WorldWideScience

Sample records for surrounding normal skin

  1. Spectrophotometer is useful for assessing vitiligo and chemical leukoderma severity by quantifying color difference with surrounding normally pigmented skin.

    Science.gov (United States)

    Hayashi, M; Okamura, K; Araki, Y; Suzuki, M; Tanaka, T; Abe, Y; Nakano, S; Yoshizawa, J; Hozumi, Y; Inoie, M; Suzuki, T

    2018-05-01

    Acquired skin hypopigmentation has many etiologies, including autoimmune melanocyte destruction, skin aging, inflammation, and chemical exposure. Distinguishing lesions from normally pigmented skin is clinically important to precisely assess disease severity. However, no gold standard assessment method has been reported. We aimed to investigate whether spectrophotometers are useful for assessing vitiligo and rhododendrol (4-(4-hydroxyphenol)-2-butanol) (Rhododenol ® )-induced leukoderma disease severity by quantifying skin color. Mexameter ® MX18 and CM-700d spectrophotometer were used for assessing vitiligo/leukoderma by measuring melanin index, L*a*b* color space, and ΔE*ab value, which represents the color difference between two subjects and is calculated by the values of L*a*b*. MX18 and CM-700d can quantitatively distinguish vitiligo/leukoderma from normally pigmented skin based on melanin index. CM-700d consistently quantified the color of vitiligo/leukoderma lesions and surrounding normally pigmented skin in L*a*b* color spaces and ΔE*ab. ΔE*ab is well correlated with melanin index and clinical appearance. ΔE*ab has been frequently used in aesthetic dentistry; however, current study is the first to use it in the measurement of skin color. ΔE*ab seems to be a useful parameter to evaluate the color contrast between vitiligo/leukoderma and surrounding normally pigmented skin and can be used to evaluate disease severity and patient's quality of life. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. MRI of normal pituitary glands and their surrounding structures

    International Nuclear Information System (INIS)

    Sato, Yoshiyuki

    1991-01-01

    Normal MRI appearances of the pituitary glands and their surrounding structures were evaluated in 332 patients without sellar and parasellar diseases. The height of the pituitary gland was maximum at 10-19 years of age reflecting hormonal activity. The width of the pituitary gland decreased, while that of the cavernous sinus increased with aging. This is probably due to atherosclerotic change of the internal carotid artery. Females younger than 30 years of age tended to show a convex upper surface of the pituitary gland and the displacement of the pituitary stalk was common after 50 years of age. Almost all of the anterior lobe of the pituitary gland showed isointensity relative to the pons or cerebral cortex and the majority (85.1%) of the posterior lobe showed hyperintensity. However, the anterior lobe in 2 newborns showed hyperintensity similar to the normal posterior lobe in adults. The posterior lobe was located off the midline in 19.1% of the subjects. One case of pars intermedia cyst was discovered among 14 subjects who were administered Gd-DTPA. The dural membrane between the pituitary gland and cavernous sinus was recognizable only in 8.6% on the right side and 7.5% on the left side. Primary empty sella was identified in 4.5%. Knowledge of the above normal ranges and variations of the pituitary gland and its surrounding structures is important in diagnosing sellar and parasellar lesions. (author) 52 refs

  3. Mast cell distribution in normal adult skin

    NARCIS (Netherlands)

    A.S. Janssens (Artiena Soe); R. Heide (Rogier); J.C. den Hollander (Jan); P.G.M. Mulder (P. G M); B. Tank (Bhupendra); A.P. Oranje (Arnold)

    2005-01-01

    markdownabstract__AIMS:__ To investigate mast cell distribution in normal adult skin to provide a reference range for comparison with mastocytosis. __METHODS:__ Mast cells (MCs) were counted in uninvolved skin adjacent to basal cell carcinomas and other dermatological disorders in adults.

  4. On the transition to the normal phase for superconductors surrounded by normal conductors

    DEFF Research Database (Denmark)

    Fournais, Søren; Kachmar, Ayman

    2009-01-01

    For a cylindrical superconductor surrounded by a normal material, we discuss transition to the normal phase of stable, locally stable and critical configurations. Associated with those phase transitions, we define critical magnetic fields and we provide a sufficient condition for which those...

  5. Mast cell distribution in normal adult skin.

    Science.gov (United States)

    Janssens, A S; Heide, R; den Hollander, J C; Mulder, P G M; Tank, B; Oranje, A P

    2005-03-01

    To investigate mast cell distribution in normal adult skin to provide a reference range for comparison with mastocytosis. Mast cells (MCs) were counted in uninvolved skin adjacent to basal cell carcinomas and other dermatological disorders in adults. There was an uneven distribution of MCs in different body sites using the anti-tryptase monoclonal antibody technique. Numbers of MCs on the trunk, upper arm, and upper leg were similar, but were significantly different from those found on the lower leg and forearm. Two distinct groups were formed--proximal and distal. There were 77.0 MCs/mm2 at proximal body sites and 108.2 MCs/mm2 at distal sites. Adjusted for the adjacent diagnosis and age, this difference was consistent. The numbers of MCs in uninvolved skin adjacent to basal cell carcinomas and other dermatological disorders were not different from those in the control group. Differences in the numbers of MCs between the distal and the proximal body sites must be considered when MCs are counted for a reliable diagnosis of mastocytosis. A pilot study in patients with mastocytosis underlined the variation in the numbers of MCs in mastocytosis and normal skin, but showed a considerable overlap. The observed numbers of MCs in adults cannot be extrapolated to children. MC numbers varied significantly between proximal and distal body sites and these differences must be considered when MCs are counted for a reliable diagnosis of mastocytosis. There was a considerable overlap between the numbers of MCs in mastocytosis and normal skin.

  6. Normal variants of skin in neonates

    Directory of Open Access Journals (Sweden)

    Kulkarni M

    1996-01-01

    Full Text Available 2221 consecutive live births taking place between March 1994 and February 1995 were evaluated for a minimum period of 5 days to note for the occurrence of various normal anatomical variants specially those of skin. Birth weight, gestational age, maternal age, socio-economic status and consanguinity were carefully recorded in all the cases. Mongolian spots (72%, Epstein pearls (43.8%, Milia (26.2% and Erythema toxicum (25.2%, were the common dermatological variants noted. Maturity of the babies and possibly genetic factors (consanguinity are important factors in their causation as ordered in our study.

  7. Can the Hydroxyapatite-Coated Skin-Penetrating Abutment for Bone Conduction Hearing Implants Integrate with the Surrounding Skin?

    Science.gov (United States)

    van Hoof, Marc; Wigren, Stina; Duimel, Hans; Savelkoul, Paul H M; Flynn, Mark; Stokroos, Robert Jan

    2015-01-01

    Percutaneous implants, such as bone conduction hearing implants, suffer from complications that include inflammation of the surrounding skin. A sealed skin-abutment interface can prevent the ingress of bacteria, which should reduce the occurrence of peri-abutment dermatitis. It was hypothesized that a hydroxyapatite (HA)-coated abutment in conjunction with soft tissue preservation surgery should enable integration with the adjacent skin. Previous research has confirmed that integration is never achieved with as-machined titanium abutments. Here, we investigate, in vivo, if skin integration is achievable in patients using a HA-coated abutment. One titanium abutment (control) and one HA-coated abutment (case) together with the surrounding skin were surgically retrieved from two patients who had a medical indication for this procedure. Histological sections of the skin were investigated using light microscopy. The abutment was qualitatively analyzed using scanning electron microscopy. The titanium abutment only had a partial and thin layer of attached amorphous biological material. The HA-coated abutment was almost fully covered by a pronounced thick layer of organized skin, composed of different interconnected structural layers. Proof-of-principle evidence that the HA-coated abutment can achieve integration with the surrounding skin was presented for the first time.

  8. Skin hydration, microrelief and greasiness of normal skin in Antarctica.

    Science.gov (United States)

    Tsankov, N; Mateev, D; Darlenski, R

    2018-03-01

    The skin is the primary defence of the human body against external factors from physical, chemical, mechanical and biologic origin. Climatic factors together with low temperature and sun radiation affect the skin. The effect of climatic conditions in Antarctica on healthy skin has not been previously addressed. The aim of this study was to evaluate the changes in the skin hydration, greasiness and microrelief due to the extreme climatic environmental factors during the stay of the members of the Bulgarian Antarctic expedition. Fifty-nine Caucasian healthy subjects, 42 men and 17 women with mean age 50.9 years (27-68), were enrolled. The study was performed in five consecutive years from 2011 to 2016 at the Bulgarian Antarctic base camp at Livingston Island. The study protocol consisted of two parts: study A: duration of 15 days with measurement of skin physiology parameters on a daily basis, and study B: five measurements at baseline and at days 14, 30, 45 and 50 upon arrival in Antarctica. We measured three biophysical parameters related to skin physiology at cheek skin by an impedance measuring device. No statistically significant difference between parameters at the different measurement points. There is a variation in skin hydration reaching its lower point at day 11 and then returning to values similar to baseline. Initially, an increase in skin greasiness was witnessed with a sharp depression at day 11 and final values at day 15 resembling the ones at baseline. An increase, although not statistically significant, in skin roughness was observed in the first 15 days of the study. Study B showed no statistically significant variances between values of the three parameters. Our studies show the pioneer results of the effect of Antarctic climate on human skin physiology. © 2017 European Academy of Dermatology and Venereology.

  9. The skin immune system (SIS): distribution and immunophenotype of lymphocyte subpopulations in normal human skin

    NARCIS (Netherlands)

    Bos, J. D.; Zonneveld, I.; Das, P. K.; Krieg, S. R.; van der Loos, C. M.; Kapsenberg, M. L.

    1987-01-01

    The complexity of immune response-associated cells present in normal human skin was recently redefined as the skin immune system (SIS). In the present study, the exact immunophenotypes of lymphocyte subpopulations with their localizations in normal human skin were determined quantitatively. B cells

  10. Clinical and histological effects of blue light on normal skin.

    NARCIS (Netherlands)

    Kleinpenning, M.M.; Smits, T.; Frunt, M.H.A.; Erp, P.E.J. van; Kerkhof, P.C.M. van de; Gerritsen, R.M.

    2010-01-01

    INTRODUCTION: Phototherapy with visible light is gaining interest in dermatological practice. Theoretically, blue light could induce biological effects comparable to ultraviolet A (UVA) radiation. OBJECTIVES: To study the effects of blue light on normal skin in terms of photodamage, skin ageing and

  11. Reproducible pattern of microRNA in normal human skin

    DEFF Research Database (Denmark)

    Holst, Line; Kaczkowski, Bogumil; Gniadecki, Robert

    2010-01-01

    RNA expression pattern in normal human skin. Here we investigated miRNA expression profiles from skin biopsies of 8 healthy volunteers taken from sun protected and mildly photo damaged skin using the modified protocol for miRNA extraction. We were able to show a constant pattern of miRNA expression between......MicroRNAs (miRNAs) regulate cell growth, differentiation and apoptosis via specific targeting of messenger RNA (mRNA). Aberrant mRNA expression contributes to pathological processes such as carcinogenesis. To take advantage of miRNA profiling in skin disease it is essential to investigate mi...... different individuals. We did not find any significant differences in miRNA expression between sun protected and mildly photodamaged skin. These results may be valuable for future design of studies on miRNA expression in skin disease....

  12. Reproducible pattern of microRNA in normal human skin

    DEFF Research Database (Denmark)

    Holst, Line; Kaczkowski, Bogumil; Gniadecki, Robert

    2010-01-01

    RNA expression pattern in normal human skin. Here we investigated miRNA expression profiles from skin biopsies of 8 healthy volunteers taken from sun protected and mildly photo damaged skin using the modified protocol for miRNA extraction. We were able to show a constant pattern of miRNA expression between...... different individuals. We did not find any significant differences in miRNA expression between sun protected and mildly photodamaged skin. These results may be valuable for future design of studies on miRNA expression in skin disease.......MicroRNAs (miRNAs) regulate cell growth, differentiation and apoptosis via specific targeting of messenger RNA (mRNA). Aberrant mRNA expression contributes to pathological processes such as carcinogenesis. To take advantage of miRNA profiling in skin disease it is essential to investigate mi...

  13. Estrogen Receptor and Progesterone Receptor Expression in Normal Terminal Duct Lobular Units Surrounding Invasive Breast Cancer

    Science.gov (United States)

    Yang, Xiaohong R.; Figueroa, Jonine D.; Hewitt, Stephen M.; Falk, Roni T.; Pfeiffer, Ruth M.; Lissowska, Jolanta; Peplonska, Beata; Brinton, Louise A.; Garcia-Closas, Montserrat; Sherman, Mark E.

    2014-01-01

    Introduction Molecular and morphological alterations related to carcinogenesis have been found in terminal duct lobular units (TDLUs), the microscopic structures from which most breast cancer precursors and cancers develop, and therefore, analysis of these structures may reveal early changes in breast carcinogenesis and etiologic heterogeneity. Accordingly, we evaluated relationships of breast cancer risk factors and tumor pathology to estrogen receptor (ER) and progesterone receptor (PR) expression in TDLUs surrounding breast cancers. Methods We analyzed 270 breast cancer cases included in a population-based breast cancer case-control study conducted in Poland. TDLUs were mapped in relation to breast cancer: within the same block as the tumor (TDLU-T), proximal to tumor (TDLU-PT), or distant from (TDLU-DT). ER/PR was quantitated using image analysis of immunohistochemically stained TDLUs prepared as tissue microarrays. Results In surgical specimens containing ER-positive breast cancers, ER and PR levels were significantly higher in breast cancer cells than in normal TDLUs, and higher in TDLU-T than in TDLU-DT or TDLU-PT, which showed similar results. Analyses combining DT-/PT TDLUs within subjects demonstrated that ER levels were significantly lower in premenopausal women vs. postmenopausal women (odds ratio [OR]=0.38, 95% confidence interval [CI]=0.19, 0.76, P=0.0064) and among recent or current menopausal hormone therapy users compared with never users (OR=0.14, 95% CI=0.046–0.43, Ptrend=0.0006). Compared with premenopausal women, TDLUs of postmenopausal women showed lower levels of PR (OR=0.90, 95% CI=0.83–0.97, Ptrend=0.007). ER and PR expression in TDLUs was associated with epidermal growth factor receptor (EGFR) expression in invasive tumors (P=0.019 for ER and P=0.03 for PR), but not with other tumor features. Conclusions Our data suggest that TDLUs near breast cancers reflect field effects, whereas those at a distance demonstrate influences of breast

  14. Skin flora: Differences between people affected by Albinism and those with normally pigmented skin in Northern Tanzania - cross sectional study.

    Science.gov (United States)

    Kiprono, Samson K; Masenga, John E; Chaula, Baraka M; Naafs, Bernard

    2012-07-30

    Skin flora varies from one site of the body to another. Individual's health, age and gender determine the type and the density of skin flora. A 1  cm² of the skin on the sternum was rubbed with sterile cotton swab socked in 0.9% normal saline and plated on blood agar. This was cultured at 35 °C. The bacteria were identified by culturing on MacConkey agar, coagulase test, catalase test and gram staining. Swabs were obtained from 66 individuals affected by albinism and 31 individuals with normal skin pigmentation. Those with normal skin were either relatives or staying with the individuals affected by albinism who were recruited for the study. The mean age of the 97 recruited individuals was 30.6 (SD ± 14.9) years. The mean of the colony forming units was 1580.5 per cm2. Those affected by albinism had a significantly higher mean colony forming units (1680  CFU per cm²) as compared with 453.5  CFU per cm² in those with normally pigmented skin (p = 0.023). The skin type and the severity of sun- damaged skin was significantly associated with a higher number of colony forming units (p = 0.038). Individuals affected by albinism have a higher number of colony forming units which is associated with sun- damaged skin.

  15. Histopathology of normal skin and melanomas after nanosecond pulsed electric field treatment

    Science.gov (United States)

    Chen, Xinhua; Swanson, R. James; Kolb, Juergen F.; Nuccitelli, Richard; Schoenbach, Karl H.

    2011-01-01

    Nanosecond pulsed electric fields (nsPEFs) can affect the intracellular structures of cells in vitro. This study shows the direct effects of nsPEFs on tumor growth, tumor volume, and histological characteristics of normal skin and B16-F10 melanoma in SKH-1 mice. A melanoma model was set up by injecting B16-F10 into female SKH-1 mice. After a 100-pulse treatment with an nsPEF (40-kV/cm field strength; 300-ns duration; 30-ns rise time; 2-Hz repetition rate), tumor growth and histology were studied using transillumination, light microscopy with hematoxylin and eosin stain and transmission electron microscopy. Melanin and iron within the melanoma tumor were also detected with specific stains. After nsPEF treatment, tumor development was inhibited with decreased volumes post-nsPEF treatment compared with control tumors (Pelectric fields surrounding the needle electrodes. PMID:19730404

  16. Direct immunofluorescence of normal skin in rheumatoid arthritis.

    Science.gov (United States)

    Fitzgerald, O M; Barnes, L; Woods, R; McHugh, L; Barry, C; O'Loughlin, S

    1985-11-01

    The clinical significance of previously described immunoglobulin and complement deposition in the superficial dermal vessel walls of patients with rheumatoid arthritis is unknown. In the present study, skin biopsies were obtained from the normal forearm and buttock of 48 unselected patients with rheumatoid arthritis and were examined by direct immunofluorescence (IF) for the presence of immunoglobulin (IgG,A,M) and complement (C3) in the vessel walls. Deposits of C3, IgM or IgG were detected in 10 patients. Five patients had deposits at the forearm sample alone, four patients had deposits at both biopsy sites, while one patient was positive at the buttock alone. Clinical features were similar in patients with and without vessel IF. However, patients with IF were significantly more seropositive with lower levels of complement and raised levels of serum IgA and IgM. There was also an increased level of circulating IgG immune complexes in these patients. Further analysis following exclusion of seronegative patients revealed similar results. This study suggests that the presence of vessel IF identifies a subgroup of patients who have evidence of more severe immunological disturbance.

  17. Muscle biopsies off-set normal cellular signaling in surrounding musculature

    DEFF Research Database (Denmark)

    Krag, Thomas O; Hauerslev, Simon; Dahlqvist, Julia R

    2013-01-01

    muscle tissue for at least 3 weeks after the biopsy was performed and magnetic resonance imaging suggests that an effect of a biopsy may persist for at least 5 months. Cellular signaling after a biopsy resembles what is seen in severe limb-girdle muscular dystrophy type 2I with respect to protein......Studies of muscle physiology and muscular disorders often require muscle biopsies to answer questions about muscle biology. In this context, we have often wondered if muscle biopsies, especially if performed repeatedly, would affect interpretation of muscle morphology and cellular signaling. We...... hypothesized that muscle morphology and cellular signaling involved in myogenesis/regeneration and protein turnover can be changed by a previous muscle biopsy in close proximity to the area under investigation. Here we report a case where a past biopsy or biopsies affect cellular signaling of the surrounding...

  18. Normal tissue tolerance to external beam radiation therapy: Skin

    International Nuclear Information System (INIS)

    Ginot, A.; Doyen, J.; Hannoun-Levi, J.M.; Courdi, A.

    2010-01-01

    Acute skin toxicity is frequent during radiation therapy and can lead to temporary arrest of the treatment. Chronic toxicity can occur and conduct to cosmetic problems. Alopecia is the most frequent toxicity concerning hair and is most of the time reversible. Several factors linked to patients influence skin toxicity, such as under-nutrition, old age, obesity, smoking, skin diseases, autoimmune diseases, failure of DNA reparation. Skin, hair and nail toxicities depend also on radiation schedule. Acute toxicity is greater when dose per fraction increases. Chronic and acute toxicities are more often when total dose increases. Under 45 Gy, the risk of severe skin toxicity is low, and begins above 50 Gy. Skin toxicity depends also on the duration of radiotherapy and split course schedules are associated with less toxicities. Irradiation surface seems to influence skin toxicity but interaction is more complex. Reirradiation is often feasible in case of cancer recurrence but with a risk of grade 3-4 toxicity above all in head and neck cancer. The benefit/risk ratio has to be always precisely evaluated. Permanent alopecia is correlated with the follicle dose. Modern techniques of radiation therapy allow to spare skin. (authors)

  19. Morphology and epidermal thickness of normal skin imaged by optical coherence tomography

    DEFF Research Database (Denmark)

    Mogensen, Mette; Morsy, Hanan A.; Thrane, Lars

    2008-01-01

    colour. Methods: OCT imaging is based on infrared light reflection/backscatter from tissue. PS-OCT detects birefringence of tissue. Imaging was performed in 12 skin regions. ET was calculated from the OCT images. Results: Normal skin has a layered structure. Layering is less pronounced in adults......Background: Optical coherence tomography (OCT) is an optical imaging technology with a potential in the non-invasive diagnosis of skin cancer. To identify skin pathologies using OCT, it is of prime importance to establish baseline morphological features of normal skin. Aims: The aim of this study...... is to describe normal skin morphology using OCT and polarization-sensitive OCT (PS-OCT), which is a way of representing birefringent tissue such as collagen in OCT images. Anatomical locations in 20 healthy volunteers were imaged, and epidermal thickness (ET) was measured and compared to age, gender and skin...

  20. Effect of friction on vibrotactile sensation of normal and dehydrated skin.

    Science.gov (United States)

    Chen, S; Ge, S; Tang, W; Zhang, J

    2016-02-01

    Vibrotactile sensation mediated is highly dependent on surface mechanical and frictional properties. Dehydration of skin could change these properties. To investigate the relationship between friction and vibrotactile sensation of normal and dehydrated skin. Vibrations were firstly measured during surface exploration using a biomimetic sensor. Piglet skin was used as human skin model to study frictional properties for both normal and dehydrated skin using an atomic force microscope on nanoscale and a pin-on-disk tribometer on macroscale. Effect of vibrational frequency on friction and vibrotactile perception was also observed on nano and macro scale for normal and dehydrated skin. The result indicated that dehydrated skin was less sensitive than normal skin. The coefficient of friction of dehydrated skin is smaller than that of normal skin on both nano and macro scale. The coefficient of friction increases as increasing scanning frequencies. There is a positive correlation between coefficient of friction and vibrotactile sensation on nanoscale and macroscale. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Epidermal stem cells - role in normal, wounded and pathological psoriatic and cancer skin

    DEFF Research Database (Denmark)

    Kamstrup, M.; Faurschou, A.; Gniadecki, R.

    2008-01-01

    In this review we focus on epidermal stem cells in the normal regeneration of the skin as well as in wounded and psoriatic skin. Furthermore, we discuss current data supporting the idea of cancer stem cells in the pathogenesis of skin carcinoma and malignant melanoma. Epidermal stem cells present...... or transit amplifying cells constitute a primary pathogenetic factor in the epidermal hyperproliferation seen in psoriasis. In cutaneous malignancies mounting evidence supports a stem cell origin in skin carcinoma and malignant melanoma and a possible existence of cancer stem cells Udgivelsesdato: 2008/5...

  2. Reflectance spectrometry of normal and bruised human skins: experiments and modeling

    International Nuclear Information System (INIS)

    Kim, Oleg; Alber, Mark; McMurdy, John; Lines, Collin; Crawford, Gregory; Duffy, Susan

    2012-01-01

    A stochastic photon transport model in multilayer skin tissue combined with reflectance spectroscopy measurements is used to study normal and bruised skins. The model is shown to provide a very good approximation to both normal and bruised real skin tissues by comparing experimental and simulated reflectance spectra. The sensitivity analysis of the skin reflectance spectrum to variations of skin layer thicknesses, blood oxygenation parameter and concentrations of main chromophores is performed to optimize model parameters. The reflectance spectrum of a developed bruise in a healthy adult is simulated, and the concentrations of bilirubin, blood volume fraction and blood oxygenation parameter are determined for different times as the bruise progresses. It is shown that bilirubin and blood volume fraction reach their peak values at 80 and 55 h after contusion, respectively, and the oxygenation parameter is lower than its normal value during 80 h after contusion occurred. The obtained time correlations of chromophore concentrations in developing contusions are shown to be consistent with previous studies. The developed model uses a detailed seven-layer skin approximation for contusion and allows one to obtain more biologically relevant results than those obtained with previous models using one- to three-layer skin approximations. A combination of modeling with spectroscopy measurements provides a new tool for detailed biomedical studies of human skin tissue and for age determination of contusions. (paper)

  3. The effect of a daily facial cleanser for normal to oily skin on the skin barrier of subjects with acne.

    Science.gov (United States)

    Draelos, Zoe D

    2006-07-01

    Acne vulgaris is a common skin disorder that affects many people every year, especially the teenaged population. People with acne find the condition especially difficult to manage because of the disease's chronicity and variability in response to treatment. Acne is the result of pores clogged with shed skin cells combined with sebum in the hair follicle. Successful treatment of acne is important because acne has the potential to result in lasting physical and emotional scarring. For many years, physicians have agreed that although cleansing is not effective on its own, effective cleansing is an important part of any acne treatment regimen. However, patients have not been satisfied with the types of cleansers available. In addition to containing dyes and perfumes that can irritate and exacerbate acne, these cleansers often are too harsh and can result in excessive drying of the skin, which leads to overcompensation by the oil glands and ultimately to more oil on the surface of the skin. This study examined the use of a daily facial cleanser formulated for normal to oily skin in subjects with mild facial acne. The cleanser was studied for 2 weeks in the absence of additional treatments to eliminate the confounding effects of various treatments. Subjects were monitored for skin barrier function through transepidermal water loss (TEWL) and corneometry, sebum level, and lesion counts. The results of the study indicate that the facial cleanser is gentle and does not damage the skin barrier or result in sebum overcompensation; additionally, the cleanser is effective at deep-pore cleansing, which may help to manage some acne-associated symptoms.

  4. Skin perfusion measurement: the normal range, the effects of ambient temperature and its clinical application

    International Nuclear Information System (INIS)

    Henry, R.E.; Malone, J.M.; Daly, M.J.; Hughes, J.H.; Moore, W.S.

    1982-01-01

    Quantitation of skin perfusion provides objective criteria to determine the optimal amputation level in ischemic limb disease, to assess the maturation of pedicle flaps in reconstructive surgery, and to select appropriate treatment for chronic skin ulcers. A technique for measurement of skin perfusion using intradermal (ID) Xe-133 and a gamma camera/minicomputer system was previously reported. An update of this procedure is now reported, the normal range for the lower extremity in men, observations on the effects of ambient temperature, and an experience using the procedure to determine amputation level

  5. Analysis of vegetation recovery surrounding a restored wetland using the normalized difference infrared index (NDII) and normalized difference vegetation index (NDVI)

    Science.gov (United States)

    Wilson, Natalie R.; Norman, Laura

    2018-01-01

    Watershed restoration efforts seek to rejuvenate vegetation, biological diversity, and land productivity at Cienega San Bernardino, an important wetland in southeastern Arizona and northern Sonora, Mexico. Rock detention and earthen berm structures were built on the Cienega San Bernardino over the course of four decades, beginning in 1984 and continuing to the present. Previous research findings show that restoration supports and even increases vegetation health despite ongoing drought conditions in this arid watershed. However, the extent of restoration impacts is still unknown despite qualitative observations of improvement in surrounding vegetation amount and vigor. We analyzed spatial and temporal trends in vegetation greenness and soil moisture by applying the normalized difference vegetation index (NDVI) and normalized difference infrared index (NDII) to one dry summer season Landsat path/row from 1984 to 2016. The study area was divided into zones and spectral data for each zone was analyzed and compared with precipitation record using statistical measures including linear regression, Mann– Kendall test, and linear correlation. NDVI and NDII performed differently due to the presence of continued grazing and the effects of grazing on canopy cover; NDVI was better able to track changes in vegetation in areas without grazing while NDII was better at tracking changes in areas with continued grazing. Restoration impacts display higher greenness and vegetation water content levels, greater increases in greenness and water content through time, and a decoupling of vegetation greenness and water content from spring precipitation when compared to control sites in nearby tributary and upland areas. Our results confirm the potential of erosion control structures to affect areas up to 5 km downstream of restoration sites over time and to affect 1 km upstream of the sites.

