and mortality. Analysis of genetic factors connected with the renin-angiotensin system that influences the survival of the patients with end-stage kidney disease supports the ongoing search for improved outcomes. To assess survival and its association with the polymorphism of renin-angiotensin system genes: angiotensin I-converting enzyme insertion/deletion and angiotensinogen M235T in patients undergoing hemodialysis. Our study was designed to examine the role of renin-angiotensin system genes. It was an observational study. We analyzed 473 chronic hemodialysis patients in four dialysis units in the state of Rio de Janeiro. Survival rates were calculated by the Kaplan-Meier method and the differences between the curves were evaluated by Tarone-Ware, Peto-Prentice, and log rank tests. We also used logistic regression analysis and the multinomial model. A p value ≤ 0.05 was considered to be statistically significant. The local medical ethics committee gave their approval to this study. The mean age of patients was 45.8 years old. The overall survival rate was 48% at 11 years. The major causes of death were cardiovascular diseases (34%) and infections (15%). Logistic regression analysis found statistical significance for the following variables: age (p = 0.000038), TT angiotensinogen (p = 0.08261), and family income greater than five times the minimum wage (p = 0.03089), the latter being a protective factor. The survival of hemodialysis patients is likely to be influenced by the TT of the angiotensinogen M235T gene.

  4. Survival and Predictive Factors of Lethality in Hemodyalisis: D/I Polymorphism of The Angiotensin I-Converting Enzyme and of the Angiotensinogen M235T Genes

    Directory of Open Access Journals (Sweden)

    Mauro Alves

    2014-09-01

    Full Text Available Background: End-stage kidney disease patients continue to have markedly increased cardiovascular disease morbidity and mortality. Analysis of genetic factors connected with the renin-angiotensin system that influences the survival of the patients with end-stage kidney disease supports the ongoing search for improved outcomes. Objective: To assess survival and its association with the polymorphism of renin-angiotensin system genes: angiotensin I-converting enzyme insertion/deletion and angiotensinogen M235T in patients undergoing hemodialysis. Methods: Our study was designed to examine the role of renin-angiotensin system genes. It was an observational study. We analyzed 473 chronic hemodialysis patients in four dialysis units in the state of Rio de Janeiro. Survival rates were calculated by the Kaplan-Meier method and the differences between the curves were evaluated by Tarone-Ware, Peto-Prentice, and log rank tests. We also used logistic regression analysis and the multinomial model. A p value ≤ 0.05 was considered to be statistically significant. The local medical ethics committee gave their approval to this study. Results: The mean age of patients was 45.8 years old. The overall survival rate was 48% at 11 years. The major causes of death were cardiovascular diseases (34% and infections (15%. Logistic regression analysis found statistical significance for the following variables: age (p = 0.000038, TT angiotensinogen (p = 0.08261, and family income greater than five times the minimum wage (p = 0.03089, the latter being a protective factor. Conclusions: The survival of hemodialysis patients is likely to be influenced by the TT of the angiotensinogen M235T gene.

  5. Vaccinia virus induces rapid necrosis in keratinocytes by a STAT3-dependent mechanism.

    Directory of Open Access Journals (Sweden)

    Yong He

    Full Text Available Humans with a dominant negative mutation in STAT3 are susceptible to severe skin infections, suggesting an essential role for STAT3 signaling in defense against cutaneous pathogens.To focus on innate antiviral defenses in keratinocytes, we used a standard model of cutaneous infection of severe combined immunodeficient mice with the current smallpox vaccine, ACAM-2000. In parallel, early events post-infection with the smallpox vaccine ACAM-2000 were investigated in cultured keratinocytes of human and mouse origin.Mice treated topically with a STAT3 inhibitor (Stattic developed larger vaccinia lesions with higher virus titers and died more rapidly than untreated controls. Cultured human and murine keratinocytes infected with ACAM-2000 underwent rapid necrosis, but when treated with Stattic or with inhibitors of RIP1 kinase or caspase-1, they survived longer, produced higher titers of virus, and showed reduced activation of type I interferon responses and inflammatory cytokines release. Treatment with inhibitors of RIP1 kinase and STAT3, but not caspase-1, also reduced the inflammatory response of keratinocytes to TLR ligands. Vaccinia growth properties in Vero cells, which are known to be defective in some antiviral responses, were unaffected by inhibition of RIP1K, caspase-1, or STAT3.Our findings indicate that keratinocytes suppress the replication and spread of vaccinia virus by undergoing rapid programmed cell death, in a process requiring STAT3. These data offer a new framework for understanding susceptibility to skin infection in patients with STAT3 mutations. Interventions which promote prompt necroptosis/pyroptosis of infected keratinocytes may reduce risks associated with vaccination with live vaccinia virus.

  6. Oncolytic vaccinia therapy of squamous cell carcinoma

    Directory of Open Access Journals (Sweden)

    Yu Yong A

    2009-07-01

    Full Text Available Abstract Background Novel therapies are necessary to improve outcomes for patients with squamous cell carcinomas (SCC of the head and neck. Historically, vaccinia virus was administered widely to humans as a vaccine and led to the eradication of smallpox. We examined the therapeutic effects of an attenuated, replication-competent vaccinia virus (GLV-1h68 as an oncolytic agent against a panel of six human head and neck SCC cell lines. Results All six cell lines supported viral transgene expression (β-galactosidase, green fluorescent protein, and luciferase as early as 6 hours after viral exposure. Efficient transgene expression and viral replication (>150-fold titer increase over 72 hrs were observed in four of the cell lines. At a multiplicity of infection (MOI of 1, GLV-1h68 was highly cytotoxic to the four cell lines, resulting in ≥ 90% cytotoxicity over 6 days, and the remaining two cell lines exhibited >45% cytotoxicity. Even at a very low MOI of 0.01, three cell lines still demonstrated >60% cell death over 6 days. A single injection of GLV-1h68 (5 × 106 pfu intratumorally into MSKQLL2 xenografts in mice exhibited localized intratumoral luciferase activity peaking at days 2–4, with gradual resolution over 10 days and no evidence of spread to normal organs. Treated animals exhibited near-complete tumor regression over a 24-day period without any observed toxicity, while control animals demonstrated rapid tumor progression. Conclusion These results demonstrate significant oncolytic efficacy by an attenuated vaccinia virus for infecting and lysing head and neck SCC both in vitro and in vivo, and support its continued investigation in future clinical trials.

  7. Antiviral treatment is more effective than smallpox vaccination upon lethal monkeypox virus infection.

    Science.gov (United States)

    Stittelaar, Koert J; Neyts, Johan; Naesens, Lieve; van Amerongen, Geert; van Lavieren, Rob F; Holý, Antonin; De Clercq, Erik; Niesters, Hubert G M; Fries, Edwin; Maas, Chantal; Mulder, Paul G H; van der Zeijst, Ben A M; Osterhaus, Albert D M E

    2006-02-09

    There is concern that variola virus, the aetiological agent of smallpox, may be used as a biological weapon. For this reason several countries are now stockpiling (vaccinia virus-based) smallpox vaccine. Although the preventive use of smallpox vaccination has been well documented, little is known about its efficacy when used after exposure to the virus. Here we compare the effectiveness of (1) post-exposure smallpox vaccination and (2) antiviral treatment with either cidofovir (also called HPMPC or Vistide) or with a related acyclic nucleoside phosphonate analogue (HPMPO-DAPy) after lethal intratracheal infection of cynomolgus monkeys (Macaca fascicularis) with monkeypox virus (MPXV). MPXV causes a disease similar to human smallpox and this animal model can be used to measure differences in the protective efficacies of classical and new-generation candidate smallpox vaccines. We show that initiation of antiviral treatment 24 h after lethal intratracheal MPXV infection, using either of the antiviral agents and applying various systemic treatment regimens, resulted in significantly reduced mortality and reduced numbers of cutaneous monkeypox lesions. In contrast, when monkeys were vaccinated 24 h after MPXV infection, using a standard human dose of a currently recommended smallpox vaccine (Elstree-RIVM), no significant reduction in mortality was observed. When antiviral therapy was terminated 13 days after infection, all surviving animals had virus-specific serum antibodies and antiviral T lymphocytes. These data show that adequate preparedness for a biological threat involving smallpox should include the possibility of treating exposed individuals with antiviral compounds such as cidofovir or other selective anti-poxvirus drugs.

  8. Sequential transition of the injury phenotype, temperature-dependent survival and transcriptional response in Listeria monocytogenes following lethal H2O2 exposure.

    Science.gov (United States)

    Ochiai, Yoshitsugu; Yamada, Fumiya; Yoshikawa, Yuko; Mochizuki, Mariko; Takano, Takashi; Hondo, Ryo; Ueda, Fukiko

    2017-10-16

    The food-borne pathogen Listeria monocytogenes is present persistently in food processing environments, where this bacterium is exposed to various stress factors, including oxidative stress. This study aimed to elucidate the temperature-dependent response of L. monocytogenes to H2O2 exposure and the phenotypic changes in colony formation by H2O2-treated bacteria. Survival curves indicated an increase in the resistance to H2O2 in L. monocytogenes as the temperature decreased during the stress exposure procedure. Transcriptional induction of genes with key roles in response to H2O2, including sigB and kat, was observed at 37°C, but not at 20°C, whereas other stress response genes were induced at both temperatures. Following H2O2 exposure, L. monocytogenes produced small colony phenotypes and the colony size decreased in a stress exposure duration-dependent manner. Resuscitated cells with no ability to form colonies in the absence of sodium pyruvate were also found. Our findings show the possibility that a sequential transition in the injury phenotype from small colony phenotype to resuscitated cells occurred during the course of exposure to H2O2. The higher H2O2 resistance at 20°C than 37°C suggests further investigation of the response to H2O2 exposure under the lower temperatures, including refrigeration temperature, which may contribute to elucidation of bacterial survival over extended time periods in food-processing environments. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Vulvar vaccinia infection after sexual contact with a smallpox vaccinee.

    Science.gov (United States)

    Muzny, Christina A; King, Heather; Byers, Paul; Currier, Mary; Nolan, Rathel; Mena, Leandro

    2009-04-01

    Vaccinia (smallpox) vaccine is an effective immunizing agent that brought about global eradication of naturally occurring smallpox, as declared by the World Health Organization in 1980. The United States ceased generalized smallpox vaccination in 1972 but reinstated it in 2002 for military personnel and selected healthcare workers (first responders who may be investigating possible cases of smallpox or caring for patients in selected hospitals) after the 2001 bioterrorism attacks. Since reinstitution of the vaccine, reports of transmission of vaccinia virus through contact with military smallpox vaccinees have been published, including four cases of female genital infection. We report a subsequent case of vulvar vaccinia infection acquired during sexual contact with a military vaccinee.

  10. Vaccinia virus, a promising new therapeutic agent for pancreatic cancer.

    Science.gov (United States)

    Al Yaghchi, Chadwan; Zhang, Zhongxian; Alusi, Ghassan; Lemoine, Nicholas R; Wang, Yaohe

    2015-01-01

    The poor prognosis of pancreatic cancer patients signifies a need for radically new therapeutic strategies. Tumor-targeted oncolytic viruses have emerged as attractive therapeutic candidates for cancer treatment due to their inherent ability to specifically target and lyse tumor cells as well as induce antitumor effects by multiple action mechanisms. Vaccinia virus has several inherent features that make it particularly suitable for use as an oncolytic agent. In this review, we will discuss the potential of vaccinia virus in the management of pancreatic cancer in light of our increased understanding of cellular and immunological mechanisms involved in the disease process as well as our extending knowledge in the biology of vaccinia virus.

  11. Origin-independent plasmid replication occurs in vaccinia virus cytoplasmic factories and requires all five known poxvirus replication factors

    Directory of Open Access Journals (Sweden)

    Moss Bernard

    2005-03-01

    Full Text Available Abstract Background Replication of the vaccinia virus genome occurs in cytoplasmic factory areas and is dependent on the virus-encoded DNA polymerase and at least four additional viral proteins. DNA synthesis appears to start near the ends of the genome, but specific origin sequences have not been defined. Surprisingly, transfected circular DNA lacking specific viral sequences is also replicated in poxvirus-infected cells. Origin-independent plasmid replication depends on the viral DNA polymerase, but neither the number of additional viral proteins nor the site of replication has been determined. Results Using a novel real-time polymerase chain reaction assay, we detected a >400-fold increase in newly replicated plasmid in cells infected with vaccinia virus. Studies with conditional lethal mutants of vaccinia virus indicated that each of the five proteins known to be required for viral genome replication was also required for plasmid replication. The intracellular site of replication was determined using a plasmid containing 256 repeats of the Escherichia coli lac operator and staining with an E. coli lac repressor-maltose binding fusion protein followed by an antibody to the maltose binding protein. The lac operator plasmid was localized in cytoplasmic viral factories delineated by DNA staining and binding of antibody to the viral uracil DNA glycosylase, an essential replication protein. In addition, replication of the lac operator plasmid was visualized continuously in living cells infected with a recombinant vaccinia virus that expresses the lac repressor fused to enhanced green fluorescent protein. Discrete cytoplasmic fluorescence was detected in cytoplasmic juxtanuclear sites at 6 h after infection and the area and intensity of fluorescence increased over the next several hours. Conclusion Replication of a circular plasmid lacking specific poxvirus DNA sequences mimics viral genome replication by occurring in cytoplasmic viral factories

  12. Thy1+ Nk Cells from Vaccinia Virus-Primed Mice Confer Protection against Vaccinia Virus Challenge in the Absence of Adaptive Lymphocytes

    Science.gov (United States)

    Gillard, Geoffrey O.; Bivas-Benita, Maytal; Hovav, Avi-Hai; Grandpre, Lauren E.; Panas, Michael W.; Seaman, Michael S.; Haynes, Barton F.; Letvin, Norman L.

    2011-01-01

    While immunological memory has long been considered the province of T- and B- lymphocytes, it has recently been reported that innate cell populations are capable of mediating memory responses. We now show that an innate memory immune response is generated in mice following infection with vaccinia virus, a poxvirus for which no cognate germline-encoded receptor has been identified. This immune response results in viral clearance in the absence of classical adaptive T and B lymphocyte populations, and is mediated by a Thy1+ subset of natural killer (NK) cells. We demonstrate that immune protection against infection from a lethal dose of virus can be adoptively transferred with memory hepatic Thy1+ NK cells that were primed with live virus. Our results also indicate that, like classical immunological memory, stronger innate memory responses form in response to priming with live virus than a highly attenuated vector. These results demonstrate that a defined innate memory cell population alone can provide host protection against a lethal systemic infection through viral clearance. PMID:21829360

  13. Modeling synthetic lethality

    OpenAIRE

    Le Meur, Nolwenn; Gentleman, Robert

    2008-01-01

    Background Synthetic lethality defines a genetic interaction where the combination of mutations in two or more genes leads to cell death. The implications of synthetic lethal screens have been discussed in the context of drug development as synthetic lethal pairs could be used to selectively kill cancer cells, but leave normal cells relatively unharmed. A challenge is to assess genome-wide experimental data and integrate the results to better understand the underlying biological processes. We...

  14. Protective efficacy of a recombinant vaccinia virus in vaccinia-immune mice.

    Science.gov (United States)

    Andrew, M E

    1989-10-01

    Recombinant viral vectors offer a potential means of vaccinating against diseases for which there are no current safe vaccines. One of the criteria on which a viral vaccine vector would be selected is that it either circulates in the human or livestock population without producing overt disease (e.g. adenovirus) or has a history as a safe vaccine (e.g. vaccinia virus). However, this selection criterion also means that the target population is likely to have circulating antibodies that are specific to the vaccine vector. Since a percentage of the world's population has been vaccinated during the World Health Organization's Smallpox Eradication Campaign, such antibody titres, which are likely to lower vaccine efficacy, have been raised as an objection to the use of recombinant vaccinia viruses as vaccines. We have tested the effect of vaccinia-specific immunity on the protective efficacy of a recombinant virus, VV-PR8-HA6 (1) which expresses the haemagglutinin of the influenza virus A/PR/8/34.

  15. Use of a recombinant vaccinia virus expressing interferon gamma for post-exposure protection against vaccinia and ectromelia viruses.

    Directory of Open Access Journals (Sweden)

    Susan A Holechek

    Full Text Available Post-exposure vaccination with vaccinia virus (VACV has been suggested to be effective in minimizing death if administered within four days of smallpox exposure. While there is anecdotal evidence for efficacy of post-exposure vaccination this has not been definitively studied in humans. In this study, we analyzed post-exposure prophylaxis using several attenuated recombinant VACV in a mouse model. A recombinant VACV expressing murine interferon gamma (IFN-γ was most effective for post-exposure protection of mice infected with VACV and ectromelia virus (ECTV. Untreated animals infected with VACV exhibited severe weight loss and morbidity leading to 100% mortality by 8 to 10 days post-infection. Animals treated one day post-infection had milder symptoms, decreased weight loss and morbidity, and 100% survival. Treatment on days 2 or 3 post-infection resulted in 40% and 20% survival, respectively. Similar results were seen in ECTV-infected mice. Despite the differences in survival rates in the VACV model, the viral load was similar in both treated and untreated mice while treated mice displayed a high level of IFN-γ in the serum. These results suggest that protection provided by IFN-γ expressed by VACV may be mediated by its immunoregulatory activities rather than its antiviral effects. These results highlight the importance of IFN-γ as a modulator of the immune response for post-exposure prophylaxis and could be used potentially as another post-exposure prophylaxis tool to prevent morbidity following infection with smallpox and other orthopoxviruses.

  16. Vaccinia Virus Infections in a Martial Arts Gym

    Centers for Disease Control (CDC) Podcasts

    2011-04-04

    This podcast discusses an outbreak of vaccinia virus in Maryland in 2008. Christine Hughes, a health scientist with the Poxvirus and Rabies Branch at CDC, and co-author of a paper in the April 2011 issue of CDC's journal, discusses vaccinia virus infections in a martial arts gym.  Created: 4/4/2011 by National Center for Emerging Zoonotic and Infectious Diseases (NCEZID).   Date Released: 4/5/2011.

  17. CD69 Deficiency Enhances the Host Response to Vaccinia Virus Infection through Altered NK Cell Homeostasis.

    Science.gov (United States)

    Notario, Laura; Alari-Pahissa, Elisenda; de Molina, Antonio; Lauzurica, Pilar

    2016-07-15

    During the host response to viral infection, the transmembrane CD69 protein is highly upregulated in all immune cells. We have studied the role of CD69 in the murine immune response to vaccinia virus (VACV) infection, and we report that the absence of CD69 enhances protection against VACV at both short and long times postinfection in immunocompetent and immunodeficient mice. Natural killer (NK) cells were implicated in the increased infection control, since the differences were greatly diminished when NK cells were depleted. This role of NK cells was not based on an altered NK cell reactivity, since CD69 did not affect the NK cell activation threshold in response to major histocompatibility complex class I NK cell targets or protein kinase C activation. Instead, NK cell numbers were increased in the spleen and peritoneum of CD69-deficient infected mice. That was not just secondary to better infection control in CD69-deficient mice, since NK cell numbers in the spleens and the blood of uninfected CD69(-/-) mice were already augmented. CD69-deficient NK cells from infected mice did not have an altered proliferation capacity. However, a lower spontaneous cell death rate was observed for CD69(-/-) lymphocytes. Thus, our results suggest that CD69 limits the innate immune response to VACV infection at least in part through cell homeostatic survival. We show that increased natural killer (NK) cell numbers augment the host response and survival after infection with vaccinia virus. This phenotype is found in the absence of CD69 in immunocompetent and immunodeficient hosts. As part of the innate immune system, NK lymphocytes are activated and participate in the defense against infection. Several studies have focused on the contribution of NK cells to protection against infection with vaccinia virus. In this study, it was demonstrated that the augmented early NK cell response in the absence of CD69 is responsible for the increased protection seen during infection with

  18. Vaccination scars in HIV infected patients – does vaccinia vaccination confer protection against HIV?

    DEFF Research Database (Denmark)

    Jespersen, Sanne; Hønge, Bo Langhoff; Medina, Candida

    Vaccination scars in HIV infected patients – does vaccinia vaccination confer protection against HIV?......Vaccination scars in HIV infected patients – does vaccinia vaccination confer protection against HIV?...

  19. Mucosal Vaccination Overcomes the Barrier to Recombinant Vaccinia Immunization Caused by Preexisting Poxvirus Immunity

    Science.gov (United States)

    Belyakov, Igor M.; Moss, Bernard; Strober, Warren; Berzofsky, Jay A.

    1999-04-01

    Overcoming preexisting immunity to vaccinia virus in the adult population is a key requirement for development of otherwise potent recombinant vaccinia vaccines. Based on our observation that s.c. immunization with vaccinia induces cellular and antibody immunity to vaccinia only in systemic lymphoid tissue and not in mucosal sites, we hypothesized that the mucosal immune system remains naive to vaccinia and therefore amenable to immunization with recombinant vaccinia vectors despite earlier vaccinia exposure. We show that mucosal immunization of vaccinia-immune BALB/c mice with recombinant vaccinia expressing HIV gp160 induced specific serum antibody and strong HIV-specific cytotoxic T lymphocyte responses. These responses occurred not only in mucosal but also in systemic lymphoid tissue, whereas systemic immunization was ineffective under these circumstances. In this context, intrarectal immunization was more effective than intranasal immunization. Boosting with a second dose of recombinant vaccinia was also more effective via the mucosal route. The systemic HIV-specific cytotoxic T lymphocyte response was enhanced by coadministration of IL-12 at the mucosal site. These results also demonstrate the independent compartmentalization of the mucosal versus systemic immune systems and the asymmetric trafficking of lymphocytes between them. This approach to circumvent previous vaccinia immunity may be useful for induction of protective immunity against infectious diseases and cancer in the sizable populations with preexisting immunity to vaccinia from smallpox vaccination.

  20. Modeling synthetic lethality.

    Science.gov (United States)

    Le Meur, Nolwenn; Gentleman, Robert

    2008-01-01

    Synthetic lethality defines a genetic interaction where the combination of mutations in two or more genes leads to cell death. The implications of synthetic lethal screens have been discussed in the context of drug development as synthetic lethal pairs could be used to selectively kill cancer cells, but leave normal cells relatively unharmed. A challenge is to assess genome-wide experimental data and integrate the results to better understand the underlying biological processes. We propose statistical and computational tools that can be used to find relationships between synthetic lethality and cellular organizational units. In Saccharomyces cerevisiae, we identified multi-protein complexes and pairs of multi-protein complexes that share an unusually high number of synthetic genetic interactions. As previously predicted, we found that synthetic lethality can arise from subunits of an essential multi-protein complex or between pairs of multi-protein complexes. Finally, using multi-protein complexes allowed us to take into account the pleiotropic nature of the gene products. Modeling synthetic lethality using current estimates of the yeast interactome is an efficient approach to disentangle some of the complex molecular interactions that drive a cell. Our model in conjunction with applied statistical methods and computational methods provides new tools to better characterize synthetic genetic interactions.

  1. Oncolytic vaccinia virotherapy of anaplastic thyroid cancer in vivo.

    Science.gov (United States)

    Lin, Shu-Fu; Price, Daniel L; Chen, Chun-Hao; Brader, Peter; Li, Sen; Gonzalez, Lorena; Zhang, Qian; Yu, Yong A; Chen, Nanhai; Szalay, Aladar A; Fong, Yuman; Wong, Richard J

    2008-11-01

    Anaplastic thyroid carcinoma (ATC) is a fatal disease with a median survival of only 6 months. Novel therapies are needed to improve dismal outcomes. A mutated, replication-competent, vaccinia virus (GLV-1h68) has oncolytic effects on human ATC cell lines in vitro. We assessed the utility of GLV-1h68 in treating anaplastic thyroid cancer in vivo. Athymic nude mice with xenograft flank tumors of human ATCs (8505C and DRO90-1) were treated with a single intratumoral injection of GLV-1h68 at low dose (5x10(5) plaque-forming unit), high dose (5x10(6) plaque-forming unit), or PBS. Virus-mediated marker gene expression (luciferase, green fluorescent protein, and beta-galactosidase), viral biodistribution, and flank tumor volumes were measured. Luciferase expression was detected 2 d after injection. Continuous viral replication within tumors was reflected by increasing luciferase activity to d 9. At d 10, tumor viral recovery was increased more than 50-fold as compared with the injected dose, and minimal virus was recovered from the lung, liver, brain, heart, spleen, and kidneys. High-dose virus directly injected into normal tissues was undetectable at d 10. The mean volume of control 8505C tumors increased 50.8-fold by d 45, in contrast to 10.5-fold (low dose) and 2.1-fold (high dose; P=0.028) increases for treated tumors. DRO90-1 tumors also showed significant growth inhibition by high-dose virus. No virus-related toxicity was observed throughout the study. GLV-1h68 efficiently infects, expresses transgenes within, and inhibits the growth of ATC in vivo. These promising findings support future clinical trials for patients with ATC.

  2. Cryo-electron tomography of vaccinia virus

    Science.gov (United States)

    Cyrklaff, Marek; Risco, Cristina; Fernández, Jose Jesús; Jiménez, Maria Victoria; Estéban, Mariano; Baumeister, Wolfgang; Carrascosa, José L.

    2005-01-01

    The combination of cryo-microscopy and electron tomographic reconstruction has allowed us to determine the structure of one of the more complex viruses, intracellular mature vaccinia virus, at a resolution of 4–6 nm. The tomographic reconstruction allows us to dissect the different structural components of the viral particle, avoiding projection artifacts derived from previous microscopic observations. A surface-rendering representation revealed brick-shaped viral particles with slightly rounded edges and dimensions of ≈360 × 270 × 250 nm. The outer layer was consistent with a lipid membrane (5–6 nm thick), below which usually two lateral bodies were found, built up by a heterogeneous material without apparent ordering or repetitive features. The internal core presented an inner cavity with electron dense coils of presumptive DNA–protein complexes, together with areas of very low density. The core was surrounded by two layers comprising an overall thickness of ≈18–19 nm; the inner layer was consistent with a lipid membrane. The outer layer was discontinuous, formed by a periodic palisade built by the side interaction of T-shaped protein spikes that were anchored in the lower membrane and were arranged into small hexagonal crystallites. It was possible to detect a few pore-like structures that communicated the inner side of the core with the region outside the layer built by the T-shaped spike palisade. PMID:15699328

  3. Membrane remodelling during vaccinia virus morphogenesis.

    Science.gov (United States)

    Chichón, Francisco Javier; Rodríguez, María Josefa; Risco, Cristina; Fraile-Ramos, Alberto; Fernández, José Jesús; Esteban, Mariano; Carrascosa, José L

    2009-07-01

    VACV (vaccinia virus) is one of the most complex viruses, with a size exceeding 300 nm and more than 100 structural proteins. Its assembly involves sequential interactions and important rearrangements of its structural components. We have used electron tomography of sections of VACV-infected cells to follow, in three dimensions, the remodelling of the membrane components of the virus during envelope maturation. The tomograms obtained suggest that a number of independent 'crescents' interact with each other to enclose the volume of an incomplete ellipsoid in the viral factory area, attaining the overall shape and size characteristic of the first immature form of the virus [IV (immature virus)]. The incorporation of the DNA into these forms leads to particles with a nucleoid [IVN (IV with nucleoid)] that results in local disorganization of the envelope in regions near the condensed DNA. These particles suffer the progressive disappearance of the membrane outer spikes with a change in the shape of the membrane, becoming locally curled. The transformation of the IVN into the mature virus involves an extreme rearrangement of the particle envelope, which becomes fragmented and undulated. During this process, we also observed connections between the outer membranes with internal ones, suggesting that the latter originate from internalization of the IV envelope. The main features observed for VACV membrane maturation during morphogenesis resemble the breakdown and reassembly of cellular endomembranes.

  4. Incongruencies in Vaccinia Virus Phylogenetic Trees

    Directory of Open Access Journals (Sweden)

    Chad Smithson

    2014-10-01

    Full Text Available Over the years, as more complete poxvirus genomes have been sequenced, phylogenetic studies of these viruses have become more prevalent. In general, the results show similar relationships between the poxvirus species; however, some inconsistencies are notable. Previous analyses of the viral genomes contained within the vaccinia virus (VACV-Dryvax vaccine revealed that their phylogenetic relationships were sometimes clouded by low bootstrapping confidence. To analyze the VACV-Dryvax genomes in detail, a new tool-set was developed and integrated into the Base-By-Base bioinformatics software package. Analyses showed that fewer unique positions were present in each VACV-Dryvax genome than expected. A series of patterns, each containing several single nucleotide polymorphisms (SNPs were identified that were counter to the results of the phylogenetic analysis. The VACV genomes were found to contain short DNA sequence blocks that matched more distantly related clades. Additionally, similar non-conforming SNP patterns were observed in (1 the variola virus clade; (2 some cowpox clades; and (3 VACV-CVA, the direct ancestor of VACV-MVA. Thus, traces of past recombination events are common in the various orthopoxvirus clades, including those associated with smallpox and cowpox viruses.

  5. A single cidofovir treatment rescues animals at progressive stages of lethal orthopoxvirus disease

    Directory of Open Access Journals (Sweden)

    Israely Tomer

    2012-06-01

    Full Text Available Abstract Background In an event of a smallpox outbreak in humans, the window for efficacious treatment by vaccination with vaccinia viruses (VACV is believed to be limited to the first few days post-exposure (p.e.. We recently demonstrated in a mouse model for human smallpox, that active immunization 2–3 days p.e. with either VACV-Lister or modified VACV Ankara (MVA vaccines, can rescue animals from lethal challenge of ectromelia virus (ECTV, the causative agent of mousepox. The present study was carried out in order to determine whether a single dose of the anti-viral cidofovir (CDV, administered at different times and doses p.e. either alone or in conjunction with active vaccination, can rescue ECTV infected mice. Methods Animals were infected intranasally with ECTV, treated on different days with various single CDV doses and monitored for morbidity, mortality and humoral response. In addition, in order to determine the influence of CDV on the immune response following vaccination, both the "clinical take”, IFN-gamma and IgG Ab levels in the serum were evaluated as well as the ability of the mice to withstand a lethal challenge of ECTV. Finally the efficacy of a combined treatment regime of CDV and vaccination p.e. was determined. Results A single p.e. CDV treatment is sufficient for protection depending on the initiation time and dose (2.5 – 100 mg/kg of treatment. Solid protection was achieved by a low dose (5 mg/kg CDV treatment even if given at day 6 p.e., approximately 4 days before death of the control infected untreated mice (mean time to death (MTTD 10.2. At the same time point complete protection was achieved by single treatment with higher doses of CDV (25 or 100 mg/kg. Irrespective of treatment dose, all surviving animals developed a protective immune response even when the CDV treatment was initiated one day p.e.. After seven days post treatment with the highest dose (100 mg/kg, virus was still detected in some

  6. A single cidofovir treatment rescues animals at progressive stages of lethal orthopoxvirus disease.

    Science.gov (United States)

    Israely, Tomer; Paran, Nir; Lustig, Shlomo; Erez, Noam; Politi, Boaz; Shafferman, Avigdor; Melamed, Sharon

    2012-06-18

    In an event of a smallpox outbreak in humans, the window for efficacious treatment by vaccination with vaccinia viruses (VACV) is believed to be limited to the first few days post-exposure (p.e.). We recently demonstrated in a mouse model for human smallpox, that active immunization 2-3 days p.e. with either VACV-Lister or modified VACV Ankara (MVA) vaccines, can rescue animals from lethal challenge of ectromelia virus (ECTV), the causative agent of mousepox. The present study was carried out in order to determine whether a single dose of the anti-viral cidofovir (CDV), administered at different times and doses p.e. either alone or in conjunction with active vaccination, can rescue ECTV infected mice. Animals were infected intranasally with ECTV, treated on different days with various single CDV doses and monitored for morbidity, mortality and humoral response. In addition, in order to determine the influence of CDV on the immune response following vaccination, both the "clinical take", IFN-gamma and IgG Ab levels in the serum were evaluated as well as the ability of the mice to withstand a lethal challenge of ECTV. Finally the efficacy of a combined treatment regime of CDV and vaccination p.e. was determined. A single p.e. CDV treatment is sufficient for protection depending on the initiation time and dose (2.5 - 100 mg/kg) of treatment. Solid protection was achieved by a low dose (5 mg/kg) CDV treatment even if given at day 6 p.e., approximately 4 days before death of the control infected untreated mice (mean time to death (MTTD) 10.2). At the same time point complete protection was achieved by single treatment with higher doses of CDV (25 or 100 mg/kg). Irrespective of treatment dose, all surviving animals developed a protective immune response even when the CDV treatment was initiated one day p.e.. After seven days post treatment with the highest dose (100 mg/kg), virus was still detected in some organs (e.g. lung and liver) yet all animals survived, suggesting

  7. Genetically Engineered Vaccinia Viruses As Agents for Cancer Treatment, Imaging, and Transgene Delivery

    Directory of Open Access Journals (Sweden)

    Dana Haddad

    2017-05-01

    Full Text Available Despite advances in technology, the formidable challenge of treating cancer, especially if advanced, still remains with no significant improvement in survival rates, even with the most common forms of cancer. Oncolytic viral therapies have shown great promise for the treatment of various cancers, with the possible advantages of stronger treatment efficacy compared to conventional therapy due to higher tumor selectivity, and less toxicity. They are able to preferentially and selectively propagate in cancer cells, consequently destroying tumor tissue mainly via cell lysis, while leaving non-cancerous tissues unharmed. Several wild-type and genetically engineered vaccinia virus (VACV strains have been tested in both preclinical and clinical trials with promising results. Greater understanding and advancements in molecular biology have enabled the generation of genetically engineered oncolytic viruses for safer and more efficacious treatment, including arming VACVs with cytokines and immunostimulatory molecules, anti-angiogenic agents, and enzyme prodrug therapy, in addition to combining VACVs with conventional external and systemic radiotherapy, chemotherapy, immunotherapy, and other virus strains. Furthermore, novel oncolytic vaccinia virus strains have been generated that express reporter genes for the tracking and imaging of viral therapy and monitoring of therapeutic response. Further study is needed to unlock VACVs’ full potential as part of the future of cancer therapy.

  8. Genetically Engineered Vaccinia Viruses As Agents for Cancer Treatment, Imaging, and Transgene Delivery

    Science.gov (United States)

    Haddad, Dana

    2017-01-01

    Despite advances in technology, the formidable challenge of treating cancer, especially if advanced, still remains with no significant improvement in survival rates, even with the most common forms of cancer. Oncolytic viral therapies have shown great promise for the treatment of various cancers, with the possible advantages of stronger treatment efficacy compared to conventional therapy due to higher tumor selectivity, and less toxicity. They are able to preferentially and selectively propagate in cancer cells, consequently destroying tumor tissue mainly via cell lysis, while leaving non-cancerous tissues unharmed. Several wild-type and genetically engineered vaccinia virus (VACV) strains have been tested in both preclinical and clinical trials with promising results. Greater understanding and advancements in molecular biology have enabled the generation of genetically engineered oncolytic viruses for safer and more efficacious treatment, including arming VACVs with cytokines and immunostimulatory molecules, anti-angiogenic agents, and enzyme prodrug therapy, in addition to combining VACVs with conventional external and systemic radiotherapy, chemotherapy, immunotherapy, and other virus strains. Furthermore, novel oncolytic vaccinia virus strains have been generated that express reporter genes for the tracking and imaging of viral therapy and monitoring of therapeutic response. Further study is needed to unlock VACVs’ full potential as part of the future of cancer therapy. PMID:28589082

  9. Preclinical evaluation of oncolytic vaccinia virus for therapy of canine soft tissue sarcoma.

    Directory of Open Access Journals (Sweden)

    Ivaylo Gentschev

    Full Text Available Virotherapy using oncolytic vaccinia virus (VACV strains is one promising new strategy for canine cancer therapy. In this study we describe the establishment of an in vivo model of canine soft tissue sarcoma (CSTS using the new isolated cell line STSA-1 and the analysis of the virus-mediated oncolytic and immunological effects of two different Lister VACV LIVP1.1.1 and GLV-1h68 strains against CSTS. Cell culture data demonstrated that both tested VACV strains efficiently infected and destroyed cells of the canine soft tissue sarcoma line STSA-1. In addition, in our new canine sarcoma tumor xenograft mouse model, systemic administration of LIVP1.1.1 or GLV-1h68 viruses led to significant inhibition of tumor growth compared to control mice. Furthermore, LIVP1.1.1 mediated therapy resulted in almost complete tumor regression and resulted in long-term survival of sarcoma-bearing mice. The replication of the tested VACV strains in tumor tissues led to strong oncolytic effects accompanied by an intense intratumoral infiltration of host immune cells, mainly neutrophils. These findings suggest that the direct viral oncolysis of tumor cells and the virus-dependent activation of tumor-associated host immune cells could be crucial parts of anti-tumor mechanism in STSA-1 xenografts. In summary, the data showed that both tested vaccinia virus strains and especially LIVP1.1.1 have great potential for effective treatment of CSTS.

  10. Enteric Immunization of Mice Against Influenza with Recombinant Vaccinia

    Science.gov (United States)

    Meitin, Catherine A.; Bender, Bradley S.; Small, Parker A., Jr.

    1994-11-01

    Intrajejunal administration to mice of a recombinant vaccinia virus containing the influenza virus hemagglutinin gene induced IgA antibody in nasal, gut, and vaginal secretions. It also induced IgG antibody in serum and cell-mediated immunity. The immunization provided significant protection against an influenza virus challenge. This work suggests that enteric-coated recombinant vaccinia could be an orally administered, inexpensive, multivalent, temperature-stable, safe, and effective vaccine for children that could be particularly useful in developing nations, where multiple injections are not easily administered. Oral administration of vaccines should also reduce children's fear of shots at the doctor's office.

  11. Immunodomination during peripheral vaccinia virus infection.

    Directory of Open Access Journals (Sweden)

    Leon C W Lin

    Full Text Available Immunodominance is a fundamental property of CD8(+ T cell responses to viruses and vaccines. It had been observed that route of administration alters immunodominance after vaccinia virus (VACV infection, but only a few epitopes were examined and no mechanism was provided. We re-visited this issue, examining a panel of 15 VACV epitopes and four routes, namely intradermal (i.d., subcutaneous (s.c., intraperitoneal (i.p. and intravenous (i.v. injection. We found that immunodominance is sharpened following peripheral routes of infection (i.d. and s.c. compared with those that allow systemic virus dissemination (i.p. and i.v.. This increased immunodominance was demonstrated with native epitopes of VACV and with herpes simplex virus glycoprotein B when expressed from VACV. Responses to some subdominant epitopes were altered by as much as fourfold. Tracking of virus, examination of priming sites, and experiments restricting virus spread showed that priming of CD8(+ T cells in the spleen was necessary, but not sufficient to broaden responses. Further, we directly demonstrated that immunodomination occurs more readily when priming is mainly in lymph nodes. Finally, we were able to reduce immunodominance after i.d., but not i.p. infection, using a VACV expressing the costimulators CD80 (B7-1 and CD86 (B7-2, which is notable because VACV-based vaccines incorporating these molecules are in clinical trials. Taken together, our data indicate that resources for CD8(+ T cell priming are limiting in local draining lymph nodes, leading to greater immunodomination. Further, we provide evidence that costimulation can be a limiting factor that contributes to immunodomination. These results shed light on a possible mechanism of immunodomination and highlight the need to consider multiple epitopes across the spectrum of immunogenicities in studies aimed at understanding CD8(+ T cell immunity to viruses.

  12. Vaccinia virus as a subhelper for AAV replication and packaging

    Directory of Open Access Journals (Sweden)

    Andrea R Moore

    Full Text Available Adeno-associated virus (AAV has been widely used as a gene therapy vector to treat a variety of disorders. While these vectors are increasingly popular and successful in the clinic, there is still much to learn about the viruses. Understanding the biology of these viruses is essential in engineering better vectors and generating vectors more efficiently for large-scale use. AAV requires a helper for production and replication making this aspect of the viral life cycle crucial. Vaccinia virus (VV has been widely cited as a helper virus for AAV. However, to date, there are no detailed analyses of its helper function. Here, the helper role of VV was studied in detail. In contrast to common belief, we demonstrated that VV was not a sufficient helper virus for AAV replication. Vaccinia failed to produce rAAV and activate AAV promoters. While this virus could not support rAAV production, Vaccinia could initiate AAV replication and packaging when AAV promoter activation is not necessary. This activity is due to the ability of Vaccinia-driven Rep78 to transcribe in the cytoplasm and subsequently translate in the nucleus and undergo typical functions in the AAV life cycle. As such, VV is subhelper for AAV compared to complete helper functions of adenovirus.

  13. Vaccinia virus encodes a polypeptide with DNA ligase activity.

    Science.gov (United States)

    Kerr, S M; Smith, G L

    1989-11-25

    Vaccinia virus gene SalF 15R potentially encodes a polypeptide of 63 kD which shares 30% amino acid identity with S. pombe and S. cerevisiae DNA ligases. DNA ligase proteins can be identified by incubation with alpha-(32P)ATP, resulting in the formation of a covalent DNA ligase-AMP adduct, an intermediate in the enzyme reaction. A novel radio-labelled polypeptide of approximately 61 kD appears in extracts from vaccinia virus infected cells after incubation with alpha-(32P)ATP. This protein is present throughout infection and is a DNA ligase as the radioactivity is discharged in the presence of either DNA substrate or pyrophosphate. DNA ligase assays show an increase in enzyme activity in cell extracts after vaccinia virus infection. A rabbit antiserum, raised against a bacterial fusion protein of beta-galactosidase and a portion of SalF 15R, immune-precipitates polypeptides of 61 and 54 kD from extracts of vaccinia virus-infected cells. This antiserum also immune-precipitates the novel DNA ligase-AMP adduct, thus proving that the observed DNA ligase is encoded by SalF 15R.

  14. Vaccinia virus as a subhelper for AAV replication and packaging.

    Science.gov (United States)

    Moore, Andrea R; Dong, Biao; Chen, Lingxia; Xiao, Weidong

    2015-01-01

    Adeno-associated virus (AAV) has been widely used as a gene therapy vector to treat a variety of disorders. While these vectors are increasingly popular and successful in the clinic, there is still much to learn about the viruses. Understanding the biology of these viruses is essential in engineering better vectors and generating vectors more efficiently for large-scale use. AAV requires a helper for production and replication making this aspect of the viral life cycle crucial. Vaccinia virus (VV) has been widely cited as a helper virus for AAV. However, to date, there are no detailed analyses of its helper function. Here, the helper role of VV was studied in detail. In contrast to common belief, we demonstrated that VV was not a sufficient helper virus for AAV replication. Vaccinia failed to produce rAAV and activate AAV promoters. While this virus could not support rAAV production, Vaccinia could initiate AAV replication and packaging when AAV promoter activation is not necessary. This activity is due to the ability of Vaccinia-driven Rep78 to transcribe in the cytoplasm and subsequently translate in the nucleus and undergo typical functions in the AAV life cycle. As such, VV is subhelper for AAV compared to complete helper functions of adenovirus.

  15. Lethal multiple pterygium syndrome

    Directory of Open Access Journals (Sweden)

    Tulika Joshi

    2016-01-01

    Full Text Available The multiple pterygium syndrome is consist of wide range of fetal malformations which have a genetic linkage. A defect in embryonic acetylcholine receptor which can be inherited as autosomal recessive, autosomal dominant, or X-linked fashion is the cause of this syndrome. We present a sporadic case of lethal multiple pterygium syndrome.

  16. Protective properties of vaccinia virus-based vaccines: skin scarification promotes a nonspecific immune response that protects against orthopoxvirus disease.

    Science.gov (United States)

    Rice, Amanda D; Adams, Mathew M; Lindsey, Scott F; Swetnam, Daniele M; Manning, Brandi R; Smith, Andrew J; Burrage, Andrew M; Wallace, Greg; MacNeill, Amy L; Moyer, Richard W

    2014-07-01

    The process of vaccination introduced by Jenner generated immunity against smallpox and ultimately led to the eradication of the disease. Procedurally, in modern times, the virus is introduced into patients via a process called scarification, performed with a bifurcated needle containing a small amount of virus. What was unappreciated was the role that scarification itself plays in generating protective immunity. In rabbits, protection from lethal disease is induced by intradermal injection of vaccinia virus, whereas a protective response occurs within the first 2 min after scarification with or without virus, suggesting that the scarification process itself is a major contributor to immunoprotection. importance: These results show the importance of local nonspecific immunity in controlling poxvirus infections and indicate that the process of scarification should be critically considered during the development of vaccination protocols for other infectious agents. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  17. Lethal and sub-lethal effects of UVB on juvenile Biomphalaria glabrata (Mollusca: Pulmonata).

    Science.gov (United States)

    Ruelas, Debbie S; Karentz, Deneb; Sullivan, John T

    2006-11-01

    Although Schistosoma mansoni occurs mainly in the tropics, where intense levels of solar radiation are present, the impact of ultraviolet (UV) light on schistosome transmission is not known. The purpose of this study was to investigate potential effects of UVB (290-320nm) on juvenile Biomphalaria glabrata, the snail intermediate host of S. mansoni. Albino and wild-type snails were exposed to doses of UVB from UV-fluorescent lamps, and the following were measured: survival, photoreactivation (light-mediated DNA repair), effects on feeding behavior, and morphological tissue abnormalities. Irradiation with UVB is lethal to B. glabrata in a dose-dependent manner. Exposure to white light subsequent to UVB irradiation enhances survival, probably by photoreactivation. The shell offers some, but not complete, protection. Experiments in which UVB transmittance through the shell was blocked with black nail polish suggest that injury to both exposed (headfoot) and shell-enclosed (mantle and visceral mass) tissues contributes to mortality in lethally irradiated snails. Wild-type (pigmented) snails are less susceptible to lethal effects of UVB than albino snails, and they may be more capable of photoreactivation. UVB exposure inhibits snail feeding behavior, and causes tentacle forks and growths on the headfoot. Thus, UVB may influence the life cycle of S. mansoni by both lethal and sub-lethal damage to the snail intermediate host. However, the ability of snails to photoreactivate may mitigate these effects.

  18. Crash Lethality Model

    Science.gov (United States)

    2012-06-06

    UAS) could inflict life threatening injuries to 3rd party individuals and develop a model that would calculate the total Lethal Crash Area ( LCA ...given some standard UAS calculations. A literature search was done to evaluate previous models at determining LCA from aircraft accidents. Two cases were...assess 3rd party risk. Ten UAS cases were evaluated and suggest that the factor most correlated to the size of the LCA is the weight of the air

  19. Effects of nasal or pulmonary delivered treatments with an adenovirus vectored interferon (mDEF201 on respiratory and systemic infections in mice caused by cowpox and vaccinia viruses.

    Directory of Open Access Journals (Sweden)

    Donald F Smee

    Full Text Available An adenovirus 5 vector encoding for mouse interferon alpha, subtype 5 (mDEF201 was evaluated for efficacy against lethal cowpox (Brighton strain and vaccinia (WR strain virus respiratory and systemic infections in mice. Two routes of mDEF201 administration were used, nasal sinus (5-µl and pulmonary (50-µl, to compare differences in efficacy, since the preferred treatment of humans would be in a relatively small volume delivered intranasally. Lower respiratory infections (LRI, upper respiratory infections (URI, and systemic infections were induced by 50-µl intranasal, 10-µl intranasal, and 100-µl intraperitoneal virus challenges, respectively. mDEF201 treatments were given prophylactically either 24 h (short term or 56d (long-term prior to virus challenge. Single nasal sinus treatments of 10(6 and 10(7 PFU/mouse of mDEF201 protected all mice from vaccinia-induced LRI mortality (comparable to published studies with pulmonary delivered mDEF201. Systemic vaccinia infections responded significantly better to nasal sinus delivered mDEF201 than to pulmonary treatments. Cowpox LRI infections responded to 10(7 mDEF201 treatments, but a 10(6 dose was only weakly protective. Cowpox URI infections were equally treatable by nasal sinus and pulmonary delivered mDEF201 at 10(7 PFU/mouse. Dose-responsive prophylaxis with mDEF201, given one time only 56 d prior to initiating a vaccinia virus LRI infection, was 100% protective from 10(5 to 10(7 PFU/mouse. Improvements in lung hemorrhage score and lung weight were evident, as were decreases in liver, lung, and spleen virus titers. Thus, mDEF201 was able to treat different vaccinia and cowpox virus infections using both nasal sinus and pulmonary treatment regimens, supporting its development for humans.

  20. Regression of Human Prostate Tumors and Metastases in Nude Mice following Treatment with the Recombinant Oncolytic Vaccinia Virus GLV-1h68

    Directory of Open Access Journals (Sweden)

    Ivaylo Gentschev

    2010-01-01

    Full Text Available Virotherapy using oncolytic vaccinia virus strains is one of the most promising new strategies for cancer therapy. In the current study, we analyzed the therapeutic efficacy of the oncolytic vaccinia virus GLV-1h68 against two human prostate cancer cell lines DU-145 and PC-3 in cell culture and in tumor xenograft models. By viral proliferation assays and cell survival tests, we demonstrated that GLV-1h68 was able to infect, replicate in, and lyse these prostate cancer cells in culture. In DU-145 and PC-3 tumor xenograft models, a single intravenous injection with GLV-1h68 resulted in a significant reduction of primary tumor size. In addition, the GLV-1h68-infection led to strong inflammatory and oncolytic effects resulting in drastic reduction of regional lymph nodes with PC-3 metastases. Our data documented that the GLV-1h68 virus has a great potential for treatment of human prostate carcinoma.

  1. Protection of rabbits and immunodeficient mice against lethal poxvirus infections by human monoclonal antibodies.

    Directory of Open Access Journals (Sweden)

    Lindsay Crickard

    Full Text Available Smallpox (variola virus is a bioweapon concern. Monkeypox is a growing zoonotic poxvirus threat. These problems have resulted in extensive efforts to develop potential therapeutics that can prevent or treat potentially lethal poxvirus infections in humans. Monoclonal antibodies (mAbs against smallpox are a conservative approach to this problem, as the licensed human smallpox vaccine (vaccinia virus, VACV primarily works on the basis of protective antibody responses against smallpox. Fully human mAbs (hmAbs against vaccinia H3 (H3L and B5 (B5R, targeting both the mature virion (MV and extracellular enveloped virion (EV forms, have been developed as potential therapeutics for use in humans. Post-exposure prophylaxis was assessed in both murine and rabbit animal models. Therapeutic efficacy of the mAbs was assessed in three good laboratory practices (GLP studies examining severe combined immunodeficiency mice (SCID given a lethal VACV infection. Pre-exposure combination hmAb therapy provided significantly better protection against disease and death than either single hmAb or vaccinia immune globulin (VIG. Post-exposure combination mAb therapy provided significant protection against disease and death, and appeared to fully cure the VACV infection in ≥50% of SCID mice. Therapeutic efficacy was then assessed in two rabbit studies examining post-exposure hmAb prophylaxis against rabbitpox (RPXV. In the first study, rabbits were infected with RPVX and then provided hmAbs at 48 hrs post-infection, or 1 hr and 72 hrs post-infection. Rabbits in both groups receiving hmAbs were 100% protected from death. In the second rabbitpox study, 100% of animal treated with combination hmAb therapy and 100% of animals treated with anti-B5 hmAb were protected. These findings suggest that combination hmAb treatment may be effective at controlling smallpox disease in immunocompetent or immunodeficient humans.

  2. A cancer-favoring oncolytic vaccinia virus shows enhanced suppression of stem-cell like colon cancer.

    Science.gov (United States)

    Yoo, So Young; Bang, Seo Young; Jeong, Su-Nam; Kang, Dae Hwan; Heo, Jeong

    2016-03-29

    Stem cell-like colon cancer cells (SCCs) pose a major challenge in colon cancer treatment because of their resistance to chemotherapy and radiotherapy. Oncolytic virus-based therapy has shown promising results in uncured cancer patients; however, its effects on SCCs are not well studied yet. Here, we engineered a cancer-favoring oncolytic vaccinia virus (CVV) as a potent biotherapeutic and investigated its therapeutic efficacy in terms of killing SCCs. CVV is an evolved Wyeth strain vaccinia virus (EVV) lacking the viral thymidine kinase. SCC models were established using human or mouse colon cancer spheres, which continuously expressed stemness markers. The cancer-favoring characteristics and different cytotoxic pathways for killing cancer cells successfully overrode general drug resistance, thereby killing colon cancer cells regardless of the presence of SCCs. Subcutaneously injected HT29 spheres showed lower growth in CVV-treated models than in 5-Fu-treated models. Intraperitoneally injected CT26 spheres induced tumor masses in the abdominal region. CVV-treated groups showed higher survival rates and smaller tumor mass formation, compared to 5-Fu-treated groups. Interestingly, the combined treatment of CVV with 5-Fu showed improved survival rates and complete suppression of tumor mass. The CVV developed in this study, thus, effectively suppresses SCCs, which can be synergistically enhanced by simultaneous treatment with the anticancer drug 5-Fu. Our novel CVV is highly advantageous as a next-generation therapeutic for treating colon cancer.

  3. Cytoplasmic ATR Activation Promotes Vaccinia Virus Genome Replication

    Directory of Open Access Journals (Sweden)

    Antonio Postigo

    2017-05-01

    Full Text Available In contrast to most DNA viruses, poxviruses replicate their genomes in the cytoplasm without host involvement. We find that vaccinia virus induces cytoplasmic activation of ATR early during infection, before genome uncoating, which is unexpected because ATR plays a fundamental nuclear role in maintaining host genome integrity. ATR, RPA, INTS7, and Chk1 are recruited to cytoplasmic DNA viral factories, suggesting canonical ATR pathway activation. Consistent with this, pharmacological and RNAi-mediated inhibition of canonical ATR signaling suppresses genome replication. RPA and the sliding clamp PCNA interact with the viral polymerase E9 and are required for DNA replication. Moreover, the ATR activator TOPBP1 promotes genome replication and associates with the viral replisome component H5. Our study suggests that, in contrast to long-held beliefs, vaccinia recruits conserved components of the eukaryote DNA replication and repair machinery to amplify its genome in the host cytoplasm.

  4. Oncolytic vaccinia virus as an adjuvant treatment to cytoreductive surgery for malignant peritoneal mesothelioma.

    Science.gov (United States)

    Acuna, Sergio A; Ottolino-Perry, Kathryn; Çako, Besmira; Tang, Nan; Angarita, Fernando A; McCart, J Andrea

    2014-07-01

    Malignant peritoneal mesothelioma (MPM) is an aggressive cancer with a dismal prognosis. Oncolytic viruses are a promising new therapy for cancer because of their ability to kill tumor cells with minimal toxicity to normal tissues. This experimental study aimed to examine the potential of modified vaccinia virus (VV) to treat MPM when administered alone or as an adjuvant treatment to surgery. Two aggressive murine mesothelioma cell lines (AC29, AB12), were used. Cell viability and viral cytopathic effects were assessed using MTS and crystal violet assays. Immunocompetent mice were injected intraperitoneally with MPM cells and treated with intraperitoneal VV. Tumor-bearing mice also underwent cytoreductive surgery (CRS) followed by VV (or control) therapy. The cytotoxic effects of VV on MPM cell lines was significantly increased compared with the control non-cancer cell line. In both orthotopic models, VV induced tumor regression, prolonging median and long-term survival. VV treatment after incomplete CRS was not superior to VV alone; however, when mice with microscopic disease were treated with VV, further prolongation of median and long-term survivals was observed. VV selectively kills MPM cells in vitro and leads to improved survival and cures in immunocompetent murine models. Higher efficacy of the virus in the microscopic disease context suggests the use of the virus as an adjuvant treatment to complete surgical resection. These promising results justify further studies of VV in humans as a novel treatment for MPM.

  5. Epitope mapping by random peptide phage display reveals essential residues for vaccinia extracellular enveloped virion spread

    Directory of Open Access Journals (Sweden)

    He Yong

    2012-09-01

    Full Text Available Abstract Background A33 is a type II integral membrane protein expressed on the extracellular enveloped form of vaccinia virus (VACV. Passive transfer of A33-directed monoclonal antibodies or vaccination with an A33 subunit vaccine confers protection against lethal poxvirus challenge in animal models. Homologs of A33 are highly conserved among members of the Orthopoxvirus genus and are potential candidates for inclusion in vaccines or assays targeting extracellular enveloped virus activity. One monoclonal antibody directed against VACV A33, MAb-1G10, has been shown to target a conformation-dependent epitope. Interestingly, while it recognizes VACV A33 as well as the corresponding variola homolog, it does not bind to the monkeypox homolog. In this study, we utilized a random phage display library to investigate the epitope recognized by MAb-1G10 that is critical for facilitating cell-to-cell spread of the vaccinia virus. Results By screening with linear or conformational random phage libraries, we found that phages binding to MAb-1G10 display the consensus motif CEPLC, with a disulfide bond formed between two cysteine residues required for MAb-1G10 binding. Although the phage motif contained no linear sequences homologous to VACV A33, structure modeling and analysis suggested that residue D115 is important to form the minimal epitope core. A panel of point mutants expressing the ectodomain of A33 protein was generated and analyzed by either binding assays such as ELISA and immunoprecipitation or a functional assessment by blocking MAb-1G10 mediated comet inhibition in cell culture. Conclusions These results confirm L118 as a component of the MAb-1G10 binding epitope, and further identify D115 as an essential residue. By defining the minimum conformational structure, as well as the conformational arrangement of a short peptide sequence recognized by MAb-1G10, these results introduce the possibility of designing small molecule mimetics that may

  6. Frequency of adverse events after vaccination with different vaccinia strains.

    Directory of Open Access Journals (Sweden)

    Mirjam Kretzschmar

    2006-08-01

    Full Text Available BACKGROUND: Large quantities of smallpox vaccine have been stockpiled to protect entire nations against a possible reintroduction of smallpox. Planning for an appropriate use of these stockpiled vaccines in response to a smallpox outbreak requires a rational assessment of the risks of vaccination-related adverse events, compared to the risk of contracting an infection. Although considerable effort has been made to understand the dynamics of smallpox transmission in modern societies, little attention has been paid to estimating the frequency of adverse events due to smallpox vaccination. Studies exploring the consequences of smallpox vaccination strategies have commonly used a frequency of approximately one death per million vaccinations, which is based on a study of vaccination with the New York City Board of Health (NYCBH strain of vaccinia virus. However, a multitude of historical studies of smallpox vaccination with other vaccinia strains suggest that there are strain-related differences in the frequency of adverse events after vaccination. Because many countries have stockpiled vaccine based on the Lister strain of vaccinia virus, a quantitative evaluation of the adverse effects of such vaccines is essential for emergency response planning. We conducted a systematic review and statistical analysis of historical data concerning vaccination against smallpox with different strains of vaccinia virus. METHODS AND FINDINGS: We analyzed historical vaccination data extracted from the literature. We extracted data on the frequency of postvaccinal encephalitis and death with respect to vaccinia strain and age of vaccinees. Using a hierarchical Bayesian approach for meta-analysis, we estimated the expected frequencies of postvaccinal encephalitis and death with respect to age at vaccination for smallpox vaccines based on the NYCBH and Lister vaccinia strains. We found large heterogeneity between findings from different studies and a time-period effect

  7. Modified vaccinia virus Ankara protects macaques against respiratory challenge with monkeypox virus.

    NARCIS (Netherlands)

    K.J. Stittelaar (Koert); G. van Amerongen (Geert); I. Kondova (Ivanela); R.F. van Lavieren (Rob); F.H. Pistoor (Frank); H.G.M. Niesters (Bert); G.J.J. van Doornum (Gerard); B.A.M. van der Zeijst (Ben); L. Mateo (Luis); P.J. Chaplin (Paul); A.D.M.E. Osterhaus (Albert); T. Kuiken (Thijs)

    2005-01-01

    textabstractThe use of classical smallpox vaccines based on vaccinia virus (VV) is associated with severe complications in both naive and immune individuals. Modified vaccinia virus Ankara (MVA), a highly attenuated replication-deficient strain of VV, has been proven to be safe in humans and

  8. In vitro recognition of an orf virus early promoter in a vaccinia virus extract

    NARCIS (Netherlands)

    Vos, J C; Mercer, R. A.; Fleming, S B; Robinson, A J

    1992-01-01

    DNA fragments containing varying lengths of the 5' end of an orf virus early gene (ORF3) and its associated promoter were introduced into sodium deoxycholate-solubilized vaccinia virus extracts capable of initiating transcription in vitro from vaccinia virus early promoters. After separation of the

  9. Analysis of variola and vaccinia virus neutralization assays for smallpox vaccines.

    Science.gov (United States)

    Hughes, Christine M; Newman, Frances K; Davidson, Whitni B; Olson, Victoria A; Smith, Scott K; Holman, Robert C; Yan, Lihan; Frey, Sharon E; Belshe, Robert B; Karem, Kevin L; Damon, Inger K

    2012-07-01

    Possible smallpox reemergence drives research for third-generation vaccines that effectively neutralize variola virus. A comparison of neutralization assays using different substrates, variola and vaccinia (Dryvax and modified vaccinia Ankara [MVA]), showed significantly different 90% neutralization titers; Dryvax underestimated while MVA overestimated variola neutralization. Third-generation vaccines may rely upon neutralization as a correlate of protection.

  10. In silico-accelerated identification of conserved and immunogenic variola/vaccinia T-cell epitopes

    DEFF Research Database (Denmark)

    Moise, Leonard; McMurry, Julie A; Buus, Søren

    2009-01-01

    Epitopes shared by the vaccinia and variola viruses underlie the protective effect of vaccinia immunization against variola infection. We set out to identify a subset of cross-reactive epitopes using bioinformatics and immunological methods. Putative T-cell epitopes were computationally predicted...

  11. Histopathological effects of lethal and sub-lethal concentrations of ...

    African Journals Online (AJOL)

    The histopathological effects of lethal and sub-lethal concentrations of glyphosate on African catfish Clarias gariepinus were investigated. C. gariepinus juveniles were assessed in a static renewal bioassay for 96 hours (acute toxicity) and 28 days (chronic toxicity) using varying concentrations (0.0 mg/l 20.0 mg/l, 30.0 mg/l, ...

  12. Suicide Lethality: A Concept Analysis.

    Science.gov (United States)

    DeBastiani, Summer; De Santis, Joseph P

    2018-02-01

    Suicide is a significant health problem internationally. Those who complete suicide may have different behaviors and risk factors than those who attempt a non-fatal suicide. The purpose of this article is to analyze the concept of suicide lethality and propose a clear definition of the concept through the identification of antecedents, attributes, and consequences. A literature search for articles published in the English language between 1970 and 2016 was conducted using MEDLINE, the Cochrane Library, Pubmed, Psychlit, Ovid, PsycINFO, and Proquest. The bibliographies of all included studies were also reviewed to identify additional relevant citations. A concept analysis was conducted on the literature findings using six stages of Walker and Avant's method. The concept analysis differentiated between suicide, lethality, suicidal behavior, and suicide lethality. Presence of a suicide plan or a written suicide note was not found to be associated with the majority of completed suicides included in the definition of suicide lethality. There are a few scales that measure the lethality of a suicide attempt, but none that attempt to measure the concept of suicide lethality as described in this analysis. Clarifying the concept of suicide lethality encourages awareness of the possibility of different suicidal behaviors associated with different suicide outcomes and will inform the development of future nursing interventions. A clearer definition of the concept of suicide lethality will guide clinical practice, research, and policy development aimed at suicide prevention.

  13. MIDLINE LETHAL GRANULOMA COMPLICATING PREGNANCY ...

    African Journals Online (AJOL)

    Kateee

    MIDLINE LETHAL GRANULOMA COMPLICATING PREGNANCY: CASE REPORT. B.D.O. SAHEEB and M.A. OJO. ABSTRACT. A case of midline lethal granuloma in a 28-year- old female Nigerian patient is reported. Oral, ocular and nasal lesions were present and these preceded a spontaneous abortion of a three.

  14. Protein Primary Structure of the Vaccinia Virion at Increased Resolution

    Science.gov (United States)

    Ngo, Tuan; Mirzakhanyan, Yeva; Moussatche, Nissin; Gershon, Paul David

    2016-11-01

    Here we examine the protein covalent structure of the vaccinia virus virion. Within two virion preparations, >88% of the theoretical vaccinia virus-encoded proteome was detected with high confidence, including the first detection of products from 27 open reading frames (ORFs) previously designated "predicted," "uncharacterized," "inferred," or "hypothetical" polypeptides containing as few as 39 amino acids (aa) and six proteins whose detection required nontryptic proteolysis. We also detected the expression of four short ORFs, each of which was located within an ORF ("ORF-within-ORF"), including one not previously recognized or known to be expressed. Using quantitative mass spectrometry (MS), between 58 and 74 proteins were determined to be packaged. A total of 63 host proteins were also identified as candidates for packaging. Evidence is provided that some portion of virion proteins are "nicked" via a combination of endoproteolysis and concerted exoproteolysis in a manner, and at sites, independent of virus origin or laboratory procedures. The size of the characterized virion phosphoproteome was doubled from 189 (J. Matson, W. Chou, T. Ngo, and P. D. Gershon, Virology 452-453:310-323, 2014, doi:http://dx.doi.org/10.1016/j.virol.2014.01.012) to 396 confident, unique phosphorylation sites, 268 of which were within the packaged proteome. This included the unambiguous identification of phosphorylation "hot spots" within virion proteins. Using isotopically enriched ATP, 23 sites of intravirion kinase phosphorylation were detected within nine virion proteins, all at sites already partially occupied within the virion preparations. The clear phosphorylation of proteins RAP94 and RP19 was consistent with the roles of these proteins in intravirion early gene transcription. In a blind search for protein modifications, cysteine glutathionylation and O-linked glycosylation featured prominently. We provide evidence for the phosphoglycosylation of vaccinia virus proteins

  15. Genetics Home Reference: Amish lethal microcephaly

    Science.gov (United States)

    ... Facebook Twitter Home Health Conditions Amish lethal microcephaly Amish lethal microcephaly Printable PDF Open All Close All ... Javascript to view the expand/collapse boxes. Description Amish lethal microcephaly is a disorder in which infants ...

  16. Isolation and characterization of cidofovir resistant vaccinia viruses

    Directory of Open Access Journals (Sweden)

    Prichard Mark N

    2008-05-01

    Full Text Available Abstract Background The emergence of drug resistant viruses, together with the possibility of increased virulence, is an important concern in the development of new antiviral compounds. Cidofovir (CDV is a phosphonate nucleotide that is approved for use against cytomegalovirus retinitis and for the emergency treatment of smallpox or complications following vaccination. One mode of action for CDV has been demonstrated to be the inhibition of the viral DNA polymerase. Results We have isolated several CDV resistant (CDVR vaccinia viruses through a one step process, two of which have unique single mutations within the DNA polymerase. An additional resistant virus isolate provides evidence of a second site mutation within the genome involved in CDV resistance. The CDVR viruses were 3–7 fold more resistant to the drug than the parental viruses. The virulence of the CDVR viruses was tested in mice inoculated intranasally and all were found to be attenuated. Conclusion Resistance to CDV in vaccinia virus can be conferred individually by at least two different mutations within the DNA polymerase gene. Additional genes may be involved. This one step approach for isolating resistant viruses without serial passage and in the presence of low doses of drug minimizes unintended secondary mutations and is applicable to other potential antiviral agents.

  17. Protective effects of a Modified Vaccinia Ankara-based vaccine candidate against Crimean-Congo Haemorrhagic Fever virus require both cellular and humoral responses.

    Directory of Open Access Journals (Sweden)

    Stuart D Dowall

    Full Text Available Crimean-Congo Haemorrhagic Fever (CCHF is a severe tick-borne disease, endemic in many countries in Africa, the Middle East, Eastern Europe and Asia. There is no approved vaccine currently available against CCHF. The most promising candidate, which has previously been shown to confer protection in the small animal model, is a modified Vaccinia Ankara virus vector expressing the CCHF viral glycoprotein (MVA-GP. It has been shown that MVA-GP induces both humoral and cellular immunogenicity. In the present study, sera and T-lymphocytes were passively and adoptively transferred into recipient mice prior to challenge with CCHF virus. Results demonstrated that mediators from both arms of the immune system were required to demonstrate protective effects against lethal challenge.

  18. Protective effects of a Modified Vaccinia Ankara-based vaccine candidate against Crimean-Congo Haemorrhagic Fever virus require both cellular and humoral responses.

    Science.gov (United States)

    Dowall, Stuart D; Graham, Victoria A; Rayner, Emma; Hunter, Laura; Watson, Robert; Taylor, Irene; Rule, Antony; Carroll, Miles W; Hewson, Roger

    2016-01-01

    Crimean-Congo Haemorrhagic Fever (CCHF) is a severe tick-borne disease, endemic in many countries in Africa, the Middle East, Eastern Europe and Asia. There is no approved vaccine currently available against CCHF. The most promising candidate, which has previously been shown to confer protection in the small animal model, is a modified Vaccinia Ankara virus vector expressing the CCHF viral glycoprotein (MVA-GP). It has been shown that MVA-GP induces both humoral and cellular immunogenicity. In the present study, sera and T-lymphocytes were passively and adoptively transferred into recipient mice prior to challenge with CCHF virus. Results demonstrated that mediators from both arms of the immune system were required to demonstrate protective effects against lethal challenge.

  19. Lethal triad in severe burns.

    Science.gov (United States)

    Sherren, P B; Hussey, J; Martin, R; Kundishora, T; Parker, M; Emerson, B

    2014-12-01

    Hypothermia, acidaemia and coagulopathy in trauma is associated with significant mortality. This study aimed to identify the incidence of the lethal triad in major burns, and describe demographics and outcomes. Patients admitted during a 71 month period with a total body surface area burn (TBSA)≥30% were identified. A structured review of a prospective database was conducted. The lethal triad was defined as a combination of coagulopathy (International normalised ratio>1.2), hypothermia (temperature≤35.5°C) and acidaemia (pH≤7.25). Fifteen of 117 patients fulfilled the criteria for the lethal triad on admission. Lethal triad patients had a higher median (IQR) abbreviated burn severity index (ABSI) (12 (9-13) vs. 8.5 (6-10), p=0.001), mean (SD) TBSA burn (59.2% (18.7) vs. 47.9% (18.1), p=0.027), mean (SD) age (46 (22.6) vs. 33 (28.3) years, p=0.033), and had a higher incidence of inhalational injury (p0.05). The lethal triad was associated with increased mortality (66.7% vs. 13.7%, plethal triad was not shown to be a predictor of mortality (p>0.05). Burn patients with the lethal triad have a high mortality rate which reflects the severity of the injury sustained. Copyright © 2014 Elsevier Ltd and ISBI. All rights reserved.

  20. The Gottingen Minipig Is a Model of the Hematopoietic Acute Radiation Syndrome: G-Colony Stimulating Factor Stimulates Hematopoiesis and Enhances Survival From Lethal Total-Body γ-Irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Moroni, Maria, E-mail: maria.moroni@usuhs.edu [Radiation Countermeasures Program, Armed Forces Radiobiology Research Institute, Uniformed Services University of the Health Sciences, Bethesda, Maryland (United States); Ngudiankama, Barbara F. [Laboratory of Viral Diseases, National Institute of Allergy and Infectious Diseases, Bethesda, Maryland (United States); Christensen, Christine [Division of Comparative Pathology, Armed Forces Radiobiology Research Institute, Uniformed Services University of the Health Sciences, Bethesda, Maryland (United States); Olsen, Cara H. [Biostatistics Consulting Center, Uniformed Services University of the Health Sciences, Bethesda, Maryland (United States); Owens, Rossitsa [Radiation Countermeasures Program, Armed Forces Radiobiology Research Institute, Uniformed Services University of the Health Sciences, Bethesda, Maryland (United States); Lombardini, Eric D. [Veterinary Medicine Department, Armed Forces Research Institute of Medical Sciences, Bangkok (Thailand); Holt, Rebecca K. [Veterinary Science Department, Armed Forces Radiobiology Research Institute, Uniformed Services University of the Health Sciences, Bethesda, Maryland (United States); Whitnall, Mark H. [Radiation Countermeasures Program, Armed Forces Radiobiology Research Institute, Uniformed Services University of the Health Sciences, Bethesda, Maryland (United States)

    2013-08-01

    Purpose: We are characterizing the Gottingen minipig as an additional large animal model for advanced drug testing for the acute radiation syndrome (ARS) to enhance the discovery and development of novel radiation countermeasures. Among the advantages provided by this model, the similarities to human hematologic parameters and dynamics of cell loss/recovery after irradiation provide a convenient means to compare the efficacy of drugs known to affect bone marrow cellularity and hematopoiesis. Methods and Materials: Male Gottingen minipigs, 4 to 5 months old and weighing 9 to 11 kg, were used for this study. We tested the standard off-label treatment for ARS, rhG-CSF (Neupogen, 10 μg/kg/day for 17 days), at the estimated LD70/30 total-body γ-irradiation (TBI) radiation dose for the hematopoietic syndrome, starting 24 hours after irradiation. Results: The results indicated that granulocyte colony stimulating factor (G-CSF) enhanced survival, stimulated recovery from neutropenia, and induced mobilization of hematopoietic progenitor cells. In addition, the administration of G-CSF resulted in maturation of monocytes/macrophages. Conclusions: These results support continuing efforts toward validation of the minipig as a large animal model for advanced testing of radiation countermeasures and characterization of the pathophysiology of ARS, and they suggest that the efficacy of G-CSF in improving survival after total body irradiation may involve mechanisms other than increasing the numbers of circulating granulocytes.