  6. Influence of water and salt solutions on UVB irradiation of normal skin and psoriasis

    International Nuclear Information System (INIS)

    Boer, J.; Schothorst, A.A.; Boom, B.; Suurmond, D.; Hermans, J.

    1982-01-01

    The influence of tap-water (TW) and salt solutions on the minimal erythema dose (MED) was investigated for normal human skin and uninvolved skin of psoriasis patients. MED (UVB) determinations on the forearm revealed that: (1) the MED definitely decreases whenever the arm is immersed in TW or NaCl solutions with a low concentration (4%) prior to UVB exposure, whereas almost saturated NaCl solution (26%), as well as locum Dead Sea water (LDSW), do not produce a change in the MED, and (2) the decrease in MED obtained by wetting the skin with TW was no longer present when the skin was allowed to dry for 20 min. A decrease in water uptake by skin (in vivo) and by callus (in vitro) was found as the salt concentration of the external solution increased. It is proposed that water taken up by the skin plays an important role in the sensitivity of the skin to UVB exposure. Bathing in TW or 4% NaCl prior to UVB exposure offered a slight to moderate improvement in psoriasis over UVB irradiation alone. Finally, it was shown that there is no obvious difference in clearance of the psoriatic skin between a bath in TW, 4% NaCl, or LDSW prior to UVB exposure. (orig.)

  7. Mast cells are dispensable for normal and activin-promoted wound healing and skin carcinogenesis.

    Science.gov (United States)

    Antsiferova, Maria; Martin, Caroline; Huber, Marcel; Feyerabend, Thorsten B; Förster, Anja; Hartmann, Karin; Rodewald, Hans-Reimer; Hohl, Daniel; Werner, Sabine

    2013-12-15

    The growth and differentiation factor activin A is a key regulator of tissue repair, inflammation, fibrosis, and tumorigenesis. However, the cellular targets, which mediate the different activin functions, are still largely unknown. In this study, we show that activin increases the number of mature mast cells in mouse skin in vivo. To determine the relevance of this finding for wound healing and skin carcinogenesis, we mated activin transgenic mice with CreMaster mice, which are characterized by Cre recombinase-mediated mast cell eradication. Using single- and double-mutant mice, we show that loss of mast cells neither affected the stimulatory effect of overexpressed activin on granulation tissue formation and reepithelialization of skin wounds nor its protumorigenic activity in a model of chemically induced skin carcinogenesis. Furthermore, mast cell deficiency did not alter wounding-induced inflammation and new tissue formation or chemically induced angiogenesis and tumorigenesis in mice with normal activin levels. These findings reveal that mast cells are not major targets of activin during wound healing and skin cancer development and also argue against nonredundant functions of mast cells in wound healing and skin carcinogenesis in general.

  8. Mast cells and atopic dermatitis. Stereological quantification of mast cells in atopic dermatitis and normal human skin

    DEFF Research Database (Denmark)

    Damsgaard, T E; Olesen, A B; Sørensen, Flemming Brandt

    1997-01-01

    Stereological quantification of mast cell numbers was applied to sections of punch biopsies from lesional and nonlesional skin of atopic dermatitis patients and skin of healthy volunteers. We also investigated whether the method of staining and/or the fixative influenced the results...... of the determination of the mast cell profile numbers. The punch biopsies were taken from the same four locations in both atopic dermatitis patients and normal individuals. The locations were the scalp, neck and flexure of the elbow (lesional skin), and nates (nonlesional skin). Clinical scoring was carried out...... yielded the following results: (1) in atopic dermatitis lesional skin an increased number of mast cell profiles was found as compared with nonlesional skin, (2) comparing atopic dermatitis skin with normal skin, a significantly increased number of mast cell profiles per millimetre squared was found...

  9. Protoporphyrin IX formation and photobleaching in different layers of normal human skin

    DEFF Research Database (Denmark)

    Togsverd-Bo, Katrine; Idorn, Luise W; Philipsen, Peter A

    2012-01-01

    human skin was tape-stripped and incubated with 20% methylaminolevulinate (MAL) or 20% hexylaminolevulinate (HAL) for 3 h. Fluorescence microscopy quantified PpIX accumulation in epidermis, superficial, mid and deep dermis, down to 2 mm. PpIX photobleaching by light-emitting diode (LED, 632 nm, 18......Topical photodynamic therapy (PDT) is used for various skin disorders, and selective targeting of specific skin structures is desirable. The objective was to assess accumulation of PpIX fluorescence and photobleaching within skin layers using different photosensitizers and light sources. Normal...... and 37 J/cm(2)), intense pulsed light (IPL, 500-650 nm, 36 and 72 J/cm(2)) and long-pulsed dye laser (LPDL, 595 nm, 7.5 and 15 J/cm(2)) was measured using fluorescence photography and microscopy. We found higher PpIX fluorescence intensities in epidermis and superficial dermis in HAL-incubated skin than...

  10. Q-switched ruby laser irradiation of normal human skin. Histologic and ultrastructural findings.

    Science.gov (United States)

    Hruza, G J; Dover, J S; Flotte, T J; Goetschkes, M; Watanabe, S; Anderson, R R

    1991-12-01

    The Q-switched ruby laser is used for treatment of tatoos. The effects of Q-switched ruby laser pulses on sun-exposed and sun-protected human skin, as well as senile lentigines, were investigated with clinical observation, light microscopy, and transmission electron microscopy. A pinpricklike sensation occurred at radiant exposures as low as 0.2 J/cm2. Immediate erythema, delayed edema, and immediate whitening occurred with increasing radiant exposure. The threshold for immediate whitening varied inversely with skin pigmentation, ranging from a mean of 1.4 J/cm2 in lentigines to 3.1 J/cm2 in sun-protected skin. Transmission electron microscopy showed immediate alteration of mature melanosomes and nuclei within keratinocytes and melanocytes, but stage I and II melanosomes were unaffected. Histologically, immediate injury was confined to the epidermis. There was minimal inflammatory response 1 day after exposure. After 1 week, subthreshold exposures induced hyperpigmentation, with epidermal hyperplasia and increased melanin staining noted histologically. At higher radiant exposures, hypopigmentation occurred with desquamation of a pigmented scale/crust. All sites returned to normal skin color and texture without scarring within 3 to 6 months. These observations suggest that the human skin response to selective photothermolysis of pigmented cells is similar to that reported in animal models, including low radiant exposure stimulation of melanogenesis and high radiant exposure lethal injury to pigmented epidermal cells.

  11. Confocal laser-scanning microscopy of capillaries in normal and psoriatic skin

    Science.gov (United States)

    Archid, Rami; Patzelt, Alexa; Lange-Asschenfeldt, Bernhard; Ahmad, Sufian S.; Ulrich, Martina; Stockfleth, Eggert; Philipp, Sandra; Sterry, Wolfram; Lademann, Juergen

    2012-10-01

    An important and most likely active role in the pathogenesis of psoriasis has been attributed to changes in cutaneous blood vessels. The purpose of this study was to use confocal laser-scanning microscopy (CLSM) to investigate dermal capillaries in psoriatic and normal skin. The structures of the capillary loops in 5 healthy participants were compared with those in affected skin of 13 psoriasis patients. The diameters of the capillaries and papillae were measured for each group with CLSM. All investigated psoriasis patients showed elongated, widened, and tortuous microvessels in the papillary dermis, whereas all healthy controls showed a single capillary loop in each dermal papilla. The capillaries of the papillary loop and the dermal papilla were significantly enlarged in the psoriatic skin lesions (diameters 24.39±2.34 and 146.46±28.52 μm, respectively) in comparison to healthy skin (diameters 9.53±1.8 and 69.48±17.16 μm, respectively) (P<0.001). CLSM appears to represent a promising noninvasive technique for evaluating dermal capillaries in patients with psoriasis. The diameter of the vessels could be seen as a well-quantifiable indicator for the state of psoriatic skin. CLSM could be useful for therapeutic monitoring to delay possible recurrences.

  12. Incorporation of 14C-linoleic acid in lipids of normal and psoriatic human skin

    International Nuclear Information System (INIS)

    Ruestow, B.; Metz, D.; Kunze, D.; Meffert, H.

    1980-01-01

    The 14 C-linoleic acid incorporation in lipids of surviving epidermis and corium of normal and psoriatic human skin was investigated. Changes of lipid metabolism were found in both epidermis and corium. Particularly the turnover of phospholipids was increased in the uninvolved psoriatic epidermis in relation to the involved psoriatic epidermis or to healthy controls. Possible reasons of these phenomena and the significance of structural lipids in psoriasis are discussed. (author)

  13. Characterization of Ninjurin and TSC22 induction after X-irradiation of normal human skin cells

    International Nuclear Information System (INIS)

    Koike, Manabu; Ninomiya, Yasuharu; Koike, Aki

    2008-01-01

    The skin is an external organ that is most frequently exposed to radiation. It is important to elucidate the influence of radiation exposure on the skin at the molecular level. To identify radiation-responsive genes in human skin cells, we used microarray technology to examine the effects of irradiation on 641 genes in normal human epidermal keratinocytes at 4 h and 8 h postirradiation with a cytotoxic dose of X-ray (10 Gy). We found that 18 genes were upregulated and 35 genes were downregulated in keratinocytes at 4 h and/or 8 h postirradiation. Ninjurin, whose function remains unknown in keratinocytes, was induced most strongly by X-irradiation. Several known apoptosis-related genes, such as TSC22, were also upregulated. We characterized Ninjurin and TSC22 induction after X-irradiation of normal human skin cells. The induction of the expression of Ninjurin and TSC22 mRNA in keratinocytes following high-dose X-irradiation was confirmed by northern blot analysis. In dermal fibroblasts, Ninjurin, but not TSC22, was induced after X-ray irradiation. The dependence of both gene expression on the status of an apoptosis regulator, p53, was found. In addition, the expression of both mRNA was induced upon treatment with an apoptosis inducer, etoposide. On the other hand, TSC22, but not Ninjurin, was induced and accumulated in keratinocytes upon treatment with an apoptosis inducer, anisomycin. However, in transient expression assay, EYFP-TSC22, as well as EYFP-Ninjurin or EYFP alone, did not induce apoptosis in keratinocytes in contrast to EYFP-GADD45. Taken together, these findings have important implications on the understanding of the mechanism underlying the complex response of skin cells following X-irradiation. (author)

  14. Experiment K-7-29: Connective Tissue Studies. Part 1; Rat Skin, Normal and Repair

    Science.gov (United States)

    Vailas, A. C.; Grindeland, R.; Ashman, R.; Choy, V.; Durnova, G.; Graf, B.; Griffith, P.; Kaplansky, A. S.; Kolis, S.; Martinez, D.; hide

    1994-01-01

    The skin repair studies started to be problematic for the following reasons: (1) It was very difficult to locate the wound and many lesions were not of the same dimensions. A considerable amount of time was devoted to the identification of the wound using polarized light. We understand that this experiment was added on to the overall project. Marking of the wound site and standard dimensions should be recommended for the next flight experiment. (2) The tissue was frozen, therefore thawing and fixation caused problems with some of the immunocytochemical staining for obtaining better special resolution with light microscopy image processing. Despite these problems, we were unable to detect any significant qualitative differences for the following wound markers: (1) Collagen Type 3, (2) Hematotoxylin and Eosin, and (3) Macrophage Factor 13. All protein markers were isolated from rat sources and antibodies prepared and tested for cross reactivity with other molecules at the University of Wisconsin Hybridoma Facility. However, rat skin from the non lesioned site 'normal' showed interesting biochemical results. Skin was prepared for the following measurements: (1) DNA content, (2) Collagen content by hydroxyproline, and (3) uronic acid content and estimation of ground substance. The results indicated there was a non-significant increase (10%) in the DNA concentration of skin from flight animals. However, the data expressed as a ratio DNA/Collagen estimates the cell or nuclear density that supports a given quantity of collagen showed a dramatic increase in the flight group (33%). This means flight conditions may have slowed down collagen secretion and/or increased cell proliferation in adult rat skin. Further biochemical tests are being done to determine the crosslinking of elastin which will enhance the insight to assessing changes in skin turnover.

  15. Increased expression of enhancer of Zeste Homolog 2 (EZH2) differentiates squamous cell carcinoma from normal skin and actinic keratosis.

    Science.gov (United States)

    Xie, Qiang; Wang, Hongbei; Heilman, Edward R; Walsh, Michael G; Haseeb, M A; Gupta, Raavi

    2014-01-01

    Enhancer of Zeste Homolog 2 (EZH2) is a polycomb group protein that has been shown to be involved in the progression of multiple human cancers including melanoma. The expression of EZH2 in normal skin and in pre-malignant and malignant cutaneous squamous cell carcinoma (SCC) has not been studied. We examined the expression of EZH2 in normal skin, actinic keratosis (AK), SCC in situ, well-differentiated (SCC-WD), moderately-differentiated (SCC-MD) and poorly-differentiated SCC (SCC-PD) to ascertain whether EZH2 expression differentiates these conditions. Immunohistochemical staining for EZH2 was performed on formalin-fixed paraffin-embedded biopsies and a tissue microarray containing normal skin, AK, SCC in situ, and SCC of different grades. In comparison to the normal skin, EZH2 expression in actinic keratosis was increased (p=0.03). Similarly, EZH2 expression in all of the neoplastic conditions studied (SCC in situ, SCC-WD, SCC-MD and SCC-PD) was greatly increased in comparison to both the normal skin and actinic keratosis (p≤0.001). EZH2 expression increases incrementally from normal skin to AK and further to SCC, suggesting a role for EZH2 in the progression and differentiation of SCC. EZH2 expression may be used as a diagnostic marker for differentiating SCC from AK or normal skin.

  16. Dose Distribution in Bladder and Surrounding Normal Tissues in Relation to Bladder Volume in Conformal Radiotherapy for Bladder Cancer

    International Nuclear Information System (INIS)

    Majewski, Wojciech; Wesolowska, Iwona; Urbanczyk, Hubert; Hawrylewicz, Leszek; Schwierczok, Barbara; Miszczyk, Leszek

    2009-01-01

    Purpose: To estimate bladder movements and changes in dose distribution in the bladder and surrounding tissues associated with changes in bladder filling and to estimate the internal treatment margins. Methods and Materials: A total of 16 patients with bladder cancer underwent planning computed tomography scans with 80- and 150-mL bladder volumes. The bladder displacements associated with the change in volume were measured. Each patient had treatment plans constructed for a 'partially empty' (80 mL) and a 'partially full' (150 mL) bladder. An additional plan was constructed for tumor irradiation alone. A subsequent 9 patients underwent sequential weekly computed tomography scanning during radiotherapy to verify the bladder movements and estimate the internal margins. Results: Bladder movements were mainly observed cranially, and the estimated internal margins were nonuniform and largest (>2 cm) anteriorly and cranially. The dose distribution in the bladder worsened if the bladder increased in volume: 70% of patients (11 of 16) would have had bladder underdosed to 70%, 80%, and 90% of the prescribed dose was 23%, 20%, and 15% for the rectum and 162, 144, 123 cm 3 for the intestines, respectively) than with a 'partially full' bladder (volume that received >70%, 80%, and 90% of the prescribed dose was 28%, 24%, and 18% for the rectum and 180, 158, 136 cm 3 for the intestines, respectively). The change in bladder filling during RT was significant for the dose distribution in the intestines. Tumor irradiation alone was significantly better than whole bladder irradiation in terms of organ sparing. Conclusion: The displacements of the bladder due to volume changes were mainly related to the upper wall. The internal margins should be nonuniform, with the largest margins cranially and anteriorly. The changes in bladder filling during RT could influence the dose distribution in the bladder and intestines. The dose distribution in the rectum and bowel was slightly better with

  17. Dose conversion factors of radiation doses at normal operation discharges. E. Description of geographical surroundings and critical group; Dosomraekningsfaktorer foer normaldriftutslaepp. E. Omraadesbeskrivningar och kritisk grupp

    Energy Technology Data Exchange (ETDEWEB)

    Hallberg, Bengt

    2001-10-01

    A study was performed in order to develop and supplement existing models for calculating radiation doses from discharges of radionuclides under normal operating conditions at the Swedish NPPs at Barsebaeck, Forsmark, Oskarshamn and Ringhals, and at the nuclear plants at Studsvik and the Westinghouse Atom fuel plant. A general description of the surroundings of each plant is given in this report, together with an inventory of agricultural activities, forestry, areas for leisure activities etc. The conditions of the critical group has been selected based on the description of the surroundings and the modeling of dispersion in the atmosphere and fallout on the ground. In contrast to earlier models where fictive critical groups were used, the present model is based on factual circumstances.

  18. Survival of human diploid skin fibroblasts from normal individuals after X-irradiation

    International Nuclear Information System (INIS)

    Little, J.B.; Nove, J.; Strong, L.C.; Nichols, W.W.

    1988-01-01

    The cytotoxic effect of X-rays was measured by a colony formation assay in multiple experiments with fibroblast cell strains derived from 24 presumably normal individuals, received as 65 different coded and blinded samples. Each strain was received on two or more occasions at different times and bearing different codes. The means and standard deviations of the survival curve parameters for the 24 strains were: D 0 = 123 +- 23; D 10 = 273 +- 42 cGy. The D 0 ranged from 89 to 175 and the D 10 from 196 to 372 cGy. The degree of interexperimental variation, though generally minimal, differed considerably among cell strains. There was no systematic effect of passage level, cloning efficiency, serum lot, age or sex of the donor on X-ray survival. These results confirm that the intrinsic radiosensitivity varies significantly among skin fibroblasts isolated from clinically normal individuals, apparently owing to as yet unidentified genetic factors. (Author)

  19. Elemental concentration in normal skin and fibroepithelial polip lesions by synchrotron radiation total reflection X-ray fluorescence technique

    International Nuclear Information System (INIS)

    Soares, Julio C.A.C.R.; Canellas, Catarine G.L.; Lopes, Ricardo T.; Anjos, Marcelino J.

    2011-01-01

    In this work, the concentrations of trace elements were measured in acrochordon, a skin lesion also known as skin tag or fibroepithelial polyp, as well as in normal skin from the same patient. The samples were analysed by Synchrotron Radiation Total Reflection X- ray Fluorescence (SRTXRF) in the Synchrotron Light National Laboratory (LNLS) in Campinas/Sao Paulo-Brazil. The collection of lesion and healthy skin samples, including papillary dermis and epidermis, has involved 17 patients. It was evaluated the presence of P, S, Cl, K, Ca, Cr, Mn, Fe, Cu, Zn, Br and Rb in the paired samples, which were compared, and significant differences were found in some of them. (author)

  20. Fibroblast radiosensitivity versus acute and late normal skin responses in patients treated for breast cancer

    International Nuclear Information System (INIS)

    Brock, William A.; Tucker, Susan L.; Geara, Fady B.; Wike, Jennifer; Peters, Lester J.; Turesson, Ingela; Nyman, Jan

    1995-01-01

    Purpose/Objective: To determine if the radiosensitivity of normal human skin fibroblasts, measured in early passage cultures, is significantly correlated with the degree of acute or late normal skin damage in patients treated for breast cancer with radiotherapy. Methods and Materials: In the 1970s, a series of breast cancer patients was treated at the Department of Oncology in Gothenburg, Sweden with postoperative irradiation to the parasternal region. Patients were treated bilaterally using different fractionation schedules and doses to the right and left fields. Peak acute reactions were scored on a six-point scale, and skin erythema was measured by reflectance spectrophotometry. Telangiectasia was graded over time on a six-point scale. In April 1992, two small skin biopsies were obtained from 22 patients in two treatment groups (i.e., four dose-fractionation schedules) and, using either delayed or immediate plating, fibroblast radiosensitivity was measured in early passage cultures by clonogenic survival, after high and low dose-rate irradiations. Survival at 2.0 Gy (SF2) was calculated from complete survival curves. Results: To test assay reproducibility, SF2 values derived from paired biopsies of the same patient (12 cases) were compared. A reasonably good correlation (p = 0.075) was obtained for SF2s determined by high dose-rate irradiations with immediate plating, but not for delayed plating or low dose-rate treatments. The median coefficient of variation in the replicate SF2s after high dose-rate treatment and immediate plating was 13%, suggesting that the poor correlation in paired SF2 values is due to the magnitude of the uncertainty in SF2 relative to the overall spread in SF2 values between patients (CV = 28%). Individual SF2 values and averaged values from patients with data from two biopsies were compared with the acute and late clinical reactions. A significant negative correlation was found between SF2 and relative clinical response, but only when

  1. Action spectra for inactivation of normal and xeroderma pigmentosum human skin fibroblasts by ultraviolet radiations

    International Nuclear Information System (INIS)

    Keyse, S.M.; Moss, S.H.; Davies, D.J.G.

    1983-01-01

    Action spectra for UV-induced lethality as measured by colony forming ability were determined both for a normal human skin fibroblast strain (1BR) and for an excision deficient xeroderma pigmentosum strain (XP4LO) assigned to complementation group A using 7 monochromatic wavelengths in the range 254-365 nm. The relative sensitivity of the XP strain compared to the normal skin fibroblasts shows a marked decrease at wavelengths longer than 313 nm, changing from a ratio of about 20 at the shorter wavelengths to just greater than 1.0 at the longer wavelengths. The action spectra thus indicate that the influence on cell inactivation of the DNA repair defect associated with XP cells is decreased and almost reaches zero at longer UV wavelengths. This would occur, for example, if the importance of pyrimidine dimers as the lethal lesion decreased with increasing wavelength. These results are consistent with pyrimidine dimers induced in DNA being the major lethal lesion in both cell strains over the wavelength range 254-313 nm. However, it is indicated that different mechanisms of inactivation operate at wavelengths longer than 313 nm. (author)

  2. High load of Merkel cell polyomavirus DNA detected in the normal skin of Japanese patients with Merkel cell carcinoma.

    Science.gov (United States)

    Hashida, Yumiko; Nakajima, Kimiko; Nakajima, Hideki; Shiga, Takeo; Tanaka, Moe; Murakami, Masanao; Matsuzaki, Shigenobu; Naganuma, Seiji; Kuroda, Naoki; Seki, Yasutaka; Katano, Harutaka; Sano, Shigetoshi; Daibata, Masanori

    2016-09-01

    Although Merkel cell polyomavirus (MCPyV) has the potential to cause Merkel cell carcinoma (MCC), it is also found in the normal skin of healthy individuals. However, the mechanism for transformation of MCPyV to an oncogenic form is unknown. To investigate the levels of MCPyV infection in the normal skin patients with MCC compared with those in a control cohort. We studied a total of six Japanese patients with cutaneous MCC. Sun-exposed and sun-unexposed skin swabs were obtained and analyzed for MCPyV loads using quantitative real-time polymerase chain reaction. At first, we found a patient with MCC carrying an extremely high load of MCPyV DNA in normal skin. This unique case prompted us to further explore the levels of MCPyV as skin microbiota in patients with MCC. We showed that MCPyV DNA levels were significantly higher in swabs obtained from normal skin samples of six patients with MCC compared with those from 30 age-matched healthy individuals and 19 patients with other cutaneous cancers. Whereas MCPyV strains obtained from the normal skin of patients with MCC had gene sequences without structural alterations, sequences of the tumor-derived strains showed truncating mutations or deletions. Although the number of patients with MCC studied was small, our findings suggest that MCC may occur with a background of high MCPyV load in the skin, and are expected to stimulate further studies on whether such skin virome levels could be one of predictive markers for the development of MCC. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Fibroblast radiosensitivity versus acute and late normal skin responses in patients treated for breast cancer

    International Nuclear Information System (INIS)

    Brock, W.A.; Wike, J.; Tucker, S.L.

    1995-01-01

    To determine if the radiosensitivity of normal human skin fibroblasts, measured in early passage cultures, is significantly correlated with the degree of acute or late normal skin damage in patients treated for breast cancer with radiotherapy. To test assay reproducibility, SF2 values derived from paired biopsies of the same patient (12 cases) were compared. A reasonably good correlation (p = 0.075) was obtained for SF2s determined by high dose-rate irradiations with immediated plating, but not for delayed plating or low dose-rate treatments. The median coefficient of variation in the replicate SF2s after high dose-rate treatment and immediate plating was 13%, suggesting that the poor correlation in paired SF2 values is due to the magnitude of the uncertainty in SF2 relative to the overall spread in SF2 values between patients (CV = 28%). Individual SF2 values and averaged values from patients with data from two biopsies were compared with the acute and late clinical reactions. A significant negative correlation was found between SF2 and relative clinical response, but only when averaged high dose-rate SF2 values and telangiectasia scores were compared. There was no significant correlation between average SF2 values and acute responses or between individual SF2 measurements and either the acute or late clinical response. The results of this study suggest that the degree of late telangiectasia is at least partially dependent upon the intrinsic cellular radiosensitivity of normal fibroblasts, but the relationship is not clear cut. Multiple replicate assays are necessary to obtain reliable estimates of fibroblast SF2 values using current techniques. 20 refs., 3 figs., 3 tabs

  4. Expression and activity of arginase isoenzymes during normal and diabetes-impaired skin repair.

    Science.gov (United States)

    Kämpfer, Heiko; Pfeilschifter, Josef; Frank, Stefan

    2003-12-01

    Within the past years, an important role for nitric oxide (NO) in skin repair has been well defined. As NO is synthesized from L-arginine by NO synthases (NOS), the availability of L-arginine might be one rate-limiting factor of NO production at the wound site. Upon injury, arginase-1 and -2 mRNA, protein, and activity were strongly induced reaching a maximum between day 3 and day 7 postwounding. Immunohistochemistry colocalized both arginases and the inducible NOS (iNOS) at epithelial sites at the margins of the wound. Notably, diabetes-impaired skin repair in leptin-deficient mice (diabetes/diabetes, db/db; and obese/obese, ob/ob) was characterized by an abnormally elevated arginase activity in wound tissue in the absence of an expression of iNOS. Expression analyses demonstrated that arginase-1 contributed to increased arginase activities in impaired repair. Interestingly, an improved healing of chronic wound situations in leptin-supplemented ob/ob mice was strongly associated with an adjustment of the dysregulated expression of L-arginine-converting enzymes: an attenuated iNOS expression was upregulated early in repair and an augmented arginase-1 expression and activity was downregulated in the presence of markedly elevated numbers of macrophages during late repair. These data suggest a coordinated consumption of L-arginine by the NOS and arginase enzymatic pathways at the wound site as a prerequisite for a balanced NO (via iNOS) and polyamine (via arginases) synthesis that drives a normal skin repair.

  5. Influence of low-energy laser radiation on normal skin and certain tumor tissues

    Energy Technology Data Exchange (ETDEWEB)

    Pletnev, S.D.; Karpenko, O.M.

    For some years, the authors' Institute has studied the influence of various types of low-energy laser radiation on normal tissue and the growth of tumors. Radiation at 3 and 30 J/cm/sup 2/ causes an increase in biological activity of various cell elements, manifested as an increase in mitotic activity of the cells in the basal layer of the epidermis, conglomeration of chromatin in the cell nuclei and an increase in degranulation of fat cells in the process of their migration to the reticular layer. Also noted was an increase in content of fibroblastic and lymphohistocytic elements in the dermis, as well as an increase in collagenization of connective tissue. It was found that irradiation of the skin by helium-neon, cadmium-helium and nitrogen lasers before and after grafting of the cells of various tumors modifies the course of the tumor process. This effect is apparently related to the fact that systematic irradiation results in changes creating a favorable background for survival and proliferation of tumor cells in the skin tissue medium. The changes facilitate an increase in survival and growth of both pigmented and nonpigmented tumors. Low power radiation stimulates the activity of the cells or cell structures; medium power stimulates their activity; high power suppresses activity.

  6. Plasma IGF-I, INSL3, testosterone, inhibin concentrations and scrotal circumferences surrounding puberty in Japanese Black beef bulls with normal and abnormal semen.

    Science.gov (United States)

    Weerakoon, W W P N; Sakase, M; Kawate, N; Hannan, M A; Kohama, N; Tamada, H

    2018-07-01

    The relationships between semen abnormalities and peripheral concentrations of testicular and metabolic hormones in beef bulls are unclear. Here we compared plasma insulin-like growth factor I (IGF-I), insulin-like peptide 3 (INSL3), testosterone, inhibin concentrations, and scrotal circumferences surrounding puberty in Japanese Black beef bulls (n = 66) with normal or abnormal semen. We collected blood samples and measured scrotal circumferences monthly from 4 to 24 months of age. Semen was collected weekly from 12 months until at least 18 months of age. Fresh semen was evaluated for semen volume, sperm motility, concentrations, and morphological defects. The normal fresh semen was frozen by a standard method and examined for post-thaw sperm motility and fertility. Bulls were classified as having either normal post-thaw semen (n = 45) or abnormal semen (n = 21, when at least one of the above test items was abnormal for 6 months). Abnormal semen was classified into abnormal fresh or low-fertility post-thaw which evaluated for rates of transferable embryos. The abnormal fresh was categorized as having sperm morphological defects, low motility, and morphological defects plus low motility. Scrotal circumferences were smaller for the abnormal-semen group vs. the normal-semen group at 20 and 24 months (p IGF-I, INSL3, and inhibin concentrations in the abnormal-semen group were lower than those of the normal-semen group (p IGF-I; 6, 9, 11-14, 17, and 20-21 months for INSL3; 5, 8-13, 16, 17, 19, and 20 months for inhibin). The plasma testosterone concentrations were lower in the abnormal-semen bulls vs. normal-semen bulls only at 22 months (p IGF-I and inhibin concentrations for low-fertility post-thaw semen (p IGF-I, INSL3, and inhibin surrounding puberty may be associated with semen aberration in beef bulls. Notably, the combined sperm abnormality of morphological defects and low motility in fresh semen could involve lowered INSL3, whereas the low

  7. Characterization of skin friction coefficient, and relationship to stratum corneum hydration in a normal Chinese population.

    Science.gov (United States)

    Zhu, Y H; Song, S P; Luo, W; Elias, P M; Man, M Q

    2011-01-01

    Studies have demonstrated that some cutaneous biophysical properties vary with age, gender and body sites. However, the characteristics of the skin friction coefficient in different genders and age groups have not yet been well established. In the present study, we assess the skin friction coefficient in a larger Chinese population. A total of 633 subjects (300 males and 333 females) aged 0.15-79 years were enrolled. A Frictiometer FR 770 and Corneometer CM 825 (C&K MPA 5) were used to measure the skin friction coefficient and stratum corneum hydration, respectively, on the dorsal surface of the hand, the forehead and the canthus. In the females, the maximum skin friction coefficients on both the canthus and the dorsal hand skin were observed around the age of 40 years. In the males, the skin friction coefficient on the dorsal hand skin gradually increased from 0 to 40 years of age, and changed little afterward. Skin friction coefficients on some body sites were higher in females than in age-matched males in some age groups. On the canthus and the dorsal hand skin of females, a positive correlation was found between skin friction coefficient and stratum corneum hydration (p skin friction coefficient was positively correlated with stratum corneum hydration on the forehead and the dorsal hand skin (p skin friction coefficient varies with age, gender and body site, and positively correlates with stratum corneum hydration on some body sites. Copyright © 2010 S. Karger AG, Basel.

  8. Genetic deletion of amphiregulin restores the normal skin phenotype in a mouse model of the human skin disease tylosis

    Directory of Open Access Journals (Sweden)

    Vishnu Hosur

    2017-08-01

    Full Text Available In humans, gain-of-function (GOF mutations in RHBDF2 cause the skin disease tylosis. We generated a mouse model of human tylosis and show that GOF mutations in RHBDF2 cause tylosis by enhancing the amount of amphiregulin (AREG secretion. Furthermore, we show that genetic disruption of AREG ameliorates skin pathology in mice carrying the human tylosis disease mutation. Collectively, our data suggest that RHBDF2 plays a critical role in regulating EGFR signaling and its downstream events, including development of tylosis, by facilitating enhanced secretion of AREG. Thus, targeting AREG could have therapeutic benefit in the treatment of tylosis.

  9. Mast cells and atopic dermatitis. Stereological quantification of mast cells in atopic dermatitis and normal human skin

    DEFF Research Database (Denmark)

    Damsgaard, T E; Olesen, A B; Sørensen, Flemming Brandt

    1997-01-01

    Stereological quantification of mast cell numbers was applied to sections of punch biopsies from lesional and nonlesional skin of atopic dermatitis patients and skin of healthy volunteers. We also investigated whether the method of staining and/or the fixative influenced the results...... of the determination of the mast cell profile numbers. The punch biopsies were taken from the same four locations in both atopic dermatitis patients and normal individuals. The locations were the scalp, neck and flexure of the elbow (lesional skin), and nates (nonlesional skin). Clinical scoring was carried out...... at the site of each biopsy. After fixation and plastic embedding, the biopsies were cut into 2 microns serial sections. Ten sections, 30 microns apart, from each biopsy were examined and stained alternately with either toluidine blue or Giemsa stain and mast cell profile numbers were determined. The study...

  10. Distribution and ultrastructure of pigment cells in the skins of normal and albino adult turbot, Scophthalmus Maximus

    Institute of Scientific and Technical Information of China (English)

    GUO Huarong; HUANG Bing; QI Fei; ZHANG Shicui

    2007-01-01

    The distribution and ultrastructure of pigment cells in skins of normal and albino adult turbots were examined with transmission electron microscopy (TEM). Three types of pigment cells of melanophore, iridophore and xanthophore have been recognized in adult turbot skins. The skin color depends mainly on the amount and distribution of melanophore and iridophore, as xanthophore is quite rare. No pigment cells can be found in the epidermis of the skins. In the pigmented ocular skin of the turbot, melanophore and iridophore are usually co-localized in the dermis. This is quite different from the distribution in larvae skin. In albino and white blind skins of adult turbots, however, only iridophore monolayer still exists, while the melanophore monolayer disappears. This cytological evidence explains why the albino adult turbot, unlike its larvae, could never resume its body color no matter what environmental and nutritional conditions were provided. Endocytosis is quite active in the cellular membrane of the iridophore. This might be related to the formation of reflective platelet and stability of the iridophore.

  11. The examination of biophysical parameters of skin (transepidermal water loss, skin hydration and pH value) in different body regions of normal cats of both sexes.

    Science.gov (United States)

    Szczepanik, Marcin P; Wilkołek, Piotr M; Adamek, Lukasz R; Pomorski, Zbigniew J H

    2011-04-01

    The purpose of this study was to evaluate transepidermal water loss (TEWL), skin hydration and skin pH in normal cats. Twenty shorthaired European cats of both sexes were examined in the study. Measurements were taken from five different sites: the lumbar region, the axillary fossa, the inguinal region, the ventral abdominal region and the left thoracic region. In each of the regions, TEWL, skin hydration and skin pH were measured. The highest TEWL value was observed in the axillary fossa (18.22g/h/m(2)) and the lowest in the lumbar region (10.53g/h/m(2)). The highest skin hydration was found in the inguinal region (18.29CU) and the lowest in the lumbar region (4.62CU). The highest skin pH was observed in the inguinal region (6.64) and the lowest in the lumbar region (6.39). Statistically significant differences in TEWL were observed between the lumbar region and the left side of the thorax region (P=0.016), the axillary fossa (P=0.0004), the ventral region (P=0.005), and the inguinal region (P=0.009). There were significant differences in skin hydration between the lumbar region and the left thorax (P=0.000003), the axillary fossa (P=0.002), the ventral abdomen (P=0.03), and the inguinal region (P=0.0003) as well as between the thorax and the ventral abdomen (P=0.005). TEWL was higher in females (15g/h/m(2)) than in males (4.57g/h/m(2)). Skin hydration was higher in females (13.89CU) than in males (12.28CU). Significant differences were not found between males and females for TEWL and skin hydration. Skin pH was higher in males (6.94) than in females (6.54), which was significant (P=0.004). Crown Copyright © 2010. Published by Elsevier Ltd. All rights reserved.

  12. Potentially lethal damage repair in cell lines of radioresistant human tumours and normal skin fibroblasts

    International Nuclear Information System (INIS)

    Marchese, M.J.; Minarik, L.; Hall, E.J.; Zaider, M.

    1985-01-01

    Radiation cell survival data were obtained in vitro for three cell lines isolated from human tumours traditionally considered to be radioresistant-two melanomas and one osteosarcoma-as well as from a diploid skin fibroblast cell line. One melanoma cell line was much more radioresistant than the other, while the osteosarcoma and fibroblast cell lines were more radiosensitive than either. For cells growing exponentially, little potentially lethal damage repair (PLDR) could be demonstrated by comparing survival data for cells in which subculture was delayed by 6 h with those sub-cultured immediately after treatment. For the malignant cells in plateau phase, which in these cells might be better termed 'slowed growth phase', since an appreciable fraction of the cells are still cycling, a small amount of PLDR was observed, but not as much as reported by other investigators in the literature. The normal fibroblasts, which achieved a truer plateau phase in terms of noncycling cells, showed a significantly larger amount of PLDR than the tumour cells. (author)

  13. Optical spectroscopy of radiotherapy and photodynamic therapy responses in normal rat skin shows vascular breakdown products

    Science.gov (United States)

    Teles de Andrade, Cintia; Nogueira, Marcelo S.; Kanick, Stephen C.; Marra, Kayla; Gunn, Jason; Andreozzi, Jacqueline; Samkoe, Kimberley S.; Kurachi, Cristina; Pogue, Brian W.

    2016-03-01

    Photodynamic therapy (PDT) and radiotherapy are non-systemic cancer treatment options with different mechanisms of damage. So combining these techniques has been shown to have some synergy, and can mitigate their limitations such as low PDT light penetration or radiotherapy side effects. The present study monitored the induced tissue changes after PDT, radiotherapy, and a combination protocol in normal rat skin, using an optical spectroscopy system to track the observed biophysical changes. The Wistar rats were treated with one of the protocols: PDT followed by radiotherapy, PDT, radiotherapy and radiotherapy followed by PDT. Reflectance spectra were collected in order to observe the effects of these combined therapies, especially targeting vascular response. From the reflectance, information about oxygen saturation, met-hemoglobin and bilirubin concentration, blood volume fraction (BVF) and vessel radius were extracted from model fitting of the spectra. The rats were monitored for 24 hours after treatment. Results showed that there was no significant variation in the vessel size or BVF after the treatments. However, the PDT caused a significant increase in the met-hemoglobin and bilirubin concentrations, indicating an important blood breakdown. These results may provide an important clue on how the damage establishment takes place, helping to understand the effect of the combination of those techniques in order to verify the existence of a known synergistic effect.

  14. Spectral analysis of blood perfusion in the free latissimus dorsi myocutaneous flap and in normal skin

    International Nuclear Information System (INIS)

    Liu Xudong; Zeng Bingfang; Fan Cunyi; Jiang Peizhu; Hu Xiao

    2006-01-01

    To find the properties in the oscillatory components of the cutaneous blood flow on the successful free flap, a wavelet transform was applied to the laser Doppler flowmetry (LDF) signals which were measured simultaneously on the surfaces of the free latissimus dorsi myocutaneous flap and on the adjacent intact skin of the healthy limb, of 18 patients. The frequency interval from 0.0095 to 1.6 Hz was examined and was divided into five subintervals (I: 0.0095-0.021 Hz; II: 0.021-0.052 Hz; III: 0.052-0.145 Hz; IV: 0.145-0.6 Hz and V: 0.6-1.6 Hz) corresponding to endothelial metabolic, neurogenic, myogenic, respiratory and cardiac origins. The average amplitude and total power in the frequency range 0.0095-1.6 Hz as well as within subintervals I, II, IV and V were significantly lower for signals measured on the free flap than those obtained in the healthy limb. However in interval III, they were significantly higher. The normalized spectral amplitude and power in the free flap were significantly lower in only two intervals, I and II, yet in interval III they were significantly higher; no statistical significance was observed in intervals IV and V. The distinctive finding made in this study, aside from the decrease of endothelial metabolic processes and sympathetic control, was the significant increase of myogenic activity in the free flap. It is hoped that this work will contribute towards knowledge on blood circulation in free flaps and make the monitoring by LDF more reliable

  15. A comparison study of lipid profile levels between skin tags affected people and normal population in Tehran, Iran

    Directory of Open Access Journals (Sweden)

    Abbas Rasi

    2014-01-01

    Full Text Available Background: For many years the association of skin tags and endocrynopathies has been postulated, although many reports are available but it has never been evaluated to mean normal population. Dyslipidemia is a frequent disorder among people and seemed to be necessary for screening within skin tag condition. This study is designed to find any possible association between skin tags and dyslipidemia. Materials and Methods: From April 2009 to June 2011, 168 patients enrolled the study. Among the remaining 152 patients, there were 89 females (58.5% and 63 males (%41.5. Based on the TLGS study 136 men and 220 women enrolled the control group of study. The mean age was 28.4 years. Patients trained to have normal free diet for at least 1 month then referred to the laboratory. Blood samples were taken over 12 hours fasting with 2 hours intervals. Hypertriglyceridemia was defined as plasma level ≥160 mg/dl for men and ≥130 mg/dl for women. Hypercholesterolemia pointed at its value >200 mg/dl. Normal HDL levels was defined as >39 mg/dl for men and >35 mg/dl to women. Results: Mean skin tag number was 12.6 per subject. The most frequent localizations of skin tags were neck and upper chest (mean number: 13.4, 48.9% followed by axilla (mean number: 11.6, 33% and breast (10.2, 10.1% in the patient group. The mean cholesterol level of case group was 192.2 ± 33.1 mg/dl, while it was 187.0 ± 42 mg/dl in the control group. The mean ± SD for triglyceride was 132.1 ± 69 mg/dl in comparison to 129 ± 74 in the control group. Conclusion: The study showed no significant differences between normal population and patients′ lipid profile.

  16. Normal Skin Microbiota is Altered in Pre-clinical Hidradenitis Suppurativa

    DEFF Research Database (Denmark)

    Ring, Hans Christian; Bay, Lene; Kallenbach, Klaus

    2017-01-01

    therefore hypothesized that clinically unaffected HS skin would also have an increased presence of biofilm compared with that of healthy controls. We conducted a case-control study, investigating the morphology of the axillary skin microbiota. Peptide nucleic acid – fluorescence in situ hybridization probes...... were used in combination with confocal laser scanning microscopy. Significant differences were found in both distribution and quantity of the cutaneous microbiota in clinically non-affected axillary skin of patients with HS compared with healthy controls. Surprisingly, we detected fewer bacteria...... and less biofilm in patients with HS. The reduced microbiota in patients with HS may play an important role in the early course of the disease....

  17. Site, gender and age variation in normal skin colour on the back and the forearm: tristimulus colorimeter measurements.

    Science.gov (United States)

    Fullerton, A; Serup, J

    1997-02-01

    To study whether anatomical location and age and gender of subjects had any influence on the objective skin colour measurements. Baseline colour in prone position was measured with the Minolta ChromaMeter® in the upper, middle and lower level of the upper back and on the forearm of 168 volunteers. These two sites are commonly used in skin testing. Higher basal a* and lower basal L* levels were found on the upper scapular region compared to the lower scapular region and the subscapular region. The basal b* level showed no variation relative to site. The basal a* and the basal b* levels were lower on the forearm compared to the upper back while the basal L* level was higher. Females above 65 years showed a less coloured skin with lower values as compared to those of younger age. Females were found to have a generally lower basal a* level than males both on the upper back and forearm skin. These relatively major differences and sources of variation have to be considered when planning irritancy studies where colour differences between erythema and normal skin is used.

  18. Real-time visualization of melanin granules in normal human skin using combined multiphoton and reflectance confocal microscopy.

    Science.gov (United States)

    Majdzadeh, Ali; Lee, Anthony M D; Wang, Hequn; Lui, Harvey; McLean, David I; Crawford, Richard I; Zloty, David; Zeng, Haishan

    2015-05-01

    Recent advances in biomedical optics have enabled dermal and epidermal components to be visualized at subcellular resolution and assessed noninvasively. Multiphoton microscopy (MPM) and reflectance confocal microscopy (RCM) are noninvasive imaging modalities that have demonstrated promising results in imaging skin micromorphology, and which provide complementary information regarding skin components. This study assesses whether combined MPM/RCM can visualize intracellular and extracellular melanin granules in the epidermis and dermis of normal human skin. We perform MPM and RCM imaging of in vivo and ex vivo skin in the infrared domain. The inherent three-dimensional optical sectioning capability of MPM/RCM is used to image high-contrast granular features across skin depths ranging from 50 to 90 μm. The optical images thus obtained were correlated with conventional histologic examination including melanin-specific staining of ex vivo specimens. MPM revealed highly fluorescent granular structures below the dermal-epidermal junction (DEJ) region. Histochemical staining also demonstrated melanin-containing granules that correlate well in size and location with the granular fluorescent structures observed in MPM. Furthermore, the MPM fluorescence excitation wavelength and RCM reflectance of cell culture-derived melanin were equivalent to those of the granules. This study suggests that MPM can noninvasively visualize and quantify subepidermal melanin in situ. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. Chemical peeling by SA-PEG remodels photo-damaged skin: suppressing p53 expression and normalizing keratinocyte differentiation.

    Science.gov (United States)

    Dainichi, Teruki; Amano, Satoshi; Matsunaga, Yukiko; Iriyama, Shunsuke; Hirao, Tetsuji; Hariya, Takeshi; Hibino, Toshihiko; Katagiri, Chika; Takahashi, Motoji; Ueda, Setsuko; Furue, Masutaka

    2006-02-01

    Chemical peeling with salicylic acid in polyethylene glycol vehicle (SA-PEG), which specifically acts on the stratum corneum, suppresses the development of skin tumors in UVB-irradiated hairless mice. To elucidate the mechanism through which chemical peeling with SA-PEG suppresses skin tumor development, the effects of chemical peeling on photodamaged keratinocytes and cornified envelopes (CEs) were evaluated in vivo. Among UVB-irradiated hairless mice, the structural atypia and expression of p53 protein in keratinocytes induced by UVB irradiation were intensely suppressed in the SA-PEG-treated mice 28 days after the start of weekly SA-PEG treatments when compared to that in the control UVB-irradiated mice. Incomplete expression of filaggrin and loricrin in keratinocytes from the control mice was also improved in keratinocytes from the SA-PEG-treated mice. In photo-exposed human facial skin, immature CEs were replaced with mature CEs 4 weeks after treatment with SA-PEG. Restoration of photodamaged stratum corneum by treatment with SA-PEG, which may affect remodeling of the structural environment of the keratinocytes, involved the normalization of keratinocyte differentiation and suppression of skin tumor development. These results suggest that the stratum corneum plays a protective role against carcinogenesis, and provide a novel strategy for the prevention of photo-induced skin tumors.

  20. Smart Surroundings

    NARCIS (Netherlands)

    Havinga, Paul J.M.; Jansen, P.G.; Lijding, M.E.M.; Scholten, Johan

    2004-01-01

    Ambient systems are networked embedded systems integrated with everyday environments and supporting people in their activities. These systems will create a Smart Surrounding for people to facilitate and enrich daily life and increase productivity at work. Such systems will be quite different from

  1. Distribution of erlotinib in rash and normal skin in cancer patients receiving erlotinib visualized by matrix assisted laser desorption/ionization mass spectrometry imaging.

    Science.gov (United States)

    Nishimura, Meiko; Hayashi, Mitsuhiro; Mizutani, Yu; Takenaka, Kei; Imamura, Yoshinori; Chayahara, Naoko; Toyoda, Masanori; Kiyota, Naomi; Mukohara, Toru; Aikawa, Hiroaki; Fujiwara, Yasuhiro; Hamada, Akinobu; Minami, Hironobu

    2018-04-06

    The development of skin rashes is the most common adverse event observed in cancer patients treated with epidermal growth factor receptor-tyrosine kinase inhibitors such as erlotinib. However, the pharmacological evidence has not been fully revealed. Erlotinib distribution in the rashes was more heterogeneous than that in the normal skin, and the rashes contained statistically higher concentrations of erlotinib than adjacent normal skin in the superficial skin layer (229 ± 192 vs. 120 ± 103 ions/mm 2 ; P = 0.009 in paired t -test). LC-MS/MS confirmed that the concentration of erlotinib in the skin rashes was higher than that in normal skin in the superficial skin layer (1946 ± 1258 vs. 1174 ± 662 ng/cm 3 ; P = 0.028 in paired t -test). The results of MALDI-MSI and LC-MS/MS were well correlated (coefficient of correlation 0.879, P distribution of erlotinib in the skin tissue was visualized using non-labeled MALDI-MSI. Erlotinib concentration in the superficial layer of the skin rashes was higher than that in the adjacent normal skin. We examined patients with advanced pancreatic cancer who developed skin rashes after treatment with erlotinib and gemcitabine. We biopsied both the rash and adjacent normal skin tissues, and visualized and compared the distribution of erlotinib within the skin using matrix-assisted laser desorption/ionization mass spectrometry imaging (MALDI-MSI). The tissue concentration of erlotinib was also measured by liquid chromatography-tandem mass spectrometry (LC-MS/MS) with laser microdissection.

  2. Gene expression analysis of skin grafts and cultured keratinocytes using synthetic RNA normalization reveals insights into differentiation and growth control.

    Science.gov (United States)

    Katayama, Shintaro; Skoog, Tiina; Jouhilahti, Eeva-Mari; Siitonen, H Annika; Nuutila, Kristo; Tervaniemi, Mari H; Vuola, Jyrki; Johnsson, Anna; Lönnerberg, Peter; Linnarsson, Sten; Elomaa, Outi; Kankuri, Esko; Kere, Juha

    2015-06-25

    Keratinocytes (KCs) are the most frequent cells in the epidermis, and they are often isolated and cultured in vitro to study the molecular biology of the skin. Cultured primary cells and various immortalized cells have been frequently used as skin models but their comparability to intact skin has been questioned. Moreover, when analyzing KC transcriptomes, fluctuation of polyA+ RNA content during the KCs' lifecycle has been omitted. We performed STRT RNA sequencing on 10 ng samples of total RNA from three different sample types: i) epidermal tissue (split-thickness skin grafts), ii) cultured primary KCs, and iii) HaCaT cell line. We observed significant variation in cellular polyA+ RNA content between tissue and cell culture samples of KCs. The use of synthetic RNAs and SAMstrt in normalization enabled comparison of gene expression levels in the highly heterogenous samples and facilitated discovery of differences between the tissue samples and cultured cells. The transcriptome analysis sensitively revealed genes involved in KC differentiation in skin grafts and cell cycle regulation related genes in cultured KCs and emphasized the fluctuation of transcription factors and non-coding RNAs associated to sample types. The epidermal keratinocytes derived from tissue and cell culture samples showed highly different polyA+ RNA contents. The use of SAMstrt and synthetic RNA based normalization allowed the comparison between tissue and cell culture samples and thus proved to be valuable tools for RNA-seq analysis with translational approach. Transciptomics revealed clear difference both between tissue and cell culture samples and between primary KCs and immortalized HaCaT cells.

  3. An Assessment of Normalized Difference Skin Index Robustness in Aquatic Environments

    Science.gov (United States)

    2014-03-27

    20 11 40 0. 56 0. 57 0. 58 0. 590 . 6 0. 61 0. 62 0. 63 W av el en gt h (n m ) Reflectance 0 m L 1. 07 m L 2. 14 m L 3. 21 m L 4. 28 m L 35 .7 1...thickness from water concentration profiles obtained with Raman spectroscopy”. Acta Dermato-Venereologica, 87(1):4–8, 2007. [10] Eismann, Michael T...confocal Raman spectroscopy”. Skin Research and Technology, 16(2):137–141, 2009. [35] Nunez, Abel S. “A physical model of human skin and its application

  4. Macro-environment of breast carcinoma: frequent genetic alterations in the normal appearing skins of patients with breast cancer.

    Science.gov (United States)

    Moinfar, Farid; Beham, Alfred; Friedrich, Gerhard; Deutsch, Alexander; Hrzenjak, Andelko; Luschin, Gero; Tavassoli, Fattaneh A

    2008-05-01

    Genetic abnormalities in microenvironmental tissues with subsequent alterations of reciprocal interactions between epithelial and mesenchymal cells play a key role in the breast carcinogenesis. Although a few reports have demonstrated abnormal fibroblastic functions in normal-appearing fibroblasts taken from the skins of breast cancer patients, the genetic basis of this phenomenon and its implication for carcinogenesis are unexplored. We analyzed 12 mastectomy specimens showing invasive ductal carcinomas. In each case, morphologically normal epidermis and dermis, carcinoma, normal stroma close to carcinoma, and stroma at a distant from carcinoma were microdissected. Metastatic-free lymphatic tissues from lymph nodes served as a control. Using PCR, DNA extracts were examined with 11 microsatellite markers known for a high frequency of allelic imbalances in breast cancer. Losses of heterozygosity and/or microsatellite instability were detected in 83% of the skin samples occurring either concurrently with or independently from the cancerous tissues. In 80% of these cases at least one microsatellite marker displayed loss of heterozygosity or microsatellite instability in the skin, which was absent in carcinoma. A total of 41% of samples showed alterations of certain loci observed exclusively in the carcinoma but not in the skin compartments. Our study suggests that breast cancer is not just a localized genetic disorder, but rather part of a larger field of genetic alterations/instabilities affecting multiple cell populations in the organ with various cellular elements, ultimately contributing to the manifestation of the more 'localized' carcinoma. These data indicate that more global assessment of tumor micro- and macro-environment is crucial for our understanding of breast carcinogenesis.

  5. T-cell receptor gamma delta bearing cells in normal human skin

    NARCIS (Netherlands)

    Bos, J. D.; Teunissen, M. B.; Cairo, I.; Krieg, S. R.; Kapsenberg, M. L.; Das, P. K.; Borst, J.

    1990-01-01

    T-cell antigen receptors (TCR) are divided into common alpha beta and less common gamma delta types. In the murine skin, TCR gamma delta+ cells have been reported to form the great majority of epidermal T lymphocytes. We have examined the relative contribution of TCR alpha beta+ and TCR gamma delta+

  6. Cold urticaria patients exhibit normal skin levels of functional mast cells and histamine after tolerance induction

    DEFF Research Database (Denmark)

    Kring Tannert, Line; Stahl Skov, Per; Bjerremann Jensen, Louise

    2012-01-01

    Cold urticaria is a skin condition characterized by rapid appearance of itchy wheals and occasionally angioedema in response to cold stimulation. Antihistamines do not sufficiently protect all patients from symptoms, even when used in higher than standard doses. In these patients, desensitization...

  7. Skin

    International Nuclear Information System (INIS)

    Hunter, R.D.

    1985-01-01

    Malignant disease involving the skin represents a significant work load to the general radiotherapist and can involve interesting diagnostic and therapeutic decisions. Primary skin cancer is also relatively common and there is a need to provide an efficient service in which the first treatment is successful in the majority of patients. The reward for careful attention to technique is very considerable both in terms of clinical cancer control and functional results. Squamous cell carcinoma, basal cell carcinoma, and intra-epidermal carcinoma constitute the majority of the lesions dealt with clinically, but metastatic disease, lymphomas, and malignant melanomas are also referred regularly for opinions and may require radiotherapy. The general principle of the techniques of assessment and radiotherapeutic management to be described are equally applicable to any malignant skin tumour once the decision has been made to accept it for radiotherapy. Dosage and fractionation may have to be adjusted to allow for the nature of the disease process and the intent of the treatment

  8. Research surface resistance of copper normal and abnormal skin-effects depending on the frequency of electromagnetic field

    International Nuclear Information System (INIS)

    Kutovyi, V.A.; Komir, A.I.