  1. The mechanisms of genetically modified vaccinia viruses for the treatment of cancer.

    Science.gov (United States)

    Jefferson, Artrish; Cadet, Valerie E; Hielscher, Abigail

    2015-09-01

    The use of oncolytic viruses for the treatment of cancer is an emerging field of cancer research and therapy. Oncolytic viruses are designed to induce tumor specific immunity while replicating selectively within cancer cells to cause lysis of the tumor cells. While there are several forms of oncolytic viruses, the use of vaccinia viruses for oncolysis may be more beneficial than other forms of oncolytic viruses. For example, vaccinia viruses have been shown to exert their anti-tumor effects through genetic engineering strategies which enhance their therapeutic efficacy. This paper will address some of the most common forms of genetically modified vaccinia viruses and will explore the mechanisms whereby they selectively target, enter and destroy cancer cells. Furthermore, this review will highlight how vaccinia viruses activate host immune responses against cancer cells and will address clinical trials evaluating the tumor-directed and killing efficacy of these viruses against solid tumors. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  2. Pox proteomics: mass spectrometry analysis and identification of Vaccinia virion proteins

    Directory of Open Access Journals (Sweden)

    Vemulapalli Srilakshmi

    2006-03-01

    Full Text Available Abstract Background Although many vaccinia virus proteins have been identified and studied in detail, only a few studies have attempted a comprehensive survey of the protein composition of the vaccinia virion. These projects have identified the major proteins of the vaccinia virion, but little has been accomplished to identify the unknown or less abundant proteins. Obtaining a detailed knowledge of the viral proteome of vaccinia virus will be important for advancing our understanding of orthopoxvirus biology, and should facilitate the development of effective antiviral drugs and formulation of vaccines. Results In order to accomplish this task, purified vaccinia virions were fractionated into a soluble protein enriched fraction (membrane proteins and lateral bodies and an insoluble protein enriched fraction (virion cores. Each of these fractions was subjected to further fractionation by either sodium dodecyl sulfate-polyacrylamide gel electophoresis, or by reverse phase high performance liquid chromatography. The soluble and insoluble fractions were also analyzed directly with no further separation. The samples were prepared for mass spectrometry analysis by digestion with trypsin. Tryptic digests were analyzed by using either a matrix assisted laser desorption ionization time of flight tandem mass spectrometer, a quadrupole ion trap mass spectrometer, or a quadrupole-time of flight mass spectrometer (the latter two instruments were equipped with electrospray ionization sources. Proteins were identified by searching uninterpreted tandem mass spectra against a vaccinia virus protein database created by our lab and a non-redundant protein database. Conclusion Sixty three vaccinia proteins were identified in the virion particle. The total number of peptides found for each protein ranged from 1 to 62, and the sequence coverage of the proteins ranged from 8.2% to 94.9%. Interestingly, two vaccinia open reading frames were confirmed as being expressed

  3. Immune Modulation in Primary Vaccinia virus Zoonotic Human Infections

    Directory of Open Access Journals (Sweden)

    Juliana Assis Silva Gomes

    2012-01-01

    Full Text Available In 2010, the WHO celebrated the 30th anniversary of the smallpox eradication. Ironically, infections caused by viruses related to smallpox are being increasingly reported worldwide, including Monkeypox, Cowpox, and Vaccinia virus (VACV. Little is known about the human immunological responses elicited during acute infections caused by orthopoxviruses. We have followed VACV zoonotic outbreaks taking place in Brazil and analyzed cellular immune responses in patients acutely infected by VACV. Results indicated that these patients show a biased immune modulation when compared to noninfected controls. Amounts of B cells are low and less activated in infected patients. Although present, T CD4+ cells are also less activated when compared to noninfected individuals, and so are monocytes/macrophages. Similar results were obtained when Balb/C mice were experimentally infected with a VACV sample isolated during the zoonotic outbreaks. Taking together, the data suggest that zoonotic VACVs modulate specific immune cell compartments during an acute infection in humans.

  4. Human CD4+ T cell epitopes from vaccinia virus induced by vaccination or infection.

    Directory of Open Access Journals (Sweden)

    J Mauricio Calvo-Calle

    2007-10-01

    Full Text Available Despite the importance of vaccinia virus in basic and applied immunology, our knowledge of the human immune response directed against this virus is very limited. CD4(+ T cell responses are an important component of immunity induced by current vaccinia-based vaccines, and likely will be required for new subunit vaccine approaches, but to date vaccinia-specific CD4(+ T cell responses have been poorly characterized, and CD4(+ T cell epitopes have been reported only recently. Classical approaches used to identify T cell epitopes are not practical for large genomes like vaccinia. We developed and validated a highly efficient computational approach that combines prediction of class II MHC-peptide binding activity with prediction of antigen processing and presentation. Using this approach and screening only 36 peptides, we identified 25 epitopes recognized by T cells from vaccinia-immune individuals. Although the predictions were made for HLA-DR1, eight of the peptides were recognized by donors of multiple haplotypes. T cell responses were observed in samples of peripheral blood obtained many years after primary vaccination, and were amplified after booster immunization. Peptides recognized by multiple donors are highly conserved across the poxvirus family, including variola, the causative agent of smallpox, and may be useful in development of a new generation of smallpox vaccines and in the analysis of the immune response elicited to vaccinia virus. Moreover, the epitope identification approach developed here should find application to other large-genome pathogens.

  5. Human CD4+ T Cell Epitopes from Vaccinia Virus Induced by Vaccination or Infection

    Science.gov (United States)

    Calvo-Calle, J. Mauricio; Strug, Iwona; Nastke, Maria-Dorothea; Baker, Stephen P; Stern, Lawrence J

    2007-01-01

    Despite the importance of vaccinia virus in basic and applied immunology, our knowledge of the human immune response directed against this virus is very limited. CD4+ T cell responses are an important component of immunity induced by current vaccinia-based vaccines, and likely will be required for new subunit vaccine approaches, but to date vaccinia-specific CD4+ T cell responses have been poorly characterized, and CD4+ T cell epitopes have been reported only recently. Classical approaches used to identify T cell epitopes are not practical for large genomes like vaccinia. We developed and validated a highly efficient computational approach that combines prediction of class II MHC-peptide binding activity with prediction of antigen processing and presentation. Using this approach and screening only 36 peptides, we identified 25 epitopes recognized by T cells from vaccinia-immune individuals. Although the predictions were made for HLA-DR1, eight of the peptides were recognized by donors of multiple haplotypes. T cell responses were observed in samples of peripheral blood obtained many years after primary vaccination, and were amplified after booster immunization. Peptides recognized by multiple donors are highly conserved across the poxvirus family, including variola, the causative agent of smallpox, and may be useful in development of a new generation of smallpox vaccines and in the analysis of the immune response elicited to vaccinia virus. Moreover, the epitope identification approach developed here should find application to other large-genome pathogens. PMID:17937498

  6. Chronic exposure of corals to fine sediments: lethal and sub-lethal impacts.

    Science.gov (United States)

    Flores, Florita; Hoogenboom, Mia O; Smith, Luke D; Cooper, Timothy F; Abrego, David; Negri, Andrew P

    2012-01-01

    Understanding the sedimentation and turbidity thresholds for corals is critical in assessing the potential impacts of dredging projects in tropical marine systems. In this study, we exposed two species of coral sampled from offshore locations to six levels of total suspended solids (TSS) for 16 weeks in the laboratory, including a 4 week recovery period. Dose-response relationships were developed to quantify the lethal and sub-lethal thresholds of sedimentation and turbidity for the corals. The sediment treatments affected the horizontal foliaceous species (Montipora aequituberculata) more than the upright branching species (Acropora millepora). The lowest sediment treatments that caused full colony mortality were 30 mg l(-1) TSS (25 mg cm(-2) day(-1)) for M. aequituberculata and 100 mg l(-1) TSS (83 mg cm(-2) day(-1)) for A. millepora after 12 weeks. Coral mortality generally took longer than 4 weeks and was closely related to sediment accumulation on the surface of the corals. While measurements of damage to photosystem II in the symbionts and reductions in lipid content and growth indicated sub-lethal responses in surviving corals, the most reliable predictor of coral mortality in this experiment was long-term sediment accumulation on coral tissue.

  7. Chronic exposure of corals to fine sediments: lethal and sub-lethal impacts.

    Directory of Open Access Journals (Sweden)

    Florita Flores

    Full Text Available Understanding the sedimentation and turbidity thresholds for corals is critical in assessing the potential impacts of dredging projects in tropical marine systems. In this study, we exposed two species of coral sampled from offshore locations to six levels of total suspended solids (TSS for 16 weeks in the laboratory, including a 4 week recovery period. Dose-response relationships were developed to quantify the lethal and sub-lethal thresholds of sedimentation and turbidity for the corals. The sediment treatments affected the horizontal foliaceous species (Montipora aequituberculata more than the upright branching species (Acropora millepora. The lowest sediment treatments that caused full colony mortality were 30 mg l(-1 TSS (25 mg cm(-2 day(-1 for M. aequituberculata and 100 mg l(-1 TSS (83 mg cm(-2 day(-1 for A. millepora after 12 weeks. Coral mortality generally took longer than 4 weeks and was closely related to sediment accumulation on the surface of the corals. While measurements of damage to photosystem II in the symbionts and reductions in lipid content and growth indicated sub-lethal responses in surviving corals, the most reliable predictor of coral mortality in this experiment was long-term sediment accumulation on coral tissue.

  8. The role of GATA2 in lethal prostate cancer aggressiveness

    Science.gov (United States)

    Rodriguez-Bravo, Veronica; Carceles-Cordon, Marc; Hoshida, Yujin; Cordon-Cardo, Carlos; Galsky, Matthew D.; Domingo-Domenech, Josep

    2017-01-01

    Advanced prostate cancer is a classic example of the intractability and consequent lethality that characterizes metastatic carcinomas. Novel treatments have improved the survival of men with prostate cancer; however, advanced prostate cancer invariably becomes resistant to these therapies and ultimately progresses to a lethal metastatic stage. Consequently, detailed knowledge of the molecular mechanisms that control prostate cancer cell survival and progression towards this lethal stage of disease will benefit the development of new therapeutics. The transcription factor endothelial transcription factor GATA-2 (GATA2) has been reported to have a key role in driving prostate cancer aggressiveness. In addition to being a pioneer transcription factor that increases androgen receptor (AR) binding and activity, GATA2 regulates a core subset of clinically relevant genes in an AR-independent manner. Functionally, GATA2 overexpression in prostate cancer increases cellular motility and invasiveness, proliferation, tumorigenicity, and resistance to standard therapies. Thus, GATA2 has a multifaceted function in prostate cancer aggressiveness and is a highly attractive target in the development of novel treatments against lethal prostate cancer. PMID:27872477

  9. Antidotes to lethal cocaine toxicity in the rat.

    Science.gov (United States)

    Trouvé, R; Nahas, G G

    1990-01-01

    Cocaine, like catecholamines or angiotensin II, may induce lethal cardiac or cerebral damage. Restrained rats were fitted with a caudal arterial catheter for on-line cardiovascular monitoring and antidote administration. They were given 60 mg/kg of cocaine i.p., a dose which produces behavioral and cardiovascular effects, convulsions and death in an average time of 10 min. Selected antidotes were administered 5 min after the lethal dose of cocaine. Incidence of lethality was not changed by propranolol, prazosin, labetalol, diazepam or enalaprilat, a converting enzyme inhibitor. Animals treated with any one of the following agents, alpha- or beta-blockers, diazepam or competitive inhibitors of angiotensin II [Sar-1-ile-8] and [Sar-1-thr-8] angiotensin II, presented myocardial infarction. All animals treated with calcium channel antagonists or enalaprilat, whether they survived or not, did not present myocardial infarction. Treatment with nitrendipine, flunarizine or diltiazem, resulted in survival of the animals with no observable aftereffects. Similar results were observed when enalaprilat was administered, with diazepam as an antidote, to a lethal dose of cocaine. Antagonists to the sympatho-adrenal system and to the renin angiotensin system appear to be effective antidotes to cocaine toxicity in the present experimental model.

  10. A Crimean-Congo hemorrhagic fever (CCHF) viral vaccine expressing nucleoprotein is immunogenic but fails to confer protection against lethal disease.

    Science.gov (United States)

    Dowall, S D; Buttigieg, K R; Findlay-Wilson, S J D; Rayner, E; Pearson, G; Miloszewska, A; Graham, V A; Carroll, M W; Hewson, R

    2016-01-01

    Crimean-Congo Hemorrhagic Fever (CCHF) is a severe tick-borne disease, endemic in many countries in Africa, the Middle East, Eastern Europe and Asia. Between 15-70% of reported cases are fatal with no approved vaccine available. In the present study, the attenuated poxvirus vector, Modified Vaccinia virus Ankara, was used to develop a recombinant candidate vaccine expressing the CCHF virus nucleoprotein. Cellular and humoral immunogenicity was confirmed in 2 mouse strains, including type I interferon receptor knockout mice, which are susceptible to CCHF disease. Despite the immune responses generated post-immunisation, the vaccine failed to protect animals from lethal disease in a challenge model.

  11. [The "lethal white foal" syndrome].

    Science.gov (United States)

    Blendinger, C; Müller, G; Bostedt, H

    1994-06-01

    The lethal white foal syndrome (congenital intestinal aganglionosis) was diagnosed by history, clinical signs and pathological findings in a female foal, born in March 1992, that was an offspring of two overo-spotted paint horses. The syndrome is a congenital innervation defect of the gastrointestinal tract. A literature review of this condition, relatively unknown in Germany, is given.

  12. Experimental Salmonella typhimurium infections in rats. II. Active and passive immunization as protection against a lethal bacterial dose

    DEFF Research Database (Denmark)

    Hougen, H P; Jensen, E T; Klausen, B

    1990-01-01

    Immunization against a lethal dose of Salmonella typhimurium was studied in athymic and thymus-bearing LEW rats. Active immunization was performed with formalin-killed whole cell vaccine or sublethal infection prior to the lethal infection. After vaccination with killed bacteria the euthymic...... animals produced antibodies against S.typhimurium, but neither the euthymic nor the athymic animals survived the infection. After non-lethal infection euthymic and thymus-grafted nude rats were not affected by the second and otherwise lethal bacterial dose, and had high antibody titres. All the athymic...... nude rats died after the second and lethal bacterial challenge. Passive immunization with plasma from immunized euthymic animals did not protect any of the animals against the lethal bacterial dose. However, all animals survived when treated with large doses of spleen cells from immunized euthymic rats...

  13. Induction of Synthetic Lethality by Natural Compounds Targeting Cancer Signaling.

    Science.gov (United States)

    Farrand, Lee; Byun, Sanguine

    2017-11-16

    Despite the breakthroughs that have been achieved, significant unmet needs relating to the inadequate efficacy and toxicity of currently-available cancer therapies remain. Kinase inhibitors are a class of agents that target signaling factors responsible for the survival of malignant cells, and may address at least some of these issues. The concept of synthetic lethality provides a potential solution to counteract pathway redundancies, and refers to situations in which a mutation in one of two particular genes alone permits cell survival, while simultaneous mutation in both results in cell death. When exploited in the context of cancer therapy, pathways that are uniquely upregulated in cancer cells become selective targets, with reduced off-target toxicity toward their healthy counterparts. Natural compounds represent a large and readily-accessible library of bioactive structures that can be screened for synthetically lethal interactions by testing for the inhibition of kinases relevant to cancer cell survival. In this review, we discuss the concept of synthetic lethality and focus on scenarios in which natural compounds that target kinases may be applied to tip the balance in favor of cancer cell death during therapeutic challenge. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  14. Protective effect of Toll-like receptor 4 in pulmonary vaccinia infection.

    Directory of Open Access Journals (Sweden)

    Martha A Hutchens

    2008-09-01

    Full Text Available Innate immune responses are essential for controlling poxvirus infection. The threat of a bioterrorist attack using Variola major, the smallpox virus, or zoonotic transmission of other poxviruses has renewed interest in understanding interactions between these viruses and their hosts. We recently determined that TLR3 regulates a detrimental innate immune response that enhances replication, morbidity, and mortality in mice in response to vaccinia virus, a model pathogen for studies of poxviruses. To further investigate Toll-like receptor signaling in vaccinia infection, we first focused on TRIF, the only known adapter protein for TLR3. Unexpectedly, bioluminescence imaging showed that mice lacking TRIF are more susceptible to vaccinia infection than wild-type mice. We then focused on TLR4, the other Toll-like receptor that signals through TRIF. Following respiratory infection with vaccinia, mice lacking TLR4 signaling had greater viral replication, hypothermia, and mortality than control animals. The mechanism of TLR4-mediated protection was not due to increased release of proinflammatory cytokines or changes in total numbers of immune cells recruited to the lung. Challenge of primary bone marrow macrophages isolated from TLR4 mutant and control mice suggested that TLR4 recognizes a viral ligand rather than an endogenous ligand. These data establish that TLR4 mediates a protective innate immune response against vaccinia virus, which informs development of new vaccines and therapeutic agents targeted against poxviruses.

  15. Non-coding RNAs and heme oxygenase-1 in vaccinia virus infection

    Energy Technology Data Exchange (ETDEWEB)

    Meseda, Clement A. [Division of Viral Products, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD (United States); Srinivasan, Kumar [Division of Transfusion Transmitted Diseases, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD (United States); Wise, Jasen [Qiagen, Frederick, MD (United States); Catalano, Jennifer [Center for Tobacco Products, Food and Drug Administration, Bethesda, MD (United States); Yamada, Kenneth M. [National Institute of Dental and Craniofacial Research, National Institutes of Health, Bethesda, MD (United States); Dhawan, Subhash, E-mail: subhash.dhawan@fda.hhs.gov [Division of Transfusion Transmitted Diseases, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD (United States)

    2014-11-07

    Highlights: • Heme oxygenase-1 (HO-1) induction inhibited vaccinia virus infection of macrophages. • Reduced infectivity inversely correlated with increased expression of non-coding RNAs. • The regulation of HO-1 and ncRNAs suggests a novel host defense response against vaccinia virus infection. - Abstract: Small nuclear RNAs (snRNAs) are <200 nucleotide non-coding uridylate-rich RNAs. Although the functions of many snRNAs remain undetermined, a population of snRNAs is produced during the early phase of infection of cells by vaccinia virus. In the present study, we demonstrate a direct correlation between expression of the cytoprotective enzyme heme oxygenase-1 (HO-1), suppression of selective snRNA expression, and inhibition of vaccinia virus infection of macrophages. Hemin induced HO-1 expression, completely reversed virus-induced host snRNA expression, and suppressed vaccinia virus infection. This involvement of specific virus-induced snRNAs and associated gene clusters suggests a novel HO-1-dependent host-defense pathway in poxvirus infection.

  16. Assembly of vaccinia virus: Role of the intermediate compartment between the endoplasmic reticulum and the Golgi stacks

    NARCIS (Netherlands)

    Sodeik, B.; Doms, R.W.; Ericsson, M.; Hiller, G.; Machamer, C.E.; van 't Hof, W.J.; van Meer, G.|info:eu-repo/dai/nl/068570368; Moss, B.; Griffiths, G.

    1993-01-01

    Vaccinia virus, the prototype of the Poxviridae, is a large DNA virus which replicates in the cytoplasm of the host cell. The assembly pathway of vaccinia virus displays several unique features, such as the production of two structurally distinct, infectious forms. One of these, termed intracellular

  17. In a nutshell: structure and assembly of the vaccinia virion.

    Science.gov (United States)

    Condit, Richard C; Moussatche, Nissin; Traktman, Paula

    2006-01-01

    Poxviruses comprise a large family of viruses characterized by a large, linear dsDNA genome, a cytoplasmic site of replication and a complex virion morphology. The most notorious member of the poxvirus family is variola, the causative agent of smallpox. The laboratory prototype virus used for the study of poxviruses is vaccinia, the virus that was used as a live, naturally attenuated vaccine for the eradication of smallpox. Both the morphogenesis and structure of poxvirus virions are unique among viruses. Poxvirus virions apparently lack any of the symmetry features common to other viruses such as helical or icosahedral capsids or nucleocapsids. Instead poxvirus virions appear as "brick shaped" or "ovoid" membrane-bound particles with a complex internal structure featuring a walled, biconcave core flanked by "lateral bodies." The virion assembly pathway involves a remarkable fabrication of membrane-containing crescents and immature virions, which evolve into mature virions in a process that is unparalleled in virology. As a result of significant advances in poxvirus genetics and molecular biology during the past 15 years, we can now positively identify over 70 specific gene products contained in poxvirus virions, and we can describe the effects of mutations in over 50 specific genes on poxvirus assembly. This review summarizes these advances and attempts to assemble them into a comprehensible and thoughtful picture of poxvirus structure and assembly.

  18. Deletion of the K1L Gene Results in a Vaccinia Virus That Is Less Pathogenic Due to Muted Innate Immune Responses, yet Still Elicits Protective Immunity.

    Science.gov (United States)

    Bravo Cruz, Ariana G; Han, Aiguo; Roy, Edward J; Guzmán, Arielle B; Miller, Rita J; Driskell, Elizabeth A; O'Brien, William D; Shisler, Joanna L

    2017-08-01

    All viruses strategically alter the antiviral immune response to their benefit. The vaccinia virus (VACV) K1 protein has multiple immunomodulatory effects in tissue culture models of infection, including NF-κB antagonism. However, the effect of K1 during animal infection is poorly understood. We determined that a K1L-less vaccinia virus (vΔK1L) was less pathogenic than wild-type VACV in intranasal and intradermal models of infection. Decreased pathogenicity was correlated with diminished virus replication in intranasally infected mice. However, in intradermally inoculated ears, vΔK1L replicated to levels nearly identical to those of VACV, implying that the decreased immune response to vΔK1L infection, not virus replication, dictated lesion size. Several lines of evidence support this theory. First, vΔK1L induced slightly less edema than vK1L, as revealed by histopathology and noninvasive quantitative ultrasound technology (QUS). Second, infiltrating immune cell populations were decreased in vΔK1L-infected ears. Third, cytokine and chemokine gene expression was decreased in vΔK1L-infected ears. While these results identified the biological basis for smaller lesions, they remained puzzling; because K1 antagonizes NF-κB in vitro, antiviral gene expression was expected to be higher during vΔK1L infection. Despite these diminished innate immune responses, vΔK1L vaccination induced a protective VACV-specific CD8+ T cell response and protected against a lethal VACV challenge. Thus, vΔK1L is the first vaccinia virus construct reported that caused a muted innate immune gene expression profile and decreased immune cell infiltration in an intradermal model of infection yet still elicited protective immunity.IMPORTANCE The vaccinia virus (VACV) K1 protein inhibits NF-κB activation among its other antagonistic functions. A virus lacking K1 (vΔK1L) was predicted to be less pathogenic because it would trigger a more robust antiviral immune response than VACV. Indeed

  19. Doxycycline Inducible Melanogenic Vaccinia Virus as Theranostic Anti-Cancer Agent.

    Science.gov (United States)

    Kirscher, Lorenz; Deán-Ben, Xosé Luis; Scadeng, Miriam; Zaremba, Angelika; Zhang, Qian; Kober, Christina; Fehm, Thomas Felix; Razansky, Daniel; Ntziachristos, Vasilis; Stritzker, Jochen; Szalay, Aladar A

    2015-01-01

    We reported earlier the diagnostic potential of a melanogenic vaccinia virus based system in magnetic resonance (MRI) and optoacoustic deep tissue imaging (MSOT). Since melanin overproduction lead to attenuated virus replication, we constructed a novel recombinant vaccinia virus strain (rVACV), GLV-1h462, which expressed the key enzyme of melanogenesis (tyrosinase) under the control of an inducible promoter-system. In this study melanin production was detected after exogenous addition of doxycycline in two different tumor xenograft mouse models. Furthermore, it was confirmed that this novel vaccinia virus strain still facilitated signal enhancement as detected by MRI and optoacoustic tomography. At the same time we demonstrated an enhanced oncolytic potential compared to the constitutively melanin synthesizing rVACV system.

  20. Horizontal study of vaccinia virus infections in an endemic area: epidemiologic, phylogenetic and economic aspects.

    Science.gov (United States)

    Assis, Felipe L; Franco-Luiz, Ana Paula M; Paim, Luis M; Oliveira, Graziele P; Pereira, Alexandre F; de Almeida, Gabriel M F; Figueiredo, Leandra B; Tanus, Adriano; Trindade, Giliane S; Ferreira, Paulo P; Kroon, Erna G; Abrahão, Jônatas S

    2015-11-01

    Vaccinia virus (VACV), the etiological agent of bovine vaccinia (BV), is widespread in Brazil and present in most of the milk-producing regions. We conducted a horizontal study of BV in Bahia, a state of Brazil in which the production of milk is increasing. During 2011, human and bovine clinical samples were collected during outbreaks for BV diagnosis, virus isolation and molecular analysis. We collected data for epidemiological inferences. Vaccinia virus was detected in 87.7% of the analyzed outbreaks, highlighting the effective circulation of VACV in Bahia. The molecular data showed the spreading of group 1 Brazilian VACV to Bahia. We observed a seasonal profile of BV, with its peak in the drier and cooler season. Manual milking was observed in 96 % of the visited properties, showing its importance to viral spread in herds. Under-notification of BV, ineffective animal trade surveillance, and bad milking practices have contributed to the spread of VACV in Brazil.

  1. INTERFERENCE INDUCED AGAINST VACCINIA IN AN ADENOVIRUS-RHF-1 SYSTEM.

    Science.gov (United States)

    KHOOBYARIAN, N

    1964-01-01

    Khoobyarian, Newton (University of Illinois, Chicago). Interference induced against vaccinia in an adenovirus-RHF-1 system. J. Bacteriol. 87:24-32. 1964.-It was observed that a continuous line of rabbit heart cell culture (strain RHF-1), when overlaid with growth medium after infection of cultures with adenovirus types 2, 3, 4, and 7, would develop resistance to vaccinia plaque formation. Data are presented to provide some information on the nature of such resistance observed specifically in an adenovirus 2-RHF-1 system. An analysis of this phenomenon indicated the following. (i) At least 6 hr were required before the start of vaccinia inhibition, and 15 to 18 hr were necessary for the maximal occurrence of inhibition; the degree of interference established varied with the concentration of adenovirus. (ii) The site of interference action was inside rather than outside the cells, since hardly any difference could be shown in the rate of vaccinia adsorption on resistant and susceptible cells. (iii) The interaction of adenovirus with RHF-1 cells not only would inhibit cell infection with vaccinia but would also suppress the 24- to 48-hr yield of virus. (iv) When RHF-1 cells were overlaid with maintenance medium after their infection with a low multiplicity of RHF-1 passaged adenovirus 2 (to establish sublethal infection), an inhibitory substance of varied activity could be detected daily over a period of at least 10 days which, when transferred to normal RHF-1 cultures, would render them resistant to vaccinia infection. (v) Although limited growth of virus appeared to be responsible for the production of the inhibitor, increase in inhibitory activity did not seem to coincide with increase in virus titer. (vi) The inhibitor seemed to resemble interferons in inhibiting virus plaque production, but its exact identity and the mode of action remain to be determined.

  2. Effects of poliovirus 2A(pro) on vaccinia virus gene expression.

    Science.gov (United States)

    Feduchi, E; Aldabe, R; Novoa, I; Carrasco, L

    1995-12-15

    The effects of transient expression of poliovirus 2A(pro) on p220 cleavage in COS cells have been analyzed. When 2A(pro) was cloned in plasmid pTM1 and transiently expressed in COS cells, efficient cleavage of p220 occurred after infection of these cells with a recombinant vaccinia virus bearing phage T7 RNA polymerase. High numbers of COS cells were transfected with pTM1-2A, as judged by p220 cleavage, thereby allowing an analysis of the effects of poliovirus 2A(pro) on vaccinia virus gene expression. A 40-50% cleavage of p220 by transfected poliovirus 2A(pro) was observed ten hours post infection and cleavage was almost complete (80-90%) 20-25 hours post infection with vaccinia virus. Profound inhibition of vaccinia virus protein synthesis was detectable ten hours post infection and was maximal 20-25 hours post infection. This inhibition resulted from neither a blockade of transcription of vaccinia virus nor a lack of translatability of the mRNAs present in cells that synthesize poliovirus 2A(pro). Addition of ara-C inhibited the replication of vaccinia virus and allowed the continued synthesis of cellular proteins. Under these conditions, 2A(pro) is expressed and blocks cellular translation. Finally, p220 cleavage by 2A(pro) did not inhibit the translation of a mRNA encoding poliovirus protein 2C, as directed by the 5' leader sequences of encephalomiocarditis virus. Therefore, these findings show a correlation between p220 cleavage and inhibition of translation from newly made mRNAs. Our results are discussed in the light of present knowledge of p220 function, and new approaches are considered that might provide further insights into the function(s) of initiation factor eIF-4F.

  3. Reliable method for reconstituting thymectomized, lethally irradiated guinea pigs with bone marrow cells

    Energy Technology Data Exchange (ETDEWEB)

    Terata, N.; Tanio, Y.; Zbar, B. (National Cancer Institute, Frederick, MD (USA). Cancer Research Facility)

    1984-05-25

    The authors developed a reliable method for reconstituting thymectomized, lethally irradiated guinea pigs. Injection of 2.5-10 x 10/sup 7/ syngeneic bone marrow cells into adult thymectomized, lethally irradiated guinea pigs produced survival of 46-100% of treated animals. Gentamycin sulfate (5 mg/kg of body weight) for 10 days was required for optimal results. Acidified drinking water (pH 2.5) appeared to be required for optimal results. Thymectomized, lethally irradiated, bone marrow reconstituted ('B') guinea pigs had impaired ability to develop delayed cutaneous hypersensitivity to mycobacterial antigens and cutaneous basophil hypersensitivity to keyhole limpet hemocyanin; proliferative responses to phytohemagglutinin were impaired.

  4. The repair of sub-lethal damage and the stimulated repair of potentially lethal damage in Saintpaulia.

    Science.gov (United States)

    Leenhouts, H P; Sijsma, M J; Litwiniszyn, M; Chadwick, K H

    1981-10-01

    The repair of sublethal and potentially lethal damage in stationary resting epidermal cells of Saintpaulia has been investigated. Fractionation experiments reveal an efficient repair of sublethal damage with a half-life of 1.9 hours. No repair of potentially lethal damage was noted when cultivation of the leaves was delayed for 24 hours after irradiation. At delay times of 2, 3 and 4 days some repair of potentially lethal damage has been found. A small pre-dose given 24 hours before a challenging dose improved the cells' chance to regenerate and the improvement has been shown to be compatible with an improved repair of potentially lethal damage induced by X-rays and fast neutrons. It hs been shown that the stimulated repair process takes 12 to 24 hours to develop, is dependent on the size of the pre-dose, has single-hit dose kinetics, and an r.b.e. of 1 for neutrons. With delayed cultivation of 2 days the stimulated repair process leads to an alteration in the shape of the regeneration (survival)-dose relationship which increases the low dose r.b.e. for neutrons from 10 to 35.

  5. Live-Cell Imaging of Vaccinia Virus Recombination.

    Directory of Open Access Journals (Sweden)

    Patrick Paszkowski

    2016-08-01

    Full Text Available Recombination between co-infecting poxviruses provides an important mechanism for generating the genetic diversity that underpins evolution. However, poxviruses replicate in membrane-bound cytoplasmic structures known as factories or virosomes. These are enclosed structures that could impede DNA mixing between co-infecting viruses, and mixing would seem to be essential for this process. We hypothesize that virosome fusion events would be a prerequisite for recombination between co-infecting poxviruses, and this requirement could delay or limit viral recombination. We have engineered vaccinia virus (VACV to express overlapping portions of mCherry fluorescent protein fused to a cro DNA-binding element. In cells also expressing an EGFP-cro fusion protein, this permits live tracking of virus DNA and genetic recombination using confocal microscopy. Our studies show that different types of recombination events exhibit different timing patterns, depending upon the relative locations of the recombining elements. Recombination between partly duplicated sequences is detected soon after post-replicative genes are expressed, as long as the reporter gene sequences are located in cis within an infecting genome. The same kinetics are also observed when the recombining elements are divided between VACV and transfected DNA. In contrast, recombination is delayed when the recombining sequences are located on different co-infecting viruses, and mature recombinants aren't detected until well after late gene expression is well established. The delay supports the hypothesis that factories impede inter-viral recombination, but even after factories merge there remain further constraints limiting virus DNA mixing and recombinant gene assembly. This delay could be related to the continued presence of ER-derived membranes within the fused virosomes, membranes that may once have wrapped individual factories.

  6. Myxoma and vaccinia viruses bind differentially to human leukocytes.

    Science.gov (United States)

    Chan, Winnie M; Bartee, Eric C; Moreb, Jan S; Dower, Ken; Connor, John H; McFadden, Grant

    2013-04-01

    Myxoma virus (MYXV) and vaccinia virus (VACV), two distinct members of the family Poxviridae, are both currently being developed as oncolytic virotherapeutic agents. Recent studies have demonstrated that ex vivo treatment with MYXV can selectively recognize and kill contaminating cancerous cells from autologous bone marrow transplants without perturbing the engraftment of normal CD34(+) hematopoietic stem and progenitor cells. However, the mechanism(s) by which MYXV specifically recognizes and eliminates the cancer cells in the autografts is not understood. While little is known about the cellular attachment factor(s) exploited by MYXV for entry into any target cells, VACV has been shown to utilize cell surface glycosaminoglycans such as heparan sulfate (HS), the extracellular matrix protein laminin, and/or integrin β1. We have constructed MYXV and VACV virions tagged with the Venus fluorescent protein and compared their characteristics of binding to various human cancer cell lines as well as to primary human leukocytes. We report that the binding of MYXV or VACV to some adherent cell lines could be partially inhibited by heparin, but laminin blocked only VACV binding. In contrast to cultured fibroblasts, the binding of MYXV and VACV to a wide spectrum of primary human leukocytes could not be competed by either HS or laminin. Additionally, MYXV and VACV exhibited very different binding characteristics against certain select human leukocytes, suggesting that the two poxviruses utilize different cell surface determinants for the attachment to these cells. These results indicate that VACV and MYXV can exhibit very different oncolytic tropisms against some cancerous human leukocytes.

  7. Tasers – Less than Lethal!

    Science.gov (United States)

    Sharma, Abiram; Theivacumar, Nada S; Souka, Hesham M

    2009-01-01

    We report a case of potentially lethal injury associated with the use of Taser. A 42-year-old man was stopped by police for potential detention. He held a large carving knife over his epigasrium threatening to stab himself.With a view to achieving immobilisation, a Taser gun was used. On activation of the Taser, the subject suffered a 7-cm wide and 10-cm deep stab injury to the upper abdomen. In this case, activation of the Taser resulted in the contraction of skeletal muscles, flexors more intensely than extensors, resulting in the stab injury. PMID:19416583

  8. The membrane fusion step of vaccinia virus entry is cooperatively mediated by multiple viral proteins and host cell components.

    Directory of Open Access Journals (Sweden)

    Jason P Laliberte

    2011-12-01

    Full Text Available For many viruses, one or two proteins allow cell attachment and entry, which occurs through the plasma membrane or following endocytosis at low pH. In contrast, vaccinia virus (VACV enters cells by both neutral and low pH routes; four proteins mediate cell attachment and twelve that are associated in a membrane complex and conserved in all poxviruses are dedicated to entry. The aim of the present study was to determine the roles of cellular and viral proteins in initial stages of entry, specifically fusion of the membranes of the mature virion and cell. For analysis of the role of cellular components, we used well characterized inhibitors and measured binding of a recombinant VACV virion containing Gaussia luciferase fused to a core protein; viral and cellular membrane lipid mixing with a self-quenching fluorescent probe in the virion membrane; and core entry with a recombinant VACV expressing firefly luciferase and electron microscopy. We determined that inhibitors of tyrosine protein kinases, dynamin GTPase and actin dynamics had little effect on binding of virions to cells but impaired membrane fusion, whereas partial cholesterol depletion and inhibitors of endosomal acidification and membrane blebbing had a severe effect at the later stage of core entry. To determine the role of viral proteins, virions lacking individual membrane components were purified from cells infected with members of a panel of ten conditional-lethal inducible mutants. Each of the entry protein-deficient virions had severely reduced infectivity and except for A28, L1 and L5 greatly impaired membrane fusion. In addition, a potent neutralizing L1 monoclonal antibody blocked entry at a post-membrane lipid-mixing step. Taken together, these results suggested a 2-step entry model and implicated an unprecedented number of viral proteins and cellular components involved in signaling and actin rearrangement for initiation of virus-cell membrane fusion during poxvirus entry.

  9. Electroshock weapons can be lethal!

    Science.gov (United States)

    Lundquist, Marjorie

    2008-03-01

    Electroshock weapons (EWs)-stun guns, tasers, riot shields-are electroconductive devices designed to safely incapacitate healthy men neuromuscularly, so they are called nonlethal or less-lethal. EW firms seeking large nonmilitary markets targeted law enforcement and corrections personnel, who began using EWs in prisons/jails and on public patrol in 1980 in the USA. This shifted the EW-shocked population from healthy soldiers to a heterogeneous mix of both sexes, ages 6-92, in a wide variety of health conditions! An EW operates by disrupting normal physiological processes, producing transient effects in healthy people. But if a person's health is sufficiently compromised, the margin of safety can be lost, resulting in death or permanent health problems. 325 people have died after EW shock since 1980. Did the EW cause these deaths? Evidence indicates that EWs do play a causal role in most such deaths. EWs can be lethal for people in diabetic shock^1 (hypoglycemia), which may be why Robert Dziekanski-a Polish immigrant to Canada-died so quickly after he was tasered at Vancouver Airport: not having eaten for over 10 hours, he likely was severely hypoglycemic. The EW death rate in North America is 30 times higher than need be, because EW users have not been properly trained to use EWs on a heterogeneous population safely! ^1J. Clinical Engineering 30(3):111(2005).

  10. A novel vaccine against Crimean-Congo Haemorrhagic Fever protects 100% of animals against lethal challenge in a mouse model.

    Directory of Open Access Journals (Sweden)

    Karen R Buttigieg

    Full Text Available Crimean-Congo Haemorrhagic Fever (CCHF is a severe tick-borne disease, endemic in many countries in Africa, the Middle East, Eastern Europe and Asia. Between 15-70% of reported cases are fatal. There is no approved vaccine available, and preclinical protection in vivo by an experimental vaccine has not been demonstrated previously. In the present study, the attenuated poxvirus vector, Modified Vaccinia virus Ankara, was used to develop a recombinant candidate vaccine expressing the CCHF virus glycoproteins. Cellular and humoral immunogenicity was confirmed in two mouse strains, including type I interferon receptor knockout mice, which are susceptible to CCHF disease. This vaccine protected all recipient animals from lethal disease in a challenge model adapted to represent infection via a tick bite. Histopathology and viral load analysis of protected animals confirmed that they had been exposed to challenge virus, even though they did not exhibit clinical signs. This is the first demonstration of efficacy of a CCHF vaccine.

  11. A novel vaccine against Crimean-Congo Haemorrhagic Fever protects 100% of animals against lethal challenge in a mouse model.

    Science.gov (United States)

    Buttigieg, Karen R; Dowall, Stuart D; Findlay-Wilson, Stephen; Miloszewska, Aleksandra; Rayner, Emma; Hewson, Roger; Carroll, Miles W

    2014-01-01

    Crimean-Congo Haemorrhagic Fever (CCHF) is a severe tick-borne disease, endemic in many countries in Africa, the Middle East, Eastern Europe and Asia. Between 15-70% of reported cases are fatal. There is no approved vaccine available, and preclinical protection in vivo by an experimental vaccine has not been demonstrated previously. In the present study, the attenuated poxvirus vector, Modified Vaccinia virus Ankara, was used to develop a recombinant candidate vaccine expressing the CCHF virus glycoproteins. Cellular and humoral immunogenicity was confirmed in two mouse strains, including type I interferon receptor knockout mice, which are susceptible to CCHF disease. This vaccine protected all recipient animals from lethal disease in a challenge model adapted to represent infection via a tick bite. Histopathology and viral load analysis of protected animals confirmed that they had been exposed to challenge virus, even though they did not exhibit clinical signs. This is the first demonstration of efficacy of a CCHF vaccine.

  12. Resveratrol Antagonizes Antimicrobial Lethality and Stimulates Recovery of Bacterial Mutants.

    Directory of Open Access Journals (Sweden)

    Yuanli Liu

    Full Text Available Reactive oxygen species (ROS; superoxide, peroxide, and hydroxyl radical are thought to contribute to the rapid bactericidal activity of diverse antimicrobial agents. The possibility has been raised that consumption of antioxidants in food may interfere with the lethal action of antimicrobials. Whether nutritional supplements containing antioxidant activity are also likely to interfere with antimicrobial lethality is unknown. To examine this possibility, resveratrol, a popular antioxidant dietary supplement, was added to cultures of Escherichia coli and Staphylococcus aureus that were then treated with antimicrobial and assayed for bacterial survival and the recovery of mutants resistant to an unrelated antimicrobial, rifampicin. Resveratrol, at concentrations likely to be present during human consumption, caused a 2- to 3-fold reduction in killing during a 2-hr treatment with moxifloxacin or kanamycin. At higher, but still subinhibitory concentrations, resveratrol reduced antimicrobial lethality by more than 3 orders of magnitude. Resveratrol also reduced the increase in reactive oxygen species (ROS characteristic of treatment with quinolone (oxolinic acid. These data support the general idea that the lethal activity of some antimicrobials involves ROS. Surprisingly, subinhibitory concentrations of resveratrol promoted (2- to 6-fold the recovery of rifampicin-resistant mutants arising from the action of ciprofloxacin, kanamycin, or daptomycin. This result is consistent with resveratrol reducing ROS to sublethal levels that are still mutagenic, while the absence of resveratrol allows ROS levels to high enough to kill mutagenized cells. Suppression of antimicrobial lethality and promotion of mutant recovery by resveratrol suggests that the antioxidant may contribute to the emergence of resistance to several antimicrobials, especially if new derivatives and/or formulations of resveratrol markedly increase bioavailability.

  13. Derepression of a novel class of vaccinia virus genes upon DNA replication

    NARCIS (Netherlands)

    Vos, J C; Stunnenberg, H.G.

    1988-01-01

    A novel class of vaccinia virus genes, called intermediate, is expressed immediately post-replication and prior to the onset of late gene transcription. Intermediate transcription is dependent on trans-acting factors which are present in an active state in virus-infected cells prior to the onset of

  14. The development of a monolith-based purification process for Orthopoxvirus vaccinia virus Lister strain.

    Science.gov (United States)

    Vincent, David; Kramberger, Petra; Hudej, Rosana; Štrancar, Aleš; Wang, Yaohe; Zhou, Yuhong; Velayudhan, Ajoy

    2017-11-17

    The purification of large viruses remains an important field of research and development. The development of efficient purification trains is restricted by limited analytical methods, as well as by the complexity of large viruses, as well as the high variability in starting material from cell culture. Vaccinia virus holds great potential as an oncolytic and immunotherapeutic vaccine against a broad spectrum of cancers. In this work, monolith-based capture and polishing chromatographic steps for vaccinia virus Lister strain has been developed. Virus produced in CV-1 cells was harvested and passed through a 0.8μm pre-filter before loading onto CIEX, AIEX and HIC CIM monoliths. Without the need for nuclease treatment, up to 99% of the total DNA loaded can be removed from the vaccinia feed stream by the CIM OH monolith, which also reduces the total protein concentration in the product pool to LLOQ levels, and achieves infectious virus recoveries of 90%. Binding capacities of greater than 1×109pfu of vaccinia per mL of matrix were obtained on both CIM SO3 and CIM OH monoliths. Multiple orthogonal analytical methods have been used to develop process knowledge and understanding. Copyright © 2017. Published by Elsevier B.V.

  15. Effective tumor immunotherapy directed against an oncogene-encoded product using a vaccinia virus vector

    NARCIS (Netherlands)

    Bernards, R.A.; Destree, A.; McKenzie, S.; Gordon, E.; Weinberg, R.A.; Panicali, D.

    1987-01-01

    We have constructed a vaccinia virus recombinant that expresses the extracellular domain of the rat neu oncogene-encoded protein, a 185-kDa transmembrane glycoprotein termed p185. Strain NFS mice immunized with this recombinant virus developed a strong antibody response against the neu oncogene

  16. Attenuation of vaccinia virus by the expression of human Flt3 ligand

    Czech Academy of Sciences Publication Activity Database

    Žurková, K.; Hainz, P.; Kryštofová, J.; Kutinová, L.; Šanda, Miloslav; Němečková, Š.

    2010-01-01

    Roč. 7, č. 1 (2010), 109/1-109/15 ISSN 1743-422X Institutional research plan: CEZ:AV0Z40550506 Keywords : vaccinia virus * antibodies * virulence Subject RIV: CE - Biochemistry Impact factor: 2.546, year: 2010

  17. Interactions between Vaccinia Virus IEV Membrane Proteins and Their Roles in IEV Assembly and Actin Tail Formation

    OpenAIRE

    Röttger, Sabine; Frischknecht, Friedrich; Reckmann, Inge; Smith, Geoffrey L.; Way, Michael

    1999-01-01

    The intracellular enveloped form of vaccinia virus (IEV) induces the formation of actin tails that are strikingly similar to those seen in Listeria and Shigella infections. In contrast to the case for Listeria and Shigella, the vaccinia virus protein(s) responsible for directly initiating actin tail formation remains obscure. However, previous studies with recombinant vaccinia virus strains have suggested that the IEV-specific proteins A33R, A34R, A36R, B5R, and F13L play an undefined role in...

  18. Tolerization with BLP down-regulates HMGB1 a critical mediator of sepsis-related lethality.

    LENUS (Irish Health Repository)

    Coffey, J Calvin

    2012-02-03

    Tolerization with bacterial lipoprotein (BLP) affords a significant survival benefit in sepsis. Given that high mobility group box protein-1 (HMGB1) is a recognized mediator of sepsis-related lethality, we determined if tolerization with BLP leads to alterations in HMGB1. In vitro, BLP tolerization led to a reduction in HMGB1 gene transcription. This was mirrored at the protein level, as HMGB1 protein expression and release were reduced significantly in BLP-tolerized human THP-1 monocytic cells. BLP tolerance in vivo led to a highly significant, long-term survival benefit following challenge with lethal dose BLP in C57BL\\/6 mice. This was associated with an attenuation of HMGB1 release into the circulation, as evidenced by negligible serum HMGB1 levels in BLP-tolerized mice. Moreover, HMGB1 levels in peritoneal macrophages from BLP-tolerized mice were reduced significantly. Hence, tolerization with BLP leads to a down-regulation of HMGB1 protein synthesis and release. The improved survival associated with BLP tolerance could thus be explained by a reduction in HMGB1, were the latter associated with lethality in BLP-related sepsis. In testing this hypothesis, it was noted that neutralization of HMGB1, using anti-HMGB1 antibodies, abrogated BLP-associated lethality almost completely. To conclude, tolerization with BLP leads to a down-regulation of HMGB1, thus offering a novel means of targeting the latter. HMGB1 is also a mediator of lethality in BLP-related sepsis.

  19. Long-term survival in Patau syndrome.

    Science.gov (United States)

    Tunca, Y; Kadandale, J S; Pivnick, E K

    2001-04-01

    A female patient with an extra chromosome 13 (Patau syndrome) is described. There are only five previous reports of patients with trisomy 13 who have survived past the first decade. It is concluded that non-lethal congenital anomalies and aggressive medical care play an important role in the survival of patients with trisomy 13.

  20. Characterization of a new Vaccinia virus isolate reveals the C23L gene as a putative genetic marker for autochthonous Group 1 Brazilian Vaccinia virus.

    Directory of Open Access Journals (Sweden)

    Felipe L Assis

    Full Text Available Since 1999, several Vaccinia virus (VACV isolates, the etiological agents of bovine vaccinia (BV, have been frequently isolated and characterized with various biological and molecular methods. The results from these approaches have grouped these VACV isolates into two different clusters. This dichotomy has elicited debates surrounding the origin of the Brazilian VACV and its epidemiological significance. To ascertain vital information to settle these debates, we and other research groups have made efforts to identify molecular markers to discriminate VACV from other viruses of the genus Orthopoxvirus (OPV and other VACV-BR groups. In this way, some genes have been identified as useful markers to discriminate between the VACV-BR groups. However, new markers are needed to infer ancestry and to correlate each sample or group with its unique epidemiological and biological features. The aims of this work were to characterize a new VACV isolate (VACV DMTV-2005 molecularly and biologically using conserved and non-conserved gene analyses for phylogenetic inference and to search for new genes that would elucidate the VACV-BR dichotomy. The VACV DMTV-2005 isolate reported in this study is biologically and phylogenetically clustered with other strains of Group 1 VACV-BR, the most prevalent VACV group that was isolated during the bovine vaccinia outbreaks in Brazil. Sequence analysis of C23L, the gene that encodes for the CC-chemokine-binding protein, revealed a ten-nucleotide deletion, which is a new Group 1 Brazilian VACV genetic marker. This deletion in the C23L open reading frame produces a premature stop-codon that is shared by all Group 1 VACV-BR strains and may also reflect the VACV-BR dichotomy; the deletion can also be considered to be a putative genetic marker for non-virulent Brazilian VACV isolates and may be used for the detection and molecular characterization of new isolates.

  1. Control of lethal browning by using ascorbic acid on shoot tip ...

    African Journals Online (AJOL)

    The use of ascorbic acid during explants preparation and the effect of different concentrations of ascorbic acid in controlling lethal browning and survival of the explants in local banana cv. Mzuzu banana were investigated. The explants were taken from young suckers. The shoot tips were cultured on Murashige and Skoog's ...

  2. Control of lethal browning by using ascorbic acid on shoot tip ...

    African Journals Online (AJOL)

    SAM

    2014-04-16

    Apr 16, 2014 ... Completely randomized design was used in this study. The results indicate that the use of ascorbic acid as an antioxidant during explants preparation significantly reduced the extent of lethal browning and survival of the explants followed by ... surface of plant tissues due to the oxidation of phenolic.

  3. Protection from rabies by a vaccinia virus recombinant containing the rabies virus glycoprotein gene.

    OpenAIRE

    Wiktor, T. J.; Macfarlan, R I; Reagan, K J; Dietzschold, B; Curtis, P. J.; Wunner, W. H.; Kieny, M P; Lathe, R; Lecocq, J P; Mackett, M.

    1984-01-01

    Inoculation of rabbits and mice with a vaccinia-rabies glycoprotein recombinant (V-RG) virus resulted in rapid induction of high concentrations of rabies virus-neutralizing antibodies and protection from severe intracerebral challenge with several strains of rabies virus. Protection from virus challenge also was achieved against the rabies-related Duvenhage virus but not against the Mokola virus. Effective immunization by V-RG depended on the expression of a rabies glycoprotein that registere...

  4. Sequence-Independent Targeting of Transmembrane Proteins Synthesized within Vaccinia Virus Factories to Nascent Viral Membranes▿

    OpenAIRE

    Husain, Matloob; Weisberg, Andrea S.; Moss, Bernard

    2006-01-01

    The primary membrane of vaccinia virus, as well as those of other poxviruses, forms within a discrete cytoplasmic factory region. We recently determined the existence of an operative pathway from the endoplasmic reticulum within the virus factory to nascent viral membranes and demonstrated that a viral protein could be diverted from this pathway to Golgi membranes by the addition of COPII-binding sites (M. Husain, A. S. Weisberg, and B. Moss, Proc. Natl. Acad. Sci. USA, 103:19506-19511, 2006)...

  5. Modulation of the Myxoma Virus Plaque Phenotype by Vaccinia Virus Protein F11

    OpenAIRE

    Irwin, Chad R; Evans, David H.

    2012-01-01

    Vaccinia virus (VACV) produces large plaques consisting of a rapidly expanding ring of infected cells surrounding a lytic core, whereas myxoma virus (MYXV) produces small plaques that resemble a focus of transformed cells. This is odd, because bioinformatics suggests that MYXV carries homologs of nearly all of the genes regulating Orthopoxvirus attachment, entry, and exit. So why does MYXV produce foci? One notable difference is that MYXV-infected cells produce few of the actin microfilaments...

  6. Permissivity of the NCI-60 cancer cell lines to oncolytic Vaccinia Virus GLV-1h68

    Directory of Open Access Journals (Sweden)

    Bedognetti Davide

    2011-10-01

    Full Text Available Abstract Background Oncolytic viral therapy represents an alternative therapeutic strategy for the treatment of cancer. We previously described GLV-1h68, a modified Vaccinia Virus with exclusive tropism for tumor cells, and we observed a cell line-specific relationship between the ability of GLV-1h68 to replicate in vitro and its ability to colonize and eliminate tumor in vivo. Methods In the current study we surveyed the in vitro permissivity to GLV-1h68 replication of the NCI-60 panel of cell lines. Selected cell lines were also tested for permissivity to another Vaccinia Virus and a vesicular stomatitis virus (VSV strain. In order to identify correlates of permissity to viral infection, we measured transcriptional profiles of the cell lines prior infection. Results We observed highly heterogeneous permissivity to VACV infection amongst the cell lines. The heterogeneity of permissivity was independent of tissue with the exception of B cell derivation. Cell lines were also tested for permissivity to another Vaccinia Virus and a vesicular stomatitis virus (VSV strain and a significant correlation was found suggesting a common permissive phenotype. While no clear transcriptional pattern could be identified as predictor of permissivity to infection, some associations were observed suggesting multifactorial basis permissivity to viral infection. Conclusions Our findings have implications for the design of oncolytic therapies for cancer and offer insights into the nature of permissivity of tumor cells to viral infection.

  7. Dairy production practices and associated risks for bovine vaccinia exposure in cattle, Brazil

    Directory of Open Access Journals (Sweden)

    I.A. Borges

    2017-11-01

    Full Text Available A cross-sectional serosurvey was performed to identify environmental features or practices of dairy farms associated with risk for exposure to vaccinia-like viruses in dairy cattle in Brazil. Sera from 103 cows from 18 farms in Minas Gerais state were examined for Orthopoxvirus-neutralizing antibodies. A database of 243 binary or multiple-selection categorical variables regarding the physical features and surrounding ecology of each property was obtained. Thirteen of 46 presumptive predictor variables were found to be significantly associated with Orthopoxvirus serostatus by univariate logistic regression methods. Use of teat sanitizer and having felids on the property were independently associated with virus exposure by multivariable analysis. Rodents have long been suspected of serving as maintenance reservoirs for vaccinia-like viruses in Brazil. Therefore, domestic felids are not only effective predators of small rodent pests, but also their urine can serve as a deterrent to rodent habitation in buildings such as stables and barns. These results corroborate previous evidence of the high significance of rodents in the Vaccinia virus transmission cycle, and they also raise questions regarding the common use of teat sanitizers in dairy production areas.

  8. The vaccinia virus E6 protein influences virion protein localization during virus assembly

    Energy Technology Data Exchange (ETDEWEB)

    Condit, Richard C., E-mail: condit@mgm.ufl.edu; Moussatche, Nissin

    2015-08-15

    Vaccinia virus mutants in which expression of the virion core protein gene E6R is repressed are defective in virion morphogenesis. E6 deficient infections fail to properly package viroplasm into viral membranes, resulting in an accumulation of empty immature virions and large aggregates of viroplasm. We have used immunogold electron microscopy and immunofluorescence confocal microscopy to assess the intracellular localization of several virion structural proteins and enzymes during E6R mutant infections. We find that during E6R mutant infections virion membrane proteins and virion transcription enzymes maintain a normal localization within viral factories while several major core and lateral body proteins accumulate in aggregated virosomes. The results support a model in which vaccinia virions are assembled from at least three substructures, the membrane, the viroplasm and a “pre-nucleocapsid”, and that the E6 protein is essential for maintaining proper localization of the seven-protein complex and the viroplasm during assembly. - Highlights: • Mutation of E6 disrupts association of viral membranes with viral core proteins • Mutation of E6 does not perturb viral membrane biosynthesis • Mutation of E6 does not perturb localization of viral transcription enzymes • Mutation of E6 causes mis-localization and aggregation of viral core proteins • Vaccinia assembly uses three subassemblies: membranes, viroplasm, prenucleocapsid.

  9. Humoral Immunity to Primary Smallpox Vaccination: Impact of Childhood versus Adult Immunization on Vaccinia Vector Vaccine Development in Military Populations.

    Science.gov (United States)

    Slike, Bonnie M; Creegan, Matthew; Marovich, Mary; Ngauy, Viseth

    2017-01-01

    Modified Vaccinia virus has been shown to be a safe and immunogenic vector platform for delivery of HIV vaccines. Use of this vector is of particular importance to the military, with the implementation of a large scale smallpox vaccination campaign in 2002 in active duty and key civilian personnel in response to potential bioterrorist activities. Humoral immunity to smallpox vaccination was previously shown to be long lasting (up to 75 years) and protective. However, using vaccinia-vectored vaccine delivery for other diseases on a background of anti-vector antibodies (i.e. pre-existing immunity) may limit their use as a vaccine platform, especially in the military. In this pilot study, we examined the durability of vaccinia antibody responses in adult primary vaccinees in a healthy military population using a standard ELISA assay and a novel dendritic cell neutralization assay. We found binding and neutralizing antibody (NAb) responses to vaccinia waned after 5-10 years in a group of 475 active duty military, born after 1972, who were vaccinated as adults with Dryvax®. These responses decreased from a geometric mean titer (GMT) of 250 to baseline (vaccination. This contrasted with a comparator group of adults, ages 35-49, who were vaccinated with Dryvax® as children. In the childhood vaccinees, titers persisted for >30 years with a GMT of 210 (range 112-3234). This data suggests limited durability of antibody responses in adult vaccinees compared to those vaccinated in childhood and further that adult vaccinia recipients may benefit similarly from receipt of a vaccinia based vaccine as those who are vaccinia naïve. Our findings may have implications for the smallpox vaccination schedule and support the ongoing development of this promising viral vector in a military vaccination program.

  10. Humoral Immunity to Primary Smallpox Vaccination: Impact of Childhood versus Adult Immunization on Vaccinia Vector Vaccine Development in Military Populations.

    Directory of Open Access Journals (Sweden)

    Bonnie M Slike

    Full Text Available Modified Vaccinia virus has been shown to be a safe and immunogenic vector platform for delivery of HIV vaccines. Use of this vector is of particular importance to the military, with the implementation of a large scale smallpox vaccination campaign in 2002 in active duty and key civilian personnel in response to potential bioterrorist activities. Humoral immunity to smallpox vaccination was previously shown to be long lasting (up to 75 years and protective. However, using vaccinia-vectored vaccine delivery for other diseases on a background of anti-vector antibodies (i.e. pre-existing immunity may limit their use as a vaccine platform, especially in the military. In this pilot study, we examined the durability of vaccinia antibody responses in adult primary vaccinees in a healthy military population using a standard ELISA assay and a novel dendritic cell neutralization assay. We found binding and neutralizing antibody (NAb responses to vaccinia waned after 5-10 years in a group of 475 active duty military, born after 1972, who were vaccinated as adults with Dryvax®. These responses decreased from a geometric mean titer (GMT of 250 to baseline (30 years with a GMT of 210 (range 112-3234. This data suggests limited durability of antibody responses in adult vaccinees compared to those vaccinated in childhood and further that adult vaccinia recipients may benefit similarly from receipt of a vaccinia based vaccine as those who are vaccinia naïve. Our findings may have implications for the smallpox vaccination schedule and support the ongoing development of this promising viral vector in a military vaccination program.

  11. Experiences in therapy for lethal midline granuloma

    Energy Technology Data Exchange (ETDEWEB)

    Tosaka, K.; Ishikawa, T. (Kumamoto Univ. (Japan). School of Medicine)

    1982-03-01

    Four cases of the lethal midline granuloma or malignant granuloma of the nose were treated by irradiation and chemotherapy, which are generally prescribed for malignant lymphomas. Clinical, histological and laboratory examination indicated that they were the lethal midline granuloma and clearly differentiated from Wegener's granulomatosis or malignant lymphoma. All of the cases exhibited primary remission. The four cases were observed up to 38, 22, 14, and 10 months since the beginning of the therapy, showing no local or general recurrence.

  12. Vectors based on modified vaccinia Ankara expressing influenza H5N1 hemagglutinin induce substantial cross-clade protective immunity.

    Directory of Open Access Journals (Sweden)

    Annett Hessel

    Full Text Available BACKGROUND: New highly pathogenic H5N1 influenza viruses are continuing to evolve with a potential threat for an influenza pandemic. So far, the H5N1 influenza viruses have not widely circulated in humans and therefore constitute a high risk for the non immune population. The aim of this study was to evaluate the cross-protective potential of the hemagglutinins of five H5N1 strains of divergent clades using a live attenuated modified vaccinia Ankara (MVA vector vaccine. METHODOLOGY/PRINCIPAL FINDINGS: The replication-deficient MVA virus was used to express influenza hemagglutinin (HA proteins. Specifically, recombinant MVA viruses expressing the HA genes of the clade 1 virus A/Vietnam/1203/2004 (VN/1203, the clade 2.1.3 virus A/Indonesia/5/2005 (IN5/05, the clade 2.2 viruses A/turkey/Turkey/1/2005 (TT01/05 and A/chicken/Egypt/3/2006 (CE/06, and the clade 2.3.4 virus A/Anhui/1/2005 (AH1/05 were constructed. These experimental live vaccines were assessed in a lethal mouse model. Mice vaccinated with the VN/1203 hemagglutinin-expressing MVA induced excellent protection against all the above mentioned clades. Also mice vaccinated with the IN5/05 HA expressing MVA induced substantial protection against homologous and heterologous AH1/05 challenge. After vaccination with the CE/06 HA expressing MVA, mice were fully protected against clade 2.2 challenge and partially protected against challenge of other clades. Mice vaccinated with AH1/05 HA expressing MVA vectors were only partially protected against homologous and heterologous challenge. The live vaccines induced substantial amounts of neutralizing antibodies, mainly directed against the homologous challenge virus, and high levels of HA-specific IFN-γ secreting CD4 and CD8 T-cells against epitopes conserved among the H5 clades and subclades. CONCLUSIONS/SIGNIFICANCE: The highest level of cross-protection was induced by the HA derived from the VN/1203 strain, suggesting that pandemic H5 vaccines

  13. A pandemic influenza H1N1 live vaccine based on modified vaccinia Ankara is highly immunogenic and protects mice in active and passive immunizations.

    Directory of Open Access Journals (Sweden)

    Annett Hessel

    Full Text Available BACKGROUND: The development of novel influenza vaccines inducing a broad immune response is an important objective. The aim of this study was to evaluate live vaccines which induce both strong humoral and cell-mediated immune responses against the novel human pandemic H1N1 influenza virus, and to show protection in a lethal animal challenge model. METHODOLOGY/PRINCIPAL FINDINGS: For this purpose, the hemagglutinin (HA and neuraminidase (NA genes of the influenza A/California/07/2009 (H1N1 strain (CA/07 were inserted into the replication-deficient modified vaccinia Ankara (MVA virus--a safe poxviral live vector--resulting in MVA-H1-Ca and MVA-N1-Ca vectors. These live vaccines, together with an inactivated whole virus vaccine, were assessed in a lung infection model using immune competent Balb/c mice, and in a lethal challenge model using severe combined immunodeficient (SCID mice after passive serum transfer from immunized mice. Balb/c mice vaccinated with the MVA-H1-Ca virus or the inactivated vaccine were fully protected from lung infection after challenge with the influenza H1N1 wild-type strain, while the neuraminidase virus MVA-N1-Ca induced only partial protection. The live vaccines were already protective after a single dose and induced substantial amounts of neutralizing antibodies and of interferon-gamma-secreting (IFN-gamma CD4- and CD8 T-cells in lungs and spleens. In the lungs, a rapid increase of HA-specific CD4- and CD8 T cells was observed in vaccinated mice shortly after challenge with influenza swine flu virus, which probably contributes to the strong inhibition of pulmonary viral replication observed. In addition, passive transfer of antisera raised in MVA-H1-Ca vaccinated immune-competent mice protected SCID mice from lethal challenge with the CA/07 wild-type virus. CONCLUSIONS/SIGNIFICANCE: The non-replicating MVA-based H1N1 live vaccines induce a broad protective immune response and are promising vaccine candidates for

  14. Salinity and survival of Martesia striata (Linn) in Cochin harbour

    OpenAIRE

    Cheriyan, P.V.; Cherian, C.J.

    1980-01-01

    The effects of salinity variations on the survival of Martesia striata from Cochin harbour are presented. It is observed that at least a few of the animals survive the low saline conditions during monsoon. Laboratory experiments showed the lethal salinity as 6‰ when animals acclimatised in 34‰ were subjected to abrupt changes in salinity. But acclimatisation to 17‰ salinity showed a downward shift in the lethal salinity to 4‰. The present observations indicate that M. striata is euryhaline ar...

  15. Efficient cleavage of p220 by poliovirus 2Apro expression in mammalian cells: effects on vaccinia virus.

    Science.gov (United States)

    Aldabe, R; Feduchi, E; Novoa, I; Carrasco, L

    1995-10-24

    Poliovirus protease 2A cleaves p220, a component of initiation factor eIF-4F. Polyclonal antibodies that recognize p220 and the cleaved products from different species have been raised. Transfection of several cell lines with poliovirus 2Apro cloned in different plasmids leads to efficient cleavage of p220 upon infection with VT7, a recombinant vaccinia virus that expresses the T7 RNA polymerase. Under these conditions vaccinia virus protein synthesis is severely inhibited, while expression of poliovirus protein 2C from a similar plasmid has no effect. These results show by the first time the effects of p220 cleavage on vaccinia virus translation in the infected cells.

  16. Lethality Index 2008-2014: Less shootings, same lethality, more opacity

    Directory of Open Access Journals (Sweden)

    Carlos Silva Forné

    2017-07-01

    Full Text Available This article evaluates the use of lethal force by Mexican federal security forces during shootings with presumed members of organized crime from 2008-2014. The authors use official data and press reports on deaths and wounded in shootings to construct indicators such as the number of dead civilians over the number of dead officials from the federal security forces and the number of dead civilians over the number of wounded civilians. In a context where certain factors that contribute to an excessive use of force become more common, the results of the study show a growing use of lethal force. This raises questions over the possible excessive use of lethal force as a normal or systematic practice. The study also shows a growing context of opacity in the infor­mation available to evaluate the use of lethal force and the general lack of a legal framework to regulate the use of lethal force in Mexico.

  17. Lethal intimate partner violence: an interactional perspective on women's perceptions of lethal incidents.

    Science.gov (United States)

    Vatnar, Solveig Karin Bø; Bjørkly, Stål

    2013-01-01

    Intimate partner homicide (IPH) is the only lethal violence in which women are the principal victims. This research reports on an investigation of possible differences between dynamics of lethal and nonlethal intimate partner violence (IPV). A representative sample of 157 help-seeking female victims of IPV in Norway was interviewed. Results from multivariate logistic regression analysis indicated that women who perceived they had been subjected to lethal IPV were different from those who had not perceived the IPV as lethal concerning interactional dimensions of IPV and in their help-seeking responses. There was no difference related to sociodemographic factors. Because some IPV help-seeking women may be at a heightened risk for lethal violence, it is imperative that their efforts to seek assistance are responded to with care and structured risk assessment.

  18. Proteomic characterization of a temperature-sensitive conditional lethal in Drosophila melanogaster

    DEFF Research Database (Denmark)

    Pedersen, Kamilla Sofie; Codrea, M.C; Vermeulen, Corneel

    2010-01-01

    Genetic variation that is expressed only under specific environmental conditions can contribute to additional adverse effects of inbreeding if environmental conditions change. We present a proteomic characterization of a conditional lethal found in an inbred line of Drosophila melanogaster....... The lethal effect is apparent as a large increase in early mortality at the restrictive temperature (29 °C) as opposed to normal survival at the permissive temperature (20 °C). The increased mortality in response to the restrictive temperature is probably caused by a single recessive major locus....... A quantitative trait locus (QTL) region segregating variation affecting the lethal effect has been identified, allowing for a separation of primary/causal effects and secondary consequences in the proteome expression patterns observed. In this study, the proteomic response to the restrictive temperature...

  19. A novel high-throughput vaccinia virus neutralization assay and preexisting immunity in populations from different geographic regions in China.

    Directory of Open Access Journals (Sweden)

    Qiang Liu

    Full Text Available BACKGROUND: Pre-existing immunity to Vaccinia Tian Tan virus (VTT resulting from a large vaccination campaign against smallpox prior to the early 1980s in China, has been a major issue for application of VTT-vector based vaccines. It is essential to establish a sensitive and high-throughput neutralization assay to understand the epidemiology of Vaccinia-specific immunity in current populations in China. METHODOLOGY/PRINCIPAL FINDINGS: A new anti-Vaccinia virus (VACV neutralization assay that used the attenuated replication-competent VTT carrying the firefly luciferase gene of Photinus pyralis (rTV-Fluc was established and standardized for critical parameters that included the choice of cell line, viral infection dose, and the infection time. The current study evaluated the maintenance of virus-specific immunity after smallpox vaccination by conducting a non-randomized, cross-sectional analysis of antiviral antibody-mediated immune responses in volunteers examined 30-55 years after vaccination. The rTV-Fluc neutralization assay was able to detect neutralizing antibodies (NAbs against Vaccinia virus without the ability to differentiate strains of Vaccinia virus. We showed that the neutralizing titers measured by our assay were similar to those obtained by the traditional plaque reduction neutralization test (PRNT. Using this assay, we found a low prevalence of NAb to VTT (7.6% in individuals born before 1980 from Beijing and Anhui provinces in China, and when present, anti-VTT NAb titers were low. No NAbs were detected in all 222 samples from individuals born after 1980. There was no significant difference observed for titer or prevalence by gender, age range and geographic origin. CONCLUSION: A simplified, sensitive, standardized, reproducible, and high-throughput assay was developed for the quantitation of NAbs against different Vaccinia strains. The current study provides useful insights for the future development of VTT-based vaccination in

  20. Synthetically lethal nanoparticles for treatment of endometrial cancer

    Science.gov (United States)

    Ebeid, Kareem; Meng, Xiangbing; Thiel, Kristina W.; Do, Anh-Vu; Geary, Sean M.; Morris, Angie S.; Pham, Erica L.; Wongrakpanich, Amaraporn; Chhonker, Yashpal S.; Murry, Daryl J.; Leslie, Kimberly K.; Salem, Aliasger K.

    2018-01-01

    Uterine serous carcinoma, one of the most aggressive types of endometrial cancer, is characterized by poor outcomes and mutations in the tumour suppressor p53. Our objective was to engender synthetic lethality to paclitaxel (PTX), the frontline treatment for endometrial cancer, in tumours with mutant p53 and enhance the therapeutic efficacy using polymeric nanoparticles (NPs). First, we identified the optimal NP formulation through comprehensive analyses of release profiles and cellular-uptake and cell viability studies. Not only were PTX-loaded NPs superior to PTX in solution, but the combination of PTX-loaded NPs with the antiangiogenic molecular inhibitor BIBF 1120 (BIBF) promoted synthetic lethality specifically in cells with the loss-of-function (LOF) p53 mutation. In a xenograft model of endometrial cancer, this combinatorial therapy resulted in a marked inhibition of tumour progression and extended survival. Together, our data provide compelling evidence for future studies of BIBF- and PTX-loaded NPs as a therapeutic opportunity for LOF p53 cancers.

  1. Attenuation of vaccinia virus by the expression of human Flt3 ligand

    Directory of Open Access Journals (Sweden)

    Sanda Miloslav

    2010-05-01

    Full Text Available Abstract Background Vaccinia virus, one of the best known members of poxvirus family, has a wide host range both in vivo and in vitro. The expression of Flt3 ligand (FL by recombinant vaccinia virus (rVACV highly influenced properties of the virus in dependence on the level of expression. Results High production of FL driven by the strong synthetic promoter decreased the growth of rVACV in macrophage cell line J774.G8 in vitro as well as its multiplication in vivo when inoculated in mice. The inhibition of replication in vivo was mirrored in low levels of antibodies against vaccinia virus (anti-VACV which nearly approached to the negative serum level in non-infected mice. Strong FL expression changed not only the host range of the recombinant but also the basic protein contents of virions. The major proteins - H3L and D8L - which are responsible for the virus binding to the cells, and 28 K protein that serves as a virulence factor, were changed in the membrane portion of P13-E/L-FL viral particles. The core virion fraction contained multiple larger, uncleaved proteins and a higher amount of cellular proteins compared to the control virus. The overexpression of FL also resulted in its incorporation into the viral core of P13-E/L-FL IMV particles. In contrary to the equimolar ratio of glycosylated and nonglycosylated FL forms found in cells transfected with the expression plasmid, the recombinant virus incorporated mainly the smaller, nonglycosylated FL. Conclusions It has been shown that the overexpression of the Flt3L gene in VACV results in the attenuation of the virus in vivo.