    2013-01-01

    The results of the frequency dependence of surface resistance of copper in diffuse and specular reflection of electrons from the conductive surface of the high-frequency resonance of the system depending on the frequency of the electromagnetic field in the normal and anomalous skin effect. Found, the surface resistance of copper is reduced by more than 10 times at the temperature of liquid helium, as compared with a surface resistivity at room temperature, at frequencies f ≤ 173 MHz, for diffuse reflection of conduction electrons from the surface of the conductive layer, and the specular reflection - at frequencies f ≤ 346 MHz

  9. Effects of the association of chemotherapy and radiotherapy on normal mouse skin

    International Nuclear Information System (INIS)

    Guigon, M.; Frindel, E.; Tubiana, M.; Hewitt, J.

    1978-01-01

    The effects of an association of chemotherapy and radiotherapy on the skin of mice were studied. The following drugs were tested; hydroxyurea, Methotrexate, and Bleomycin; they were injected at various times before irradiation. When hydroxyurea was injected 15 min before irradiation, the early and late cutaneous reactions were significantly lower than with irradiation alone. This protective effect corresponds to about 500 rad for an irradiation dose of 2500 rad. In the other protocols, we observed either no increase of the effect as a result of adjuvant chemotherapy (Methotrexate) or slightly increased reactions

  10. Site-Specific Differentiation of Fibroblasts in Normal and Scleroderma Skin

    National Research Council Canada - National Science Library

    Chang, Howard Y

    2008-01-01

    The results from year I of funding suggest that appropriate markers and technologies are in place for systematic investigation of the positional identity of fibroblasts both in normal and diseased tissues...

  11. Impact of overweight on the normal physiology of human in vivo skin

    Directory of Open Access Journals (Sweden)

    Liliana Tavares

    2013-06-01

    Full Text Available Obesity is an increasing public health issue, particularly in Portugal, where more than 50% of the population is obese. The pathophysiological consequences of being overweight have a severe cutaneous impact. However, there is still a lack of studies to link these alterations to BMI categories. This present work intends to identify the hydration and biomechanical behaviour changes related to weight augmentation. This transversal study was performed on a convenience sample of 57 volunteers, all females, aged between 20 and 46 (30±8 years old. Volunteers were divided in two groups – group I, with a BMI between 19,9 and 24,9 Kg/m2 and group II, between 25 and 29,9 Kg/m2. One single determination of the superficial hydration, transepidermal water loss and biomechanical behaviour of the skin, was obtained with non-invasive methods. The data showed that weight increase positively influences hydration levels and transepidermal water loss, and negatively influences the skin's biomechanical behaviour. Despite the relevance of these results, there is still a need for complementary studies, with a wider number of individuals, in order to better understand its nature and meaning.

  12. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

    Energy Technology Data Exchange (ETDEWEB)

    Yamakoshi, Takako [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Makino, Teruhiko, E-mail: tmakino@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Ur Rehman, Mati; Yoshihisa, Yoko [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Sugimori, Michiya [Department of Integrative Neuroscience, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Shimizu, Tadamichi, E-mail: shimizut@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan)

    2013-03-01

    Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes.

  13. Effect of capping agents on the cytotoxicity of silver nanoparticles in human normal and cancer skin cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Netchareonsirisuk, Ponsawan [Chulalongkorn University, Program in Biotechnology, Faculty of Science (Thailand); Puthong, Songchan [Chulalongkorn University, Antibody Production Research Unit, Institute of Biotechnology and Genetic Engineering (Thailand); Dubas, Stephan [Chulalongkorn University, Petroleum and Petrochemical College (Thailand); Palaga, Tanapat [Chulalongkorn University, Department of Microbiology, Faculty of Science (Thailand); Komolpis, Kittinan, E-mail: kittinan.k@chula.ac.th [Chulalongkorn University, Antibody Production Research Unit, Institute of Biotechnology and Genetic Engineering (Thailand)

    2016-11-15

    Silver nanoparticles (AgNPs) are among the most widely used nanomaterials in medical and consumer products. However, safety in the uses of AgNPs is still controversial. The toxicity of AgNPs toward various cell types has been reported to depend on the surface properties of the nanoparticles. In this study, the effect of AgNPs with the average size of 5–15 nm on the viability of the CCD-986SK human normal skin fibroblast cell line and A375 human malignant melanoma cell line was evaluated. Comparative toxicity studies, based on MTT assay, were performed by using either sodium alginate or poly (4-styrenesulfonic acid-co-maleic acid) sodium salt (PSSMA) as capping agent in the nanoparticle preparation. The cytotoxicity tests revealed that AgNO{sub 3} alone was highly toxic to both cell types while both alginate and PSSMA alone were not toxic. AgNPs capped with alginate were selectively toxic to the cancer cell line but not to the normal cell line while AgNPs capped with PSSMA were toxic to both cancer and normal cell lines. Judging from the 50 % inhibition concentration (IC{sub 50}), it was found that the cancer cell line was more sensitive to AgNPs than the normal cell line. Study on the mode of cell death by annexin V and propidium iodide staining revealed that AgNPs induced more apoptotic cell death (84–90 %) than necrosis (8–12 %) in the skin cancer cell line. These results suggest that the toxicity of AgNPs depended on the type of capping agent and the type of cell line.

  14. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

    International Nuclear Information System (INIS)

    Yamakoshi, Takako; Makino, Teruhiko; Ur Rehman, Mati; Yoshihisa, Yoko; Sugimori, Michiya; Shimizu, Tadamichi

    2013-01-01

    Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes

  15. Abnormally dark or light skin

    Science.gov (United States)

    Hyperpigmentation; Hypopigmentation; Skin - abnormally light or dark ... Normal skin contains cells called melanocytes. These cells produce melanin , the substance that gives skin its color. Skin with ...

  16. Angiogenic effects of cryosurgery with liquid nitrogen on the normal skin of rats, through morphometric study.

    Science.gov (United States)

    Pimentel, Camila Bianco; Moraes, Aparecida Machado de; Cintra, Maria Letícia

    2014-01-01

    Cryosurgery is an efficient therapeutic technique used to treat benign and malignant cutaneous diseases. The primary active mechanism of cryosurgery is related to vascular effects on treated tissue. After a cryosurgical procedure, exuberant granulation tissue is formed at the injection site, probably as a result of angiogenic stimulation of the cryogen and inflammatory response, particularly in endothelial cells. To evaluate the angiogenic effects of freezing, as part of the phenomenon of healing rat skin subjected to previous injury. Two incisions were made in each of the twenty rats, which were divided randomly into two groups of ten. After 3 days, cryosurgery with liquid nitrogen was performed in one of incisions. The rats' samples were then collected, cut and stained to conduct histopathological examination, to assess the local angiogenesis in differing moments and situations. It was possible to demonstrate that cryosurgery, in spite of promoting cell death and accentuated local inflammation soon after its application, induces quicker cell proliferation in the affected tissue and maintenance of this rate in a second phase, than in tissue healing without this procedure. These findings, together with the knowledge that there is a direct relationship between mononuclear cells and neovascularization (the development of a rich system of new vessels in injury caused by cold), suggest that cryosurgery possesses angiogenic stimulus, even though complete healing takes longer to occur. The significance level for statistical tests was 5% (p<0,05).

  17. Semi-conservative deoxyribonucleic acid synthesis in unirradiated and ultraviolet-irradiated xeroderma pigmentosum and normal human skin fibroblasts

    International Nuclear Information System (INIS)

    Rude, J.M.; Friedberg, E.C.

    1977-01-01

    Rates of semiconservative DNA synthesis have been investigated in asynchronous xeroderma pigmentosum (XP), XP variant, and normal human skin fibroblasts using the technique of cellular autoradiography. In unirradiated cells, no differences in DNA synthesis rates were detected among the three cell strains. Exposure to UV radiation caused the rate of DNA synthesis to decrease for at least three hours in all three cell strains. In the normal cell strain, recovery of the DNA synthetic rate occurred at later times following a UV fluence of 5 J/m 2 . At this same UV fluence, recovery was absent in classical XP cells during a 24 h post-irradiation period while it was slower than normal in XP variant cells. When the UV fluence to classical XP and XP variant cells was reduced so that survival in all three cell strains was approximately the same (25%), recovery of the DNA synthetic rate was similar in all three cell strains. These results are discussed in terms of current models of DNA replication in UV-irradiated cells and indicate: (1) that pyrimidine dimers are very effective blocks to DNA synthesis and (2) that there is no inherent defect in semiconservative DNA synthesis in either classical XP or XP variant cells which is independent of a defect in DNA repair capacity

  18. Semi-conservative deoxyribonucleic acid synthesis in unirradiated and ultraviolet-irradiated xeroderma pigmentosum and normal human skin fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Rude' e, J.M.; Friedberg, E.C.

    1977-03-01

    Rates of semiconservative DNA synthesis have been investigated in asynchronous xeroderma pigmentosum (XP), XP variant, and normal human skin fibroblasts using the technique of cellular autoradiography. In unirradiated cells, no differences in DNA synthesis rates were detected among the three cell strains. Exposure to uv radiation caused the rate of DNA synthesis to decrease for at least three hours in all three cell strains. In the normal cell strain, recovery of the DNA synthetic rate occurred at later times following a uv fluence of 5 J/m2. At this same uv fluence, recovery was absent in classical XP cells during a 24 h post-irradiation period while it was slower than normal in XP variant cells. When the uv fluence to classical XP and XP variant cells was reduced so that survival in all three cell strains was approximately the same (25%), recovery of the DNA synthetic rate was similar in all three cell strains. These results are discussed in terms of current models of DNA replication in uv-irradiated cells and indicate: (1) that pyrimidine dimers are very effective blocks to DNA synthesis and (2) that there is no inherent defect in semi-conservative DNA synthesis in either classical XP or XP variant cells which is independent of a defect in DNA repair capacity.

  19. Analysis of entrance skin radiation dose in mammography equipment in Rio Grande do Sul state (Ijui municipality and surroundings) and Rio de Janeiro (metropolitan area)

    International Nuclear Information System (INIS)

    Araujo, Geovane Silva; Padilha Filho, Lucas Gomes; Sousa, Carlos Henrique Simoes de; Feldmann, Gerson; Albrecht, Marcos R.A.; Souza, Sergio Augusto Lopes de

    2016-01-01

    Mammography is the technique widely used to the early detection of breast cancer, despite of not being a consensus the ideal age to initiate the radiologic examinations, it is recommended that women with the age of forty realize the examinations periodically. With the objective to analyze the entrance skin dose (ESD) in different mammography equipment, Were analyzed in the Estate of Rio Grande do Sul (Ijui City and neighborhoods) and in Rio de Janeiro (metropolitan area) 24 mammography equipment. Among them included in the study, just one presented ESD higher than the established limit of ANVISA. It was observed in the mammography equipment of Ijui and neighborhoods high levels of mAs to achieve the values of ESD next to the limit. (author)

  20. Dietary ascorbic acid normalizes ribosomal efficiency for collagen production in skin of streptozotocin-induced diabetic rats

    International Nuclear Information System (INIS)

    Schneir, M.; Imberman, M.; Ramamurthy, N.; Golub, L.

    1987-01-01

    The objective of this study was to quantify the contribution of both ribosome amount and ribosomal efficiency to decreased collagen production in skin of diabetic rats and diabetic rats treated with dietary ascorbic acid. Male Sprague-Dawley rats were distributed equally into the following categories: non-diabetic controls; diabetics; ascorbic acid-treated diabetics. On day-20, all rats were injected with ( 3 H)proline and killed after 2 h. Absolute rate of collagen production, ribosome content, and ribosomal efficiency of collagen production were quantified. Also ribosomal efficiency was quantified for ribosomes in sucrose-gradient fractionated post-mitochondrial supernatants. The results indicate that decreased ribosomal efficiency was responsible for 70% of the decreased collagen production with 30% caused by decreased ribosome content, when measured for total skin or sucrose gradient-isolated ribosomes. At both levels of analysis, ascorbic acid treatment normalized ribosomal efficiency, indicating diabetes-mediated decreased ribosomal efficiency for collagen production is related to a co-translational event, such as procollagen underhydroxylation

  1. Case of Paecilomyces lilacinus infection occurring in necrotizing fasciitis-associated skin ulcers on the face and surrounding a tracheotomy stoma.

    Science.gov (United States)

    Nagamoto, Eiko; Fujisawa, Akihiko; Yoshino, Yuichiro; Yoshitsugu, Kanako; Odo, Masashi; Watanabe, Hidetaka; Igata, Toshikatsu; Noguchi, Hiromitsu

    2014-01-01

    A 28-year-old man undergoing treatment for hemophagocytic syndrome developed Paecilomyces lilacinus infection in skin ulcers on the face and in the tracheotomy stoma. While his bone marrow was suppressed by chemotherapy with dexamethasone, cyclosporin and etoposide for hemophagocytic syndrome, dental infection led to subacute necrotizing fasciitis caused by Pseudomonas aeruginosa on the right side of the face, resulting in a large area of soft tissue defects. Etoposide was discontinued, and prophylactic treatment with itraconazole was initiated. The ulcers resulting from necrotizing fasciitis were treated conservatively using trafermin and alprostadil alfadex ointment 0.003 %, and near-complete re-epithelialization occurred, except on the right lower eyelid, right buccal mucosa and perioral area. However, 6 weeks later, pustules/crusts started to form and break down repeatedly, leading to expansion of tissue defects on the face. Direct microscopic examination revealed fungal elements, and fungal culture identified Paecilomyces lilacinus suspicious twice some other day. Based on DNA extraction from the isolated fungus, this fungal strain was identified as Paecilomyces lilacinus. Cyclosporin and itraconazole were discontinued, and treatment with liposomal amphotericin B and a tapering dose of steroids was initiated. Cure was achieved in approximately 2.5 months after treatment initiation, and no relapse has been observed. The most important factor that ultimately contributed to the resolution of fungal infection might have been release of immunosuppression by discontinuing cyclosporin and tapering steroids.

  2. Alp Rose stem cells, olive oil squalene and a natural alkyl polyglucoside emulsifier: Are they appropriate ingredients of skin moisturizers - in vivo efficacy on normal and sodium lauryl sulfate - irritated skin?.

    Science.gov (United States)

    Filipović, Mila; Gledović, Ana; Lukić, Milica; Tasić-Kostov, Marija; Isailović, Tanja; Pantelić, Ivana; Vuleta, Gordana; Savić, Snežana

    2016-11-01

    Since skin moisturization may be achieved by both actives and chosen carrier, plant stem cells, squalene and natural alkyl polyglucoside emulsifier may be potential components of contemporary cosmetic products. The aim of the study was in vivo evaluation of the skin irritation potential and the efficacy of Alpine Rose stem cells incorporated into li-posomes and olive oil squalene as ingredients of moisturizing creams, with respect to the novel emulsifier used for creams’ stabilization. With the employment of noninvasive skin biophysical measurements, skin hydration (EC), transepi-dermal water loss (TEWL), erythema index (EI) and viscoelas-ticity were measured on 76 healthy volunteers. In the first phase, skin irritation after a 24-hour occlusion and the long-term efficacy of creams (a 21-day study) on healthy skin were evaluated. Phase II of the study focused on the cream efficacy assessment after a 6-day treatment of sodium lauryl sulfate-irritated skin. After a 24-hour occlusion, there were no significant changes in the EI for any tested sample. In the second phase of the study, the EI was not significantly altered for the cream containing squalene, while the application of all active samples resulted in a significant reduction of TEWL. In both phases of the study an EC increase was recorded, espe-cially for the squalene-containing cream. Due to the lack of skin irritation and skin barrier impairment along with the marked hydration effect, it could be said that the in-vestigated actives incorporated into alkyl polyglucoside emulsi-fier-stabilized creams may be safely applied as ingredients for "tailor-made" cosmetic moisturizers intended for normal and dry skin care, whereas olive oil squalene could be used for the treatment of irritated or sensitive skin as well. [Projekat Ministarstva nauke Republike Srbije, br. TR34031

  3. Alp Rose stem cells, olive oil squalene and a natural alkyl polyglucoside emulsifier: Are they appropriate ingredients of skin moisturizers - in vivo efficacy on normal and sodium lauryl sulfate - irritated skin?

    Directory of Open Access Journals (Sweden)

    Filipović Mila

    2016-01-01

    Full Text Available Background/Aim. Since skin moisturization may be achieved by both actives and chosen carrier, plant stem cells, squalene and natural alkyl polyglucoside emulsifier may be potential components of contemporary cosmetic products. The aim of the study was in vivo evaluation of the skin irritation potential and the efficacy of Alpine Rose stem cells incorporated into li-posomes and olive oil squalene as ingredients of moisturizing creams, with respect to the novel emulsifier used for creams’ stabilization. Methods. With the employment of noninvasive skin biophysical measurements, skin hydration (EC, transepi-dermal water loss (TEWL, erythema index (EI and viscoelas-ticity were measured on 76 healthy volunteers. In the first phase, skin irritation after a 24-hour occlusion and the long-term efficacy of creams (a 21-day study on healthy skin were evaluated. Phase II of the study focused on the cream efficacy assessment after a 6-day treatment of sodium lauryl sulfate-irritated skin. Results. After a 24-hour occlusion, there were no significant changes in the EI for any tested sample. In the second phase of the study, the EI was not significantly altered for the cream containing squalene, while the application of all active samples resulted in a significant reduction of TEWL. In both phases of the study an EC increase was recorded, espe-cially for the squalene-containing cream. Conclusion. Due to the lack of skin irritation and skin barrier impairment along with the marked hydration effect, it could be said that the in-vestigated actives incorporated into alkyl polyglucoside emulsi-fier-stabilized creams may be safely applied as ingredients for "tailor-made" cosmetic moisturizers intended for normal and dry skin care, whereas olive oil squalene could be used for the treatment of irritated or sensitive skin as well. [Projekat Ministarstva nauke Republike Srbije, br. TR34031

  4. Nonlinear spectral imaging of human normal skin, basal cell carcinoma and squamous cell carcinoma based on two-photon excited fluorescence and second-harmonic generation

    Science.gov (United States)

    Xiong, S. Y.; Yang, J. G.; Zhuang, J.

    2011-10-01

    In this work, we use nonlinear spectral imaging based on two-photon excited fluorescence (TPEF) and second harmonic generation (SHG) for analyzing the morphology of collagen and elastin and their biochemical variations in basal cell carcinoma (BCC), squamous cell carcinoma (SCC) and normal skin tissue. It was found in this work that there existed apparent differences among BCC, SCC and normal skin in terms of their thickness of the keratin and epithelial layers, their size of elastic fibers, as well as their distribution and spectral characteristics of collagen. These differences can potentially be used to distinguish BCC and SCC from normal skin, and to discriminate between BCC and SCC, as well as to evaluate treatment responses.

  5. Comparison of skin barrier function and sensory nerve electric current perception threshold between IgE-high extrinsic and IgE-normal intrinsic types of atopic dermatitis.

    Science.gov (United States)

    Mori, T; Ishida, K; Mukumoto, S; Yamada, Y; Imokawa, G; Kabashima, K; Kobayashi, M; Bito, T; Nakamura, M; Ogasawara, K; Tokura, Y

    2010-01-01

    Background Two types of atopic dermatitis (AD) have been proposed, with different pathophysiological mechanisms underlying this seemingly heterogeneous disorder. The extrinsic type shows high IgE levels presumably as a consequence of skin barrier damage and feasible allergen permeation, whereas the intrinsic type exhibits normal IgE levels and is not mediated by allergen-specific IgE. Objectives To investigate the relationship between pruritus perception threshold and skin barrier function of patients with AD in a comparison between the extrinsic and intrinsic types. Methods Enrolled in this study were 32 patients with extrinsic AD, 17 with intrinsic AD and 24 healthy individuals. The barrier function of the stratum corneum was assessed by skin surface hydration and transepidermal water loss (TEWL), and pruritus perception was evaluated by the electric current perception threshold (CPT) of sensory nerves upon neuroselective transcutaneous electric stimulation. Results Skin surface hydration was significantly lower and TEWL was significantly higher in extrinsic AD than intrinsic AD or normal controls. Although there was no statistically significant difference in CPT among extrinsic AD, intrinsic AD and normal controls, CPT was significantly correlated with skin surface hydration and inversely with TEWL in intrinsic AD and normal controls, but not extrinsic AD. Finally, CPT was correlated with the visual analogue scale of itch in the nonlesional skin of patients with extrinsic but not intrinsic AD. Conclusions Patients with extrinsic AD have an impaired barrier, which increases the pre-existing pruritus but rather decreases sensitivity to external stimuli. In contrast, patients with intrinsic AD retain a normal barrier function and sensory reactivity to external pruritic stimuli.

  6. Expression and Localization of Peroxisome Proliferator-Activated Receptors and Nuclear Factor κB in Normal and Lesional Psoriatic Skin

    DEFF Research Database (Denmark)

    Westergaard, Majken; Henningsen, Jeanette; Johansen, Claus

    2003-01-01

    Abnormal epidermal proliferation and differentiation characterize the inflammatory skin disease psoriasis. Here we demonstrate that expression of PPARdelta mRNA and protein is markedly upregulated in psoriatic lesions and that lipoxygenase products accumulating in psoriatic lesions are potent...... activators of PPARdelta. The expression levels of NF-kappaB p50 and p65 were not significantly altered in lesional compared with nonlesional psoriatic skin. In the basal layer of normal epidermis both p50 and p65 were sequestered in the cytoplasm, whereas p50, but not p65, localized to nuclei...... in the suprabasal layers, and this distribution was maintained in lesional psoriatic skin. In normal human keratinocytes PPAR agonists neither impaired IL-1beta-induced translocation of p65 nor IL-1beta-induced NF-kappaB DNA binding. We show that PPARdelta physically interacts with the N-terminal Rel homology...

  7. Low doses of nanodiamonds and silica nanoparticles have beneficial hormetic effects in normal human skin fibroblasts in culture.

    Science.gov (United States)

    Mytych, Jennifer; Wnuk, Maciej; Rattan, Suresh I S

    2016-04-01

    Nanodiamonds (ND) and silica nanoparticles (SiO2-NP) have been much investigated for their toxicity at high doses, little is known about their biological activity at low concentrations. Here we report the biphasic dose response of ND and SiO2-NP in modulating normal human facial skin fibroblasts (FSF1) in culture. ND and SiO2-NP at low concentration (up to 0.5 μg/ml) had beneficial effects on FSF1 in terms of increasing their proliferation and metabolic activity. Exposure of FSF1 cells to low levels of NP enhanced their wound healing ability in vitro and slowed down aging during serial passaging as measured by maintenance of youthful morphology, reduction in the rate of loss of telomeres, and the over all proliferative characteristics. Furthermore, NP treatment induced the activation of Nrf2- and FOXO3A-mediated cellular stress responses, including an increased expression of heme oxygenease (HO-1), sirtuin (SIRT1), and DNA methyltransferase II (DNMT2). These results imply that ND and SiO2-NP at low doses are potential hormetins, which exert mild stress-induced beneficial hormetic effects through improved survival, longevity, maintenance, repair and function of human cells. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Assessment of Optical Coherence Tomography Imaging in the Diagnosis of Non-Melanoma Skin Cancer and Benign Lesions Versus Normal Skin:

    DEFF Research Database (Denmark)

    Mogensen, Mette; Jørgensen, Thomas Martini; Nürnberg, Birgit Meincke

    2009-01-01

    BACKGROUND Optical coherence tomography (OCT) is an optical imaging technique that may be useful in diagnosis of non-melanoma skin cancer (NMSC). OBJECTIVES To describe OCT features in NMSC such as actinic keratosis (AK) and basal cell carcinoma (BCC) and in benign lesions and to assess the diagn......BACKGROUND Optical coherence tomography (OCT) is an optical imaging technique that may be useful in diagnosis of non-melanoma skin cancer (NMSC). OBJECTIVES To describe OCT features in NMSC such as actinic keratosis (AK) and basal cell carcinoma (BCC) and in benign lesions and to assess...

  9. Normal tissue tolerance to external beam radiation therapy: Skin; Dose de tolerance des tissus sains: la peau et les phaneres

    Energy Technology Data Exchange (ETDEWEB)

    Ginot, A.; Doyen, J.; Hannoun-Levi, J.M.; Courdi, A. [Service d' oncologie-radiotherapie, centre Antoine-Lacassagne, 06 - Nice (France)

    2010-07-15

    Acute skin toxicity is frequent during radiation therapy and can lead to temporary arrest of the treatment. Chronic toxicity can occur and conduct to cosmetic problems. Alopecia is the most frequent toxicity concerning hair and is most of the time reversible. Several factors linked to patients influence skin toxicity, such as under-nutrition, old age, obesity, smoking, skin diseases, autoimmune diseases, failure of DNA reparation. Skin, hair and nail toxicities depend also on radiation schedule. Acute toxicity is greater when dose per fraction increases. Chronic and acute toxicities are more often when total dose increases. Under 45 Gy, the risk of severe skin toxicity is low, and begins above 50 Gy. Skin toxicity depends also on the duration of radiotherapy and split course schedules are associated with less toxicities. Irradiation surface seems to influence skin toxicity but interaction is more complex. Reirradiation is often feasible in case of cancer recurrence but with a risk of grade 3-4 toxicity above all in head and neck cancer. The benefit/risk ratio has to be always precisely evaluated. Permanent alopecia is correlated with the follicle dose. Modern techniques of radiation therapy allow to spare skin. (authors)

  10. Tenskinmetric Evaluation of Surface Energy Changes in Adult Skin: Evidence from 834 Normal Subjects Monitored in Controlled Conditions

    Directory of Open Access Journals (Sweden)

    Camilla Dal Bosco

    2014-03-01

    Full Text Available To evaluate the influence of the skin aging critical level on the adult skin epidermal functional state, an improved analytical method based on the skin surface energetic measurement (TVS modeling was developed. Tenskinmetric measurements were carried out non-invasively in controlled conditions by contact angle method using only a water-drop as reference standard liquid. Adult skin was monitored by TVS Observatory according to a specific and controlled thermal protocol (Camianta protocol in use at the interconnected “Mamma Margherita Terme spa” of Terme Euganee. From June to November 2013, the surface free energy and the epidermal hydration level of adult skin were evaluated on arrival of 265 male and 569 female adult volunteers (51–90 years of age and when they departed 2 weeks later. Sensitive measurements were carried out at 0.1 mN/m. High test compliance was obtained (93.2% of all guests. Very interesting results are obtained. The high sensitivity and discrimination power of tenskinmetry combined with a thermal Camianta protocol demonstrate the possibility to evaluate at baseline level the surface energetic changes and the skin reactivity which occurs on adult skin.

  11. Host-cell reactivation of UV-irradiated and chemically-treated herpes simplex virus-1 by xeroderma pigmentosum, xp heterozygotes and normal skin fibroblasts

    International Nuclear Information System (INIS)

    Selsky, C.A.

    1978-01-01

    The host-cell reactivation of UV-irradiated and N-acetoxy-2-acetylamino-fluorene-treated herpes simplex virus type 1 strain MP was studied in normal and xeroderma pigmentosum human skin fibroblasts. Virus treated with either agent demonstrated lower survival in XP cells from complementation groups A, B, C and D than in normal fibroblasts. The relative reactivation ability of XP cells from the different genetic complementation groups was found to be the same for both irradiated and chemically treated virus. In addition, the inactivation kinetics for virus treated with either agent in the XP variant were comparable to that seen in normal skin fibroblasts. The addition of 2 or 4 mmoles caffeine to the post-infection assay medium had no effect on the inactivation kinetics of virus treated by either agent in the XP variant or in XP cells from the different genetic complementation groups. Treatment of the virus with nitrogen mustard resulted in equivalent survival in normal and XP genetic complementation group D cells. No apparent defect was observed in the ability of XP heterozygous skin fibroblasts to repair virus damaged with up to 100 μg N-acetoxy-2-acetylaminofluorene per ml. These findings indicate that the repair of UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated virus is accomplished by the same pathway or different pathways sharing a common intermediate step and that the excision defect of XP cells plays little if any role in the reactivation of nitrogen mustard treated virus. (Auth.)

  12. Radiosensitivity of fibroblasts obtained from a cafe-au-lait spot and normal-appearing skin of a patient with neurofibromatosis (NF-6)

    International Nuclear Information System (INIS)

    Hannan, M.A.; Smith, B.P.; Sigut, D.; Sackey, K.