  2. Cambios en virus vaccinia durante la síntesis de RNA in vitro

    Directory of Open Access Journals (Sweden)

    Julio Enrique Ospina

    1971-01-01

    Full Text Available Observaciones al microscopio electrónico de virus vaccinia previamente incubados en una mezcla para la reacción de RNA polimerasa in vitro, demuestran características alteraciones morfológicas en los virus. Estructuras similares a vesículas y ocasionalmente túbulos se formaron a partir de la membrana externa del virus. Uno de los sustituyentes de la reacción de RNA polimerasa in vitro, mercaptoetanol 0.007M, es el causante de esta alteración. El cambio morfológico se acompaña de pérdida de la infectividad viral. La presencia de grupos sulfhidrilo en la mezcla de la reacción enzimática es esencial para la ocurrencia de la síntesis de RNA de vaccinia in vitro. Esta condición no se pudo sustituir por choque térmico a 70C. ni por digestión parcial del virus por tripsina. Una gran variedad de compuestos con grupos sulfhidrilo pueden reemplazar el mercaptoetanol con efectividad variable. El más activo de ellos fué el ditiotreitol. Un período de latencia de 8 minutos ocurre entre la adición de vaccinia a la mezcla completa para la reacción de RNA polimerasa y la detección de síntesis de RNA. Los datos recolectados sugieren que cambios dependientes del mercaptoetanol ocurren durante este período.

  3. The role of signalling and the cytoskeleton during Vaccinia Virus egress.

    Science.gov (United States)

    Leite, Flavia; Way, Michael

    2015-11-02

    Viruses are obligate intracellular parasites that are critically dependent on their hosts to replicate and generate new progeny. To achieve this goal, viruses have evolved numerous elegant strategies to subvert and utilise the different cellular machineries and processes of their unwilling hosts. Moreover, they often accomplish this feat with a surprisingly limited number of proteins. Among the different systems of the cell, the cytoskeleton is often one of the first to be hijacked as it provides a convenient transport system for viruses to reach their site of replication with relative ease. At the latter stages of their replication cycle, the cytoskeleton also provides an efficient means for newly assembled viral progeny to reach the plasma membrane and leave the infected cell. In this review we discuss how Vaccinia virus takes advantage of the microtubule and actin cytoskeletons of its host to promote the spread of infection into neighboring cells. In particular, we highlight how analysis of actin-based motility of Vaccinia has provided unprecedented insights into how a phosphotyrosine-based signalling network is assembled and functions to stimulate Arp2/3 complex-dependent actin polymerization. We also suggest that the formin FHOD1 promotes actin-based motility of the virus by capping the fast growing ends of actin filaments rather than directly promoting filament assembly. We have come a long way since 1976, when electron micrographs of vaccinia-infected cells implicated the actin cytoskeleton in promoting viral spread. Nevertheless, there are still many unanswered questions concerning the role of signalling and the host cytoskeleton in promoting viral spread and pathogenesis. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Modified Vaccinia Virus Ankara: History, Value in Basic Research, and Current Perspectives for Vaccine Development.

    Science.gov (United States)

    Volz, A; Sutter, G

    2017-01-01

    Safety tested Modified Vaccinia virus Ankara (MVA) is licensed as third-generation vaccine against smallpox and serves as a potent vector system for development of new candidate vaccines against infectious diseases and cancer. Historically, MVA was developed by serial tissue culture passage in primary chicken cells of vaccinia virus strain Ankara, and clinically used to avoid the undesirable side effects of conventional smallpox vaccination. Adapted to growth in avian cells MVA lost the ability to replicate in mammalian hosts and lacks many of the genes orthopoxviruses use to conquer their host (cell) environment. As a biologically well-characterized mutant virus, MVA facilitates fundamental research to elucidate the functions of poxvirus host-interaction factors. As extremely safe viral vectors MVA vaccines have been found immunogenic and protective in various preclinical infection models. Multiple recombinant MVA currently undergo clinical testing for vaccination against human immunodeficiency viruses, Mycobacterium tuberculosis or Plasmodium falciparum. The versatility of the MVA vector vaccine platform is readily demonstrated by the swift development of experimental vaccines for immunization against emerging infections such as the Middle East Respiratory Syndrome. Recent advances include promising results from the clinical testing of recombinant MVA-producing antigens of highly pathogenic avian influenza virus H5N1 or Ebola virus. This review summarizes our current knowledge about MVA as a unique strain of vaccinia virus, and discusses the prospects of exploiting this virus as research tool in poxvirus biology or as safe viral vector vaccine to challenge existing and future bottlenecks in vaccinology. © 2017 Elsevier Inc. All rights reserved.

  5. Can vaccinia virus be replaced by MVA virus for testing virucidal activity of chemical disinfectants?

    Directory of Open Access Journals (Sweden)

    Rapp Ingrid

    2010-06-01

    Full Text Available Abstract Background Vaccinia virus strain Lister Elstree (VACV is a test virus in the DVV/RKI guidelines as representative of the stable enveloped viruses. Since the potential risk of laboratory-acquired infections with VACV persists and since the adverse effects of vaccination with VACV are described, the replacement of VACV by the modified vaccinia Ankara strain (MVA was studied by testing the activity of different chemical biocides in three German laboratories. Methods The inactivating properties of different chemical biocides (peracetic acid, aldehydes and alcohols were tested in a quantitative suspension test according to the DVV/RKI guideline. All tests were performed with a protein load of 10% fetal calf serum with both viruses in parallel using different concentrations and contact times. Residual virus was determined by endpoint dilution method. Results The chemical biocides exhibited similar virucidal activity against VACV and MVA. In three cases intra-laboratory differences were determined between VACV and MVA - 40% (v/v ethanol and 30% (v/v isopropanol are more active against MVA, whereas MVA seems more stable than VACV when testing with 0.05% glutardialdehyde. Test accuracy across the three participating laboratories was high. Remarkably inter-laboratory differences in the reduction factor were only observed in two cases. Conclusions Our data provide valuable information for the replacement of VACV by MVA for testing chemical biocides and disinfectants. Because MVA does not replicate in humans this would eliminate the potential risk of inadvertent inoculation with vaccinia virus and disease in non-vaccinated laboratory workers.

  6. Dietary fat intake in relation to lethal breast cancer in two large prospective cohort studies.

    Science.gov (United States)

    Boeke, Caroline E; Eliassen, A Heather; Chen, Wendy Y; Cho, Eunyoung; Holmes, Michelle D; Rosner, Bernard; Willett, Walter C; Tamimi, Rulla M

    2014-07-01

    Whether fat intake influences risk of developing more aggressive, lethal breast tumors is unknown. We evaluated intakes of total fat, specific types of fat, and cholesterol prior to diagnosis in relation to lethal breast cancer risk in 88,759 women in the Nurses' Health Study (NHS; 1980-2010) and 93,912 women in the Nurses' Health Study II (NHSII; 1991-2010). Diet was assessed every 4 years using a semi-quantitative food frequency questionnaire. Breast cancers were confirmed with pathology reports; deaths were confirmed by next of kin or the National Death Index. We defined lethal cases as women with invasive breast cancer who died of breast cancer. We pooled the cohorts and used multivariable Cox proportional hazards models. We identified 1,529 lethal breast cancer cases (1,279 in NHS and 250 in NHSII). Higher total fat intake was associated with a slightly lower lethal breast cancer risk (top vs. bottom quintile hazard ratio [HR] 0.85; 95 % CI 0.72, 1.01; p trend = 0.05). Specific types of fat were generally not associated with lethal breast cancer risk. For example, compared with those in the lowest quintile of saturated fat intake, those in the highest quintile had a HR of 0.98 (95 % CI 0.75, 1.26; p trend = 0.96). Among women diagnosed with breast cancer, pre-diagnosis fat intake was not associated with survival. Higher pre-diagnosis fat intake was not associated with greater risk of lethal breast cancer in these large prospective cohort studies, consistent with the weight of the evidence against a causal role for fat intake and breast cancer incidence.

  7. Parenteral ophthalmic tropicamide or cyclopentolate protects rats from lethal organophosphate poisoning.

    Science.gov (United States)

    Bryant, Sean M; Rhee, James W; Thompson, Trevonne M; Lu, Jenny J; Aks, Steven E

    2009-01-01

    We determine the efficacy of parenteral ophthalmic antimuscarinic agents (tropicamide ophthalmic 1% and cyclopentolate hydrochloride ophthalmic 1%) on survivability in a rat model of acute, lethal organophosphate pesticide (OP) poisoning. After obtaining an appropriate dose-response for study comparison, rodents were randomized to receive 1 of 4 intraperitoneal antidotes; (1) 0.3 mL normal saline, (2) atropine 10 mg/kg, (3) ophthalmic tropicamide 20 mg/kg, or (4) ophthalmic cyclopentolate 20 mg/kg. Five minutes after pretreatment, 15 mg/kg of dichlorvos was administered subcutaneously. Mortality rates and time to death were compared using Fisher exact test and the Kaplan-Meier method with log-rank test, respectively. If alive at 120 minutes, survival was assumed and the study was terminated. Survival in rats pretreated with atropine (10 mg/kg) was 90%. Survival in rats pretreated with tropicamide (20 mg/kg) and cyclopentolate (20 mg/kg) were 90% [P tropicamide or cyclopentolate) was equivalent to standard atropine in preventing lethality in this rat model of acute, lethal OP poisoning.

  8. An E2?F12 complex is required for intracellular enveloped virus morphogenesis during vaccinia infection

    OpenAIRE

    Dodding, Mark P; Newsome, Timothy P; Collinson, Lucy M; Edwards, Ceri; Way, Michael

    2009-01-01

    The vaccinia virus protein, F12, has been suggested to play an important role in microtubule-based transport of intracellular enveloped virus (IEV). We found that GFP-F12 is recruited to IEV moving on microtubules but is released from virus particles when they switch to actin-based motility. In the absence of F12, although the majority of IEV remain close to their peri-nuclear site of assembly, a small number of IEV still move with linear trajectories at speeds of 0.85 ?m s?1, consistent with...

  9. Vectores recombinantes basados en el virus Vaccinia modificado de Ankara (MVA) como vacunas contra la leishmaniasis

    OpenAIRE

    Pérez Jiménez, Eva; Larraga, Vicente; Esteban, Mariano

    2005-01-01

    Vectores recombinantes basados en el virus vaccinia modificado de Ankara (MVA) como vacunas contra la leishmaniasis. Los vectores de la invención contienen secuencias codificantes de la proteína LACK, preferentemente insertadas en el locus de hemaglutinina del virus y bajo el control de un promotor que permite su expresión a lo largo del ciclo de infección del virus. Son vectores seguros, estables, que dan lugar a una potente respuesta inmune que confiere protección frente a la leishmaniasis,...

  10. Calcium antagonists protect mice against lethal doses of ionizing radiation

    Energy Technology Data Exchange (ETDEWEB)

    Floersheim, G.L. (University Hospitals, Basel (Switzerland). Dept. of Research)

    1992-11-01

    Currently available radioprotectors are poorly tolerated in man and the general use of aminothiol radioprotectors is compromised by side-effects. In a search for less toxic radioprotective agents, diltiazem, a calcium antagonist with a benzothiazepine structure, was found to protect mice against a lethal (LD[sub 100]) [gamma] radiation dose allowing survival of up to 93%. Dihydropyridine calcium antagonists such as nifedipine, nimodipine, isradipine and nitrendipine also provided radioprotection. Calcium antagonists might attenuate radiation-induced injury by inhibiting cellular calcium overload, subsequent to cell membrane damage caused by radiation-generated free radicals. In view of their good tolerance, calcium antagonists may be applied safely in situations of radiation exposure, including radiotherapy and internal radionuclide contamination. These calcium antagonists may also be viewed in other contexts where free radicals are implicated in pathological processes. (Author).

  11. Detection of low numbers of healthy and sub-lethally injured Salmonella enterica in chocolate.

    Science.gov (United States)

    Jasson, Vicky; Baert, Leen; Uyttendaele, Mieke

    2011-02-28

    The capacity to detect low levels of healthy and sub-lethally injured Salmonella enterica cells in chocolate by two alternative rapid detection methods iQ-Check(TM)Salmonella II real-time PCR (Bio-Rad) and VIDAS® Easy SLM (BioMérieux) was assessed and compared with ISO 6579:2005. Chocolate, a low moisture food known to support the survival of Salmonella, was challenged as food matrix. Buffered peptone water (BPW) did not support the recovery of low levels of sub-lethally injured S. enterica independent of the detection method, while BPW supplemented with milk powder enabled detection by the three examined methods. However, inhibition of real-time PCR was observed since for one out of three repetitions of chocolate inoculated with a low number of sub-lethally injured S. enterica cells, no PCR signal was obtained. Therefore, attention should be paid to the enrichment step to avoid false negative results due to the presence of especially sub-lethally injured Salmonella cells in chocolate. An appropriate sample preparation (such as enrichment media and conditions for incubation) remains the key factor for reliable detection including sub-lethally injured cells and should be evaluated, if necessary optimized, for each detection assay. Copyright © 2011 Elsevier B.V. All rights reserved.

  12. Lethal and sub-lethal effects of the fungicide chlorothalonil on three life stages of the grass shrimp, Palaemonetes pugio.

    Science.gov (United States)

    Key, Peter B; Meyer, Shelli L; Chung, Katy W

    2003-09-01

    Chlorothalonil (2,4,5,6-tetrachloroisophthalonitrile) is the second most widely used fungicide in the United States. Due to the widespread use of chlorothalonil, it is important to investigate the effects chlorothalonil may have on estuarine species such as the grass shrimp, Palaemonetes pugio. This study examined the toxicity of chlorothalonil to three life-history stages (embryo, larvae, adult) of the grass shrimp. Also, molting frequency, growth response and metamorphosis from a larval life cycle pulsed exposure assay were examined as sub-lethal indicators of chlorothalonil exposure. Results showed embryos were the least sensitive with a 96-h Median Lethal Concentration (LC50) of 396.0 microg/L (95% Confidence Interval [CI] 331.3-472.4 microg/L). The adult 96-h LC50 was 152.9 microg/L (95% CI 120.3-194.5 microg/L). Larvae were the most sensitive to chlorothalonil exposure with a 96-h LC50 of 49.5 microg/L (95% CI 44.4-55.27 microg/L). In the life cycle pulsed exposure assay, all surviving larvae in the treatments required significantly more molts to reach postlarvae than the control. Other measured parameters showed differences between treatments and control but there was no statistical significance. This research demonstrated that chlorothalonil is highly toxic to grass shrimp and that larval grass shrimp would be the most appropriate life stage to use for chlorothalonil risk assessments since that stage is the most sensitive.

  13. Virus-specific memory CD8 T cells provide substantial protection from lethal severe acute respiratory syndrome coronavirus infection.

    Science.gov (United States)

    Channappanavar, Rudragouda; Fett, Craig; Zhao, Jincun; Meyerholz, David K; Perlman, Stanley

    2014-10-01

    Severe acute respiratory syndrome coronavirus (SARS-CoV) caused an acute human respiratory illness with high morbidity and mortality in 2002-2003. Several studies have demonstrated the role of neutralizing antibodies induced by the spike (S) glycoprotein in protecting susceptible hosts from lethal infection. However, the anti-SARS-CoV antibody response is short-lived in patients who have recovered from SARS, making it critical to develop additional vaccine strategies. SARS-CoV-specific memory CD8 T cells persisted for up to 6 years after SARS-CoV infection, a time at which memory B cells and antivirus antibodies were undetectable in individuals who had recovered from SARS. In this study, we assessed the ability of virus-specific memory CD8 T cells to mediate protection against infection in the absence of SARS-CoV-specific memory CD4 T or B cells. We demonstrate that memory CD8 T cells specific for a single immunodominant epitope (S436 or S525) substantially protected 8- to 10-month-old mice from lethal SARS-CoV infection. Intravenous immunization with peptide-loaded dendritic cells (DCs) followed by intranasal boosting with recombinant vaccinia virus (rVV) encoding S436 or S525 resulted in accumulation of virus-specific memory CD8 T cells in bronchoalveolar lavage fluid (BAL), lungs, and spleen. Upon challenge with a lethal dose of SARS-CoV, virus-specific memory CD8 T cells efficiently produced multiple effector cytokines (gamma interferon [IFN-γ], tumor necrosis factor alpha [TNF-α], and interleukin 2 [IL-2]) and cytolytic molecules (granzyme B) and reduced lung viral loads. Overall, our results show that SARS-CoV-specific memory CD8 T cells protect susceptible hosts from lethal SARS-CoV infection, but they also suggest that SARS-CoV-specific CD4 T cell and antibody responses are necessary for complete protection. Virus-specific CD8 T cells are required for pathogen clearance following primary SARS-CoV infection. However, the role of SARS-CoV-specific memory CD

  14. A new lethal sclerosing bone dysplasia

    Energy Technology Data Exchange (ETDEWEB)

    Kingston, H.M. (Saint Mary' s Hospital, Manchester (UK). Regional Genetics Centre); Freeman, J.S. (Tameside General Hospital, Ashton-under-Lyne (UK). Dept. of Paediatrics); Hall, C.M. (Hospital for Sick Children, London (UK). Dept. of Paediatric Radiology)

    1991-02-01

    A neonate is described with a lethal sclerosing bone dysplasia associated with prenatal fractures and craniofacial abnormalities including microcephaly, exophthalmos, hypoplastic nose and mid-face, small jaw and nodular hyperplasia of the gums. Parental consanguinity suggests that an autosomal recessive mutation is the likely aetiology. (orig.).

  15. Guidebook for non-lethal experimentation

    NARCIS (Netherlands)

    Paulissen, J.J.M.; Rahimi, R.

    2011-01-01

    In the 2009-2011 timeframe, NATO conducts a capability based assessment of Non-Lethal Weapon (NLW) systems. The work, performed by the RTO study team SAS-078, involves the development of NLW requirement descriptions, which are put against a set of NLW systems. Gaps are likely to occur, indicating

  16. A lethal short rib syndrome without polydactyly.

    OpenAIRE

    Winter, R M

    1988-01-01

    A female infant is described with a lethal short rib syndrome, similar to a form of short rib-polydactyly syndrome but without polydactyly. It is felt that this infant has the same condition as that described by Beemer et al.

  17. Lethal ingestion of stored Amanita phalloides mushrooms.

    Science.gov (United States)

    Himmelmann, A; Mang, G; Schnorf-Huber, S

    2001-10-20

    We report the first case of a lethal Amanita phalloides intoxication from stored mushrooms. After picking the mushrooms were kept in a freezer for 7-8 months. This case is in accordance with the well-known stability of the amatoxins and demonstrates the possibility of A. phalloides poisoning at any time of year.

  18. Midline lethal granuloma complicating pregnancy: case report ...

    African Journals Online (AJOL)

    A case of midline lethal granuloma in a 28-year- old female Nigerian patient is reported. Oral, ocular and nasal lesions were present and these preceded a spontaneous abortion of a three month old pregnancy. The clinical course of the disease and its similarity to other granulomatous diseases, which are generally ...

  19. Shortened Lifespan and Lethal Hemorrhage in a Hemophilia A Mouse Model.

    Science.gov (United States)

    Staber, Janice M; Pollpeter, Molly J

    2016-01-01

    Hemophilia A animal models have helped advance our understanding of factor VIII deficiency. Previously, factor VIII deficient mouse models were reported to have a normal life span without spontaneous bleeds. However, the bleeding frequency and survival in these animals has not been thoroughly evaluated. To investigate the survival and lethal bleeding frequency in two strains of E-16 hemophilia A mice. We prospectively studied factor VIII deficient hemizygous affected males (n = 83) and homozygous affected females (n = 55) for survival and bleeding frequency. Animals were evaluated for presence and location of bleeds as potential cause of death. Hemophilia A mice had a median survival of 254 days, which is significantly shortened compared to wild type controls (p hemophilia A mice experienced hemorrhage in several tissues. This previously-underappreciated shortened survival in the hemophilia A murine model provides new outcomes for investigation of therapeutics and also reflects the shortened lifespan of patients if left untreated.

  20. Comparative Proteomics of Human Monkeypox and Vaccinia Intracellular Mature and Extracellular Enveloped Virions

    Energy Technology Data Exchange (ETDEWEB)

    Manes, Nathan P.; Estep, Ryan D.; Mottaz, Heather M.; Moore, Ronald J.; Clauss, Therese RW; Monroe, Matthew E.; Du, Xiuxia; Adkins, Joshua N.; Wong, Scott; Smith, Richard D.

    2008-03-07

    Orthopoxviruses are the largest and most complex of the animal viruses. In response to the recent emergence of monkeypox in Africa and the threat of smallpox bioterrorism, virulent (monkeypox virus) and benign (vaccinia virus) orthopoxviruses were proteomically compared with the goal of identifying proteins required for pathogenesis. Orthopoxviruses were grown in HeLa cells to two different viral forms (intracellular mature virus and extracellular enveloped virus), purified by sucrose gradient ultracentrifugation, denatured using RapiGest™ surfactant, and digested with trypsin. Unfractionated samples and strong cation exchange HPLC fractions were analyzed by reversed-phase LC-MS/MS, and analyses of the MS/MS spectra using SEQUEST® and X! Tandem resulted in the identification of hundreds of monkeypox, vaccinia, and copurified host proteins. The unfractionated samples were additionally analyzed by LC-MS on an LTQ-Orbitrap™, and the accurate mass and elution time tag approach was used to perform quantitative comparisons. Possible pathophysiological roles of differentially expressed orthopoxvirus genes are discussed.

  1. Treatment of Vaccinia and Cowpox Virus Infections in Mice with CMX001 and ST-246

    Directory of Open Access Journals (Sweden)

    Earl R. Kern

    2010-12-01

    Full Text Available Although a large number of compounds have been identified with antiviral activity against orthopoxviruses in tissue culture systems, it is highly preferred that these compounds have activity in vivo before they can be seriously considered for further development. One of the most commonly used animal models for the confirmation of this activity has been the use of mice infected with either vaccinia or cowpox viruses. These model systems have the advantage that they are relatively inexpensive, readily available and do not require any special containment facilities; therefore, relatively large numbers of compounds can be evaluated in vivo for their activity. The two antiviral agents that have progressed from preclinical studies to human safety trials for the treatment of orthopoxvirus infections are the cidofovir analog, CMX001, and an inhibitor of extracellular virus formation, ST-246. These compounds are the ones most likely to be used in the event of a bioterror attack. The purpose of this communication is to review the advantages and disadvantages of using mice infected with vaccinia and cowpox virus as surrogate models for human orthopoxvirus infections and to summarize the activity of CMX001 and ST-246 in these model infections.

  2. Vaccinia virus protein F12 associates with intracellular enveloped virions through an interaction with A36.

    Science.gov (United States)

    Johnston, Sara C; Ward, Brian M

    2009-02-01

    Vaccinia virus is the prototypical member of the family Poxviridae. Three morphologically distinct forms are produced during infection: intracellular mature virions (IMV), intracellular enveloped virions (IEV), and extracellular enveloped virions (EEV). Two viral proteins, F12 and A36, are found exclusively on IEV but not on IMV and EEV. Analysis of membranes from infected cells showed that F12 was only associated with membranes and is not an integral membrane protein. A yeast two-hybrid assay revealed an interaction between amino acids 351 to 458 of F12 and amino acids 91 to 111 of A36. We generated a recombinant vaccinia virus that expresses an F12, which lacks residues 351 to 458. Characterization of this recombinant revealed a small-plaque phenotype and a subsequent defect in virus release similar to a recombinant virus that had F12L deleted. In addition, F12 lacking residues 351 to 458 was unable to associate with membranes in infected cells. These results suggest that F12 associates with IEV through an interaction with A36 and that this interaction is critical for the function of F12 during viral egress.

  3. Vaccinia Virus Natural Infections in Brazil: The Good, the Bad, and the Ugly

    Directory of Open Access Journals (Sweden)

    Jaqueline Silva de Oliveira

    2017-11-01

    Full Text Available The orthopoxviruses (OPV comprise several emerging viruses with great importance to human and veterinary medicine, including vaccinia virus (VACV, which causes outbreaks of bovine vaccinia (BV in South America. Historically, VACV is the most comprehensively studied virus, however, its origin and natural hosts remain unknown. VACV was the primary component of the smallpox vaccine, largely used during the smallpox eradication campaign. After smallpox was declared eradicated, the vaccination that conferred immunity to OPV was discontinued, favoring a new contingent of susceptible individuals to OPV. VACV infections occur naturally after direct contact with infected dairy cattle, in recently vaccinated individuals, or through alternative routes of exposure. In Brazil, VACV outbreaks are frequently reported in rural areas, affecting mainly farm animals and humans. Recent studies have shown the role of wildlife in the VACV transmission chain, exploring the role of wild rodents as reservoirs that facilitate VACV spread throughout rural areas. Furthermore, VACV circulation in urban environments and the significance of this with respect to public health, have also been explored. In this review, we discuss the history, epidemiological, ecological and clinical aspects of natural VACV infections in Brazil, also highlighting alternative routes of VACV transmission, the factors involved in susceptibility to infection, and the natural history of the disease in humans and animals, and the potential for dissemination to urban environments.

  4. Expression of CCL19 from Oncolytic Vaccinia Enhances Immunotherapeutic Potential while Maintaining Oncolytic Activity

    Directory of Open Access Journals (Sweden)

    Jun Li

    2012-12-01

    Full Text Available Promising phase II clinical results have been reported recently for several oncolytic viral therapeutics, including strains based on vaccinia virus. One reason for this has been an increased appreciation of the critical therapeutic importance of the immune response raised by these viruses. However, the most commonly used approaches to enhance these immunotherapeutic effects in oncolytic viruses, typically though expression of cytokine transgenes, often also result in a reduction in oncolytic activity and premature clearance of the virotherapy from the tumor. Approaches that enhance the immunotherapeutic effects while maintaining oncolytic activity would therefore be beneficial. Here, it is demonstrated that the expression of the chemokine CCL19 (ELC from an oncolytic vaccinia virus (vvCCL19 results in increased antitumor effects in syngeneic mouse tumor models. This corresponded with increased t cell and dendritic cell infiltration into the tumor. However, vvCCL19 persisted in the tumor at equivalent levels to a control virus without CCL19, demonstrating that oncolytic activity was not curtailed. Instead, vvCCL19 was cleared rapidly and selectively from normal tissues and organs, indicating a potentially increased safety profile. The therapeutic activity of vvCCL19 could be further significantly increased through combination with adoptive transfer of therapeutic immune cells expressing CCR7, the receptor for CCL19. This approach therefore represents a means to increase the safety and therapeutic benefit of oncolytic viruses, used alone or in combination with immune cell therapies.

  5. Treatment of Vaccinia and Cowpox Virus Infections in Mice with CMX001 and ST-246.

    Science.gov (United States)

    Quenelle, Debra C; Kern, Earl R

    2010-12-01

    Although a large number of compounds have been identified with antiviral activity against orthopoxviruses in tissue culture systems, it is highly preferred that these compounds have activity in vivo before they can be seriously considered for further development. One of the most commonly used animal models for the confirmation of this activity has been the use of mice infected with either vaccinia or cowpox viruses. These model systems have the advantage that they are relatively inexpensive, readily available and do not require any special containment facilities; therefore, relatively large numbers of compounds can be evaluated in vivo for their activity. The two antiviral agents that have progressed from preclinical studies to human safety trials for the treatment of orthopoxvirus infections are the cidofovir analog, CMX001, and an inhibitor of extracellular virus formation, ST-246. These compounds are the ones most likely to be used in the event of a bioterror attack. The purpose of this communication is to review the advantages and disadvantages of using mice infected with vaccinia and cowpox virus as surrogate models for human orthopoxvirus infections and to summarize the activity of CMX001 and ST-246 in these model infections.

  6. Crosstalk between immune cell and oncolytic vaccinia therapy enhances tumor trafficking and antitumor effects.

    Science.gov (United States)

    Sampath, Padma; Li, Jun; Hou, Weizhou; Chen, Hannah; Bartlett, David L; Thorne, Steve H

    2013-03-01

    The combination of an oncolytic virus, that directly destroys tumor cells and mediates an acute immune response, with an immune cell therapy, capable of further enlisting and enhancing the host immune response, has the potential to create a potent therapeutic effect. We have previously developed several strategies for optimizing the delivery of oncolytic vaccinia virus vectors to their tumor targets, including the use of immune cell-based carrier vehicles and the incorporation of mutations that increase production of the enveloped form of vaccinia (extracellular enveloped viral (EEV)) that is better adapted to spread within a host. Here, we initially combine these approaches to create a novel therapeutic, consisting of an immune cell (cytokine-induced killer, CIK) preloaded with an oncolytic virus that is EEV enhanced. This resulted in direct interaction between the viral and immune cell components with each assisting the other in directing the therapy to the tumor and so enhancing the antitumor effects. This effect could be further improved through CCL5 expression from the virus. The resulting multicomponent therapy displays the ability for synergistic crosstalk between components, so significantly enhancing tumor trafficking and antitumor effects.

  7. Whole cell cryo-electron tomography reveals distinct disassembly intermediates of vaccinia virus.

    Directory of Open Access Journals (Sweden)

    Marek Cyrklaff

    Full Text Available At each round of infection, viruses fall apart to release their genome for replication, and then reassemble into stable particles within the same host cell. For most viruses, the structural details that underlie these disassembly and assembly reactions are poorly understood. Cryo-electron tomography (cryo-ET, a unique method to investigate large and asymmetric structures at the near molecular resolution, was previously used to study the complex structure of vaccinia virus (VV. Here we study the disassembly of VV by cryo-ET on intact, rapidly frozen, mammalian cells, infected for up to 60 minutes. Binding to the cell surface induced distinct structural rearrangements of the core, such as a shape change, the rearrangement of its surface spikes and de-condensation of the viral DNA. We propose that the cell surface induced changes, in particular the decondensation of the viral genome, are a prerequisite for the subsequent release of the vaccinia DNA into the cytoplasm, which is followed by its cytoplasmic replication. Generally, this is the first study that employs whole cell cryo-ET to address structural details of pathogen-host cell interaction.

  8. CD40 ligand and tdTomato-armed vaccinia virus for induction of antitumor immune response and tumor imaging.

    Science.gov (United States)

    Parviainen, S; Ahonen, M; Diaconu, I; Hirvinen, M; Karttunen, Å; Vähä-Koskela, M; Hemminki, A; Cerullo, V

    2014-02-01

    Oncolytic vaccinia virus is an attractive platform for immunotherapy. Oncolysis releases tumor antigens and provides co-stimulatory danger signals. However, arming the virus can improve efficacy further. CD40 ligand (CD40L, CD154) can induce apoptosis of tumor cells and it also triggers several immune mechanisms. One of these is a T-helper type 1 (Th1) response that leads to activation of cytotoxic T-cells and reduction of immune suppression. Therefore, we constructed an oncolytic vaccinia virus expressing hCD40L (vvdd-hCD40L-tdTomato), which in addition features a cDNA expressing the tdTomato fluorochrome for detection of virus, potentially important for biosafety evaluation. We show effective expression of functional CD40L both in vitro and in vivo. In a xenograft model of bladder carcinoma sensitive to CD40L treatment, we show that growth of tumors was significantly inhibited by the oncolysis and apoptosis following both intravenous and intratumoral administration. In a CD40-negative model, CD40L expression did not add potency to vaccinia oncolysis. Tumors treated with vvdd-mCD40L-tdtomato showed enhanced efficacy in a syngenic mouse model and induced recruitment of antigen-presenting cells and lymphocytes at the tumor site. In summary, oncolytic vaccinia virus coding for CD40L mediates multiple antitumor effects including oncolysis, apoptosis and induction of Th1 type T-cell responses.

  9. Mutations Conferring Resistance to Viral DNA Polymerase Inhibitors in Camelpox Virus Give Different Drug-Susceptibility Profiles in Vaccinia Virus

    Czech Academy of Sciences Publication Activity Database

    Duraffour, S.; Andrei, G.; Topalis, D.; Krečmerová, Marcela; Crance, J. M.; Garin, D.; Snoeck, R.

    2012-01-01

    Roč. 86, č. 13 (2012), s. 7310-7325 ISSN 0022-538X Institutional support: RVO:61388963 Keywords : camelpox virus * CMLV * vaccinia virus VACV * acyclic nucleoside phosphonates * HPMPDAP * cidofovir * drug resistance Subject RIV: CC - Organic Chemistry Impact factor: 5.076, year: 2012

  10. Safety and immunogenicity of LC16m8, an attenuated smallpox vaccine in vaccinia-naive adults.

    Science.gov (United States)

    Kennedy, Jeffrey S; Gurwith, Marc; Dekker, Cornelia L; Frey, Sharon E; Edwards, Kathryn M; Kenner, Julie; Lock, Michael; Empig, Cyril; Morikawa, Shigeru; Saijo, Masayuki; Yokote, Hiroyuki; Karem, Kevin; Damon, Inger; Perlroth, Mark; Greenberg, Richard N

    2011-11-01

    LC16m8 is an attenuated cell culture-adapted Lister vaccinia smallpox vaccine missing the B5R protein and licensed for use in Japan. We conducted a phase I/II clinical trial that compared the safety and immunogenicity of LC16m8 with Dryvax in vaccinia-naive participants. Adverse events were assessed, as were electrocardiography and laboratory testing for cardiotoxicity and viral culturing of the vaccination sites. Neutralization titers to vaccinia, monkeypox, and variola major were assessed and cell-mediated immune responses were measured by interferon (IFN)-γ enzyme-linked immunosorbent spot and lymphoproliferation assays. Local and systemic reactions after vaccination with LC16m8 were similar to those reported after Dryvax. No clinically significant abnormalities consistent with cardiac toxicity were seen for either vaccine. Both vaccines achieved antivaccinia, antivariola, and antimonkeypox neutralizing antibody titers >1:40, although the mean plaque reduction neutralization titer of LC16m8 at day 30 after vaccination was significantly lower than Dryvax for anti-NYCBH vaccinia (P smallpox. Clinical Trials Registration. NCT00103584.

  11. Chemical inactivation of recombinant vaccinia viruses and the effects on antigenicity and immunogenicity of recombinant simian immunodeficiency virus envelope glycoproteins.

    NARCIS (Netherlands)

    E.G.J. Hulskotte (Ellen); M.E.M. Dings (Marlinda); S.G. Norley (Stephen); A.D.M.E. Osterhaus (Albert)

    1997-01-01

    textabstractThe efficiency of paraformaldehyde (PFA) and binary ethylenimine (BEI) in inactivating recombinant vaccinia virus (rVV), present in baby hamster kidney cells expressing simian immunodeficiency virus envelope glycoproteins (SIV-Env), was measured in a series of inactivation studies. Both

  12. Discontinuous transcription or RNA processing of vaccinia virus late messengers results in a 5' poly(A) leader

    NARCIS (Netherlands)

    Schwer, B; Visca, P.; Vos, J C; Stunnenberg, H.G.

    1987-01-01

    We have demonstrated by primer elongation and cap analysis that mature vaccinia virus late transcripts are discontinuously synthesized. We have shown that RNA transcripts from a translocated 11K and from the authentic 11K and 4b late promoters are extended by approximately 35 nucleotides beyond the

  13. Immunogenicity and protective efficacy of recombinant Modified Vaccinia virus Ankara candidate vaccines delivering West Nile virus envelope antigens

    NARCIS (Netherlands)

    Volz, Asisa; Lim, Stephanie; Kaserer, Martina; Pijlman, Gorben P.

    2016-01-01

    West Nile virus (WNV) cycles between insects and wild birds, and is transmitted via mosquito vectors to horses and humans, potentially causing severe neuroinvasive disease. Modified Vaccinia virus Ankara (MVA) is an advanced viral vector for developing new recombinant vaccines against infectious

  14. Identification of sites phosphorylated by the vaccinia virus B1R kinase in viral protein H5R

    Directory of Open Access Journals (Sweden)

    Hardie Grahame

    2000-09-01

    Full Text Available Abstract Background Vaccinia virus gene B1R encodes a serine/threonine protein kinase. In vitro this protein kinase phosphorylates ribosomal proteins Sa and S2 and vaccinia virus protein H5R, proteins that become phosphorylated during infection. Nothing is known about the sites phosphorylated on these proteins or the general substrate specificity of the kinase. The work described is the first to address these questions. Results Vaccinia virus protein H5R was phosphorylated by the B1R protein kinase in vitro, digested with V8 protease, and phosphopeptides separated by HPLC. The N-terminal sequence of one radioactively labelled phosphopeptide was determined and found to correspond to residues 81-87 of the protein, with Thr-84 and Thr-85 being phosphorylated. A synthetic peptide based on this region of the protein was shown to be a substrate for the B1R protein kinase, and the extent of phosphorylation was substantially decreased if either Thr residue was replaced by an Ala. Conclusions We have identified the first phosphorylation site for the vaccinia virus B1R protein kinase. This gives important information about the substrate-specificity of the enzyme, which differs from that of other known protein kinases. It remains to be seen whether the same site is phosphorylated in vivo.

  15. Concanavalin A-mediated cell agglutinability induced by Vaccinia virions. [Uv radiation, /sup 125/I tracer technique

    Energy Technology Data Exchange (ETDEWEB)

    Mbuy, G.; Bubel, H.C.

    1978-12-01

    The induction of enhanced concanavalin A (Con A)-mediated cellular agglutinability by purified vaccinia virus was examined quantitatively. Increased HEp-2 cell agglutinability by the lectin occurred within the first hour of infection and persisted without further change throughout the virus infectious cycle. Ultraviolet, but not heat-inactivated, virus was as effective as infectious virus in causing increased Con A agglutinability. Inhibition of viral and host cell protein synthesis by Streptovitacin A failed to alter the lectin response to vaccinia virus infection. Fluorescein-labeled Con A was observed to form clusters and large fluorescent patches on the infected cell surface during the earliest stage of infection. Studies with /sup 125/I-labeled Con A revealed an early but minimal increase in lectin binding to infected cells. After the first hour of infection, no further increase in Con A binding was observed. When cells were exposed to purified vaccinia virus surface tubules increased Con A agglutinability comparable to that obtained with native virus was demonstrated. Con A-mediated agglutinability of cells was temperature-dependent and displayed a higher temperature transition in infected cells. These data suggest that upon contact with the host cell, vaccinia virions or surface tubules induce alterations in the plasma membrane which are reflected in an enhanced agglutinability by Con A.

  16. Lethal and sub-lethal effects of copper to the african catfish ( clarias ...

    African Journals Online (AJOL)

    Lethal and sub-lethal effects of copper on Clarias gariepinus were studied using a 96-hour static bioassay. Copper (as copper chloride, CuCl2 . H2O) was used to prepare the stock solution from which five standard concentrations 0.0, 1.8, 3.2, 5.6, and 10.0 mg/L were prepared (coded A – E). 15 juvenile C. gariepinus fish ...

  17. The Mitochondria-targeted Nitroxide JP4-039 Augments Potentially Lethal Irradiation Damage Repair

    OpenAIRE

    RAJAGOPALAN, MALOLAN S.; GUPTA, KANIKA; EPPERLY, MICHAEL W.; FRANICOLA, DARCY; ZHANG, XICHEN; WANG, HONG; ZHAO, HONG; TYURIN, VLADIMIR A.; PIERCE, JOSHUA G.; KAGAN, VALERIAN E.; WIPF, PETER; KANAI, ANTHONY J.; GREENBERGER, JOEL S.

    2009-01-01

    It was unknown if a mitochondria-targeted nitroxide (JP4-039) could augment potentially lethal damage repair (PLDR) of cells in quiescence. We evaluated 32D cl 3 murine hematopoietic progenitor cells which were irradiated and then either centrifuged to pellets (to simulate PLDR conditions) or left in exponential growth for 0, 24, 48 or 72 h. Pelleted cells demonstrated cell cycle arrest with a greater percentage in the G1-phase than did exponentially growing cells. Irradiation survival curves...

  18. Survival of Viral Biowarfare Agents in Disinfected Waters

    Directory of Open Access Journals (Sweden)

    Mary Margaret Wade

    2010-01-01

    Full Text Available Protecting civilian and military water supplies has received more attention since the United States began its war on terror in 2001. Both chlorine and bromine are used by branches of the U.S. military for disinfecting water supplies; however, limited data exists as to the effectiveness of these additives when used against viral biowarfare agents. The present study sought to evaluate the survival of selected viral biothreat agents in disinfected water. Disinfected water samples were spiked with vaccinia virus strain WR and Venezuelan equine encephalitis (VEE virus strain TC-83 each separately to a final concentration of approximately 1×106 PFU/mL, and survival was assessed by plaque assay. Both viruses were inactivated by 1 mg/L free available chlorine (FAC and 2mg/L total bromine within one hour. In conclusion, these results demonstrate that both chlorine and bromine are effective disinfectants against vaccinia virus and VEE strain TC-83 at the concentrations tested.

  19. Infecções humanas causadas por poxvirus relacionados ao vírus vaccinia no Brasil Human infections caused by vaccinia-like poxviruses in Brazil

    Directory of Open Access Journals (Sweden)

    Hermann G. Schatzmayr

    2009-12-01

    Full Text Available A partir de 1999, infecções humanas por Orthopoxvirus vem sendo observadas em pelo menos oito estados no país, com a formação de vesículas as quais evoluem para pústulas e crostas, principalmente nos membros superiores e face, após contacto com bovinos apresentando lesões semelhantes no úbere. Alem das lesões na pele, foram descritas nos pacientes reações ganglionares axilares por vezes dolorosas, febre, cefaléia, fadiga, desidratação, anorexia, sudorese, artralgia e mialgia, evoluindo o quadro por três a quatro semanas. Lesão vulvar bem como transmissão intrafamiliar foram igualmente descritas. Estudos moleculares demonstraram que os poxvirus identificados são geneticamente relacionados a amostras do vírus vaccinia utilizadas no passado, nas campanhas de vacinação. Especimens clínicos de 80 infecções humanas foram estudados no laboratório e a infecção por orthopoxvirus confirmada em 68 casos. São apresentadas lesões observadas em pacientes bem como discutidas as implicações desta zoonose no Brasil.Since 1999, human infection caused by Orthopoxvirus has been observed in at least eight Brazilian states, with the presence of vesicles that evolve to pustules and crusts, especially on the hands, arms and face, after contact with cows showing comparable lesions on the udder. In addition to the skin lesions, there have been descriptions of patients with axillary ganglionic reactions that are sometimes painful, along with fever, headache, fatigue, dehydration, anorexia, sudoresis, arthralgia and muscle pain. The condition evolves over a three to four-week period. Vulvar lesions and transmission within families have also been described. Molecular studies have shown that the poxviruses identified are genetically related to vaccinia virus samples that were used in vaccination campaigns in the past. Clinical specimens from 80 human infections were studied in the laboratory, and orthopoxvirus infections were confirmed in 68

  20. Unraveling the physiological complexities of antibiotic lethality.

    Science.gov (United States)

    Dwyer, Daniel J; Collins, James J; Walker, Graham C

    2015-01-01

    We face an impending crisis in our ability to treat infectious disease brought about by the emergence of antibiotic-resistant pathogens and a decline in the development of new antibiotics. Urgent action is needed. This review focuses on a less well-understood aspect of antibiotic action: the complex metabolic events that occur subsequent to the interaction of antibiotics with their molecular targets and play roles in antibiotic lethality. Independent lines of evidence from studies of the action of bactericidal antibiotics on diverse bacteria collectively suggest that the initial interactions of drugs with their targets cannot fully account for the antibiotic lethality and that these interactions elicit the production of reactive oxidants including reactive oxygen species that contribute to bacterial cell death. Recent challenges to this concept are considered in the context of the broader literature of this emerging area of research. Possible ways that this new knowledge might be exploited to improve antibiotic therapy are also considered.

  1. Synthetic lethality to overcome cancer drug resistance.

    Science.gov (United States)

    Porcelli, L; Quatrale, A E; Mantuano, P; Silvestris, N; Brunetti, A E; Calvert, H; Paradiso, A; Azzariti, A

    2012-01-01

    A large body of evidence point out that the onset of synthetic lethality may provide a useful tool for amplifying the efficacy of drugs in anticancer regimens, to uncover interdependence between genes and to identify predictive factors that would be extremely useful to guide in the selection of more effective targeted drugs and drug combinations for each patient. Here, we provide an overview on the exploitation of synthetic lethality to overcome drug resistance to conventional chemotherapy in several types of solid tumors. We report recent findings on cellular markers and gene mutations which are specifically essential for the viability of cancer cells and for resistance to chemotherapeutics. In addition, new molecularly targeted strategies to overcome drug resistance are suggested.

  2. Lethal neonatal short-limbed dwarfism

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Ok Hwa; Yim, Chung Ik; Bahk, Yong Whee [Catholic Medical College, Seoul (Korea, Republic of)

    1986-02-15

    We have detailed our experiences on 6 cases of neonatal lethal short-limbed dwarfism and reviewed the articles. They include, achondrogenesis, thanatophoric dysplasia, asphyxiating thoracic dysplasia, osteogenesis imperfect a congenita, and hypophosphatasia lethals. Five babies were born alive but died soon after birth and one was a stillbirth. The main cause of failure to thrive was respiratory insufficiency. Each case was having quite characteristic radiologic findings, even if the general appearances were similar to the achondroplasts clinically. Precise diagnosis is very important for genetic counselling of the parents and alarm to them the possibility of bone dysplasias to the next offsprings. For this purpose, the radiologists play major role for the correct diagnosis. We stress that when the baby is born with short-limbed dwarfism, whole body radiogram should be taken including lateral view and postmortem radiogram is also very precious.

  3. Neonatal striatal grafts prevent lethal syndrome produced by bilateral intrastriatal injection of kainic acid.

    Science.gov (United States)

    Tulipan, N; Huang, S; Whetsell, W O; Allen, G S

    1986-07-02

    It is reported that unilateral grafts of neonatal striatal tissue protect the recipient from the lethal aphagia and adipsia produced by bilateral intrastriatal injection of 10 nmol of kainic acid in rats. It is shown that neither adult striatum nor neonatal tissue from other sites have the same lifesaving effect and that the salutary effect of the graft is dependent upon graft survival. Grafts from a histoincompatible donor are apparently rejected, leading to the death of the recipient. Cyclosporine inhibits rejection thereby enabling recipient survival. It is postulated that the graft exerts a neurohumoral influence that protects the striatum from the toxic effect of kainate.

  4. Short rib polydactyly syndrome: lethal skeletal dysplasia

    OpenAIRE

    Huertas, Erasmo; 1 Instituto Nacional Materno Perinatal. Lima, Perú. 2 Facultad de Medicina, Universidad Nacional Mayor de San Marcos. Lima, Perú.; Íngar, Jaime; 1 Instituto Nacional Materno Perinatal. Lima, Perú. 2 Facultad de Medicina, Universidad Particular San Martín de Porres. Lima, Perú.; Gutiérrez, Guiselle; 1 Instituto Nacional Materno Perinatal. Lima, Perú. 2 Facultad de Medicina, Universidad Nacional Mayor de San Marcos. Lima, Perú.; Quiñones, Eva María; Facultad de Medicina, Universidad Particular San Martín de Porres. Lima, Perú.

    2011-01-01

    Short rib-polydactyly syndrome is a descriptive category for a group of lethal skeletal dysplasias characterized by hypoplastic thorax, short ribs, short limbs, polydactyly, and visceral abnormalities. The 4 established variants are SRPS I (Saldino-Noonan type), SRPS II (Majewski type; 263520), SRPS III (Verma-Naumoff type; 263510), and SRPS IV (Beemer-Langer type; 269860). All variants are thought to be inherited in autosomal recessive pattern. Because of the frequent phenotype overlap there...

  5. Lethal injection for execution: chemical asphyxiation?

    OpenAIRE

    Zimmers, Teresa A.; Jonathan Sheldon; Lubarsky, David A; Francisco López-Muñoz; Linda Waterman; Richard Weisman; Koniaris, Leonidas G.

    2007-01-01

    Editors' Summary Background. Lethal injection is a common form of execution in a number of countries, most prominently the US and China. The protocols currently used in the US contain three drugs: an ultrashort-acting barbiturate, thiopental (which acts as an anesthetic, but does not have any analgesic effect); a neuromuscular blocker, pancuronium bromide (which causes muscle paralysis); and an electrolyte, potassium chloride (which stops the heart from beating). Each of these drugs on its ow...

  6. Lethal Interpersonal Violence in the Middle Pleistocene

    OpenAIRE

    Nohemi Sala; Juan Luis Arsuaga; Ana Pantoja-Pérez; Adrián Pablos; Ignacio Martínez; Quam, Rolf M.; Asier Gómez-Olivencia; José María Bermúdez de Castro; Eudald Carbonell

    2015-01-01

    Evidence of interpersonal violence has been documented previously in Pleistocene members of the genus Homo, but only very rarely has this been posited as the possible manner of death. Here we report the earliest evidence of lethal interpersonal violence in the hominin fossil record. Cranium 17 recovered from the Sima de los Huesos Middle Pleistocene site shows two clear perimortem depression fractures on the frontal bone, interpreted as being produced by two episodes of localized blunt force ...

  7. Lethal midline granuloma syndrome: a diagnostic dilemma

    Energy Technology Data Exchange (ETDEWEB)

    Ribeiro, Bruno Niemeyer de Freitas; Bahia, Paulo Roberto Valle [Radiology, Hospital Universitario Clementino Fraga Filho - Universidade Federal do Rio de Janeiro (HUCFF-UFRJ), Rio de Janeiro, RJ (Brazil); Oliveira, Ana Luiza Vianna Sobral de Magalhaes [Resident of Medical Practice, Hospital Federal da Lagoa, Rio de Janeiro, RJ (Brazil); Marchon Junior, Joao Luiz [Unit of Computed Tomography, Hospital Federal da Lagoa, Rio de Janeiro, RJ (Brazil)

    2012-11-15

    The rare lethal midline granuloma syndrome is difficult to diagnose because of the wide array of related diseases and lack of knowledge by the majority of physicians. In the present report, the authors describe the case of a patient with this disease, caused by squamous cell carcinoma, drawing attention to differential diagnoses and to clinical and radiological findings that may be useful to define the diagnosis. (author)

  8. Lethal interpersonal violence in the Middle Pleistocene.

    Science.gov (United States)

    Sala, Nohemi; Arsuaga, Juan Luis; Pantoja-Pérez, Ana; Pablos, Adrián; Martínez, Ignacio; Quam, Rolf M; Gómez-Olivencia, Asier; Bermúdez de Castro, José María; Carbonell, Eudald

    2015-01-01

    Evidence of interpersonal violence has been documented previously in Pleistocene members of the genus Homo, but only very rarely has this been posited as the possible manner of death. Here we report the earliest evidence of lethal interpersonal violence in the hominin fossil record. Cranium 17 recovered from the Sima de los Huesos Middle Pleistocene site shows two clear perimortem depression fractures on the frontal bone, interpreted as being produced by two episodes of localized blunt force trauma. The type of injuries, their location, the strong similarity of the fractures in shape and size, and the different orientations and implied trajectories of the two fractures suggest they were produced with the same object in face-to-face interpersonal conflict. Given that either of the two traumatic events was likely lethal, the presence of multiple blows implies an intention to kill. This finding shows that the lethal interpersonal violence is an ancient human behavior and has important implications for the accumulation of bodies at the site, supporting an anthropic origin.

  9. Lethal interpersonal violence in the Middle Pleistocene.

    Directory of Open Access Journals (Sweden)

    Nohemi Sala

    Full Text Available Evidence of interpersonal violence has been documented previously in Pleistocene members of the genus Homo, but only very rarely has this been posited as the possible manner of death. Here we report the earliest evidence of lethal interpersonal violence in the hominin fossil record. Cranium 17 recovered from the Sima de los Huesos Middle Pleistocene site shows two clear perimortem depression fractures on the frontal bone, interpreted as being produced by two episodes of localized blunt force trauma. The type of injuries, their location, the strong similarity of the fractures in shape and size, and the different orientations and implied trajectories of the two fractures suggest they were produced with the same object in face-to-face interpersonal conflict. Given that either of the two traumatic events was likely lethal, the presence of multiple blows implies an intention to kill. This finding shows that the lethal interpersonal violence is an ancient human behavior and has important implications for the accumulation of bodies at the site, supporting an anthropic origin.

  10. Lethal Interpersonal Violence in the Middle Pleistocene

    Science.gov (United States)

    Sala, Nohemi; Arsuaga, Juan Luis; Pantoja-Pérez, Ana; Pablos, Adrián; Martínez, Ignacio; Quam, Rolf M.; Gómez-Olivencia, Asier; Bermúdez de Castro, José María; Carbonell, Eudald

    2015-01-01

    Evidence of interpersonal violence has been documented previously in Pleistocene members of the genus Homo, but only very rarely has this been posited as the possible manner of death. Here we report the earliest evidence of lethal interpersonal violence in the hominin fossil record. Cranium 17 recovered from the Sima de los Huesos Middle Pleistocene site shows two clear perimortem depression fractures on the frontal bone, interpreted as being produced by two episodes of localized blunt force trauma. The type of injuries, their location, the strong similarity of the fractures in shape and size, and the different orientations and implied trajectories of the two fractures suggest they were produced with the same object in face-to-face interpersonal conflict. Given that either of the two traumatic events was likely lethal, the presence of multiple blows implies an intention to kill. This finding shows that the lethal interpersonal violence is an ancient human behavior and has important implications for the accumulation of bodies at the site, supporting an anthropic origin. PMID:26018668

  11. Summer survival of Phytophthora ramorum in California bay laurel leaves

    Science.gov (United States)

    Elizabeth J. Fichtner; David M. Rizzo; Shannon C. Lynch; Jennifer Davidson; Gerri Buckles; Jennifer Parker

    2008-01-01

    Sudden oak death manifests as non-lethal foliar lesions on bay laurel (Umbellularia californica), which support sporulation and survival of Phytophthora ramorum in forest ecosystems. Infected bay laurel leaves are more likely to abscise than uninfected leaves, resulting in an accumulation of inoculum at the forest floor. The pathogen survives the dry...

  12. Protective Effects of Hong Shan Capsule against Lethal Total-Body Irradiation-Induced Damage in Wistar Rats

    Directory of Open Access Journals (Sweden)

    Jianzhong Li

    2015-08-01

    Full Text Available Hong Shan Capsule (HSC, a crude drug of 11 medicinal herbs, was used in clinical practice for the treatment of radiation injuries in China. In this study, we investigated its protection in rats against acute lethal total-body irradiation (TBI. Pre-administration of HSC reduced the radiation sickness characteristics, while increasing the 30-day survival of the irradiated rats. Administration of HSC also reduced the radiation sickness characteristics and increased the 30-day survival of mice after exposure to lethal TBI. Ultrastructural observation illustrated that the pretreatment of rats with HSC significantly attenuated the TBI-induced morphological changes in the different organs of irradiated rats. Gene expression profiles revealed the dramatic effect of HSC on alterations of gene expression caused by lethal TBI. Pretreatment with HSC prevented differential expression of 66% (1398 genes of 2126 genes differentially expressed in response to TBI. Pathway enrichment analysis indicated that these genes were mainly involved in a total of 32 pathways, such as pathways in cancer and the mitogen-activated protein kinase (MAPK signaling pathway. Our analysis indicated that the pretreatment of rats with HSC modulated these pathways induced by lethal TBI, such as multiple MAPK pathways, suggesting that pretreatment with HSC might provide protective effects on lethal TBI mainly or partially through the modulation of these pathways. Our data suggest that HSC has the potential to be used as an effective therapeutic or radio-protective agent to minimize irradiation damage.

  13. An Immature Myeloid/Myeloid-Suppressor Cell Response Associated with Necrotizing Inflammation Mediates Lethal Pulmonary Tularemia.

    Directory of Open Access Journals (Sweden)

    Sivakumar Periasamy

    2016-03-01

    Full Text Available Inhalation of Francisella tularensis (Ft causes acute and fatal pneumonia. The lung cytokine milieu favors exponential Ft replication, but the mechanisms underlying acute pathogenesis and death remain unknown. Evaluation of the sequential and systemic host immune response in pulmonary tularemia reveals that in contrast to overwhelming bacterial burden or cytokine production, an overt innate cellular response to Ft drives tissue pathology and host mortality. Lethal infection with Ft elicits medullary and extra-medullary myelopoiesis supporting recruitment of large numbers of immature myeloid cells and MDSC to the lungs. These cells fail to mature and die, leading to subsequent necrotic lung damage, loss of pulmonary function, and host death that is partially dependent upon immature Ly6G+ cells. Acceleration of this process may account for the rapid lethality seen with Ft SchuS4. In contrast, during sub-lethal infection with Ft LVS the pulmonary cellular response is characterized by a predominance of mature neutrophils and monocytes required for protection, suggesting a required threshold for lethal bacterial infection. Further, eliciting a mature phagocyte response provides transient, but dramatic, innate protection against Ft SchuS4. This study reveals that the nature of the myeloid cell response may be the primary determinant of host mortality versus survival following Francisella infection.

  14. Models for pulmonary lethality and morbidity after irradiation from internal and external sources

    Energy Technology Data Exchange (ETDEWEB)

    Scott, B.R.; Filipy, R.E.; Hahn, E.F.

    1989-05-01

    This report provides a hazard-function model for estimating the risk of death from radiation pneumonitis and/or pulmonary fibrosis following a light-water nuclear power accident. A similar model is also provided for estimating the prevalence of respiratory functional morbidity among those that survive death from acute effects. Hazard-function models for lethality and for morbidity were constructed using the cumulative hazard estimator H, which is related to the risk estimator R through the equation R = 1-exp(-H). The estimator H can be calculated using information provided in the report. The method of calculation depends on the exposure scenario. In general, the total normalized dose X for lethality or for morbidity is calculated. For lethality, X = 1 corresponds to a median lethal dose (LD/sub 50/); for morbidity, X = 1 corresponds to a median effective dose (ED/sub 50/). H is related to X by the equation H = 1n(2)X/sup V/, where V depends on the type of radiation (or radiations) involved. Contributions to X can arise from each of two main modes of exposure: (1) brief exposure of the lung, at a relatively high dose rate, to mainly external gammas, followed by (2) chronic internal alpha, and/or beta, and/or gamma irradiation of the lung. Equations are provided for calculating the contributions to X from both modes of exposure. 73 refs., 16 figs., 2 tabs.

  15. Prevalence of antibodies to Vaccinia virus after smallpox vaccination in Italy.

    Science.gov (United States)

    Pütz, Mike M; Alberini, Isabella; Midgley, Claire M; Manini, Ilaria; Montomoli, Emanuele; Smith, Geoffrey L

    2005-11-01

    Decades after smallpox was eradicated and vaccination discontinued, the level of residual immunity in today's population is largely unknown. This study describes an epidemiological assessment in Italians of antibodies against the intracellular mature virus (IMV) and extracellular envelope virus (EEV) forms of Vaccinia virus. Serum samples (n = 642) were taken in 1993 and 2003 from people between 11 and 102 years old. Most citizens >27 years old were positive for antibodies to IMV and EEV. These antibodies were long-lasting and similar titres were present in citizens between 30 and 100 years old. Serum samples from 1993 and 2003 displayed very similar EEV- and IMV-specific antibody titres. By using these data and demographic considerations, it was predicted that, in 2003, 46 % of the Italian population were positive for both IMV and EEV, 42 % were negative for both and 12 % were positive for one antigen.

  16. Successful pseudorabies vaccination in maternally immune piglets using recombinant vaccinia virus vaccines.

    Science.gov (United States)

    Brockmeier, S I; Lager, K M; Mengeling, W L

    1997-01-01

    Three gilts were vaccinated with a NYVAC vaccinia recombinant expressing glycoprotein gD of pseudorabies virus (PRV) (NYVAC/gD). After farrowing, the piglets were allowed to nurse normally to obtain colostral immunity and then were divided into four groups, receiving NYVAC/gD, a NYVAC recombinant expressing glycoprotein gB of PRV (NYVAC/gB), an inactivated PRV vaccine (iPRV), or no vaccine. The piglets were vaccinated twice, three weeks apart beginning at approximately two weeks of age and later challenged with virulent PRV oronasally. Piglets that received NYVAC/gB or iPRV were the best protected based on lack of mortality, lower temperature responses, decreased weight loss and decreased viral shedding after challenge. These results indicate effective strategies for stimulating active immune response while still under the protection of maternal immunity.

  17. Myxoma and vaccinia virus exploit different mechanisms to enter and infect human cancer cells

    Science.gov (United States)

    Villa, Nancy Y.; Bartee, Eric; Mohamed, Mohamed R.; Rahman, Masmudur M.; Barrett, John W.; McFadden, Grant

    2010-01-01

    Myxoma (MYXV) and vaccinia virus (VACV) have recently emerged as potential oncolytic agents that can infect and kill different human cancer cells. Although both are structurally similar, it is unknown whether the pathway(s) used by these poxviruses to enter and cause oncolysis in cancer cells are mechanistically similar. Here, we compared the entry of MYXV and VACV-WR into various human cancer cells and observed significant differences: 1- Low pH treatment accelerates fusion-mediated entry of VACV but not MYXV, 2- The tyrosine kinase inhibitor genistein inhibits entry of VACV, but not MYXV, 3- Knockdown of PAK1 revealed that it is required for a late stage downstream of MYXV entry into cancer cells, whereas PAK1 is required for VACV entry into the same target cells. These results suggest that VACV and MYXV exploit different mechanisms to enter into human cancer cells, thus providing some rationale for their divergent cancer cell tropisms. PMID:20334889

  18. RNAi Screening Reveals Proteasome- and Cullin3-Dependent Stages in Vaccinia Virus Infection

    Directory of Open Access Journals (Sweden)

    Jason Mercer

    2012-10-01

    Full Text Available A two-step, automated, high-throughput RNAi silencing screen was used to identify host cell factors required during vaccinia virus infection. Validation and analysis of clustered hits revealed previously unknown processes during virus entry, including a mechanism for genome uncoating. Viral core proteins were found to be already ubiquitinated during virus assembly. After entering the cytosol of an uninfected cell, the viral DNA was released from the core through the activity of the cell’s proteasomes. Next, a Cullin3-based ubiquitin ligase mediated a further round of ubiquitination and proteasome action. This was needed in order to initiate viral DNA replication. The results accentuate the value of large-scale RNAi screens in providing directions for detailed cell biological investigation of complex pathways. The list of cell functions required during poxvirus infection will, moreover, provide a resource for future virus-host cell interaction studies and for the discovery of antivirals.

  19. Vaccinia virus G8R protein: a structural ortholog of proliferating cell nuclear antigen (PCNA.

    Directory of Open Access Journals (Sweden)

    Melissa Da Silva

    Full Text Available BACKGROUND: Eukaryotic DNA replication involves the synthesis of both a DNA leading and lagging strand, the latter requiring several additional proteins including flap endonuclease (FEN-1 and proliferating cell nuclear antigen (PCNA in order to remove RNA primers used in the synthesis of Okazaki fragments. Poxviruses are complex viruses (dsDNA genomes that infect eukaryotes, but surprisingly little is known about the process of DNA replication. Given our previous results that the vaccinia virus (VACV G5R protein may be structurally similar to a FEN-1-like protein and a recent finding that poxviruses encode a primase function, we undertook a series of in silico analyses to identify whether VACV also encodes a PCNA-like protein. RESULTS: An InterProScan of all VACV proteins using the JIPS software package was used to identify any PCNA-like proteins. The VACV G8R protein was identified as the only vaccinia protein that contained a PCNA-like sliding clamp motif. The VACV G8R protein plays a role in poxvirus late transcription and is known to interact with several other poxvirus proteins including itself. The secondary and tertiary structure of the VACV G8R protein was predicted and compared to the secondary and tertiary structure of both human and yeast PCNA proteins, and a high degree of similarity between all three proteins was noted. CONCLUSIONS: The structure of the VACV G8R protein is predicted to closely resemble the eukaryotic PCNA protein; it possesses several other features including a conserved ubiquitylation and SUMOylation site that suggest that, like its counterpart in T4 bacteriophage (gp45, it may function as a sliding clamp ushering transcription factors to RNA polymerase during late transcription.

  20. Vaccinia virus Transmission through Experimentally Contaminated Milk Using a Murine Model.

    Directory of Open Access Journals (Sweden)

    Izabelle Silva Rehfeld

    Full Text Available Bovine vaccinia (BV is a zoonosis caused by Vaccinia virus (VACV, which affects dairy cattle and humans. Previous studies have detected the presence of viable virus particles in bovine milk samples naturally and experimentally contaminated with VACV. However, it is not known whether milk contaminated with VACV could be a route of viral transmission. However, anti-Orthopoxvirus antibodies were detected in humans from BV endemic areas, whom had no contact with affected cows, which suggest that other VACV transmission routes are possible, such as consumption of contaminated milk and dairy products. Therefore, it is important to study the possibility of VACV transmission by contaminated milk. This study aimed to examine VACV transmission, pathogenesis and shedding in mice orally inoculated with experimentally contaminated milk. Thirty mice were orally inoculated with milk containing 107 PFU/ml of VACV, and ten mice were orally inoculated with uncontaminated milk. Clinical examinations were performed for 30 consecutive days, and fecal samples and oral swabs (OSs were collected every other day. Mice were euthanized on predetermined days, and tissue and blood samples were collected. Nested-PCR, plaque reduction neutralization test (PRNT, viral isolation, histopathology, and immunohistochemistry (IHC methods were performed on the collected samples. No clinical changes were observed in the animals. Viral DNA was detected in feces, blood, OSs and tissues, at least in one of the times tested. The lungs displayed moderate to severe interstitial lymphohistiocytic infiltrates, and only the heart, tonsils, tongue, and stomach did not show immunostaining at the IHC analysis. Neutralizing antibodies were detected at the 20th and 30th days post infection in 50% of infected mice. The results revealed that VACV contaminated milk could be a route of viral transmission in mice experimentally infected, showing systemic distribution and shedding through feces and oral

  1. Crystal Structure of the Vaccinia Virus Uracil-DNA Glycosylase in Complex with DNA*

    Science.gov (United States)

    Burmeister, Wim P.; Tarbouriech, Nicolas; Fender, Pascal; Contesto-Richefeu, Céline; Peyrefitte, Christophe N.; Iseni, Frédéric

    2015-01-01

    Vaccinia virus polymerase holoenzyme is composed of the DNA polymerase catalytic subunit E9 associated with its heterodimeric co-factor A20·D4 required for processive genome synthesis. Although A20 has no known enzymatic activity, D4 is an active uracil-DNA glycosylase (UNG). The presence of a repair enzyme as a component of the viral replication machinery suggests that, for poxviruses, DNA synthesis and base excision repair is coupled. We present the 2.7 Å crystal structure of the complex formed by D4 and the first 50 amino acids of A20 (D4·A201–50) bound to a 10-mer DNA duplex containing an abasic site resulting from the cleavage of a uracil base. Comparison of the viral complex with its human counterpart revealed major divergences in the contacts between protein and DNA and in the enzyme orientation on the DNA. However, the conformation of the dsDNA within both structures is very similar, suggesting a dominant role of the DNA conformation for UNG function. In contrast to human UNG, D4 appears rigid, and we do not observe a conformational change upon DNA binding. We also studied the interaction of D4·A201–50 with different DNA oligomers by surface plasmon resonance. D4 binds weakly to nonspecific DNA and to uracil-containing substrates but binds abasic sites with a Kd of DNA complex structure of a family I UNG gives new insight into the role of D4 as a co-factor of vaccinia virus DNA polymerase and allows a better understanding of the structural determinants required for UNG action. PMID:26045555

  2. Crystal Structure of the Vaccinia Virus Uracil-DNA Glycosylase in Complex with DNA.

    Science.gov (United States)

    Burmeister, Wim P; Tarbouriech, Nicolas; Fender, Pascal; Contesto-Richefeu, Céline; Peyrefitte, Christophe N; Iseni, Frédéric

    2015-07-17

    Vaccinia virus polymerase holoenzyme is composed of the DNA polymerase catalytic subunit E9 associated with its heterodimeric co-factor A20·D4 required for processive genome synthesis. Although A20 has no known enzymatic activity, D4 is an active uracil-DNA glycosylase (UNG). The presence of a repair enzyme as a component of the viral replication machinery suggests that, for poxviruses, DNA synthesis and base excision repair is coupled. We present the 2.7 Å crystal structure of the complex formed by D4 and the first 50 amino acids of A20 (D4·A201-50) bound to a 10-mer DNA duplex containing an abasic site resulting from the cleavage of a uracil base. Comparison of the viral complex with its human counterpart revealed major divergences in the contacts between protein and DNA and in the enzyme orientation on the DNA. However, the conformation of the dsDNA within both structures is very similar, suggesting a dominant role of the DNA conformation for UNG function. In contrast to human UNG, D4 appears rigid, and we do not observe a conformational change upon DNA binding. We also studied the interaction of D4·A201-50 with different DNA oligomers by surface plasmon resonance. D4 binds weakly to nonspecific DNA and to uracil-containing substrates but binds abasic sites with a Kd of DNA complex structure of a family I UNG gives new insight into the role of D4 as a co-factor of vaccinia virus DNA polymerase and allows a better understanding of the structural determinants required for UNG action. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Modulation of the myxoma virus plaque phenotype by vaccinia virus protein F11.

    Science.gov (United States)

    Irwin, Chad R; Evans, David H

    2012-07-01

    Vaccinia virus (VACV) produces large plaques consisting of a rapidly expanding ring of infected cells surrounding a lytic core, whereas myxoma virus (MYXV) produces small plaques that resemble a focus of transformed cells. This is odd, because bioinformatics suggests that MYXV carries homologs of nearly all of the genes regulating Orthopoxvirus attachment, entry, and exit. So why does MYXV produce foci? One notable difference is that MYXV-infected cells produce few of the actin microfilaments that promote VACV exit and spread. This suggested that although MYXV carries homologs of the required genes (A33R, A34R, A36R, and B5R), they are dysfunctional. To test this, we produced MYXV recombinants expressing these genes, but we could not enhance actin projectile formation even in cells expressing all four VACV proteins. Another notable difference between these viruses is that MYXV lacks a homolog of the F11L gene. F11 inhibits the RhoA-mDia signaling that maintains the integrity of the cortical actin layer. We constructed an MYXV strain encoding F11L and observed that, unlike wild-type MYXV, the recombinant virus disrupted actin stress fibers and produced plaques up to 4-fold larger than those of controls, and these plaques expanded ∼6-fold faster. These viruses also grew to higher titers in multistep growth conditions, produced higher levels of actin projectiles, and promoted infected cell movement, although neither process was to the extent of that observed in VACV-infected cells. Thus, one reason for why MYXV produces small plaques is that it cannot spread via actin filaments, although the reason for this deficiency remains obscure. A second reason is that leporipoxviruses lack vaccinia's capacity to disrupt cortical actin.

  4. Modulation of gene expression in a human cell line caused by poliovirus, vaccinia virus and interferon

    Directory of Open Access Journals (Sweden)

    Hoddevik Gunnar

    2007-03-01

    Full Text Available Abstract Background The project was initiated to describe the response of a human embryonic fibroblast cell line to the replication of two different viruses, and, more specifically, to look for candidate genes involved in viral defense. For this purpose, the cells were synchronously infected with poliovirus in the absence or presence of interferon-alpha, or with vaccinia virus, a virus that is not inhibited by interferon. By comparing the changes in transcriptosome due to these different challenges, it should be possible to suggest genes that might be involved in defense. Results The viral titers were sufficient to yield productive infection in a majority of the cells. The cells were harvested in triplicate at various time-points, and the transcriptosome compared with mock infected cells using oligo-based, global 35 k microarrays. While there was very limited similarities in the response to the different viruses, a large proportion of the genes up-regulated by interferon-alpha were also up-regulated by poliovirus. Interferon-alpha inhibited poliovirus replication, but there were no signs of any interferons being induced by poliovirus. The observations suggest that the cells do launch an antiviral response to poliovirus in the absence of interferon. Analyses of the data led to a list of candidate antiviral genes. Functional information was limited, or absent, for most of the candidate genes. Conclusion The data are relevant for our understanding of how the cells respond to poliovirus and vaccinia virus infection. More annotations, and more microarray studies with related viruses, are required in order to narrow the list of putative defence-related genes.

  5. Overproduced ethylene causes programmed cell death leading to temperature-sensitive lethality in hybrid seedlings from the cross Nicotiana suaveolens x N. tabacum.

    Science.gov (United States)

    Yamada, Tetsuya; Marubashi, Wataru

    2003-09-01

    Reproductive isolation mechanisms (RIMs) often become obstacles in crossbreeding. Hybrid lethality is a subtype of RIM but its physiological mechanism remains poorly elucidated. Interspecific hybrids of Nicotiana suaveolens Lehm. x N. tabacum L. cv. Hicks-2 expressed temperature-sensitive lethality. This lethality was induced by programmed cell death (PCD) that was accompanied by the characteristic changes of animal apoptosis in hybrid seedlings at 28 degrees C but not at 36 degrees C. When hybrid seedlings were cultured at 28 degrees C, DNA fragmentation started in the cotyledon, and nuclear fragmentation subsequently progressed with lethal symptoms spreading throughout the seedlings. At 28 degrees C, ethylene production in hybrid seedlings was detectable at a high level compared with the level in parental seedlings. In contrast, the ethylene production rate in hybrid seedlings cultured at 36 degrees C was equal to that in parental seedlings. Treatment with ethylene biosynthetic inhibitors, amino-oxyacetic acid and amino-ethoxyvinyl glycine, suppressed lethal symptoms and apoptotic changes, and also prolonged survival of hybrid seedlings. Thus, the increase in the ethylene production rate correlated closely with expression of lethal symptoms and apoptotic changes in hybrid seedlings. From these observations, we conclude that overproduced ethylene acts as an essential factor mediating PCD and subsequent lethality in hybrid seedlings. Furthermore, the present study has provided the first evidence that ethylene is involved in the phenomenon of hybrid lethality.

  6. Facile induction of apoptosis into plant cells associated with temperature-sensitive lethality shown on interspecific hybrid from the cross Nicotiana suaveolens x N. tabacum.

    Science.gov (United States)

    Yamada, T; Marubashi, W; Niwa, M

    2001-02-01

    Two lines of suspension culture cells were obtained from a hybrid seedling of Nicotiana suaveolens Lehm. x N. tabacum L. cv. Hicks-2 expressing temperature-sensitive lethality. One of them (LH line) was inducible cell death in accordance with the lethality at 28 degrees C but not under high-temperature conditions (36 degrees C). Another one (SH line) lost the lethality and survived at 28 degrees C. The cells of LH line showed apoptotic changes when they were cultured at 28 degrees C. Fragmentation of nuclei was correlated with the lethality in the cells, as confirmed by fluorimetry of the nuclear DNA using laser scanning cytometry. Agarose gel analysis of DNA extracted from the cells expressing the lethality revealed a specific ladder pattern suggesting nucleosomal fragmentation that is one of the biochemical characteristics of apoptosis. From these facts, we confirmed that the process of cell death leading to hybrid lethality in the cells is certainly apoptosis. Hybrid cells were used in the experiments to estimate the point of no return in temperature-sensitive lethality and to examine the influence of cation in DNA fragmentation during apoptosis. The utility of hybrid cells as an experimental system for studies of hybrid lethality and apoptosis in plants was confirmed.

  7. Cancer-Specific Synthetic Lethality between ATR and CHK1 Kinase Activities

    Directory of Open Access Journals (Sweden)

    Kumar Sanjiv

    2016-01-01

    Full Text Available ATR and CHK1 maintain cancer cell survival under replication stress and inhibitors of both kinases are currently undergoing clinical trials. As ATR activity is increased after CHK1 inhibition, we hypothesized that this may indicate an increased reliance on ATR for survival. Indeed, we observe that replication stress induced by the CHK1 inhibitor AZD7762 results in replication catastrophe and apoptosis, when combined with the ATR inhibitor VE-821 specifically in cancer cells. Combined treatment with ATR and CHK1 inhibitors leads to replication fork arrest, ssDNA accumulation, replication collapse, and synergistic cell death in cancer cells in vitro and in vivo. Inhibition of CDK reversed replication stress and synthetic lethality, demonstrating that regulation of origin firing by ATR and CHK1 explains the synthetic lethality. In conclusion, this study exemplifies cancer-specific synthetic lethality between two proteins in the same pathway and raises the prospect of combining ATR and CHK1 inhibitors as promising cancer therapy.

  8. Carbon dioxide as an under-ice lethal control for invasive fishes

    Science.gov (United States)

    Cupp, Aaron R.; Woiak, Zebadiah; Erickson, Richard A.; Amberg, Jon; Gaikowski, Mark

    2017-01-01

    Resource managers need effective tools to control invasive fish populations. In this study, we tested under-ice carbon dioxide (CO2) injection as a novel piscicide method for non-native Silver Carp (Hypophthalmichthys molitrix), Bighead Carp (Hypophthalmichthys nobilis), Grass Carp (Ctenopharyngodon idella), Common Carp (Cyprinus carpio) and native Bigmouth Buffalo (Ictiobus cyprinellus). Fish were held overwinter in nine outdoor ponds (0.04 ha surface area; 340,000 L volume) treated with no CO2 (control), 43.5–44.0 kg CO2 (low treatment), and 87.5–88.5 kg CO2 (high treatment). Ponds were harvested immediately after ice-out to assess survival and condition. Resulting survival in low (mean = 32%) and high (mean = 5%) CO2-treated ponds was significantly lower than untreated control ponds (mean = 84%). Lethal efficacy varied across species with no Bighead Carp, Silver Carp, or Bigmouth Buffalo surviving the high CO2 treatment. External infections were observed more frequently after CO2 treatments (means = 49–67%) relative to untreated ponds (mean = 2%), suggesting a secondary mechanism for poor survival. This study demonstrates that CO2 can be used as a lethal control for invasive fishes, but effectiveness may vary by species and CO2concentration.

  9. Issues surrounding lethal injection as a means of capital punishment.

    Science.gov (United States)

    Romanelli, Frank; Whisman, Tyler; Fink, Joseph L

    2008-12-01

    Lethal injection as a method of state-sanctioned capital punishment was initially proposed in the United States in 1977 and used for the first time in 1982. Most lethal injection protocols use a sequential drug combination of sodium thiopental, pancuronium bromide, and potassium chloride. Lethal injection was originally introduced as a more humane form of execution compared with existing mechanical methods such as electrocution, toxic gassing, hanging, or firing squad. Lethal injection has not, however, been without controversy. Several states are considering whether lethal injection meets constitutional scrutiny forbidding cruel and unusual punishment. Recently in the case of Ralph Baze and Thomas C. Bowling, Petitioners, v John D. Rees, Commissioner, Kentucky Department of Corrections et al, the United States Supreme Court upheld the constitutionality of the lethal injection protocol as carried out in the Commonwealth of Kentucky. Most of the debate has surrounded the dosing and procedures used in lethal injection and whether the drug combinations and measures for administering the drugs truly produce a timely, pain-free, and fail-safe death. Many have also raised issues regarding the "medicalization" of execution and the ethics of health care professionals' participation in any part of the lethal injection process. As a result of all these issues, the future of lethal injection as a means of execution in the United States is under significant scrutiny. Outcomes of ongoing legislative and judicial reviews might result in cessation of lethal injection in totality or in alterations involving specific drug combinations or administration procedures.

  10. Evaluating anti-Orthopoxvirus antibodies in individuals from Brazilian rural areas prior to the bovine vaccinia era.

    Science.gov (United States)

    Figueiredo, Poliana de Oliveira; Silva-Fernandes, André Tavares da; Mota, Bruno Eduardo Fernandes; Costa, Galileu Barbosa; Borges, Iara Apolinário; Ferreira, Paulo César Peregrino; Abrahão, Jônatas Santos; Braga, Erika Martins; Kroon, Erna Geessien; Trindade, Giliane de Souza

    2015-09-01

    Vaccinia virus naturally circulates in Brazil and is the causative agent of a zoonotic disease known as bovine vaccinia (BV). We retrospectively evaluated two populations from the Amazon and Southeast Regions. BV outbreaks had not been reported in these regions before sample collection. Neutralising antibodies were found in 13 individuals (n = 132) with titres ranging from 100 ≥ 6,400 neutralising units/mL. Univariate analysis identified age and vaccination as statistically significant risk factors in individuals from the Southeast Region. The absence of detectable antibodies in vaccinated individuals raises questions about the protection of smallpox vaccine years after vaccination and reinforces the need for surveillance of Orthopoxvirus in Brazilian populations without evidence of previous outbreaks.

  11. Evaluating anti-Orthopoxvirus antibodies in individuals from Brazilian rural areas prior to the bovine vaccinia era

    Directory of Open Access Journals (Sweden)

    Poliana de Oliveira Figueiredo

    2015-09-01

    Full Text Available Vaccinia virus naturally circulates in Brazil and is the causative agent of a zoonotic disease known as bovine vaccinia (BV. We retrospectively evaluated two populations from the Amazon and Southeast Regions. BV outbreaks had not been reported in these regions before sample collection. Neutralising antibodies were found in 13 individuals (n = 132 with titres ranging from 100 ≥ 6,400 neutralising units/mL. Univariate analysis identified age and vaccination as statistically significant risk factors in individuals from the Southeast Region. The absence of detectable antibodies in vaccinated individuals raises questions about the protection of smallpox vaccine years after vaccination and reinforces the need for surveillance of Orthopoxvirus in Brazilian populations without evidence of previous outbreaks.

  12. Vaccinia virus-mediated melanin production allows MR and optoacoustic deep tissue imaging and laser-induced thermotherapy of cancer.

    Science.gov (United States)

    Stritzker, Jochen; Kirscher, Lorenz; Scadeng, Miriam; Deliolanis, Nikolaos C; Morscher, Stefan; Symvoulidis, Panagiotis; Schaefer, Karin; Zhang, Qian; Buckel, Lisa; Hess, Michael; Donat, Ulrike; Bradley, William G; Ntziachristos, Vasilis; Szalay, Aladar A

    2013-02-26

    We reported earlier the delivery of antiangiogenic single chain antibodies by using oncolytic vaccinia virus strains to enhance their therapeutic efficacy. Here, we provide evidence that gene-evoked production of melanin can be used as a therapeutic and diagnostic mediator, as exemplified by insertion of only one or two genes into the genome of an oncolytic vaccinia virus strain. We found that produced melanin is an excellent reporter for optical imaging without addition of substrate. Melanin production also facilitated deep tissue optoacoustic imaging as well as MRI. In addition, melanin was shown to be a suitable target for laser-induced thermotherapy and enhanced oncolytic viral therapy. In conclusion, melanin as a mediator for thermotherapy and reporter for different imaging modalities may soon become a versatile alternative to replace fluorescent proteins also in other biological systems. After ongoing extensive preclinical studies, melanin overproducing oncolytic virus strains might be used in clinical trials in patients with cancer.

  13. Significant Growth Inhibition of Canine Mammary Carcinoma Xenografts following Treatment with Oncolytic Vaccinia Virus GLV-1h68

    Science.gov (United States)

    Gentschev, Ivaylo; Ehrig, Klaas; Donat, Ulrike; Hess, Michael; Rudolph, Stephan; Chen, Nanhai; Yu, Yong A.; Zhang, Qian; Bullerdiek, Jörn; Nolte, Ingo; Stritzker, Jochen; Szalay, Aladar A.

    2010-01-01

    Canine mammary carcinoma is a highly metastatic tumor that is poorly responsive to available treatment. Therefore, there is an urgent need to identify novel agents for therapy of this disease. Recently, we reported that the oncolytic vaccinia virus GLV-1h68 could be a useful tool for therapy of canine mammary adenoma in vivo. In this study we analyzed the therapeutic effect of GLV-1h68 against canine mammary carcinoma. Cell culture data demonstrated that GLV-1h68 efficiently infected and destroyed cells of the mammary carcinoma cell line MTH52c. Furthermore, after systemic administration, this attenuated vaccinia virus strain primarily replicated in canine tumor xenografts in nude mice. Finally, infection with GLV-1h68 led to strong inflammatory and oncolytic effects resulting in significant growth inhibition of the tumors. In summary, the data showed that the GLV-1h68 virus strain has promising potential for effective treatment of canine mammary carcinoma. PMID:20631910

  14. Potential lethal and non-lethal effects of predators on dispersal of spider mites.

    Science.gov (United States)

    Otsuki, Hatsune; Yano, Shuichi

    2014-11-01

    Predators can affect prey dispersal lethally by direct consumption or non-lethally by making prey hesitate to disperse. These lethal and non-lethal effects are detectable only in systems where prey can disperse between multiple patches. However, most studies have drawn their conclusions concerning the ability of predatory mites to suppress spider mites based on observations of their interactions on a single patch or on heavily infested host plants where spider mites could hardly disperse toward intact patches. In these systems, specialist predatory mites that penetrate protective webs produced by spider mites quickly suppress the spider mites, whereas generalist predators that cannot penetrate the webs were ineffective. By using a connected patch system, we revealed that a generalist ant, Pristomyrmex punctatus Mayr (Hymenoptera: Formicidae), effectively prevented dispersal of spider mites, Tetranychus kanzawai Kishida (Acari: Tetranychidae), by directly consuming dispersing individuals. We also revealed that a generalist predatory mite, Euseius sojaensis Ehara (Acari: Phytoseiidae), prevented between-patch dispersal of T. kanzawai by making them hesitate to disperse. In contrast, a specialist phytoseiid predatory mite, Neoseiulus womersleyi Schicha, allowed spider mites to escape an initial patch, increasing the number of colonized patches within the system. Our results suggest that ants and generalist predatory mites can effectively suppress Tetranychus species under some conditions, and should receive more attention as agents for conservation biological control in agroecosystems.

  15. Oral immunization and protection of raccoons (Procyon lotor) with a vaccinia-rabies glycoprotein recombinant virus vaccine.

    OpenAIRE

    Rupprecht, C. E.; Wiktor, T. J.; Johnston, D H; Hamir, A. N.; Dietzschold, B; Wunner, W. H.; Glickman, L T; Koprowski, H

    1986-01-01

    Animal rabies control has been frustrated by the existence of multiple wildlife reservoirs and the lack of efficacious oral vaccines. In this investigation, raccoons fed a vaccinia-rabies glycoprotein recombinant virus in a sponge bait developed rabies virus-neutralizing antibody (0.6-54.0 units) and resisted street rabies virus infection 28 and 205 days after feeding. Additional raccoons immunized by oral infusion with attenuated antigenic variants of rabies virus strains CVS-11 and ERA fail...

  16. Prospective surveillance for cardiac adverse events in healthy adults receiving modified vaccinia Ankara vaccines: a systematic review.

    Directory of Open Access Journals (Sweden)

    Marnie L Elizaga

    Full Text Available Vaccinia-associated myo/pericarditis was observed during the US smallpox vaccination (DryVax campaign initiated in 2002. A highly-attenuated vaccinia strain, modified vaccinia Ankara (MVA has been evaluated in clinical trials as a safer alternative to DryVax and as a vector for recombinant vaccines. Due to the lack of prospectively collected cardiac safety data, the US Food and Drug Administration required cardiac screening and surveillance in all clinical trials of MVA since 2004. Here, we report cardiac safety surveillance from 6 phase I trials of MVA vaccines.Four clinical research organizations contributed cardiac safety data using common surveillance methods in trials administering MVA or recombinant MVA vaccines to healthy participants. 'Routine cardiac investigations' (ECGs and cardiac enzymes obtained 2 weeks after injections of MVA or MVA-HIV recombinants, or placebo-controls, and 'Symptom-driven cardiac investigations' are reported. The outcome measure is the number of participants who met the CDC-case definition for vaccinia-related myo/pericarditis or who experienced cardiac adverse events from an MVA vaccine.Four hundred twenty-five study participants had post-vaccination safety data analyzed, 382 received at least one MVA-containing vaccine and 43 received placebo; 717 routine ECGs and 930 cardiac troponin assays were performed. Forty-five MVA recipients (12% had additional cardiac testing performed; 22 for cardiac symptoms, 19 for ECG/laboratory changes, and 4 for cardiac symptoms with an ECG/laboratory change. No participant had evidence of symptomatic or asymptomatic myo/pericarditis meeting the CDC-case definition and judged to be related to an MVA vaccine.Prospective surveillance of MVA recipients for myo/pericarditis did not detect cardiac adverse reactions in 382 study participants.ClinicalTrials.gov NCT00082446 NCT003766090 NCT00252148 NCT00083603 NCT00301184 NCT00428337.

  17. Prospective surveillance for cardiac adverse events in healthy adults receiving modified vaccinia Ankara vaccines: a systematic review.

    Science.gov (United States)

    Elizaga, Marnie L; Vasan, Sandhya; Marovich, Mary A; Sato, Alicia H; Lawrence, Dale N; Chaitman, Bernard R; Frey, Sharon E; Keefer, Michael C

    2013-01-01

    Vaccinia-associated myo/pericarditis was observed during the US smallpox vaccination (DryVax) campaign initiated in 2002. A highly-attenuated vaccinia strain, modified vaccinia Ankara (MVA) has been evaluated in clinical trials as a safer alternative to DryVax and as a vector for recombinant vaccines. Due to the lack of prospectively collected cardiac safety data, the US Food and Drug Administration required cardiac screening and surveillance in all clinical trials of MVA since 2004. Here, we report cardiac safety surveillance from 6 phase I trials of MVA vaccines. Four clinical research organizations contributed cardiac safety data using common surveillance methods in trials administering MVA or recombinant MVA vaccines to healthy participants. 'Routine cardiac investigations' (ECGs and cardiac enzymes obtained 2 weeks after injections of MVA or MVA-HIV recombinants, or placebo-controls), and 'Symptom-driven cardiac investigations' are reported. The outcome measure is the number of participants who met the CDC-case definition for vaccinia-related myo/pericarditis or who experienced cardiac adverse events from an MVA vaccine. Four hundred twenty-five study participants had post-vaccination safety data analyzed, 382 received at least one MVA-containing vaccine and 43 received placebo; 717 routine ECGs and 930 cardiac troponin assays were performed. Forty-five MVA recipients (12%) had additional cardiac testing performed; 22 for cardiac symptoms, 19 for ECG/laboratory changes, and 4 for cardiac symptoms with an ECG/laboratory change. No participant had evidence of symptomatic or asymptomatic myo/pericarditis meeting the CDC-case definition and judged to be related to an MVA vaccine. Prospective surveillance of MVA recipients for myo/pericarditis did not detect cardiac adverse reactions in 382 study participants. ClinicalTrials.gov NCT00082446 NCT003766090 NCT00252148 NCT00083603 NCT00301184 NCT00428337.

  18. [Modified vaccinia virus ankara (MVA)--development as recombinant vaccine and prospects for use in veterinary medicine].

    Science.gov (United States)

    Volz, Asisa; Fux, Robert; Langenmayer, Martin C; Sutter, Gerd

    2015-01-01

    Poxviruses as expression vectors are widely used in medical research for the development of recombinant vaccines and molecular therapies. Here we review recent accomplishments in vaccine research using recombinant modified vaccinia virus ankara (MVA). MVA is a highly attenuated vaccinia virus strain that originated from serial tissue culture passage in chicken embryo fibroblasts more than 40 years ago. Growth adaptation to avian host cells caused deletions and mutations in the viral genome affecting about 15% of the original genetic information. In consequence, MVA is replication-deficient in cells of mammalian origin and fails to produce many of the virulence factors encoded by conventional vaccinia virus. Because of its safety for the general environment MVA can be handled under conditions of biosafety level one. Non-replicating MVA can enter any target cell and activate its molecular life cycle to express all classes of viral and recombinant genes. Therefore, recombinant MVA have been established as an extremely safe and efficient vector system for vaccine development in medical research. By now, various recombinant MVA vaccines have been found safe and immunogenic when used for phase I/II clinical testing in humans, and suitable for industrial scale production following good practice of manufacturing. Thus, there is an obvious usefulness of recombinant MVA vaccines for novel prophylactic and therapeutic approaches also in veterinary medicine. Results from first studies in companion and farm animals are highly promising.

  19. Biosafety aspects of modified vaccinia virus Ankara (MVA)-based vectors used for gene therapy or vaccination.

    Science.gov (United States)

    Verheust, Céline; Goossens, Martine; Pauwels, Katia; Breyer, Didier

    2012-03-30

    The modified vaccinia virus Ankara (MVA) strain is a highly attenuated strain of vaccinia virus that has been demonstrated to be safe for humans. MVA is widely considered as the vaccinia virus strain of choice for clinical investigation because of its high safety profile. It also represents an excellent candidate for use as vector system in recombinant vaccine development for gene delivery or vaccination against infectious diseases or tumours, even in immunocompromised individuals. The use of MVA and recombinant MVA vectors must comply with various regulatory requirements, particularly relating to the assessment of potential risks for human health and the environment. The purpose of the present paper is to highlight some biological characteristics of MVA and MVA-based recombinant vectors and to discuss these from a biosafety point of view in the context of the European regulatory framework for genetically modified organisms with emphasis on the assessment of potential risks associated with environmental release. Copyright © 2012 Elsevier Ltd. All rights reserved.

  20. The effects of chronic mercury exposure on the survival, reproduction, and population dynamics of Mysidopsis bahia

    National Research Council Canada - National Science Library

    Gentile, J.H; Gentile, S

    1981-01-01

    The purpose of this study is to demonstrate that M. bahia can be used as a model for evaluating the effects of chronic pollutant exposure on survival patterns, sub-lethal reprodutive responses and populatioon growth rates...

  1. Survival and chlamydospore production of Phytophthora ramorum in California bay laurel leaves

    Science.gov (United States)

    E. Fichtner; D. Rizzo; S. Lynch; D. Rizzo; G. Buckles; J. Parke

    2009-01-01

    Sudden oak death manifests as non-lethal foliar lesions on bay laurel (Umbellularia californica), which support sporulation and survival of Phytophthora ramorum in forest ecosystems. The pathogen survives the dry summers in a proportion of attached bay leaves, but the propagules responsible for survival are...

  2. Repression of Stress-Induced LINE-1 Expression Protects Cancer Cell Subpopulations from Lethal Drug Exposure.

    Science.gov (United States)

    Guler, Gulfem Dilek; Tindell, Charles Albert; Pitti, Robert; Wilson, Catherine; Nichols, Katrina; KaiWai Cheung, Tommy; Kim, Hyo-Jin; Wongchenko, Matthew; Yan, Yibing; Haley, Benjamin; Cuellar, Trinna; Webster, Joshua; Alag, Navneet; Hegde, Ganapati; Jackson, Erica; Nance, Tracy Leah; Giresi, Paul Garrett; Chen, Kuan-Bei; Liu, Jinfeng; Jhunjhunwala, Suchit; Settleman, Jeff; Stephan, Jean-Philippe; Arnott, David; Classon, Marie

    2017-08-14

    Maintenance of phenotypic heterogeneity within cell populations is an evolutionarily conserved mechanism that underlies population survival upon stressful exposures. We show that the genomes of a cancer cell subpopulation that survives treatment with otherwise lethal drugs, the drug-tolerant persisters (DTPs), exhibit a repressed chromatin state characterized by increased methylation of histone H3 lysines 9 and 27 (H3K9 and H3K27). We also show that survival of DTPs is, in part, maintained by regulators of H3K9me3-mediated heterochromatin formation and that the observed increase in H3K9me3 in DTPs is most prominent over long interspersed repeat element 1 (LINE-1). Disruption of the repressive chromatin over LINE-1 elements in DTPs results in DTP ablation, which is partially rescued by reducing LINE-1 expression or function. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Bipyridine (2,2′-dipyridyl) potentiates Escherichia coli lethality induced by nitrogen mustard mechlorethamine

    Energy Technology Data Exchange (ETDEWEB)

    De Alencar, T.A.M.; Wilmart-Gonçalves, T.C.; Vidal, L.S.; Fortunato, R.S.; Leitão, A.C. [Laboratório de Radiobiologia Molecular (Brazil); Lage, C., E-mail: claudia_lage_dna@yahoo.com.br [Laboratório de Radiações em Biologia (Brazil)

    2014-07-15

    Highlights: • Reduction of Fe{sup 2+} ensues a respiratory burst to reduce the oxidized iron pool. • Through Harber–Weiss recycling, superoxide electrons can reduce oxidized iron. • Redox imbalance sensitized repair proficient Escherichia coli to mustard lethal crosslinks. • A stronger synergism impacted survival of a superoxide dismutase-deficient strain. • Anti-cancer cocktails added of an iron chelator may impact hypoxia and genotoxicity. - Abstract: Alkylating agents are used in anti-tumor chemotherapy because they bind covalently to DNA and generate adducts that may lead to cell death. Bifunctional (HN2) and monofunctional (HN1) nitrogen are two such agents, and HN2 was the first drug successfully employed in anti-leukemia chemotherapy. Currently, HN2 is used either alone or combined with other drugs to treat Hodgkin's disease. It is well known that several crosslinking agents require metabolic activation via reactive oxygen species (ROS) to exert their lethal effects. The objective of this work was therefore to determine whether the abovementioned mustards would also require metabolic activation to exert lethal action against Escherichia coli. For this purpose, we measured survival following exposure to HN2 in E. coli strains that were deficient in nucleotide excision repair (uvrA NER mutant), base excision repair (xthA nfo nth fpg BER mutant) or superoxide dismutase (sodAB mutant) activity. We also performed the same experiments in cells pretreated with an iron chelator (2,2′-dipyridyl, DIP). The NER and BER mutants were only sensitive to HN2 treatment (survival rates similar to those of the wild-type were achieved with 5-fold lower HN2 doses). However, wild-type and sodAB strains were not sensitive to treatment with HN2. In all tested strains, survival dropped by 2.5-fold following pretreatment with DIP compared to treatment with HN2 alone. Furthermore, DIP treatment increased ROS generation in both wild type and sodAB-deficient strains

  4. Retrograde Transport from Early Endosomes to the trans-Golgi Network Enables Membrane Wrapping and Egress of Vaccinia Virus Virions.

    Science.gov (United States)

    Sivan, Gilad; Weisberg, Andrea S; Americo, Jeffrey L; Moss, Bernard

    2016-10-01

    The anterograde pathway, from the endoplasmic reticulum through the trans-Golgi network to the cell surface, is utilized by trans-membrane and secretory proteins. The retrograde pathway, which directs traffic in the opposite direction, is used following endocytosis of exogenous molecules and recycling of membrane proteins. Microbes exploit both routes: viruses typically use the anterograde pathway for envelope formation prior to exiting the cell, whereas ricin and Shiga-like toxins and some nonenveloped viruses use the retrograde pathway for cell entry. Mining a human genome-wide RNA interference (RNAi) screen revealed a need for multiple retrograde pathway components for cell-to-cell spread of vaccinia virus. We confirmed and extended these results while discovering that retrograde trafficking was required for virus egress rather than entry. Retro-2, a specific retrograde trafficking inhibitor of protein toxins, potently prevented spread of vaccinia virus as well as monkeypox virus, a human pathogen. Electron and confocal microscopy studies revealed that Retro-2 prevented wrapping of virions with an additional double-membrane envelope that enables microtubular transport, exocytosis, and actin polymerization. The viral B5 and F13 protein components of this membrane, which are required for wrapping, normally colocalize in the trans-Golgi network. However, only B5 traffics through the secretory pathway, suggesting that F13 uses another route to the trans-Golgi network. The retrograde route was demonstrated by finding that F13 was largely confined to early endosomes and failed to colocalize with B5 in the presence of Retro-2. Thus, vaccinia virus makes novel use of the retrograde transport system for formation of the viral wrapping membrane. Efficient cell-to-cell spread of vaccinia virus and other orthopoxviruses depends on the wrapping of infectious particles with a double membrane that enables microtubular transport, exocytosis, and actin polymerization

  5. Lethal fish hook attachment - An unusual occurrence.

    Science.gov (United States)

    Byard, Roger W

    2013-02-01

    A 39-year-old fisherman is reported who was dragged into the water from a boat after he became entangled in fishing line. His death was attributed to salt water drowning. At autopsy the cause of death was confirmed and the mechanism of the lethal event elucidated. Specifically, a large fish hook attached to line was embedded in his right wrist. The hook had passed beneath flexor tendons and had firmly attached him to fishing line that was being dropped from the vessel. There were no other significant injuries or underlying diseases present. This case demonstrates another rare situation in the commercial fishing industry that may result in a victim being dragged from a boat and drowned. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  6. Straightening Beta: Overdispersion of Lethal Chromosome Aberrations following Radiotherapeutic Doses Leads to Terminal Linearity in the Alpha–Beta Model

    Directory of Open Access Journals (Sweden)

    Igor Shuryak

    2017-12-01

    Full Text Available Recent technological advances allow precise radiation delivery to tumor targets. As opposed to more conventional radiotherapy—where multiple small fractions are given—in some cases, the preferred course of treatment may involve only a few (or even one large dose(s per fraction. Under these conditions, the choice of appropriate radiobiological model complicates the tasks of predicting radiotherapy outcomes and designing new treatment regimens. The most commonly used model for this purpose is the venerable linear-quadratic (LQ formalism as it applies to cell survival. However, predictions based on the LQ model are frequently at odds with data following very high acute doses. In particular, although the LQ predicts a continuously bending dose–response relationship for the logarithm of cell survival, empirical evidence over the high-dose region suggests that the survival response is instead log-linear with dose. Here, we show that the distribution of lethal chromosomal lesions among individual human cells (lymphocytes and fibroblasts exposed to gamma rays and X rays is somewhat overdispersed, compared with the Poisson distribution. Further, we show that such overdispersion affects the predicted dose response for cell survival (the fraction of cells with zero lethal lesions. This causes the dose response to approximate log-linear behavior at high doses, even when the mean number of lethal lesions per cell is well fitted by the continuously curving LQ model. Accounting for overdispersion of lethal lesions provides a novel, mechanistically based explanation for the observed shapes of cell survival dose responses that, in principle, may offer a tractable and clinically useful approach for modeling the effects of high doses per fraction.

  7. Reverse Genetics of SARS-Related Coronavirus Using Vaccinia Virus-Based Recombination

    Science.gov (United States)

    Zevenhoven, Jessika C.; Weber, Friedemann; Züst, Roland; Kuri, Thomas; Dijkman, Ronald; Chang, Guohui; Siddell, Stuart G.; Snijder, Eric J.; Thiel, Volker; Davidson, Andrew D.

    2012-01-01

    Severe acute respiratory syndrome (SARS) is a zoonotic disease caused by SARS-related coronavirus (SARS-CoV) that emerged in 2002 to become a global health concern. Although the original outbreak was controlled by classical public health measures, there is a real risk that another SARS-CoV could re-emerge from its natural reservoir, either in its original form or as a more virulent or pathogenic strain; in which case, the virus would be difficult to control in the absence of any effective antiviral drugs or vaccines. Using the well-studied SARS-CoV isolate HKU-39849, we developed a vaccinia virus-based SARS-CoV reverse genetic system that is both robust and biosafe. The SARS-CoV genome was cloned in separate vaccinia virus vectors, (vSARS-CoV-5prime and vSARS-CoV-3prime) as two cDNAs that were subsequently ligated to create a genome-length SARS-CoV cDNA template for in vitro transcription of SARS-CoV infectious RNA transcripts. Transfection of the RNA transcripts into permissive cells led to the recovery of infectious virus (recSARS-CoV). Characterization of the plaques produced by recSARS-CoV showed that they were similar in size to the parental SARS-CoV isolate HKU-39849 but smaller than the SARS-CoV isolate Frankfurt-1. Comparative analysis of replication kinetics showed that the kinetics of recSARS-CoV replication are similar to those of SARS-CoV Frankfurt-1, although the titers of virus released into the culture supernatant are approximately 10-fold less. The reverse genetic system was finally used to generate a recSARS-CoV reporter virus expressing Renilla luciferase in order to facilitate the analysis of SARS-CoV gene expression in human dendritic cells (hDCs). In parallel, a Renilla luciferase gene was also inserted into the genome of human coronavirus 229E (HCoV-229E). Using this approach, we demonstrate that, in contrast to HCoV-229E, SARS-CoV is not able to mediate efficient heterologous gene expression in hDCs. PMID:22412934

  8. Adverse events post smallpox-vaccination: insights from tail scarification infection in mice with Vaccinia virus.

    Science.gov (United States)

    Mota, Bruno E F; Gallardo-Romero, Nadia; Trindade, Giliane; Keckler, M Shannon; Karem, Kevin; Carroll, Darin; Campos, Marco A; Vieira, Leda Q; da Fonseca, Flávio G; Ferreira, Paulo C P; Bonjardim, Cláudio A; Damon, Inger K; Kroon, Erna G

    2011-04-15

    Adverse events upon smallpox vaccination with fully-replicative strains of Vaccinia virus (VACV) comprise an array of clinical manifestations that occur primarily in immunocompromised patients leading to significant host morbidity/mortality. The expansion of immune-suppressed populations and the possible release of Variola virus as a bioterrorist act have given rise to concerns over vaccination complications should more widespread vaccination be reinitiated. Our goal was to evaluate the components of the host immune system that are sufficient to prevent morbidity/mortality in a murine model of tail scarification, which mimics immunological and clinical features of smallpox vaccination in humans. Infection of C57BL/6 wild-type mice led to a strictly localized infection, with complete viral clearance by day 28 p.i. On the other hand, infection of T and B-cell deficient mice (Rag1(-/-)) produced a severe disease, with uncontrolled viral replication at the inoculation site and dissemination to internal organs. Infection of B-cell deficient animals (µMT) produced no mortality. However, viral clearance in µMT animals was delayed compared to WT animals, with detectable viral titers in tail and internal organs late in infection. Treatment of Rag1(-/-) with rabbit hyperimmune anti-vaccinia serum had a subtle effect on the morbidity/mortality of this strain, but it was effective in reduce viral titers in ovaries. Finally, NUDE athymic mice showed a similar outcome of infection as Rag1(-/-), and passive transfer of WT T cells to Rag1(-/-) animals proved fully effective in preventing morbidity/mortality. These results strongly suggest that both T and B cells are important in the immune response to primary VACV infection in mice, and that T-cells are required to control the infection at the inoculation site and providing help for B-cells to produce antibodies, which help to prevent viral dissemination. These insights might prove helpful to better identify individuals with

  9. Adverse events post smallpox-vaccination: insights from tail scarification infection in mice with Vaccinia virus.

    Directory of Open Access Journals (Sweden)

    Bruno E F Mota

    Full Text Available Adverse events upon smallpox vaccination with fully-replicative strains of Vaccinia virus (VACV comprise an array of clinical manifestations that occur primarily in immunocompromised patients leading to significant host morbidity/mortality. The expansion of immune-suppressed populations and the possible release of Variola virus as a bioterrorist act have given rise to concerns over vaccination complications should more widespread vaccination be reinitiated. Our goal was to evaluate the components of the host immune system that are sufficient to prevent morbidity/mortality in a murine model of tail scarification, which mimics immunological and clinical features of smallpox vaccination in humans. Infection of C57BL/6 wild-type mice led to a strictly localized infection, with complete viral clearance by day 28 p.i. On the other hand, infection of T and B-cell deficient mice (Rag1(-/- produced a severe disease, with uncontrolled viral replication at the inoculation site and dissemination to internal organs. Infection of B-cell deficient animals (µMT produced no mortality. However, viral clearance in µMT animals was delayed compared to WT animals, with detectable viral titers in tail and internal organs late in infection. Treatment of Rag1(-/- with rabbit hyperimmune anti-vaccinia serum had a subtle effect on the morbidity/mortality of this strain, but it was effective in reduce viral titers in ovaries. Finally, NUDE athymic mice showed a similar outcome of infection as Rag1(-/-, and passive transfer of WT T cells to Rag1(-/- animals proved fully effective in preventing morbidity/mortality. These results strongly suggest that both T and B cells are important in the immune response to primary VACV infection in mice, and that T-cells are required to control the infection at the inoculation site and providing help for B-cells to produce antibodies, which help to prevent viral dissemination. These insights might prove helpful to better identify

  10. Adverse Events Post Smallpox-Vaccination: Insights from Tail Scarification Infection in Mice with Vaccinia virus

    Science.gov (United States)

    Mota, Bruno E. F.; Gallardo-Romero, Nadia; Trindade, Giliane; Keckler, M. Shannon; Karem, Kevin; Carroll, Darin; Campos, Marco A.; Vieira, Leda Q.; da Fonseca, Flávio G.; Ferreira, Paulo C. P.; Bonjardim, Cláudio A.; Damon, Inger K.; Kroon, Erna G.

    2011-01-01

    Adverse events upon smallpox vaccination with fully-replicative strains of Vaccinia virus (VACV) comprise an array of clinical manifestations that occur primarily in immunocompromised patients leading to significant host morbidity/mortality. The expansion of immune-suppressed populations and the possible release of Variola virus as a bioterrorist act have given rise to concerns over vaccination complications should more widespread vaccination be reinitiated. Our goal was to evaluate the components of the host immune system that are sufficient to prevent morbidity/mortality in a murine model of tail scarification, which mimics immunological and clinical features of smallpox vaccination in humans. Infection of C57BL/6 wild-type mice led to a strictly localized infection, with complete viral clearance by day 28 p.i. On the other hand, infection of T and B-cell deficient mice (Rag1−/−) produced a severe disease, with uncontrolled viral replication at the inoculation site and dissemination to internal organs. Infection of B-cell deficient animals (µMT) produced no mortality. However, viral clearance in µMT animals was delayed compared to WT animals, with detectable viral titers in tail and internal organs late in infection. Treatment of Rag1−/− with rabbit hyperimmune anti-vaccinia serum had a subtle effect on the morbidity/mortality of this strain, but it was effective in reduce viral titers in ovaries. Finally, NUDE athymic mice showed a similar outcome of infection as Rag1−/−, and passive transfer of WT T cells to Rag1−/− animals proved fully effective in preventing morbidity/mortality. These results strongly suggest that both T and B cells are important in the immune response to primary VACV infection in mice, and that T-cells are required to control the infection at the inoculation site and providing help for B-cells to produce antibodies, which help to prevent viral dissemination. These insights might prove helpful to better identify individuals

  11. Reverse genetics of SARS-related coronavirus using vaccinia virus-based recombination.

    Directory of Open Access Journals (Sweden)

    Sjoerd H E van den Worm

    Full Text Available Severe acute respiratory syndrome (SARS is a zoonotic disease caused by SARS-related coronavirus (SARS-CoV that emerged in 2002 to become a global health concern. Although the original outbreak was controlled by classical public health measures, there is a real risk that another SARS-CoV could re-emerge from its natural reservoir, either in its original form or as a more virulent or pathogenic strain; in which case, the virus would be difficult to control in the absence of any effective antiviral drugs or vaccines. Using the well-studied SARS-CoV isolate HKU-39849, we developed a vaccinia virus-based SARS-CoV reverse genetic system that is both robust and biosafe. The SARS-CoV genome was cloned in separate vaccinia virus vectors, (vSARS-CoV-5prime and vSARS-CoV-3prime as two cDNAs that were subsequently ligated to create a genome-length SARS-CoV cDNA template for in vitro transcription of SARS-CoV infectious RNA transcripts. Transfection of the RNA transcripts into permissive cells led to the recovery of infectious virus (recSARS-CoV. Characterization of the plaques produced by recSARS-CoV showed that they were similar in size to the parental SARS-CoV isolate HKU-39849 but smaller than the SARS-CoV isolate Frankfurt-1. Comparative analysis of replication kinetics showed that the kinetics of recSARS-CoV replication are similar to those of SARS-CoV Frankfurt-1, although the titers of virus released into the culture supernatant are approximately 10-fold less. The reverse genetic system was finally used to generate a recSARS-CoV reporter virus expressing Renilla luciferase in order to facilitate the analysis of SARS-CoV gene expression in human dendritic cells (hDCs. In parallel, a Renilla luciferase gene was also inserted into the genome of human coronavirus 229E (HCoV-229E. Using this approach, we demonstrate that, in contrast to HCoV-229E, SARS-CoV is not able to mediate efficient heterologous gene expression in hDCs.

  12. Presence of Virus Neutralizing Antibodies in Cerebral Spinal Fluid Correlates with Non-Lethal Rabies in Dogs

    Science.gov (United States)

    Leyson, Christina M.; Huang, Chien-tsun; Salyards, Gregory; Harvey, Stephen B.; Chen, Zhenhai; He, Biao; Yang, Yang; Hooper, D. C.; Dietzchold, Berhnard; Fu, Zhen F.

    2013-01-01

    Background Rabies is traditionally considered a uniformly fatal disease after onset of clinical manifestations. However, increasing evidence indicates that non-lethal infection as well as recovery from flaccid paralysis and encephalitis occurs in laboratory animals as well as humans. Methodology/Principal Findings Non-lethal rabies infection in dogs experimentally infected with wild type dog rabies virus (RABV, wt DRV-Mexico) correlates with the presence of high level of virus neutralizing antibodies (VNA) in the cerebral spinal fluid (CSF) and mild immune cell accumulation in the central nervous system (CNS). By contrast, dogs that succumbed to rabies showed only little or no VNA in the serum or in the CSF and severe inflammation in the CNS. Dogs vaccinated with a rabies vaccine showed no clinical signs of rabies and survived challenge with a lethal dose of wild-type DRV. VNA was detected in the serum, but not in the CSF of immunized dogs. Thus the presence of VNA is critical for inhibiting virus spread within the CNS and eventually clearing the virus from the CNS. Conclusions/Significance Non-lethal infection with wt RABV correlates with the presence of VNA in the CNS. Therefore production of VNA within the CNS or invasion of VNA from the periphery into the CNS via compromised blood-brain barrier is important for clearing the virus infection from CNS, thereby preventing an otherwise lethal rabies virus infection. PMID:24069466

  13. Vaccinia virus, herpes simplex virus, and carcinogens induce DNA amplification in a human cell line and support replication of a helpervirus dependent parvovirus

    Energy Technology Data Exchange (ETDEWEB)

    Schlehofer, J.R.; Ehrbar, M.; zur Hausen, H.

    1986-07-15

    The SV40-transformed human kidney cell line, NB-E, amplifies integrated as well as episomal SV40 DNA upon treatment with chemical (DMBA) or physical (uv irradiation) carcinogens (initiators) as well as after infection with herpes simplex virus (HSV) type 1 or with vaccinia virus. In addition it is shown that vaccinia virus induces SV40 DNA amplification also in the SV40-transformed Chinese hamster embryo cell line, CO631. These findings demonstrate that human cells similar to Chinese hamster cells amplify integrated DNA sequences after treatment with carcinogens or infection with specific viruses. Furthermore, a poxvirus--vaccinia virus--similar to herpes group viruses induces DNA amplification. As reported for other systems, the vaccinia virus-induced DNA amplification in NB-E cells is inhibited by coinfection with adeno-associated virus (AAV) type 5. This is in line with previous studies on inhibition of carcinogen- or HSV-induced DNA amplification in CO631 cells. The experiments also demonstrate that vaccinia virus, in addition to herpes and adenoviruses acts as a helper virus for replication and structural antigen synthesis of AAV-5 in NB-E cells.

  14. A hepatic protein, fetuin-A, occupies a protective role in lethal systemic inflammation.

    Directory of Open Access Journals (Sweden)

    Wei Li

    2011-02-01

    Full Text Available A liver-derived protein, fetuin-A, was first purified from calf fetal serum in 1944, but its potential role in lethal systemic inflammation was previously unknown. This study aims to delineate the molecular mechanisms underlying the regulation of hepatic fetuin-A expression during lethal systemic inflammation (LSI, and investigated whether alterations of fetuin-A levels affect animal survival, and influence systemic accumulation of a late mediator, HMGB1.LSI was induced by endotoxemia or cecal ligation and puncture (CLP in fetuin-A knock-out or wild-type mice, and animal survival rates were compared. Murine peritoneal macrophages were challenged with exogenous (endotoxin or endogenous (IFN-γ stimuli in the absence or presence of fetuin-A, and HMGB1 expression and release was assessed. Circulating fetuin-A levels were decreased in a time-dependent manner, starting between 26 h, reaching a nadir around 24-48 h, and returning towards base-line approximately 72 h post onset of endotoxemia or sepsis. These dynamic changes were mirrored by an early cytokine IFN-γ-mediated inhibition (up to 50-70% of hepatic fetuin-A expression. Disruption of fetuin-A expression rendered animals more susceptible to LSI, whereas supplementation of fetuin-A (20-100 mg/kg dose-dependently increased animal survival rates. The protection was associated with a significant reduction in systemic HMGB1 accumulation in vivo, and parallel inhibition of IFN-γ- or LPS-induced HMGB1 release in vitro.These experimental data suggest that fetuin-A is protective against lethal systemic inflammation partly by inhibiting active HMGB1 release.

  15. Adsorption of recombinant poxvirus L1-protein to aluminum hydroxide/CpG vaccine adjuvants enhances immune responses and protection of mice from vaccinia virus challenge.

    Science.gov (United States)

    Xiao, Yuhong; Zeng, Yuhong; Alexander, Edward; Mehta, Shyam; Joshi, Sangeeta B; Buchman, George W; Volkin, David B; Middaugh, C Russell; Isaacs, Stuart N

    2013-01-02

    The stockpiling of live vaccinia virus vaccines has enhanced biopreparedness against the intentional or accidental release of smallpox. Ongoing research on future generation smallpox vaccines is providing key insights into protective immune responses as well as important information about subunit-vaccine design strategies. For protein-based recombinant subunit vaccines, the formulation and stability of candidate antigens with different adjuvants are important factors to consider for vaccine design. In this work, a non-tagged secreted L1-protein, a target antigen on mature virus, was expressed using recombinant baculovirus technology and purified. To identify optimal formulation conditions for L1, a series of biophysical studies was performed over a range of pH and temperature conditions. The overall physical stability profile was summarized in an empirical phase diagram. Another critical question to address for development of an adjuvanted vaccine was if immunogenicity and protection could be affected by the interactions and binding of L1 to aluminum salts (Alhydrogel) with and without a second adjuvant, CpG. We thus designed a series of vaccine formulations with different binding interactions between the L1 and the two adjuvants, and then performed a series of vaccination-challenge experiments in mice including measurement of antibody responses and post-challenge weight loss and survival. We found that better humoral responses and protection were conferred with vaccine formulations when the L1-protein was adsorbed to Alhydrogel. These data demonstrate that designing vaccine formulation conditions to maximize antigen-adjuvant interactions is a key factor in smallpox subunit-vaccine immunogenicity and protection. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. Mapping vaccinia virus DNA replication origins at nucleotide level by deep sequencing.

    Science.gov (United States)

    Senkevich, Tatiana G; Bruno, Daniel; Martens, Craig; Porcella, Stephen F; Wolf, Yuri I; Moss, Bernard

    2015-09-01

    Poxviruses reproduce in the host cytoplasm and encode most or all of the enzymes and factors needed for expression and synthesis of their double-stranded DNA genomes. Nevertheless, the mode of poxvirus DNA replication and the nature and location of the replication origins remain unknown. A current but unsubstantiated model posits only leading strand synthesis starting at a nick near one covalently closed end of the genome and continuing around the other end to generate a concatemer that is subsequently resolved into unit genomes. The existence of specific origins has been questioned because any plasmid can replicate in cells infected by vaccinia virus (VACV), the prototype poxvirus. We applied directional deep sequencing of short single-stranded DNA fragments enriched for RNA-primed nascent strands isolated from the cytoplasm of VACV-infected cells to pinpoint replication origins. The origins were identified as the switching points of the fragment directions, which correspond to the transition from continuous to discontinuous DNA synthesis. Origins containing a prominent initiation point mapped to a sequence within the hairpin loop at one end of the VACV genome and to the same sequence within the concatemeric junction of replication intermediates. These findings support a model for poxvirus genome replication that involves leading and lagging strand synthesis and is consistent with the requirements for primase and ligase activities as well as earlier electron microscopic and biochemical studies implicating a replication origin at the end of the VACV genome.

  17. Vaccinia-Related Kinase 2 Modulates the Stress Response to Hypoxia Mediated by TAK1▿

    Science.gov (United States)

    Blanco, Sandra; Santos, Claudio; Lazo, Pedro A.

    2007-01-01

    Hypoxia represents a major stress that requires an immediate cellular response in which different signaling pathways participate. Hypoxia induces an increase in the activity of TAK1, an atypical mitogen-activated protein kinase kinase kinase (MAPKKK), which responds to oxidative stress by triggering cascades leading to the activation of c-Jun N-terminal kinase (JNK). JNK activation by hypoxia requires assembly with the JIP1 scaffold protein, which might also interact with other intracellular proteins that are less well known but that might modulate MAPK signaling. We report that TAK1 is able to form a stable complex with JIP1 and thus regulate the activation of JNK, which in turn determines the cellular stress response to hypoxia. This activation of TAK1-JIP1-JNK is suppressed by vaccinia-related kinase 2 (VRK2). VRK2A is able to interact with TAK1 by its C-terminal region, forming stable complexes. The kinase activity of VRK2 is not necessary for this interaction or the downregulation of AP1-dependent transcription. Furthermore, reduction of the endogenous VRK2 level with short hairpin RNA can increase the response induced by hypoxia, suggesting that the intracellular levels of VRK2 can determine the magnitude of this stress response. PMID:17709393

  18. Comparison of the locations of homologous fowlpox and vaccinia virus genes reveals major genome reorganization.

    Science.gov (United States)

    Mockett, B; Binns, M M; Boursnell, M E; Skinner, M A

    1992-10-01

    We have derived a restriction enzyme map for the fowlpox virus FP9 strain. Sites for BamHI, PvuII, PstI and NcoI have been mapped mainly by Southern blotting. The size of the genome derived from the restriction maps (254 kb) corresponds to the figure of 260 +/- 8 kb determined from analysis of genomic DNA by pulsed-field electrophoresis. The map can be compared with a previously published map for a different strain of fowlpox virus using the PstI digest which is common to both studies. Some 65 kb of fowlpox virus sequence, in 11 blocks, as well as individual M13 clones have been aligned with the map. Where those blocks correspond with blocks of homologous genes in vaccinia virus, it is possible to compare the genomic locations for those genes in the two viruses. This comparison reveals that, whereas there are blocks of sequence within which genes exist in the same relative position in the two viruses, the genomic location of those sequence blocks differs widely between the two viruses.

  19. Study of Vaccinia and Cowpox viruses' replication in Rac1-N17 dominant-negative cells

    Science.gov (United States)

    Salgado, Ana Paula Carneiro; Soares-Martins, Jamária Adriana Pinheiro; Andrade, Luciana Garcia; Albarnaz, Jonas Dutra; Ferreira, Paulo César Peregrino; Kroon, Erna Geessien; Bonjardim, Cláudio Antônio

    2013-01-01

    Interfering with cellular signal transduction pathways is a common strategy used by many viruses to create a propitious intracellular environment for an efficient replication. Our group has been studying cellular signalling pathways activated by the orthopoxviruses Vaccinia (VACV) and Cowpox (CPXV) and their significance to viral replication. In the present study our aim was to investigate whether the GTPase Rac1 was an upstream signal that led to the activation of MEK/ERK1/2, JNK1/2 or Akt pathways upon VACV or CPXV' infections. Therefore, we generated stable murine fibroblasts exhibiting negative dominance to Rac1-N17 to evaluate viral growth and the phosphorylation status of ERK1/2, JNK1/2 and Akt. Our results demonstrated that VACV replication, but not CPXV, was affected in dominant-negative (DN) Rac1-N17 cell lines in which viral yield was reduced in about 10-fold. Viral late gene expression, but not early, was also reduced. Furthermore, our data showed that Akt phosphorylation was diminished upon VACV infection in DN Rac1-N17 cells, suggesting that Rac1 participates in the phosphoinositide-3 kinase pathway leading to the activation of Akt. In conclusion, our results indicate that while Rac1 indeed plays a role in VACV biology, perhaps another GTPase may be involved in CPXV replication. PMID:23903969

  20. Study of Vaccinia and Cowpox viruses' replication in Rac1-N17 dominant-negative cells

    Directory of Open Access Journals (Sweden)

    Ana Paula Carneiro Salgado

    2013-08-01

    Full Text Available Interfering with cellular signal transduction pathways is a common strategy used by many viruses to create a propitious intracellular environment for an efficient replication. Our group has been studying cellular signalling pathways activated by the orthopoxviruses Vaccinia (VACV and Cowpox (CPXV and their significance to viral replication. In the present study our aim was to investigate whether the GTPase Rac1 was an upstream signal that led to the activation of MEK/ERK1/2, JNK1/2 or Akt pathways upon VACV or CPXV' infections. Therefore, we generated stable murine fibroblasts exhibiting negative dominance to Rac1-N17 to evaluate viral growth and the phosphorylation status of ERK1/2, JNK1/2 and Akt. Our results demonstrated that VACV replication, but not CPXV, was affected in dominant-negative (DN Rac1-N17 cell lines in which viral yield was reduced in about 10-fold. Viral late gene expression, but not early, was also reduced. Furthermore, our data showed that Akt phosphorylation was diminished upon VACV infection in DN Rac1-N17 cells, suggesting that Rac1 participates in the phosphoinositide-3 kinase pathway leading to the activation of Akt. In conclusion, our results indicate that while Rac1 indeed plays a role in VACV biology, perhaps another GTPase may be involved in CPXV replication.

  1. Potential effect of prior raccoonpox virus infection in raccoons on vaccinia-based rabies immunization

    Directory of Open Access Journals (Sweden)

    MacCarthy Kathleen A

    2008-10-01

    Full Text Available Abstract Background The USDA, Wildlife Services cooperative oral rabies vaccination (ORV program uses a live vaccinia virus-vectored (genus Orthopoxvirus vaccine, Raboral V-RG® (V-RG, to vaccinate specific wildlife species against rabies virus in several regions of the U.S. Several naturally occurring orthopoxviruses have been found in North America, including one isolated from asymptomatic raccoons (Procyon lotor. The effect of naturally occurring antibodies to orthopoxviruses on successful V-RG vaccination in raccoons is the focus of this study. Results Overall, raccoons pre-immunized (n = 10 with a recombinant raccoonpox virus vaccine (RCN-F1 responded to vaccination with V-RG with lower rabies virus neutralizing antibody (VNA titers than those which were not pre-immunized (n = 10 and some failed to seroconvert for rabies VNA to detectable levels. Conclusion These results suggest that the success of some ORV campaigns may be hindered where raccoonpox virus or possibly other orthopoxvirus antibodies are common in wildlife species targeted for ORV. If these areas are identified, different vaccination strategies may be warranted.

  2. Increased ATP generation in the host cell is required for efficient vaccinia virus production

    Directory of Open Access Journals (Sweden)

    Hsu Che-Fang

    2009-09-01

    Full Text Available Abstract To search for cellular genes up-regulated by vaccinia virus (VV infection, differential display-reverse transcription-polymerase chain reaction (ddRT-PCR assays were used to examine the expression of mRNAs from mock-infected and VV-infected HeLa cells. Two mitochondrial genes for proteins that are part of the electron transport chain that generates ATP, ND4 and CO II, were up-regulated after VV infection. Up-regulation of ND4 level by VV infection was confirmed by Western blotting analysis. Up-regulation of ND4 was reduced by the MAPK inhibitor, apigenin, which has been demonstrated elsewhere to inhibit VV replication. The induction of ND4 expression occurred after viral DNA replication since ara C, an inhibitor of poxviral DNA replication, could block this induction. ATP production was increased in the host cells after VV infection. Moreover, 4.5 μM oligomycin, an inhibitor of ATP production, reduced the ATP level 13 hr after virus infection to that of mock-infected cells and inhibited viral protein expression and virus production, suggesting that increased ATP production is required for efficient VV production. Our results further suggest that induction of ND4 expression is through a Bcl-2 independent pathway.

  3. Genomic identification of human vaccinia virus keratoconjunctivitis and its importance as a laboratory-acquired infection

    Directory of Open Access Journals (Sweden)

    Zahra Movahedi Motlagh

    2016-01-01

    Full Text Available Context: Vaccinia virus (VACV is a member of orthopoxvirus genus of the family Poxviridae. VACVs are enveloped, double-stranded DNA viruses. Several species of this family, for example, molluscum contagiosum, smallpox, deerpox, horsepox, rabbitpox, and VACVs may cause conjunctivitis. Aims: Given the high incidence of keratoconjunctivitis in Iran (approximately 3.6%-53.9% and insufficient clinical diagnostic measures, laboratory tests for detection of its causes and determination of accurate keratoconjunctivitis/conjunctivitis prevalence due to different pathogens are essential. Settings and Design: In this research, conjunctival samples collected from 100 patients with keratoconjunctivitis signs were referred to an eye hospital of Iran. Subjects and Methods: After DNA extraction, polymerase chain reaction (PCR was carried out for detection of VACV. PCR-positive products were further subjected to DNA sequencing. Statistical Analysis Used: The results were analyzed using Chi-square test. Results: In this study, 28% of the samples were positive and a statistically significant relationship obtained between working in medical or research laboratories and VACV prevalence (P < 0.05. Conclusions: This study showed a high rate of VACV keratoconjunctivitis, and therefore, further studies for its prevention and control are necessary.

  4. Hazard Characterization of Modified Vaccinia Virus Ankara Vector: What Are the Knowledge Gaps?

    Directory of Open Access Journals (Sweden)

    Malachy I. Okeke

    2017-10-01

    Full Text Available Modified vaccinia virus Ankara (MVA is the vector of choice for human and veterinary applications due to its strong safety profile and immunogenicity in vivo. The use of MVA and MVA-vectored vaccines against human and animal diseases must comply with regulatory requirements as they pertain to environmental risk assessment, particularly the characterization of potential adverse effects to humans, animals and the environment. MVA and recombinant MVA are widely believed to pose low or negligible risk to ecosystem health. However, key aspects of MVA biology require further research in order to provide data needed to evaluate the potential risks that may occur due to the use of MVA and MVA-vectored vaccines. The purpose of this paper is to identify knowledge gaps in the biology of MVA and recombinant MVA that are of relevance to its hazard characterization and discuss ongoing and future experiments aimed at providing data necessary to fill in the knowledge gaps. In addition, we presented arguments for the inclusion of uncertainty analysis and experimental investigation of verifiable worst-case scenarios in the environmental risk assessment of MVA and recombinant MVA. These will contribute to improved risk assessment of MVA and recombinant MVA vaccines.

  5. Stunned silence: gene expression programs in human cells infected with monkeypox or vaccinia virus.

    Directory of Open Access Journals (Sweden)

    Kathleen H Rubins

    Full Text Available Poxviruses use an arsenal of molecular weapons to evade detection and disarm host immune responses. We used DNA microarrays to investigate the gene expression responses to infection by monkeypox virus (MPV, an emerging human pathogen, and Vaccinia virus (VAC, a widely used model and vaccine organism, in primary human macrophages, primary human fibroblasts and HeLa cells. Even as the overwhelmingly infected cells approached their demise, with extensive cytopathic changes, their gene expression programs appeared almost oblivious to poxvirus infection. Although killed (gamma-irradiated MPV potently induced a transcriptional program characteristic of the interferon response, no such response was observed during infection with either live MPV or VAC. Moreover, while the gene expression response of infected cells to stimulation with ionomycin plus phorbol 12-myristate 13-acetate (PMA, or poly (I-C was largely unimpaired by infection with MPV, a cluster of pro-inflammatory genes were a notable exception. Poly(I-C induction of genes involved in alerting the innate immune system to the infectious threat, including TNF-alpha, IL-1 alpha and beta, CCL5 and IL-6, were suppressed by infection with live MPV. Thus, MPV selectively inhibits expression of genes with critical roles in cell-signaling pathways that activate innate immune responses, as part of its strategy for stealthy infection.

  6. Safety mechanism assisted by the repressor of tetracycline (SMART) vaccinia virus vectors for vaccines and therapeutics.

    Science.gov (United States)

    Grigg, Patricia; Titong, Allison; Jones, Leslie A; Yilma, Tilahun D; Verardi, Paulo H

    2013-09-17

    Replication-competent viruses, such as Vaccinia virus (VACV), are powerful tools for the development of oncolytic viral therapies and elicit superior immune responses when used as vaccine and immunotherapeutic vectors. However, severe complications from uncontrolled viral replication can occur, particularly in immunocompromised individuals or in those with other predisposing conditions. VACVs constitutively expressing interferon-γ (IFN-γ) replicate in cell culture indistinguishably from control viruses; however, they replicate in vivo to low or undetectable levels, and are rapidly cleared even in immunodeficient animals. In an effort to develop safe and highly effective replication-competent VACV vectors, we established a system to inducibly express IFN-γ. Our SMART (safety mechanism assisted by the repressor of tetracycline) vectors are designed to express the tetracycline repressor under a constitutive VACV promoter and IFN-γ under engineered tetracycline-inducible promoters. Immunodeficient SCID mice inoculated with VACVs not expressing IFN-γ demonstrated severe weight loss, whereas those given VACVs expressing IFN-γ under constitutive VACV promoters showed no signs of infection. Most importantly, mice inoculated with a VACV expressing the IFN-γ gene under an inducible promoter remained healthy in the presence of doxycycline, but exhibited severe weight loss in the absence of doxycycline. In this study, we developed a safety mechanism for VACV based on the conditional expression of IFN-γ under a tightly controlled tetracycline-inducible VACV promoter for use in vaccines and oncolytic cancer therapies.

  7. Silver nanoparticles inhibit vaccinia virus infection by preventing viral entry through a macropinocytosis-dependent mechanism.

    Science.gov (United States)

    Trefry, John C; Wooley, Dawn P

    2013-09-01

    Silver nanoparticles have been shown to inhibit viruses. However, very little is known about the mechanism of antiviral activity. This study tested the hypothesis that 25-nm silver nanoparticles inhibited Vaccinia virus replication by preventing viral entry. Plaque reduction, confocal microscopy, and beta-galactosidase reporter gene assays were used to examine viral attachment and entry in the presence and absence of silver nanoparticles. To explore the mechanism of inhibition, viral entry experiments were conducted with silver nanoparticles and small interfering RNAs designed to silence the gene coding for p21-activated kinase 1, a key mediator of macropinocytosis. The silver nanoparticles caused a 4- to 5-log reduction in viral titer at concentrations that were not toxic to cells. Virus was capable of adsorbing to cells but could not enter cells in the presence of silver nanoparticles. Virus particles that had adsorbed to cells in the presence of silver nanoparticles were found to be infectious upon removal from the cells, indicating lack of direct virucidal effect. The half maximal inhibitory concentration for viral entry in the presence of silver nanoparticles was 27.4+/-3.3 microg/ml. When macropinocytosis was blocked, this inhibition was significantly reduced. Thus, macropinocytosis was required for the full antiviral effect. For the first time, this study points to the novel result that a cellular process involved in viral entry is responsible for the antiviral effects of silver nanoparticles.

  8. Brazilian vaccinia virus strains show a classical orthopoxvirus in-fection course and cross-protection

    Institute of Scientific and Technical Information of China (English)

    Betania Paiva Drumond; Jonatas Santos Abraho; Zlia Ins Portela Lobato; Cludio Antonio Bonjardim; Paulo Csar Peregrino Ferreira; Erna Geessien Kroon

    2009-01-01

    Objectives:The purpose of this work was to study the infection course and cross-protection in mice after intra-dermal injection of Vaccinia virus (VACV ) strain Western Reserve and three Brazilian VACV strains:Araatuba,Muriaéand BeAn58058 isolated from cow,human and rodent,respectively.Methods:Balb /c mice were inoculated by footpad and back scarification and daily monitored regarding lesion development and weight loss.To check cross protection after intradermal VACV inoculation,mice were subsequently infected with different VACV strains and monitored to check lesion development.Serum neutralization assays were per-formed to check for the presence of antibodies against Orthopoxvirus.Results:After VACV intradermal inocu-lation the lesion development pattern was similar in mice infected with the different virus strains.By using the footpad scarification model,cross-protection among VACV strains was observed.Moreover,neutralizing anti-bodies against Orthopoxvirus were detected in sera from mice infected with all VACV strains.Conclusion:Al-though it was not possible to observe virulence differences among VACV strains isolated from cow,rodent and human using the murine model,this inoculation route showed to be an appropriated model to study lesions de-velopment since it mimics natural infections by VACV in nature.

  9. Myxoma and vaccinia viruses exploit different mechanisms to enter and infect human cancer cells.

    Science.gov (United States)

    Villa, Nancy Y; Bartee, Eric; Mohamed, Mohamed R; Rahman, Masmudur M; Barrett, John W; McFadden, Grant

    2010-06-05

    Myxoma (MYXV) and vaccinia (VACV) viruses have recently emerged as potential oncolytic agents that can infect and kill different human cancer cells. Although both are structurally similar, it is unknown whether the pathway(s) used by these poxviruses to enter and cause oncolysis in cancer cells are mechanistically similar. Here, we compared the entry of MYXV and VACV-WR into various human cancer cells and observed significant differences: 1--low-pH treatment accelerates fusion-mediated entry of VACV but not MYXV, 2--the tyrosine kinase inhibitor genistein inhibits entry of VACV, but not MYXV, 3--knockdown of PAK1 revealed that it is required for a late stage event downstream of MYXV entry into cancer cells, whereas PAK1 is required for VACV entry into the same target cells. These results suggest that VACV and MYXV exploit different mechanisms to enter into human cancer cells, thus providing some rationale for their divergent cancer cell tropisms. 2010 Elsevier Inc. All rights reserved.

  10. Oncolytic gene therapy with recombinant vaccinia strain GLV-2b372 efficiently kills hepatocellular carcinoma.

    Science.gov (United States)

    Ady, Justin W; Johnsen, Clark; Mojica, Kelly; Heffner, Jacqueline; Love, Damon; Pugalenthi, Amudhan; Belin, Laurence J; Chen, Nanhai G; Yu, Yong A; Szalay, Aladar A; Fong, Yuman

    2015-08-01

    Hepatocellular carcinoma (HCC) commonly presents at a late stage when surgery is no longer a curative option. As such, novel therapies for advanced HCC are needed. Oncolytic viruses are a viable option for cancer therapy owing to their ability to specifically infect, replicate within, and kill cancer cells. In this study, we have investigated the ability of GLV-2b372, a novel light-emitting recombinant vaccinia virus derived from a wild-type Lister strain, to kill HCC. Four human HCC cell lines were assayed in vitro for infectivity and cytotoxicity. Viral replication was quantified via standard viral plaque assays. Flank HCC xenografts generated in athymic nude mice were treated with intratumoral GLV-2b372 to assess for tumor growth inhibition and viral biodistribution. Infectivity occurred in a time- and concentration-dependent manner with 70% cell death in all cell lines by day 5. All cell lines supported efficient viral replication. At 25 days after infection, flank tumor volumes decreased by 50% whereas controls increased by 400%. Tumor tissue demonstrated substantial GLV-2b372 infection at 24 hours, 48 hours, and 2 weeks. We demonstrate that GLV-2b372 efficiently kills human HCC in vitro and in vivo and is a viable treatment option for patients with HCC. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. RAB1A promotes Vaccinia virus replication by facilitating the production of intracellular enveloped virions

    Energy Technology Data Exchange (ETDEWEB)

    Pechenick Jowers, Tali; Featherstone, Rebecca J.; Reynolds, Danielle K.; Brown, Helen K. [The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh, Roslin, Midlothian EH25 9RG, Scotland (United Kingdom); James, John; Prescott, Alan [Division of Cell Signalling and Immunology, College of Life Sciences, University of Dundee, Dundee DD1 5EH, Scotland (United Kingdom); Haga, Ismar R. [The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh, Roslin, Midlothian EH25 9RG, Scotland (United Kingdom); Beard, Philippa M., E-mail: pip.beard@roslin.ed.ac.uk [The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh, Roslin, Midlothian EH25 9RG, Scotland (United Kingdom)

    2015-01-15

    Vaccinia virus (VACV) is a large double-stranded DNA virus with a complex cytoplasmic replication cycle that exploits numerous cellular proteins. This work characterises the role of a proviral cellular protein, the small GTPase RAB1A, in VACV replication. Using siRNA, we identified RAB1A as required for the production of extracellular enveloped virions (EEVs), but not intracellular mature virions (IMVs). Immunofluorescence and electron microscopy further refined the role of RAB1A as facilitating the wrapping of IMVs to become intracellular enveloped virions (IEVs). This is consistent with the known function of RAB1A in maintenance of ER to Golgi transport. VACV can therefore be added to the growing list of viruses which require RAB1A for optimal replication, highlighting this protein as a broadly proviral host factor. - Highlights: • Characterisation of the role of the small GTPase RAB1A in VACV replication. • RAB1A is not required for production of the primary virion form (IMV). • RAB1A is required for production of processed virion forms (IEVs, CEVs and EEVs). • Consistent with known role of RAB1A in ER to Golgi transport.

  12. Antigen Gene Transfer to Human Plasmacytoid Dendritic Cells Using Recombinant Adenovirus and Vaccinia Virus Vectors

    Directory of Open Access Journals (Sweden)

    Hetty J. Bontkes

    2005-01-01

    Full Text Available Recombinant adenoviruses (RAd and recombinant vaccinia viruses (RVV expressing tumour-associated antigens (TAA are used as anti-tumour vaccines. It is important that these vaccines deliver the TAA to dendritic cells (DC for the induction of a strong immune response. Infection of myeloid DC (MDC with RAd alone is relatively inefficient but CD40 retargeting significantly increases transduction efficiency and DC maturation. Infection with RVV is efficient without DC maturation. Plasmacytoid dendritic cells (PDC play a role in the innate immune response to viral infections through the secretion of IFNα but may also play a role in specific T-cell induction. The aim of our study was to investigate whether PDC are better targets for RAd and RVV based vaccines. RAd alone hardly infected PDC (2% while CD40 retargeting did not improve transduction efficiency, but it did increase PDC maturation (25% CD83 positive cells. Accordingly, specific CTL activation by RAd infected PDC was limited (the number of IFNγ producing CTL was reduced by 75% compared to stimulation with peptide loaded PDC. RVV infected PDC specifically stimulated CTL but PDC were not activated. These Results indicate that PDC are not ideal targets for RAd and RVV based vaccines. However, PDC induced specific CTL activation after pulsing with recombinant protein, indicating that PDC can also cross-present antigens released from surrounding infected cells.

  13. Diagnostic characteristics of lethal prostate cancer

    DEFF Research Database (Denmark)

    Helgstrand, John Thomas; Røder, Martin Andreas; Klemann, Nina

    2017-01-01

    BACKGROUND: The diagnostic characteristics of men who eventually die from prostate cancer (PCa) and the extent to which early diagnostic strategies have affected these characteristics are unclear. We aimed to investigate trends in survival and clinical presentation at diagnosis in men who...... eventually died from PCa. PATIENTS AND METHODS: Based on the national database, the Danish Prostate Cancer Registry, a nationwide population-based study of all 19,487 men who died from PCa in Denmark between 1995 and 2013 was conducted. Trends in median survival and trends in age, prostate-specific antigen...

  14. Fitness of transgenic mosquito Aedes aegypti males carrying a dominant lethal genetic system.

    Directory of Open Access Journals (Sweden)

    Blandine Massonnet-Bruneel

    Full Text Available OX513A is a transgenic strain of Aedes aegypti engineered to carry a dominant, non-sex-specific, late-acting lethal genetic system that is repressed in the presence of tetracycline. It was designed for use in a sterile-insect (SIT pest control system called RIDL® (Release of Insects carrying a Dominant Lethal gene by which transgenic males are released in the field to mate with wild females; in the absence of tetracycline, the progeny from such matings will not survive. We investigated the mating fitness of OX513A in the laboratory. Male OX513A were as effective as Rockefeller (ROCK males at inducing refractoriness to further mating in wild type females and there was no reduction in their ability to inseminate multiple females. They had a lower mating success but yielded more progeny than the wild-type comparator strain (ROCK when one male of each strain was caged with a ROCK female. Mating success and fertility of groups of 10 males-with different ratios of RIDL to ROCK-competing for five ROCK females was similar, but the median longevity of RIDL males was somewhat (18% lower. We conclude that the fitness under laboratory conditions of OX513A males carrying a tetracycline repressible lethal gene is comparable to that of males of the wild-type comparator strain.

  15. Engineered repressible lethality for controlling the pink bollworm, a lepidopteran pest of cotton.

    Directory of Open Access Journals (Sweden)

    Neil I Morrison

    Full Text Available The sterile insect technique (SIT is an environmentally friendly method of pest control in which insects are mass-produced, irradiated and released to mate with wild counterparts. SIT has been used to control major pest insects including the pink bollworm (Pectinophora gossypiella Saunders, a global pest of cotton. Transgenic technology has the potential to overcome disadvantages associated with the SIT, such as the damaging effects of radiation on released insects. A method called RIDL (Release of Insects carrying a Dominant Lethal is designed to circumvent the need to irradiate insects before release. Premature death of insects' progeny can be engineered to provide an equivalent to sterilisation. Moreover, this trait can be suppressed by the provision of a dietary antidote. In the pink bollworm, we generated transformed strains using different DNA constructs, which showed moderate-to-100% engineered mortality. In permissive conditions, this effect was largely suppressed. Survival data on cotton in field cages indicated that field conditions increase the lethal effect. One strain, called OX3402C, showed highly penetrant and highly repressible lethality, and was tested on host plants where its larvae caused minimal damage before death. These results highlight a potentially valuable insecticide-free tool against pink bollworm, and indicate its potential for development in other lepidopteran pests.