    1990-01-01

    Fibroblast cells derived from a cafe-au-lait spot and normal-appearing skin of a neurofibromatosis (NF-6) patient were studied for radiosensitivity in comparison with two normal cell lines used as controls. No difference in radiosensitivity was observed between the patient's cell lines and the controls using acute gamma-irradiation. However, a markedly increased radiosensitivity of the fibroblasts obtained from the patient's skin of normal appearance was demonstrated after chronic gamma-irradiation. The cells from the cafe-au-lait spot showed intermediate sensitivity to chronic irradiation as compared with the control cell lines and the fibroblasts derived from the normal skin of the patient. These results showed the usefulness of chronic irradiation in detecting increased cellular radiosensitivity which may result from a unique DNA repair defect in an NF patient. We suggest that enhanced genetic changes in radiosensitive NF patients may lead to formation of cafe-au-lait lesions and certain tumors. Such a transformation may be associated with production of radiotolerant cells

  13. Skin Graft

    OpenAIRE

    Shimizu, Ruka; Kishi, Kazuo

    2012-01-01

    Skin graft is one of the most indispensable techniques in plastic surgery and dermatology. Skin grafts are used in a variety of clinical situations, such as traumatic wounds, defects after oncologic resection, burn reconstruction, scar contracture release, congenital skin deficiencies, hair restoration, vitiligo, and nipple-areola reconstruction. Skin grafts are generally avoided in the management of more complex wounds. Conditions with deep spaces and exposed bones normally require the use o...

  14. Host-cell reactivation of uv-irradiated and chemically treated Herpes simplex virus type 1 strain MP in normal and xeroderma pigmentosum skin fibroblasts

    International Nuclear Information System (INIS)

    Selsky, C.A.

    1976-01-01

    The host-cell reactivation of UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated herpes simplex virus type 1 strain mp was studied in normal human skin fibroblasts and xeroderma pigmentosum skin fibroblasts from XP genetic complementation groups A-D and in an XP variant. The increasing relative order for the host-cell reactivation of both types of damaged virus in the different complementation groups is A = D < B < C; XP variant = normal controls. XP complementation group D cells, which manifest the most severe inhibition of her ability for both UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated virus, can reactivate nitrogen mustard treated HSV-1 mp to the same extent as normal cells. Together, these results indicate that (1) Excision repair of UV and N-acetoxy-2-acetylaminofluorene DNA damaged viruses share a common rate limiting enzymatic step and (2) The repair defect in xeroderma pigmentosum cells plays little or no role in the recovery of nitrogen mustard treated virus. The results of studies on the effect of caffeine on the survival of both UV- and N-acetoxy-2-acetylaminofluorene-treated virus in normal and XP cells imply that the reactivation of HSV-1 mp is mediated by an excision repair process with little if any recovery contributed by post-replication repair mechanisms. The host-cell reactivation of N-acetoxy-2-acetylaminofluorene-treated HSV-1 mp was also correlated with the defective UV-induced unscheduled DNA synthesis in two skin fibroblast strains established from a skin biopsy obtained from each of two juvenile females who had been clinically diagnosed as xeroderma pigmentosum. These findings are discussed in relation to the further characterization of the xeroderma pigmentosum phenotype and their possible utilization for the selection and isolation of new mammalian cell DNA repair mutants

  15. Forehead Skin Blood Flow in Normal Neonates during Active and Quiet Sleep, Measured with a Diode Laser Doppler Instrument

    NARCIS (Netherlands)

    Suichies, H.E.; Aarnoudse, J.G.; Okken, A.; Jentink, H.W.; de Mul, F.F.M.; Greve, Jan

    1988-01-01

    Changes in forehead skin blood flow during active and quiet sleep were determined in 16 healthy neonates using a recently developed semi-conductor laser Doppler flow meter without light conducting fibres. Measurements were carried out at a postnatal age varying from 5 hours to 7 days. The two sleep

  16. An oral TRPV1 antagonist attenuates laser radiant-heat-evoked potentials and pain ratings from UV(B)-inflamed and normal skin.

    Science.gov (United States)

    Schaffler, Klaus; Reeh, Peter; Duan, W Rachel; Best, Andrea E; Othman, Ahmed A; Faltynek, Connie R; Locke, Charles; Nothaft, Wolfram

    2013-02-01

    Laser (radiant-heat) evoked potentials (LEPs) from vertex-EEG peak-to-peak (PtP) amplitude were used to determine acute antinociceptive/antihyperalgesic efficacy of ABT-102, a novel TRPV1 antagonist efficacious in preclinical pain models, compared with active controls and placebo in normal and UV(B)-inflamed skin. This was a randomized, placebo- and active-controlled, double-blind, intra-individual, crossover trial. Twenty-four healthy subjects received six sequences of single doses of ABT-102 (0.5, 2, 6 mg), etoricoxib 90 mg, tramadol 100 mg and placebo. Painful stimuli were induced by CO(2) -laser on normal and UV(B) -inflamed skin. LEPs and visual analogue scale (VAS-pain) ratings were taken at baseline and hourly up to 8 h post-dose from both skin types. Compared with placebo, significant mean decreases in the primary variable of LEP PtP-amplitude from UV(B)-inflamed skin were observed with ABT-102 6 mg (P < 0.001), ABT-102 2 mg (P = 0.002), tramadol 100 mg (P < 0.001), and etoricoxib 90 mg (P = 0.001) over the 8 h period; ABT-102 0.5 mg was similar to placebo. ABT-102 6 mg was superior to active controls over the 8 h period (P < 0.05) whereas ABT-102 2 mg was comparable. Improvements in VAS scores compared with placebo were observed with ABT-102 6 mg (P < 0.001) and ABT-102 2 mg (P = 0.002). ABT-102 average plasma concentrations were 1.3, 4.4 and 9.4 ng ml(-1) for the 0.5, 2 and 6 mg doses, respectively. There were no clinically significant safety findings. TRPV-1 antagonism appears promising in the management of clinical pain, but requires further investigation. © 2012 Abbott. British Journal of Clinical Pharmacology © 2012 The British Pharmacological Society.

  17. Investigation of the predictive validity of laser-EPs in normal, UVB-inflamed and capsaicin-irritated skin with four analgesic compounds in healthy volunteers.

    Science.gov (United States)

    Schaffler, Klaus; Nicolas, Laurent B; Borta, Andreas; Brand, Tobias; Reitmeir, Peter; Roebling, Robert; Scholpp, Joachim

    2017-07-01

    The aim of the present study was to assess the predictivity of laser-(radiant-heat)-evoked potentials (LEPs) from the vertex electroencephalogram, using an algesimetric procedure, testing the anti-nociceptive/anti-hyperalgesic effects of single oral doses of four marketed analgesics (of different compound classes) vs. placebo, in healthy volunteers with three skin types. This was a randomized, placebo-controlled, single-blind, five-way-crossover trial. Twenty-five healthy male/female Caucasians were included (receiving celecoxib 200 mg, pregabalin 150 mg, duloxetine 60 mg, lacosamide 100 mg or placebo) in a Williams design, with CO 2 laser-induced painful stimuli to normal, ultraviolet (UV) B-inflamed and capsaicin-irritated skin. LEPs and visual analogue scale ratings were taken at baseline and hourly for 6 h postdose from all three skin types. In normal skin, the averaged postdose LEP peak-to-peak-(PtP)-amplitudes were reduced by pregabalin (-2.68 μV; 95% confidence interval (CI) -4.16, 1.19) and duloxetine (-1.73 μV; 95% CI -3.21, -0.26) but not by lacosamide and celecoxib vs. placebo. On UVB-irradiated skin, reflecting inflammatory pain, celecoxib induced a pronounced reduction in LEP PtP amplitudes vs. placebo (-6.2 μV; 95% CI -7.88, -4.51), with a smaller reduction by duloxetine (-4.54 μV; 95% CI -6.21, -2.87) and pregabalin (-3.72 μV; 95% CI -5.40, -2.04), whereas lacosamide was inactive. LEP PtP amplitudes on capsaicin-irritated skin, reflecting peripheral/spinal sensitization, as in neuropathic pain, were reduced by pregabalin (-3.78 μV; 95% CI -5.31, -2.25) and duloxetine (-2.32 μV; 95% CI -3.82, -0.82) but not by celecoxib or lacosamide vs. placebo, which was in agreement with known clinical profiles. Overall, PtP amplitude reductions were in agreement with subjective ratings. LEP algesimetry is sensitive to analgesics with different modes of action and may enable the effects of novel analgesics to be assessed during early clinical

  18. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  19. Methylmalonic and propionic acidemias: lipid profiles of normal and affected human skin fibroblasts incubated with [1-14C]propionate

    International Nuclear Information System (INIS)

    Giudici, T.A.; Chen, R.G.; Oizumi, J.; Shaw, K.N.; Ng, W.G.; Donnell, G.N.

    1986-01-01

    Normal human skin fibroblasts and those from methylmalonic acidemia and propionic acidemia patients were grown in culture. Following incubation with [1- 14 C]propionate, the major lipid classes in the cells were separated by thin layer chromatography and isolated fractions analyzed by radio gas chromatography for the presence of odd-numbered long-chain fatty acids; the pattern of even-numbered long-chain fatty acids was obtained also. Normal fibroblasts incorporated a small percentage of propionate into odd-numbered fatty acids which were present in all lipids studied. The abnormal cells incorporated a larger amount while maintaining the characteristic ratios of odd-numbered fatty acids found in the normal line. Most of the radioactivity was associated with phospholipids which are the predominant constituents of cell membranes. A characteristic C15/C17 ratio was found for different phospholipids and the triglyceride fraction; pentadecanoic acid was the principal odd-numbered fatty acid utilized in the assembly of complex lipids. Compared to even-numbered long-chain fatty acids the absolute amount of odd-numbered fatty acids was low (1-2%), even in affected cells. An unusual polar lipid fraction was isolated in the course of the study. In the normal cell it contained several unlabeled eicosanoids which were missing from the same fraction of both affected cell lines

  20. Interleukin 22 early affects keratinocyte differentiation, but not proliferation, in a three-dimensional model of normal human skin

    Energy Technology Data Exchange (ETDEWEB)

    Donetti, Elena, E-mail: elena.donetti@unimi.it [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Cornaghi, Laura; Arnaboldi, Francesca; Landoni, Federica [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Romagnoli, Paolo [Department of Experimental and Clinical Medicine, Università degli Studi di Firenze, 50125 Florence (Italy); Mastroianni, Nicolino [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Pescitelli, Leonardo [Department of Surgery and Translational Medicine, Università degli Studi di Firenze, 50125 Florence (Italy); Baruffaldi Preis, Franz W. [I.R.C.C.S. Istituto Ortopedico Galeazzi, 20161 Milan (Italy); Prignano, Francesca [Department of Surgery and Translational Medicine, Università degli Studi di Firenze, 50125 Florence (Italy)

    2016-07-15

    Interleukin (IL)-22 is a pro-inflammatory cytokine driving the progression of the psoriatic lesion with other cytokines, as Tumor Necrosis Factor (TNF)-alpha and IL-17. Our study was aimed at evaluating the early effect of IL-22 alone or in combination with TNF-alpha and IL-17 by immunofluorescence on i) keratinocyte (KC) proliferation, ii) terminal differentiation biomarkers as keratin (K) 10 and 17 expression, iii) intercellular junctions. Transmission electron microscopy (TEM) analysis was performed. A model of human skin culture reproducing a psoriatic microenvironment was used. Plastic surgery explants were obtained from healthy young women (n=7) after informed consent. Fragments were divided before adding IL-22 or a combination of the three cytokines, and harvested 24 (T24), 48 (T48), and 72 (T72) h later. From T24, in IL-22 samples we detected a progressive decrease in K10 immunostaining in the spinous layer paralleled by K17 induction. By TEM, after IL-22 incubation, keratin aggregates were evident in the perinuclear area. Occludin immunostaining was not homogeneously distributed. Conversely, KC proliferation was not inhibited by IL-22 alone, but only by the combination of cytokines. Our results suggest that IL-22 affects keratinocyte terminal differentiation, whereas, in order to induce a proliferation impairment, a more complex psoriatic-like microenvironment is needed.

  1. Interleukin 22 early affects keratinocyte differentiation, but not proliferation, in a three-dimensional model of normal human skin

    International Nuclear Information System (INIS)

    Donetti, Elena; Cornaghi, Laura; Arnaboldi, Francesca; Landoni, Federica; Romagnoli, Paolo; Mastroianni, Nicolino; Pescitelli, Leonardo; Baruffaldi Preis, Franz W.; Prignano, Francesca

    2016-01-01

    Interleukin (IL)-22 is a pro-inflammatory cytokine driving the progression of the psoriatic lesion with other cytokines, as Tumor Necrosis Factor (TNF)-alpha and IL-17. Our study was aimed at evaluating the early effect of IL-22 alone or in combination with TNF-alpha and IL-17 by immunofluorescence on i) keratinocyte (KC) proliferation, ii) terminal differentiation biomarkers as keratin (K) 10 and 17 expression, iii) intercellular junctions. Transmission electron microscopy (TEM) analysis was performed. A model of human skin culture reproducing a psoriatic microenvironment was used. Plastic surgery explants were obtained from healthy young women (n=7) after informed consent. Fragments were divided before adding IL-22 or a combination of the three cytokines, and harvested 24 (T24), 48 (T48), and 72 (T72) h later. From T24, in IL-22 samples we detected a progressive decrease in K10 immunostaining in the spinous layer paralleled by K17 induction. By TEM, after IL-22 incubation, keratin aggregates were evident in the perinuclear area. Occludin immunostaining was not homogeneously distributed. Conversely, KC proliferation was not inhibited by IL-22 alone, but only by the combination of cytokines. Our results suggest that IL-22 affects keratinocyte terminal differentiation, whereas, in order to induce a proliferation impairment, a more complex psoriatic-like microenvironment is needed.

  2. Quantification of Sunscreen Ethylhexyl Triazone in Topical Skin-Care Products by Normal-Phase TLC/Densitometry

    OpenAIRE

    Sobanska, Anna W.; Pyzowski, Jaroslaw

    2012-01-01

    Ethylhexyl triazone (ET) was separated from other sunscreens such as avobenzone, octocrylene, octyl methoxycinnamate, and diethylamino hydroxybenzoyl hexyl benzoate and from parabens by normal-phase HPTLC on silica gel 60 as stationary phase. Two mobile phases were particularly effective: (A) cyclohexane-diethyl ether 1 : 1 (v/v) and (B) cyclohexane-diethyl ether-acetone 15 : 1 : 2 (v/v/v) since apart from ET analysis they facilitated separation and quantification of other sunscreens present ...

  3. Formation of DNA single-strand breaks by near-ultraviolet and gamma-rays in normal and Bloom's syndrome skin fibroblasts

    International Nuclear Information System (INIS)

    Hirschi, M.; Netrawali, M.S.; Remsen, J.F.; Cerutti, P.A.

    1981-01-01

    The formation of single-strand breaks by near-ultraviolet light at 313 nm and by aerobic gamma-rays was compared for skin fibroblast monolayer cultures from 4 normal donors (NF) and 8 patients with Bloom's syndrome (BS) by the alkaline elution method. In 6 of 8 BS strains, the number of breaks induced by near-ultraviolet light, 2.25 kJ/sq m, at 0 degrees was comparable to NF, while elevated breakage was observed in BS strains HG 369 and HG 916. Breakage frequencies were increased substantially in 6 of 8 BS strains relative to NF when the near-ultraviolet light exposure was at 37 degrees. BS strain GM 2520 represents an exception since normal breakage frequencies were induced both at 0 degrees and 37 degrees. Aerobic gamma-rays (75 R) induced comparable numbers of single-strand breaks in BS and NF strains at 0 degrees. The breakage frequencies were reduced an average of 17% in NF when the same dose was given at 30 degrees followed by 6 min incubation. Under the same conditions, the breakage frequencies were on the average reduced by 42% relative to 0 degrees in the BS strains, indicating that they possess normal or possibly slightly increased capacities for the rejoining of gamma-ray-induced breaks

  4. Effect of treatment in fractionated schedules with the combination of x-irradiation and six cytotoxic drugs on the RIF-1 tumor and normal mouse skin

    International Nuclear Information System (INIS)

    Lelieveld, P.; Scoles, M.A.; Brown, J.M.; Phil, D.; Kallman, R.F.

    1985-01-01

    RIF-1 tumors, implanted syngeneically in the gastrocnemius muscles of the right hind legs of C3H/Km mice, were treated either with X ray alone, drug alone, or drug and X ray combined. The drugs tested were bleomycin, BCNU, cis-diamminedichloro platinum, adriamycin, cyclophosphamide, and actinomycin-D. All drugs were administered either in the maximum tolerated dose or a dose that causes minimal tumor growth delay. Both drugs and X rays were administered either as a single dose or in five daily fractions. In addition to the single modality controls, seven different schedules of combined modalities were tested. Tumors were measured periodically after treatment in order that the day at which each tumor reached 4 times its initial cross-sectional area, i.e., its size at the time of treatment, could be determined. The effect of treatment on tumors was based upon excess growth delay (GD), i.e., T400% (treated)-T400% (untreated control). Treatment effects for the same combined modality schedules were also determined for normal skin, using the early skin reaction as an endpoint. Dose effect factors (DEF) were computed for all combined modality schedules and were based upon calculated radiation dose equivalents. We also calculated supra-additivity ratios, SR/sub I/ and SR/sub II/, therapeutic gain factors and adjusted therapeutic gain factors. The only drugs to produce significant supra-additivity with X rays were cis-Pt and cyclo

  5. Quantification of Sunscreen Ethylhexyl Triazone in Topical Skin-Care Products by Normal-Phase TLC/Densitometry

    Directory of Open Access Journals (Sweden)

    Anna W. Sobanska

    2012-01-01

    Full Text Available Ethylhexyl triazone (ET was separated from other sunscreens such as avobenzone, octocrylene, octyl methoxycinnamate, and diethylamino hydroxybenzoyl hexyl benzoate and from parabens by normal-phase HPTLC on silica gel 60 as stationary phase. Two mobile phases were particularly effective: (A cyclohexane-diethyl ether 1 : 1 (v/v and (B cyclohexane-diethyl ether-acetone 15 : 1 : 2 (v/v/v since apart from ET analysis they facilitated separation and quantification of other sunscreens present in the formulations. Densitometric scanning was performed at 300 nm. Calibration curves for ET were nonlinear (second-degree polynomials, with R > 0.998. For both mobile phases limits of detection (LOD were 0.03 and limits of quantification (LOQ 0.1 μg spot−1. Both methods were validated.

  6. Quantification of sunscreen ethylhexyl triazone in topical skin-care products by normal-phase TLC/densitometry.

    Science.gov (United States)

    Sobanska, Anna W; Pyzowski, Jaroslaw

    2012-01-01

    Ethylhexyl triazone (ET) was separated from other sunscreens such as avobenzone, octocrylene, octyl methoxycinnamate, and diethylamino hydroxybenzoyl hexyl benzoate and from parabens by normal-phase HPTLC on silica gel 60 as stationary phase. Two mobile phases were particularly effective: (A) cyclohexane-diethyl ether 1 : 1 (v/v) and (B) cyclohexane-diethyl ether-acetone 15 : 1 : 2 (v/v/v) since apart from ET analysis they facilitated separation and quantification of other sunscreens present in the formulations. Densitometric scanning was performed at 300 nm. Calibration curves for ET were nonlinear (second-degree polynomials), with R > 0.998. For both mobile phases limits of detection (LOD) were 0.03 and limits of quantification (LOQ) 0.1 μg spot(-1). Both methods were validated.

  7. Reconstructing in-vivo reflectance spectrum of pigmented skin lesion by Monte Carlo simulation

    Science.gov (United States)

    Wang, Shuang; He, Qingli; Zhao, Jianhua; Lui, Harvey; Zeng, Haishan

    2012-03-01

    In dermatology applications, diffuse reflectance spectroscopy has been extensively investigated as a promising tool for the noninvasive method to distinguish melanoma from benign pigmented skin lesion (nevus), which is concentrated with the skin chromophores like melanin and hemoglobin. We carried out a theoretical study to examine melanin distribution in human skin tissue and establish a practical optical model for further pigmented skin investigation. The theoretical simulation was using junctional nevus as an example. A multiple layer skin optical model was developed on established anatomy structures of skin, the published optical parameters of different skin layers, blood and melanin. Monte Carlo simulation was used to model the interaction between excitation light and skin tissue and rebuild the diffuse reflectance process from skin tissue. A testified methodology was adopted to determine melanin contents in human skin based on in vivo diffuse reflectance spectra. The rebuild diffuse reflectance spectra were investigated by adding melanin into different layers of the theoretical model. One of in vivo reflectance spectra from Junctional nevi and their surrounding normal skin was studied by compare the ratio between nevus and normal skin tissue in both the experimental and simulated diffuse reflectance spectra. The simulation result showed a good agreement with our clinical measurements, which indicated that our research method, including the spectral ratio method, skin optical model and modifying the melanin content in the model, could be applied in further theoretical simulation of pigmented skin lesions.

  8. Skin perfusion pressure measured with a photo sensor in an air-filled plastic balloon: validity and reproducibility on the lower leg in normal subjects and patients suspected of obliterative arterial disease

    DEFF Research Database (Denmark)

    Nielsen, Steen Levin; Nielsen, Anne Lerberg; Vind, Susanne Haase

    2011-01-01

    An inflatable small plastic bag including a photo sensor was constructed for measurement of skin perfusion pressure avoiding the rim of the photo sensor over bony and tendineous surfaces of the tibia below the knee, at the ankle, and on the dorsal forefoot. Compression was obtained using a conical...... blood pressure cuff with continuous decrease from suprasystolic arm pressure. The validity of skin perfusion pressure with the new device was compared to that of isotope washout below the knee in normal subjects and in patients with an ischemic forefoot with acceptable agreement. The method had a high...... reproducibility within and between days in normal subjects. Compared to systolic arterial pressure measured using a strain gauge with a cuff on the ankle in normal subjects and patients with intermittent claudication the new device showed blood pressure in the skin closer to the diastolic pressure. The new...

  9. Skin graft - slideshow

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/presentations/100100.htm Skin graft - series—Normal anatomy To use the sharing features ... entire body, and acts as a protective barrier. Skin grafts may be recommended for: Extensive wounds Burns Specific ...

  10. Neuromodulators for Aging Skin

    Science.gov (United States)

    ... Light treatment to the skin and Restylane to tear troughs and outer eyebrow. Photo courtesy of Rebecca Fitzagerald, MD - Los Angeles, California Possible risks Soreness Mild bruising Temporary weakness of surrounding muscles Headache Drooping eyelid Why choose neuromodulators for aging ...

  11. A new algorithm for the discrimination of actinic keratosis from normal skin and squamous cell carcinoma based on in vivo analysis of optical properties by high-definition optical coherence tomography

    DEFF Research Database (Denmark)

    Boone, M A L M; Suppa, M; Marneffe, A

    2016-01-01

    properties for discrimination of AK from SCC and from normal sun exposed skin and to subdifferentiate AKs. METHODS: The technique of semi-log plot has been implemented on HD-OCT signals. This permitted the in vivo measurement of OCT signals coming from the skin entrance up to the superficial reticular dermis...... involvement, non-Bowenoid AK with follicular involvement, Bowenoid AK, hypertrophic and lichenoid form of AK and squamous cell carcinoma. CONCLUSION: HD-OCT seems to enable the combination of in vivo morphological analysis of cellular and 3D microarchitectural structures with in vivo analysis of optical...... properties of tissue scatterers in AK/SCC lesions and normal sun-exposed skin. In vivoHD-OCT analysis of optical properties permits AK discrimination from SCC and AK subdifferentiation with higher accuracy than in vivoHD-OCT analysis of morphology alone....

  12. Effects of sulfate deprivation on the production of chondroitin/dermatan sulfate by cultures of skin fibroblasts from normal and diabetic individuals

    International Nuclear Information System (INIS)

    Silbert, C.K.; Humphries, D.E.; Palmer, M.E.; Silbert, J.E.

    1991-01-01

    Human skin fibroblast monolayer cultures from two normal men, three Type I diabetic men, and one Type I diabetic woman were incubated with [3H]glucosamine in the presence of diminished concentrations of sulfate. Although total synthesis of [3H]chondroitin/dermatan glycosaminoglycans varied somewhat between cell lines, glycosaminoglycan production was not affected within any line when sulfate levels were decreased from 0.3 mM to 0.06 mM to 0.01 mM to 0 added sulfate. Lowering of sulfate concentrations resulted in diminished sulfation of chondroitin/dermatan in a progressive manner, so that overall sulfation dropped to as low as 19% for one of the lines. Sulfation of chondroitin to form chondroitin 4-sulfate and chondroitin 6-sulfate was progressively and equally affected by decreasing the sulfate concentration in the culture medium. However, sulfation to form dermatan sulfate was preserved to a greater degree, so that the relative proportion of dermatan sulfate to chondroitin sulfate increased. Essentially all the nonsulfated residues were susceptible to chondroitin AC lyase, indicating that little epimerization of glucuronic acid residues to iduronic acid had occurred in the absence of sulfation. These results confirm the previously described dependency of glucuronic/iduronic epimerization on sulfation, and indicate that sulfation of the iduronic acid-containing disaccharide residues of dermatan can take place with sulfate concentrations lower than those needed for 6-sulfation and 4-sulfation of the glucuronic acid-containing disaccharide residues of chondroitin. There were considerable differences among the six fibroblast lines in susceptibility to low sulfate medium and in the proportion of chondroitin 6-sulfate, chondroitin 4-sulfate, and dermatan sulfate. However, there was no pattern of differences between normals and diabetics

  13. Proteomics reveals novel oxidative and glycolytic mechanisms in type 1 diabetic patients' skin which are normalized by kidney-pancreas transplantation.

    Directory of Open Access Journals (Sweden)

    Franco Folli

    2010-03-01

    Full Text Available In type 1 diabetes (T1D vascular complications such as accelerated atherosclerosis and diffused macro-/microangiopathy are linked to chronic hyperglycemia with a mechanism that is not yet well understood. End-stage renal disease (ESRD worsens most diabetic complications, particularly, the risk of morbidity and mortality from cardiovascular disease is increased several fold.We evaluated protein regulation and expression in skin biopsies obtained from T1D patients with and without ESRD, to identify pathways of persistent cellular changes linked to diabetic vascular disease. We therefore examined pathways that may be normalized by restoration of normoglycemia with kidney-pancreas (KP transplantation. Using proteomic and ultrastructural approaches, multiple alterations in the expression of proteins involved in oxidative stress (catalase, superoxide dismutase 1, Hsp27, Hsp60, ATP synthase delta chain, and flavin reductase, aerobic and anaerobic glycolysis (ACBP, pyruvate kinase muscle isozyme, and phosphoglycerate kinase 1, and intracellular signaling (stratifin-14-3-3, S100-calcyclin, cathepsin, and PPI rotamase as well as endothelial vascular abnormalities were identified in T1D and T1D+ESRD patients. These abnormalities were reversed after KP transplant. Increased plasma levels of malondialdehyde were observed in T1D and T1D+ESRD patients, confirming increased oxidative stress which was normalized after KP transplant.Our data suggests persistent cellular changes of anti-oxidative machinery and of aerobic/anaerobic glycolysis are present in T1D and T1D+ESRD patients, and these abnormalities may play a key role in the pathogenesis of hyperglycemia-related vascular complications. Restoration of normoglycemia and removal of uremia with KP transplant can correct these abnormalities. Some of these identified pathways may become potential therapeutic targets for a new generation of drugs.

  14. Both near ultraviolet radiation and the oxidizing agent hydrogen peroxide induce a 32-kDa stress protein in normal human skin fibroblasts

    International Nuclear Information System (INIS)

    Keyse, S.M.; Tyrrell, R.M.