  16. [Construction and identification of non-replication recombinant vaccinia virus co-expressing human papillomavirus type 16 L1/L2/E6/E7 proteins].

    Science.gov (United States)

    Huang, Wei; Tian, Hou-wen; Ren, Jiao; Fan, Jiang-tao; Zhao, Li; Bian, Tao; Lu, Zhen-hua; Ruan, Li

    2005-09-01

    To generate a human papillomavirus (HPV16) prophylactic and therapeutic vaccine candidate for cervical cancer. HPV16 major capsid protein L1 gene/minor capsid protein L2 gene and HPV16 early E6/E7 genes were inserted into a vaccinia virus expression vector. A strain of non-recombinant vaccinia virus containing the sequences was obtained through a homologous recombination and identified. DNA hybridization confirmed that the HPV16L1/L2/E6/E7 genes were integrated into vaccinia virus DNA. Western Blot result showed that full-length L1/L2/E6/E7 proteins were co-expressed in CEF cells infected with the recombinant virus. NTVJE6E7CKL1L2 could be taken as a candidate of prophylactic and therapeutic vaccine for HPV-associated tumors and their precancerous transformations.

  17. Lethal and sub-lethal effects of five pesticides used in rice farming on the earthworm Eisenia fetida

    NARCIS (Netherlands)

    Rico, Andreu; Sabater, Consuelo; Castillo, María Ángeles

    2016-01-01

    The toxicity of five pesticides typically used in rice farming (trichlorfon, dimethoate, carbendazim, tebuconazole and prochloraz) was evaluated on different lethal and sub-lethal endpoints of the earthworm Eisenia fetida. The evaluated endpoints included: avoidance behaviour after an exposure

  18. A track-event theory of cell survival

    Energy Technology Data Exchange (ETDEWEB)

    Besserer, Juergen; Schneider, Uwe [Zuerich Univ. (Switzerland). Inst. of Physics; Radiotherapy Hirslanden, Zuerich (Switzerland)

    2015-09-01

    When fractionation schemes for hypofractionation and stereotactic body radiotherapy are considered, a reliable cell survival model at high dose is needed for calculating doses of similar biological effectiveness. In this work a simple model for cell survival which is valid also at high dose is developed from Poisson statistics. An event is defined by two double strand breaks (DSB) on the same or different chromosomes. An event is always lethal due to direct lethal damage or lethal binary misrepair by the formation of chromosome aberrations. Two different mechanisms can produce events: one-track events (OTE) or two-track-events (TTE). The target for an OTE is always a lethal event, the target for an TTE is one DSB. At least two TTEs on the same or different chromosomes are necessary to produce an event. Both, the OTE and the TTE are statistically independent. From the stochastic nature of cell kill which is described by the Poisson distribution the cell survival probability was derived. It was shown that a solution based on Poisson statistics exists for cell survival. It exhibits exponential cell survival at high dose and a finite gradient of cell survival at vanishing dose, which is in agreement with experimental cell studies. The model fits the experimental data nearly as well as the three-parameter formula of Hug-Kellerer and is only based on two free parameters. It is shown that the LQ formalism is an approximation of the model derived in this work. It could be also shown that the derived model predicts a fractionated cell survival experiment better than the LQ-model. It was shown that cell survival can be described with a simple analytical formula on the basis of Poisson statistics. This solution represents in the limit of large dose the typical exponential behavior and predicts cell survival after fractionated dose application better than the LQ-model.

  19. Using a Lethality Index to Assess Susceptibility of Tribolium confusum and Oryzaephilus surinamensis to Insecticides.

    Directory of Open Access Journals (Sweden)

    Paraskevi Agrafioti

    Full Text Available We evaluated knockdown caused by four insecticides: alpha-cypermethrin, chlorfenapyr, pirimiphos-methyl and fipronil against adults of Tribolium confusum Jacquelin Duval, the confused flour beetle and Oryzaephilus surinamensis (L., the sawtoothed grain beetle. Bioassays were conducted on concrete and metal surfaces. Adults of the tested species were exposed on both surfaces treated with the above insecticides at two doses (low and high. Knockdown assessment was done after 15, 30 and 60 min of adult exposure in the treated surfaces. Also, after 1, 3, 5, 7 and 14 d of exposure, a lethality index was calculated with an equation resulting to values from 0 to 100, where 100 indicated complete mortality and 0 complete survival. We also developed a lethality index by ranking each adult on each surface from 0 to 4, 0: adults moved normally, 1: adults were knocked down, but were able to walk for short intervals, 2: adults were knocked down and unable to walk, but with visible movement of antennae etc., 3: adults were knocked down, with very minimal movement of the tarsi and the antennae and 4: adults were dead (no movement. Knockdown of adults immediately after exposure (15-60 min was higher for pirimiphos-methyl followed by alpha-cypermethrin, for both dose rates tested and species, but only on the metal surface. The lethality index was nearly 100 for all insecticides after 5d of exposure for O. surinamensis, while for T. confusum the adult lethality index was considerably lower for alpha-cypermethrin, suggesting that that recovery from knockdown occurred. Chlorfenapyr was the only insecticide that was more effective on concrete than on metal, while the reverse was noted for the other three insecticides. These results show that knockdown has different levels, which can be used as indicators of insect mortality or recovery.

  20. Unintentional transfer of vaccinia virus associated with smallpox vaccines: ACAM2000(®) compared with Dryvax(®).

    Science.gov (United States)

    Tack, Danielle M; Karem, Kevin L; Montgomery, Jay R; Collins, Limone; Bryant-Genevier, Marthe G; Tiernan, Rosemary; Cano, Maria; Lewis, Paige; Engler, Renata J M; Damon, Inger K; Reynolds, Mary G

    2013-07-01

    Routine vaccination against smallpox (variola) ceased in the US in 1976. However, in 2002 limited coverage for military personnel and some healthcare workers was reinstituted. In March 2008, ACAM2000® replaced Dryvax® as the vaccine used in the United States against smallpox. Unintentional transfer of vaccinia virus from a vaccination site by autoinoculation or contact transmission, can have significant public health implications. We summarize unintentional virus transfer AEs associated with ACAM2000® since March 2008 and compare with Dryvax®. We identified 309 reports for ACAM2000® with skin or ocular involvement, of which 93 were autoinoculation cases and 20 were contact transmission cases. The rate for reported cases of autoinoculation was 20.6 per 100,000 vaccinations and for contact transmission was 4.4 per 100,000 vaccinations. Eighteen contact transmission cases could be attributed to contact during a sporting activity (45%) or intimate contact (45%). Of the 113 unintentional transfer cases, 6 met the case definition for ocular vaccinia. The most common locations for all autoinoculation and contact cases were arm/elbow/shoulder (35/113; 31%) and face (24/113; 21%). Methods We reviewed 753 reports associated with smallpox in the Vaccine Adverse Event Reporting System and CDC Poxvirus consultation log, reported from March 2008 to August 2010. Reports were classified into categories based upon standard case definitions. Overall, unintentional transfer events for ACAM2000® and Dryvax® are similar. We recommend continued efforts to prevent transfer events and continuing education for healthcare providers focused on recognition of vaccinia lesions, proper sample collection, and laboratory testing to confirm diagnosis.

  1. Radiation rescue: mesenchymal stromal cells protect from lethal irradiation.

    Directory of Open Access Journals (Sweden)

    Claudia Lange

    Full Text Available BACKGROUND: Successful treatment of acute radiation syndromes relies on immediate supportive care. In patients with limited hematopoietic recovery potential, hematopoietic stem cell (HSC transplantation is the only curative treatment option. Because of time consuming donor search and uncertain outcome we propose MSC treatment as an alternative treatment for severely radiation-affected individuals. METHODS AND FINDINGS: Mouse mesenchymal stromal cells (mMSCs were expanded from bone marrow, retrovirally labeled with eGFP (bulk cultures and cloned. Bulk and five selected clonal mMSCs populations were characterized in vitro for their multilineage differentiation potential and phenotype showing no contamination with hematopoietic cells. Lethally irradiated recipients were i.v. transplanted with bulk or clonal mMSCs. We found a long-term survival of recipients with fast hematopoietic recovery after the transplantation of MSCs exclusively without support by HSCs. Quantitative PCR based chimerism analysis detected eGFP-positive donor cells in peripheral blood immediately after injection and in lungs within 24 hours. However, no donor cells in any investigated tissue remained long-term. Despite the rapidly disappearing donor cells, microarray and quantitative RT-PCR gene expression analysis in the bone marrow of MSC-transplanted animals displayed enhanced regenerative features characterized by (i decreased proinflammatory, ECM formation and adhesion properties and (ii boosted anti-inflammation, detoxification, cell cycle and anti-oxidative stress control as compared to HSC-transplanted animals. CONCLUSIONS: Our data revealed that systemically administered MSCs provoke a protective mechanism counteracting the inflammatory events and also supporting detoxification and stress management after radiation exposure. Further our results suggest that MSCs, their release of trophic factors and their HSC-niche modulating activity rescue endogenous hematopoiesis

  2. Radiation rescue: mesenchymal stromal cells protect from lethal irradiation.

    Science.gov (United States)

    Lange, Claudia; Brunswig-Spickenheier, Bärbel; Cappallo-Obermann, Heike; Eggert, Katharina; Gehling, Ursula M; Rudolph, Cornelia; Schlegelberger, Brigitte; Cornils, Kerstin; Zustin, Jozef; Spiess, Andrej-Nikolai; Zander, Axel R

    2011-01-05

    Successful treatment of acute radiation syndromes relies on immediate supportive care. In patients with limited hematopoietic recovery potential, hematopoietic stem cell (HSC) transplantation is the only curative treatment option. Because of time consuming donor search and uncertain outcome we propose MSC treatment as an alternative treatment for severely radiation-affected individuals. Mouse mesenchymal stromal cells (mMSCs) were expanded from bone marrow, retrovirally labeled with eGFP (bulk cultures) and cloned. Bulk and five selected clonal mMSCs populations were characterized in vitro for their multilineage differentiation potential and phenotype showing no contamination with hematopoietic cells. Lethally irradiated recipients were i.v. transplanted with bulk or clonal mMSCs. We found a long-term survival of recipients with fast hematopoietic recovery after the transplantation of MSCs exclusively without support by HSCs. Quantitative PCR based chimerism analysis detected eGFP-positive donor cells in peripheral blood immediately after injection and in lungs within 24 hours. However, no donor cells in any investigated tissue remained long-term. Despite the rapidly disappearing donor cells, microarray and quantitative RT-PCR gene expression analysis in the bone marrow of MSC-transplanted animals displayed enhanced regenerative features characterized by (i) decreased proinflammatory, ECM formation and adhesion properties and (ii) boosted anti-inflammation, detoxification, cell cycle and anti-oxidative stress control as compared to HSC-transplanted animals. Our data revealed that systemically administered MSCs provoke a protective mechanism counteracting the inflammatory events and also supporting detoxification and stress management after radiation exposure. Further our results suggest that MSCs, their release of trophic factors and their HSC-niche modulating activity rescue endogenous hematopoiesis thereby serving as fast and effective first-line treatment to

  3. Recombinant raccoon pox vaccine protects mice against lethal plague

    Science.gov (United States)

    Osorio, J.E.; Powell, T.D.; Frank, R.S.; Moss, K.; Haanes, E.J.; Smith, S.R.; Rocke, T.E.; Stinchcomb, D.T.

    2003-01-01

    Using a raccoon poxvirus (RCN) expression system, we have developed new recombinant vaccines that can protect mice against lethal plague infection. We tested the effects of a translation enhancer (EMCV-IRES) in combination with a secretory (tPA) signal or secretory (tPA) and membrane anchoring (CHV-gG) signals on in vitro antigen expression of F1 antigen in tissue culture and the induction of antibody responses and protection against Yersinia pestis challenge in mice. The RCN vector successfully expressed the F1 protein of Y. pestis in vitro. In addition, the level of expression was increased by the insertion of the EMCV-IRES and combinations of this and the secretory signal or secretory and anchoring signals. These recombinant viruses generated protective immune responses that resulted in survival of 80% of vaccinated mice upon challenge with Y. pestis. Of the RCN-based vaccines we tested, the RCN-IRES-tPA-YpF1 recombinant construct was the most efficacious. Mice vaccinated with this construct withstood challenge with as many as 1.5 million colony forming units of Y. pestis (7.7??104LD50). Interestingly, vaccination with F1 fused to the anchoring signal (RCN-IRES-tPA-YpF1-gG) elicited significant anti-F1 antibody titers, but failed to protect mice from plague challenge. Our studies demonstrate, in vitro and in vivo, the potential importance of the EMCV-IRES and secretory signals in vaccine design. These molecular tools provide a new approach for improving the efficacy of vaccines. In addition, these novel recombinant vaccines could have human, veterinary, and wildlife applications in the prevention of plague. ?? 2002 Elsevier Science Ltd. All rights reserved.

  4. The novel capripoxvirus vector lumpy skin disease virus efficiently boosts modified vaccinia Ankara human immunodeficiency virus responses in rhesus macaques.

    Science.gov (United States)

    Burgers, Wendy A; Ginbot, Zekarias; Shen, Yen-Ju; Chege, Gerald K; Soares, Andreia P; Müller, Tracey L; Bunjun, Rubina; Kiravu, Agano; Munyanduki, Henry; Douglass, Nicola; Williamson, Anna-Lise

    2014-10-01

    Poxvirus vectors represent promising human immunodeficiency virus (HIV) vaccine candidates and were a component of the only successful HIV vaccine efficacy trial to date. We tested the immunogenicity of a novel recombinant capripoxvirus vector, lumpy skin disease virus (LSDV), in combination with modified vaccinia Ankara (MVA), both expressing genes from HIV-1. Here, we demonstrated that the combination regimen was immunogenic in rhesus macaques, inducing high-magnitude, broad and balanced CD4(+) and CD8(+) T-cell responses, and transient activation of the immune response. These studies support further development of LSDV as a vaccine vector. © 2014 The Authors.

  5. Identification of Protective Brucella Antigens and their Expressions in Vaccinia Virus to Prevent Disease in Animals and Humans.

    Science.gov (United States)

    1996-05-01

    selected antigens is through fractionation of Brucella strain RB51 or E.coli recombinants expressing the appropriateBrucella antigen. Briefly, the method...animal species infected with Brucella spp. It is also able to induce the in vitro production of INF-y with lymphocytes of RB51 vaccinated mice (Table...SOD RB51 1IkDa 20 15 x0 0- 10 E 0- Uve Acetone Buffer Void 0-0.1 0.1-0-25 0.25->0.5 0.5-0.75 0.75->1.0 Klled 14 Preparation of new vaccinia/ Brucella

  6. Cognitive Inhibition in Elderly High-Lethality Suicide Attempters

    Science.gov (United States)

    Richard-Devantoy, Stéphane; Szanto, Katalin; Butters, Meryl A.; Kalkus, Jan; Dombrovski, Alexandre Y.

    2014-01-01

    Background People who attempt suicide often display cognitive impairments, particularly poor cognitive control. Could poor cognitive control contribute to high suicide rates in old age? A component of cognitive control, cognitive inhibition – active suppression of task-irrelevant processing – is very sensitive to aging and has been linked to attempted suicide. We investigated cognitive inhibition in older high-lethality suicide attempters, closely resembling suicide victims, as well as low-lethality attempters, and control groups with and without depression and suicidal ideation. Methods 102 participants aged 60+ (17 psychiatrically healthy control subjects, 38 depressed control subjects, 16 suicide ideators, 14 low-lethality suicide attempters, and 17 high-lethality suicide attempters) underwent comprehensive clinical and cognitive assessments. They completed the Delis–Kaplan Executive Function System Color-Word Interference Test, a validated modification of the Stroop test. Results High-lethality suicide attempters demonstrated a distinct pattern of cognitive inhibition deficits. Compared to psychiatrically healthy control subjects and suicide ideators, high-lethality attempters took longer to complete inhibition trials, even after accounting for potential confounding factors (age, education, MMSE score, information processing speed, and accuracy). Compared to non-suicidal depressed and healthy control subjects, low-lethality suicide attempters committed more uncorrected errors; however, this difference was not specific to the inhibition condition. Conclusions Older suicide attempters are a cognitively heterogeneous group. Poor cognitive control in high-lethality attempters may undermine their ability to solve real-life problems, precipitating a catastrophic accumulation of stressors. Meanwhile, low-lethality attempters' poor performance may reflect a careless approach to the task or faulty monitoring. PMID:24816626

  7. Survival Analysis

    CERN Document Server

    Miller, Rupert G

    2011-01-01

    A concise summary of the statistical methods used in the analysis of survival data with censoring. Emphasizes recently developed nonparametric techniques. Outlines methods in detail and illustrates them with actual data. Discusses the theory behind each method. Includes numerous worked problems and numerical exercises.

  8. Modelling survival

    DEFF Research Database (Denmark)

    Ashauer, Roman; Albert, Carlo; Augustine, Starrlight

    2016-01-01

    well GUTS, calibrated with short-term survival data of Gammarus pulex exposed to four pesticides, can forecast effects of longer-term pulsed exposures. Thirdly, we tested the ability of GUTS to estimate 14-day median effect concentrations of malathion for a range of species and use these estimates...

  9. Protection of Rhesus Macaques against Lethal Plasmodium knowlesi Malaria by a Heterologous DNA Priming and Poxvirus Boosting Immunization Regimen

    Science.gov (United States)

    Rogers, William O.; Weiss, Walter R.; Kumar, Anita; Aguiar, João C.; Tine, John A.; Gwadz, Robert; Harre, Joseph G.; Gowda, Kalpana; Rathore, Dharmendar; Kumar, Sanjai; Hoffman, Stephen L.

    2002-01-01

    We tested a cytokine-enhanced, multiantigen, DNA priming and poxvirus boosting vaccine regimen for prevention of malaria in the Plasmodium knowlesi-rhesus macaque model system. Animals were primed with a mixture of DNA plasmids encoding two preerythrocytic-stage proteins and two erythrocytic-stage proteins from P. knowlesi and combinations of the cytokines granulocyte-macrophage colony-stimulating factor, interleukin-4, and tumor necrosis factor alpha and were boosted with a mixture of four recombinant, attenuated vaccinia virus strains encoding the four P. knowlesi antigens. Two weeks after boosting, the geometric mean immunofluorescence titers in the immunized groups against sporozoites and infected erythrocytes ranged from 160 to 8,096 and from 1,810 to 5,120, respectively. The geometric mean anti-P. knowlesi circumsporozoite protein (PkCSP) titers ranged from 1,761 to 24,242. Peripheral blood mononuclear cells (PBMC) from the immunized monkeys produced gamma interferon (IFN-γ) in response to incubation with pooled peptides from the PkCSP at frequencies of 10 to 571 spot-forming cells/106 PBMC. Following challenge with 100 infectious P. knowlesi sporozoites, 2 of 11 immunized monkeys were sterilely protected, and 7 of the 9 infected monkeys resolved their parasitemias spontaneously. In contrast, all four controls became infected and required treatment for overwhelming parasitemia. Early protection was strongly associated with IFN-γ responses against a pool of peptides from the preerythrocytic-stage antigen, PkCSP. These findings demonstrate that a multistage, multiantigen, DNA priming and poxvirus boosting vaccine regimen can protect nonhuman primates from an otherwise lethal malaria sporozoite challenge. PMID:12117942

  10. Insoluble glycogen, a metabolizable internal adsorbent, decreases the lethality of endotoxin shock in rats

    Directory of Open Access Journals (Sweden)

    S. Sipka

    1997-01-01

    Full Text Available Insoluble glycogen is an enzymatically modified form of naturally occurring soluble glycogen with a great adsorbing capacity. It can be metabolized by phagocytes to glucose. In this study we used insoluble glycogen intravenously in the experimental endotoxin shock of rats. Wistar male rats were sensitized to endotoxin by Pb acetate. The survival of rats were compared in groups of animals endotoxin shock treated and non-treated with insoluble glycogen. Furthermore, we have determined in vitro the binding capacity of insoluble glycogen for endotoxin, tumour necrosis factor alpha, interleukin-1 and secretable phospholipase A2. Use of 10 mg/kg dose of insoluble glycogen could completely prevent the lethality of shock induced by LD50 quantity of endotoxin in rats. All animals treated survived. Insoluble glycogen is a form of ‘metabolizable internal adsorbents’. It can potentially be used for treatment of septic shock.

  11. Shortened Lifespan and Lethal Hemorrhage in a Hemophilia A Mouse Model.

    Directory of Open Access Journals (Sweden)

    Janice M Staber

    Full Text Available Hemophilia A animal models have helped advance our understanding of factor VIII deficiency. Previously, factor VIII deficient mouse models were reported to have a normal life span without spontaneous bleeds. However, the bleeding frequency and survival in these animals has not been thoroughly evaluated.To investigate the survival and lethal bleeding frequency in two strains of E-16 hemophilia A mice.We prospectively studied factor VIII deficient hemizygous affected males (n = 83 and homozygous affected females (n = 55 for survival and bleeding frequency. Animals were evaluated for presence and location of bleeds as potential cause of death.Hemophilia A mice had a median survival of 254 days, which is significantly shortened compared to wild type controls (p < 0.0001. In addition, the hemophilia A mice experienced hemorrhage in several tissues. This previously-underappreciated shortened survival in the hemophilia A murine model provides new outcomes for investigation of therapeutics and also reflects the shortened lifespan of patients if left untreated.

  12. Broad spectrum antiviral activity of favipiravir (T-705: protection from highly lethal inhalational Rift Valley Fever.

    Directory of Open Access Journals (Sweden)

    Amy L Caroline

    2014-04-01

    Full Text Available BACKGROUND: Development of antiviral drugs that have broad-spectrum activity against a number of viral infections would be of significant benefit. Due to the evolution of resistance to currently licensed antiviral drugs, development of novel anti-influenza drugs is in progress, including Favipiravir (T-705, which is currently in human clinical trials. T-705 displays broad-spectrum in vitro activity against a number of viruses, including Rift Valley Fever virus (RVFV. RVF is an important neglected tropical disease that causes human, agricultural, and economic losses in endemic regions. RVF has the capacity to emerge in new locations and also presents a potential bioterrorism threat. In the current study, the in vivo efficacy of T-705 was evaluated in Wistar-Furth rats infected with the virulent ZH501 strain of RVFV by the aerosol route. METHODOLOGY/PRINCIPAL FINDINGS: Wistar-Furth rats are highly susceptible to a rapidly lethal disease after parenteral or inhalational exposure to the pathogenic ZH501 strain of RVFV. In the current study, two experiments were performed: a dose-determination study and a delayed-treatment study. In both experiments, all untreated control rats succumbed to disease. Out of 72 total rats infected with RVFV and treated with T-705, only 6 succumbed to disease. The remaining 66 rats (92% survived lethal infection with no significant weight loss or fever. The 6 treated rats that succumbed survived significantly longer before succumbing to encephalitic disease. CONCLUSIONS/SIGNIFICANCE: Currently, there are no licensed antiviral drugs for treating RVF. Here, T-705 showed remarkable efficacy in a highly lethal rat model of Rift Valley Fever, even when given up to 48 hours post-infection. This is the first study to show protection of rats infected with the pathogenic ZH501 strain of RVFV. Our data suggest that T-705 has potential to be a broad-spectrum antiviral drug.

  13. Genomic sequence and virulence of clonal isolates of vaccinia virus Tiantan, the Chinese smallpox vaccine strain.

    Directory of Open Access Journals (Sweden)

    Qicheng Zhang

    Full Text Available Despite the worldwide eradication of smallpox in 1979, the potential bioterrorism threat from variola virus and the ongoing use of vaccinia virus (VACV as a vector for vaccine development argue for continued research on VACV. In China, the VACV Tiantan strain (TT was used in the smallpox eradication campaign. Its progeny strain is currently being used to develop a human immunodeficiency virus (HIV vaccine. Here we sequenced the full genomes of five TT clones isolated by plaque purification from the TT (752-1 viral stock. Phylogenetic analysis with other commonly used VACV strains showed that TT (752-1 and its clones clustered and exhibited higher sequence diversity than that found in Dryvax clones. The ∼190 kbp genomes of TT appeared to encode 273 open reading frames (ORFs. ORFs located in the middle of the genome were more conserved than those located at the two termini, where many virulence and immunomodulation associated genes reside. Several patterns of nucleotide changes including point mutations, insertions and deletions were identified. The polymorphisms in seven virulence-associated proteins and six immunomodulation-related proteins were analyzed. We also investigated the neuro- and skin- virulence of TT clones in mice and rabbits, respectively. The TT clones exhibited significantly less virulence than the New York City Board of Health (NYCBH strain, as evidenced by less extensive weight loss and morbidity in mice as well as produced smaller skin lesions and lower incidence of putrescence in rabbits. The complete genome sequences, ORF annotations, and phenotypic diversity yielded from this study aid our understanding of the Chinese historic TT strain and are useful for HIV vaccine projects employing TT as a vector.

  14. A loss of function analysis of host factors influencing Vaccinia virus replication by RNA interference.

    Directory of Open Access Journals (Sweden)

    Philippa M Beard

    Full Text Available Vaccinia virus (VACV is a large, cytoplasmic, double-stranded DNA virus that requires complex interactions with host proteins in order to replicate. To explore these interactions a functional high throughput small interfering RNA (siRNA screen targeting 6719 druggable cellular genes was undertaken to identify host factors (HF influencing the replication and spread of an eGFP-tagged VACV. The experimental design incorporated a low multiplicity of infection, thereby enhancing detection of cellular proteins involved in cell-to-cell spread of VACV. The screen revealed 153 pro- and 149 anti-viral HFs that strongly influenced VACV replication. These HFs were investigated further by comparisons with transcriptional profiling data sets and HFs identified in RNAi screens of other viruses. In addition, functional and pathway analysis of the entire screen was carried out to highlight cellular mechanisms involved in VACV replication. This revealed, as anticipated, that many pro-viral HFs are involved in translation of mRNA and, unexpectedly, suggested that a range of proteins involved in cellular transcriptional processes and several DNA repair pathways possess anti-viral activity. Multiple components of the AMPK complex were found to act as pro-viral HFs, while several septins, a group of highly conserved GTP binding proteins with a role in sequestering intracellular bacteria, were identified as strong anti-viral VACV HFs. This screen has identified novel and previously unexplored roles for cellular factors in poxvirus replication. This advancement in our understanding of the VACV life cycle provides a reliable knowledge base for the improvement of poxvirus-based vaccine vectors and development of anti-viral theraputics.

  15. Antibody against extracellular vaccinia virus (EV protects mice through complement and Fc receptors.

    Directory of Open Access Journals (Sweden)

    Matthew E Cohen

    Full Text Available Protein-based subunit smallpox vaccines have shown their potential as effective alternatives to live virus vaccines in animal model challenge studies. We vaccinated mice with combinations of three different vaccinia virus (VACV proteins (A33, B5, L1 and examined how the combined antibody responses to these proteins cooperate to effectively neutralize the extracellular virus (EV infectious form of VACV. Antibodies against these targets were generated in the presence or absence of CpG adjuvant so that Th1-biased antibody responses could be compared to Th2-biased responses to the proteins with aluminum hydroxide alone, specifically with interest in looking at the ability of anti-B5 and anti-A33 polyclonal antibodies (pAb to utilize complement-mediated neutralization in vitro. We found that neutralization of EV by anti-A33 or anti-B5 pAb can be enhanced in the presence of complement if Th1-biased antibody (IgG2a is generated. Mechanistic differences found for complement-mediated neutralization showed that anti-A33 antibodies likely result in virolysis, while anti-B5 antibodies with complement can neutralize by opsonization (coating. In vivo studies found that mice lacking the C3 protein of complement were less protected than wild-type mice after passive transfer of anti-B5 pAb or vaccination with B5. Passive transfer of anti-B5 pAb or monoclonal antibody into mice lacking Fc receptors (FcRs found that FcRs were also important in mediating protection. These results demonstrate that both complement and FcRs are important effector mechanisms for antibody-mediated protection from VACV challenge in mice.

  16. Structure of vaccinia virus thymidine kinase in complex with dTTP: insights for drug design

    Directory of Open Access Journals (Sweden)

    Balzarini Jan

    2006-10-01

    Full Text Available Abstract Background Development of countermeasures to bioterrorist threats such as those posed by the smallpox virus (variola, include vaccination and drug development. Selective activation of nucleoside analogues by virus-encoded thymidine (dThd kinases (TK represents one of the most successful strategies for antiviral chemotherapy as demonstrated for anti-herpes drugs. Vaccinia virus TK is a close orthologue of variola TK but also shares a relatively high sequence identity to human type 2 TK (hTK, thus achieving drug selectivity relative to the host enzyme is challenging. Results In order to identify any differences compared to hTK that may be exploitable in drug design, we have determined the crystal structure of VVTK, in complex with thymidine 5'-triphosphate (dTTP. Although most of the active site residues are conserved between hTK and VVTK, we observe a difference in conformation of residues Asp-43 and Arg-45. The equivalent residues in hTK hydrogen bond to dTTP, whereas in subunit D of VVTK, Asp-43 and Arg-45 adopt a different conformation preventing interaction with this nucleotide. Asp-43 and Arg-45 are present in a flexible loop, which is disordered in subunits A, B and C. The observed difference in conformation and flexibility may also explain the ability of VVTK to phosphorylate (South-methanocarbathymine whereas, in contrast, no substrate activity with hTK is reported for this compound. Conclusion The difference in conformation for Asp-43 and Arg-45 could thus be used in drug design to generate VVTK/Variola TK-selective nucleoside analogue substrates and/or inhibitors that have lower affinity for hTK.

  17. A vaccinia virus renaissance: new vaccine and immunotherapeutic uses after smallpox eradication.

    Science.gov (United States)

    Verardi, Paulo H; Titong, Allison; Hagen, Caitlin J

    2012-07-01

    In 1796, Edward Jenner introduced the concept of vaccination with cowpox virus, an Orthopoxvirus within the family Poxviridae that elicits cross protective immunity against related orthopoxviruses, including smallpox virus (variola virus). Over time, vaccinia virus (VACV) replaced cowpox virus as the smallpox vaccine, and vaccination efforts eventually led to the successful global eradication of smallpox in 1979. VACV has many characteristics that make it an excellent vaccine and that were crucial for the successful eradication of smallpox, including (1) its exceptional thermal stability (a very important but uncommon characteristic in live vaccines), (2) its ability to elicit strong humoral and cell-mediated immune responses, (3) the fact that it is easy to propagate, and (4) that it is not oncogenic, given that VACV replication occurs exclusively within the host cell cytoplasm and there is no evidence that the viral genome integrates into the host genome. Since the eradication of smallpox, VACV has experienced a renaissance of interest as a viral vector for the development of recombinant vaccines, immunotherapies, and oncolytic therapies, as well as the development of next-generation smallpox vaccines. This revival is mainly due to the successful use and extensive characterization of VACV as a vaccine during the smallpox eradication campaign, along with the ability to genetically manipulate its large dsDNA genome while retaining infectivity and immunogenicity, its wide mammalian host range, and its natural tropism for tumor cells that allows its use as an oncolytic vector. This review provides an overview of new uses of VACV that are currently being explored for the development of vaccines, immunotherapeutics, and oncolytic virotherapies.

  18. Tagging of the vaccinia virus protein F13 with mCherry causes aberrant virion morphogenesis.

    Science.gov (United States)

    Carpentier, David C J; Hollinshead, Michael S; Ewles, Helen A; Lee, Stacey-Ann; Smith, Geoffrey L

    2017-09-20

    Vaccinia virus produces two distinct infectious virions; the single-enveloped intracellular mature virus (IMV), which remains in the cell until cell lysis, and the double-enveloped extracellular enveloped virus (EEV), which mediates virus spread. The latter is derived from a triple-enveloped intracellular enveloped virus (IEV) precursor, which is transported to the cell periphery by the kinesin-1 motor complex. This transport involves the viral protein A36 as well as F12 and E2. A36 is an integral membrane protein associated with the outer virus envelope and is the only known direct link between virion and kinesin-1 complex. Yet in the absence of A36 virion egress still occurs on microtubules, albeit at reduced efficiency. In this paper double-fluorescent labelling of the capsid protein A5 and outer-envelope protein F13 was exploited to visualize IEV transport by live-cell imaging in the absence of either A36 or F12. During the generation of recombinant viruses expressing both A5-GFP and F13-mCherry a plaque size defect was identified that was particularly severe in viruses lacking A36. Electron microscopy showed that this phenotype was caused by abnormal wrapping of IMV to form IEV, and this resulted in reduced virus egress to the cell surface. The aberrant wrapping phenotype suggests that the fluorescent fusion protein interferes with an interaction of F13 with the IMV surface that is required for tight association between IMVs and wrapping membranes. The severity of this defect suggests that these viruses are imperfect tools for characterizing virus egress.

  19. An E2-F12 complex is required for intracellular enveloped virus morphogenesis during vaccinia infection.

    Science.gov (United States)

    Dodding, Mark P; Newsome, Timothy P; Collinson, Lucy M; Edwards, Ceri; Way, Michael

    2009-05-01

    The vaccinia virus protein, F12, has been suggested to play an important role in microtubule-based transport of intracellular enveloped virus (IEV). We found that GFP-F12 is recruited to IEV moving on microtubules but is released from virus particles when they switch to actin-based motility. In the absence of F12, although the majority of IEV remain close to their peri-nuclear site of assembly, a small number of IEV still move with linear trajectories at speeds of 0.85 μm s(-1) , consistent with microtubule transport. Using a recombinant virus expressing GST-F12, we found that the viral protein E2 interacts directly with F12. In infected cells, GFP-E2 is observed on moving IEV as well as in the Golgi region, but is not associated with actin tails. In the absence of E2L, IEV accumulate in the peri-nuclear region and F12 is not recruited. Conversely, GFP-E2 is not observed on IEV in the absence of F12. Ultra-structural analysis of ΔE2L- and ΔF12L-infected cells reveals that loss of either protein results in defects in membrane wrapping during IEV formation. We suggest that E2 and F12 function as a complex that is necessary for IEV morphogenesis prior to their microtubule-based transport towards the plasma membrane. © 2009 The Authors. Journal compilation © 2009 Blackwell Publishing Ltd.

  20. Crystal structure of vaccinia virus uracil-DNA glycosylase reveals dimeric assembly

    Directory of Open Access Journals (Sweden)

    DeLucas Lawrence

    2007-07-01

    Full Text Available Abstract Background Uracil-DNA glycosylases (UDGs catalyze excision of uracil from DNA. Vaccinia virus, which is the prototype of poxviruses, encodes a UDG (vvUDG that is significantly different from the UDGs of other organisms in primary, secondary and tertiary structure and characteristic motifs. It adopted a novel catalysis-independent role in DNA replication that involves interaction with a viral protein, A20, to form the processivity factor. UDG:A20 association is essential for assembling of the processive DNA polymerase complex. The structure of the protein must have provisions for such interactions with A20. This paper provides the first glimpse into the structure of a poxvirus UDG. Results Results of dynamic light scattering experiments and native size exclusion chromatography showed that vvUDG is a dimer in solution. The dimeric assembly is also maintained in two crystal forms. The core of vvUDG is reasonably well conserved but the structure contains one additional β-sheet at each terminus. A glycerol molecule is found in the active site of the enzyme in both crystal forms. Interaction of this glycerol molecule with the protein possibly mimics the enzyme-substrate (uracil interactions. Conclusion The crystal structures reveal several distinctive features of vvUDG. The new structural features may have evolved for adopting novel functions in the replication machinery of poxviruses. The mode of interaction between the subunits in the dimers suggests a possible model for binding to its partner and the nature of the processivity factor in the polymerase complex.

  1. Cellular expression of a functional nodavirus RNA replicon from vaccinia virus vectors.

    Science.gov (United States)

    Ball, L A

    1992-04-01

    RNA replication provides a powerful means for the amplification of RNA, but to date it has been found to occur naturally only among RNA viruses. In an attempt to harness this process for the amplification of heterologous mRNAs, both an RNA replicase and its corresponding RNA templates have been expressed in functional form, using vaccinia virus-bacteriophage T7 RNA polymerase vectors. Plasmids were constructed which contained in 5'-to-3' order (i) a bacteriophage T7 promoter; (ii) a full-length cDNA encoding either the RNA replicase (RNA 1) or the coat protein (RNA 2) of flock house virus (FHV), (iii) a cDNA sequence that encoded the self-cleaving ribozyme of satellite tobacco ringspot virus, and (iv) a T7 transcriptional terminator. Both in vitro and in vivo, circular plasmids of this structure were transcribed by T7 RNA polymerase to produce RNAs with sizes that closely resembled those of the two authentic FHV genomic RNAs, RNA 1 and RNA 2. In baby hamster kidney cells that expressed authentic FHV RNA replicase, the RNA 2 (coat protein) transcripts were accurately replicated. Moreover, the RNA 1 (replicase) transcripts directed the synthesis of an enzyme that could replicate not only authentic virion-derived FHV RNA but also the plasmid-derived transcripts themselves. Under the latter conditions, replicative amplification of the RNA transcripts ensued and resulted in a high rate of synthesis of the encoded proteins. This successful expression from a DNA vector of the complex biological process of RNA replication will greatly facilitate studies of its mechanism and is a major step towards the goal of harnessing RNA replication for mRNA amplification.

  2. Cleavage of Dicer protein by I7 protease during vaccinia virus infection.

    Directory of Open Access Journals (Sweden)

    Jhih-Si Chen

    Full Text Available Dicer is the key component in the miRNA pathway. Degradation of Dicer protein is facilitated during vaccinia virus (VV infection. A C-terminal cleaved product of Dicer protein was detected in the presence of MG132 during VV infection. Thus, it is possible that Dicer protein is cleaved by a viral protease followed by proteasome degradation of the cleaved product. There is a potential I7 protease cleavage site in the C-terminus of Dicer protein. Indeed, reduction of Dicer protein was detected when Dicer was co-expressed with I7 protease but not with an I7 protease mutant protein lack of the protease activity. Mutation of the potential I7 cleavage site in the C-terminus of Dicer protein resisted its degradation during VV infection. Furthermore, Dicer protein was reduced dramatically by recombinant VV vI7Li after the induction of I7 protease. If VV could facilitate the degradation of Dicer protein, the process of miRNA should be affected by VV infection. Indeed, accumulation of precursor miR122 was detected after VV infection or I7 protease expression. Reduction of miR122 would result in the suppression of HCV sub-genomic RNA replication, and, in turn, the amount of viral proteins. As expected, significant reduction of HCVNS5A protein was detected after VV infection and I7 protease expression. Therefore, our results suggest that VV could cleave Dicer protein through I7 protease to facilitate Dicer degradation, and in turn, suppress the processing of miRNAs. Effect of Dicer protein on VV replication was also studied. Exogenous expression of Dicer protein suppresses VV replication slightly while knockdown of Dicer protein does not affect VV replication significantly.

  3. Apoptosis and necrosis in vaccinia virus-infected HeLa G and BSC-40 cells.

    Science.gov (United States)

    Liskova, Jana; Knitlova, Jarmila; Honner, Richard; Melkova, Zora

    2011-09-01

    In most cells, vaccinia virus (VACV) infection is considered to cause a lytic cell death, an equivalent of necrosis. However, upon infection of the epithelial cell lines HeLa G and BSC-40 with VACV strain Western Reserve (WR), we have previously observed an increased activation of and activity attributable to caspases, a typical sign of apoptosis. In this paper, we have further analyzed the type of cell death in VACV-infected cells HeLa G and BSC-40. In a cell-based flow cytometric assay, we showed a specific activation of caspase-2 and 4 in HeLa G and BSC-40 cells infected with VACV, strain WR, while we did not find any effects of inhibitors of calpain and cathepsin D and E. The actual activity of the two caspases, but also of caspase-3, was then confirmed in lysates of infected HeLa G, but not in BSC-40 cells. Accordingly, poly(ADP)-ribose polymerase (PARP) cleavage was found increased only in infected HeLa G cells. Consequently, we have determined morphological features of apoptosis and/or activity of the executioner caspase-3 in infected HeLa G cells in situ, while only a background apoptosis was observed in infected BSC-40 cells. Finally, vaccination strains Dryvax and Praha were found to induce apoptosis in both HeLa G and BSC-40 cells, as characterized morphologically and by PARP cleavage. These findings may be important for understanding the differences in VACV-host interactions and post-vaccination complications in different individuals. Copyright © 2011 Elsevier B.V. All rights reserved.

  4. Efficacy of delayed brincidofovir treatment against a lethal rabbitpox virus challenge in New Zealand White rabbits.

    Science.gov (United States)

    Grossi, Irma M; Foster, Scott A; Gainey, Melicia R; Krile, Robert T; Dunn, John A; Brundage, Thomas; Khouri, Jody M

    2017-07-01

    In the event of a bioterror attack with variola virus (smallpox), exposure may only be identified following onset of fever. To determine if antiviral therapy with brincidofovir (BCV; CMX001) initiated at, or following, onset of fever could prevent severe illness and death, a lethal rabbitpox model was used. BCV is in advanced development as an antiviral for the treatment of smallpox under the US Food and Drug Administration's 'Animal Rule'. This pivotal study assessed the efficacy of immediate versus delayed treatment with BCV following onset of symptomatic disease in New Zealand White rabbits intradermally inoculated with a lethal rabbitpox virus (RPXV), strain Utrecht. Infected rabbits with confirmed fever were randomized to blinded treatment with placebo, BCV, or BCV delayed by 24, 48, or 72 h. The primary objective evaluated the survival benefit with BCV treatment. The assessment of reduction in the severity and progression of clinical events associated with RPXV were secondary objectives. Clinically and statistically significant reductions in mortality were observed when BCV was initiated up to 48 h following the onset of fever; survival rates were 100%, 93%, and 93% in the immediate treatment, 24-h, and 48-h delayed treatment groups, respectively, versus 48% in the placebo group (p smallpox outbreak when vaccination is contraindicated or when diagnosis follows the appearance of clinical signs and symptoms. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Association between overall environmental quality and lung cancer survival

    Science.gov (United States)

    Lung cancer remains one of the most prevalent and lethal cancers in the United States. Individual environmental exposures have been associated with lung cancer incidence. However, the impact of cumulative environmental exposures on survival is not well understood. To address this...

  6. A Combination of Pre- and Post-Exposure Ascorbic Acid Rescues Mice from Radiation-Induced Lethal Gastrointestinal Damage

    Science.gov (United States)

    Ito, Yasutoshi; Kinoshita, Manabu; Yamamoto, Tetsuo; Sato, Tomohito; Obara, Takeyuki; Saitoh, Daizoh; Seki, Shuhji; Takahashi, Yukihiro

    2013-01-01

    The development of an effective therapy for radiation-induced gastrointestinal damage is important, because it is currently a major complication of treatment and there are few effective therapies available. Although we have recently demonstrated that pretreatment with ascorbic acid attenuates lethal gastrointestinal damage in irradiated mice, more than half of mice eventually died, thus indicating that better approach was needed. We then investigated a more effective therapy for radiation-induced gastrointestinal damage. Mice receiving abdominal radiation at 13 Gy were orally administered ascorbic acid (250 mg/kg/day) for three days before radiation (pretreatment), one shot of engulfment (250 mg/kg) at 8 h before radiation, or were administered the agent for seven days after radiation (post-treatment). None of the control mice survived the abdominal radiation at 13 Gy due to severe gastrointestinal damage (without bone marrow damage). Neither pretreatment with ascorbic acid (20% survival), engulfment (20%), nor post-treatment (0%) was effective in irradiated mice. However, combination therapy using ascorbic acid, including pretreatment, engulfment and post-treatment, rescued all of the mice from lethal abdominal radiation, and was accompanied by remarkable improvements in the gastrointestinal damage (100% survival). Omitting post-treatment from the combination therapy with ascorbic acid markedly reduced the mouse survival (20% survival), suggesting the importance of post-treatment with ascorbic acid. Combination therapy with ascorbic acid may be a potent therapeutic tool for radiation-induced gastrointestinal damage. PMID:24084715

  7. Lethal and sub-lethal responses of native freshwater mussels exposed to granular Bayluscide®, a sea lamprey larvicide

    Science.gov (United States)

    Newton, Teresa; Boogaard, Michael A.; Gray, Brian R.; Hubert, Terrance D.; Schloesser, Nicholas

    2017-01-01

    The invasive sea lamprey (Petromyzon marinus) poses a substantial threat to fish communities in the Great Lakes. Efforts to control sea lamprey populations typically involve treating tributary streams with lampricides on a recurring cycle. The presence of a substantial population of larval sea lampreys in the aquatic corridor between Lakes Huron and Erie prompted managers to propose a treatment using the granular formulation of Bayluscide® that targets larval sea lampreys that reside in sediments. However, these treatments could cause adverse effects on native freshwater mussels—imperiled animals that also reside in sediments. We estimated the risk of mortality and sub-lethal effects among eight species of adult and sub-adult mussels exposed to Bayluscide® for durations up to 8 h to mimic field applications. Mortality was appreciable in some species, especially in sub-adults (range, 23–51%). The lethal and sub-lethal effects were positively associated with the duration of exposure in most species and life stage combinations. Estimates of the median time of exposure that resulted in lethal and sub-lethal effects suggest that sub-adults were often affected by Bayluscide® earlier than adults. Siphoning activity and burrowing position of mussels during exposure may have moderated the uptake of Bayluscide® and may have influenced lethal and sub-lethal responses. Given that the various species and life stages were differentially affected, it will be difficult to predict the effects of Bayluscide® treatments on mussels.

  8. Use of Vaccinia Virus Smallpox Vaccine in Laboratory and Health Care Personnel at Risk for Occupational Exposure to Orthopoxviruses - Recommendations of the Advisory Committee on Immunization Practices (ACIP), 2015.

    Science.gov (United States)

    Petersen, Brett W; Harms, Tiara J; Reynolds, Mary G; Harrison, Lee H

    2016-03-18

    On June 25, 2015, the Advisory Committee on Immunization Practices (ACIP) recommended routine vaccination with live smallpox (vaccinia) vaccine (ACAM2000) for laboratory personnel who directly handle 1) cultures or 2) animals contaminated or infected with replication-competent vaccinia virus, recombinant vaccinia viruses derived from replication-competent vaccinia strains (i.e., those that are capable of causing clinical infection and producing infectious virus in humans), or other orthopoxviruses that infect humans (e.g., monkeypox, cowpox, and variola) (recommendation category: A, evidence type 2 [Box]). Health care personnel (e.g., physicians and nurses) who currently treat or anticipate treating patients with vaccinia virus infections and whose contact with replication-competent vaccinia viruses is limited to contaminated materials (e.g., dressings) and persons administering ACAM2000 smallpox vaccine who adhere to appropriate infection prevention measures can be offered vaccination with ACAM2000 (recommendation category: B, evidence type 2 [Box]). These revised recommendations update the previous ACIP recommendations for nonemergency use of vaccinia virus smallpox vaccine for laboratory and health care personnel at risk for occupational exposure to orthopoxviruses (1). Since 2001, when the previous ACIP recommendations were developed, ACAM2000 has replaced Dryvax as the only smallpox vaccine licensed by the U.S. Food and Drug Administration (FDA) and available for use in the United States (2). These recommendations contain information on ACAM2000 and its use in laboratory and health care personnel at risk for occupational exposure to orthopoxviruses.

  9. Genetics Home Reference: platyspondylic lethal skeletal dysplasia, Torrance type

    Science.gov (United States)

    ... cause platyspondylic lethal skeletal dysplasia, torrance type, and define a novel subfamily within the type 2 collagenopathies. ... What is newborn screening? New Pages type 2 diabetes mitochondrial complex I deficiency mitochondrial complex V deficiency ...

  10. Prediction of Lethality in Suicide Attempts: Gender Matters.

    Science.gov (United States)

    Choo, Carol C; Harris, Keith M; Ho, Roger C

    2017-01-01

    This study explores gender differences in lethality of suicide attempts. Three years of medical records related to suicide attempters ( N = 666) were subjected to analysis. Of the sample, 69.2% were female, 30.8% male; 63.8% Chinese, 15.8% Indian, and 15.0 % Malay. Ages ranged from 10 to 85 years old ( M = 29.7, SD = 16.1). More males than females made attempts with high perceived lethality (χ2 = 12.10, p attempts and more than 80% of high perceived lethality attempts. Suicide intent and opportunity for rescue were significant predictors for both measures of lethality. Gender differences were examined. Findings were discussed in regard to implications in suicide assessments and interventions.

  11. Lethal effects of short-wavelength visible light on insects

    OpenAIRE

    Hori, Masatoshi; Shibuya, Kazuki; Sato, Mitsunari; Saito, Yoshino

    2014-01-01

    We investigated the lethal effects of visible light on insects by using light-emitting diodes (LEDs). The toxic effects of ultraviolet (UV) light, particularly shortwave (i.e., UVB and UVC) light, on organisms are well known. However, the effects of irradiation with visible light remain unclear, although shorter wavelengths are known to be more lethal. Irradiation with visible light is not thought to cause mortality in complex animals including insects. Here, however, we found that irradiatio...

  12. Estimation of median human lethal radiation dose computed from data on occupants of reinforced concrete structures in Nagasaki, Japan.

    Science.gov (United States)

    Levin, S G; Young, R W; Stohler, R L

    1992-11-01

    This paper presents an estimate of the median lethal dose for humans exposed to total-body irradiation and not subsequently treated for radiation sickness. The median lethal dose was estimated from calculated doses to young adults who were inside two reinforced concrete buildings that remained standing in Nagasaki after the atomic detonation. The individuals in this study, none of whom have previously had calculated doses, were identified from a detailed survey done previously. Radiation dose to the bone marrow, which was taken as the critical radiation site, was calculated for each individual by the Engineering Physics and Mathematics Division of the Oak Ridge National Laboratory using a new three-dimensional discrete-ordinates radiation transport code that was developed and validated for this study using the latest site geometry, radiation yield, and spectra data. The study cohort consisted of 75 individuals who either survived > 60 d or died between the second and 60th d postirradiation due to radiation injury, without burns or other serious injury. Median lethal dose estimates were calculated using both logarithmic (2.9 Gy) and linear (3.4 Gy) dose scales. Both calculations, which met statistical validity tests, support previous estimates of the median lethal dose based solely on human data, which cluster around 3 Gy.

  13. Protective Effect of Surfactant Protein D in Pulmonary Vaccinia Virus Infection: Implication of A27 Viral Protein

    Directory of Open Access Journals (Sweden)

    Julien Perino

    2013-03-01

    Full Text Available Vaccinia virus (VACV was used as a surrogate of variola virus (VARV (genus Orthopoxvirus, the causative agent of smallpox, to study Orthopoxvirus infection. VARV is principally transmitted between humans by aerosol droplets. Once inhaled, VARV first infects the respiratory tract where it could encounter surfactant components, such as soluble pattern recognition receptors. Surfactant protein D (SP-D, constitutively present in the lining fluids of the respiratory tract, plays important roles in innate host defense against virus infection. We investigated the role of SP-D in VACV infection and studied the A27 viral protein involvement in the interaction with SP-D. Interaction between SP-D and VACV caused viral inhibition in a lung cell model. Interaction of SP-D with VACV was mediated by the A27 viral protein. Binding required Ca2+ and interactions were blocked in the presence of excess of SP-D saccharide ligands. A27, which lacks glycosylation, directly interacted with SP-D. The interaction between SP-D and the viral particle was also observed using electron microscopy. Infection of mice lacking SP-D (SP-D-/- resulted in increased mortality compared to SP-D+/+ mice. Altogether, our data show that SP-D participates in host defense against the vaccinia virus infection and that the interaction occurs with the viral surface protein A27.

  14. Safety and biodistribution of a double-deleted oncolytic vaccinia virus encoding CD40 ligand in laboratory Beagles

    Directory of Open Access Journals (Sweden)

    Karoliina Autio

    2014-01-01

    Full Text Available We evaluated adverse events, biodistribution and shedding of oncolytic vaccinia virus encoding CD40 ligand in two Beagles, in preparation for a phase 1 trial in canine cancer patients. Dog 1 received one dose of vaccinia virus and was euthanized 24 hours afterwards, while dog 2 received virus four times once weekly and was euthanized 7 days after that. Dogs were monitored for adverse events and underwent a detailed postmortem examination. Blood, saliva, urine, feces, and organs were collected for virus detection. Dog 1 had mild fever and lethargy while dog 2 experienced a possible seizure 5.5 hours after first virus administration. Viral DNA declined quickly in the blood after virus administration in both dogs but was still detectable 1 week later by quantitative polymerase chain reaction. Only samples taken directly after virus infusion contained infectious virus. Small amounts of viral DNA, but no infectious virus, were detected in a few saliva and urine samples. Necropsies did not reveal any relevant pathological changes and virus DNA was detected mainly in the spleen. The dogs in the study did not have cancer, and thus adverse events could be more common and viral load higher in dogs with tumors which allow viral amplification.

  15. Vaccinia Virus Protein F12 Associates with Intracellular Enveloped Virions through an Interaction with A36▿

    Science.gov (United States)

    Johnston, Sara C.; Ward, Brian M.

    2009-01-01

    Vaccinia virus is the prototypical member of the family Poxviridae. Three morphologically distinct forms are produced during infection: intracellular mature virions (IMV), intracellular enveloped virions (IEV), and extracellular enveloped virions (EEV). Two viral proteins, F12 and A36, are found exclusively on IEV but not on IMV and EEV. Analysis of membranes from infected cells showed that F12 was only associated with membranes and is not an integral membrane protein. A yeast two-hybrid assay revealed an interaction between amino acids 351 to 458 of F12 and amino acids 91 to 111 of A36. We generated a recombinant vaccinia virus that expresses an F12, which lacks residues 351 to 458. Characterization of this recombinant revealed a small-plaque phenotype and a subsequent defect in virus release similar to a recombinant virus that had F12L deleted. In addition, F12 lacking residues 351 to 458 was unable to associate with membranes in infected cells. These results suggest that F12 associates with IEV through an interaction with A36 and that this interaction is critical for the function of F12 during viral egress. PMID:19052096

  16. Expression of DAI by an oncolytic vaccinia virus boosts the immunogenicity of the virus and enhances antitumor immunity

    Directory of Open Access Journals (Sweden)

    Mari Hirvinen

    2016-01-01

    Full Text Available In oncolytic virotherapy, the ability of the virus to activate the immune system is a key attribute with regard to long-term antitumor effects. Vaccinia viruses bear one of the strongest oncolytic activities among all oncolytic viruses. However, its capacity for stimulation of antitumor immunity is not optimal, mainly due to its immunosuppressive nature. To overcome this problem, we developed an oncolytic VV that expresses intracellular pattern recognition receptor DNA-dependent activator of IFN-regulatory factors (DAI to boost the innate immune system and to activate adaptive immune cells in the tumor. We showed that infection with DAI-expressing VV increases expression of several genes related to important immunological pathways. Treatment with DAI-armed VV resulted in significant reduction in the size of syngeneic melanoma tumors in mice. When the mice were rechallenged with the same tumor, DAI-VV-treated mice completely rejected growth of the new tumor, which indicates immunity established against the tumor. We also showed enhanced control of growth of human melanoma tumors and elevated levels of human T-cells in DAI-VV-treated mice humanized with human peripheral blood mononuclear cells. We conclude that expression of DAI by an oncolytic VV is a promising way to amplify the vaccine potency of an oncolytic vaccinia virus to trigger the innate—and eventually the long-lasting adaptive immunity against cancer.

  17. Biophysical analysis of bacterial and viral systems. A shock tube study of bio-aerosols and a correlated AFM/nanosims investigation of vaccinia virus

    Energy Technology Data Exchange (ETDEWEB)

    Gates, Sean Damien [Stanford Univ., CA (United States)

    2013-05-01

    The work presented herein is concerned with the development of biophysical methodology designed to address pertinent questions regarding the behavior and structure of select pathogenic agents. Two distinct studies are documented: a shock tube analysis of endospore-laden bio-aerosols and a correlated AFM/NanoSIMS study of the structure of vaccinia virus.

  18. Mutational analysis of the resolution sequence of vaccinia virus DNA: essential sequence consists of two separate AT-rich regions highly conserved among poxviruses.

    Science.gov (United States)

    Merchlinsky, M

    1990-01-01

    In replicative forms of vaccinia virus DNA, the unit genomes are connected by palindromic junction fragments that are resolved into mature viral genomes with hairpin termini. Bacterial plasmids containing the junction fragment for vaccinia virus or Shope fibroma virus were converted into linear minichromosomes of vector sequence flanked by poxvirus hairpin loops after transfection into infected cells. Analysis of a series of symmetrical deletion mutations demonstrated that in vaccinia virus the presence of the DNA sequence ATTTAGTGTCTAGAAAAAAA on both sides of the apical segment of the concatemer junction is crucial for resolution. To determine the precise architecture of the resolution site, a series of site-directed mutations within this tract of nucleotides were made and the relative contribution of each nucleotide to the efficaciousness of resolution was determined. The nucleotide sequence necessary for the resolution of the vaccinia virus concatemer junction, (A/T)TTT(A/G)N7-9AAAAAAA, is highly conserved among poxviruses and found proximal to the hairpin loop in the genomes of members of the Leporipoxvirus, Avipoxvirus, and Capripoxvirus genera. Images PMID:2398534

  19. High-affinity human leucocyte antigen class I binding variola-derived peptides induce CD4(+) T cell responses more than 30 years post-vaccinia virus vaccination

    DEFF Research Database (Denmark)

    Wang, M.; Tang, Sheila Tuyet; Lund, Ole

    2009-01-01

    Interferon-gamma secreting T lymphocytes against pox virus-derived synthetic 9-mer peptides were tested by enzyme-linked immunospot in peripheral blood of individuals vaccinated with vaccinia virus more than 30 years ago. The peptides were characterized biochemically as high-affinity human...

  20. Molecular network, pathway, and functional analysis of time-dependent gene changes associated with pancreatic cancer susceptibility to oncolytic vaccinia virotherapy

    Directory of Open Access Journals (Sweden)

    Dana Haddad

    2016-01-01

    Conclusions: Our study reveals the ability to assess time-dependent changes in gene expression patterns in pancreatic cancer cells associated with infection and susceptibility to vaccinia viruses. This suggests that molecular assays may be useful to develop safer and more efficacious oncolyticvirotherapies and support the idea that these treatments may target pathways implicated in pancreatic cancer resistance to conventional therapies.

  1. Effect of selected anti-inflammatory drugs on the lethal actions of Leiurus quinquestriatus venom

    Directory of Open Access Journals (Sweden)

    N. A. Abdoon

    2006-01-01

    Full Text Available The cumulative actions of scorpion neurotoxins are complex and may be traced to activation of different ion channels with subsequent release of various transmitters and modulators including inflammatory mediators. This could lead to various pathological manifestations such as acute respiratory distress syndrome (ARDS, systemic inflammatory response syndrome (SIRS, and multiple organ failure (MOF. Several approaches have been advocated to treat the multitude of scorpion-venom-elicited pathological changes. However, few have tried to combat the venom-induced effects on the inflammatory process, which manifest as ARDS, SIDS and MOF. Thus, the aim of this study was to determine the capability of inhibitors of different steps of the inflammatory sequence of events in scorpion envenomation to ameliorate the detrimental action of the venom and prolong survival of mice injected with Leiurus quinquestriatus quinquestriatus (LQQ venom. Animals were divided into groups (n = 10 and given montelukast (10 or 20 mg.kg-1, orally, hydrocortisone (5 or 10 mg.kg-1, intravenously or indomethacin (10 or 20 mg kg-1, intravenously. Then, all animals were subcutaneously injected with either 0.25 or 0.3 mg.kg-1 LQQ venom. Signs and symptoms of envenomation were recorded and survival percentages after 24 hours as well as survival time were determined in each group. To analyze data, we utilized Covariance Wilcoxon survival statistics and survival distribution curves. In general, when compared to venom alone, administration of montelukast (p<0.001, hydrocortisone (p<0.05 and indomethacin (p<0.05 prolonged survival time and increased the percentage of surviving animals per group, with montelukast exhibiting the greatest protecting power. Thus, anti-inflammatory drugs may play an important role in protection against the lethal effects of scorpion venoms.

  2. Studying early lethality of 45,XO (Turner's syndrome embryos using human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Achia Urbach

    Full Text Available Turner's syndrome (caused by monosomy of chromosome X is one of the most common chromosomal abnormalities in females. Although 3% of all pregnancies start with XO embryos, 99% of these pregnancies terminate spontaneously during the first trimester. The common genetic explanation for the early lethality of monosomy X embryos, as well as the phenotype of surviving individuals is haploinsufficiency of pseudoautosomal genes on the X chromosome. Another possible mechanism is null expression of imprinted genes on the X chromosome due to the loss of the expressed allele. In contrast to humans, XO mice are viable, and fertile. Thus, neither cells from patients nor mouse models can be used in order to study the cause of early lethality in XO embryos. Human embryonic stem cells (HESCs can differentiate in culture into cells from the three embryonic germ layers as well as into extraembryonic cells. These cells have been shown to have great value in modeling human developmental genetic disorders. In order to study the reasons for the early lethality of 45,XO embryos we have isolated HESCs that have spontaneously lost one of their sex chromosomes. To examine the possibility that imprinted genes on the X chromosome play a role in the phenotype of XO embryos, we have identified genes that were no longer expressed in the mutant cells. None of these genes showed a monoallelic expression in XX cells, implying that imprinting is not playing a major role in the phenotype of XO embryos. To suggest an explanation for the embryonic lethality caused by monosomy X, we have differentiated the XO HESCs in vitro an in vivo. DNA microarray analysis of the differentiated cells enabled us to compare the expression of tissue specific genes in XO and XX cells. The tissue that showed the most significant differences between the clones was the placenta. Many placental genes are expressed at much higher levels in XX cells in compare to XO cells. Thus, we suggest that abnormal

  3. Inferring synthetic lethal interactions from mutual exclusivity of genetic events in cancer.

    Science.gov (United States)

    Srihari, Sriganesh; Singla, Jitin; Wong, Limsoon; Ragan, Mark A

    2015-10-01

    Synthetic lethality (SL) refers to the genetic interaction between two or more genes where only their co-alteration (e.g. by mutations, amplifications or deletions) results in cell death. In recent years, SL has emerged as an attractive therapeutic strategy against cancer: by targeting the SL partners of altered genes in cancer cells, these cells can be selectively killed while sparing the normal cells. Consequently, a number of studies have attempted prediction of SL interactions in human, a majority by extrapolating SL interactions inferred through large-scale screens in model organisms. However, these predicted SL interactions either do not hold in human cells or do not include genes that are (frequently) altered in human cancers, and are therefore not attractive in the context of cancer therapy. Here, we develop a computational approach to infer SL interactions directly from frequently altered genes in human cancers. It is based on the observation that pairs of genes that are altered in a (significantly) mutually exclusive manner in cancers are likely to constitute lethal combinations. Using genomic copy-number and gene-expression data from four cancers, breast, prostate, ovarian and uterine (total 3980 samples) from The Cancer Genome Atlas, we identify 718 genes that are frequently amplified or upregulated, and are likely to be synthetic lethal with six key DNA-damage response (DDR) genes in these cancers. By comparing with published data on gene essentiality (~16000 genes) from ten DDR-deficient cancer cell lines, we show that our identified genes are enriched among the top quartile of essential genes in these cell lines, implying that our inferred genes are highly likely to be (synthetic) lethal upon knockdown in these cell lines. Among the inferred targets are tousled-like kinase 2 (TLK2) and the deubiquitinating enzyme ubiquitin-specific-processing protease 7 (USP7) whose overexpression correlates with poor survival in cancers. Mutual exclusivity between

  4. Lethality of MalE-LacZ hybrid protein shares mechanistic attributes with oxidative component of antibiotic lethality.

    Science.gov (United States)

    Takahashi, Noriko; Gruber, Charley C; Yang, Jason H; Liu, Xiaobo; Braff, Dana; Yashaswini, Chittampalli N; Bhubhanil, Sakkarin; Furuta, Yoshikazu; Andreescu, Silvana; Collins, James J; Walker, Graham C

    2017-08-09

    Downstream metabolic events can contribute to the lethality of drugs or agents that interact with a primary cellular target. In bacteria, the production of reactive oxygen species (ROS) has been associated with the lethal effects of a variety of stresses including bactericidal antibiotics, but the relative contribution of this oxidative component to cell death depends on a variety of factors. Experimental evidence has suggested that unresolvable DNA problems caused by incorporation of oxidized nucleotides into nascent DNA followed by incomplete base excision repair contribute to the ROS-dependent component of antibiotic lethality. Expression of the chimeric periplasmic-cytoplasmic MalE-LacZ72-47 protein is an historically important lethal stress originally identified during seminal genetic experiments that defined the SecY-dependent protein translocation system. Multiple, independent lines of evidence presented here indicate that the predominant mechanism for MalE-LacZ lethality shares attributes with the ROS-dependent component of antibiotic lethality. MalE-LacZ lethality requires molecular oxygen, and its expression induces ROS production. The increased susceptibility of mutants sensitive to oxidative stress to MalE-LacZ lethality indicates that ROS contribute causally to cell death rather than simply being produced by dying cells. Observations that support the proposed mechanism of cell death include MalE-LacZ expression being bacteriostatic rather than bactericidal in cells that overexpress MutT, a nucleotide sanitizer that hydrolyzes 8-oxo-dGTP to the monophosphate, or that lack MutM and MutY, DNA glycosylases that process base pairs involving 8-oxo-dGTP. Our studies suggest stress-induced physiological changes that favor this mode of ROS-dependent death.

  5. Littoral Combat Ship: Knowledge of Survivability and Lethality Capabilities Needed Prior to Making Major Funding Decisions

    Science.gov (United States)

    2015-12-01

    aluminum through a die using a hydraulic press. While extrusions have industrial advantages, the Navy has no experience with the damage responses from...McCain Chairman The Honorable Jack Reed Ranking Member Committee on Armed Services United States Senate The Honorable Thad Cochran Chairman The

  6. Administration of isoferulic acid improved the survival rate of lethal influenza virus pneumonia in mice

    Directory of Open Access Journals (Sweden)

    Shinya Sakai

    2001-01-01

    Full Text Available Background: Isoferulic acid (IFA is a main active ingredient of the rhizoma of Cimicifuga heracleifolia, which is used frequently in Japanese traditional medicine as an anti-inflammatory drug. It has been revealed that IFA inhibits the production of macrophage inflammatory protein-2 (MIP-2, which is a murine counterpart of the chemokine family that may contribute to the pathogenesis of inflammatory diseases through the chemotactic activity for inflammatory and immune effector cells.

  7. Treatment of Irradiated Mice with High-Dose Ascorbic Acid Reduced Lethality

    Science.gov (United States)

    Sato, Tomohito; Kinoshita, Manabu; Yamamoto, Tetsuo; Ito, Masataka; Nishida, Takafumi; Takeuchi, Masaru; Saitoh, Daizoh; Seki, Shuhji; Mukai, Yasuo

    2015-01-01

    Ascorbic acid is an effective antioxidant and free radical scavenger. Therefore, it is expected that ascorbic acid should act as a radioprotectant. We investigated the effects of post-radiation treatment with ascorbic acid on mouse survival. Mice received whole body irradiation (WBI) followed by intraperitoneal administration of ascorbic acid. Administration of 3 g/kg of ascorbic acid immediately after exposure significantly increased mouse survival after WBI at 7 to 8 Gy. However, administration of less than 3 g/kg of ascorbic acid was ineffective, and 4 or more g/kg was harmful to the mice. Post-exposure treatment with 3 g/kg of ascorbic acid reduced radiation-induced apoptosis in bone marrow cells and restored hematopoietic function. Treatment with ascorbic acid (3 g/kg) up to 24 h (1, 6, 12, or 24 h) after WBI at 7.5 Gy effectively improved mouse survival; however, treatments beyond 36 h were ineffective. Two treatments with ascorbic acid (1.5 g/kg × 2, immediately and 24 h after radiation, 3 g/kg in total) also improved mouse survival after WBI at 7.5 Gy, accompanied with suppression of radiation-induced free radical metabolites. In conclusion, administration of high-dose ascorbic acid might reduce radiation lethality in mice even after exposure. PMID:25651298

  8. Comparison of host cell gene expression in cowpox, monkeypox or vaccinia virus-infected cells reveals virus-specific regulation of immune response genes.

    Science.gov (United States)

    Bourquain, Daniel; Dabrowski, Piotr Wojtek; Nitsche, Andreas

    2013-02-20

    Animal-borne orthopoxviruses, like monkeypox, vaccinia and the closely related cowpox virus, are all capable of causing zoonotic infections in humans, representing a potential threat to human health. The disease caused by each virus differs in terms of symptoms and severity, but little is yet know about the reasons for these varying phenotypes. They may be explained by the unique repertoire of immune and host cell modulating factors encoded by each virus. In this study, we analysed the specific modulation of the host cell's gene expression profile by cowpox, monkeypox and vaccinia virus infection. We aimed to identify mechanisms that are either common to orthopoxvirus infection or specific to certain orthopoxvirus species, allowing a more detailed description of differences in virus-host cell interactions between individual orthopoxviruses. To this end, we analysed changes in host cell gene expression of HeLa cells in response to infection with cowpox, monkeypox and vaccinia virus, using whole-genome gene expression microarrays, and compared these to each other and to non-infected cells. Despite a dominating non-responsiveness of cellular transcription towards orthopoxvirus infection, we could identify several clusters of infection-modulated genes. These clusters are either commonly regulated by orthopoxvirus infection or are uniquely regulated by infection with a specific orthopoxvirus, with major differences being observed in immune response genes. Most noticeable was an induction of genes involved in leukocyte migration and activation in cowpox and monkeypox virus-infected cells, which was not observed following vaccinia virus infection. Despite their close genetic relationship, the expression profiles induced by infection with different orthopoxviruses vary significantly. It may be speculated that these differences at the cellular level contribute to the individual characteristics of cowpox, monkeypox and vaccinia virus infections in certain host species.

  9. Vaccinia virus-encoded ribonucleotide reductase subunits are differentially required for replication and pathogenesis.

    Directory of Open Access Journals (Sweden)

    Don B Gammon

    2010-07-01

    Full Text Available Ribonucleotide reductases (RRs are evolutionarily-conserved enzymes that catalyze the rate-limiting step during dNTP synthesis in mammals. RR consists of both large (R1 and small (R2 subunits, which are both required for catalysis by the R1(2R2(2 heterotetrameric complex. Poxviruses also encode RR proteins, but while the Orthopoxviruses infecting humans [e.g. vaccinia (VACV, variola, cowpox, and monkeypox viruses] encode both R1 and R2 subunits, the vast majority of Chordopoxviruses encode only R2 subunits. Using plaque morphology, growth curve, and mouse model studies, we investigated the requirement of VACV R1 (I4 and R2 (F4 subunits for replication and pathogenesis using a panel of mutant viruses in which one or more viral RR genes had been inactivated. Surprisingly, VACV F4, but not I4, was required for efficient replication in culture and virulence in mice. The growth defects of VACV strains lacking F4 could be complemented by genes encoding other Chordopoxvirus R2 subunits, suggesting conservation of function between poxvirus R2 proteins. Expression of F4 proteins encoding a point mutation predicted to inactivate RR activity but still allow for interaction with R1 subunits, caused a dominant negative phenotype in growth experiments in the presence or absence of I4. Co-immunoprecipitation studies showed that F4 (as well as other Chordopoxvirus R2 subunits form hybrid complexes with cellular R1 subunits. Mutant F4 proteins that are unable to interact with host R1 subunits failed to rescue the replication defect of strains lacking F4, suggesting that F4-host R1 complex formation is critical for VACV replication. Our results suggest that poxvirus R2 subunits form functional complexes with host R1 subunits to provide sufficient dNTPs for viral replication. Our results also suggest that R2-deficient poxviruses may be selective oncolytic agents and our bioinformatic analyses provide insights into how poxvirus nucleotide metabolism proteins may

  10. Reactions of Cre with methylphosphonate DNA: similarities and contrasts with Flp and vaccinia topoisomerase.

    Directory of Open Access Journals (Sweden)

    Chien-Hui Ma

    2009-09-01

    Full Text Available Reactions of vaccinia topoisomerase and the tyrosine site-specific recombinase Flp with methylphosphonate (MeP substituted DNA substrates, have provided important insights into the electrostatic features of the strand cleavage and strand joining steps catalyzed by them. A conserved arginine residue in the catalytic pentad, Arg-223 in topoisomerase and Arg-308 in Flp, is not essential for stabilizing the MeP transition state. Topoisomerase or its R223A variant promotes cleavage of the MeP bond by the active site nucleophile Tyr-274, followed by the rapid hydrolysis of the MeP-tyrosyl intermediate. Flp(R308A, but not wild type Flp, mediates direct hydrolysis of the activated MeP bond. These findings are consistent with a potential role for phosphate electrostatics and active site electrostatics in protecting DNA relaxation and site-specific recombination, respectively, against abortive hydrolysis.We have examined the effects of DNA containing MeP substitution in the Flp related Cre recombination system. Neutralizing the negative charge at the scissile position does not render the tyrosyl intermediate formed by Cre susceptible to rapid hydrolysis. Furthermore, combining the active site R292A mutation in Cre (equivalent to the R223A and R308A mutations in topoisomerase and Flp, respectively with MeP substitution does not lead to direct hydrolysis of the scissile MeP bond in DNA. Whereas Cre follows the topoisomerase paradigm during the strand cleavage step, it follows the Flp paradigm during the strand joining step.Collectively, the Cre, Flp and topoisomerase results highlight the contribution of conserved electrostatic complementarity between substrate and active site towards transition state stabilization during site-specific recombination and DNA relaxation. They have potential implications for how transesterification reactions in nucleic acids are protected against undesirable abortive side reactions. Such protective mechanisms are significant

  11. Lethality and developmental delay in Drosophila melanogaster larvae after ingestion of selected Pseudomonas fluorescens strains.