    1987-01-01

    We have analyzed the pattern of protein synthesis in solar near ultraviolet (334 nm, 365 nm) and near visible (405 nm) irradiated normal human skin fibroblasts. Two hours after irradiation we find that one major stress protein of approximately 32 kDa is induced in irradiated cells. This protein is not induced by ultraviolet radiation at wavelengths shorter than 334 nm and is not inducible by heat shock treatment of these cells. Although sodium arsenite, diamide, and menadione all induced a 32-kDa protein, they also induced the major heat shock proteins. In contrast, the oxidizing agent, hydrogen peroxide, induced the low molecular weight stress protein without causing induction of the major heat shock proteins. A comparison of the 32-kDa proteins induced by sodium arsenite, H 2 O 2 , and solar near ultraviolet radiation using chemical peptide mapping shows that they are closely related. These results imply that the pathways for induction of the heat shock response and the 32-kDa protein are not identical and suggest that, at least in the case of radiation and treatment with H 2 O 2 , the 32-kDa protein might be induced in response to cellular oxidative stress. This conclusion is supported by the observation that depletion of endogenous cellular glutathione prior to solar near ultraviolet irradiation lowers the fluence threshold for induction of the 32-kDa stress protein

  15. The Use of Matriderm and Autologous Skin Graft in the Treatment of Full Thickness Skin Defects

    Directory of Open Access Journals (Sweden)

    Jang Hwan Min

    2014-07-01

    Full Text Available Background For patients with full thickness skin defects, autologous Split-thickness skin grafts (STSG are generally regarded as the mainstay of treatment. However, skin grafts have some limitations, including undesirable outcomes resulting from scars, poor elasticity, and limitations in joint movement due to contractures. In this study, we present outcomes of Matriderm grafts used for various skin tissue defects whether it improves on these drawbacks. Methods From January 2010 to March 2012, a retrospective review of patients who had undergone autologous STSG with Matriderm was performed. We assessed graft survival to evaluate the effectiveness of Matriderm. We also evaluated skin quality using a Cutometer, Corneometer, Tewameter, or Mexameter, approximately 12 months after surgery. Results A total of 31 patients underwent STSG with Matriderm during the study period. The success rate of skin grafting was 96.7%. The elasticity value of the portion on which Matriderm was applied was 0.765 (range, 0.635-0.800, the value of the trans-epidermal water loss (TEWL was 10.0 (range, 8.15-11.00 g/hr/m2, and the humidification value was 24.0 (range, 15.5-30.0. The levels of erythema and melanin were 352.0 arbitrary unit (AU (range, 299.25-402.75 AU and 211.0 AU (range, 158.25-297.00 AU, respectively. When comparing the values of elasticity and TEWL of the skin treated with Matriderm to the values of the surrounding skin, there was no statistically significant difference between the groups. Conclusions The results of this study demonstrate that a dermal substitute (Matriderm with STSG was adopted stably and with minimal complications. Furthermore, comparing Matriderm grafted skin to normal skin using Cutometer, Matriderm proved valuable in restoring skin elasticity and the skin barrier.

  16. Skin perfusion pressure measured with a photo sensor in an air-filled plastic balloon: validity and reproducibility on the lower leg in normal subjects and patients suspected of obliterative arterial disease

    International Nuclear Information System (INIS)

    Nielsen, Steen Levin; Nielsen, Anne Lerberg; Vind, Susanne Haase; Thomassen, Anders

    2011-01-01

    An inflatable small plastic bag including a photo sensor was constructed for measurement of skin perfusion pressure avoiding the rim of the photo sensor over bony and tendineous surfaces of the tibia below the knee, at the ankle, and on the dorsal forefoot. Compression was obtained using a conical blood pressure cuff with continuous decrease from suprasystolic arm pressure. The validity of skin perfusion pressure with the new device was compared to that of isotope washout below the knee in normal subjects and in patients with an ischemic forefoot with acceptable agreement. The method had a high reproducibility within and between days in normal subjects. Compared to systolic arterial pressure measured using a strain gauge with a cuff on the ankle in normal subjects and patients with intermittent claudication the new device showed blood pressure in the skin closer to the diastolic pressure. The new pressure device thus had acceptable validity and reproducibility for estimation of the skin perfusion pressure and can be used on bony and tendineous sites on the lower limb in regions where critical wound healing is frequent, e.g. ankle and forefoot

  17. Skin graft

    Science.gov (United States)

    Skin transplant; Skin autografting; FTSG; STSG; Split thickness skin graft; Full thickness skin graft ... donor site. Most people who are having a skin graft have a split-thickness skin graft. This takes ...

  18. Psychoneuroimmunology and the Skin.

    Science.gov (United States)

    Honeyman, Juan F

    2016-08-23

    The nervous, immune, endocrine and integumentary systems are closely related and interact in a number of normal and pathological conditions. Nervous system mediators may bring about direct changes to the skin or may induce the release of immunological or hormonal mediators that cause pathological changes to the skin. This article reviews the psychological mechanisms involved in the development of skin diseases.

  19. Presence of non-fibrillar amyloid beta protein in skin biopsies of Alzheimer's disease (AD), Down's syndrome and non-AD normal persons

    DEFF Research Database (Denmark)

    Wen, G Y; Wisniewski, H M; Blondal, H

    1994-01-01

    A total of 66 skin biopsies from persons with Alzheimer's disease (AD) or Down's syndrome (DS) and from persons without AD were used in this study. The age range was from 7 to 89 years. Positive immunoreactivity of skin biopsies to monoclonal antibody 4G8, which is reactive to amino acid residue 17...

  20. Ultrasonography of Skin Changes in Legs with Chronic Venous Disease.

    Science.gov (United States)

    Caggiati, A

    2016-10-01

    In daily practice, ultrasonography (US) is used only to designate the location and pattern of venous lesions. Skin US is not performed between routine venous investigations. Skin morphology is evaluated by the same probes used for routine Duplex evaluation of superficial veins. US findings from evident skin lesions are comparatively evaluated with those from the surrounding apparently normal skin and from the contralateral leg. Inflammation and dermal edema can be found in the apparently normal skin of C2 legs. Swollen legs show thickening of the subcutaneous layer as a result of diffuse soaking or anechoic cavities, with or without dermal edema. Chronic hypodermitis is characterized by inflammatory edema in initial phases, and by liposclerosis in advanced cases. Recrudescence of inflammation provokes focal rarefactions of the subcutaneous layer, possibly related to ulcer opening. In legs with venous disorders, sonography refines clinical evaluation of the skin and may reveal changes not highlighted by inspection. Some of these changes could require further investigation because they have not yet been explained or described. Skin sonography should improve knowledge of the natural history of skin changes, as well as contribute to a better grading of venous diseases severity In particular, US evidence of cutaneous and subcutaneous changes in C2 legs should be considered to stratify the treatment in C2 legs, by identifying those in which varicose veins are not simply a cosmetic problem. Copyright © 2016 European Society for Vascular Surgery. Published by Elsevier Ltd. All rights reserved.

  1. Esterification of all-trans-retinol in normal human epithelial cell strains and carcinoma lines from oral cavity, skin and breast: reduced expression of lecithin:retinol acyltransferase in carcinoma lines.

    Science.gov (United States)

    Guo, X; Ruiz, A; Rando, R R; Bok, D; Gudas, L J

    2000-11-01

    When exogenous [(3)H]retinol (vitamin A) was added to culture medium, normal human epithelial cells from the oral cavity, skin, lung and breast took up and esterified essentially all of the [(3)H]retinol within a few hours. As shown by [(3)H]retinol pulse-chase experiments, normal epithelial cells then slowly hydrolyzed the [(3)H]retinyl esters to [(3)H]retinol, some of which was then oxidized to [(3)H]retinoic acid (RA) over a period of several days. In contrast, cultured normal human fibroblasts and human umbilical vein endothelial cells (HUVEC) did not esterify significant amounts of [(3)H]retinol; this lack of [(3)H]retinol esterification was correlated with a lack of expression of lecithin:retinol acyltransferase (LRAT) transcripts in normal fibroblast and HUVEC strains. These results indicate that normal, differentiated cell types differ in their ability to esterify retinol. Human carcinoma cells (neoplastically transformed epithelial cells) of the oral cavity, skin and breast did not esterify much [(3)H]retinol and showed greatly reduced LRAT expression. Transcripts of the neutral, bile salt-independent retinyl ester hydrolase and the bile salt-dependent retinyl ester hydrolase were undetectable in all of the normal cell types, including the epithelial cells. These experiments suggest that retinoid-deficiency in the tumor cells could develop because of the lack of retinyl esters, a storage form of retinol.

  2. Skin Diseases: Skin Health and Skin Diseases

    Science.gov (United States)

    Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Skin Health and Skin Diseases Past Issues / Fall 2008 Table of Contents ... acne to wrinkles Did you know that your skin is the largest organ of your body? It ...

  3. Study of skin and nail Candida species as a normal flora based on age groups in healthy persons in Tehran-Iran.

    Science.gov (United States)

    Rafat, Z; Hashemi, S J; Ahamdikia, K; Daie Ghazvini, R; Bazvandi, F

    2017-12-01

    The skin is the body's largest organ that hosts heterogeneous inhabitants. Until now, the diversity of the cutaneous microbiome was mainly investigated for bacteria and there is a little information about the skin fungal flora. Also, among skin fungal flora, Candida is found as a main member whose distribution is affected by sex, age, climate. In this study, differences in Candida community structure associated with 9 different skin sites of 238 healthy people during 10 months from July to March 2016, are described. These subjects were divided by age into 4 groups: infants, children, adults and geriatrics. The collected samples were examined by culture on Sabouraud Chloramphenicol Agar and CHROM-agar Candida. For precise identification of species ITS1-5. 8S-ITS2 rDNA regions were sequenced where needed. The frequency of Candida species was significantly different between age groups. The most Candida isolations were related to the elderly age group and the fewest in the infants. C. parapsilosis virtually, was the predominant isolated species in all age groups. This study showed no statistically significant effect of the subject's sex on Candida population resident on human skin surface. Copyright © 2017. Published by Elsevier Masson SAS.

  4. Blood flow in skin, subcutaneous adipose tissue and skeletal muscle in the forearm of normal man during an oral glucose load

    DEFF Research Database (Denmark)

    Bülow, J; Astrup, A; Christensen, N J

    1987-01-01

    Blood flow to the forearm, and the subcutaneous tissue and skin in the forearm were measured by strain gauge plethysmography, 133Xe-elimination and Laser Doppler flowmetry during an oral glucose load (I g glucose kg-1 lean body mass) and during control conditions. The forearm blood flow remained...... constant during both experiments. Glucose induced a two-fold vasodilatation in subcutaneous tissue. In skin, glucose induced a relative vasodilatation and later a relative vasoconstriction compared with control experiments. When estimated from forearm blood flow and subcutaneous and skin blood flows......, muscle blood flow decreased about 20-30% during both experiments. Proximal nervous blockade did not abolish the glucose-induced vasodilatation in subcutaneous tissue. In the glucose experiment, arterial glucose concentration increased to 7.8 +/- 1.17 mmol l-1 30 min after the load was given...

  5. In vivo study of the human skin by the method of laser-induced fluorescence spectroscopy

    International Nuclear Information System (INIS)

    Borisova, E.; Avramov, L.

    2000-01-01

    The goals of this study are to perform a preliminary evaluation of the diagnostic potential of noninvasive laser-induced auto-fluorescence spectroscopy (LIAFS) for human skin and optimize of detection and diagnosis of hollow organs and skin. In recent years, there has been growing interest in the use of laser-induced fluorescence to discriminate disease from normal surrounding tissue. The most fluorescence studies have used exogenous fluorophores of this discrimination. The laser-induced auto-fluorescence which is used for diagnosis of tissues in the human body avoids administration of any drugs. In this study a technique for optical biopsy of in vivo human skin is presented. The auto-fluorescence characterization of tissue relies on different spectral properties of tissues. It was demonstrated a differentiation between normal skin and skin with vitiligo. Two main endogenous fluorophores in the human skin account for most of the cellular auto-fluorescence for excitation wavelength 337 nm reduced from of nicotinamide adenine dinucleotide and collagen. The auto-fluorescence spectrum of human skin depend on main internal absorbers which are blood and melanin. In this study was described the effect caused by blood and melanin content on the shape of the auto-fluorescence spectrum of human skin. Human skin fluorescence spectrum might provide dermatologists with important information and such investigations are successfully used now in skin disease diagnostics, in investigation of the environmental factor impact or for evaluation of treatment efficiency. (authors)

  6. Diffuse Reflectance Spectroscopy of Human Skin Using a Commercial Fiber Optic Spectrometer

    International Nuclear Information System (INIS)

    Atencio, J. A. Delgado; Rodriguez, M. Cunill; Montiel, S. Vazquez y; Castro, Jorge; Rodriguez, A. Cornejo; Gutierrez, J. L.; Martinez, F.; Gutierrez, B.; Orozco, E.

    2008-01-01

    Diffuse reflectance spectroscopy is a reliable and easy to implement technique in human tissue characterization. In this work we evaluate the performance of the commercial USB4000 miniature fiber optic spectrometer in the in-vivo measurement of the diffuse reflectance spectra of different healthy skin sites and lesions in a population of 54 volunteers. Results show, that this spectrometer reproduces well the typical signatures of skin spectra over the 400-1000 nm region. Remarkable spectral differences exist between lesions and normal surrounding skin. A diffusion-based model was used to simulate reflectance spectra collected by the optical probe of the system

  7. Sun’s effect on skin

    Science.gov (United States)

    The skin uses sunlight to help manufacture vitamin D, which is important for normal bone formation. But sometimes its ultraviolet light can be ... the pigment melanin. Melanin protects skin from the sun's ultraviolet rays, which can burn the skin, and ...

  8. Effect of Exercise-induced Sweating on facial sebum, stratum corneum hydration, and skin surface pH in normal population.

    Science.gov (United States)

    Wang, Siyu; Zhang, Guirong; Meng, Huimin; Li, Li

    2013-02-01

    Evidence demonstrated that sweat was an important factor affecting skin physiological properties. We intended to assess the effects of exercise-induced sweating on the sebum, stratum corneum (SC) hydration and skin surface pH of facial skin. 102 subjects (aged 5-60, divided into five groups) were enrolled to be measured by a combination device called 'Derma Unit SSC3' in their frontal and zygomatic regions when they were in a resting state (RS), at the beginning of sweating (BS), during excessive sweating (ES) and an hour after sweating (AS), respectively. Compared to the RS, SC hydration in both regions increased at the BS or during ES, and sebum increased at the BS but lower during ES. Compared to during ES, Sebum increased in AS but lower than RS. Compared to the RS, pH decreased in both regions at the BS in the majority of groups, and increased in frontal region during ES and in zygomatic region in the AS. There was an increase in pH in both regions during ES in the majority of groups compared to the BS, but a decrease in the AS compared to during ES. The study implies that even in summer, after we sweat excessively, lipid products should be applied locally in order to maintain stability of the barrier function of the SC. The study suggests that after a short term(1 h or less) of self adjustment, excessive sweat from moderate exercise will not impair the primary acidic surface pH of the facial skin. Exercise-induced sweating significantly affected the skin physiological properties of facial region. © 2012 John Wiley & Sons A/S.

  9. Efficacy of keishibukuryogan, a traditional Japanese herbal medicine, in treating cold sensation and numbness after stroke: clinical improvement and skin temperature normalization in 22 stroke patients.

    Science.gov (United States)

    Fujita, Keishi; Yamamoto, Tetsuya; Kamezaki, Takao; Matsumura, Akira

    2010-01-01

    Cold sensation and numbness have been reported as post-stroke sensory sequelae attributable to distal axonopathy, which is caused by chronic ischemia of diseased limbs resulting from dysfunction of vasomotor regulatory systems. Keishibukuryogan is a traditional herbal medicine used to treat symptoms of peripheral ischemia such as cold extremities. This study investigated clinical improvement and skin temperature in peripheral ischemia patients to determine the efficacy of keishibukuryogan in alleviating post-stroke cold sensation and numbness. Twenty-two stroke patients with cold sensation and/or numbness were enrolled in this study. Subjective cold sensation and numbness, evaluated using the visual analogue scale, were found in 21 and 31 limbs, respectively. The skin temperature of diseased and healthy limbs was recorded. We observed all patients for 4 weeks and 17 patients for 8 weeks after administration of keishibukuryogan. The skin temperature of diseased limbs was significantly higher than baseline at 4 weeks and 8 weeks, whereas that of healthy limbs did not change significantly. Cold sensation and numbness were significantly improved at 4 weeks and 8 weeks compared to baseline. Keishibukuryogan administration resulted in warming of diseased limbs and improved cold sensation and numbness, probably by increasing peripheral blood flow.

  10. Your Skin

    Science.gov (United States)

    ... Safe Videos for Educators Search English Español Your Skin KidsHealth / For Kids / Your Skin What's in this ... body) are really dead skin cells. Bye-Bye Skin Cells These old cells are tough and strong, ...

  11. Comparative potency of formulations of mometasone furoate in terms of inhibition of ′PIRHR′ in the forearm skin of normal human subjects measured with laser doppler velocimetry

    Directory of Open Access Journals (Sweden)

    Kulhalli Prabhakar

    2005-01-01

    Full Text Available BACKGROUND AND AIMS: Topical glucocorticoid formulations are widely used for effective treatment and control of a variety of dermatoses. Mometasone furoate is a newer corticoid that has high potency but low systemic toxicity. Pharmaceutical factors are known to significantly influence potency and systemic absorption of topically applied glucocorticoids. We studied the potency of "Elocon", a topical formulation of mometasone furoate, compared with two other branded formulations of the same corticoid. METHODS: Corticoid potency was measured by employing a pharmacodynamic parameter of an inhibitory effect of the corticoid on post-ischemic-reactive-hyperemic-response (PIRHR in human forearm skin under occlusive dressing. The PIRHR was expressed in terms of % increase in the skin blood flow (SBF as measured with laser doppler velocimetry (LDV. RESULTS : All three active branded formulations of mometasone furoate produced significant inhibition of PIRHR. The AUC(0-2min of PIRHR was ( Mean ± SEM , Control = 213.52 ± 11.80, Placebo = 209.77 ± 19.31, Formulation A = 119.83 ± 13.71, Formulation C = 53.67 ± 4.85 and Formulation D = 111.46 ± 22.87. Formulation "C" exhibited significantly higher topical anti-inflammatory potency than formulations "A" or "D". CONCLUSIONS: Thus, branded formulations of the same glucocorticoid, mometasone furoate significantly differed in their topical anti-inflammatory potency. "Elocon" was significantly more potent than the two other branded formulations studied.

  12. Nonablative fractional laser resurfacing in Asian skin--a review.

    Science.gov (United States)

    Sachdeva, Silonie

    2010-12-01

    Skin resurfacing has been a part of cosmetic dermatology for more than two decades now, and most of it has been ablative with traditional aggressive lasers including the CO(2) and erbium. The last few years have seen a revolutionary change with the invention of nonablative lasers for skin tightening. Fractional resurfacing is a new concept of cutaneous remodeling whereby laser-induced zones of microthermal injury are surrounded by normal untreated tissue that helps in quicker healing. The various wavelengths used are 1320, 1440, and 2940 nm with depth of penetration ranging from 25 μ to 1.2 mm. This article reviews the history of nonablative fractional laser resurfacing, its indications, contraindications, and a review of use in Asian skin with Fitzpatrick type III-VI. © 2010 Wiley Periodicals, Inc.

  13. Immunohistochemical analysis of regulatory T cell markers FOXP3 and GITR on CD4(+) CD25(+) T cells in normal skin and inflammatory dermatoses

    NARCIS (Netherlands)

    de Boer, Onno J.; van der Loos, Chris M.; Teeling, Peter; van der Wal, Allard C.; Teunissen, Marcel B. M.

    2007-01-01

    Regulatory T cells (Treg) are a subset of T lymphocytes that play a central role in immunologic tolerance and in the termination of immune responses. The identification of these cells in normal and inflammatory conditions may contribute to a better understanding of underlying pathology. We

  14. Skin Conditions

    Science.gov (United States)

    Your skin is your body's largest organ. It covers and protects your body. Your skin Holds body fluids in, preventing dehydration Keeps harmful ... it Anything that irritates, clogs, or inflames your skin can cause symptoms such as redness, swelling, burning, ...

  15. Potentiation by caffeine of x-ray damage to cultured human skin fibroblasts from normal subjects and ataxia-telangiectasia patients

    International Nuclear Information System (INIS)

    Furcinitti, P.S.

    1983-01-01

    Caffeine was found to potentiate x-ray-induced killing of human diploid fibroblasts from a normal subject and an ataxia-telangiectasia (AT) patient when it was present at 2 mM concentration for 30 to 66 h postirradiation. The dose-modifying factor for caffeine-treated normal cells had an average value of 1.26 +- 0.13 which did not vary significantly with treatment time or x-ray dose. The dose-modifying factor for caffeine-treated AT cells was 1.12 +- 0.12 at 30 h, rose to 1.66 +- 0.17 at 41 h, and decreased to 1.31 +- 0.13 at 66 h. Thus no clear difference was observed between these two cell strains' susceptibility to postirradiation caffeine treatment

  16. Circumstances surrounding aneurysmal subarachnoid hemorrhage

    NARCIS (Netherlands)

    Schievink, W. I.; Karemaker, J. M.; Hageman, L. M.; van der Werf, D. J.

    1989-01-01

    The circumstances surrounding aneurysmal subarachnoid hemorrhage were investigated in a group of 500 consecutive patients admitted to a neurosurgical center. Subarachnoid hemorrhage occurred during stressful events in 42.8% of the patients, during nonstrenuous activities in 34.4%, and during rest or

  17. Skin abscess

    Science.gov (United States)

    Abscess - skin; Cutaneous abscess; Subcutaneous abscess; MRSA - abscess; Staph infection - abscess ... Skin abscesses are common and affect people of all ages. They occur when an infection causes pus ...

  18. EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA); Scientific Opinion on the substantiation of health claims related to astaxanthin and protection of the skin from UV-induced damage (ID 1687, 1979), defence against Helicobacter pylori (ID 1686), contribution to normal spermatogenesis

    DEFF Research Database (Denmark)

    Tetens, Inge

    claims in relation to astaxanthin and protection of the skin from UV-induced damage, defence against Helicobacter pylori, contribution to normal spermatogenesis, contribution to normal muscle function, and “immune system”. The scientific substantiation is based on the information provided by the Member...

  19. Stimulus size dependence of hue changes induced by chromatic surrounds.

    Science.gov (United States)

    Kellner, Christian Johannes; Wachtler, Thomas

    2016-03-01

    A chromatic surround induces a change in the perceived hue of a stimulus. This shift in hue depends on the chromatic difference between the stimulus and the surround. We investigated how chromatic induction varies with stimulus size and whether the size dependence depends on the surround hue. Subjects performed asymmetric matching of color stimuli with different sizes in surrounds of different chromaticities. Generally, induced hue shifts decreased with increasing stimulus size. This decrease was quantitatively different for different surround hues. However, when size effects were normalized to an overall induction strength, the chromatic specificity was largely reduced. The separability of inducer chromaticity and stimulus size suggests that these effects are mediated by different neural mechanisms.

  20. Effect of Equal Daily Doses Achieved by Different Power Densities of Low-Level Laser Therapy at 635 nm on Open Skin Wound Healing in Normal and Diabetic Rats

    Directory of Open Access Journals (Sweden)

    Róbert Kilík

    2014-01-01

    Full Text Available Background and Objective. Despite the fact that the molecular mechanism of low-level laser therapy (LLLT is not yet known, the exploitation of phototherapy in clinical medicine and surgery is of great interest. The present study investigates the effects of LLLT on open skin wound healing in normal and diabetic rats. Materials and Methods. Four round full-thickness skin wounds on dorsum were performed in male adult nondiabetic (n=24 and diabetic (n=24 Sprague–Dawley rats. AlGaInP (635 nm, wavelength; 5 J/cm2, daily dose was used to deliver power densities of 1, 5, and 15 mW/cm2 three times daily until euthanasia. Results. PMNL infiltration was lower in the irradiated groups (15 mW/cm2. The synthesis and organisation of collagen fibres were consecutively enhanced in the 5 mW/cm2 and 15 mW/cm2 groups compared to the others in nondiabetic rats. In the diabetic group the only significant difference was recorded in the ratio PMNL/Ma at 15 mW/cm2. A significant difference in the number of newly formed capillaries in the irradiated group (5, 15 mW/cm2 was recorded on day six after injury compared to the control group. Conclusion. LLLT confers a protective effect against excessive inflammatory tissue response; it stimulates neovascularization and the early formation of collagen fibres.

  1. Skin Cancer.

    Science.gov (United States)

    Linares, Miguel A; Zakaria, Alan; Nizran, Parminder

    2015-12-01

    Skin cancer accounts for most malignancies across the globe. They are primarily divided into melanoma and nonmelanoma skin malignancies. Nonmelanoma skin cancer includes basal cell carcinoma and squamous cell carcinoma. Fair skin and chronic ultraviolet B exposure are the most important risk factors. Primary prevention is achieved by avoiding sun exposure and tanning beds. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Skin tightening.

    Science.gov (United States)

    Woolery-Lloyd, Heather; Kammer, Jenna N

    2011-01-01

    Skin tightening describes the treatment of skin laxity via radiofrequency (RF), ultrasound, or light-based devices. Skin laxity on the face is manifested by progressive loss of skin elasticity, loosening of the connective tissue framework, and deepening of skin folds. This results in prominence of submandibular and submental tissues. Genetic factors (chronological aging) and extrinsic factors (ultraviolet radiation) both contribute to skin laxity. There are many RF, ultrasound, and light-based devices directed at treating skin laxity. All of these devices target and heat the dermis to induce collagen contraction. Heating of the dermis causes collagen denaturation and immediate collagen contraction in addition to long-term collagen remodeling. Via RF, light, or ultrasound, these skin tightening devices deliver heat to the dermis to create new collagen and induce skin tightening. This chapter will provide an overview of the various skin tightening devices. Copyright © 2011 S. Karger AG, Basel.

  3. Diffuse reflectance imaging for non-melanoma skin cancer detection using laser feedback interferometry

    Science.gov (United States)

    Mowla, Alireza; Taimre, Thomas; Lim, Yah L.; Bertling, Karl; Wilson, Stephen J.; Prow, Tarl W.; Soyer, H. P.; Rakić, Aleksandar D.

    2016-04-01

    We propose a compact, self-aligned, low-cost, and versatile infrared diffuse-reflectance laser imaging system using a laser feedback interferometry technique with possible applications in in vivo biological tissue imaging and skin cancer detection. We examine the proposed technique experimentally using a three-layer agar skin phantom. A cylindrical region with a scattering rate lower than that of the surrounding normal tissue was used as a model for a non-melanoma skin tumour. The same structure was implemented in a Monte Carlo computational model. The experimental results agree well with the Monte Carlo simulations validating the theoretical basis of the technique. Results prove the applicability of the proposed technique for biological tissue imaging, with the capability of depth sectioning and a penetration depth of well over 1.2 mm into the skin phantom.

  4. Y-type congenital urethral duplication with normal dorsal urethra and small ventral fistula to perineal skin – 28th reported case

    Directory of Open Access Journals (Sweden)

    Donald E. Meier

    2016-05-01

    Full Text Available There are numerous types of urethral duplication previously described in the literature including a Type IIA2Y where a large ventral channel branches from the hypoplastic, dorsal, orthotopic urethra. There have been 27 previously reported cases of a similar defect, called “congenital posterior urethrocutaneous fistula” (CUPF with the only difference being that the ventral urethra is hypoplastic and the dorsal, orthotopic one normal. The difference in treatment for these 2 entities is markedly different, and preoperative identification of the appropriate abnormality is essential. Treatment of CUPF requires only safe excision of the ventral segment, but treatment for a Type IIA2Y duplication requires resection of the hypoplastic, orthotopic urethra and transposition of the larger ventral segment into the dorsal orthotopic position. The outcome for treatment of CUPF is much better than for treatment of Type IIA2Y entities. We herein present the 28th case of CUPF in the English literature with discussion of the anatomy, appropriate diagnostic criteria, and safe method of treatment for these entities.