    Directory of Open Access Journals (Sweden)

    Marika H Olcott

    2010-09-01

    Full Text Available The fruit fly, Drosophila melanogaster, is a well-established model organism for probing the molecular and cellular basis of physiological and immune system responses of adults or late stage larvae to bacterial challenge. However, very little is known about the consequences of bacterial infections that occur in earlier stages of development. We have infected mid-second instar larvae with strains of Pseudomonas fluorescens to determine how infection alters the ability of larvae to survive and complete development.We mimicked natural routes of infection using a non-invasive feeding procedure to study the toxicity of the three sequenced P. fluorescens strains (Pf0-1, SBW25, and Pf-5 to Drosophila melanogaster. Larvae fed with the three strains of P. fluorescens showed distinct differences in developmental trajectory and survival. Treatment with SBW25 caused a subset of insects to die concomitant with a systemic melanization reaction at larval, pupal or adult stages. Larvae fed with Pf-5 died in a dose-dependent manner with adult survivors showing eye and wing morphological defects. In addition, larvae in the Pf-5 treatment groups showed a dose-dependent delay in the onset of metamorphosis relative to control-, Pf0-1-, and SBW25-treated larvae. A functional gacA gene is required for the toxic properties of wild-type Pf-5 bacteria.These experiments are the first to demonstrate that ingestion of P. fluorescens bacteria by D. melanogaster larvae causes both lethal and non-lethal phenotypes, including delay in the onset of metamorphosis and morphological defects in surviving adult flies, which can be decoupled.

  12. Insulin-Like Growth Factor 1 Mitigates Hematopoietic Toxicity After Lethal Total Body Irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Dunhua; Deoliveira, Divino; Kang, Yubin; Choi, Seung S. [Department of Medicine, Duke University Medical Center, Durham, North Carolina (United States); Li, Zhiguo [Department of Biostatistics and Bioinformatics, Duke University Medical Center, Durham, North Carolina (United States); Chao, Nelson J. [Department of Medicine, Duke University Medical Center, Durham, North Carolina (United States); Department of Pathology, Duke University Medical Center, Durham, North Carolina (United States); Department of Immunology, Duke University Medical Center, Durham, North Carolina (United States); Duke Cancer Institute, Duke University Medical Center, Durham, North Carolina (United States); Chen, Benny J., E-mail: chen0032@mc.duke.edu [Duke Cancer Institute, Duke University Medical Center, Durham, North Carolina (United States); Department of Medicine, Duke University Medical Center, Durham, North Carolina (United States)

    2013-03-15

    Purpose: To investigate whether and how insulin-like growth factor 1 (IGF-1) mitigates hematopoietic toxicity after total body irradiation. Methods and Materials: BALB/c mice were irradiated with a lethal dose of radiation (7.5 Gy) and treated with IGF-1 at a dose of 100 μg/dose intravenously once a day for 5 consecutive days starting within 1 hour after exposure. Survival and hematopoietic recovery were monitored. The mechanisms by which IGF-1 promotes hematopoietic recovery were also studied by use of an in vitro culture system. Results: IGF-1 protected 8 of 20 mice (40%) from lethal irradiation, whereas only 2 of 20 mice (10%) in the saline control group survived for more than 100 days after irradiation. A single dose of IGF-1 (500 μg) was as effective as daily dosing for 5 days. Positive effects were noted even when the initiation of treatment was delayed as long as 6 hours after irradiation. In comparison with the saline control group, treatment with IGF-1 significantly accelerated the recovery of both platelets and red blood cells in peripheral blood, total cell numbers, hematopoietic stem cells, and progenitor cells in the bone marrow when measured at day 14 after irradiation. IGF-1 protected both hematopoietic stem cells and progenitor cells from radiation-induced apoptosis and cell death. In addition, IGF-1 was able to facilitate the proliferation and differentiation of nonirradiated and irradiated hematopoietic progenitor cells. Conclusions: IGF-1 mitigates radiation-induced hematopoietic toxicity through protecting hematopoietic stem cells and progenitor cells from apoptosis and enhancing proliferation and differentiation of the surviving hematopoietic progenitor cells.

  13. Innovations’ Survival

    Directory of Open Access Journals (Sweden)

    Jakub Tabas

    2016-01-01

    Full Text Available Innovations currently represent a tool of maintaining the going concern of a business entity and its competitiveness. However, effects of innovations are not infinite and if an innovation should constantly preserve a life of business entity, it has to be a continual chain of innovations, i.e. continual process. Effective live of a single innovation is limited while the limitation is derived especially from industry. The paper provides the results of research on innovations effects in the financial performance of small and medium-sized enterprises in the Czech Republic. Objective of this paper is to determine the length and intensity of the effects of technical innovations in company’s financial performance. The economic effect of innovations has been measured at application of company’s gross production power while the Deviation Analysis has been applied for three years’ time series. Subsequently the Survival Analysis has been applied. The analyses are elaborated for three statistical samples of SMEs constructed in accordance to the industry. The results obtained show significant differences in innovations’ survival within these three samples of enterprises then. The results are quite specific for the industries, and are confronted and discussed with the results of authors’ former research on the issue.

  14. Effects of radiation response modifiers given after lethal whole-abdominal irradiation.

    Science.gov (United States)

    Huang, Eng-Yen; Peng, Chen-Tzu; Wang, Chung-Chih

    2018-03-01

    Although radiation is used to treat cancer and generate electricity, radiotherapy-induced complications and nuclear disasters are issues of great concern. The small bowel and bone marrow are the two major organs injured by radiation, especially that from nuclear disasters. The development of effective drugs to alleviate radiation injuries is very important. We tested potential radiation response modifiers given after irradiation to alleviate radiation injuries and mortality. Xenografts of C33A tumor cells with or without galectin-1 expression were implanted in SCID mice. Local tumor irradiation (6 Gy) was used to study radiosensitivity. The rate and time of tumor growth to 2 cm were observed using the Kaplan-Meier method. C57BL/6N mice were used to study the effects of whole-abdominal or whole-body irradiation. Drug administration was as follows: (1) vehicle; (2) interleukin 6 (IL-6) (50 ng/day); (3) anginex (10 mg/kg/day) (galectin-1 antagonist); or (4) flagellin (0.2 mg/kg) (Toll-like receptor 5 agonist). These treatments were compared for tumor size and survival time. The median time of tumor growth delay after 6 Gy irradiation was one week in tumors without galectin-1 expression, regardless of anginex administration. Anginex did not prolong the survival time after 18 Gy whole-abdominal irradiation. Flagellin did not prolong survival time after 18 Gy whole-abdominal irradiation. IL-6 prolonged the survival time after 18 Gy whole-abdominal irradiation, with 5% survival. This was the best result in treating lethal 18 Gy whole-abdominal irradiation. Other than IL-6, no drugs decreased the survival rate after 7.5 Gy whole-body irradiation. Anginex has no protective effects against radiation injury and no radiosensitized effects on tumors. IL-6 is a potential agent for treating radiation-induced lethal injuries to the small bowel. However, it is not suitable for treating bone marrow damage after whole-body irradiation.

  15. The Rorschach Suicide Constellation: assessing various degrees of lethality.

    Science.gov (United States)

    Fowler, J C; Piers, C; Hilsenroth, M J; Holdwick, D J; Padawer, J R

    2001-04-01

    In this article we examine the relation between the Rorschach Comprehensive System's Suicide Constellation (S-CON; Exner, 1993; Exner & Wiley, 1977) and lethality of suicide attempts during the course of patients' hospitalization at the Austen Riggs Center (Stockbridge, MA). Patient records were rated as nonsuicidal (n = 37), parasuicidal (n = 37), or near-lethal (n = 30) based on the presence and lethality of self-destructive acts. Diagnostic efficiency statistics utilizing a cutoff score of 7 or more positive indicators successfully predicted which patients would engage in near-lethal suicidal activity relative to parasuicidal patients (overall correct classification rate [OCC] = .79), nonsuicidal inpatients (OCC = .79), and college students (OCC = .89). Although these predictions were influenced by relatively high base rates in the hospital population (14.5%), base rate estimates were calculated for other hypothetical populations revealing different prediction estimates that should be considered when judging the relative efficacy of the S-CON. Logistic regression analysis revealed that an S-CON score of 7 or more was the sole predictor of near-lethal suicide attempts among 9 psychiatric and demographic variables.

  16. Ecdysone receptor agonism leading to lethal molting ...

    Science.gov (United States)

    Molting is a key biological process in growth, development, reproduction and survival in arthropods. Complex neuroendocrine pathways are involved in the regulation of molting and may potentially become targets of environmental endocrine disrupting compounds (EDCs). For example, several classes of pesticides used in agriculture and aquaculture specifically target key endocrine regulators of the molting process. These chemicals may also pose hazards to non-target species by causing molting defects, thus affecting the health of the ecosystems. The present review summarized the available knowledge on molting-related endocrine regulation and disruption in arthropods (with special focus on insects and crustaceans), in order to identify research gaps and develop a toxicity mechanism-based model for environmental hazard and risk assessment. Based on the review, multiple targets in the molting processes that EDCs can interact with were characterized to inform future studies. An adverse outcome pathway (AOP) describing ecdysone receptor agonism leading to incomplete ecdysis associated mortality was developed according to the OECD guideline and evaluated for weight of evidence using the Evolved Bradford Hill Criteria. This review proposed the first invertebrate endocrine disruption AOP and may serve as a knowledge foundation for future environmental studies and AOP development. Development of high throughput toxicology (HTT) programs (e.g., ToxCast, Tox21) and potential a

  17. Rapidly Progressive and Almost Lethal Pneumonia.

    Science.gov (United States)

    Martínez-González, Juancarlo; Robles-Arias, Carlos; Rodríguez-Cintrón, William

    2017-03-01

    We herein describe the case of a 65-year-old male patient who presented with Osler's triad, which is the combination of endocarditis, pneumonia, and meningitis. This report is even more unusual since the pathogen isolated was the invasive and virulent strain of Streptococcus pneumoniae serotype 3. The clinical entity described is also called Austrian syndrome. Even though rare in this antibiotic era, the syndrome remains one of high morbidity and mortality. This particular case is of paramount importance for the clinician reader. First, it documents the clinical features associated with invasive pneumococcal disease and the Austrian syndrome. Second, and equally important, it highlights why following the Surviving Sepsis Campaign guidelines saves lives. For this case, the following steps were taken: 1. As a surrogate for perfusion, early and aggressive fluid resuscitation therapy (guided by lactic acid levels) was instituted; 2. also early in the treatment, broad spectrum antibiotics were administered; 3. to guide antibiotic therapy, microbiological cultures were obtained. The patient subsequently improved and was transferred to the internal medicine ward to complete 4 weeks of antibiotic therapy.

  18. Interactions between Vaccinia Virus IEV Membrane Proteins and Their Roles in IEV Assembly and Actin Tail Formation

    Science.gov (United States)

    Röttger, Sabine; Frischknecht, Friedrich; Reckmann, Inge; Smith, Geoffrey L.; Way, Michael

    1999-01-01

    The intracellular enveloped form of vaccinia virus (IEV) induces the formation of actin tails that are strikingly similar to those seen in Listeria and Shigella infections. In contrast to the case for Listeria and Shigella, the vaccinia virus protein(s) responsible for directly initiating actin tail formation remains obscure. However, previous studies with recombinant vaccinia virus strains have suggested that the IEV-specific proteins A33R, A34R, A36R, B5R, and F13L play an undefined role in actin tail formation. In this study we have sought to understand how these proteins, all of which are predicted to have small cytoplasmic domains, are involved in IEV assembly and actin tail formation. Our data reveal that while deletion of A34R, B5R, or F13L resulted in a severe reduction in IEV particle assembly, IEVs formed by the ΔB5R and ΔF13L deletion strains, but not ΔA34R, were still able to induce actin tails. The ΔA36R deletion strain produced normal amounts of IEV particles, although these were unable to induce actin tails. Using several different approaches, we demonstrated that A36R is a type Ib membrane protein with a large, 195-amino-acid cytoplasmic domain exposed on the surface of IEV particles. Finally, coimmunoprecipitation experiments demonstrated that A36R interacts with A33R and A34R but not with B5R and that B5R forms a complex with A34R but not with A33R or A36R. Using extracts from ΔA34R- and ΔA36R-infected cells, we found that the interaction of A36R with A33R and that of A34R with B5R are independent of A34R and A36R, respectively. We conclude from our observations that multiple interactions between IEV membrane proteins exist which have important implications for IEV assembly and actin tail formation. Furthermore, these data suggest that while A34R is involved in IEV assembly and organization, A36R is critical for actin tail formation. PMID:10074134

  19. Drug Driven Synthetic Lethality: bypassing tumor cell genetics with a combination of Dbait and PARP inhibitors

    Science.gov (United States)

    Jdey, Wael; Thierry, Sylvain; Russo, Christophe; Devun, Flavien; Abo, Muthana Al; Noguiez-Hellin, Patricia; Sun, Jian-Sheng; Barillot, Emmanuel; Zinovyev, Andrei; Kuperstein, Inna; Pommier, Yves; Dutreix, Marie

    2016-01-01

    Purpose Cancer treatments using tumor defects in DNA repair pathways have shown promising results but are restricted to small subpopulations of patients. The most advanced drugs in this field are Poly(ADP-Ribose) Polymerase (PARP) inhibitors (PARPi), which trigger synthetic lethality in tumors with Homologous Recombination (HR) deficiency. Using AsiDNA, an inhibitor of HR and Non Homologous End Joining, together with PARPi should allow bypassing the genetic restriction for PARPi efficacy. Experimental design We characterized the DNA repair inhibition activity of PARPi (olaparib) and AsiDNA by monitoring repair foci formation and DNA damage. We analyzed the cell survival to standalone and combined treatments of 21 tumor cells, and 3 non-tumor cells. In 12 Breast Cancer (BC) cell lines, correlation with sensitivity to each drug and transcriptome were statistically analyzed to identify resistance pathways. Results Molecular analyses demonstrate that olaparib and AsiDNA respectively prevent recruitment of XRCC1 and RAD51/53BP1 repair enzymes to damage sites. Combination of both drugs increases the accumulation of unrepaired damage resulting in an increase of cell death in all tumor cells. In contrast, non-tumor cells do not show an increase of DNA damage nor lethality. Analysis of multi-level omics data from BC cells highlighted different DNA repair and cell cycle molecular profiles associated with resistance to AsiDNA or olaparib, rationalizing combined treatment. Treatment synergy was also confirmed with 6 other PARPi in development. Conclusion Our results highlight the therapeutic interest of combining AsiDNA and PARPi to recapitulate synthetic lethality in all tumors independently of their HR status. PMID:27559053

  20. Third-party CD4+ invariant natural killer T cells protect from murine GVHD lethality.

    Science.gov (United States)

    Schneidawind, Dominik; Baker, Jeanette; Pierini, Antonio; Buechele, Corina; Luong, Richard H; Meyer, Everett H; Negrin, Robert S

    2015-05-28

    Graft-versus-host disease (GVHD) is driven by extensive activation and proliferation of alloreactive donor T cells causing significant morbidity and mortality following allogeneic hematopoietic cell transplantation (HCT). Invariant natural killer T (iNKT) cells are a potent immunoregulatory T-cell subset in both humans and mice. Here, we explored the role of adoptively transferred third-party CD4(+) iNKT cells for protection from lethal GVHD in a murine model of allogeneic HCT across major histocompatibility barriers. We found that low numbers of CD4(+) iNKT cells from third-party mice resulted in a significant survival benefit with retained graft-versus-tumor effects. In vivo expansion of alloreactive T cells was diminished while displaying a T helper cell 2-biased phenotype. Notably, CD4(+) iNKT cells from third-party mice were as protective as CD4(+) iNKT cells from donor mice although third-party CD4(+) iNKT cells were rejected early after allogeneic HCT. Adoptive transfer of third-party CD4(+) iNKT cells resulted in a robust expansion of donor CD4(+)CD25(+)FoxP3(+) regulatory T cells (Tregs) that were required for protection from lethal GVHD. However, in vivo depletion of myeloid-derived suppressor cells abrogated both Treg expansion and protection from lethal GVHD. Despite the fact that iNKT cells are a rare cell population, the almost unlimited third-party availability and feasibility of in vitro expansion provide the basis for clinical translation. © 2015 by The American Society of Hematology.

  1. Comparative genomics and proteomic analyses between lethal and nonlethal strains of Plasmodium berghei.

    Science.gov (United States)

    Niikura, Mamoru; Inoue, Shin-Ichi; Fukutomi, Toshiyuki; Yamagishi, Junya; Asahi, Hiroko; Kobayashi, Fumie

    2018-02-01

    Plasmodium berghei (Pb) XAT, a rodent malaria parasite, is an irradiation-attenuated variant derived from the lethal strain Pb NK65. Differences in genome sequence, protein structure and function between Pb XAT and Pb NK65 are currently unknown. In this study, to investigate genetic alterations in Pb XAT, we performed comparative genomics and proteomics analyses of nonlethal and lethal strains of Pb. We found mutations, such as a deletion mutation in rhoptry-associated protein (rap) 1, and deletion of rap2/3 and skeleton-binding protein 1 (sbp1), in Pb XAT. RAP1 is required for targeting of RAP2 to the rhoptries. However, the contribution of RAP2/3 to the lethality of Plasmodium is unclear. Therefore, we generated RAP1- and RAP2/3-deficient mutants of Pb ANKA, a reference strain of P. berghei. Furthermore, we investigated the effect of RAP1 and RAP2/3 deficiency on the outcome of infection. The parasitemia in mice infected with RAP1-deficient parasites was increased compared to that in control parasite-infected mice during the early phase of infection. However, mice infected with RAP1-deficient parasites survived longer than did control parasite-infected mice. Moreover, mice infected with RAP2/3-deficient parasites showed low levels of parasitemia and ultimately recovered from the infection The aim of this study was to investigate the effect of RAP2/3 expression on the outcome of infection with Pb XAT using a RAP2/3-expressing Pb XAT. Results showed that complementation of RAP2/3 expression in Pb XAT partially restored virulence. Our findings suggest that RAP1 and RAP2/3 contribute to virulence and a decrease in their expression explains the loss of virulence of the Pb XAT strain. Copyright © 2018 Elsevier Inc. All rights reserved.

  2. Radiation lethality potentiation in total body irradiated mice by a commonly prescribed proton pump inhibitor, Pantoprazole sodium.

    Science.gov (United States)

    Biju, Prabath G; Gubrij, Igor; Garg, Sarita; Gupta, Prem K; Hauer-Jensen, Martin; Burnett, Alexander F

    2014-07-01

    Pantoprazole sodium (Protonix) is a proton pump inhibitor (PPI) widely used to treat peptic ulcer and gastroesophageal reflux due to its ability to inhibit gastric acid secretion. Therefore, a large group of the population exposed to total body irradiation (TBI) in the event of a nuclear disaster would be on this or similar medications. We investigated the effect of pantoprazole on TBI-induced lethality in mice. Male CD2F1 mice were exposed to various doses of uniform TBI using a (137)Cs irradiator. Pantoprazole was administered by twice daily subcutaneous injection in saline from 4 days before to 5 days after irradiation. Effects on gastric pH, and gastrointestinal (GI) and hematopoietic toxicity were evaluated. Pantoprazole administration significantly exacerbated 30 day lethality and gastrointestinal toxicity. Median survival after 9.0 Gy TBI was reduced from 22 days to 12 days (p = 0.006). Pantoprazole adversely effected intestinal crypt survival and mucosal surface area. In contrast, equivalent doses of a histamine type-2(H2) receptor blocker (cimetidine) did not alter TBI-induced lethality. The adverse effect of pantoprazole on TBI-induced lethality is highly important because of the widespread use of PPI in the general population, as well as use of these drugs for acid suppression in individuals exposed to radiation. Further studies of the mechanisms underlying the adverse effect of PPI after exposure to TBI are clearly warranted. Until results from such studies are available, other acid-suppressing strategies should be preferred in the context of radiation exposure.

  3. Lethal effects of short-wavelength visible light on insects

    Science.gov (United States)

    Hori, Masatoshi; Shibuya, Kazuki; Sato, Mitsunari; Saito, Yoshino

    2014-12-01

    We investigated the lethal effects of visible light on insects by using light-emitting diodes (LEDs). The toxic effects of ultraviolet (UV) light, particularly shortwave (i.e., UVB and UVC) light, on organisms are well known. However, the effects of irradiation with visible light remain unclear, although shorter wavelengths are known to be more lethal. Irradiation with visible light is not thought to cause mortality in complex animals including insects. Here, however, we found that irradiation with short-wavelength visible (blue) light killed eggs, larvae, pupae, and adults of Drosophila melanogaster. Blue light was also lethal to mosquitoes and flour beetles, but the effective wavelength at which mortality occurred differed among the insect species. Our findings suggest that highly toxic wavelengths of visible light are species-specific in insects, and that shorter wavelengths are not always more toxic. For some animals, such as insects, blue light is more harmful than UV light.

  4. Lethal hypophosphatasia successfully treated with enzyme replacement from day 1 after birth.

    Science.gov (United States)

    Okazaki, Yoko; Kitajima, Hiroyuki; Mochizuki, Narutaka; Kitaoka, Taichi; Michigami, Toshimi; Ozono, Keiichi

    2016-03-01

    Hypophosphatasia (HPP) is a rare metabolic bone disease caused by loss-of-function mutations in the gene ALPL encoding the tissue nonspecific alkaline phosphatase (TNSALP). There is a broad range of severity in the phenotype of HPP, and the most severe form exhibits perinatal lethality without mineralization of the skeleton. Here, we describe a female infant with perinatal lethal HPP diagnosed in utero. She was treated with a recombinant ALP (asfotase alfa) as an enzyme replacement therapy (ERT), which started from 1 day after birth. She required invasive ventilation immediately upon birth and demonstrated severe hypomineralization of whole body bone. Severe respiratory insufficiency was controlled by intensive respiratory care with high-frequency oscillation ventilation and nitric oxide inhalation and deep sedation just after birth. Bone mineralization improved with treatment; improvements were visible by 3 weeks of age and continued with treatment. Serum calcium levels decreased following treatment, resulting in hypocalcemia and convulsion, and calcium supplementation was required until 3 months of treatment. She was weaned from mechanical ventilation and has now survived more than 1 year. This case demonstrates the success of ERT in treating the severest HPP and highlights the importance of early diagnosis and intervention for these patients.

  5. Severe hypoglycemia-induced lethal cardiac arrhythmias are mediated by sympathoadrenal activation.

    Science.gov (United States)

    Reno, Candace M; Daphna-Iken, Dorit; Chen, Y Stefanie; VanderWeele, Jennifer; Jethi, Krishan; Fisher, Simon J

    2013-10-01

    For people with insulin-treated diabetes, severe hypoglycemia can be lethal, though potential mechanisms involved are poorly understood. To investigate how severe hypoglycemia can be fatal, hyperinsulinemic, severe hypoglycemic (10-15 mg/dL) clamps were performed in Sprague-Dawley rats with simultaneous electrocardiogram monitoring. With goals of reducing hypoglycemia-induced mortality, the hypotheses tested were that: 1) antecedent glycemic control impacts mortality associated with severe hypoglycemia; 2) with limitation of hypokalemia, potassium supplementation could limit hypoglycemia-associated deaths; 3) with prevention of central neuroglycopenia, brain glucose infusion could prevent hypoglycemia-associated arrhythmias and deaths; and 4) with limitation of sympathoadrenal activation, adrenergic blockers could prevent hypoglycemia-induced arrhythmic deaths. Severe hypoglycemia-induced mortality was noted to be worsened by diabetes, but recurrent antecedent hypoglycemia markedly improved the ability to survive an episode of severe hypoglycemia. Potassium supplementation tended to reduce mortality. Severe hypoglycemia caused numerous cardiac arrhythmias including premature ventricular contractions, tachycardia, and high-degree heart block. Intracerebroventricular glucose infusion reduced severe hypoglycemia-induced arrhythmias and overall mortality. β-Adrenergic blockade markedly reduced cardiac arrhythmias and completely abrogated deaths due to severe hypoglycemia. Under conditions studied, sudden deaths caused by insulin-induced severe hypoglycemia were mediated by lethal cardiac arrhythmias triggered by brain neuroglycopenia and the marked sympathoadrenal response.

  6. Severe Hypoglycemia–Induced Lethal Cardiac Arrhythmias Are Mediated by Sympathoadrenal Activation

    Science.gov (United States)

    Reno, Candace M.; Daphna-Iken, Dorit; Chen, Y. Stefanie; VanderWeele, Jennifer; Jethi, Krishan; Fisher, Simon J.

    2013-01-01

    For people with insulin-treated diabetes, severe hypoglycemia can be lethal, though potential mechanisms involved are poorly understood. To investigate how severe hypoglycemia can be fatal, hyperinsulinemic, severe hypoglycemic (10–15 mg/dL) clamps were performed in Sprague-Dawley rats with simultaneous electrocardiogram monitoring. With goals of reducing hypoglycemia-induced mortality, the hypotheses tested were that: 1) antecedent glycemic control impacts mortality associated with severe hypoglycemia; 2) with limitation of hypokalemia, potassium supplementation could limit hypoglycemia-associated deaths; 3) with prevention of central neuroglycopenia, brain glucose infusion could prevent hypoglycemia-associated arrhythmias and deaths; and 4) with limitation of sympathoadrenal activation, adrenergic blockers could prevent hypoglycemia-induced arrhythmic deaths. Severe hypoglycemia–induced mortality was noted to be worsened by diabetes, but recurrent antecedent hypoglycemia markedly improved the ability to survive an episode of severe hypoglycemia. Potassium supplementation tended to reduce mortality. Severe hypoglycemia caused numerous cardiac arrhythmias including premature ventricular contractions, tachycardia, and high-degree heart block. Intracerebroventricular glucose infusion reduced severe hypoglycemia–induced arrhythmias and overall mortality. β-Adrenergic blockade markedly reduced cardiac arrhythmias and completely abrogated deaths due to severe hypoglycemia. Under conditions studied, sudden deaths caused by insulin-induced severe hypoglycemia were mediated by lethal cardiac arrhythmias triggered by brain neuroglycopenia and the marked sympathoadrenal response. PMID:23835337

  7. Human cathepsin L rescues the neurodegeneration and lethality incathepsin B/L double deficient mice

    Energy Technology Data Exchange (ETDEWEB)

    Sevenich, Lisa; Pennacchio, Len A.; Peters, Christoph; Reinheckel, Thomas

    2006-01-09

    Cathepsin B (CTSB) and cathepsin L (CTSL) are two widelyexpressed cysteine proteases thought to predominantly reside withinlysosomes. Functional analysis of CTSL in humans is complicated by theexistence of two CTSL-like homologues (CTSL and CTSL2), in contrast tomice which contain only one CTSL enzyme. Thus transgenic expression ofhuman CTSL in CTSL deficient mice provides an opportunity to study the invivo functions of this human protease without interference by its highlyrelated homologue. While mice with single gene deficiencies for murineCTSB or CTSL survive without apparent neuromuscular impairment, murineCTSB/CTSL double deficient mice display degeneration of cerebellarPurkinje cells and neurons of the cerebral cortex, resulting in severehypotrophy, motility defects, and lethality during their third to fourthweek of life. Here we show that expression of human CTSL through agenomic transgene results in widespread expression of human CTSL in themouse which is capable of rescuing the lethality found in CTSB/CTSLdouble-deficient animals. Human CTSL is expressed in the brain of thesecompound mutants predominantly in neurons of the cerebral cortex and inPurkinje cells of the cerebellum, where it appears to prevent neuronalcell death.

  8. Local delivery of Granulocyte/Macrophage Colony Stimulating Factor protects mice from lethal pneumococcal pneumonia1

    Science.gov (United States)

    Steinwede, Kathrin; Tempelhof, Ole; Bolte, Kristine; Maus, Regina; Bohling, Jennifer; Ueberberg, Bianca; Länger, Florian; Christman, John W.; Paton, James C.; Ask, Kjetil; Maharaj, Shyam; Kolb, Martin; Gauldie, Jack; Welte, Tobias; Maus, Ulrich A.

    2013-01-01

    The growth factor granulocyte/macrophage-colony stimulating factor (GM-CSF) has an important role in pulmonary surfactant metabolism and the regulation of antibacterial activities of lung sentinel cells. However, the potential of intra-alveolar GM-CSF to augment lung protective immunity against inhaled bacterial pathogens has not been defined in preclinical infection models. We hypothesized that transient overexpression of GM-CSF in the lungs of mice by adenoviral gene transfer (Ad-GM-CSF) would protect mice from subsequent lethal pneumococcal pneumonia. Our data show that intra-alveolar delivery of Ad-GM-CSF led to sustained increased pSTAT5 expression and PU.1 protein expression in alveolar macrophages during a 28 day observation period. Pulmonary Ad-GM-CSF delivery two or four weeks prior to infection of mice with S. pneumoniae significantly reduced mortality rates relative to control vector treated mice. This increased survival was accompanied by increased iNOS expression, antibacterial activity and a significant reduction in caspase 3 dependent apoptosis and secondary necrosis of lung sentinel cells. Importantly, therapeutic treatment of mice with recombinant GM-CSF improved lung protective immunity and accelerated bacterial clearance after pneumococcal challenge. We conclude that prophylactic delivery of GM-CSF triggers long-lasting immunostimulatory effects in the lung in vivo and rescues mice from lethal pneumococcal pneumonia by improving antibacterial immunity. These data support use of novel antibiotic-independent immunostimulatory therapies to protect patients against bacterial pneumonias. PMID:22003204

  9. Cyclopeptide toxins of lethal amanitas: Compositions, distribution and phylogenetic implication.

    Science.gov (United States)

    Tang, Shanshan; Zhou, Qian; He, Zhengmi; Luo, Tao; Zhang, Ping; Cai, Qing; Yang, Zhuliang; Chen, Jia; Chen, Zuohong

    2016-09-15

    Lethal amanitas (Amanita sect. Phalloideae) are responsible for 90% of all fatal mushroom poisonings. Since 2000, more than ten new lethal Amanita species have been discovered and some of them had caused severe mushroom poisonings in China. However, the contents and distribution of cyclopeptides in these lethal mushrooms remain poorly known. In this study, the diversity of major cyclopeptide toxins in seven Amanita species from Eastern Asia and three species from Europe and North America were systematically analyzed, and a new approach to inferring phylogenetic relationships using cyclopeptide profile was evaluated for the first time. The results showed that there were diversities of the cyclopeptides among lethal Amanita species, and cyclopeptides from Amanita rimosa and Amanita fuligineoides were reported for the first time. The amounts of amatoxins in East Asian Amanita species were significantly higher than those in European and North American species. The analysis of distribution of amatoxins and phallotoxins in various Amanita species demonstrated that the content of phallotoxins was higher than that of amatoxins in Amanita phalloides and Amanita virosa. In contrast, the content of phallotoxins was significantly lower than that of amatoxins in all East Asian lethal Amanita species tested. However, the distribution of amatoxins and phallotoxins in different tissues showed the same tendency. Eight cyclopeptides and three unknown compounds were identified using cyclopeptide standards and high-resolution MS. Based on the cyclopeptide profiles, phylogenetic relationships of lethal amanitas were inferred through a dendrogram generated by UPGMA method. The results showed high similarity to the phylogeny established previously based on the multi-locus DNA sequences. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Comparative analysis of viral gene expression programs during poxvirus infection: a transcriptional map of the vaccinia and monkeypox genomes.

    Directory of Open Access Journals (Sweden)

    Kathleen H Rubins

    2008-07-01

    Full Text Available Poxviruses engage in a complex and intricate dialogue with host cells as part of their strategy for replication. However, relatively little molecular detail is available with which to understand the mechanisms behind this dialogue.We designed a specialized microarray that contains probes specific to all predicted ORFs in the Monkeypox Zaire (MPXV and Vaccinia Western Reserve (VACV genomes, as well as >18,000 human genes, and used this tool to characterize MPXV and VACV gene expression responses in vitro during the course of primary infection of human monocytes, primary human fibroblasts and HeLa cells. The two viral transcriptomes show distinct features of temporal regulation and species-specific gene expression, and provide an early foundation for understanding global gene expression responses during poxvirus infection.The results provide a temporal map of the transcriptome of each virus during infection, enabling us to compare viral gene expression across species, and classify expression patterns of previously uncharacterized ORFs.

  11. Vaccinia viruses isolated from skin infection in horses produced cutaneous and systemic disease in experimentally infected rabbits.

    Science.gov (United States)

    Cargnelutti, Juliana Felipetto; Schmidt, Candice; Masuda, Eduardo Kenji; Nogueira, Paula Rochelle Kurrle; Weiblen, Rudi; Flores, Eduardo Furtado

    2012-10-01

    The susceptibility of rabbits to two isolates of Vaccinia virus (VACV) recovered from cutaneous disease in horses in Southern Brazil was investigated. Rabbits were inoculated in the ear skin with both VACV isolates, either in single or mixed infection. All inoculated animals presented local skin lesions characterized by hyperaemia, papules, vesicles, pustules and ulcers. Infectious virus was detected in the lungs and intestine of rabbits that died during acute disease. Histological examination of the skin revealed changes characteristic of those associated with members of the genus Orthopoxvirus. These results demonstrate that rabbits develop skin disease accompanied by systemic signs upon intradermal inoculation of these two equine VACV isolates, either alone or in combination, opening the way for using rabbits to study selected aspects of the biology and pathogenesis of VACV infection. Copyright © 2011 Elsevier Ltd. All rights reserved.

  12. Myristoylation increases the CD8+T-cell response to a GFP prototype antigen delivered by modified vaccinia virus Ankara.

    Science.gov (United States)

    Marr, Lisa; Lülf, Anna-Theresa; Freudenstein, Astrid; Sutter, Gerd; Volz, Asisa

    2016-04-01

    Activation of CD8(+)T-cells is an essential part of immune responses elicited by recombinant modified vaccinia virus Ankara (MVA). Strategies to enhance T-cell responses to antigens may be particularly necessary for broadly protective immunization against influenza A virus infections or for candidate vaccines targeting chronic infections and cancer. Here, we tested recombinant MVAs that targeted a model antigen, GFP, to different localizations in infected cells. In vitro characterization demonstrated that GFP accumulated in the nucleus (MVA-nls-GFP), associated with cellular membranes (MVA-myr-GFP) or was equally distributed throughout the cell (MVA-GFP). On vaccination, we found significantly higher levels of GFP-specific CD8(+)T-cells in MVA-myr-GFP-vaccinated BALB/c mice than in those immunized with MVA-GFP or MVA-nls-GFP. Thus, myristoyl modification may be a useful strategy to enhance CD8(+)T-cell responses to MVA-delivered target antigens.

  13. Separate worlds set to collide: smallpox, vaccinia virus vaccination, and human immunodeficiency virus and acquired immunodeficiency syndrome.

    Science.gov (United States)

    Amorosa, Valerianna K; Isaacs, Stuart N

    2003-08-01

    Concerns about the possible release of smallpox by bioterrorists has led to policies that recommend smallpox vaccination of some health care providers, and, in the near future, the vaccine may become available to the general population on a voluntary basis. Both smallpox virus (variola virus) and the smallpox vaccine (vaccinia virus) will have a significant impact on people infected with human immunodeficiency virus (HIV). Given that populations with acquired immunodeficiency syndrome and populations with immunosuppressed conditions due to solid organ and bone marrow transplantation were not present in the days when smallpox was prevalent, we will speculate on how smallpox might present in immunodeficient patients, and we will review the adverse events expected from the smallpox vaccine in hosts with HIV infection.

  14. Recombination-mediated genetic engineering of a bacterial artificial chromosome clone of modified vaccinia virus Ankara (MVA)

    DEFF Research Database (Denmark)

    Cottingham, Matthew G; Andersen, Rikke F; Spencer, Alexandra J

    2008-01-01

    -length, rescuable clones were obtained, which had indistinguishable immunogenicity in mice. One clone was shotgun sequenced and found to be identical to the parent. We employed GalK recombination-mediated genetic engineering (recombineering) of MVA-BAC to delete five selected viral genes. Deletion of C12L, A44L, A...... to infectious virus using a Fowlpox virus helper to supply transcriptional machinery. We apply here a similar approach to the attenuated strain Modified Vaccinia virus Ankara (MVA), now widely used as a safe non-replicating recombinant vaccine vector in mammals, including humans. Four apparently full......-2006). In addition, we found a higher frequency of triple-positive IFN-gamma, TNF-alpha and IL-2 secreting E3-specific CD8+ T-cells 8 weeks after vaccination with MVA lacking B15R. Furthermore, a recombinant vaccine capable of inducing CD8(+) T cells against an epitope from Plasmodium berghei was created using Gal...

  15. Both NK cell-intrinsic and -extrinsic STAT1 signaling are required for NK cell response against vaccinia virus.

    Science.gov (United States)

    Fortin, Carl; Huang, Xiaopei; Yang, Yiping

    2013-07-01

    NK cells play an important role in innate immune control of the infection with vaccinia virus (VV). However, it remains incompletely defined how the activation of NK cells in response to VV is regulated. In this study, we showed that STAT1 was critical for NK cell activation upon VV infection and the subsequent clearance of VV infection in vivo. We further demonstrated that STAT1 signaling in both NK and accessory cells such as dendritic cells was required for efficient NK cell activation upon VV infection. Mechanistically, STAT1 signaling in dendritic cells promoted the expression of NKG2D ligands, which is required for NK cell activation via the NKG2D pathway. Taken together, our data suggest that STAT1 mediates anti-VV effect by promoting NK cell activation through both NK-intrinsic and extrinsic mechanisms and may provide insights into the design of effective NK cell-based therapies for viral infections.

  16. Evaluation of radiation effects against C6 glioma in combination with vaccinia virus-p53 gene therapy

    Science.gov (United States)

    Gridley, D. S.; Andres, M. L.; Li, J.; Timiryasova, T.; Chen, B.; Fodor, I.; Nelson, G. A. (Principal Investigator)

    1998-01-01

    The primary objective of this study was to evaluate the antitumor effects of recombinant vaccinia virus-p53 (rVV-p53) in combination with radiation therapy against the C6 rat glioma, a p53 deficient tumor that is relatively radioresistant. VV-LIVP, the parental virus (Lister strain), was used as a control. Localized treatment of subcutaneous C6 tumors in athymic mice with either rVV-p53 or VV-LIVP together with tumor irradiation resulted in low tumor incidence and significantly slower tumor progression compared to the agents given as single modalities. Assays of blood and spleen indicated that immune system activation may account, at least partly, for the enhance tumor inhibition seen with combined treatment. No overt signs of treatment-related toxicity were noted.

  17. Ribonuclease activity of vaccinia DNA topoisomerase IB: kinetic and high-throughput inhibition studies using a robust continuous fluorescence assay.

    Science.gov (United States)

    Kwon, Keehwan; Nagarajan, Rajesh; Stivers, James T

    2004-11-30

    Vaccinia type I DNA topoisomerase exhibits a strong site-specific ribonuclease activity when provided a DNA substrate that contains a single uridine ribonucleotide within a duplex DNA containing the sequence 5' CCCTU 3'. The reaction involves two steps: attack of the active site tyrosine nucleophile of topo I at the 3' phosphodiester of the uridine nucleotide to generate a covalent enzyme-DNA adduct, followed by nucleophilic attack of the uridine 2'-hydroxyl to release the covalently tethered enzyme. Here we report the first continuous spectroscopic assay for topoisomerase that allows monitoring of the ribonuclease reaction under multiple-turnover conditions. The assay is especially robust for high-throughput screening applications because sensitive molecular beacon technology is utilized, and the topoisomerase is released during the reaction to allow turnover of multiple substrate molecules by a single molecule of enzyme. Direct computer simulation of the fluorescence time courses was used to obtain the rate constants for substrate binding and release, covalent complex formation, and formation of the 2',3'-cyclic phosphodiester product of the ribonuclease reaction. The assay allowed rapid screening of a 500 member chemical library from which several new inhibitors of topo I were identified with IC(50) values in the range of 2-100 microM. Three of the most potent hits from the high-throughput screening were also found to inhibit plasmid supercoil relaxation by the enzyme, establishing the utility of the assay in identifying inhibitors of the biologically relevant DNA relaxation reaction. One of the most potent inhibitors of the vaccinia enzyme, 3-benzo[1,3]dioxol-5-yl-2-oxoproprionic acid, did not inhibit the closely related human enzyme. The inhibitory mechanism of this compound is unique and involves a step required for recycling the enzyme for steady-state turnover.

  18. Unpolarized release of vaccinia virus and HIV antigen by colchicine treatment enhances intranasal HIV antigen expression and mucosal humoral responses.

    Directory of Open Access Journals (Sweden)

    Yan Zhang

    Full Text Available The induction of a strong mucosal immune response is essential to building successful HIV vaccines. Highly attenuated recombinant HIV vaccinia virus can be administered mucosally, but even high doses of immunization have been found unable to induce strong mucosal antibody responses. In order to solve this problem, we studied the interactions of recombinant HIV vaccinia virus Tiantan strain (rVTT-gagpol in mucosal epithelial cells (specifically Caco-2 cell layers and in BALB/c mice. We evaluated the impact of this virus on HIV antigen delivery and specific immune responses. The results demonstrated that rVTT-gagpol was able to infect Caco-2 cell layers and both the nasal and lung epithelia in BALB/c mice. The progeny viruses and expressed p24 were released mainly from apical surfaces. In BALB/c mice, the infection was limited to the respiratory system and was not observed in the blood. This showed that polarized distribution limited antigen delivery into the whole body and thus limited immune response. To see if this could be improved upon, we stimulated unpolarized budding of the virus and HIV antigens by treating both Caco-2 cells and BALB/c mice with colchicine. We found that, in BALB/c mice, the degree of infection and antigen expression in the epithelia went up. As a result, specific immune responses increased correspondingly. Together, these data suggest that polarized budding limits antigen delivery and immune responses, but unpolarized distribution can increase antigen expression and delivery and thus enhance specific immune responses. This conclusion can be used to optimize mucosal HIV vaccine strategies.

  19. HIV-1 vaccines based on replication-competent Tiantan vaccinia protected Chinese rhesus macaques from simian HIV infection.

    Science.gov (United States)

    Liu, Qiang; Li, Yue; Luo, Zhenwu; Yang, Guibo; Liu, Yong; Liu, Ying; Sun, Maosheng; Dai, Jiejie; Li, Qihan; Qin, Chuan; Shao, Yiming

    2015-03-27

    To assess the efficacy of HIV vaccines constructed from replication-competent Tiantan vaccinia virus (rTV) alone or combined with DNA in protecting Chinese rhesus macaques from homologous Simian/Human Immunodeficiency Virus (SHIV)-CN97001 challenge. The nef, gag, pol, and gp140 genes from strain CRF07_BC HIV-1 CN54 were selected to construct an HIV vaccine using the rTV or rTV/DNA vaccine. After vaccination, the vaccine and control groups were intravenously challenged with SHIV-CN97001 (32 MID50). HIV-specific antibodies and neutralizing antibodies, gp70 V1V2 binding antibodies, and cytotoxic T-lymphocyte responses were measured prospectively after vaccination with an ELISA, a virus infectivity assay in TZM-bl cells, and ELISPOT assays, respectively. Viral RNA was quantified after challenge with real-time reverse transcriptase-PCR (RT-PCR), and protection efficacy was determined with an analysis of CD8 lymphocyte depletion in vivo. Both rTV and DNA/rTV vaccine groups developed strong cellular and humoral responses against HIV-1 CN54 antigens, including Gag and Env, and also developed significant and persistent anti-Env antibodies and neutralizing antibodies after immunization. Both the rTV and DNA/rTV groups were significantly protected against SHIV-CN97001 or displayed lower viremia than the controls. After CD8 lymphocyte depletion, no viremia was detectable in the vaccinated monkeys, but rebounded rapidly in the control animals. Protection against infection correlated with vaccine-elicited neutralizing antibodies specific for homologous HIV-1 viruses. An rTV-based HIV-1 vaccine, with or without a DNA primer, provided protection from SHIV challenge in a macaque model. Replication-competent Tiantan vaccinia is a promising vector and should enable advances in HIV-1 vaccine development.

  20. Expanding the repertoire of Modified Vaccinia Ankara-based vaccine vectors via genetic complementation strategies.

    Directory of Open Access Journals (Sweden)

    David A Garber

    Full Text Available Modified Vaccinia virus Ankara (MVA is a safe, highly attenuated orthopoxvirus that is being developed as a recombinant vaccine vector for immunization against a number of infectious diseases and cancers. However, the expression by MVA vectors of large numbers of poxvirus antigens, which display immunodominance over vectored antigens-of-interest for the priming of T cell responses, and the induction of vector-neutralizing antibodies, which curtail the efficacy of subsequent booster immunizations, remain as significant impediments to the overall utility of such vaccines. Thus, genetic approaches that enable the derivation of MVA vectors that are antigenically less complex may allow for rational improvement of MVA-based vaccines.We have developed a genetic complementation system that enables the deletion of essential viral genes from the MVA genome, thereby allowing us to generate MVA vaccine vectors that are antigenically less complex. Using this system, we deleted the essential uracil-DNA-glycosylase (udg gene from MVA and propagated this otherwise replication-defective variant on a complementing cell line that constitutively expresses the poxvirus udg gene and that was derived from a newly identified continuous cell line that is permissive for growth of wild type MVA. The resulting virus, MVADeltaudg, does not replicate its DNA genome or express late viral gene products during infection of non-complementing cells in culture. As proof-of-concept for immunological 'focusing', we demonstrate that immunization of mice with MVADeltaudg elicits CD8+ T cell responses that are directed against a restricted repertoire of vector antigens, as compared to immunization with parental MVA. Immunization of rhesus macaques with MVADeltaudg-gag, a udg(- recombinant virus that expresses an HIV subtype-B consensus gag transgene, elicited significantly higher frequencies of Gag-specific CD8 and CD4 T cells following both primary (2-4-fold and booster (2-fold

  1. Lethal and sub-lethal effects of commonly used anti-sea lice formulations on non-target crab Metacarcinus edwardsii larvae.

    Science.gov (United States)

    Gebauer, Paulina; Paschke, Kurt; Vera, Claudia; Toro, Jorge E; Pardo, Miguel; Urbina, Mauricio

    2017-10-01

    The pesticides used by the salmon industry to treat sea lice, are applied in situ via a bath solution and are subsequently discharged into the surrounding medium. The effects of cypermethrin, deltamethrin, azamethiphos and hydrogen peroxide were assessed on the performance of Metacarcinus edwardsii larvae, an important crab for Chilean fishery. All larvae were dead or dying after 30 min of exposure to cypermethrin and after 40 min to deltamethrin at concentrations 100 and 20 times lower (0.15 and 0.1 μg L-1, respectively) than the concentrations and exposure times recommended by the manufacturers (CRM) to treat sea lice. Azamethiphos affected all larvae at a concentration 10 times lower than CRM. Hydrogen peroxide had the lowest detrimental effects, but at the CRM, 100% of the larvae were affected. Sub-lethal effects, i.e prolonged developmental time, were observed at concentrations lower than CRM. Repeated exposure to azamethiphos (0.0625-0.5 μg L-1) and hydrogen peroxide (188-1500 mg L-1) had effects on survival. In conclusion, the pesticides used against parasitic copepod tested here, negatively affect non-target crustacean larvae. Due to the product's characteristics, the lethal effects of the pyrethroids probably are restricted to the time and area of application, while the action of azamethiphos may extend to a wider area. Current data are insufficient to accurately dimension the effects of these compounds in the field. More research is required to evaluate the consequences of prolonged developmental times and/or reduction in appendage mobility, so as the effects of these compounds on the pelagic and benthic communities. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Lethal and sub-lethal evaluation of Indigo Carmine dye and byproducts after TiO2 photocatalysis in the immune system of Eisenia andrei earthworms.

    Science.gov (United States)

    Genázio Pereira, Patrícia Christina; Reimão, Roberta Valoura; Pavesi, Thelma; Saggioro, Enrico Mendes; Moreira, Josino Costa; Veríssimo Correia, Fábio

    2017-09-01

    The Indigo carmine (IC) dye has been widely used in textile industries, even though it has been considered toxic for rats, pigs and humans. Owing to its toxicity, wastes containing this compound should be treated to minimize or eliminate their toxic effects on the biota. As an alternative to wastewater treatment, advanced oxidative processes (AOPs) have been highlighted due to their high capacity to destruct organic molecules. In this context, this study aimed to evaluate Indigo Carmine toxicity to soil organisms using the earthworm Eisenia andrei as a model-organism and also verify the efficiency of AOP in reducing its toxicity to these organisms. To this end, lethal (mortality) and sub-lethal (loss or gain of biomass, reproduction, behavior, morphological changes and immune system cells) effects caused by this substance and its degradation products in these annelids were evaluated. Morphological changes were observed even in organisms exposed to low concentrations, while mortality was the major effect observed in individuals exposed to high levels of indigo carmine dye. The organisms exposed to the IC during the contact test showed mortality after 72h of exposure (LC50 = 75.79mgcm-2), while those exposed to photoproducts showed mortality after 48h (LC50 = 243min). In the chronic study, the organisms displayed a mortality rate of 14%, while those exposed to the photoproduct reached up to 32.7%. A negative influence of the dye on the reproduction rate was observed, while by-products affected juvenile survival. A loss of viability and alterations in the cellular proportion was verified during the chronic test. However, the compounds did not alter the behavior of the annelids in the leak test (RL ranged from 20% to 30%). Although photocatalysis has been presented as an alternative technology for the treatment of waste containing the indigo carmine dye, this process produced byproducts even more toxic than the original compounds to E. andrei. Copyright © 2017

  3. The Bloom syndrome protein limits the lethality associated with RAD51 deficiency.

    Science.gov (United States)

    Lahkim Bennani-Belhaj, Kenza; Rouzeau, Sébastien; Buhagiar-Labarchède, Géraldine; Chabosseau, Pauline; Onclercq-Delic, Rosine; Bayart, Emilie; Cordelières, Fabrice; Couturier, Jérôme; Amor-Guéret, Mounira

    2010-03-01

    Little is known about the functional interaction between the Bloom's syndrome protein (BLM) and the recombinase RAD51 within cells. Using RNA interference technology, we provide the first demonstration that RAD51 acts upstream from BLM to prevent anaphase bridge formation. RAD51 downregulation was associated with an increase in the frequency of BLM-positive anaphase bridges, but not of BLM-associated ultrafine bridges. Time-lapse live microscopy analysis of anaphase bridge cells revealed that BLM promoted cell survival in the absence of Rad51. Our results directly implicate BLM in limiting the lethality associated with RAD51 deficiency through the processing of anaphase bridges resulting from the RAD51 defect. These findings provide insight into the molecular basis of some cancers possibly associated with variants of the RAD51 gene family.

  4. Histone deacetylase inhibitor treatment attenuates coagulation imbalance in a lethal murine model of sepsis

    DEFF Research Database (Denmark)

    Zhao, Ting; Li, Yongqing; Liu, Baoling

    2014-01-01

    BACKGROUND: Sepsis has a profound impact on the inflammatory and hemostatic systems. In addition to systemic inflammation, it can produce disseminated intravascular coagulation, microvascular thrombosis, consumptive coagulopathy, and multiple organ failure. We have shown that treatment with suber......BACKGROUND: Sepsis has a profound impact on the inflammatory and hemostatic systems. In addition to systemic inflammation, it can produce disseminated intravascular coagulation, microvascular thrombosis, consumptive coagulopathy, and multiple organ failure. We have shown that treatment...... with suberoylanilide hydroxamic acid (SAHA), a histone deacetylase inhibitor (HDACI), improves survival in a lethal model of cecal ligation and puncture (CLP) in mice, but its effect on coagulation remains unknown. The goal of this study was to quantify the impact of SAHA treatment on coagulopathy in sepsis. METHODS...

  5. The sub-lethal effects of repeated freezing in the woolly bear caterpillar Pyrrharctia isabella.

    Science.gov (United States)

    Marshall, Katie E; Sinclair, Brent J

    2011-04-01

    Repeated freeze-thaw cycles are common and are increasing in frequency with climate change in many temperate locations, yet understanding of their impact on freeze-tolerant insects is extremely limited. We investigated the effects of repeated freezing and thawing on the freeze-tolerant final instar caterpillars of the moth Pyrrharctia isabella (Lepidoptera: Arctiidae) by subjecting individuals to either a single sustained 35 h freeze or five 7 h freezes. Sub-lethal effects were quantified with changes in three broad groups of measures: (1) cold hardiness, (2) metabolic rate and energy reserves and (3) survival after challenge with fungal spores. Repeated freeze-thaw cycles increased mortality to almost 30% and increased tissue damage in Malpighian tubules and hemocytes. Repeated freezing increased caterpillar glycerol concentration by 0.82 mol l(-1). There were no changes in metabolic rate or energy reserves with repeated freezing. For the first time, we report increased survival after immune challenge in caterpillars after freezing and suggest that this may be linked to wounding during freezing. We suggest that little repair of freezing damage is possible in P. isabella caterpillars and repeated freeze-thaw cycles may present significant challenges to survival in this species.

  6. Protective effect of Cl-amidine against CLP-induced lethal septic shock in mice.

    Science.gov (United States)

    Zhao, Ting; Pan, Baihong; Alam, Hasan B; Liu, Baoling; Bronson, Roderick T; Deng, Qiufang; Wu, Erxi; Li, Yongqing

    2016-11-07

    Production of innate and adaptive immune cells from hematopoietic stem cells, and maturation of T lymphocytes are effective immune responses to fight severe microbial infection. In sepsis, this emergency myelopoiesis is damaged, leading to failure of bacterial clearance, and excessive stress-induced steroids cause immature T-lymphocyte apoptosis in thymus. We recently found that Cl-amidine, a peptidylarginine deiminase (PAD) inhibitor, improves survival in a mouse model of cecal ligation and puncture (CLP)-induced septic shock. In the present study we investigated how Cl-amidine promotes survival, focusing on protective effects of Cl-amidine on immune response. We confirmed survival-improving effect of Cl-amidine and are the first to explore the role of Cl-amidine in immune response. CLP caused bone marrow (BM) and thymus atrophy, decreased innate immune cells in BM. CLP increased levels of cytokines (IL-1β, IL-6, and TNF-α) and bacteria load in blood/liver. In primary splenocyte culture, lipopolysaccharide increased TNF-α production. In contrast, Cl-amidine attenuated these CLP and lipopolysaccharide-induced alterations. Moreover, Cl-amidine increased circulating monocytes. Collectively, our results demonstrate Cl-amidine plays protective roles by significantly decreasing BM and thymus atrophy, restoring innate immune cells in BM, increasing blood monocytes and blood/liver bacteria clearance, and attenuating pro-inflammatory cytokine production in a murine model of lethal sepsis.

  7. Serious post-tonsillectomy hemorrhage with and without lethal outcome in children and adolescents.

    Science.gov (United States)

    Windfuhr, J P; Schloendorff, G; Baburi, D; Kremer, B

    2008-07-01

    Serious post-tonsillectomy hemorrhage (PTH) is an uncommon complication requiring immediate and adequate medical treatment. This study was undertaken to describe and evaluate the clinical data and courses of serious PTH, with and without lethal outcome in children and adolescents. Bleeding episodes accompanied by hemorrhagic shock requiring resuscitation and/or major medical treatment were labeled as serious PTH, with or without lethal outcome. Personal experiences as surgeons and expert reports in connection with lawsuits and Professional Boards, as well as reports collected after a published request contributed to the data collection. Thirty-one boys and 21 girls (gender not stated for three patients) younger than 18 years of age were enrolled in our study (mean: 8.47; median: 6; S.D.: 4.73 years). Thirty-three children were 8 years of age or younger (60%). Lethal outcome was reported for 19 patients of whom 11 had experienced repeated episodes of bleeding. The majority of the surviving children experienced serious PTH without remaining sequelae (32), however, four children suffered from remaining sequelae. Forty-three children experienced repeated episodes of PTH. The first episode of PTH occurred either at home (32) or in the hospital (22; location not stated for one child). Primary hemorrhage (24h) for 52 children (94.5%). A total of 169 bleeding episodes was reported of whom 149 were specified as massive (56), major (31), minor (15), diffuse (12), with spontaneous cessation (19) or vomiting of considerable amounts of blood (16). Aspiration was confirmed at the autopsy of seven patients. Ligature of greater arteries in the neck was performed in 35 cases, suturing of the faucal pillars in four and packing of the oropharynx in six patients. Twenty-four children received blood transfusions. Resuscitation was performed in 17 cases but remained ineffective in seven patients. Repeated episodes of bleeding should be considered as a warning sign of serious PTH

  8. Yohimbine enhances protection of berberine against LPS-induced mouse lethality through multiple mechanisms.

    Directory of Open Access Journals (Sweden)

    Hui Li

    Full Text Available Sepsis remains a major cause of mortality in intensive care units, better therapies are urgently needed. Gram-negative bacterial lipopolysaccharide (LPS is an important trigger of sepsis. We have demonstrated that berberine (Ber protects against lethality induced by LPS, which is enhanced by yohimbine (Y pretreatment, and Ber combined with Y also improves survival in septic mice. However, the precise mechanisms by which Y enhances protection of Ber against LPS-induced lethality remain unclear. The present study confirmed that simultaneously administered Y also enhanced protection of Ber against LPS-induced lethality. Ber or/and Y attenuated liver injury, but not renal injury in LPS-challenged mice. Ber or/and Y all inhibited LPS-stimulated IκBα, JNK and ERK phosphorylation, NF-κB activation as well as TNF-α production. Ber also increased IL-10 production in LPS-challenged mice, which was enhanced by Y. Furthermore, Ber or/and Y all suppressed LPS-induced IRF3, TyK2 and STAT1 phosphorylation, as well as IFN-β and IP-10 mRNA expression in spleen of mice at 1 h after LPS challenge. Especially, Y enhanced the inhibitory effect of Ber on LPS-induced IP-10 mRNA expression. In vitro experiments further demonstrated that Y significantly enhanced the inhibitory effect of Ber on TNF-α production in LPS-treated peritoneal macrophages, Ber combined with Y promoted LPS-induced IL-10 production and LPS-stimulated IκBα, JNK, ERK and IRF3 phosphorylation and NF-κB activation were also suppressed by Ber or/and Y pretreatment in peritoneal macrophages. Taken together, these results demonstrate that Y enhances the protection of Ber against LPS-induced lethality in mice via attenuating liver injury, upregulating IL-10 production and suppressing IκBα, JNK, ERK and IRF3 phosphorylation. Ber combined with Y may be an effective immunomodulator agent for the prevention of sepsis.

  9. Fgf10 deficiency is causative for lethality in a mouse model of bronchopulmonary dysplasia.

    Science.gov (United States)

    Chao, Cho-Ming; Yahya, Faady; Moiseenko, Alena; Tiozzo, Caterina; Shrestha, Amit; Ahmadvand, Negah; El Agha, Elie; Quantius, Jennifer; Dilai, Salma; Kheirollahi, Vahid; Jones, Matthew; Wilhem, Jochen; Carraro, Gianni; Ehrhardt, Harald; Zimmer, Klaus-Peter; Barreto, Guillermo; Ahlbrecht, Katrin; Morty, Rory E; Herold, Susanne; Abellar, Rosanna G; Seeger, Werner; Schermuly, Ralph; Zhang, Jin-San; Minoo, Parviz; Bellusci, Saverio

    2017-01-01

    Inflammation-induced FGF10 protein deficiency is associated with bronchopulmonary dysplasia (BPD), a chronic lung disease of prematurely born infants characterized by arrested alveolar development. So far, experimental evidence for a direct role of FGF10 in lung disease is lacking. Using the hyperoxia-induced neonatal lung injury as a mouse model of BPD, the impact of Fgf10 deficiency in Fgf10(+/-) versus Fgf10(+/+) pups was investigated. In normoxia, no lethality of Fgf10(+/+) or Fgf10(+/-) pups was observed. By contrast, all Fgf10(+/-) pups died within 8 days of hyperoxic injury, with lethality starting at day 5, whereas Fgf10(+/+) pups were all alive. Lungs of pups from the two genotypes were collected on postnatal day 3 following normoxia or hyperoxia exposure for further analysis. In hyperoxia, Fgf10(+/-) lungs exhibited increased hypoalveolarization. Analysis by FACS of the Fgf10(+/-) versus control lungs in normoxia revealed a decreased ratio of alveolar epithelial type II (AECII) cells over total Epcam-positive cells. In addition, gene array analysis indicated reduced AECII and increased AECI transcriptome signatures in isolated AECII cells from Fgf10(+/-) lungs. Such an imbalance in differentiation is also seen in hyperoxia and is associated with reduced mature surfactant protein B and C expression. Attenuation of the activity of Fgfr2b ligands postnatally in the context of hyperoxia also led to increased lethality with decreased surfactant expression. In summary, decreased Fgf10 mRNA levels lead to congenital lung defects, which are compatible with postnatal survival, but which compromise the ability of the lungs to cope with sub-lethal hyperoxic injury. Fgf10 deficiency affects quantitatively and qualitatively the formation of AECII cells. In addition, Fgfr2b ligands are also important for repair after hyperoxia exposure in neonates. Deficient AECII cells could be an additional complication for patients with BPD. Copyright © 2016 Pathological Society of

  10. Effect of experimental manipulation on survival and recruitment of feral pigs

    Science.gov (United States)

    Hanson, L.B.; Mitchell, M.S.; Grand, J.B.; Jolley, D.B.; Sparklin, B.D.; Ditchkoff, S.S.

    2009-01-01

    Lethal removal is commonly used to reduce the density of invasive-species populations, presuming it reduces population growth rate; the actual effect of lethal removal on the vital rates contributing to population growth, however, is rarely tested. We implemented a manipulative experiment of feral pig (Sus scrofa) populations at Fort Benning, Georgia, USA, to assess the demographic effects of harvest intensity. Using markrecapture data, we estimated annual survival, recruitment, and population growth rates of populations in a moderately harvested area and a heavily harvested area for 200406. Population growth rates did not differ between the populations. The top-ranked model for survival included a harvest intensity effect; model-averaged survival was lower for the heavily harvested population than for the moderately harvested population. Increased immigration and reproduction likely compensated for the increased mortality in the heavily harvested population. We conclude that compensatory responses in feral pig recruitment can limit the success of lethal control efforts. ?? 2009 CSIRO.

  11. Thrombomodulin contributes to gamma tocotrienol-mediated lethality protection and hematopoietic cell recovery in irradiated mice.

    Directory of Open Access Journals (Sweden)

    Rupak Pathak

    Full Text Available Systemic administration of recombinant thrombomodulin (TM confers radiation protection partly by accelerating hematopoietic recovery. The uniquely potent radioprotector gamma tocotrienol (GT3, in addition to being a strong antioxidant, inhibits the enzyme hydroxy-methyl-glutaryl-coenzyme A reductase (HMGCR and thereby likely modulates the expression of TM. We hypothesized that the mechanism underlying the exceptional radioprotective properties of GT3 partly depends on the presence of endothelial TM. In vitro studies confirmed that ionizing radiation suppresses endothelial TM (about 40% at 4 hr after 5 Gy γ-irradiation and that GT3 induces TM expression (about 2 fold at the mRNA level after 5 μM GT3 treatment for 4 hr. In vivo survival studies showed that GT3 was significantly more effective as a radioprotector in TM wild type (TM+/+ mice than in mice with low TM function (TMPro/-. After exposure to 9 Gy TBI, GT3 pre-treatment conferred 85% survival in TM+/+ mice compared to only 50% in TMPro/-. Thus, GT3-mediated radiation lethality protection is partly dependent on endothelial TM. Significant post-TBI recovery of hematopoietic cells, particularly leukocytes, was observed in TM+/+ mice (p = 0.003, but not in TMPro/- mice, despite the fact that GT3 induced higher levels of granulocyte colony stimulating factor (G-CSF in TMPro/- mice (p = 0.0001. These data demonstrate a critical, G-CSF-independent, role for endothelial TM in GT3-mediated lethality protection and hematopoietic recovery after exposure to TBI and may point to new strategies to enhance the efficacy of current medical countermeasures in radiological/nuclear emergencies.

  12. An antivector vaccine protects against a lethal vector-borne pathogen.

    Directory of Open Access Journals (Sweden)

    Milan Labuda

    2006-04-01

    Full Text Available Vaccines that target blood-feeding disease vectors, such as mosquitoes and ticks, have the potential to protect against the many diseases caused by vector-borne pathogens. We tested the ability of an anti-tick vaccine derived from a tick cement protein (64TRP of Rhipicephalus appendiculatus to protect mice against tick-borne encephalitis virus (TBEV transmitted by infected Ixodes ricinus ticks. The vaccine has a "dual action" in immunized animals: when infested with ticks, the inflammatory and immune responses first disrupt the skin feeding site, resulting in impaired blood feeding, and then specific anti-64TRP antibodies cross-react with midgut antigenic epitopes, causing rupture of the tick midgut and death of engorged ticks. Three parameters were measured: "transmission," number of uninfected nymphal ticks that became infected when cofeeding with an infected adult female tick; "support," number of mice supporting virus transmission from the infected tick to cofeeding uninfected nymphs; and "survival," number of mice that survived infection by tick bite and subsequent challenge by intraperitoneal inoculation of a lethal dose of TBEV. We show that one dose of the 64TRP vaccine protects mice against lethal challenge by infected ticks; control animals developed a fatal viral encephalitis. The protective effect of the 64TRP vaccine was comparable to that of a single dose of a commercial TBEV vaccine, while the transmission-blocking effect of 64TRP was better than that of the antiviral vaccine in reducing the number of animals supporting virus transmission. By contrast, the commercial antitick vaccine (TickGARD that targets only the tick's midgut showed transmission-blocking activity but was not protective. The 64TRP vaccine demonstrates the potential to control vector-borne disease by interfering with pathogen transmission, apparently by mediating a local cutaneous inflammatory immune response at the tick-feeding site.

  13. Lethal and sub-lethal effects of cypermethrin and glyphosate on the freshwater’s copepod, Acanthocyclops robustus

    OpenAIRE

    AM Houssou; EJ Daguégué; E Montchowui

    2017-01-01

    The study aims to evaluate the acute and chronic toxicity of cypermethrin and glyphosate to a freshwater’s copepod, Arcanthocyclops robustus. The acute sensibility was assessed by estimating lethal concentrations. Then the chronic exposure allowed to assess the effects of low concentrations (0.2489 ppb and 0.4978 ppb respectively 10 % and 20 % of LC50 at 48 h of cypermethrin and 1.3 ppm and 2.6 ppm respectively for glyphosate) on the species. The estimated lethal concentrations at...

  14. Lethal and Sub-lethal Effects of UVB on Juvenile Biomphalaria glabrata (Mollusca: Pulmonata)

    OpenAIRE

    Ruelas, Debbie S.; Karentz, Deneb; Sullivan, John T.

    2006-01-01

    Although Schistosoma mansoni occurs mainly in the tropics, where intense levels of solar radiation are present, the impact of ultraviolet (UV) light on schistosome transmission is not known. The purpose of this study was to investigate potential effects of UVB (290–320 nm) on juvenile Biomphalaria glabrata, the snail intermediate host of S. mansoni. Albino and wild type snails were exposed to doses of UVB from UV-fluorescent lamps, and the following were measured: survival, photoreactivation ...

  15. Sub-lethal radiation enhances anti-tumor immunotherapy in a transgenic mouse model of pancreatic cancer

    Directory of Open Access Journals (Sweden)

    Hanahan Douglas

    2002-05-01

    Full Text Available Abstract Background It is not uncommon to observe circulating tumor antigen-specific T lymphocytes in cancer patients despite a lack of significant infiltration and destruction of their tumors. Thus, an important goal for tumor immunotherapy is to identify ways to modulate in vivo anti-tumor immunity to achieve clinical efficacy. We investigate this proposition in a spontaneous mouse tumor model, Rip1-Tag2. Methods Experimental therapies were carried out in two distinctive trial designs, intended to either intervene in the explosive growth of small tumors, or regress bulky end-stage tumors. Rip1-Tag2 mice received a single transfer of splenocytes from Tag-specific, CD4+ T cell receptor transgenic mice, a single sub-lethal radiation, or a combination therapy in which the lymphocyte transfer was preceded by the sub-lethal radiation. Tumor burden, the extent of lymphocyte infiltration into solid tumors and host survival were used to assess the efficacy of these therapeutic approaches. Results In either intervention or regression, the transfer of Tag-specific T cells alone did not result in significant lymphocyte infiltration into solid tumors, not did it affect tumor growth or host survival. In contrast, the combination therapy resulted in significant reduction in tumor burden, increase in lymphocyte infiltration into solid tumors, and extension of survival. Conclusions The results indicate that certain types of solid tumors may be intrinsically resistant to infiltration and destruction by tumor-specific T lymphocytes. Our data suggest that such resistance can be disrupted by sub-lethal radiation. The combinatorial approach presented here merits consideration in the design of clinical trials aimed to achieve T cell-mediated anti-tumor immunity.

  16. Effect of sub-lethal exposure to ultraviolet radiation on the escape performance of Atlantic cod larvae (Gadus morhua.

    Directory of Open Access Journals (Sweden)

    Yuichi Fukunishi

    Full Text Available The amount of ultraviolet (UV radiation reaching the earth's surface has increased due to depletion of the ozone layer. Several studies have reported that UV radiation reduces survival of fish larvae. However, indirect and sub-lethal impacts of UV radiation on fish behavior have been given little consideration. We observed the escape performance of larval cod (24 dph, SL: 7.6±0.2 mm; 29 dph, SL: 8.2±0.3 mm that had been exposed to sub-lethal levels of UV radiation vs. unexposed controls. Two predators were used (in separate experiments: two-spotted goby (Gobiusculus flavescens; a suction predator and lion's mane jellyfish (Cyanea capillata; a "passive" ambush predator. Ten cod larvae were observed in the presence of a predator for 20 minutes using a digital video camera. Trials were replicated 4 times for goby and 5 times for jellyfish. Escape rate (total number of escapes/total number of attacks ×100, escape distance and the number of larvae remaining at the end of the experiment were measured. In the experiment with gobies, in the UV-treated larvae, both escape rate and escape distance (36%, 38±7.5 mm respectively were significantly lower than those of control larvae (75%, 69±4.7 mm respectively. There was a significant difference in survival as well (UV: 35%,63%. No apparent escape response was observed, and survival rate was not significantly different, between treatments (UV: 66%,74% in the experiment with jellyfish. We conclude that the effect and impact of exposure to sub-lethal levels of UV radiation on the escape performance of cod larvae depends on the type of predator. Our results also suggest that prediction of UV impacts on fish larvae based only on direct effects are underestimations.

  17. Tuning of the Lethal Response to Multiple Stressors with a Single-Site Mutation during Clinical Infection by Staphylococcus aureus

    Directory of Open Access Journals (Sweden)

    Krishan Kumar

    2017-10-01

    Full Text Available The agr system of Staphylococcus aureus promotes invasion of host tissues, and as expected, agents that block agr quorum sensing have anti-infective properties. Paradoxically, agr-defective mutants are frequently recovered from patients, especially those persistently infected with S. aureus. We found that an agr deficiency increased survival of cultured bacteria during severe stress, such as treatment with gentamicin, ciprofloxacin, heat, or low pH. With daptomycin, deletion of agr decreased survival. Therefore, agr activity can be either detrimental or protective, depending on the type of lethal stress. Deletion of agr had no effect on the ability of the antimicrobials to block bacterial growth, indicating that agr effects are limited to lethal action. Thus, the effect of an agr deletion is on bacterial tolerance, not resistance. For gentamicin and daptomycin, activity can be altered by agr-regulated secreted factors. For ciprofloxacin, a detrimental function was downregulation of glutathione peroxidase (bsaA, an enzyme responsible for defense against oxidative stress. Deficiencies in agr and bsaA were epistatic for survival, consistent with agr having a destructive role mediated by reactive oxygen species. Enhanced susceptibility to lethal stress by wild-type agr, particularly antimicrobial stress, helps explain why inactivating mutations in S. aureus agr commonly occur in hospitalized patients during infection. Moreover, the agr quorum-sensing system of S. aureus provides a clinically relevant example in which a single-step change in the response to severe stress alters the evolutionary path of a pathogen during infection.

  18. Activated protein C ameliorates Bacillus anthracis lethal toxin-induced lethal pathogenesis in rats

    Directory of Open Access Journals (Sweden)

    Kau Jyh-Hwa

    2012-11-01

    Full Text Available Abstract Background Lethal toxin (LT is a major virulence factor of Bacillus anthracis. Sprague Dawley rats manifest pronounced lung edema and shock after LT treatments, resulting in high mortality. The heart failure that is induced by LT has been suggested to be a principal mechanism of lung edema and mortality in rodents. Since LT-induced death occurs more rapidly in rats than in mice, suggesting that other mechanisms in addition to the heart dysfunction may be contributed to the fast progression of LT-induced pathogenesis in rats. Coagulopathy may contribute to circulatory failure and lung injury. However, the effect of LT on coagulation-induced lung dysfunction is unclear. Methods To investigate the involvement of coagulopathy in LT-mediated pathogenesis, the mortality, lung histology and coagulant levels of LT-treated rats were examined. The effects of activated protein C (aPC on LT-mediated pathogenesis were also evaluated. Results Fibrin depositions were detected in the lungs of LT-treated rats, indicating that coagulation was activated. Increased levels of plasma D-dimer and thrombomodulin, and the ameliorative effect of aPC further suggested that the activation of coagulation-fibrinolysis pathways plays a role in LT-mediated pathogenesis in rats. Reduced mortality was associated with decreased plasma levels of D-dimer and thrombomodulin following aPC treatments in rats with LT-mediated pathogenesis. Conclusions These findings suggest that the activation of coagulation in lung tissue contributes to mortality in LT-mediated pathogenesis in rats. In addition, anticoagulant aPC may help to develop a feasible therapeutic strategy.

  19. Molecular Epidemiology Investigation of Obesity and Lethal Prostate Cancer

    Science.gov (United States)

    2015-09-01

    diet, lifestyle behaviors, medical history , and disease outcomes • Medical records and pathology reports were reviewed to confirm prostate cancer ...Shah, T. E. Eling, P. A. Wade, Obesity, rather than diet, drives epigenomic alterations in colonic epithelium resembling cancer progression. Cell...1 AWARD NUMBER: W81XWH-14-1-0250 TITLE: Molecular Epidemiology Investigation of Obesity and Lethal Prostate Cancer PRINCIPAL INVESTIGATOR: Ericka

  20. The Lethal "Femme Fatale" in the Noir Tradition.

    Science.gov (United States)

    Boozer, Jack

    2000-01-01

    Traces the lethal seductress through Hollywood's "noir" history from "Double Indemnity" (1944) to "The Last Seduction" (1996). Examines how this figure largely abjures traditional romance and passive domesticity, choosing instead to apply her sexuality to homicidal plots toward greed. Argues that her narrative…

  1. Median lethal dose (LD 50 ) evaluation of some polyherbal ...

    African Journals Online (AJOL)

    The polyherbal preparations reported here are traditionally used in Northern Nigeria for the treatment of wide range of illnesses. The aim of this study was to evaluate the acute toxicity potential of 70% ethanol extracts of forty polyherbal products by determining their median lethal dose (LD50) estimates intraperitoneally and ...

  2. Papaya Lethal Yellowing Virus (PLYV) Infects Vasconcellea cauliflora

    NARCIS (Netherlands)

    Amaral, P.P.R.; Resende, de R.O.; Souza, M.T.

    2006-01-01

    Papaya lethal yellowing virus (PLYV) é um dos três vírus descritos infectando mamoeiros (Carica papaya L.) no Brasil. Vasconcellea cauliflora (Jacq.) A. DC., antes denominada de Carica cauliflora (Jacq.), é uma reconhecida fonte de resistência natural ao Papaya ringspot virus (PRSV), causador da

  3. Some Pathological studies on Indomethacin-Induced Lethality in Rats

    African Journals Online (AJOL)

    At the lethal doses, indomethacin increased bleeding time but not more than a therapeutic dose of aspirin. Mean weight and locomotor activity were reduced significantly by the third day following the administration of 12mgkg-1 of indomethacin. The studies show that other injuries aside from GIT lesions contribute to ...

  4. Dominant-lethal mutations and heritable translocations in mice

    Energy Technology Data Exchange (ETDEWEB)

    Generoso, W.M.

    1983-01-01

    Chromosome aberrations are a major component of radiation or chemically induced genetic damage in mammalian germ cells. The types of aberration produced are dependent upon the mutagen used and the germ-cell stage treated. For example, in male meiotic and postmeiotic germ cells certain alkylating chemicals induce both dominant-lethal mutations and heritable translocations while others induce primarily dominant-lethal mutations. Production of these two endpoints appears to be determined by the stability of alkylation products with the chromosomes. If the reaction products are intact in the male chromosomes at the time of sperm entry, they may be repaired in fertilized eggs. If repair is not effected and the alkylation products persist to the time of pronuclear chromosome replication, they lead to chromatid-type aberrations and eventually to dominant-lethality. The production of heritable translocations, on the other hand, requires a transformation of unstable alkylation products into suitable intermediate lesions. The process by which these lesions are converted into chromosome exchange within the male genome takes place after sperm enters the egg but prior to the time of pronuclear chromosome replication (i.e., chromosome-type). Thus, dominant-lethal mutations result from both chromatid- and chromosome-type aberrations while heritable translocations result primarily from the latter type. DNA target sites associated with the production of these two endpoints are discussed.

  5. Lethal head entrapment--a problem characteristic of early childhood.

    Science.gov (United States)

    Byard, Roger W; Charlwood, Cheryl

    2009-08-01

    Accidental deaths in infancy and early childhood often result from young childrens' lack of understanding of the dangers of certain situations and their physical inability to extricate themselves from potentially lethal circumstances. Two cases are reported to demonstrate an age-related susceptibility in the young to lethal head entrapment. Case 1: a 5-month-old girl smothered when she slipped down in her stroller, trapping her head beneath the frame and forcing her face into the soft material of the base. Case 2: a 14-month-old boy was hanged while exploring a filing cabinet when his head became caught between two lower drawers. Additional mental and physical characteristics that predispose young children and infants to lethal head entrapment include an inability to effectively problem solve once confronted with a hazardous situation, and relatively large heads and weak neck musculature. Because of these features lethal head entrapment represents a particular circumstance that may predispose to accidental asphyxial deaths in the very young. A combination of careful death scene and autopsy evaluations will be required to confirm the alleged circumstances of death in these cases, including mortuary re-enactments and assessment of the deceased infant's level of physical maturity and mobility.

  6. Perforated appendicitis presenting as a thigh abscess: A lethal ...

    African Journals Online (AJOL)

    Typical cases of acute appendicitis have excellent treatment outcomes, if managed appropriately.1 We discuss an unusual case of perforated retrocaecal appendicitis that presented as a right thigh abscess without prominent abdominal symptoms, which highlights the lethal nature of advanced appendicitis even when ...

  7. Brine shrimp lethality and antimicrobial studies on the seeds of ...

    African Journals Online (AJOL)

    Garcinia kola (Family, Guttiferae) is employed in a variety of therapies ranging from skin, gastrointestinal, chest to tumour problems. Preparations of the stem and roots are used as antitumour in traditional medicine but the potential of the seeds as antitumour had not yet been investigated hence the brine-shrimp lethality and ...

  8. The "Lethal Chamber": Further Evidence of the Euthanasia Option.

    Science.gov (United States)

    Elks, Martin A.

    1993-01-01

    Historical discussions of the euthanasia or "lethal chamber" option in relation to people with mental retardation are presented. The paper concludes that eugenic beliefs in the primacy of heredity over environment and the positive role of natural selection may have condoned the poor conditions characteristic of large, segregated institutions and…

  9. Conditional lethality strains for the biological control of Anastrepha species

    Science.gov (United States)

    Pro-apoptotic cell death genes are promising candidates for biologically-based autocidal control of pest insects as demonstrated by tetracycline (tet)-suppressible systems for conditional embryonic lethality in Drosophila melanogaster (Dm) and the medfly, Ceratitis capitata (Cc). However, for medfly...

  10. Perinatal lethal type II osteogenesis imperfecta: a case report | Ayadi ...

    African Journals Online (AJOL)

    We report a new case of osteogenesis imperfecta (OI) type II which is a perinatal lethal form. First trimester ultrasound didn't identified abnormalities. Second trimester ultrasound showed incurved limbs, narrow chest, with hypomineralization and multiple fractures of ribs and long bones. Parents refused pregnancy ...

  11. Comment on "Lethally hot temperatures during the Early Triassic greenhouse".

    Science.gov (United States)

    Goudemand, N; Romano, C; Brayard, A; Hochuli, P A; Bucher, H

    2013-03-01

    Sun et al. (Reports, 19 October 2012, p. 366) reconstructed Permian to Middle Triassic equatorial seawater temperatures. After correct temporal positioning of their data points, their presumed trends of temperature changes, and hence their assumption of a one-to-one relationship between putative "lethally hot" seawater temperatures and a disputable equatorial "eclipse" of some organisms, are no longer supported by their data.

  12. Brine Shrimp Lethality of Alkaloids from Croton sylvaticus Hoechst ...

    African Journals Online (AJOL)

    Euphorbiaceae) and evaluated for their brine shrimp lethality. Julocrotine, a glutarimide alkaloid, was very toxic in vitro with a LC50 (95% confidence interval) value of 0.074 (0.052-0.105) μg/ml. Lupeol and penduliflaworosin were not toxic. The structures ...

  13. Fighting Lethal Yellowing Disease for Coconut Farmers (CIFSRF ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Understanding lethal yellowing disease. The project will: map the geographic extent of the disease;; identify distinct local vectors and secondary plant hosts;; characterize and compare local strains with African and Caribbean strains of the disease; and; develop effective, practical disease management strategies. The project ...

  14. Radiographic and prenatal ultrasound features of perinatal lethal ...

    African Journals Online (AJOL)

    (22 mm) at 27 weeks and polyhydramnios, platyspondyly and a small thoracic cavity at 36 weeks' gestation. Radiographic and prenatal ultrasound features of perinatal lethal hypophosphatasia – differentia- tion from osteogenesis imperfecta type II. S Wiebe, MD, FRCPC. Department of Medical Imaging, Royal University ...

  15. Drosophila simulans Lethal hybrid rescue mutation (Lhr) rescues ...

    Indian Academy of Sciences (India)

    Our results reveal that the phenotypes of the 'Lhr dependent rescued' hybrids were largely dependent on the genetic background and the dominance in species and hybrids, and not on Lhr. Cytological examination reveal that while the salivary chromosome of 'larval lethal' male carrying melanogaster X chromosome was ...

  16. Antioxidant, icthyotoxicity and brine shrimp lethality tests of Magonia glabrata.

    Science.gov (United States)

    Lemos, Telma L G; Machado, Luciana L; Souza, João S N; Fonseca, Aluisio M; Maia, Juliana L; Pessoa, Otilia D L

    2006-09-01

    The ethanolic extract of the fruit bark from Magonia glabrata yielded shikimic acid, scopoletin, sitosterol glycoside and 2-O-methyl-l-inositol. Antioxidant, icthyotoxicity and brine shrimp lethality activities were observed in this extract. The major constituent, 2-O-methyl-l-inositol, was found to be inactive in two assays but showed moderate activity as a radical scavenger.

  17. Markers of inflammation as risk predictors of lethal outcome in patients diagnosed with delirium

    Directory of Open Access Journals (Sweden)

    Stašević-Karličić Ivana

    2016-01-01

    Full Text Available Background/Aim. Delirium is an acute or subacute, and most frequently reversible syndrome of higher cortical functions disturbances that is manifested as generalized disorder. If not prevented, it is associated with various adverse outcomes. The aim of this study was to determine the connection between the markers of inflammation and lethal outcome in patients diagnosed with delirium, hospitalized in the psychiatric intensive care unit. Methods. This retrospective study included 120 patients hospitalized in the psychiatric intensive care unit in whom examination of differences in inflammation markers was done. The examinees have been divided into two groups: the case group of 40 patients who died during the hospitalization, and the control group of 80 examinees who were discharged with the diagnosis Post delirium status. The following variables were taken into account: age, gender, clinical diagnosis of infection (pneumonia and urinary tract infection, laboratory parameters (total of white blood cells, granulocytes, monocytes, C-reactive protein − CRP and type of delirium (withdrawal or organic. Results. The average age of patients was 50.3 ± 13.1 years. The patients who survived delirium, were on the average 10.5 years younger than the deceased (p < 0.001. More than half (57.5% of the deceased had pneumonia. There was a statistically significant correlation between pneumonia and lethal outcome in the patients with delirium (p < 0.001. The examinees with lethal outcome had significantly higher median CRP levels than the group of examinees who survived (75.6% ± 54.0 vs 30.3 ± 42.5 ng/L, p < 0.001. Conclusion. Aiming to better and more precise diagnostics of this complicated and still unclear neuropsychiatric syndrome it would be useful to consider introduction of more precise diagnostic algorithms in every unit of intensive care. That would significantly reduce the number of delirium diagnosis overlook, decrease complication of clinical

  18. Annotating novel genes by integrating synthetic lethals and genomic information

    Directory of Open Access Journals (Sweden)

    Faty Mahamadou

    2008-01-01

    Full Text Available Abstract Background Large scale screening for synthetic lethality serves as a common tool in yeast genetics to systematically search for genes that play a role in specific biological processes. Often the amounts of data resulting from a single large scale screen far exceed the capacities of experimental characterization of every identified target. Thus, there is need for computational tools that select promising candidate genes in order to reduce the number of follow-up experiments to a manageable size. Results We analyze synthetic lethality data for arp1 and jnm1, two spindle migration genes, in order to identify novel members in this process. To this end, we use an unsupervised statistical method that integrates additional information from biological data sources, such as gene expression, phenotypic profiling, RNA degradation and sequence similarity. Different from existing methods that require large amounts of synthetic lethal data, our method merely relies on synthetic lethality information from two single screens. Using a Multivariate Gaussian Mixture Model, we determine the best subset of features that assign the target genes to two groups. The approach identifies a small group of genes as candidates involved in spindle migration. Experimental testing confirms the majority of our candidates and we present she1 (YBL031W as a novel gene involved in spindle migration. We applied the statistical methodology also to TOR2 signaling as another example. Conclusion We demonstrate the general use of Multivariate Gaussian Mixture Modeling for selecting candidate genes for experimental characterization from synthetic lethality data sets. For the given example, integration of different data sources contributes to the identification of genetic interaction partners of arp1 and jnm1 that play a role in the same biological process.

  19. Annotating novel genes by integrating synthetic lethals and genomic information.

    Science.gov (United States)

    Schöner, Daniel; Kalisch, Markus; Leisner, Christian; Meier, Lukas; Sohrmann, Marc; Faty, Mahamadou; Barral, Yves; Peter, Matthias; Gruissem, Wilhelm; Bühlmann, Peter

    2008-01-14

    Large scale screening for synthetic lethality serves as a common tool in yeast genetics to systematically search for genes that play a role in specific biological processes. Often the amounts of data resulting from a single large scale screen far exceed the capacities of experimental characterization of every identified target. Thus, there is need for computational tools that select promising candidate genes in order to reduce the number of follow-up experiments to a manageable size. We analyze synthetic lethality data for arp1 and jnm1, two spindle migration genes, in order to identify novel members in this process. To this end, we use an unsupervised statistical method that integrates additional information from biological data sources, such as gene expression, phenotypic profiling, RNA degradation and sequence similarity. Different from existing methods that require large amounts of synthetic lethal data, our method merely relies on synthetic lethality information from two single screens. Using a Multivariate Gaussian Mixture Model, we determine the best subset of features that assign the target genes to two groups. The approach identifies a small group of genes as candidates involved in spindle migration. Experimental testing confirms the majority of our candidates and we present she1 (YBL031W) as a novel gene involved in spindle migration. We applied the statistical methodology also to TOR2 signaling as another example. We demonstrate the general use of Multivariate Gaussian Mixture Modeling for selecting candidate genes for experimental characterization from synthetic lethality data sets. For the given example, integration of different data sources contributes to the identification of genetic interaction partners of arp1 and jnm1 that play a role in the same biological process.

  20. Protective effects of a Modified Vaccinia Ankara-based vaccine candidate against Crimean-Congo Haemorrhagic Fever virus require both cellular and humoral responses

    OpenAIRE

    Dowall, Stuart D.; Graham, Victoria A.; Emma Rayner; Laura Hunter; Robert Watson; Irene Taylor; Antony Rule; Carroll, Miles W.; Roger Hewson

    2016-01-01

    Crimean-Congo Haemorrhagic Fever (CCHF) is a severe tick-borne disease, endemic in many countries in Africa, the Middle East, Eastern Europe and Asia. There is no approved vaccine currently available against CCHF. The most promising candidate, which has previously been shown to confer protection in the small animal model, is a modified Vaccinia Ankara virus vector expressing the CCHF viral glycoprotein (MVA-GP). It has been shown that MVA-GP induces both humoral and cellular immunogenicity. I...

  1. Protective Immunity against Lethal F. tularensis holarctica LVS Provided by Vaccination with Selected Novel CD8+ T Cell Epitopes

    Science.gov (United States)

    Bar-Haim, Erez; Bar-On, Liat; Ehrlich, Sharon; Shafferman, Avigdor

    2014-01-01

    Recently we described an unbiased bacterial whole-genome immunoinformatic analysis aimed at selection of potential CTL epitopes located in “hotspots” of predicted MHC-I binders. Applying this approach to the proteome of the facultative intra-cellular pathogen Francisella tularensis resulted in identification of 170 novel CTL epitopes, several of which were shown to elicit highly robust T cell responses. Here we demonstrate that by DNA immunization using a short DNA fragment expressing six of the most prominent identified CTL epitopes a potent and specific CD8+ T cell responses is being induced, to all encoded epitopes, a response not observed in control mice immunized with the DNA vector alone Moreover, this CTL-specific mediated immune response prevented disease development, allowed for a rapid clearance of the bacterial infection and provided complete protection against lethal challenge (10LD50) with F. tularensis holarctica Live Vaccine Strain (LVS) (a total to 30 of 30 immunized mice survived the challenge while all control DNA vector immunized mice succumbed). Furthermore, and in accordance with these results, CD8 deficient mice could not be protected from lethal challenge after immunization with the CTL-polyepitope. Vaccination with the DNA poly-epitope construct could even protect mice (8/10) against the more demanding pulmonary lethal challenge of LVS. Our approach provides a proof-of-principle for selecting and generating a multi-epitpoe CD8 T cell-stimulating vaccine against a model intracellular bacterium. PMID:24400128

  2. Protective immunity against lethal F. tularensis holarctica LVS provided by vaccination with selected novel CD8+ T cell epitopes.

    Science.gov (United States)

    Rotem, Shahar; Cohen, Ofer; Bar-Haim, Erez; Bar-On, Liat; Ehrlich, Sharon; Shafferman, Avigdor

    2014-01-01

    Recently we described an unbiased bacterial whole-genome immunoinformatic analysis aimed at selection of potential CTL epitopes located in "hotspots" of predicted MHC-I binders. Applying this approach to the proteome of the facultative intra-cellular pathogen Francisella tularensis resulted in identification of 170 novel CTL epitopes, several of which were shown to elicit highly robust T cell responses. Here we demonstrate that by DNA immunization using a short DNA fragment expressing six of the most prominent identified CTL epitopes a potent and specific CD8+ T cell responses is being induced, to all encoded epitopes, a response not observed in control mice immunized with the DNA vector alone Moreover, this CTL-specific mediated immune response prevented disease development, allowed for a rapid clearance of the bacterial infection and provided complete protection against lethal challenge (10LD50) with F. tularensis holarctica Live Vaccine Strain (LVS) (a total to 30 of 30 immunized mice survived the challenge while all control DNA vector immunized mice succumbed). Furthermore, and in accordance with these results, CD8 deficient mice could not be protected from lethal challenge after immunization with the CTL-polyepitope. Vaccination with the DNA poly-epitope construct could even protect mice (8/10) against the more demanding pulmonary lethal challenge of LVS. Our approach provides a proof-of-principle for selecting and generating a multi-epitpoe CD8 T cell-stimulating vaccine against a model intracellular bacterium.

  3. LRP5 and LRP6 are not required for protective antigen-mediated internalization or lethality of anthrax lethal toxin.

    Directory of Open Access Journals (Sweden)

    John J Young

    2007-03-01

    Full Text Available Anthrax toxin (AnTx plays a key role in the pathogenesis of anthrax. AnTx is composed of three proteins: protective antigen (PA, edema factor, and lethal factor (LF. PA is not toxic but serves to bind cells and translocate the toxic edema factor or LF moieties to the cytosol. Recently, the low-density lipoprotein receptor-related protein LRP6 has been reported to mediate internalization and lethality of AnTx. Based on its similarity to LRP6, we hypothesized that LRP5 may also play a role in cellular uptake of AnTx. We assayed PA-dependent uptake of anthrax LF or a cytotoxic LF fusion protein (FP59 in cells and mice harboring targeted deletions of Lrp5 or Lrp6. Unexpectedly, we observed that uptake was unaltered in the presence or absence of either Lrp5 or Lrp6 expression. Moreover, we observed efficient PA-mediated uptake into anthrax toxin receptor (ANTXR-deficient Chinese hamster ovary cells (PR230 that had been stably engineered to express either human ANTXR1 or human ANTXR2 in the presence or absence of siRNA specific for LRP5 or LRP6. Our results demonstrate that neither LRP5 nor LRP6 is necessary for PA-mediated internalization or lethality of anthrax lethal toxin.

  4. A capripoxvirus detection PCR and antibody ELISA based on the major antigen P32, the homolog of the vaccinia virus H3L gene.

    Science.gov (United States)

    Heine, H G; Stevens, M P; Foord, A J; Boyle, D B

    1999-07-30

    Sheeppoxvirus (SPV), goatpoxvirus (GPV) and lumpy skin disease virus (LSDV) of cattle belong to the Capripoxvirus genus of the Poxviridae family and can cause significant economic losses in countries where they are endemic. Capripox diagnosis by classical virological methods dependent on live capripox virus is not suitable in countries such as Australia where the virus is exotic and live virus is not available. To develop diagnostic tests based on recombinant material, we cloned and sequenced a 3.7 kb viral DNA fragment of SPV that contained open reading frames homologous to the vaccinia virus J6R, H1L, H2R, H3L and H4L genes. A capripoxvirus specific PCR assay was developed that differentiated between SPV and LSDV on the basis of unique restriction sites in the corresponding PCR fragments. The vaccinia virus H3L homolog was identified as the capripoxvirus P32 antigen. The P32 proteins of SPV and LSDV were expressed in Escherichia coli as a fusion protein with a poly-histidine tag and affinity purified on metal binding resin. The full-length P32 protein contained a transmembrane region close to the carboxy terminus and was membrane associated but could be solubilised in detergent and used as trapping antigen in an antibody detection ELISA. The ELISA was specific for capripoxvirus as only sera from sheep infected with capripoxvirus but not orf or vaccinia virus reacted with the capripoxvirus P32 antigen.

  5. Vaccinia virus outperforms a panel of other poxviruses as a potent oncolytic agent for the control of head and neck squamous cell carcinoma cell lines.

    Science.gov (United States)

    Nichols, Anthony C; Yoo, John; Um, Sung; Mundi, Neil; Palma, David A; Fung, Kevin; Macneil, S Danielle; Koropatnick, James; Mymryk, Joe S; Barrett, John W

    2014-01-01

    Head and neck squamous cell carcinoma (HNSCC) is the fifth most common cancer worldwide. Existing therapies for advanced tumors have high failure rates and can have severe consequences in terms of pain, disfigurement, and poor speech and swallowing function. New treatment strategies are needed to improve outcomes for patients suffering with this disease and oncolytic viruses represent a promising approach. We infected six well-characterized HNSCC cell lines (Cal27, Detroit562, FaDu, SCC4, SCC15, SCC25), with increasing doses of a panel of poxviruses (including myxoma, vaccinia, raccoonpox and tanapox viruses) modified to express green fluorescence protein to determine which virus was the most effective oncolytic agent in cell-based assays. While myxoma, raccoonpox and tanapox displayed differing efficacy in the panel of cell lines, vaccinia virus was the most potent of the tested poxviruses and was highly effective in controlling cell growth in all cell lines. Oncolytic poxviruses, particularly vaccinia virus, were effective in killing HNSCC in vitro and hold promise as potential treatments for patients with HNSCC. Copyright © 2013 S. Karger AG, Basel.

  6. Immunogenicity and virulence of attenuated vaccinia virus Tian Tan encoding HIV-1 muti-epitope genes, p24 and cholera toxin B subunit in mice.

    Science.gov (United States)

    Du, Shouwen; Wang, Yuhang; Liu, Cunxia; Wang, Maopeng; Zhu, Yilong; Tan, Peng; Ren, Dayong; Li, Xiao; Tian, Mingyao; Yin, Ronglan; Li, Chang; Jin, Ningyi

    2015-07-01

    No effective prophylactic or therapeutic vaccine against HIV-1 in humans is currently available. This study analyzes the immunogenicity and safety of a recombinant attenuated vaccinia virus. A chimeric gene of HIV-1 multi-epitope genes containing CpG ODN and cholera toxin B subunit (CTB) was inserted into Chinese vaccinia virus Tian Tan strain (VTT) mutant strain. The recombinant virus rddVTT(-CCMp24) was assessed for immunogenicity and safety in mice. Results showed that the protein CCMp24 was expressed stably in BHK-21 infected with rddVTT(-CCMp24). And the recombinant virus induced the production of HIV-1 p24 specific immunoglobulin G (IgG), IL-2 and IL-4. The recombinant vaccine induced γ-interferon secretion against HIV peptides, and elicited a certain levels of immunological memory. Results indicated that the recombinant virus had certain immunogenicity to HIV-1. Additionally, the virulence of the recombinant virus was been attenuated in vivo of mice compared with wild type VTT (wtVTT), and the introduction of CTB and HIV Mp24 did not alter the infectivity and virulence of defective vaccinia virus. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. The effects of thermal acclimation on lethal temperatures and critical thermal limits in the green vegetable bug, Nezara viridula (L. (Hemiptera: Pentatomidae

    Directory of Open Access Journals (Sweden)

    Pol eChanthy

    2012-12-01

    Full Text Available According to geographical distribution, Nezara viridula (Heteroptera: Pentatomidae can be found across tropical, subtropical and temperate regions and this pattern is assumed to reflect differences in thermal adaptation, particularly in cold tolerance. Here the lethal temperature and critical thermal limits (thermal tolerance are examined for N. viridula. The upper lethal temperature for N. viridula at two contrasting climate locations (Breeza and Grafton, New South Wales, Australia was 40.3ºC with 20% survival under the stress of high temperature. The lower lethal temperature did not differ between these two populations and was -8.0ºC with 20% survival under low temperature stress. Survival of N. viridula increased after acclimation at high temperature for seven days. In contrast, when acclimated at lower temperatures (10 and 15ºC, survival of Breeza and Grafton N. viridula was lower than 20% at -8.0ºC.Control-reared N. viridula adults (25ºC had a mean CTMinOnset (cold stupor of 1.3 ± 2.1ºC and a mean CTMax (heat coma of 45.9 ± 0.9ºC. After 7 days of acclimation at 10, 20, 30, or 35ºC, N. viridula adults exhibited a 1ºC change in CTMax and a ~ 1.5ºC change in CTMinOnset. CTMax and CTMinOnset of Breeza and Grafton N. viridula populations did not differ across acclimation temperatures. These results suggest that short-term temperature acclimation is more important than provenance for determining lethal temperatures and critical thermal limits in N. viridula.

  8. Increased Radioresistance to Lethal Doses of Gamma Rays in Mice and Rats after Exposure to Microwave Radiation Emitted by a GSM Mobile Phone Simulator.

    Science.gov (United States)

    Mortazavi, Smj; Mosleh-Shirazi, Ma; Tavassoli, Ar; Taheri, M; Mehdizadeh, Ar; Namazi, Sas; Jamali, A; Ghalandari, R; Bonyadi, S; Haghani, M; Shafie, M

    2013-01-01

    The aim of this study was to investigate the effect of pre-irradiation with microwaves on the induction of radioadaptive response. In the 1(st) phase of the study, 110 male mice were divided into 8 groups. The animals in these groups were exposed/sham-exposed to microwave, low dose rate gamma or both for 5 days. On day six, the animals were exposed to a lethal dose (LD). In the 2(nd) phase, 30 male rats were divided into 2 groups of 15 animals. The 1(st) group received microwave exposure. The 2(nd) group (controls) received the same LD but there was no treatment before the LD. On day 5, all animals were whole-body irradiated with the LD. Statistically significant differences between the survival rate of the mice only exposed to lethal dose of gamma radiation before irradiation with a lethal dose of gamma radiation with those of the animals pre-exposed to either microwave (p=0.02), low dose rate gamma (p=0.001) or both of these physical adapting doses (p=0.003) were observed. Likewise, a statistically significant difference between survival rates of the rats in control and test groups was observed. Altogether, these experiments showed that exposure to microwave radiation may induce a significant survival adaptive response.

  9. An Overview of Crowd Control Theory and Considerations for the Employment of Non-Lethal Weapons

    National Research Council Canada - National Science Library

    Grieger, Dion

    2003-01-01

    .... In campaigns such as these, there is a case for the use of non-lethal weapons to complement the existing range of traditional weapons in order to help bridge the gap between responding with lethal...

  10. Susac's syndrome, a rare, potentially severe or lethal neurological disease.

    Science.gov (United States)

    Saux, A; Niango, G; Charif, M; Morales, R; Mura, F; Bonafe, A; Mourand, I

    2010-10-15

    Susac's syndrome (SS) is a rare, immune-mediated endotheliopathy affecting the microvasculature of the brain, the inner ear and the retina. Clinical presentation is characterised by a triad: encephalopathy, hearing loss and branch retinal artery occlusion (BRAO). Given the rarity of this disease, its natural history still remains partially unknown, but lethal cases appear to be extremely rare since there has never been, to our knowledge, a report of SS leading to death. We report 2 cases of SS illustrating the multiplicity of neurological symptomatology and its unpredictable course. One case is particularly unusual due to its severe neurological evolution, leading to death despite treatments. This report presents clinical and paraclinical findings contributory to SS diagnosis and offers an innovative perspective on disease management. These cases represent the potential severity of this disease. Early, aggressive treatment strategies may be warranted for SS in order to avoid neurological deterioration and lethal evolution. Copyright 2010 Elsevier B.V. All rights reserved.

  11. Tuning of the Lethal Response to Multiple Stressors with a Single-Site Mutation during Clinical Infection by Staphylococcus aureus.

    Science.gov (United States)

    Kumar, Krishan; Chen, John; Drlica, Karl; Shopsin, Bo

    2017-10-24

    The agr system of Staphylococcus aureus promotes invasion of host tissues, and as expected, agents that block agr quorum sensing have anti-infective properties. Paradoxically, agr-defective mutants are frequently recovered from patients, especially those persistently infected with S. aureus We found that an agr deficiency increased survival of cultured bacteria during severe stress, such as treatment with gentamicin, ciprofloxacin, heat, or low pH. With daptomycin, deletion of agr decreased survival. Therefore, agr activity can be either detrimental or protective, depending on the type of lethal stress. Deletion of agr had no effect on the ability of the antimicrobials to block bacterial growth, indicating that agr effects are limited to lethal action. Thus, the effect of an agr deletion is on bacterial tolerance, not resistance. For gentamicin and daptomycin, activity can be altered by agr-regulated secreted factors. For ciprofloxacin, a detrimental function was downregulation of glutathione peroxidase (bsaA), an enzyme responsible for defense against oxidative stress. Deficiencies in agr and bsaA were epistatic for survival, consistent with agr having a destructive role mediated by reactive oxygen species. Enhanced susceptibility to lethal stress by wild-type agr, particularly antimicrobial stress, helps explain why inactivating mutations in S. aureus agr commonly occur in hospitalized patients during infection. Moreover, the agr quorum-sensing system of S. aureus provides a clinically relevant example in which a single-step change in the response to severe stress alters the evolutionary path of a pathogen during infection.IMPORTANCE When phenotypes produced in response to an environmental stress are inadequate to buffer against that stress, changes that do buffer may become genetically encoded by natural selection. A clinically relevant example is seen with S. aureus mutants that are deficient in the key virulence regulator agr Paradoxically, defects in agr

  12. Linear Epitopes in Vaccinia Virus A27 Are Targets of Protective Antibodies Induced by Vaccination against Smallpox.

    Science.gov (United States)

    Kaever, Thomas; Matho, Michael H; Meng, Xiangzhi; Crickard, Lindsay; Schlossman, Andrew; Xiang, Yan; Crotty, Shane; Peters, Bjoern; Zajonc, Dirk M

    2016-05-01

    Vaccinia virus (VACV) A27 is a target for viral neutralization and part of the Dryvax smallpox vaccine. A27 is one of the three glycosaminoglycan (GAG) adhesion molecules and binds to heparan sulfate. To understand the function of anti-A27 antibodies, especially their protective capacity and their interaction with A27, we generated and subsequently characterized 7 murine monoclonal antibodies (MAbs), which fell into 4 distinct epitope groups (groups I to IV). The MAbs in three groups (groups I, III, and IV) bound to linear peptides, while the MAbs in group II bound only to VACV lysate and recombinant A27, suggesting that they recognized a conformational and discontinuous epitope. Only group I antibodies neutralized the mature virion in a complement-dependent manner and protected against VACV challenge, while a group II MAb partially protected against VACV challenge but did not neutralize the mature virion. The epitope for group I MAbs was mapped to a region adjacent to the GAG binding site, a finding which suggests that group I MAbs could potentially interfere with the cellular adhesion of A27. We further determined the crystal structure of the neutralizing group I MAb 1G6, as well as the nonneutralizing group IV MAb 8E3, bound to the corresponding linear epitope-containing peptides. Both the light and the heavy chains of the antibodies are important in binding to their antigens. For both antibodies, the L1 loop seems to dominate the overall polar interactions with the antigen, while for MAb 8E3, the light chain generally appears to make more contacts with the antigen. Vaccinia virus is a powerful model to study antibody responses upon vaccination, since its use as the smallpox vaccine led to the eradication of one of the world's greatest killers. The immunodominant antigens that elicit the protective antibodies are known, yet for many of these antigens, little information about their precise interaction with antibodies is available. In an attempt to better

  13. Recombination-mediated genetic engineering of a bacterial artificial chromosome clone of modified vaccinia virus Ankara (MVA.

    Directory of Open Access Journals (Sweden)

    Matthew G Cottingham

    2008-02-01

    Full Text Available The production, manipulation and rescue of a bacterial artificial chromosome clone of Vaccinia virus (VAC-BAC in order to expedite construction of expression vectors and mutagenesis of the genome has been described (Domi & Moss, 2002, PNAS99 12415-20. The genomic BAC clone was 'rescued' back to infectious virus using a Fowlpox virus helper to supply transcriptional machinery. We apply here a similar approach to the attenuated strain Modified Vaccinia virus Ankara (MVA, now widely used as a safe non-replicating recombinant vaccine vector in mammals, including humans. Four apparently full-length, rescuable clones were obtained, which had indistinguishable immunogenicity in mice. One clone was shotgun sequenced and found to be identical to the parent. We employed GalK recombination-mediated genetic engineering (recombineering of MVA-BAC to delete five selected viral genes. Deletion of C12L, A44L, A46R or B7R did not significantly affect CD8(+ T cell immunogenicity in BALB/c mice, but deletion of B15R enhanced specific CD8(+ T cell responses to one of two endogenous viral epitopes (from the E2 and F2 proteins, in accordance with published work (Staib et al., 2005, J. Gen. Virol.86, 1997-2006. In addition, we found a higher frequency of triple-positive IFN-gamma, TNF-alpha and IL-2 secreting E3-specific CD8+ T-cells 8 weeks after vaccination with MVA lacking B15R. Furthermore, a recombinant vaccine capable of inducing CD8(+ T cells against an epitope from Plasmodium berghei was created using GalK counterselection to insert an antigen expression cassette lacking a tandem marker gene into the traditional thymidine kinase locus of MVA-BAC. MVA continues to feature prominently in clinical trials of recombinant vaccines against diseases such as HIV-AIDS, malaria and tuberculosis. Here we demonstrate in proof-of-concept experiments that MVA-BAC recombineering is a viable route to more rapid and efficient generation of new candidate mutant and recombinant

  14. Efficacy of Favipiravir Alone and in Combination With Ribavirin in a Lethal, Immunocompetent Mouse Model of Lassa Fever.

    Science.gov (United States)

    Oestereich, Lisa; Rieger, Toni; Lüdtke, Anja; Ruibal, Paula; Wurr, Stephanie; Pallasch, Elisa; Bockholt, Sabrina; Krasemann, Susanne; Muñoz-Fontela, César; Günther, Stephan

    2016-03-15

    We studied the therapeutic potential of favipiravir (T-705) for Lassa fever, both alone and in combination with ribavirin. Favipiravir suppressed Lassa virus replication in cell culture by 5 log10 units. In a novel lethal mouse model, it lowered the viremia level and the virus load in organs and normalized levels of cell-damage markers. Treatment with 300 mg/kg per day, commenced 4 days after infection, when the viremia level had reached 4 log10 virus particles/mL, rescued 100% of Lassa virus-infected mice. We found a synergistic interaction between favipiravir and ribavirin in vitro and an increased survival rate and extended survival time when combining suboptimal doses in vivo. © The Author 2015. Published by Oxford University Press for the Infectious Diseases Society of America.

  15. CA-074Me Protection against Anthrax Lethal Toxin▿

    OpenAIRE

    Zachary L Newman; Stephen H Leppla; Moayeri, Mahtab

    2009-01-01

    Anthrax lethal toxin (LT) activates the NLRP1b (NALP1b) inflammasome and caspase-1 in macrophages from certain inbred mouse strains, but the mechanism by which this occurs is poorly understood. We report here that similar to several NLRP3 (NALP3, cryopyrin)-activating stimuli, LT activation of the NLRP1b inflammasome involves lysosomal membrane permeabilization (LMP) and subsequent cytoplasmic cathepsin B activity. CA-074Me, a potent cathepsin B inhibitor, protects LT-sensitive macrophages fr...

  16. [Lethal intravenous infusion of a wound antiseptic containing polyhexanide].

    Science.gov (United States)

    Wehner, Frank; Wehner, Heinz-Dieter; Schulz, Martin Manfred

    2009-01-01

    Polyhexamethylene biguanide (PHMB) is considered to be highly histocompatible and is one of the most frequently used wound antiseptics. Only one case of intoxication has been reported so far. The present case of a lethal intoxication is the first fatal incident described where causality is substantiated by a temporal coincidence between application and ascertainable organ damage. The laboratory-chemical and histological investigations verified the toxicity of this substance after intravenous application with the main findings being severe hepatic and pancreatic damage.

  17. Autopsy observations in lethal short-rib polydactyly syndromes.

    Science.gov (United States)

    Okiro, Patricia; Wainwright, Helen; Spranger, Jürgen; Beighton, Peter

    2015-01-01

    The short rib-polydactyly syndromes are a heterogeneous group of lethal autosomal recessive disorders (SRP I-IV), which result from cellular ciliary dysfunction during embryogenesis. Diagnosis is conventionally based on radiographic imaging. Since 1976, postmortem investigations of 5 affected fetuses or stillbirths have been undertaken and the visceral abnormalities have been documented. These anomalies are discussed in the context of prenatal differential diagnosis and prognostication following imaging in pregnancy and at autopsy following miscarriage or stillbirth.

  18. Lethal Autonomous Weapons: Take the Human Out of the Loop

    Science.gov (United States)

    2017-06-16

    necessarily endorsed by the US Naval War College or the Department of the Navy. 16 June 2017 3 4 Table of Contents Introduction ... Introduction Lethal Autonomous Weapons (LAWS) should be employed by the United States on the field of battle. LAWS will save lives because they are... philosophy and my training guidance, they’ll know the 28 Ibid. 29 Ibid. 18 lessons that I

  19. Meckel-Gruber syndrome: A rare and lethal anomaly.

    Science.gov (United States)

    Kheir, Abdelmoneim E M; Imam, Abdelmutalab; Omer, Ilham M; Hassan, Ibtsama M A; Elamin, Sara A; Awadalla, Esra A; Gadalla, Mohammed H; Hamdoon, Tagwa A

    2012-01-01

    Meckel-Gruber syndrome is a rare and lethal autosomal recessive disorder characterized by occipital encephalocele, postaxial polydactyly and bilateral dysplastic cystic kidneys. It can be associated with many other conditions. Antenatal ultrasound examination establishes the diagnosis by identifying at least two of the major features described. We describe a female baby who had the typical triad of Meckel-Gruber syndrome and died shortly after birth.

  20. Meckel-Gruber syndrome: A rare and lethal anomaly

    OpenAIRE

    Kheir, Abdelmoneim E. M.; Imam, Abdelmutalab; Omer, Ilham M.; Hassan, Ibtsama M.A.; Elamin, Sara A.; Awadalla, Esra A.; Gadalla, Mohammed H.; Hamdoon, Tagwa A.

    2012-01-01

    Meckel-Gruber syndrome is a rare and lethal autosomal recessive disorder characterized by occipital encephalocele, postaxial polydactyly and bilateral dysplastic cystic kidneys. It can be associated with many other conditions. Antenatal ultrasound examination establishes the diagnosis by identifying at least two of the major features described. We describe a female baby who had the typical triad of Meckel-Gruber syndrome and died shortly after birth.

  1. Protection against lethal Marburg virus infection mediated by lipid encapsulated small interfering RNA.

    Science.gov (United States)

    Ursic-Bedoya, Raul; Mire, Chad E; Robbins, Marjorie; Geisbert, Joan B; Judge, Adam; MacLachlan, Ian; Geisbert, Thomas W

    2014-02-15

    Marburg virus (MARV) infection causes severe morbidity and mortality in humans and nonhuman primates. Currently, there are no licensed therapeutics available for treating MARV infection. Here, we present the in vitro development and in vivo evaluation of lipid-encapsulated small interfering RNA (siRNA) as a potential therapeutic for the treatment of MARV infection. The activity of anti-MARV siRNAs was assessed using dual luciferase reporter assays followed by in vitro testing against live virus. Lead candidates were tested in lethal guinea pig models of 3 different MARV strains (Angola, Ci67, Ravn). Treatment resulted in 60%-100% survival of guinea pigs infected with MARV. Although treatment with siRNA targeting other MARV messenger RNA (mRNA) had a beneficial effect, targeting the MARV NP mRNA resulted in the highest survival rates. NP-718m siRNA in lipid nanoparticles provided 100% protection against MARV strains Angola and Ci67, and 60% against Ravn. A cocktail containing NP-718m and NP-143m provided 100% protection against MARV Ravn. These data show protective efficacy against the most pathogenic Angola strain of MARV. Further development of the lipid nanoparticle technology has the potential to yield effective treatments for MARV infection.

  2. Active and passive immunization protects against lethal, extreme drug resistant-Acinetobacter baumannii infection.

    Directory of Open Access Journals (Sweden)

    Guanpingshen Luo

    Full Text Available Extreme-drug-resistant (XDR Acinetobacter baumannii is a rapidly emerging pathogen causing infections with unacceptably high mortality rates due to inadequate available treatment. New methods to prevent and treat such infections are a critical unmet medical need. To conduct a rational vaccine discovery program, OmpA was identified as the primary target of humoral immune response after intravenous infection by A. baumannii in mice. OmpA was >99% conserved at the amino acid level across clinical isolates harvested between 1951 and 2009 from cerebrospinal fluid, blood, lung, and wound infections, including carbapenem-resistant isolates, and was ≥89% conserved among other sequenced strains, but had minimal homology to the human proteome. Vaccination of diabetic mice with recombinant OmpA (rOmpA with aluminum hydroxide adjuvant markedly improved survival and reduced tissue bacterial burden in mice infected intravenously. Vaccination induced high titers of anti-OmpA antibodies, the levels of which correlated with survival in mice. Passive transfer with immune sera recapitulated protection. Immune sera did not enhance complement-mediated killing but did enhance opsonophagocytic killing of A. baumannii. These results define active and passive immunization strategies to prevent and treat highly lethal, XDR A. baumannii infections.

  3. Loss of p53 Ser18 and Atm results in embryonic lethality without cooperation in tumorigenesis.

    Directory of Open Access Journals (Sweden)

    Heather L Armata

    Full Text Available Phosphorylation at murine Serine 18 (human Serine 15 is a critical regulatory process for the tumor suppressor function of p53. p53Ser18 residue is a substrate for ataxia-telangiectasia mutated (ATM and ATM-related (ATR protein kinases. Studies of mice with a germ-line mutation that replaces Ser18 with Ala (p53(S18A mice have demonstrated that loss of phosphorylation of p53Ser18 leads to the development of tumors, including lymphomas, fibrosarcomas, leukemia and leiomyosarcomas. The predominant lymphoma is B-cell lymphoma, which is in contrast to the lymphomas observed in Atm(-/- animals. This observation and the fact that multiple kinases phosphorylate p53Ser18 suggest Atm-independent tumor suppressive functions of p53Ser18. Therefore, in order to examine p53Ser18 function in relationship to ATM, we analyzed the lifespan and tumorigenesis of mice with combined mutations in p53Ser18 and Atm. Surprisingly, we observed no cooperation in survival and tumorigenesis in compound p53(S18A and Atm(-/- animals. However, we observed embryonic lethality in the compound mutant animals. In addition, the homozygous p53Ser18 mutant allele impacted the weight of Atm(-/- animals. These studies examine the genetic interaction of p53Ser18 and Atm in vivo. Furthermore, these studies demonstrate a role of p53Ser18 in regulating embryonic survival and motor coordination.

  4. Post-exposure Treatment with Anti-rabies VHH and Vaccine Significantly Improves Protection of Mice from Lethal Rabies Infection.

    Science.gov (United States)

    Terryn, Sanne; Francart, Aurélie; Rommelaere, Heidi; Stortelers, Catelijne; Van Gucht, Steven

    2016-08-01

    Post-exposure prophylaxis (PEP) against rabies infection consists of a combination of passive immunisation with plasma-derived human or equine immune globulins and active immunisation with vaccine delivered shortly after exposure. Since anti-rabies immune globulins are expensive and scarce, there is a need for cheaper alternatives that can be produced more consistently. Previously, we generated potent virus-neutralising VHH, also called Nanobodies, against the rabies glycoprotein that are effectively preventing lethal disease in an in vivo mouse model. The VHH domain is the smallest antigen-binding functional fragment of camelid heavy chain-only antibodies that can be manufactured in microbial expression systems. In the current study we evaluated the efficacy of half-life extended anti-rabies VHH in combination with vaccine for PEP in an intranasal rabies infection model in mice. The PEP combination therapy of systemic anti-rabies VHH and intramuscular vaccine significantly delayed the onset of disease compared to treatment with anti-rabies VHH alone, prolonged median survival time (35 versus 14 days) and decreased mortality (60% versus 19% survival rate), when treated 24 hours after rabies virus challenge. Vaccine alone was unable to rescue mice from lethal disease. As reported also for immune globulins, some interference of anti-rabies VHH with the antigenicity of the vaccine was observed, but this did not impede the synergistic effect. Post exposure treatment with vaccine and human anti-rabies immune globulins was unable to protect mice from lethal challenge. Anti-rabies VHH and vaccine act synergistically to protect mice after rabies virus exposure, which further validates the possible use of anti-rabies VHH for rabies PEP.

  5. Post-exposure Treatment with Anti-rabies VHH and Vaccine Significantly Improves Protection of Mice from Lethal Rabies Infection

    Science.gov (United States)

    Terryn, Sanne; Francart, Aurélie; Rommelaere, Heidi; Stortelers, Catelijne; Van Gucht, Steven

    2016-01-01

    Post-exposure prophylaxis (PEP) against rabies infection consists of a combination of passive immunisation with plasma-derived human or equine immune globulins and active immunisation with vaccine delivered shortly after exposure. Since anti-rabies immune globulins are expensive and scarce, there is a need for cheaper alternatives that can be produced more consistently. Previously, we generated potent virus-neutralising VHH, also called Nanobodies, against the rabies glycoprotein that are effectively preventing lethal disease in an in vivo mouse model. The VHH domain is the smallest antigen-binding functional fragment of camelid heavy chain-only antibodies that can be manufactured in microbial expression systems. In the current study we evaluated the efficacy of half-life extended anti-rabies VHH in combination with vaccine for PEP in an intranasal rabies infection model in mice. The PEP combination therapy of systemic anti-rabies VHH and intramuscular vaccine significantly delayed the onset of disease compared to treatment with anti-rabies VHH alone, prolonged median survival time (35 versus 14 days) and decreased mortality (60% versus 19% survival rate), when treated 24 hours after rabies virus challenge. Vaccine alone was unable to rescue mice from lethal disease. As reported also for immune globulins, some interference of anti-rabies VHH with the antigenicity of the vaccine was observed, but this did not impede the synergistic effect. Post exposure treatment with vaccine and human anti-rabies immune globulins was unable to protect mice from lethal challenge. Anti-rabies VHH and vaccine act synergistically to protect mice after rabies virus exposure, which further validates the possible use of anti-rabies VHH for rabies PEP. PMID:27483431

  6. Lack of dominant lethality in mice following 1-bromopropane treatment.

    Science.gov (United States)

    Yu, Wook-Joon; Kim, Jong-Choon; Chung, Moon-Koo

    2008-03-29

    1-Bromopropane (1-BP) is widely used in spray adhesives, precision cleaner, and degreaser. This study was conducted to investigate the potential of 1-BP to induce dominant lethality in mice. 1-BP was orally administered to males at doses of 300 and 600 mg/kg for 10 days before mating. Cyclophosphamide was used as a positive control (PC), which was administered intraperitoneally to males at 40 mg/kg for 5 days. The vehicle control (VC) group received corn oil only. Thereafter, males were mated with untreated females during six sequential mating periods of a week each. Males were sacrificed at the end of mating and so were the pregnant females on days 15-17 of gestation. Clinical signs, gross findings, mating index, gestation index, the numbers of corpora lutea, implantations, live fetuses, resorptions and dead fetuses, pre- and post-implantation losses, and dominant lethal mutation rate were examined. There were no treatment-related changes in clinical signs, gross findings, mating index, gestation index, number of corpora lutea and implantations, pre-implantation loss, live fetuses, resorptions, dead fetuses, post-implantation loss at any 1-BP doses tested. In the PC group, there were no treatment-related changes in mating index, gestation index, number of corpora lutea, and dead fetuses. However, a decrease in the number of implantations and an increase in pre-implantation loss were observed during the first 2 weeks as compared to those of the VC group. No treatment-related changes were observed in the third to sixth weeks. Increases in resorptions, fetal deaths and post-implantation loss, and a decrease in the number of live fetuses were observed in the first 3 weeks of the PC group compared to those of the VC group. However, no treatment-related changes were observed during the forth to sixth weeks. An increase in dominant lethal mutation rate was observed in 1-3 weeks of mating of the PC group, but there was no significant difference in 1-6 weeks of mating of

  7. Lethal and Sub-lethal Effects of Four Insecticides on the Aphidophagous Coccinellid Adalia bipunctata (Coleoptera: Coccinellidae).

    Science.gov (United States)

    Depalo, Laura; Lanzoni, Alberto; Masetti, Antonio; Pasqualini, Edison; Burgio, Giovanni

    2017-12-05

    Conventional insecticide assays, which measure the effects of insecticide exposure on short-term mortality, overlook important traits, including persistence of toxicity or sub-lethal effects. Therefore, such approaches are especially inadequate for prediction of the overall impact of insecticides on beneficial arthropods. In this study, the side effects of four modern insecticides (chlorantraniliprole, emamectin benzoate, spinosad, and spirotetramat) on Adalia bipunctata (L.) (Coleoptera: Coccinellidae) were evaluated under laboratory conditions by exposition on treated potted plants. In addition to investigation of acute toxicity and persistence of harmful activity in both larvae and adults of A. bipunctata, demographic parameters were evaluated, to provide a comprehensive picture of the nontarget effects of these products. Field doses of the four insecticides caused detrimental effects to A. bipunctata; but in different ways. Overall, spinosad showed the best toxicological profile among the products tested. Emamectin benzoate could be considered a low-risk insecticide, but had high persistence. Chlorantraniliprole exhibited lethal effects on early instar larvae and adults, along with a long-lasting activity, instead spirotetramat showed a low impact on larval and adult mortality and can be considered a short-lived insecticide. However, demographic analysis demonstrated that chlorantraniliprole and spirotetramat caused sub-lethal effects. Our findings highlight that sole assessment of mortality can lead to underestimation of the full impact of pesticides on nontarget insects. Demographic analysis was demonstrated to be a sensitive method for detection of the sub-lethal effects of insecticides on A. bipunctata, and this approach should be considered for evaluation of insecticide selectivity. © The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  8. Mapping evaporative water loss in desert passerines reveals an expanding threat of lethal dehydration.

    Science.gov (United States)

    Albright, Thomas P; Mutiibwa, Denis; Gerson, Alexander R; Smith, Eric Krabbe; Talbot, William A; O'Neill, Jacqueline J; McKechnie, Andrew E; Wolf, Blair O

    2017-02-28

    Extreme high environmental temperatures produce a variety of consequences for wildlife, including mass die-offs. Heat waves are increasing in frequency, intensity, and extent, and are projected to increase further under climate change. However, the spatial and temporal dynamics of die-off risk are poorly understood. Here, we examine the effects of heat waves on evaporative water loss (EWL) and survival in five desert passerine birds across the southwestern United States using a combination of physiological data, mechanistically informed models, and hourly geospatial temperature data. We ask how rates of EWL vary with temperature across species; how frequently, over what areas, and how rapidly lethal dehydration occurs; how EWL and die-off risk vary with body mass; and how die-off risk is affected by climate warming. We find that smaller-bodied passerines are subject to higher rates of mass-specific EWL than larger-bodied counterparts and thus encounter potentially lethal conditions much more frequently, over shorter daily intervals, and over larger geographic areas. Warming by 4 °C greatly expands the extent, frequency, and intensity of dehydration risk, and introduces new threats for larger passerine birds, particularly those with limited geographic ranges. Our models reveal that increasing air temperatures and heat wave occurrence will potentially have important impacts on the water balance, daily activity, and geographic distribution of arid-zone birds. Impacts may be exacerbated by chronic effects and interactions with other environmental changes. This work underscores the importance of acute risks of high temperatures, particularly for small-bodied species, and suggests conservation of thermal refugia and water sources.

  9. CLEC5A regulates Japanese encephalitis virus-induced neuroinflammation and lethality.

    Directory of Open Access Journals (Sweden)

    Szu-Ting Chen

    Full Text Available CLEC5A/MDL-1, a member of the myeloid C-type lectin family expressed on macrophages and neutrophils, is critical for dengue virus (DV-induced hemorrhagic fever and shock syndrome in Stat1⁻/⁻ mice and ConA-treated wild type mice. However, whether CLEC5A is involved in the pathogenesis of viral encephalitis has not yet been investigated. To investigate the role of CLEC5A to regulate JEV-induced neuroinflammation, antagonistic anti-CLEC5A mAb and CLEC5A-deficient mice were generated. We find that Japanese encephalitis virus (JEV directly interacts with CLEC5A and induces DAP12 phosphorylation in macrophages. In addition, JEV activates macrophages to secrete proinflammatory cytokines and chemokines, which are dramatically reduced in JEV-infected Clec5a⁻/⁻ macrophages. Although blockade of CLEC5A cannot inhibit JEV infection of neurons and astrocytes, anti-CLEC5A mAb inhibits JEV-induced proinflammatory cytokine release from microglia and prevents bystander damage to neuronal cells. Moreover, JEV causes blood-brain barrier (BBB disintegrity and lethality in STAT1-deficient (Stat1⁻/⁻ mice, whereas peripheral administration of anti-CLEC5A mAb reduces infiltration of virus-harboring leukocytes into the central nervous system (CNS, restores BBB integrity, attenuates neuroinflammation, and protects mice from JEV-induced lethality. Moreover, all surviving mice develop protective humoral and cellular immunity against JEV infection. These observations demonstrate the critical role of CLEC5A in the pathogenesis of Japanese encephalitis, and identify CLEC5A as a target for the development of new treatments to reduce virus-induced brain damage.

  10. Lethal and sub-lethal effects of thymol on honeybee (Apis mellifera) larvae reared in vitro.

    Science.gov (United States)

    Charpentier, Gael; Vidau, Cyril; Ferdy, Jean-Baptiste; Tabart, Jeremy; Vetillard, Angelique

    2014-01-01

    Thymol offers an attractive alternative to synthetic chemicals to keep Varroa under control. However, thymol accumulates in bee products and is suspected of having adverse effects on colonies and especially on larvae. In this study, we investigated the effects of acute and chronic exposure to thymol on larvae reared in vitro with contaminated food and compared results to the theoretical larval exposure based on the amount of pollen and honey consumed by larvae during their development. The laboratory assays reveal that, first, the 48 h-LD50 of thymol introduced into larval food is 0.044 mg larva(-1) . Second, the 6 day-LC50 is 700 mg kg(-1) food. A significant decrease of larval survival and mass occurred from 500 mg thymol kg(-1) food (P thymol kg(-1) food (P thymol residue found in honey and pollen, these results suggest that the contamination of food by thymol represents no notable risk for the early-developing larvae. © 2013 Society of Chemical Industry.

  11. Human and animal infections by vaccinia-like viruses in the state of Rio de Janeiro: a novel expanding zoonosis.

    Science.gov (United States)

    Schatzmayr, H G; Costa, R V C; Gonçalves, M C R; D'Andréa, P S; Barth, O M

    2011-12-30

    Since 1999, vesicular infections caused by Orthopoxvirus in humans and animals, mainly in dairy cattle, have been identified in 20 municipalities in the Rio de Janeiro state of Brazil. This paper describes studies conducted in counties of the northwestern, middle-Paraíba Valley and southern regions of the Rio de Janeiro state where 77 human, 346 bovine and 78 rodent samples were collected over the past ten years. Laboratory investigations using virus isolation, electron microscopy, molecular biology (PCR) and serological analysis confirmed Orthopoxvirus infections in 77.9% of human, 49.2% of dairy cattle and 17.9% of rodent samples. The characterisation of the Cantagalo/IOC strain reconfirmed that this virus was a vaccinia-like virus. In other regions of the Rio de Janeiro state, vesicular/pustular infections in animals and humans are suspected but these have not yet been confirmed. A continuous surveillance system has been established to monitor these regions in addition to several other states of the Brazilian Federation. Copyright © 2011 Elsevier Ltd. All rights reserved.

  12. Protein and modified vaccinia virus Ankara-based influenza virus nucleoprotein vaccines are differentially immunogenic in BALB/c mice.

    Science.gov (United States)

    Altenburg, A F; Magnusson, S E; Bosman, F; Stertman, L; de Vries, R D; Rimmelzwaan, G F

    2017-10-01

    Because of the high variability of seasonal influenza viruses and the eminent threat of influenza viruses with pandemic potential, there is great interest in the development of vaccines that induce broadly protective immunity. Most probably, broadly protective influenza vaccines are based on conserved proteins, such as nucleoprotein (NP). NP is a vaccine target of interest as it has been shown to induce cross-reactive antibody and T cell responses. Here we tested and compared various NP-based vaccine preparations for their capacity to induce humoral and cellular immune responses to influenza virus NP. The immunogenicity of protein-based vaccine preparations with Matrix-M™ adjuvant as well as recombinant viral vaccine vector modified Vaccinia virus Ankara (MVA) expressing the influenza virus NP gene, with or without modifications that aim at optimization of CD8 + T cell responses, was addressed in BALB/c mice. Addition of Matrix-M™ adjuvant to NP wild-type protein-based vaccines significantly improved T cell responses. Furthermore, recombinant MVA expressing the influenza virus NP induced strong antibody and CD8 + T cell responses, which could not be improved further by modifications of NP to increase antigen processing and presentation. © 2017 British Society for Immunology.

  13. Comparison of the Cowpox Virus and Vaccinia Virus Mature Virion Proteome: Analysis of the Species- and Strain-Specific Proteome.

    Directory of Open Access Journals (Sweden)

    Joerg Doellinger

    Full Text Available Cowpox virus (CPXV causes most zoonotic orthopoxvirus (OPV infections in Europe and Northern as well as Central Asia. The virus has the broadest host range of OPV and is transmitted to humans from rodents and other wild or domestic animals. Increasing numbers of human CPXV infections in a population with declining immunity have raised concerns about the virus' zoonotic potential. While there have been reports on the proteome of other human-pathogenic OPV, namely vaccinia virus (VACV and monkeypox virus (MPXV, the protein composition of the CPXV mature virion (MV is unknown. This study focused on the comparative analysis of the VACV and CPXV MV proteome by label-free single-run proteomics using nano liquid chromatography and high-resolution tandem mass spectrometry (nLC-MS/MS. The presented data reveal that the common VACV and CPXV MV proteome contains most of the known conserved and essential OPV proteins and is associated with cellular proteins known to be essential for viral replication. While the species-specific proteome could be linked mainly to less genetically-conserved gene products, the strain-specific protein abundance was found to be of high variance in proteins associated with entry, host-virus interaction and protein processing.

  14. A marker-free system for highly efficient construction of vaccinia virus vectors using CRISPR Cas9

    Directory of Open Access Journals (Sweden)

    Ming Yuan

    Full Text Available The current method for creation of vaccinia virus (VACV vectors involves using a selection and purification marker, however inclusion of a gene without therapeutic value in the resulting vector is not desirable for clinical use. The Cre-LoxP system has been used to make marker-free Poxviruses, but the efficiency was very low. To obtain a marker-free VACV vector, we developed marker gene excision systems to modify the thymidine kinase (TK region and N1L regions using Cre-Loxp and Flp-FRET systems respectively. CRISPR-Cas9 system significantly resulted in a high efficiency (∼90% in generation of marker gene-positive TK-mutant VACV vector. The marker gene (RFP could be excised from the recombinant virus using Cre recombinase. To make a marker-free VV vector with double gene deletions targeting the TK and N1L gene, we constructed a donor repair vector targeting the N1L gene, which can carry a therapeutic gene and the marker (RFP that could be excised from the recombinant virus using Flp recombinase. The marker-free system developed here can be used to efficiently construct VACV vectors armed with any therapeutic genes in the TK region or N1L region without marker genes. Our marker-free system platform has significant potential for development of new marker-free VACV vectors for clinical application.

  15. An E2–F12 complex is required for intracellular enveloped virus morphogenesis during vaccinia infection

    Science.gov (United States)

    Dodding, Mark P; Newsome, Timothy P; Collinson, Lucy M; Edwards, Ceri; Way, Michael

    2009-01-01

    The vaccinia virus protein, F12, has been suggested to play an important role in microtubule-based transport of intracellular enveloped virus (IEV). We found that GFP-F12 is recruited to IEV moving on microtubules but is released from virus particles when they switch to actin-based motility. In the absence of F12, although the majority of IEV remain close to their peri-nuclear site of assembly, a small number of IEV still move with linear trajectories at speeds of 0.85 μm s−1, consistent with microtubule transport. Using a recombinant virus expressing GST-F12, we found that the viral protein E2 interacts directly with F12. In infected cells, GFP-E2 is observed on moving IEV as well as in the Golgi region, but is not associated with actin tails. In the absence of E2L, IEV accumulate in the peri-nuclear region and F12 is not recruited. Conversely, GFP-E2 is not observed on IEV in the absence of F12. Ultra-structural analysis of ΔE2L- and ΔF12L-infected cells reveals that loss of either protein results in defects in membrane wrapping during IEV formation. We suggest that E2 and F12 function as a complex that is necessary for IEV morphogenesis prior to their microtubule-based transport towards the plasma membrane. PMID:19207726

  16. NK cell-extrinsic IL-18 signaling is required for efficient NK-cell activation by vaccinia virus.

    Science.gov (United States)

    Brandstadter, Joshua D; Huang, Xiaopei; Yang, Yiping

    2014-09-01

    NK cells are important for the control of vaccinia virus (VV) in vivo. Recent studies have shown that multiple pathways are required for effective activation of NK cells. These include both TLR-dependent and -independent pathways, as well as the NKG2D activating receptor that recognizes host stress-induced NKG2D ligands. However, it remains largely unknown what controls the upregulation of NKG2D ligands in response to VV infection. In this study using C57BL/6 mice, we first showed that IL-18 is critical for NK-cell activation and viral clearance. We then demonstrated that IL-18 signaling on both NK cells and DCs is required for efficient NK-cell activation upon VV infection in vitro. We further showed in vivo that efficient NK-cell activation in response to VV is dependent on DCs and IL-18 signaling in non-NK cells, suggesting an essential role for NK cell-extrinsic IL-18 signaling in NK-cell activation. Mechanistically, IL-18 signaling in DCs promotes expression of Rae-1, an NKG2D ligand. Collectively, our data reveal a previously unrecognized role for NK cell-extrinsic IL-18 signaling in NK-cell activation through upregulation of NKG2D ligands. These observations may provide insights into the design of effective NK-cell-based therapies for viral infections and cancer. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Systemic treatment of xenografts with vaccinia virus GLV-1h68 reveals the immunologic facet of oncolytic therapy

    Directory of Open Access Journals (Sweden)

    Liu Hui

    2009-07-01

    Full Text Available Abstract Background GLV-1h68 is an attenuated recombinant vaccinia virus (VACV that selectively colonizes established human xenografts inducing their complete regression. Results Here, we explored xenograft/VACV/host interactions in vivo adopting organism-specific expression arrays and tumor cell/VACV in vitro comparing VACV replication patterns. There were no clear-cut differences in vitro among responding and non-responding tumors, however, tumor rejection was associated in vivo with activation of interferon-stimulated genes (ISGs and innate immune host's effector functions (IEFs correlating with VACV colonization of the xenografts. These signatures precisely reproduce those observed in humans during immune-mediated tissue-specific destruction (TSD that causes tumor or allograft rejection, autoimmunity or clearance of pathogens. We recently defined these common pathways in the "immunologic constant of rejection" hypothesis (ICR. Conclusion This study provides the first prospective validation of a universal mechanism associated with TSD. Thus, xenograft infection by oncolytic VACV, beyond offering a promising therapy of established cancers, may represent a reliable pre-clinical model to test therapeutic strategies aimed at modulating the central pathways leading to TSD; this information may lead to the identification of principles that could refine the treatment of cancer and chronic infection by immune stimulation or autoimmunity and allograft rejection through immune tolerance.

  18. Generation of Recombinant Modified Vaccinia Virus Ankara Encoding VP2, NS1, and VP7 Proteins of Bluetongue Virus.

    Science.gov (United States)

    Marín-López, Alejandro; Ortego, Javier

    2016-01-01

    Modified Vaccinia Virus Ankara (MVA) is employed widely as an experimental vaccine vector for its lack of replication in mammalian cells and high expression level of foreign/heterologous genes. Recombinant MVAs (rMVAs) are used as platforms for protein production as well as vectors to generate vaccines against a high number of infectious diseases and other pathologies. The portrait of the virus combines desirable elements such as high-level biological safety, the ability to activate appropriate innate immune mediators upon vaccination, and the capacity to deliver substantial amounts of heterologous antigens. Recombinant MVAs encoding proteins of bluetongue virus (BTV), an Orbivirus that infects domestic and wild ruminants transmitted by biting midges of the Culicoides species, are excellent vaccine candidates against this virus. In this chapter we describe the methods for the generation of rMVAs encoding VP2, NS1, and VP7 proteins of bluetongue virus as a model example for orbiviruses. The protocols included cover the cloning of VP2, NS1, and VP7 BTV-4 genes in a transfer plasmid, the construction of recombinant MVAs, the titration of virus working stocks and the protein expression analysis by immunofluorescence and radiolabeling of rMVA infected cells as well as virus purification.

  19. RNA-Seq Based Transcriptome Analysis of the Type I Interferon Host Response upon Vaccinia Virus Infection of Mouse Cells

    Directory of Open Access Journals (Sweden)

    Bruno Hernáez

    2017-01-01

    Full Text Available Vaccinia virus (VACV encodes the soluble type I interferon (IFN binding protein B18 that is secreted from infected cells and also attaches to the cell surface, as an immunomodulatory strategy to inhibit the host IFN response. By using next generation sequencing technologies, we performed a detailed RNA-seq study to dissect at the transcriptional level the modulation of the IFN based host response by VACV and B18. Transcriptome profiling of L929 cells after incubation with purified recombinant B18 protein showed that attachment of B18 to the cell surface does not trigger cell signalling leading to transcriptional activation. Consistent with its ability to bind type I IFN, B18 completely inhibited the IFN-mediated modulation of host gene expression. Addition of UV-inactivated virus particles to cell cultures altered the expression of a set of 53 cellular genes, including genes involved in innate immunity. Differential gene expression analyses of cells infected with replication competent VACV identified the activation of a broad range of host genes involved in multiple cellular pathways. Interestingly, we did not detect an IFN-mediated response among the transcriptional changes induced by VACV, even after the addition of IFN to cells infected with a mutant VACV lacking B18. This is consistent with additional viral mechanisms acting at different levels to block IFN responses during VACV infection.

  20. Histone deacetylase inhibitor treatment attenuates coagulation imbalance in a lethal murine model of sepsis.

    Science.gov (United States)

    Zhao, Ting; Li, Yongqing; Liu, Baoling; Wu, Erxi; Sillesen, Martin; Velmahos, George C; Halaweish, Ihab; Alam, Hasan B

    2014-08-01

    Sepsis has a profound impact on the inflammatory and hemostatic systems. In addition to systemic inflammation, it can produce disseminated intravascular coagulation, microvascular thrombosis, consumptive coagulopathy, and multiple organ failure. We have shown that treatment with suberoylanilide hydroxamic acid (SAHA), a histone deacetylase inhibitor (HDACI), improves survival in a lethal model of cecal ligation and puncture (CLP) in mice, but its effect on coagulation remains unknown. The goal of this study was to quantify the impact of SAHA treatment on coagulopathy in sepsis. C57BL/6J mice were subjected to CLP, and 1 hour later given intraperitoneally either SAHA dissolved in dimethyl sulfoxide (DMSO) or DMSO only. Sham-operated animals were handled in similar manner without CLP. Blood samples were collected by cardiac puncture and evaluated using the TEG 5000 Thrombelastograph Hemostasis Analyzer System. Compared with the sham group, all animals in DMSO vehicle group died within 72 hours, and developed coagulopathy that manifested as prolonged initial fibrin formation and fibrin cross-linkage time, and decreased clot formation speed, platelet function, and clot rigidity. SAHA treatment significantly improved survival and was associated with improvement in fibrin cross-linkage and clot formation, as well as platelet function and clot rigidity, without a significant impact on the clot initiation parameters. SAHA treatment enhances survival and attenuates sepsis-associated coagulopathy by improving fibrin cross-linkage, rate of clot formation, platelet function, and clot strength. HDACI may represent a novel therapeutic strategy for correcting sepsis-associated coagulopathy. Copyright © 2014 Mosby, Inc. All rights reserved.

  1. Lethal now or lethal later: The natural history of Grade 4 blunt cerebrovascular injury.

    Science.gov (United States)

    Lauerman, Margaret H; Feeney, Timothy; Sliker, Clint W; Saksobhavivat, Nitima; Bruns, Brandon R; Laser, Adriana; Tesoriero, Ronald; Brenner, Megan; Scalea, Thomas M; Stein, Deborah M

    2015-06-01

    Grade 4 blunt cerebrovascular injury (BCVI4) has a known, significant rate of stroke. However, little is known about the natural history of BCVI4 and the pathophysiology of subsequent stroke formation. A 4-year review of patients with BCVI4 at the R Adams Cowley Shock Trauma Center was performed. Rates of BCVI4-related stroke, stroke-related mortality, and overall mortality were calculated. The relationship of change in vessel characteristics and BCVI4-related stroke was examined, as was the mechanism of stroke formation. There were 82 BCVI4s identified, with 13 carotid artery (ICA) and 69 vertebral artery BCVI4s. BCVI4-related stroke rate was 2.9% in vertebral artery BCVI4 and 70% in ICA BCVI4 patients surviving to reimaging. Stroke mechanisms included embolic strokes, thrombotic strokes, and combined embolic and thrombotic strokes. Peristroke vessel recanalization and an embolic stroke mechanism were seen in 100% of ICA BCVI4-related strokes developing after admission. BCVI4-related stroke occurred within 10 hours of hospital admission in 67% of the patients with strokes. Contraindications to anticoagulation were present in most patients with BCVI4-related stroke developing after admission. Multiple etiologies of stroke formation exist in BCVI4. Early risk-benefit analysis for initiation of anticoagulation or antiplatelet agents should be performed in all patients with BCVI4, and the use of endovascular vessel occlusion should be considered in those with true contraindications to anticoagulation. However, more aggressive medical therapy may be needed to lessen BCVI4-related stroke development. Prognostic study, level IV; therapeutic study, level V.