  5. Opportunity's Surroundings on Sol 1818

    Science.gov (United States)

    2009-01-01

    NASA's Mars Exploration Rover Opportunity used its navigation camera to take the images combined into this full-circle view of the rover's surroundings during the 1,818th Martian day, or sol, of Opportunity's surface mission (March 5, 2009). South is at the center; north at both ends. The rover had driven 80.3 meters (263 feet) southward earlier on that sol. Tracks from the drive recede northward in this view. The terrain in this portion of Mars' Meridiani Planum region includes dark-toned sand ripples and lighter-toned bedrock. This view is presented as a cylindrical projection with geometric seam correction.

  6. Hydrogen water intake via tube-feeding for patients with pressure ulcer and its reconstructive effects on normal human skin cells in vitro

    Science.gov (United States)

    2013-01-01

    Background Pressure ulcer (PU) is common in immobile elderly patients, and there are some research works to investigate a preventive and curative method, but not to find sufficient effectiveness. The aim of this study is to clarify the clinical effectiveness on wound healing in patients with PU by hydrogen-dissolved water (HW) intake via tube-feeding (TF). Furthermore, normal human dermal fibroblasts OUMS-36 and normal human epidermis-derived cell line HaCaT keratinocytes were examined in vitro to explore the mechanisms relating to whether hydrogen plays a role in wound-healing at the cellular level. Methods Twenty-two severely hospitalized elderly Japanese patients with PU were recruited in the present study, and their ages ranged from 71.0 to 101.0 (86.7 ± 8.2) years old, 12 male and 10 female patients, all suffering from eating disorder and bedridden syndrome as the secondary results of various underlying diseases. All patients received routine care treatments for PU in combination with HW intake via TF for 600 mL per day, in place of partial moisture replenishment. On the other hand, HW was prepared with a hydrogen-bubbling apparatus which produces HW with 0.8-1.3 ppm of dissolved hydrogen concentration (DH) and −602 mV to −583 mV of oxidation-reduction potential (ORP), in contrast to reversed osmotic ultra-pure water (RW), as the reference, with DH of < 0.018 ppm and ORP of +184 mV for use in the in vitro experimental research. In in vitro experiments, OUMS-36 fibroblasts and HaCaT keratinocytes were respectively cultured in medium prepared with HW and/or RW. Immunostain was used for detecting type-I collagen reconstruction in OUMS-36 cells. And intracellular reactive oxygen species (ROS) were quantified by NBT assay, and cell viability of HaCaT cells was examined by WST-1 assay, respectively. Results Twenty-two patients were retrospectively divided into an effective group (EG, n = 12) and a less effective group (LG, n = 10) according to

  7. Targeted Therapy in Nonmelanoma Skin Cancers

    Directory of Open Access Journals (Sweden)

    Giulia Spallone

    2011-05-01

    Full Text Available Nonmelanoma skin cancer (NMSC is the most prevalent cancer in light-skinned populations, and includes mainly Basal Cell Carcinomas (BCC, representing around 75% of NMSC and Squamous Cell Carcinomas (SCC. The incidence of these tumors is continuously growing. It was found that the overall number of procedures for NMSC in US rose by 76%, from 1,158,298 in 1992 to 2,048,517 in 2006. Although mortality from NMSC tends to be very low, clearly the morbidity related to these skin cancers is very high. Treatment options for NMSC include both surgical and nonsurgical interventions. Surgery was considered the gold standard therapy, however, advancements in the knowledge of pathogenic mechanisms of NMSCs led to the identification of key targets for drug intervention and to the consequent development of several targeted therapies. These represent the future in treatment of these common forms of cancer ensuring a high cure rate, preservation of the maximal amount of normal surrounding tissue and optimal cosmetic outcome. Here, we will review recent advancements in NMSC targeted therapies focusing on BCC and SCC.

  8. Targeted Therapy in Nonmelanoma Skin Cancers

    International Nuclear Information System (INIS)

    Spallone, Giulia; Botti, Elisabetta; Costanzo, Antonio

    2011-01-01

    Nonmelanoma skin cancer (NMSC) is the most prevalent cancer in light-skinned populations, and includes mainly Basal Cell Carcinomas (BCC), representing around 75% of NMSC and Squamous Cell Carcinomas (SCC). The incidence of these tumors is continuously growing. It was found that the overall number of procedures for NMSC in US rose by 76%, from 1,158,298 in 1992 to 2,048,517 in 2006. Although mortality from NMSC tends to be very low, clearly the morbidity related to these skin cancers is very high. Treatment options for NMSC include both surgical and nonsurgical interventions. Surgery was considered the gold standard therapy, however, advancements in the knowledge of pathogenic mechanisms of NMSCs led to the identification of key targets for drug intervention and to the consequent development of several targeted therapies. These represent the future in treatment of these common forms of cancer ensuring a high cure rate, preservation of the maximal amount of normal surrounding tissue and optimal cosmetic outcome. Here, we will review recent advancements in NMSC targeted therapies focusing on BCC and SCC

  9. Opportunity's Surroundings on Sol 1687

    Science.gov (United States)

    2009-01-01

    NASA's Mars Exploration Rover Opportunity used its navigation camera to take the images combined into this 360-degree view of the rover's surroundings on the 1,687th Martian day, or sol, of its surface mission (Oct. 22, 2008). Opportunity had driven 133 meters (436 feet) that sol, crossing sand ripples up to about 10 centimeters (4 inches) tall. The tracks visible in the foreground are in the east-northeast direction. Opportunity's position on Sol 1687 was about 300 meters southwest of Victoria Crater. The rover was beginning a long trek toward a much larger crater, Endeavour, about 12 kilometers (7 miles) to the southeast. This view is presented as a cylindrical projection with geometric seam correction.

  10. Opportunity's Surroundings on Sol 1798

    Science.gov (United States)

    2009-01-01

    NASA's Mars Exploration Rover Opportunity used its navigation camera to take the images combined into this 180-degree view of the rover's surroundings during the 1,798th Martian day, or sol, of Opportunity's surface mission (Feb. 13, 2009). North is on top. The rover had driven 111 meters (364 feet) southward on the preceding sol. Tracks from that drive recede northward in this view. For scale, the distance between the parallel wheel tracks is about 1 meter (about 40 inches). The terrain in this portion of Mars' Meridiani Planum region includes dark-toned sand ripples and lighter-toned bedrock. This view is presented as a cylindrical projection with geometric seam correction.

  11. Is the Fractional Laser Still Effective in Assisting Cutaneous Macromolecule Delivery in Barrier-Deficient Skin? Psoriasis and Atopic Dermatitis as the Disease Models.

    Science.gov (United States)

    Lee, Woan-Ruoh; Shen, Shing-Chuan; Sung, Calvin T; Liu, Pei-Ying; Fang, Jia-You

    2018-04-26

    Most of the investigations into laser-assisted skin permeation have used the intact skin as the permeation barrier. Whether the laser is effective in improving cutaneous delivery via barrier-defective skin is still unclear. In this study, ablative (Er:YAG) and non-ablative (Er:glass) lasers were examined for the penetration of peptide and siRNA upon topical application on in vitro skin with a healthy or disrupted barrier. An enhanced peptide flux (6.9 fold) was detected after tape stripping of the pig stratum corneum (SC). A further increase of flux to 11.7 fold was obtained after Er:YAG laser irradiation of the SC-stripped skin. However, the application of Er:glass modality did not further raise the flux via the SC-stripped skin. A similar trend was observed in the case of psoriasiform skin. Conversely, the flux was enhanced 3.7 and 2.6 fold after treatment with the Er:YAG and the Er:glass laser on the atopic dermatitis (AD)-like skin. The 3-D skin structure captured by confocal microscopy proved the distribution of peptide and siRNA through the microchannels and into the surrounding tissue. The fractional laser was valid for ameliorating macromolecule permeation into barrier-disrupted skin although the enhancement level was lower than that of normal skin.

  12. Skin Complications

    Science.gov (United States)

    ... Text Size: A A A Listen En Español Skin Complications Diabetes can affect every part of the ... lipoidica diabeticorum, diabetic blisters, and eruptive xanthomatosis. General Skin Conditions Bacterial Infections Several kinds of bacterial infections ...

  13. Cryotherapy - skin

    Science.gov (United States)

    Cryosurgery - skin; Warts - freezing; Warts - cryotherapy; Actinic keratosis - cryotherapy; Solar keratosis - cryotherapy ... may be used to: Remove warts Destroy precancerous skin lesions (actinic keratoses or solar keratoses) In rare ...

  14. Skin Cancer

    Science.gov (United States)

    Skin cancer is the most common form of cancer in the United States. The two most common types ... face, neck, hands, and arms. Another type of skin cancer, melanoma, is more dangerous but less common. Anyone ...

  15. Sagging Skin

    Science.gov (United States)

    ... turkey neck,” this occurs as skin loses its elasticity and in cases where individuals have lost a ... technique or procedure is appropriate for my skin type? Did the doctor show me before-and-after ...

  16. Skin Biopsy

    Science.gov (United States)

    ... Development Infections Diseases & Conditions Pregnancy & Baby Nutrition & Fitness Emotions & Behavior School & Family Life First Aid & Safety Doctors & ... like these: skin rashes or conditions, such as eczema or psoriasis skin infections, such as staph diseases, ...

  17. Modifications of center-surround, spot detection and dot-pattern selective operators

    NARCIS (Netherlands)

    Petkov, Nicolai; Visser, Wicher T.

    2005-01-01

    This paper describes modifications of the models of center-surround and dot-pattern selective cells proposed previously. These modifications concern mainly the normalization of the difference of Gaussians (DoG) function used to model center-surround receptive fields, the normalization of

  18. Skin Aging

    Science.gov (United States)

    Your skin changes as you age. You might notice wrinkles, age spots and dryness. Your skin also becomes thinner and loses fat, making it ... heal, too. Sunlight is a major cause of skin aging. You can protect yourself by staying out ...

  19. Anti-oxidant defence mechanism in vitiliginous skin increases with skin type

    NARCIS (Netherlands)

    Briganti, S.; Caron-Schreinemachers, A.-L. D. B.; Picardo, M.; Westerhof, W.

    2012-01-01

    Background Vitiligo skin shows different burning capacity in people with different phototype. In normal skin antioxidant status is correlated to skin phototype, but unexpectedly it appears that there is a gradual decrease in burning susceptibility of depigmented skin of individuals with increasing

  20. The measurement of skin impedance for the diagnosis of skin cancer

    International Nuclear Information System (INIS)

    Menzies, S.; Crook, B.; McCarthy, W.

    1996-01-01

    Full text: In vivo skin impedance measurements have been reported to be diagnostic in differentiating benign from malignant skin tumours (Kiss G et al. Borgyogy Vener Szle 45: 164,1969; Melczer N. In: Cancer of the Skin. Saunders Co. Philadelphia, 1976, pp293-313). However, in contrast to non-melanoma skin cancer, only, a small sample of malignant melanomas were reported in these previous studies. We performed skin impedance measurements on a larger sample of melanomas in order to assess the potential use of such instrumentation for clinical diagnosis. The diagnostic method described by Kiss and Horvath was reproduced with only minor modifications. Low voltage impedance measurements at 1600 Hz were taken over each lesion and on nearby surrounding normal skin. Filter paper (4mm diameter) soaked in 0.1 M KCl was used at the skin-probe interface. A minimum of 2 skin and 1 lesion measurements were taken. All lesions were taken from relatively hairless sites and were non abraded or ulcerated. With the exception of 6 seborrhoeic keratoses all lesions were excised for histological diagnosis. The lesions tested were 27 invasive melanomas, 3 in situ melanomas, 27 basal cell carcinomas (BCC), 70 benign melanocytic lesions, 19 seborrhoeic keratoses, 5 Bowens disease (in situ SCC), 1 squamous cell carcinoma (SCC) and 25 other benign lesions. Results were interpreted as previously (Melczer) by the quotient of skin impedance / lesion impedance > 1.5 indicating malignancy. Analysis of total melanocytic lesions gave a sensitivity of 44% and specificity of 83% for the diagnosis of invasive melanoma (p < 0.05). Fifty two percent of BCCs were positively diagnosed. Analysis of all benign versus all invasive malignancy gave a sensitivity of 47% and specificity of 77% for the diagnosis of invasive malignancy (p < 0.01). While impedance measurements at 1600 Hz provide a statistically significant differentiation of melanoma versus non-melanoma and invasive malignancy versus benign lesions

  1. ICRP-26 and skin contamination

    International Nuclear Information System (INIS)

    Finnigan, T.; Huda, W.; Newbery, G.R.

    1979-01-01

    The experience of dealing with skin contamination incidents at The Radiochemical Centre over a 3-year period is presented. Data are given for the primary isotopes involved, the duration of skin contamination, and the skin doses that arise from these incidents. The methods employed in performing dosimetry for skin contamination are discussed and examples involving the isotopes carbon-14 and indium-111 are described. For skin contamination incidents, the mode of penetration of the activity into skin is normally not known and this can be of major significance for the final skin dose estimate. The operational health physics difficulties encountered in complying with both ICRP-26 and UK legislation for skin contamination are considered. In the event of multiple exposure (i.e. skin doses calculated from whole body film badges, extremity TLD dose meters and skin contamination) there is ambiguity in the precise meaning of the skin dose. The usefulness of Derived Working Levels is also discussed. Experience at The Radiochemical Centre has shown that good plant design, proper training and prompt action in dealing with contamination incidents ensures that overexposures to skin from accidental contamination are rare occurrences. (author)

  2. Quantification of thermal damage in skin tissue

    Institute of Scientific and Technical Information of China (English)

    Xu Feng; Wen Ting; Lu Tianjian; Seffen Keith

    2008-01-01

    Skin thermal damage or skin burns are the most commonly encountered type of trauma in civilian and military communities. Besides, advances in laser, microwave and similar technologies have led to recent developments of thermal treatments for disease and damage involving skin tissue, where the objective is to induce thermal damage precisely within targeted tissue structures but without affecting the surrounding, healthy tissue. Further, extended pain sensation induced by thermal damage has also brought great problem for burn patients. Thus, it is of great importance to quantify the thermal damage in skin tissue. In this paper, the available models and experimental methods for quantification of thermal damage in skin tissue are discussed.

  3. Binaural Rendering in MPEG Surround

    Directory of Open Access Journals (Sweden)

    Kristofer Kjörling

    2008-04-01

    Full Text Available This paper describes novel methods for evoking a multichannel audio experience over stereo headphones. In contrast to the conventional convolution-based approach where, for example, five input channels are filtered using ten head-related transfer functions, the current approach is based on a parametric representation of the multichannel signal, along with either a parametric representation of the head-related transfer functions or a reduced set of head-related transfer functions. An audio scene with multiple virtual sound sources is represented by a mono or a stereo downmix signal of all sound source signals, accompanied by certain statistical (spatial properties. These statistical properties of the sound sources are either combined with statistical properties of head-related transfer functions to estimate “binaural parameters” that represent the perceptually relevant aspects of the auditory scene or used to create a limited set of combined head-related transfer functions that can be applied directly on the downmix signal. Subsequently, a binaural rendering stage reinstates the statistical properties of the sound sources by applying the estimated binaural parameters or the reduced set of combined head-related transfer functions directly on the downmix. If combined with parametric multichannel audio coders such as MPEG Surround, the proposed methods are advantageous over conventional methods in terms of perceived quality and computational complexity.

  4. Skin Picking Disorder

    Directory of Open Access Journals (Sweden)

    Pinar Cetinay Aydin

    2014-08-01

    Full Text Available Skin picking disorder is not a dermatological disorder and it is a table characterized with picking skin excessively and repetitively, leading to damage in skin tissue. Unlike normal picking behaviour, psychogenic skin picking is repetitive and it can lead to severe damage in the skin and even complications which constitute vital danger. While some patients define frequent but short lasting picking attacks, others define rarer attacks which last a few hours. Skin picking disorder, which is not included in the classification systems up to DSM-5 as a separate diagnosis category, is included as an independent diagnosis in Obsessive Compulsive Disorder and Associated Disorders category in DSM-5. In case reports, open label studies and double blind studies selective serotonin reuptake inhibitors are shown to be effective in the treatment of skin picking disorder. Mostly, cognitive-behaviourial techniques are used and have been proven to be useful in psychotherapy. Habit reversal is one of the behaviourial techniques which are frequently applied, give positive results in which well-being state can be maintained. [Psikiyatride Guncel Yaklasimlar - Current Approaches in Psychiatry 2014; 6(4.000: 401-428

  5. Characterization of oily mature skin by biophysical and skin imaging techniques.

    Science.gov (United States)

    de Melo, M O; Maia Campos, P M B G

    2018-02-13

    The skin is a complex biological system and may suffer change according to the environmental factors, as higher temperatures can increase sebum excretion, presenting oiliness and acne. These alterations can persist during the aging and provoke more changes in aged skin. In this study we evaluated the mature oily skin characteristics using biophysical and skin imaging techniques. Sixty healthy female subjects, aged between 39 and 55 years old were recruited and separated into 2 groups according to their skin type: normal/dry and oily skin. The skin was evaluated in terms of stratum corneum water content, transepidermal water loss (TEWL) sebum content, dermis thickness and echogenicity, skin microrelief, and pores content. The mature oily skin presented no significant differences when compared to the normal/dry skin on the stratum corneum water content and TEWL parameters. The sebum content was significantly higher on the oily skin group. The microrelief analysis showed an increase of skin roughness values in the oily skin and increase of scaliness in the normal/dry skin. The oily skin showed lower dermis echogenicity mainly in the frontal region and higher dermis thickness when compared to normal/dry skin. The mature oily skin showed different characteristics from normal/dry skin in terms of sebum content, microrelief parameters, and dermis thickness. This way, the characterization of mature oily skin in an objective way is very important to development of dermocosmetic products for more effective treatments focused specially on this type of skin. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. Quantification of thermal damage in skin tissue

    Institute of Scientific and Technical Information of China (English)

    徐峰; 文婷; 卢天健; Seffen; Keith

    2008-01-01

    Skin thermal damage or skin burns are the most commonly encountered type of trauma in civilian and military communities. Besides, advances in laser, microwave and similar technologies have led to recent developments of thermal treatments for disease and damage involving skin tissue, where the objective is to induce thermal damage precisely within targeted tissue structures but without affecting the surrounding, healthy tissue. Further, extended pain sensation induced by thermal damage has also brought great...

  7. The glycan-specific sulfotransferase (R77W)GalNAc-4-ST1 putatively responsible for peeling skin syndrome has normal properties consistent with a simple sequence polymorphisim.

    Science.gov (United States)

    Fiete, Dorothy; Mi, Yiling; Beranek, Mary; Baenziger, Nancy L; Baenziger, Jacques U

    2017-05-01

    Expanded access to DNA sequencing now fosters ready detection of site-specific human genome alterations whose actual significance requires in-depth functional study to rule in or out disease-causing mutations. This is a particular concern for genomic sequence differences in glycosyltransferases, whose implications are often difficult to assess. A recent whole-exome sequencing study identifies (c.229 C > T) in the GalNAc-4-ST1 glycosyltransferase (CHST8) as a disease-causing missense R77W mutation yielding the genodermatosis peeling skin syndrome (PSS) when homozygous. Cabral et al. (Genomics. 2012;99:202-208) cite this sequence change as reducing keratinocyte GalNAc-4-ST1 activity, thus decreasing glycosaminoglycan sulfation, as the mechanism for this blistering disorder. Such an identification could point toward potential clinical and/or prenatal diagnosis of a harmful medical condition. However, GalNAc-4-ST1 has minimal activity toward glycosaminoglycans, instead modifying terminal β1,4-linked GalNAc on N- and O-linked oligosaccharides on specific glycoproteins. We find expression, processing and catalytic activity of GalNAc-4-ST1 completely equivalent between wild type and (R77W) sulfotransferases. Moreover, keratinocytes have little or no GalNAc-4-ST1 mRNA, indicating that they do not express GalNAc-4-ST1. In addition, loss-of-function of GalNAc-4-ST1 primarily presents as reproductive system aberrations rather than skin effects. These findings, an allele frequency of 0.004357, and a 10-fold difference in prevalence of CHST8 (c.299 C > T, R77W) across different ethnic groups, suggest that this sequence represents a "passenger" distributed polymorphism, a simple sequence variant form of the enzyme having normal activity, rather than a "driver" disease-causing mutation that accounts for PSS. This study presents an example for guiding biomedical research initiatives, as well as medical and personal/family perspectives, regarding newly-identified genomic sequence

  8. Monitoring program of surrounding of the NPP SE-EBO

    International Nuclear Information System (INIS)

    Dobis, L.; Kostial, J.

    1997-01-01

    The paper dealt with monitoring program of radiation control of surrounding of the NPP Bohunice, which has the aim: (1) to ensure the control of influence of work of the NPP Bohunice on the environment in their surrounding; (2) to ensure the back-ground for regular brief of control and supervisory organs about condition of the environment in surrounding of the NPP Bohunice; (3) to maintain the expected technical level of control of the NPP Bohunice and to exploit optimally the technical means; (4) to solicit permanently the data about the radioactivity of environment in surrounding of the NPP Bohunice for forming of files of the data; (5) to exploit purposefully the technical equipment, technical workers and to maintain their in permanent emergency and technical eligibility for the case of the breakdown; (6) to obtain permanently the files of the values for qualification of the reference levels. This program of monitoring includes the radiation control of surrounding of the NPP Bohunice, in the time of normal work of power-station's blocks, inclusively of all types of trouble-shooting and repairer works in surrounding of the NPP Bohunice, up to distance 20 km from power-station. The monitoring includes: outlets from the NPP Bohunice, monitoring of radiation characteristics in surrounding of the NPP Bohunice, (aerosols, fall-outs, soil), the links of food chains: (grass and fodder, milk, agriculture products), hydrosphere in surrounding (surface waters, drink water, bores of radiation control in complex of the NPP Bohunice, components of the hydrosphere), measurement of radiation from external sources (measurement of the dose rates, measurement of the doses [sk

  9. Dry Skin Relief

    Science.gov (United States)

    ... on a budget Skin care products Skin care secrets Skin lighteners Skin of color Summer skin problems ... condition, such as eczema. Additional related information Dermatologists' top tips for relieving dry skin FIND A DERMATOLOGIST ...

  10. A Comparison of the Local Flap and Skin Graft by Location of Face in Reconstruction after Resection of Facial Skin Cancer.

    Science.gov (United States)

    Lee, Kyung Suk; Kim, Jun Oh; Kim, Nam Gyun; Lee, Yoon Jung; Park, Young Ji; Kim, Jun Sik

    2017-12-01

    Surgery for reconstruction of defects after surgery should be performed selectively and the many points must be considered. The authors conducted this study to compare the local flap and skin graft by facial location in the reconstruction after resection of facial skin cancer. The authors performed the study in patients that had received treatment in Department of Plastic Surgery, Gyeongsang National University. The cases were analyzed according to the reconstruction methods for the defects after surgery, sex, age, tumor site, and tumor size. Additionally, the authors compared differences of aesthetic satisfaction (out of 5 points) of patients in the local flap and skin graft by facial location after resection of facial skin cancer by dividing the face into eight areas. A total of 153 cases were confirmed. The most common facial skin cancer was basal cell carcinoma (56.8%, 87 cases), followed by squamous cell carcinoma (37.2%, 57 cases) and bowen's disease (5.8%, 9 cases). The most common reconstruction method was local flap 119 cases (77.7%), followed by skin graft 34 cases (22.3%). 86 patients answered the questionnaire and mean satisfaction of the local flap and skin graft were 4.3 and 3.5 ( p =0.04), respectively, indicating that satisfaction of local flap was significantly high. When comparing satisfaction of patients according to results, local flap shows excellent effects in functional and cosmetic aspects would be able to provide excellent results rather than using a skin graft with poor touch and tone compared to the surrounding normal skin.

  11. Skin graft viability test

    International Nuclear Information System (INIS)

    Wahner, H.W.; Robertson, J.S.

    1983-01-01

    With respect to skin pedicles (tubular pedicle or direct flap), an estimation of the blood supply is of great importance in making a decision as to when to perform the separation from the original blood supply. This decision is based on empiric observation of the normal time of healing and varies greatly with the site and the concepts of the individual surgery. A number of methods have been proposed for testing the circulation of pedicle skin flaps or tubes, and these methods all seem more complicated and less accurate than the isotope method that is described in this chapter

  12. Skin cancer

    International Nuclear Information System (INIS)

    Yamada, Michiko

    1992-01-01

    This chapter reviews the development of skin cancer associated with radiation, focusing on the knowledge of A-bomb radiation-induced skin cancer. Since the discovery of X radiation in 1895, acute and chronic radiation dermatitis has been the first matter of concern. Then, in 1902, skin cancer found among radiological personnel has posed a social problem. In earlier study determining the relationship between skin cancer and A-bomb radiation, there is no increase in the incidence of either skin cancer or precancerous condition during the first 20 years after A-bombing. More recent studies have showed that there is a significant correlation between the incidence of skin cancer and distance from the hypocenter; and the incidence of skin cancer is found to be remarkably increased since 1975 in the group exposed at ≤2,000 m. Excess relative risk is 2.2 at one Gy dose. The incidence of skin cancer is also found to be extremely increased with aging. Relative risk is high in younger A-bomb survivors at the time of exposure. Histologically, basal cell carcinoma is more senstitive to ionizing radiation than squamous cell carcinoma. (N.K.)

  13. Ultrastructural changes in human skin after exposure to a pulsed laser

    Energy Technology Data Exchange (ETDEWEB)

    Nakagawa, H.; Tan, O.T.; Parrish, J.A.

    1985-05-01

    Selective vascular injury following irradiation using a pulsed laser source at 577 nm was examined using ultrastructural methods in the skin of 3 fair-skinned healthy human volunteers. This vascular-specific damage was confined to the papillary dermis. Red blood cells were altered in several ways. As well as an increase in the electron density, configurational distortion modified the normal biconcave forms to ameboid structures. The most interesting finding was the appearance within these altered cells of well-defined circular/oval electron-lucent areas of 800 A diameter, possibly representing a heat-fixed record of steam formation within the red blood cell. In addition, considerable degenerative changes were evident in endothelial cells and pericytes, while mast cells, neutrophils, histiocytes, and fibroblasts as well as collagen bundles immediately surrounding most laser-damaged blood vessels appeared normal.

  14. Skin care products can aggravate epidermal function: studies in a murine model suggest a pathogenic role in sensitive skin

    OpenAIRE

    Li, Z; Hu, L; Elias, PM; Man, M-Q

    2018-01-01

    Sensitive skin is defined as a spectrum of unpleasant sensations in response to a variety of stimuli. However, only some skin care products provoke cutaneous symptoms in individuals with sensitive skin. Hence, it would be useful to identify products that could provoke cutaneous symptoms in individuals with sensitive skin.To assess whether vehicles, as well as certain branded skin care products, can alter epidermal function following topical applications to normal mouse skin.Following topical ...

  15. Skin Dictionary

    Science.gov (United States)

    ... Registration General information Housing & travel Education Exhibit hall Mobile app 2019 Annual Meeting Derm Exam Prep Course ... SkinPAC State societies Scope of practice Truth in advertising NP/PA laws Action center Public and patients ...

  16. Hyperelastic skin

    Science.gov (United States)

    ... is most often seen in people who have Ehlers-Danlos syndrome. People with this disorder have very elastic skin. ... any member of your family been diagnosed with Ehlers-Danlos syndrome? What other symptoms are present? Genetic counseling may ...

  17. Skin Cancer

    Science.gov (United States)

    ... sunlamps. There are 2 types of UV rays: UVA rays (long-wave) – UVA rays penetrate clouds and glass. They penetrate the ... to cancer. But studies have shown that both UVA and UVB damage the skin and can cause ...