  2. Human vaccinia-like virus outbreaks in São Paulo and Goiás States, Brazil: virus detection, isolation and identification Surtos de vírus Vaccinia-like nos Estados de São Paulo e Goiás, Brasil: detecção, isolamento e identificação viral

    Directory of Open Access Journals (Sweden)

    Teresa Keico Nagasse-Sugahara

    2004-04-01

    Full Text Available Since October 2001, the Adolfo Lutz Institute has been receiving vesicular fluids and scab specimens of patients from Paraíba Valley region in the São Paulo and Minas Gerais States and from São Patricio Valley, in the Goiás State. Epidemiological data suggested that the outbreaks were caused by Cowpox virus or Vaccinia virus. Most of the patients are dairy milkers that had vesiculo-pustular lesions on the hands, arms, forearms, and some of them, on the face. Virus particles with orthopoxvirus morphology were detected by direct electron microscopy (DEM in samples of 49 (66.21% patients of a total of 74 analyzed. Viruses were isolated in Vero cell culture and on chorioallantoic membrane (CAM of embryonated chicken eggs. Among 21 samples submitted to PCR using primers for hemagglutinin (HA gene, 19 were positive. Restriction digestion with TaqI resulted in four characteristic Vaccinia virus fragments. HA nucleotide sequences showed 99.9% similarity with Cantagalo virus, described as a strain of Vaccinia virus. The only difference observed was the substitution of one nucleotide in the position 616 leading to change in one amino acid of the protein in the position 206. The phylogenetic analysis showed that the isolates clustered together with Cantagalo virus, other Vaccinia strains and Rabbitpox virus.A partir de outubro de 2001, o Instituto Adolfo Lutz tem recebido amostras de líquido vesicular e crostas de lesões de pele de pacientes das regiões do Vale do Paraíba, Estado de São Paulo e do Vale do São Patricio, Estado de Goiás. Os dados clínicos e epidemiológicos sugeriam que os surtos poderiam ser causados por Cowpox virus ou Vaccinia virus. A maioria dos pacientes era ordenhadores que tinham lesões vesicopustulares nas mãos, braços, antebraços e alguns na face. A análise por microscopia eletrônica direta (MED detectou partículas com morfologia de vírus do gênero Orthopoxvirus em amostras de 49 (66,21% pacientes dos 74

  3. Association between environmental quality and lung cancer survival in the United States, 2000-2005.

    Science.gov (United States)

    Background/Aims Lung cancer remains one of the most prevalent and lethal cancers in the United States. Individual environmental exposures have been associated with lung cancer incidence. However, the impact of cumulative environmental exposures on survival is not well understood ...

  4. Genome-wide association study of prostate cancer-specific survival

    DEFF Research Database (Denmark)

    Szulkin, Robert; Karlsson, Robert; Whitington, Thomas

    2015-01-01

    BACKGROUND: Unnecessary intervention and overtreatment of indolent disease are common challenges in clinical management of prostate cancer. Improved tools to distinguish lethal from indolent disease are critical. METHODS: We performed a genome-wide survival analysis of cause-specific death in 24,...

  5. Reconstructing the Lethal Part of the 1790 Eruption at Kilauea

    Science.gov (United States)

    Swanson, D.; Weaver, S. J.; Houghton, B. F.

    2011-12-01

    The most lethal known eruption from a volcano in the United States took place in November 1790 at Kilauea, killing perhaps 400-800 people (estimates range widely) who were crossing the summit on their way to a distant battle site. The eruption culminated ca. 300 years of sporadic explosive activity after the formation of Kilauea Caldera in about 1500. No contemporary account exists of the 1790 activity, but an eruption plume was observed from Kawaihae, 100 km NW of Kilauea, that probably was 10 km or higher. We are attempting to piece together the lethal event from a study of the 1790 and enclosing deposits and by using published accounts, written several decades later, based on interviews with survivors or others with knowledge of the tragedy. Determining what deposits actually formed in November 1790 is crucial. The best tie to that date is a deposit of phreatomagmatic lithic lapilli and ash that occurs SE of the caldera and must have been advected by high-level (>~10 km) westerly winds rather than low-level NE trade winds. It is the only contender for deposits from the high column observed in 1790. Small lapilli from the high column fell onto, and sank deeply into, a 3-5-cm-thick accretionary lapilli layer that was wet and likely no more than a few hours old. The wet ash occurs south of the caldera, where the lithic lapilli fell into it, and is also found west of the caldera in the saddle between Kilauea and Mauna Loa, where the victims were probably walking along a main foot trail still visible today. A lithic pyroclastic surge swept across the saddle, locally scouring away the wet accretionary lapilli layer but generally leaving a deposit think we have identified the lethal surge of the eruption, and it is sobering to realize that it overwhelmed the place where this abstract is being written 221 years later.

  6. Left ventricular function during lethal and sublethal endotoxemia in swine

    Energy Technology Data Exchange (ETDEWEB)

    Goldfarb, R.D.; Nightingale, L.M.; Kish, P.; Weber, P.B.; Loegering, D.J.

    1986-08-01

    Previous studies suggested that after a median lethal dose (LD50) of endotoxin, cardiac contractility was depressed in nonsurviving dogs. The canine cardiovascular system is unlike humans in that dogs have a hepatic vein sphincter that is susceptible to adrenergic stimulation capable of raising hepatic and splanchnic venous pressures. The authors retested the hypothesis that lethality after endotoxin administration is associated with cardiac contractile depression in pigs, because of the hepatic circulation in this species is similar to that of humans. They compared cardiac mechanical function of pigs administered a high dose (250 g/kg) or a low dose (100 g/kg) endotoxin by use of the slope of the end-systolic pressure-diameter relationship (ESPDR) as well as other measurements of cardiac performance. In all the pigs administered a high dose, ESPDR demonstrated a marked, time-dependent depression whereas we observed no significant ESPDR changes after low endotoxin doses. The other cardiodynamic variables were uninterpretable, due to the significant changes in heart rate, end-diastolic diameter (preload), and aortic diastolic pressure (afterload). Plasma myocardia depressant factor activity accumulated in all endotoxin-administered animals, tending to be greater in the high-dose group. In this group, both subendocardial blood flow and global function were depressed, whereas pigs administered the low dose endotoxin demonstrated slight, but nonsignificant, increases in flow and function. These observations indicate that myocardial contractile depression is associated with a lethal outcome to high doses of endotoxin. Myocardial perfusion was measured using radiolabeled microspheres infused into the left atria.

  7. Interferon-induced Ifit2/ISG54 protects mice from lethal VSV neuropathogenesis.

    Science.gov (United States)

    Fensterl, Volker; Wetzel, Jaime L; Ramachandran, Srividya; Ogino, Tomoaki; Stohlman, Stephen A; Bergmann, Cornelia C; Diamond, Michael S; Virgin, Herbert W; Sen, Ganes C

    2012-01-01

    Interferon protects mice from vesicular stomatitis virus (VSV) infection and pathogenesis; however, it is not known which of the numerous interferon-stimulated genes (ISG) mediate the antiviral effect. A prominent family of ISGs is the interferon-induced with tetratricopeptide repeats (Ifit) genes comprising three members in mice, Ifit1/ISG56, Ifit2/ISG54 and Ifit3/ISG49. Intranasal infection with a low dose of VSV is not lethal to wild-type mice and all three Ifit genes are induced in the central nervous system of the infected mice. We tested their potential contributions to the observed protection of wild-type mice from VSV pathogenesis, by taking advantage of the newly generated knockout mice lacking either Ifit2 or Ifit1. We observed that in Ifit2 knockout (Ifit2(-/-)) mice, intranasal VSV infection was uniformly lethal and death was preceded by neurological signs, such as ataxia and hind limb paralysis. In contrast, wild-type and Ifit1(-/-) mice were highly protected and survived without developing such disease. However, when VSV was injected intracranially, virus replication and survival were not significantly different between wild-type and Ifit2(-/-) mice. When administered intranasally, VSV entered the central nervous system through the olfactory bulbs, where it replicated equivalently in wild-type and Ifit2(-/-) mice and induced interferon-β. However, as the infection spread to other regions of the brain, VSV titers rose several hundred folds higher in Ifit2(-/-) mice as compared to wild-type mice. This was not caused by a broadened cell tropism in the brains of Ifit2(-/-) mice, where VSV still replicated selectively in neurons. Surprisingly, this advantage for VSV replication in the brains of Ifit2(-/-) mice was not observed in other organs, such as lung and liver. Pathogenesis by another neurotropic RNA virus, encephalomyocarditis virus, was not enhanced in the brains of Ifit2(-/-) mice. Our study provides a clear demonstration of tissue-, virus- and

  8. Queueing models of potentially lethal damage repair in irradiated cells.

    Science.gov (United States)

    Myasnikova, E M; Rachev, S T; Yakovlev, A Y

    1996-07-01

    Some of the ideas arising in queueing theory are applied to describe the repair mechanisms responsible for recovery of cells from potentially lethal radiation damage. Two alternative versions are presented of a queueing model of damage repair after a single dose of irradiation. The first version represents a linear misrepair model, and the second invokes the idea of spontaneous lesion fixation. They are pieced together in the third model, allowing for both mechanisms. The consistency of the proposed models with published experimental data is tested.

  9. Intimate partner homicide: new insights for understanding lethality and risks.

    Science.gov (United States)

    Sheehan, Brynn E; Murphy, Sharon B; Moynihan, Mary M; Dudley-Fennessey, Erin; Stapleton, Jane G

    2015-02-01

    Research on covictims, family members, and close friends who have lost loved ones to intimate partner homicide (IPH) is a neglected area of study. We conducted phenomenological interviews with covictims to gain insights into risk and lethality, examined affidavits from criminal case files, and reviewed news releases. The data uncovered acute risk factors prior to the homicide, identified changes in the perpetrators' behavior and the perpetrators' perceived loss of control over the victim, and described barriers that victims faced when attempting to gain safety. Findings suggest that recognizing acute risk factors is an important area for future IPH research. © The Author(s) 2014.

  10. Mining of lethal recessive genetic variation in Danish cattle

    DEFF Research Database (Denmark)

    Das, Ashutosh

    2015-01-01

    The widespread use of artificial insemination in cattle breeding Worldwide leads to reduced effective population sizes and increased inbreeding levels. Increased inbreeding result in increased probalility of expression of recessive defective alleles, which probably is reflected in a decline...... in fertility. The primary objective of this PhD projekt was to identify recessive lethal gentic variants in the main Danish dairy cattle breed. Holstein-Friesian utilzing next generation sequencing (NGS) data. This study shows a potential for the use of the NGS-based reverse genetic approach in identifying...

  11. Lethal subarachnoid bleeding under immunosuppressive therapy due to mycotic arteritis

    Energy Technology Data Exchange (ETDEWEB)

    Weigel, S.; Kloska, S.; Freund, M. [Dept. of Clinical Radiology, Univ. Hospital of Muenster, Muenster (Germany); Kehl, H.G. [Dept. of Pediatric Cardiology, Univ. Hospital of Muenster, Muenster (Germany)

    2003-12-01

    A subarachnoid haemorrhage (SAH) occurred 67 days after cardiac transplantation in 10-year-old girl with consecutive immunocompromising therapy. Neither digital subtraction angiography (DSA) nor computed tomographic angiography showed signs of intracranial vascular malformations. One month before the lethal SAH occurred, she had developed arterial hypertension and attacks of severe headache with cerebrospinal fluid (CSF) pleocytosis while CT scans showed an infarct of the left thalamus. Pathologic findings established the rare diagnosis of SAH due to aspergillosis-related mycotic arteritis. Imaging characteristics are presented. (orig.)

  12. Perinatal lethal type II osteogenesis imperfecta: a case report.

    Science.gov (United States)

    Ayadi, Imene Dahmane; Hamida, Emira Ben; Rebeh, Rania Ben; Chaouachi, Sihem; Marrakchi, Zahra

    2015-01-01

    We report a new case of osteogenesis imperfecta (OI) type II which is a perinatal lethal form. First trimester ultrasound didn't identified abnormalities. Second trimester ultrasound showed incurved limbs, narrow chest, with hypomineralization and multiple fractures of ribs and long bones. Parents refused pregnancy termination; they felt that the diagnosis was late. At birth, the newborn presented immediate respiratory distress. Postnatal examination and bone radiography confirmed the diagnosis of OI type IIA. Death occurred on day 25 of life related to respiratory failure.

  13. Papaya Lethal Yellowing Virus (PLYV) Infects Vasconcellea cauliflora

    OpenAIRE

    Amaral, P.P.R.; Resende MR; Souza, M.T.

    2006-01-01

    Papaya lethal yellowing virus (PLYV) é um dos três vírus descritos infectando mamoeiros (Carica papaya L.) no Brasil. Vasconcellea cauliflora (Jacq.) A. DC., antes denominada de Carica cauliflora (Jacq.), é uma reconhecida fonte de resistência natural ao Papaya ringspot virus (PRSV), causador da "Mancha Anelar" ou "Mosaico" do mamoeiro. Neste estudo é demonstrado que V. cauliflora pode ser infectada por PLYV mediante inoculação mecânica. Esta é a segunda hospedeira de PLYV descrita até o mome...

  14. [Refractory status epilepticus in two children with lethal rhabdomyolysis].

    Science.gov (United States)

    Kreft, Andreas; Rasmussen, Niels; Hansen, Lars Kjaersgård

    2008-10-13

    We are reporting two cases of SE with lethal rhabdomyolysis. Both were treated according to the guidelines on antiepileptic drug management by the Danish Paediatric Society, with one and two hours' delay, respectively. Intubation and midazolam infusion were needed to control seizures. After approximately one day both developed severe rhabdomyolysis with progressive DIC and acute renal failure, causing death despite intensive care, including acute hemodialysis. The aim of this case report is to emphasise one of the rare but severe consequences of SE and also to suggest that patients with known repetitive SE may benefit from written individual treatment schedules to avoid wasting time.

  15. Family Relationship In Gabrielle Lord`s Lethal Factor

    Directory of Open Access Journals (Sweden)

    Ruth Sri Kinanti

    2007-05-01

    Full Text Available Jenis karya sastra cerita detektif bukan hal baru dalam kesusastraan Australia. Salah satu penulis cerita detektif, Gabrielle Lord, menampilkan masalah yang tidak pernah diangkat oleh penulis lainnya, yaitu masalah hubungan keluarga. Novel yang akan dikaji dalam tulisan ini adalah Lethal Factor. Dalam karya ini masalah keluarga dan penyalahgunaan anak dibahas dan dilibatkan dalam kasus kriminal yang terjadi dalam kehidupan penyidik forensic, Jack McCain. Kasus kriminal terjadi dalam beberapa kasus yang menggunakan senjata tajam yang menimpa seorang biarawati dan senjata racun kimia yang menimpa teman McCain. Persoalan menjadi menarik dan penting ketika McCain juga harus menyelesaikan kasusnya dengan istri dan terancamnya jiwa anaknya.

  16. Recombinant vaccinia DIs expressing simian immunodeficiency virus gag and pol in mammalian cells induces efficient cellular immunity as a safe immunodeficiency virus vaccine candidate.

    Science.gov (United States)

    Okamura, Tomotaka; Someya, Kenji; Matsuo, Kazuhiro; Hasegawa, Atsuhiko; Yamamoto, Naoki; Honda, Mitsuo

    2006-01-01

    A highly attenuated vaccinia virus substrain of Dairen-I (DIs) shows promise as a candidate vector for eliciting positive immunity against immune deficiency virus. DIs was randomly obtained by serial 1-day egg passages of a chorioarantoic membrane-adapted Dairen strain (DIE), resulting in substantial genomic deletion, including various genes regulating the virus-host-range. To investigate the impact of that deletion and of the subsequent insertion of a foreign gene into that region of DIs on the ability of the DIs recombinant to induce antigen-specific immunity, we generated a recombinant vaccinia DIs expressing fulllength gag and pol genes of simian immunodeficiency virus (SIV) (rDIsSIV gag/pol) and studied the biological and immunological characteristics of the recombinant natural mutant. The rDIsSIV gag/pol developed a tiny plaque on the chick embryo fibroblast (CEF). Viral particles of rDIsSIV gag/pol as well as SIV Gag-like particles were electromicroscopically detected in the cytoplasm. Interestingly, the recombinant DIs strain grows well in CEF cells but not in mammalian cells. While rDIsSIV gag/pol produces SIV proteins in mammalian HeLa and CV-1 cells, recombinant modified vaccinia Ankara strain (MVA) expressing SIV gag and pol genes (MVA/SIV239 gag/pol) clearly replicates in HeLa and CV-1 cell lines under synchronized growth conditions and produces the SIV protein in all cell lines. Moreover, intradermal administration of rDIsSIV gag/pol or of MVA/SIV239 gag/pol elicited similar levels of IFN-gamma spot-forming cells specific for SIV Gag. If the non-productive infection characteristically induced by recombinant DIs is sufficient to trigger immune induction, as we believe it is, then a human immunodeficiency virus vaccine employing the DIs recombinant would have the twin advantages of being both effective and safe.

  17. Lethal and sub-lethal chronic effects of the herbicide diuron on seagrass

    Energy Technology Data Exchange (ETDEWEB)

    Negri, Andrew P., E-mail: a.negri@aims.gov.au [Australian Institute of Marine Science, Townsville, Queensland 4810 (Australia); Flores, Florita [Australian Institute of Marine Science, Townsville, Queensland 4810 (Australia); Mercurio, Phil [Australian Institute of Marine Science, Townsville, Queensland 4810 (Australia); University of Queensland and National Research Centre for Environmental Toxicology, Coopers Plains, Queensland 4108 (Australia); Mueller, Jochen F. [University of Queensland and National Research Centre for Environmental Toxicology, Coopers Plains, Queensland 4108 (Australia); Collier, Catherine J. [Centre for Tropical Water & Aquatic Ecosystem Research (TropWATER), James Cook University, Cairns, Queensland 4870 (Australia)

    2015-08-15

    approximately halved following diuron exposure at and above 1.7 μg l{sup −1}. During the 2-week recovery period, the photosynthetic capacity of the seagrass improved with only plants from the highest diuron treatment still exhibiting chronic damage to PSII. This study shows that, although seagrass may survive prolonged herbicide exposures, concentrations ≥0.6 μg l{sup −1} diuron equivalents cause measureable impacts on energetic status that may leave the plants vulnerable to other simultaneous stressors. For example, tropical seagrasses have been heavily impacted by reduced light from coastal flood plumes and the effects on plant energetics from light limitation and diuron exposure (highest in flood plumes) are very similar, potentially leading to cumulative negative effects.

  18. Safety, immunogenicity, and efficacy of prime-boost immunization with recombinant poxvirus FP9 and modified vaccinia virus Ankara encoding the full-length Plasmodium falciparum circumsporozoite protein.

    Science.gov (United States)

    Walther, Michael; Thompson, Fiona M; Dunachie, Susanna; Keating, Sheila; Todryk, Stephen; Berthoud, Tamara; Andrews, Laura; Andersen, Rikke F; Moore, Anne; Gilbert, Sarah C; Poulton, Ian; Dubovsky, Filip; Tierney, Eveline; Correa, Simon; Huntcooke, Angela; Butcher, Geoffrey; Williams, Jack; Sinden, Robert E; Hill, Adrian V S

    2006-05-01

    Heterologous prime-boost immunization with DNA and various recombinant poxviruses encoding malaria antigens is capable of inducing strong cell-mediated immune responses and partial protection in human sporozoite challenges. Here we report a series of trials assessing recombinant fowlpox virus and modified vaccinia virus Ankara encoding the Plasmodium falciparum circumsporozoite protein in various prime-boost combinations, doses, and application routes. For the first time, these vaccines were administered intramuscularly and at doses of up to 5 x 10(8) PFU. Vaccines containing this antigen proved safe and induced modest immune responses but showed no evidence of efficacy in a sporozoite challenge.

  19. HIVIS-DNA or HIVISopt-DNA priming followed by CMDR vaccinia-based boosts induce both humoral and cellular murine immune responses to HIV

    Directory of Open Access Journals (Sweden)

    J Hinkula

    2017-06-01

    Conclusions: HIVIS-DNA was modified to obtain HIVISopt-DNA that had fewer plasmids, and additional epitopes. Even with one DNA prime followed by two MVA-CMDR boosts, humoral and cell-mediated immune responses were readily induced by priming with either DNA construct composition. Priming by HIV-DNA augmented neutralizing antibody responses revealed by boosting with the vaccinia-based heterologous sequences. Cellular and antibody responses covered selected strains representing HIV-1 subtypes A, B, C and CRF01_AE. We assume this is related to the inclusion of heterologous full genes in the vaccine schedule.

  20. A selective Seoul-Fluor-based bioprobe, SfBP, for vaccinia H1-related phosphatase--a dual-specific protein tyrosine phosphatase.

    Science.gov (United States)

    Jeong, Myeong Seon; Kim, Eunha; Kang, Hyo Jin; Choi, Eun Joung; Cho, Alvin R; Chung, Sang J; Park, Seung Bum

    2012-07-04

    We report a Seoul-Fluor-based bioprobe, SfBP, for selective monitoring of protein tyrosine phosphatases (PTPs). A rational design based on the structures at the active site of dual-specific PTPs can enable SfBP to selectively monitor the activity of these PTPs with a 93-fold change in brightness. Moreover, screening results of SfBP against 30 classical PTPs and 35 dual-specific PTPs show that it is selective toward vaccinia H1-related (VHR) phosphatase, a dual-specific PTP (DUSP-3).

  1. Lethal and sub-lethal effects of elevated CO2 concentrations on marine benthic invertebrates and fish.

    Science.gov (United States)

    Lee, Changkeun; Hong, Seongjin; Kwon, Bong-Oh; Lee, Jung-Ho; Ryu, Jongseong; Park, Young-Gyu; Kang, Seong-Gil; Khim, Jong Seong

    2016-08-01

    Concern about leakage of carbon dioxide (CO2) from deep-sea storage in geological reservoirs is increasing because of its possible adverse effects on marine organisms locally or at nearby coastal areas both in sediment and water column. In the present study, we examined how elevated CO2 affects various intertidal epibenthic (benthic copepod), intertidal endobenthic (Manila clam and Venus clam), sub-tidal benthic (brittle starfish), and free-living (marine medaka) organisms in areas expected to be impacted by leakage. Acute lethal and sub-lethal effects were detected in the adult stage of all test organisms exposed to varying concentrations of CO2, due to the associated decline in pH (8.3 to 5.2) during 96-h exposure. However, intertidal organisms (such as benthic copepods and clams) showed remarkable resistance to elevated CO2, with the Venus clam being the most tolerant (LpH50 = 5.45). Sub-tidal species (such as brittle starfish [LpH50 = 6.16] and marine medaka [LpH50 = 5.91]) were more sensitive to elevated CO2 compared to intertidal species, possibly because they have fewer defensive capabilities. Of note, the exposure duration might regulate the degree of acute sub-lethal effects, as evidenced by the Venus clam, which showed a time-dependent effect to elevated CO2. Finally, copper was chosen as a model toxic element to find out the synergistic or antagonistic effects between ocean acidification and metal pollution. Combination of CO2 and Cu exposure enhances the adverse effects to organisms, generally supporting a synergistic effect scenario. Overall, the significant variation in the degree to which CO2 adversely affected organisms (viz., working range and strength) was clearly observed, supporting the general concept of species-dependent effects of elevated CO2.

  2. Effect of salinity on survival and growth of giant freshwater prawn Macrobrachium rosenbergii (de Man

    Directory of Open Access Journals (Sweden)

    B.K. Chand

    2015-11-01

    Full Text Available Two independent experiments were performed to determine the effects of salinity on survival and growth of juvenile Macrobrachium rosenbergii, first one was to determine the median lethal salinity (MLS-5096 h and second one was to assess the survival and growth at different sub-lethal salinities under field condition. In MLS-5096 h study 0, 5, 10, 15, 20, 25 and 30 ppt salinities were used to initially find out the salinity tolerance range. Accordingly, a definitive salinity tolerance test was done in next phase to find out exact median lethal salinity by directly transferring the test species to 21, 22, 23, 24, 25, 26 and 27 ppt salinity for 96 h. The median lethal salinity of M. rosenbergii was estimated at 24.6 ppt. In the second experiment, survival and growth performances of the prawn were recorded at different sub-lethal salinities viz., 5, 10, 15 and 20 ppt along with 0 ppt as control during 60 days culture period. The prawn exhibited lowest final average weight at 20 ppt salinity and significantly highest at 10 ppt salinity. Highest SGR and weight gain were obtained at 10 ppt followed by 5 ppt, 15 ppt and 0 ppt salinity but differences among treatment were not significant (P > 0.05. Survival rate of prawn varied between 91% (at 0 ppt and 78% (at 20 ppt. The prawn grew and survived satisfactorily at 0–15 ppt salinities, implying that the species can be cultured commercially at wide salinity range. M. rosenbergii can be considered as an ideal species to promote, in view of current and future climate variables as more and more coastal areas of India are going to be vulnerable to saline water inundation.

  3. Close is dead: determinants of firearm injury lethality in women.

    Science.gov (United States)

    Finlay-Morreale, Heather E; Tsuei, Betty J; Fisher, Bonnie S; Davis, Kenneth; Johannigman, Jay A

    2009-04-01

    Accurate data regarding intimate partner violence is difficult to obtain, particularly when examining only homicides or trauma registries. This study characterizes firearm violence against women by examining data from both the county coroner and an urban level I trauma center. The Trauma Registry and Coroners database were reviewed for female victims of firearm assault from 1998 to 2006. Data collected included age, race, location of assault (home, public, unknown), mortality, and injuries. Assailants were categorized as intimate partners (IP), acquaintances, strangers, or undetermined. Adjusted odds ratios for effects of assailant and location were calculated using logistic regression analysis, with statistical significance at alpha = 0.05. Of 115 victims identified, 51 (44%) were fatally injured. Forty-two (37%) of assailants were IP. Fatalities occurred in 71% of IP, 50% of acquaintance, and 20% of stranger assaults. Firearm assault by IP was 10 times more lethal than injury by stranger (p firearm assaults against women may be underrepresented in current databases. These assaults are highly lethal, frequently occur at home, and often involve head injury. These observations may lend to strategies for trauma prevention.

  4. The lethal effects of Cyperus iria on Aedes aegypti.

    Science.gov (United States)

    Schwartz, A M; Paskewitz, S M; Orth, A P; Tesch, M J; Toong, Y C; Goodman, W G

    1998-03-01

    The sedge Cyperus iria, a common weed in rice, contains large amounts of the insect hormone (10R) juvenile hormone III (JH III). Given its widespread distribution in Asia and Africa, we examined the possibility that C. iria could be used as a safe, inexpensive, and readily available mosquito larvicide. Plants of varying ages were harvested and leaves tested for lethal effects on larvae of the yellow fever mosquito, Aedes aegypti. The median lethal doses (LD50s) for frozen leaves from 1- and 2-month-old plants were 267 and 427 mg/100 ml of water, respectively. Leaves from 1-month-old C. iria contained 193 micrograms JH III/g fresh weight, whereas leaves from 2-month-old plants contained 143 micrograms JH III/g fresh weight. Larval sensitivity to the plant differed with age; 4-day-old larvae displayed the greatest mortality followed in decreasing sensitivity by larvae 5, 6, 3, and 2 days old. Six Cyperus species (C. albostriatus, C. alternifolius, C. esculentus, C. iria, C. miliifolius, and C. papyrus) of similar developmental stage were assayed for JH III content. Only C. iria was found to contain significant levels of JH III.

  5. Injury risk assessment of non-lethal projectile head impacts.

    Science.gov (United States)

    Oukara, Amar; Nsiampa, Nestor; Robbe, Cyril; Papy, Alexandre

    2014-01-01

    Kinetic energy non-lethal projectiles are used to impart sufficient effect onto a person in order to deter uncivil or hazardous behavior with a low probability of permanent injury. Since their first use, real cases indicate that the injuries inflicted by such projectiles may be irreversible and sometimes lead to death, especially for the head impacts. Given the high velocities and the low masses involved in such impacts, the assessment approaches proposed in automotive crash tests and sports may not be appropriate. Therefore, there is a need of a specific approach to assess the lethality of these projectiles. In this framework, some recent research data referred in this article as "force wall approach" suggest the use of three lesional thresholds (unconsciousness, meningeal damages and bone damages) that depend on the intracranial pressure. Three corresponding critical impact forces are determined for a reference projectile. Based on the principle that equal rigid wall maximal impact forces will produce equal damage on the head, these limits can be determined for any other projectile. In order to validate the consistence of this innovative method, it is necessary to compare the results with other existing assessment methods. This paper proposes a comparison between the "force wall approach" and two different head models. The first one is a numerical model (Strasbourg University Finite Element Head Model-SUFEHM) from Strasbourg University; the second one is a mechanical surrogate (Ballistics Load Sensing Headform-BLSH) from Biokinetics.

  6. Lethal Mutagenesis of Hepatitis C Virus Induced by Favipiravir.

    Directory of Open Access Journals (Sweden)

    Ana I de Ávila

    Full Text Available Lethal mutagenesis is an antiviral approach that consists in extinguishing a virus by an excess of mutations acquired during replication in the presence of a mutagen. Here we show that favipiravir (T-705 is a potent mutagenic agent for hepatitis C virus (HCV during its replication in human hepatoma cells. T-705 leads to an excess of G → A and C → U transitions in the mutant spectrum of preextinction HCV populations. Infectivity decreased significantly in the presence of concentrations of T-705 which are 2- to 8-fold lower than its cytotoxic concentration 50 (CC50. Passaging the virus five times in the presence of 400 μM T-705 resulted in virus extinction. Since T-705 has undergone advanced clinical trials for approval for human use, the results open a new approach based on lethal mutagenesis to treat hepatitis C virus infections. If proven effective for HCV in vivo, this new anti-HCV agent may be useful in patient groups that fail current therapeutic regimens.

  7. Brine shrimp lethality bioassay of selected gymnosperm and angiosperm species

    Directory of Open Access Journals (Sweden)

    Janaćković Peđa T.

    2016-01-01

    Full Text Available Methanol extracts of selected species of flowering plants Anthemis cotula, A. ruthenica, Centaurea dubia (Asteraceae, Ajuga genevensis, A. chamaepitys, A. reptans, Micromeria albanica, M. cristata, M. dalmatica, M. juliana, Thymus tosevii (Lamiaceae and conifers - Abies alba, Picea omorika, Pinus heldreichii (Pinaceae and Taxus baccata (Taxaceae, as well as diethyl ether extracts of ten species Anthemis cotula, A. ruthenica, Centaurea dubia, Ajuga genevensis, A. chamaepitys, A. reptans, Micromeria albanica, M. cristata, M. dalmatica and M. juliana from two flowering plant families (Asteraceae and Lamiaceae were tested for general bioactivity using brine shrimp (Artemia salina lethality test. Lethal concentration (LC50 and 95% confidence intervals were determined by computer program LdP line. Out of fifteen tested methanol extracts, three possessed cytotoxic effect. Taxus baccata methanol extract showed the highest effect (LC50 = 18.60 μg/ml, while Thymus tosevii methanol extract expressed the lowest (LC50 = 842.50 μg/ml. All other analyzed species did not express significant cytotoxicity. Also, diethyl ether extracts of all tested species did not show significant cytotoxicity. The obtained results for methanol extracts which show certain cytotoxic effect could be guide for further phytochemical and pharmacological investigations. [Project of the Serbian Ministry of Education, Science and Technological Development, Grant no. 173029

  8. Experimental evaluation of the relationship between lethal or non-lethal virulence and transmission success in malaria parasite infections

    Directory of Open Access Journals (Sweden)

    Nithiuthai S

    2004-09-01

    Full Text Available Abstract Background Evolutionary theory suggests that the selection pressure on parasites to maximize their transmission determines their optimal host exploitation strategies and thus their virulence. Establishing the adaptive basis to parasite life history traits has important consequences for predicting parasite responses to public health interventions. In this study we examine the extent to which malaria parasites conform to the predicted adaptive trade-off between transmission and virulence, as defined by mortality. The majority of natural infections, however, result in sub-lethal virulent effects (e.g. anaemia and are often composed of many strains. Both sub-lethal effects and pathogen population structure have been theoretically shown to have important consequences for virulence evolution. Thus, we additionally examine the relationship between anaemia and transmission in single and mixed clone infections. Results Whereas there was a trade-off between transmission success and virulence as defined by host mortality, contradictory clone-specific patterns occurred when defining virulence by anaemia. A negative relationship between anaemia and transmission success was found for one of the parasite clones, whereas there was no relationship for the other. Notably the two parasite clones also differed in a transmission phenotype (gametocyte sex ratio that has previously been shown to respond adaptively to a changing blood environment. In addition, as predicted by evolutionary theory, mixed infections resulted in increased anaemia. The increased anaemia was, however, not correlated with any discernable parasite trait (e.g. parasite density or with increased transmission. Conclusions We found some evidence supporting the hypothesis that there is an adaptive basis correlating virulence (as defined by host mortality and transmission success in malaria parasites. This confirms the validity of applying evolutionary virulence theory to biomedical

  9. Immunological characterization of a modified vaccinia virus Ankara vector expressing the human papillomavirus 16 E1 protein.

    Science.gov (United States)

    Remy-Ziller, Christelle; Germain, Claire; Spindler, Anita; Hoffmann, Chantal; Silvestre, Nathalie; Rooke, Ronald; Bonnefoy, Jean-Yves; Préville, Xavier

    2014-02-01

    Women showing normal cytology but diagnosed with a persistent high-risk human papillomavirus (HR-HPV) infection have a higher risk of developing high-grade cervical intraepithelial neoplasia and cervical cancer than noninfected women. As no therapeutic management other than surveillance is offered to these women, there is a major challenge to develop novel targeted therapies dedicated to the treatment of these patients. As such, E1 and E2 antigens, expressed early in the HPV life cycle, represent very interesting candidates. Both proteins are necessary for maintaining coordinated viral replication and gene synthesis during the differentiation process of the epithelium and are essential for the virus to complete its normal and propagative replication cycle. In the present study, we evaluated a new active targeted immunotherapeutic, a modified vaccinia virus Ankara (MVA) vector containing the E1 sequence of HPV16, aimed at inducing cellular immune responses with the potential to help and clear persistent HPV16-related infection. We carried out an extensive comparative time course analysis of the cellular immune responses induced by different schedules of immunization in C57BL/6 mice. We showed that multiple injections of MVA-E1 allowed sustained HPV16 E1-specific cellular immune responses in vaccinated mice and had no impact on the exhaustion phenotype of the generated HPV16 E1-specific CD8⁺ T cells, but they led to the differentiation of multifunctional effector T cells with high cytotoxic capacity. This study provides proof of concept that an MVA expressing HPV16 E1 can induce robust and long-lasting E1-specific responses and warrants further development of this candidate.

  10. Mutations conferring resistance to viral DNA polymerase inhibitors in camelpox virus give different drug-susceptibility profiles in vaccinia virus.

    Science.gov (United States)

    Duraffour, Sophie; Andrei, Graciela; Topalis, Dimitri; Krečmerová, Marcela; Crance, Jean-Marc; Garin, Daniel; Snoeck, Robert

    2012-07-01

    Cidofovir or (S)-HPMPC is one of the three antiviral drugs that might be used for the treatment of orthopoxvirus infections. (S)-HPMPC and its 2,6-diaminopurine counterpart, (S)-HPMPDAP, have been described to select, in vitro, for drug resistance mutations in the viral DNA polymerase (E9L) gene of vaccinia virus (VACV). Here, to extend our knowledge of drug resistance development among orthopoxviruses, we selected, in vitro, camelpox viruses (CMLV) resistant to (S)-HPMPDAP and identified a single amino acid change, T831I, and a double mutation, A314V+A684V, within E9L. The production of recombinant CMLV and VACV carrying these amino acid substitutions (T831I, A314V, or A314V+A684V) demonstrated clearly their involvement in conferring reduced sensitivity to viral DNA polymerase inhibitors, including (S)-HPMPDAP. Both CMLV and VACV harboring the A314V change showed comparable drug-susceptibility profiles to various antivirals and similar impairments in viral growth. In contrast, the single change T831I and the double change A314V+A684V in VACV were responsible for increased levels of drug resistance and for cross-resistance to viral DNA polymerase antivirals that were not observed with their CMLV counterparts. Each amino acid change accounted for an attenuated phenotype of VACV in vivo. Modeling of E9L suggested that the T→I change at position 831 might abolish hydrogen bonds between E9L and the DNA backbone and have a direct impact on the incorporation of the acyclic nucleoside phosphonates. Our findings demonstrate that drug-resistance development in two related orthopoxvirus species may impact drug-susceptibility profiles and viral fitness differently.

  11. A novel naturally occurring tandem promoter in modified vaccinia virus ankara drives very early gene expression and potent immune responses.

    Directory of Open Access Journals (Sweden)

    Sonia T Wennier

    Full Text Available Modified vaccinia virus Ankara (MVA has been shown to be suitable for the generation of experimental vaccines against cancer and infectious diseases, eliciting strong humoral and cellular immune responses. In viral vectored vaccines, strong recombinant antigen expression and timing of expression influence the quantity and quality of the immune response. Screening of synthetic and native poxvirus promoters for strong protein expression in vitro and potent immune responses in vivo led to the identification of the MVA13.5L promoter, a unique and novel naturally occurring tandem promoter in MVA composed of two 44 nucleotide long repeated motifs, each containing an early promoter element. The MVA13.5L gene is highly conserved across orthopoxviruses, yet its function is unknown. The unique structure of its promoter is not found for any other gene in the MVA genome and is also conserved in other orthopoxviruses. Comparison of the MVA13.5L promoter activity with synthetic poxviral promoters revealed that the MVA13.5L promoter produced higher levels of protein early during infection in HeLa cells and particularly in MDBK cells, a cell line in which MVA replication stops at an early stage before the expression of late genes. Finally, a recombinant antigen expressed under the control of this novel promoter induced high antibody titers and increased CD8 T cell responses in homologous prime-boost immunization compared to commonly used promoters. In particular, the recombinant antigen specific CD8 T cell responses dominated over the immunodominant B8R vector-specific responses after three vaccinations and even more during the memory phase. These results have identified the native MVA13.5L promoter as a new potent promoter for use in MVA vectored preventive and therapeutic vaccines.

  12. Vaccinia Virus Immunomodulator A46: A Lipid and Protein-Binding Scaffold for Sequestering Host TIR-Domain Proteins.

    Directory of Open Access Journals (Sweden)

    Sofiya Fedosyuk

    2016-12-01

    Full Text Available Vaccinia virus interferes with early events of the activation pathway of the transcriptional factor NF-kB by binding to numerous host TIR-domain containing adaptor proteins. We have previously determined the X-ray structure of the A46 C-terminal domain; however, the structure and function of the A46 N-terminal domain and its relationship to the C-terminal domain have remained unclear. Here, we biophysically characterize residues 1-83 of the N-terminal domain of A46 and present the X-ray structure at 1.55 Å. Crystallographic phases were obtained by a recently developed ab initio method entitled ARCIMBOLDO_BORGES that employs tertiary structure libraries extracted from the Protein Data Bank; data analysis revealed an all β-sheet structure. This is the first such structure solved by this method which should be applicable to any protein composed entirely of β-sheets. The A46(1-83 structure itself is a β-sandwich containing a co-purified molecule of myristic acid inside a hydrophobic pocket and represents a previously unknown lipid-binding fold. Mass spectrometry analysis confirmed the presence of long-chain fatty acids in both N-terminal and full-length A46; mutation of the hydrophobic pocket reduced the lipid content. Using a combination of high resolution X-ray structures of the N- and C-terminal domains and SAXS analysis of full-length protein A46(1-240, we present here a structural model of A46 in a tetrameric assembly. Integrating affinity measurements and structural data, we propose how A46 simultaneously interferes with several TIR-domain containing proteins to inhibit NF-κB activation and postulate that A46 employs a bipartite binding arrangement to sequester the host immune adaptors TRAM and MyD88.

  13. Safety and immunogenicity of novel recombinant BCG and modified vaccinia virus Ankara vaccines in neonate rhesus macaques.

    Science.gov (United States)

    Rosario, Maximillian; Fulkerson, John; Soneji, Shamit; Parker, Joe; Im, Eung-Jun; Borthwick, Nicola; Bridgeman, Anne; Bourne, Charles; Joseph, Joan; Sadoff, Jerald C; Hanke, Tomás

    2010-08-01

    Although major inroads into making antiretroviral therapy available in resource-poor countries have been made, there is an urgent need for an effective vaccine administered shortly after birth, which would protect infants from acquiring human immunodeficiency virus type 1 (HIV-1) through breast-feeding. Bacillus Calmette-Guérin (BCG) is given to most infants at birth, and its recombinant form could be used to prime HIV-1-specific responses for a later boost by heterologous vectors delivering the same HIV-1-derived immunogen. Here, two groups of neonate Indian rhesus macaques were immunized with either novel candidate vaccine BCG.HIVA(401) or its parental strain AERAS-401, followed by two doses of recombinant modified vaccinia virus Ankara MVA.HIVA. The HIVA immunogen is derived from African clade A HIV-1. All vaccines were safe, giving local reactions consistent with the expected response at the injection site. No systemic adverse events or gross abnormality was seen at necropsy. Both AERAS-401 and BCG.HIVA(401) induced high frequencies of BCG-specific IFN-gamma-secreting lymphocytes that declined over 23 weeks, but the latter failed to induce detectable HIV-1-specific IFN-gamma responses. MVA.HIVA elicited HIV-1-specific IFN-gamma responses in all eight animals, but, except for one animal, these responses were weak. The HIV-1-specific responses induced in infants were lower compared to historic data generated by the two HIVA vaccines in adult animals but similar to other recombinant poxviruses tested in this model. This is the first time these vaccines were tested in newborn monkeys. These results inform further infant vaccine development and provide comparative data for two human infant vaccine trials of MVA.HIVA.

  14. Intrarectal vaccination with recombinant vaccinia virus expressing carcinoembronic antigen induces mucosal and systemic immunity and prevents progression of colorectal cancer.

    Science.gov (United States)

    Kim-Schulze, Seunghee; Kim, Hong Sung; Wainstein, Alberto; Kim, Dae Won; Yang, Wein Cui; Moroziewicz, Dorota; Mong, Phyllus Y; Bereta, Michal; Taback, Bret; Wang, Qin; Kaufman, Howard L

    2008-12-01

    The gastrointestinal mucosa contains an intact immune system that protects the host from pathogens and communicates with the systemic immune system. Absorptive epithelial cells in the mucosa give rise to malignant tumors although the interaction between tumor cells and the mucosal immune system is not well defined. The pathophysiology of colorectal cancer has been elucidated through studies of hereditary syndromes, such as familial adenomatous polyposis, a cancer predisposition syndrome caused by germline mutations in the adenomatous polyposis coli tumor suppressor gene. Patients with FAP develop adenomas and inevitably progress to invasive carcinomas by the age of 40. To better delineate the role of mucosal immunity in colorectal cancer, we evaluated the efficacy of intrarectal recombinant vaccinia virus expressing the human carcinoembryonic Ag (CEA) in a murine FAP model in which mice are predisposed to colorectal cancer and also express human CEA in the gut. Mucosal vaccination reduced the incidence of spontaneous adenomas and completely prevented progression to invasive carcinoma. The therapeutic effects were associated with induction of mucosal CEA-specific IgA Ab titers and CD8(+) CTLs. Mucosal vaccination was also associated with an increase in systemic CEA-specific IgG Ab titers, CD4(+) and CD8(+) T cell responses and resulted in growth inhibition of s.c. implanted CEA-expressing tumors suggesting communication between mucosal and systemic immune compartments. Thus, intrarectal vaccination induces mucosal and systemic antitumor immunity and prevents progression of spontaneous colorectal cancer. These results have implications for the prevention of colorectal cancer in high-risk individuals.

  15. Intravenous hemostatic nanoparticles increase survival following blunt trauma injury.

    Science.gov (United States)

    Shoffstall, Andrew J; Atkins, Kristyn T; Groynom, Rebecca E; Varley, Matthew E; Everhart, Lydia M; Lashof-Sullivan, Margaret M; Martyn-Dow, Blaine; Butler, Robert S; Ustin, Jeffrey S; Lavik, Erin B

    2012-11-12

    Trauma is the leading cause of death for people ages 1-44, with blood loss comprising 60-70% of mortality in the absence of lethal CNS or cardiac injury. Immediate intervention is critical to improving chances of survival. While there are several products to control bleeding for external and compressible wounds, including pressure dressings, tourniquets, or topical materials (e.g., QuikClot, HemCon), there are no products that can be administered in the field for internal bleeding. There is a tremendous unmet need for a hemostatic agent to address internal bleeding in the field. We have developed hemostatic nanoparticles (GRGDS-NPs) that reduce bleeding times by ~50% in a rat femoral artery injury model. Here, we investigated their impact on survival following administration in a lethal liver resection injury in rats. Administration of these hemostatic nanoparticles reduced blood loss following the liver injury and dramatically and significantly increased 1 h survival from 40 and 47% in controls (inactive nanoparticles and saline, respectively) to 80%. Furthermore, we saw no complications following administration of these nanoparticles. We further characterized the nanoparticles' effect on clotting time (CT) and maximum clot firmness (MCF) using rotational thromboelastometry (ROTEM), a clinical measurement of whole-blood coagulation. Clotting time is significantly reduced, with no change in MCF. Administration of these hemostatic nanoparticles after massive trauma may help staunch bleeding and improve survival in the critical window following injury, and this could fundamentally change trauma care.

  16. Drug-Driven Synthetic Lethality: Bypassing Tumor Cell Genetics with a Combination of AsiDNA and PARP Inhibitors.

    Science.gov (United States)

    Jdey, Wael; Thierry, Sylvain; Russo, Christophe; Devun, Flavien; Al Abo, Muthana; Noguiez-Hellin, Patricia; Sun, Jian-Sheng; Barillot, Emmanuel; Zinovyev, Andrei; Kuperstein, Inna; Pommier, Yves; Dutreix, Marie

    2017-02-15

    Purpose: Cancer treatments using tumor defects in DNA repair pathways have shown promising results but are restricted to small subpopulations of patients. The most advanced drugs in this field are PARP inhibitors (PARPi), which trigger synthetic lethality in tumors with homologous recombination (HR) deficiency. Using AsiDNA, an inhibitor of HR and nonhomologous end joining, together with PARPi should allow bypassing the genetic restriction for PARPi efficacy.Experimental Design: We characterized the DNA repair inhibition activity of PARPi (olaparib) and AsiDNA by monitoring repair foci formation and DNA damage. We analyzed the cell survival to standalone and combined treatments of 21 tumor cells and three nontumor cells. In 12 breast cancer (BC) cell lines, correlation with sensitivity to each drug and transcriptome were statistically analyzed to identify resistance pathways.Results: Molecular analyses demonstrate that olaparib and AsiDNA respectively prevent recruitment of XRCC1 and RAD51/53BP1 repair enzymes to damage sites. Combination of both drugs increases the accumulation of unrepaired damage resulting in an increase of cell death in all tumor cells. In contrast, nontumor cells do not show an increase of DNA damage nor lethality. Analysis of multilevel omics data from BC cells highlighted different DNA repair and cell-cycle molecular profiles associated with resistance to AsiDNA or olaparib, rationalizing combined treatment. Treatment synergy was also confirmed with six other PARPi in development.Conclusions: Our results highlight the therapeutic interest of combining AsiDNA and PARPi to recapitulate synthetic lethality in all tumors independently of their HR status. Clin Cancer Res; 23(4); 1001-11. ©2016 AACR. ©2016 American Association for Cancer Research.

  17. Liposome-encapsulated hemoglobin transfusion rescues rats undergoing progressive hemodilution from lethal organ hypoxia without scavenging nitric oxide.

    Science.gov (United States)

    Nogami, Yashiro; Kinoshita, Manabu; Takase, Bonpei; Ogata, Yoshitaka; Saitoh, Daizoh; Kikuchi, Makoto; Ishihara, Masayuki; Maehara, Tadaaki

    2008-08-01

    To investigate the efficacy of liposome-encapsulated hemoglobin (LHb) transfusion in rats undergoing lethal progressive hemodilution. Unlike other acellular hemoglobin-based oxygen carriers, LHb has lipid bilayer membranes that are similar to mammalian red blood cells (RBCs), which prevent hemoglobin from having any direct contact with the blood components and the endothelium. Acellular hemoglobin has a high affinity for nitric oxide (NO), and because they are reported to behave as NO scavengers, acellular hemoglobin-based oxygen carriers could have pressor effects on the peripheral vessels. During a massive hemorrhage, acellular hemoglobin caused vasoconstriction could decrease peripheral perfusion, thereby leading to diminished oxygen delivery. Rats were subjected to blood withdrawal (0.2 mL/min) with a simultaneous resuscitation using an isovolemic fluid transfusion that contained LHb, 5% albumin, or washed rat RBCs for 150 minutes (n = 15 in each group). All rats transfused with LHb or RBCs were rescued from lethal progressive hemodilution, whereas none of the albumin-transfused rats survived. LHb did not affect the plasma NO metabolite levels, suggesting it was not a potent NO scavenger. LHb also improved hemodilution-induced metabolic acidosis, and reduced exaggerated neuroendocrine responses and injuries to the heart, liver, and kidney. It suppressed expression of hypoxia-inducible factor-1alpha in the liver and kidney, suggesting improvement of hypoxia at molecular response levels. However, neither transfused LHb nor RBCs improved the acute lung injury that occurs after progressive hemodilution. LHb transfusion is effective in rescuing rats undergoing progressive hemodilution from lethal organ hypoxia without scavenging NO.

  18. Adeno-Associated Virus Serotype 8 Gene Transfer Rescues a Neonatal Lethal Murine Model of Propionic Acidemia

    Science.gov (United States)

    Chandler, Randy J.; Chandrasekaran, Suma; Carrillo-Carrasco, Nuria; Senac, Julien S.; Hofherr, Sean E.; Barry, Michael A.

    2011-01-01

    Abstract Propionic acidemia (PA) is an autosomal recessive disorder of metabolism caused by a deficiency of propionyl-coenzyme A carboxylase (PCC). Despite optimal dietary and cofactor therapy, PA patients still suffer from lethal metabolic instability and experience multisystemic complications. A murine model of PA (Pcca–/–) of animals that uniformly die within the first 48 hr of life was used to determine the efficacy of adeno-associated viral (AAV) gene transfer as a potential therapy for PA. An AAV serotype 8 (AAV8) vector was engineered to express the human PCCA cDNA and delivered to newborn mice via an intrahepatic injection. Greater than 64% of the Pcca–/– mice were rescued after AAV8-mediated gene transfer and survived until day of life 16 or beyond. Western analysis of liver extracts showed that PCC was completely absent from Pcca–/– mice but was restored to greater than wild-type levels after AAV gene therapy. The treated Pcca–/– mice also exhibited markedly reduced plasma levels of 2-methylcitrate compared with the untreated Pcca–/– mice, which indicates significant PCC enzymatic activity was provided by gene transfer. At the time of this report, the oldest treated Pcca–/– mice are over 6 months of age. In summary, AAV gene delivery of PCCA effectively rescues Pcca–/– mice from neonatal lethality and substantially ameliorates metabolic markers of the disease. These experiments demonstrate a gene transfer approach using AAV8 that might be used as a treatment for PA, a devastating and often lethal disorder desperately in need of new therapeutic options. PMID:20950151

  19. Arsenic-induced sub-lethal stress reprograms human bronchial epithelial cells to CD61¯ cancer stem cells.

    Science.gov (United States)

    Chang, Qingshan; Chen, Bailing; Thakur, Chitra; Lu, Yongju; Chen, Fei

    2014-03-15

    In the present report, we demonstrate that sub-lethal stress induced by consecutive exposure to 0.25 µM arsenic (As3+) for six months can trigger reprogramming of the human bronchial epithelial cell (BEAS-2B) to form cancer stem cells (CSCs) without forced introduction of the stemness transcription factors. These CSCs formed from As3+-induced sub-lethal stress featured with an increased expression of the endogenous stemness genes, including Oct4, Sox2, Klf4, Myc, and others that are associated with the pluripotency and self-renewal of the CSCs. Flow cytometry analysis indicated that 90% of the CSC cells are CD61¯, whereas 100% of the parental cells are CD61+. These CD61¯ CSCs are highly tumorigenic and metastatic to the lung in xenotransplantation tests in NOD/SCID Il2rγ-/- mice. Additional tests also revealed that the CD61¯ CSCs showed a significant decrease in the expression of the genes important for DNA repair and oxidative phosphorylation. To determine the clinical relevance of the above findings, we stratified human lung cancers based on the level of CD61 protein and found that CD61low cancer correlates with poorer survival of the patients. Such a correlation was also observed in human breast cancer and ovarian cancer. Taken together, our findings suggest that in addition to the traditional approaches of enforced introduction of the exogenous stemness circuit transcription factors, sub-lethal stress induced by consecutive low dose As3+ is also able to convert non-stem cells to the CSCs.

  20. Selective reconstitution of liver cholesterol biosynthesis promotes lung maturation but does not prevent neonatal lethality in Dhcr7 null mice

    Directory of Open Access Journals (Sweden)

    Chen Jianliang

    2007-04-01

    Full Text Available Abstract Background Targeted disruption of the murine 3β-hydroxysterol-Δ7-reductase gene (Dhcr7, an animal model of Smith-Lemli-Opitz syndrome, leads to loss of cholesterol synthesis and neonatal death that can be partially rescued by transgenic replacement of DHCR7 expression in brain during embryogenesis. To gain further insight into the role of non-brain tissue cholesterol deficiency in the pathophysiology, we tested whether the lethal phenotype could be abrogated by selective transgenic complementation with DHCR7 expression in the liver. Results We generated mice that carried a liver-specific human DHCR7 transgene whose expression was driven by the human apolipoprotein E (ApoE promoter and its associated liver-specific enhancer. These mice were then crossed with Dhcr7+/- mutants to generate Dhcr7-/- mice bearing a human DHCR7 transgene. Robust hepatic transgene expression resulted in significant improvement of cholesterol homeostasis with cholesterol concentrations increasing to 80~90 % of normal levels in liver and lung. Significantly, cholesterol deficiency in brain was not altered. Although late gestational lung sacculation defect reported previously was significantly improved, there was no parallel increase in postnatal survival in the transgenic mutant mice. Conclusion The reconstitution of DHCR7 function selectively in liver induced a significant improvement of cholesterol homeostasis in non-brain tissues, but failed to rescue the neonatal lethality of Dhcr7 null mice. These results provided further evidence that CNS defects caused by Dhcr7 null likely play a major role in the lethal pathogenesis of Dhcr7-/- mice, with the peripheral organs contributing the morbidity.

  1. Lethality of commercial whole-muscle beef jerky manufacturing processes against Salmonella serovars and Escherichia coli O157:H7.

    Science.gov (United States)

    Buege, Dennis R; Searls, Gina; Ingham, Steven C

    2006-09-01

    Thermal processes used in making whole-muscle beef jerky include a drying step, which may result in enhanced pathogen thermotolerance and evaporative cooling that reduce process lethality. Several salmonellosis outbreaks have been associated with beef jerky. In this study, a standardized process was used to inoculate beef strips with five-strain cocktails of either Salmonella serovars or Escherichia coli O157:H7, to marinate the strips at pH 5.3 for 22 to 24 h at 5 degrees C, and to convert the strips to jerky using various heating and drying regimes. Numbers of surviving organisms were determined during and after heating and drying. Salmonella reductions of > or = 6.4 log CFU and similar reductions in E. coli O157:H7 were best achieved by ensuring that high wet-bulb temperatures were reached and maintained early in the process (51.7 or 54.4 degrees C for 60 min, 57.2 degrees C for 30 min, or 60 degrees C for 10 min) followed by drying at 76.7 degrees C (dry-bulb temperature). Processes with less lethality that reduced counts of both pathogens by > or = 5.0 log CFU were (i) heating and drying at 76.7 degrees C (dry bulb) within 90 min of beginning the process, (ii) heating for successive hourly intervals at 48.9, 54.4, 60, and 76.7 degrees C (dry bulb), and (iii) heating at 51.7 degrees C (dry bulb) and then drying at 76.7 degrees C (dry bulb), starting before the product water activity dropped below 0.86. In several trials, separate beef strips were inoculated with a commercial Pediococcus acidilactici starter culture as a potential surrogate for evaluating pathogen thermotolerance. The results of these trials suggested that this experimental approach may be useful for in-plant validation of process lethality.

  2. [Prognostic value of the lethal triad among patients with multiple trauma].

    Science.gov (United States)

    González Balverde, María; Ramírez Lizardo, Ernesto J; Cardona Muñoz, Ernesto G; Totsuka Sutto, Sylvia E; García Benavides, Leonel

    2013-11-01

    Patients who have suffered multiple traumatic injuries, have a serious risk for death. Hypothermia, acidosis and coagulopathy are three complications in these patients, whose presence is known as lethal triad and indicates bad prognosis. To determine if the lethal triad in multiple trauma patients is associated with higher mortality and Injury Score Severity (ISS). One hundred multiple trauma patients aged 26 to 56 years (90 males), admitted to an emergency room, were studied. Body temperature, prothrombin time, partial thromboplastin time, platelet count and blood gases were determined on admission. Twenty six patients had the lethal triad and 15% died in the emergency room within the first 6 hours. No death was recorded among the 74 patients without the lethal triad. The mean ISS among patients with and without the lethal triad was 31.7 and 25.6, respectively (p lethal triad among patients with multiple trauma is associated with a higher mortality and ISS.

  3. Rabies Virus Antibodies from Oral Vaccination as a Correlate of Protection against Lethal Infection in Wildlife

    Directory of Open Access Journals (Sweden)

    Susan M. Moore

    2017-07-01

    Full Text Available Both cell-mediated and humoral immune effectors are important in combating rabies infection, although the humoral response receives greater attention regarding rabies prevention. The principle of preventive vaccination has been adopted for strategies of oral rabies vaccination (ORV of wildlife reservoir populations for decades to control circulation of rabies virus in free-ranging hosts. There remains much debate about the levels of rabies antibodies (and the assays to measure them that confer resistance to rabies virus. In this paper, data from published literature and our own unpublished animal studies on the induction of rabies binding and neutralizing antibodies following oral immunization of animals with live attenuated or recombinant rabies vaccines, are examined as correlates of protection against lethal rabies infection in captive challenge settings. Analysis of our studies suggests that, though serum neutralization test results are expected to reflect in vivo protection, the blocking enzyme linked immunosorbent assay (ELISA result at Day 28 was a better predictor of survival. ELISA kits may have an advantage of greater precision and ability to compare results among different studies and laboratories based on the inherent standardization of the kit format. This paper examines current knowledge and study findings to guide meaningful interpretation of serology results in oral baiting monitoring.

  4. Embryonic Lethality of Mitochondrial Pyruvate Carrier 1 Deficient Mouse Can Be Rescued by a Ketogenic Diet.

    Directory of Open Access Journals (Sweden)

    Benoît Vanderperre

    2016-05-01

    Full Text Available Mitochondrial import of pyruvate by the mitochondrial pyruvate carrier (MPC is a central step which links cytosolic and mitochondrial intermediary metabolism. To investigate the role of the MPC in mammalian physiology and development, we generated a mouse strain with complete loss of MPC1 expression. This resulted in embryonic lethality at around E13.5. Mouse embryonic fibroblasts (MEFs derived from mutant mice displayed defective pyruvate-driven respiration as well as perturbed metabolic profiles, and both defects could be restored by reexpression of MPC1. Labeling experiments using 13C-labeled glucose and glutamine demonstrated that MPC deficiency causes increased glutaminolysis and reduced contribution of glucose-derived pyruvate to the TCA cycle. Morphological defects were observed in mutant embryonic brains, together with major alterations of their metabolome including lactic acidosis, diminished TCA cycle intermediates, energy deficit and a perturbed balance of neurotransmitters. Strikingly, these changes were reversed when the pregnant dams were fed a ketogenic diet, which provides acetyl-CoA directly to the TCA cycle and bypasses the need for a functional MPC. This allowed the normal gestation and development of MPC deficient pups, even though they all died within a few minutes post-delivery. This study establishes the MPC as a key player in regulating the metabolic state necessary for embryonic development, neurotransmitter balance and post-natal survival.

  5. Lethal thermal impact at periphery of pyroclastic surges: evidences at Pompeii.

    Science.gov (United States)

    Mastrolorenzo, Giuseppe; Petrone, Pierpaolo; Pappalardo, Lucia; Guarino, Fabio M

    2010-06-15

    The evaluation of mortality of pyroclastic surges and flows (PDCs) produced by explosive eruptions is a major goal in risk assessment and mitigation, particularly in distal reaches of flows that are often heavily urbanized. Pompeii and the nearby archaeological sites preserve the most complete set of evidence of the 79 AD catastrophic eruption recording its effects on structures and people. Here we investigate the causes of mortality in PDCs at Pompeii and surroundings on the bases of a multidisciplinary volcanological and bio-anthropological study. Field and laboratory study of the eruption products and victims merged with numerical simulations and experiments indicate that heat was the main cause of death of people, heretofore supposed to have died by ash suffocation. Our results show that exposure to at least 250 degrees C hot surges at a distance of 10 kilometres from the vent was sufficient to cause instant death, even if people were sheltered within buildings. Despite the fact that impact force and exposure time to dusty gas declined toward PDCs periphery up to the survival conditions, lethal temperatures were maintained up to the PDCs extreme depositional limits. This evidence indicates that the risk in flow marginal zones could be underestimated by simply assuming that very thin distal deposits, resulting from PDCs with poor total particle load, correspond to negligible effects. Therefore our findings are essential for hazard plans development and for actions aimed to risk mitigation at Vesuvius and other explosive volcanoes.

  6. Lethal thermal impact at periphery of pyroclastic surges: evidences at Pompeii.

    Directory of Open Access Journals (Sweden)

    Giuseppe Mastrolorenzo

    Full Text Available BACKGROUND: The evaluation of mortality of pyroclastic surges and flows (PDCs produced by explosive eruptions is a major goal in risk assessment and mitigation, particularly in distal reaches of flows that are often heavily urbanized. Pompeii and the nearby archaeological sites preserve the most complete set of evidence of the 79 AD catastrophic eruption recording its effects on structures and people. METHODOLOGY/PRINCIPAL FINDINGS: Here we investigate the causes of mortality in PDCs at Pompeii and surroundings on the bases of a multidisciplinary volcanological and bio-anthropological study. Field and laboratory study of the eruption products and victims merged with numerical simulations and experiments indicate that heat was the main cause of death of people, heretofore supposed to have died by ash suffocation. Our results show that exposure to at least 250 degrees C hot surges at a distance of 10 kilometres from the vent was sufficient to cause instant death, even if people were sheltered within buildings. Despite the fact that impact force and exposure time to dusty gas declined toward PDCs periphery up to the survival conditions, lethal temperatures were maintained up to the PDCs extreme depositional limits. CONCLUSIONS/SIGNIFICANCE: This evidence indicates that the risk in flow marginal zones could be underestimated by simply assuming that very thin distal deposits, resulting from PDCs with poor total particle load, correspond to negligible effects. Therefore our findings are essential for hazard plans development and for actions aimed to risk mitigation at Vesuvius and other explosive volcanoes.

  7. The Ectromelia Virus SPI-2 Protein Causes Lethal Mousepox by Preventing NK Cell Responses▿†

    Science.gov (United States)

    Melo-Silva, Carolina R.; Tscharke, David C.; Lobigs, Mario; Koskinen, Aulikki; Wong, Yik Chun; Buller, R. Mark; Müllbacher, Arno; Regner, Matthias

    2011-01-01

    Ectromelia virus (ECTV) is a natural pathogen of mice that causes mousepox, and many of its genes have been implicated in the modulation of host immune responses. Serine protease inhibitor 2 (SPI-2) is one of these putative ECTV host response modifier proteins. SPI-2 is conserved across orthopoxviruses, but results defining its mechanism of action and in vivo function are lacking or contradictory. We studied the role of SPI-2 in mousepox by deleting the SPI-2 gene or its serine protease inhibitor reactive site. We found that SPI-2 does not affect viral replication or cell-intrinsic apoptosis pathways, since mutant viruses replicate in vitro as efficiently as wild-type virus. However, in the absence of SPI-2 protein, ECTV is attenuated in mousepox-susceptible mice, resulting in lower viral loads in the liver, decreased spleen pathology, and substantially improved host survival. This attenuation correlates with more effective immune responses in the absence of SPI-2, including an earlier serum gamma interferon (IFN-γ) response, raised serum interleukin 18 (IL-18), increased numbers of granzyme B+ CD8+ T cells, and, most notably, increased numbers and activation of NK cells. Both virus attenuation and the improved immune responses associated with SPI-2 deletion from ECTV are lost when mice are depleted of NK cells. Consequently, SPI-2 renders mousepox lethal in susceptible strains by preventing protective NK cell defenses. PMID:21849445

  8. Embryonic Lethality of Mitochondrial Pyruvate Carrier 1 Deficient Mouse Can Be Rescued by a Ketogenic Diet

    Science.gov (United States)

    Krznar, Petra; Hörl, Manuel; Ammar, Zeinab; Montessuit, Sylvie; Pierredon, Sandra; Zamboni, Nicola; Martinou, Jean-Claude

    2016-01-01

    Mitochondrial import of pyruvate by the mitochondrial pyruvate carrier (MPC) is a central step which links cytosolic and mitochondrial intermediary metabolism. To investigate the role of the MPC in mammalian physiology and development, we generated a mouse strain with complete loss of MPC1 expression. This resulted in embryonic lethality at around E13.5. Mouse embryonic fibroblasts (MEFs) derived from mutant mice displayed defective pyruvate-driven respiration as well as perturbed metabolic profiles, and both defects could be restored by reexpression of MPC1. Labeling experiments using 13C-labeled glucose and glutamine demonstrated that MPC deficiency causes increased glutaminolysis and reduced contribution of glucose-derived pyruvate to the TCA cycle. Morphological defects were observed in mutant embryonic brains, together with major alterations of their metabolome including lactic acidosis, diminished TCA cycle intermediates, energy deficit and a perturbed balance of neurotransmitters. Strikingly, these changes were reversed when the pregnant dams were fed a ketogenic diet, which provides acetyl-CoA directly to the TCA cycle and bypasses the need for a functional MPC. This allowed the normal gestation and development of MPC deficient pups, even though they all died within a few minutes post-delivery. This study establishes the MPC as a key player in regulating the metabolic state necessary for embryonic development, neurotransmitter balance and post-natal survival. PMID:27176894

  9. Synthetic lethality between CCNE1 amplification and loss of BRCA1.

    Science.gov (United States)

    Etemadmoghadam, Dariush; Weir, Barbara A; Au-Yeung, George; Alsop, Kathryn; Mitchell, Gillian; George, Joshy; Davis, Sally; D'Andrea, Alan D; Simpson, Kaylene; Hahn, William C; Bowtell, David D L

    2013-11-26

    High-grade serous ovarian cancers (HGSCs) are characterized by a high frequency of TP53 mutations, BRCA1/2 inactivation, homologous recombination dysfunction, and widespread copy number changes. Cyclin E1 (CCNE1) gene amplification has been reported to occur independently of BRCA1/2 mutation, and it is associated with primary treatment failure and reduced patient survival. Insensitivity of CCNE1-amplified tumors to platinum cross-linking agents may be partly because of an intact BRCA1/2 pathway. Both BRCA1/2 dysfunction and CCNE1 amplification are known to promote genomic instability and tumor progression. These events may be mutually exclusive, because either change provides a path to tumor development, with no selective advantage to having both mutations. Using data from a genome-wide shRNA synthetic lethal screen, we show that BRCA1 and members of the ubiquitin pathway are selectively required in cancers that harbor CCNE1 amplification. Furthermore, we show specific sensitivity of CCNE1-amplified tumor cells to the proteasome inhibitor bortezomib. These findings provide an explanation for the observed mutual exclusivity of CCNE1 amplification and BRCA1/2 loss in HGSC and suggest a unique therapeutic approach for treatment-resistant CCNE1-amplified tumors.

  10. The role of pneumolysin in mediating lung damage in a lethal pneumococcal pneumonia murine model

    Directory of Open Access Journals (Sweden)

    Pirofski Liise-Anne

    2007-01-01

    Full Text Available Abstract Background Intranasal inoculation of Streptococcus pneumoniae D39 serotype 2 causes fatal pneumonia in mice. The cytotoxic and inflammatory properties of pneumolysin (PLY have been implicated in the pathogenesis of pneumococcal pneumonia. Methods To examine the role of PLY in this experimental model we performed ELISA assays for PLY quantification. The distribution patterns of PLY and apoptosis were established by immunohistochemical detection of PLY, caspase-9 activity and TUNEL assay on tissue sections from mice lungs at various times, and the results were quantified with image analysis. Inflammatory and apoptotic cells were also quantified on lung tissue sections from antibody treated mice. Results In bronchoalveolar lavages (BAL, total PLY was found at sublytic concentrations which were located in alveolar macrophages and leukocytes. The bronchoalveolar epithelium was PLY-positive, while the vascular endothelium was not PLY reactive. The pattern and extension of cellular apoptosis was similar. Anti-PLY antibody treatment decreased the lung damage and the number of apoptotic and inflammatory cells in lung tissues. Conclusion The data strongly suggest that in vivo lung injury could be due to the pro-apoptotic and pro-inflammatory activity of PLY, rather than its cytotoxic activity. PLY at sublytic concentrations induces lethal inflammation in lung tissues and is involved in host cell apoptosis, whose effects are important to pathogen survival.

  11. Lethality and teratogenesis in F{sub 1} offspring mice following paternal fission neutron irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Shoji, Shuneki [Hiroshima Univ., Research Institute for Radiation Biology and Medicine, Hiroshima (Japan)

    2003-07-01

    Studies were conducted to determine whether following genetic damage at germ cell stages induced by paternal exposure to {sup 252}Cf fission neutron could lead to teratogenesis in the offspring. Seven-week-old C3H male mice were irradiated with graded doses of {sup 252}Cf fission neutrons and then were mated with nine-week-old C57BL females two weeks after the exposure. Three weeks later, it was found that testis and epididymal weight losses as well as the proportions of caudal epididymal sperm abnormalities in irradiated males were significantly greater than those in non-irradiated groups. Pregnant dams were sacrificed on day 18 of gestation and their fetuses were examined for the number of resorptions, intrauterine deaths and teratogenesis in F{sub 1} surviving offspring. Embryo lethality among the F{sub 1} offspring was found to be significantly higher in the irradiated group than in the non-irradiated group (p < 0.01), while the incidence of congenital malformations among the F{sub 1} offspring significantly increased in the irradiated groups. These results suggest that the paternal radiation exposure may have caused genetic transmission of DNA damage and genetic instability, which is in line with findings that show increases in incidence of teratogenesis in B{sub 6}C{sub 3}F{sub 1}. (author)

  12. Hyperactivation of Alk induces neonatal lethality in knock-in AlkF1178L mice

    Science.gov (United States)

    Lopez-Delisle, Lucille; Pierre-Eugène, Cécile; Bloch-Gallego, Evelyne; Birling, Marie-Christine; Duband, Jean-Loup; Durand, Estelle; Bourgeois, Thomas; Matrot, Boris; Sorg, Tania; Huerre, Michel; Meziane, Hamid; Roux, Michel J.; Champy, Marie-France; Gallego, Jorge; Delattre, Olivier; Janoueix-Lerosey, Isabelle

    2014-01-01

    The ALK (Anaplastic Lymphoma Kinase) gene encodes a tyrosine kinase receptor preferentially expressed in the central and peripheral nervous systems. A syndromic presentation associating congenital neuroblastoma with severe encephalopathy and an abnormal shape of the brainstem has been described in patients harbouring de novo germline F1174V and F1245V ALK mutations. Here, we investigated the phenotype of knock-in (KI) mice bearing the AlkF1178L mutation (F1174L in human). Although heterozygous KI mice did not reproduce the severe breathing and feeding difficulties observed in human patients, behavioral tests documented a reduced activity during dark phases and an increased anxiety o