  18. Understanding community norms surrounding tobacco sales.

    Directory of Open Access Journals (Sweden)

    Patricia A McDaniel

    Full Text Available In the US, denormalizing tobacco use is key to tobacco control; less attention has been paid to denormalizing tobacco sales. However, some localities have placed limits on the number and type of retailers who may sell tobacco, and some retailers have abandoned tobacco sales voluntarily. Understanding community norms surrounding tobacco sales may help accelerate tobacco denormalization.We conducted 15 focus groups with customers of California, New York, and Ohio retailers who had voluntarily discontinued tobacco sales to examine normative assumptions about where cigarettes should or should not be sold, voluntary decisions to discontinue tobacco sales, and government limits on such sales.Groups in all three states generally agreed that grocery stores that sold healthy products should not sell tobacco; California groups saw pharmacies similarly, while this was a minority opinion in the other two states. Convenience stores were regarded as a natural place to sell tobacco. In each state, it was regarded as normal and commendable for some stores to want to stop selling tobacco, although few participants could imagine convenience stores doing so. Views on government's role in setting limits on tobacco sales varied, with California and New York participants generally expressing support for restrictions, and Ohio participants expressing opposition. However, even those who expressed opposition did not approve of tobacco sales in all possible venues. Banning tobacco sales entirely was not yet normative.Limiting the ubiquitous availability of tobacco sales is key to ending the tobacco epidemic. Some limits on tobacco sales appear to be normative from the perspective of community members; it may be possible to shift norms further by problematizing the ubiquitous presence of cigarettes and drawing connections to other products already subject to restrictions.

  19. Understanding community norms surrounding tobacco sales.

    Science.gov (United States)

    McDaniel, Patricia A; Malone, Ruth E

    2014-01-01

    In the US, denormalizing tobacco use is key to tobacco control; less attention has been paid to denormalizing tobacco sales. However, some localities have placed limits on the number and type of retailers who may sell tobacco, and some retailers have abandoned tobacco sales voluntarily. Understanding community norms surrounding tobacco sales may help accelerate tobacco denormalization. We conducted 15 focus groups with customers of California, New York, and Ohio retailers who had voluntarily discontinued tobacco sales to examine normative assumptions about where cigarettes should or should not be sold, voluntary decisions to discontinue tobacco sales, and government limits on such sales. Groups in all three states generally agreed that grocery stores that sold healthy products should not sell tobacco; California groups saw pharmacies similarly, while this was a minority opinion in the other two states. Convenience stores were regarded as a natural place to sell tobacco. In each state, it was regarded as normal and commendable for some stores to want to stop selling tobacco, although few participants could imagine convenience stores doing so. Views on government's role in setting limits on tobacco sales varied, with California and New York participants generally expressing support for restrictions, and Ohio participants expressing opposition. However, even those who expressed opposition did not approve of tobacco sales in all possible venues. Banning tobacco sales entirely was not yet normative. Limiting the ubiquitous availability of tobacco sales is key to ending the tobacco epidemic. Some limits on tobacco sales appear to be normative from the perspective of community members; it may be possible to shift norms further by problematizing the ubiquitous presence of cigarettes and drawing connections to other products already subject to restrictions.

  20. Skin Cancer Screening

    Science.gov (United States)

    ... Genetics of Skin Cancer Skin Cancer Screening Research Skin Cancer Screening (PDQ®)–Patient Version What is screening? ... These are called diagnostic tests . General Information About Skin Cancer Key Points Skin cancer is a disease ...

  1. UVB 311 nm tolerance of vitiligo skin increases with skin photo type

    NARCIS (Netherlands)

    Caron-Schreinemachers, Anne-Lou D. B.; Kingswijk, Melanie M.; Bos, Jan D.; Westerhof, Wiete

    2005-01-01

    It is assumed that skin is protected against sunburn by melanin. In patients with vitiligo, there are white patches in the normal pigmented skin. We noticed that there is a difference in burning capacity of these white patches between people with different skin types. With UVB 311 nm lamps, we

  2. Optical coherence tomography for imaging of skin and skin diseases

    DEFF Research Database (Denmark)

    Mogensen, Mette; Thrane, Lars; Jørgensen, Thomas Martini

    2009-01-01

    Optical coherence tomography (OCT) is an emerging imaging technology based on light reflection. It provides real-time images with up to 2-mm penetration into the skin and a resolution of approximately 10 μm. It is routinely used in ophthalmology. The normal skin and its appendages have been studi...... technical solutions are being pursued to further improve the quality of the images and the data provided, and OCT is being integrated in multimodal imaging devices that would potentially be able to provide a quantum leap to the imaging of skin in vivo....

  3. Artificial skin in perspective: concepts and applications.

    Science.gov (United States)

    Brohem, Carla A; Cardeal, Laura B da Silva; Tiago, Manoela; Soengas, María S; Barros, Silvia B de Moraes; Maria-Engler, Silvya S

    2011-02-01

    Skin, the largest organ of the human body, is organized into an elaborate layered structure consisting mainly of the outermost epidermis and the underlying dermis. A subcutaneous adipose-storing hypodermis layer and various appendages such as hair follicles, sweat glands, sebaceous glands, nerves, lymphatics, and blood vessels are also present in the skin. These multiple components of the skin ensure survival by carrying out critical functions such as protection, thermoregulation, excretion, absorption, metabolic functions, sensation, evaporation management, and aesthetics. The study of how these biological functions are performed is critical to our understanding of basic skin biology such as regulation of pigmentation and wound repair. Impairment of any of these functions may lead to pathogenic alterations, including skin cancers. Therefore, the development of genetically controlled and well characterized skin models can have important implications, not only for scientists and physicians, but also for manufacturers, consumers, governing regulatory boards and animal welfare organizations. As cells making up human skin tissue grow within an organized three-dimensional (3D) matrix surrounded by neighboring cells, standard monolayer (2D) cell cultures do not recapitulate the physiological architecture of the skin. Several types of human skin recombinants, also called artificial skin, that provide this critical 3D structure have now been reconstructed in vitro. This review contemplates the use of these organotypic skin models in different applications, including substitutes to animal testing. © 2010 John Wiley & Sons A/S.

  4. Skin decontamination

    International Nuclear Information System (INIS)

    Moehrle, G.

    1975-01-01

    A general survey of skin decontamination is given. The success of every decontamination treatments depends mainly on the speed, but also on the care, with which the action is taken. The best way to remove the skin contaminants is thorough washing under lukewarm running water with mild soap and a soft brush. This washing is to be repeated several times for a period of several minutes. If results are not satisfactory, light duty detergents and wetting agents available commercially may also be used. Some solutions which have proved useful are mentioned. The decontamination solutions are best used in the order given. When one has no satisfactory decontamination effect, the next one is to be used. If necessary, these agents must be used several times in the stated order as long as this does not involve too much strain for the skin. All the decontamination measures mentioned refer, of course, to intact healthy skin. After decontamination has been completed, the skin should be treated with a protective cream

  5. Clarifying Normalization

    Science.gov (United States)

    Carpenter, Donald A.

    2008-01-01

    Confusion exists among database textbooks as to the goal of normalization as well as to which normal form a designer should aspire. This article discusses such discrepancies with the intention of simplifying normalization for both teacher and student. This author's industry and classroom experiences indicate such simplification yields quicker…

  6. Religion's relationship with social boundaries surrounding gender ...

    African Journals Online (AJOL)

    Religion's relationship with social boundaries surrounding gender. ... is associated with segregation, marginalization and differentiation between men and women. ... are necessary in the society it should not be mistaken for gender inequality.

  7. Analysis of entrance skin radiation dose in mammography equipment in Rio Grande do Sul state (Ijui municipality and surroundings) and Rio de Janeiro (metropolitan area); Analise de dose de entrada na pele em mamografos, no Estado do Rio Grande do Sul (Municipio de Ijui e cercanias) e Rio de Janeiro (area metropolitana)

    Energy Technology Data Exchange (ETDEWEB)

    Araujo, Geovane Silva; Padilha Filho, Lucas Gomes, E-mail: geovane.araujo@ftesm.edu.br, E-mail: lucaspadilhaemec@gmail.com [Universidade Estacio de Sa (UNESA), Rio de Janeiro, RJ (Brazil); Sousa, Carlos Henrique Simoes de, E-mail: chenriques2@gmail.com [Instituto de Radioprotecao e Dosimetria (IRD/CNEN-RJ), Rio de Janeiro, RJ (Brazil); Feldmann, Gerson; Albrecht, Marcos R.A., E-mail: gersonpraxis@gmail.com, E-mail: marcosboom@yahoo.com.br [PRAXIS Protecao Radiologica, Ijui, RS (Brazil); Souza, Sergio Augusto Lopes de, E-mail: sergioalsouza@gmail.com [Universidade Federal do Rio de Janeiro (UFRJ), RJ (Brazil)

    2016-07-01

    Mammography is the technique widely used to the early detection of breast cancer, despite of not being a consensus the ideal age to initiate the radiologic examinations, it is recommended that women with the age of forty realize the examinations periodically. With the objective to analyze the entrance skin dose (ESD) in different mammography equipment, Were analyzed in the Estate of Rio Grande do Sul (Ijui City and neighborhoods) and in Rio de Janeiro (metropolitan area) 24 mammography equipment. Among them included in the study, just one presented ESD higher than the established limit of ANVISA. It was observed in the mammography equipment of Ijui and neighborhoods high levels of mAs to achieve the values of ESD next to the limit. (author)

  8. Squamous cell skin cancer

    Science.gov (United States)

    ... that reflect light more, such as water, sand, concrete, and areas that are painted white. The higher ... - skin - squamous cell; Skin cancer - squamous cell; Nonmelanoma skin cancer - squamous ...

  9. Enhancement of Afterimage Colors by Surrounding Contours

    Directory of Open Access Journals (Sweden)

    Takao Sato

    2011-05-01

    Full Text Available Presenting luminance contours surrounding the adapted areas in test phase enhances color afterimages in both duration and color appearance. The presence of surrounding contour is crucial to some color phenomenon such as van Lier's afterimage, but the contour-effect itself has not been seriously examined. In this paper, we compared the contour-effect to color afterimages and to actually colored patches to examine the nature of color information subserving color-aftereffect. In the experiment, observers were adapted for 1 sec to a small colored square (red, green, yellow, or blue presented on a gray background. Then, a test field either with or without surrounding contour was presented. Observers matched the color of a test-patch located near the afterimage to the color of afterimage. It was found that the saturation of negative afterimage was almost doubled by the presence of surrounding contours. There was no effect of luminance contrast or polarity of contours. In contrast, no enhancement of saturation by surrounding contours was observed for actually colored patches even though the colors of patches were equalized to that of afterimage without contours. This dissociation in the contour-effect demonstrates the crucial difference between the color information for aftereffects and for ordinary bottom-up color perception.

  10. Explaining preferences for home surroundings and locations

    DEFF Research Database (Denmark)

    Andersen, Hans Skifter

    2011-01-01

    This article is based on a survey carried out in Denmark that asked a random sample of the population about their preferences for home surroundings and locations. It shows that the characteristics of social surroundings are very important and can be divided into three independent dimensions......: avoiding social nuisances, preferring social homogeneity and living close to one’s social network and place of origin. The study shows that most people have many detailed preferences, whereas some have very few. This confirms an earlier theory that some people are very connected to certain places...... with given characteristics and thus do not have priorities regarding home surroundings and locations. For others, mostly young people and singles, home is just a place to sleep and relax, whereas life is lived elsewhere. For this group, there are only preferences for location and there are few specific...

  11. Birkhoff normalization

    NARCIS (Netherlands)

    Broer, H.; Hoveijn, I.; Lunter, G.; Vegter, G.

    2003-01-01

    The Birkhoff normal form procedure is a widely used tool for approximating a Hamiltonian systems by a simpler one. This chapter starts out with an introduction to Hamiltonian mechanics, followed by an explanation of the Birkhoff normal form procedure. Finally we discuss several algorithms for

  12. Matching the skin barrier to the skin type.

    Science.gov (United States)

    Thompson, Hyacinth; North, Jacqui; Davenport, Rebecca; Williams, Julia

    Peristomal skin problems are thought to be common (Herlufsson et al, 2006; Williams et al, 2010), and can interfere with the security of stoma products. Stoma patients are reliant on the integrity of their peristomal skin to maintain a normal lifestyle. Bekkers et al (1996) highlighted that, if the peristomal skin becomes damaged, it not only affects the person physically, but also psychologically, ultimately prolonging rehabilitation and adaptation to the stoma. Therefore, it can be concluded that maintaining skin integrity is a basic and essential skill in ensuring good stoma management. This article explores the assessment of four stoma patients, highlighting the importance of matching their skin type with their skin barrier for optimum skin protection. The patients have kindly agreed for their case studies to be published as a means of informing others. All names have been changed in line with Nursing and Midwifery Council (2010) guidelines to maintain patient confidentiality. This article was originally presented at the World Council of Enterostomal Therapists' (WCET) annual conference in 2010, receiving first prize at poster presentations.

  13. Skin Pigmentation Disorders

    Science.gov (United States)

    Pigmentation means coloring. Skin pigmentation disorders affect the color of your skin. Your skin gets its color from a pigment called melanin. Special cells in the skin make melanin. When these cells become damaged or ...

  14. Skin Cancer Foundation

    Science.gov (United States)

    ... Host a Fundraising Event | About Us | Store The Skin Cancer Foundation The Skin Cancer Foundation is the ... Handbook A "Sunscreen Gene"? Skin Cancer Facts & Statistics Skin Cancer Treatment Glossary Information on medications and procedures ...

  15. Skin Cancer Treatment

    Science.gov (United States)

    ... Unusual Cancers of Childhood Treatment Genetics of Skin Cancer Skin color and being exposed to sunlight can increase ... is based on the type of nonmelanoma skin cancer or other skin condition diagnosed: Basal cell carcinoma Enlarge Basal cell ...

  16. Stages of Skin Cancer

    Science.gov (United States)

    ... Unusual Cancers of Childhood Treatment Genetics of Skin Cancer Skin color and being exposed to sunlight can increase ... is based on the type of nonmelanoma skin cancer or other skin condition diagnosed: Basal cell carcinoma Enlarge Basal cell ...

  17. Study on the Environmental Tritium in Surrounding of Bantar Gebang - Bekasi and Leuwigajah - Bandung Landfill Areas

    International Nuclear Information System (INIS)

    Satrio; Syafalni; Evarista Ristin

    2004-01-01

    The investigation of environmental tritium distribution in surrounding of Bantar Gebang - Bekasi and Leuwigajah landfill areas has been carried out. The aim of this investigation was to know tritium concentration in surrounding of both landfill areas. Normally, tritium concentration in the nature is around 0-5 TU. The results of this investigation showed that the tritium concentration in both shallow groundwater of both landfill areas were still in the range of its normal limit, whereas tritium concentration in stream along both landfill areas and leached water showed higher value. Tritium concentration in deep groundwater of Bantar Gebang landfill showed about the zero value, it means is the normal condition. (author)

  18. Bacterial skin flora of diabetic patients in the Jos University Teaching ...

    African Journals Online (AJOL)

    Diabetics frequently are afflicted with bacterial skin infections because of the high circulating blood sugar. The frequent skin infections in these patients may be a result of change in normal skin flora. This study was carried out to find out the normal skin flora of these patients. Ninety four (50 study and 44 control) consecutive ...

  19. Personnel decontamination and preventive skin care

    International Nuclear Information System (INIS)

    Henning, Klaus; Gojowczyk, Peter

    2010-01-01

    Skin contamination arises from contact with contaminated aqueous solutions and from transmission of radioactively contaminated dirt particles. As long as the surface of the skin is neither inflamed nor showing any lesions, normally only a limited part of the top layer (epidermis), i.e. the upper layers of the stratum corneum, is contaminated. The intact horny layer has a barrier function protecting against the penetration of chemicals and dirt particles. The horny layer can be damaged by water, solvents, alkaline substances, and acids. In general, it is safe to say that the horny layer acts as a natural barrier to the penetration of liquid and particulate impurities into lower layers of the skin. As long as the horny layer is intact and free from lesions, the risk of incorporation can be considered low. When decontaminating and cleansing the skin, also in daily skin cleansing, care must be taken to prevent the acid protective layer and the horny layer from being compromised. Daily cleansing and cleansing for decontamination must be carried out with a mild, weakly acidic detergent. In addition, prevention should be achieved daily by applying a non-greasy skin lotion to protect the skin. Following a systematic regular regimen in skin cleansing and preventive skin care as well as a specific approach in skin decontamination and cleansing will avoid damage to the skin and remove any contamination incurred. This approach comprises a three-pronged concept, namely skin protection, cleansing and care. (orig.)

  20. Cutaneous skin tag

    Science.gov (United States)

    Skin tag; Acrochordon; Fibroepithelial polyp ... have diabetes. They are thought to occur from skin rubbing against skin. ... The tag sticks out of the skin and may have a short, narrow stalk connecting it to the surface of the skin. Some skin tags are as long as ...

  1. Smart Chips for Smart Surroundings -- 4S

    NARCIS (Netherlands)

    Schuler, Eberhard; König, Ralf; Becker, Jürgen; Rauwerda, G.K.; van de Burgwal, M.D.; Smit, Gerardus Johannes Maria; Cardoso, João M.P.; Hübner, Michael

    2011-01-01

    The overall mission of the 4S project (Smart Chips for Smart Surroundings) was to define and develop efficient flexible, reconfigurable core building blocks, including the supporting tools, for future Ambient System Devices. Reconfigurability offers the needed flexibility and adaptability, it

  2. Childhood Suicide and Myths Surrounding It.

    Science.gov (United States)

    Greene, Dorothea B.

    1994-01-01

    Dispels five misconceptions surrounding the suicide of children: that children under the age of six do not commit suicide; that suicide in latency years is extremely rare; that psychodynamically and developmentally true depression is not possible in childhood; that child cannot understand finality of death; and that children are cognitively and…

  3. [Skin hydration and hydrating products].

    Science.gov (United States)

    Duplan, H; Nocera, T

    2018-05-01

    One of the skin's principal functions is to protect the body against its environment by maintaining an effective epidermal barrier, not only against external factors, but also to prevent water loss from the body. Indeed, water homeostasis is vital for the normal physiological functioning of skin. Hydration levels affect not only visible microscopic parameters such as the suppleness and softness of skin, but also molecular parameters, enzyme activities and cellular signalling within the epidermis. The body is continually losing some of its water, but this phenomenon is limited and the optimal hydration gradient in skin is ensured via a set of sophisticated regulatory processes that rely on the functional and dynamic properties of the uppermost level of the skin consisting of the stratum corneum. The present article brings together data recently acquired in the fields of skin hydration and the characterisation of dehydrated or dry skin, whether through study of the regulatory processes involved or as a result of changes in the techniques used for in situ measurement, and thus in optimisation of management. Copyright © 2018. Published by Elsevier Masson SAS.

  4. Histological Study on the Skin of Japanese Flounder Paralichthys olivaceus

    Institute of Scientific and Technical Information of China (English)

    ZHU Jie; ZHANG Xiumei; GAO Tianxiang

    2005-01-01

    Histological development of Japanese flounder Paralichthys olivaceus larval skin and ultrastructural difference of skin between reared normal and malpigmented Japanese flounder were studied with light microscopy (LM) and transmission electron microscopy (TEM). The results show that the skin develops slowly before the metamorphosis, while at the onset of metamorphosis, the skin develops quickly and becomes complete in structure till about 50 d after being hatched. Ultrastructural observation on the normal and malpigmented skins shows that the iridophore and melanophore are adjacent to each other. Profile and structure of the two kinds of pigment cells are more complete in the skin of normal ocular side than in the skin of pigmented blind side. The ultrastructure of typical chloride cell was observed in the skin of Japanese flounder larvae for the first time.

  5. Identification of β-SiC surrounded by relatable surrounding diamond ...

    Indian Academy of Sciences (India)

    β-SiC is identified in the presence of a relatable surrounding diamond medium using subtle, but discernible Raman ... Change in the nature of the surrounding material structure and its .... intensity implies very low graphite content in thin film. In.

  6. Focal skin defect, limb anomalies and microphthalmia.

    NARCIS (Netherlands)

    Jackson, K.E.; Andersson, H.C.

    2004-01-01

    We describe two unrelated female patients with congenital single focal skin defects, unilateral microphthalmia and limb anomalies. Growth and psychomotor development were normal and no brain malformation was detected. Although eye and limb anomalies are commonly associated, clinical anophthalmia and

  7. Skin deposits in hereditary cystatin C amyloidosis

    DEFF Research Database (Denmark)

    Benedikz, Eirikur; Blöndal, H; Gudmundsson, G

    1990-01-01

    Clinically normal skin from 47 individuals aged 9-70 years was investigated. Cystatin C amyloid deposits were found in various locations of the skin by light and/or electron microscopy, in all 12 patients with a clinical history of hereditary cystatin C amyloidosis (HCCA). Six asymptomatic...... individuals, who had the Alu 1 restriction fragment length polymorphism (RFLP) marker reported to cosegregate with the disease, also had cystatin C amyloid deposits in the skin. Three asymptomatic individuals (age 17-46) belonging to the HCCA families were without amyloid in the skin but had Alu 1 RFLP marker...

  8. Anyone Can Get Skin Cancer

    Science.gov (United States)

    ... of Skin Cancer Skin Cancer Screening Research Anyone Can Get Skin Cancer Order the free Anyone Can ... rarely, younger children can develop skin cancer. How can people with dark skin get skin cancer? Although ...

  9. Interaction between a normal shock wave and a turbulent boundary layer at high transonic speeds. Part 1: Pressure distribution. Part 2: Wall shear stress. Part 3: Simplified formulas for the prediction of surface pressures and skin friction

    Science.gov (United States)

    Adamson, T. C., Jr.; Liou, M. S.; Messiter, A. F.

    1980-01-01

    An asymptotic description is derived for the interaction between a shock wave and a turbulent boundary layer in transonic flow, for a particular limiting case. The dimensionless difference between the external flow velocity and critical sound speed is taken to be much smaller than one, but large in comparison with the dimensionless friction velocity. The basic results are derived for a flat plate, and corrections for longitudinal wall curvature and for flow in a circular pipe are also shown. Solutions are given for the wall pressure distribution and the shape of the shock wave. Solutions for the wall shear stress are obtained, and a criterion for incipient separation is derived. Simplified solutions for both the wall pressure and skin friction distributions in the interaction region are given. These results are presented in a form suitable for use in computer programs.

  10. Human Epidermal Langerhans Cells Maintain Immune Homeostasis in Skin by Activating Skin Resident Regulatory T Cells

    Science.gov (United States)

    Seneschal, Julien; Clark, Rachael A.; Gehad, Ahmed; Baecher-Allan, Clare M.; Kupper, Thomas S.

    2013-01-01

    Recent discoveries indicate that the skin of a normal individual contains 10-20 billion resident memory T cells ( which include various T helper, T cytotoxic, and T regulatory subsets, that are poised to respond to environmental antigens. Using only autologous human tissues, we report that both in vitro and in vivo, resting epidermal Langerhan cells (LC) selectively and specifically induced the activation and proliferation of skin resident regulatory T cells (Treg), a minor subset of skin resident memory T cells. In the presence of foreign pathogen, however, the same LC activated and induced proliferation of effector memory T (Tem) cells and limited Treg cells activation. These underappreciated properties of LC: namely maintenance of tolerance in normal skin, and activation of protective skin resident memory T cells upon infectious challenge, help clarify the role of LC in skin. PMID:22560445

  11. A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Madsen, Peder; Rasmussen, H H

    1991-01-01

    A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved...

  12. Prefabricated neck expanded skin flap with the superficial temporal vessels for facial resurfacing.

    Science.gov (United States)

    Lazzeri, Davide; Su, Weijie; Qian, Yunliang; Messmer, Caroline; Agostini, Tommaso; Spinelli, Giuseppe; Marcus, Jeffrey R; Levin, L Scott; Zenn, Micheal R; Zhang, Yi Xin

    2013-05-01

    The achievement of a normal-appearing face after surgical resurfacing remains an elusive goal. This is due in part to insufficient color matching, restoration of contours, and the persistence of visible scars. Flap prefabrication is a staged procedure that provides an independent axial blood supply to local expanded tissues. We describe a new reconstructive alternative with superior reconstructive surgical options for facial resurfacing that better matches damaged or discarded facial tissues. A superficial temporal fascial flap was harvested as the vascular supply of the prefabricated neck flap and located in a subcutaneous neck pocket over a tissue expander. After a 5-month period for expansion and maturation, the prefabricated skin flap was raised, islanded, and rotated to resurface the facial defect. Four patients with hemifacial postburn contracture and two patients affected by hemifacial vascular malformations aged 17 to 42 years (mean 29 years) were successfully treated with no major complication after a mean period of 15 months. Prefabricated neck-expanded skin flap demonstrated an excellent color and texture match with facial skin that surrounded the repair sites, and optimal aesthetic results were obtained. Importantly, facial expression was completely maintained due to thinness and pliability of the rotated skin. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

  13. Topical PDT in the Treatment of Benign Skin Diseases: Principles and New Applications

    Directory of Open Access Journals (Sweden)

    Miri Kim

    2015-09-01

    Full Text Available Photodynamic therapy (PDT uses a photosensitizer, light energy, and molecular oxygen to cause cell damage. Cells exposed to the photosensitizer are susceptible to destruction upon light absorption because excitation of the photosensitizing agents leads to the production of reactive oxygen species and, subsequently, direct cytotoxicity. Using the intrinsic cellular heme biosynthetic pathway, topical PDT selectively targets abnormal cells, while preserving normal surrounding tissues. This selective cytotoxic effect is the basis for the use of PDT in antitumor treatment. Clinically, PDT is a widely used therapeutic regimen for oncologic skin conditions such as actinic keratosis, squamous cell carcinoma in situ, and basal cell carcinoma. PDT has been shown, under certain circumstances, to stimulate the immune system and produce antibacterial, and/or regenerative effects while protecting cell viability. Thus, it may be useful for treating benign skin conditions. An increasing number of studies support the idea that PDT may be effective for treating acne vulgaris and several other inflammatory/infective skin diseases, including psoriasis, rosacea, viral warts, and aging-related changes. This review provides an overview of the clinical investigations of PDT and discusses each of the essential aspects of the sequence: its mechanism of action, common photosensitizers, light sources, and clinical applications in dermatology. Of the numerous clinical trials of PDT in dermatology, this review focuses on those studies that have reported remarkable therapeutic benefits following topical PDT for benign skin conditions such as acne vulgaris, viral warts, and photorejuvenation without causing severe side effects.

  14. Opportunity's Surroundings on Sol 1818 (Vertical)

    Science.gov (United States)

    2009-01-01

    NASA's Mars Exploration Rover Opportunity used its navigation camera to take the images combined into this full-circle view of the rover's surroundings during the 1,818th Martian day, or sol, of Opportunity's surface mission (March 5, 2009). South is at the center; north at both ends. This view is presented as a vertical projection with geometric seam correction. North is at the top. The rover had driven 80.3 meters (263 feet) southward earlier on that sol. Tracks from the drive recede northward in this view. The terrain in this portion of Mars' Meridiani Planum region includes dark-toned sand ripples and lighter-toned bedrock.

  15. Opportunity's Surroundings on Sol 1818 (Polar)

    Science.gov (United States)

    2009-01-01

    NASA's Mars Exploration Rover Opportunity used its navigation camera to take the images combined into this full-circle view of the rover's surroundings during the 1,818th Martian day, or sol, of Opportunity's surface mission (March 5, 2009). South is at the center; north at both ends. This view is presented as a polar projection with geometric seam correction. North is at the top. The rover had driven 80.3 meters (263 feet) southward earlier on that sol. Tracks from the drive recede northward in this view. The terrain in this portion of Mars' Meridiani Planum region includes dark-toned sand ripples and lighter-toned bedrock.

  16. Malware Normalization

    OpenAIRE

    Christodorescu, Mihai; Kinder, Johannes; Jha, Somesh; Katzenbeisser, Stefan; Veith, Helmut

    2005-01-01

    Malware is code designed for a malicious purpose, such as obtaining root privilege on a host. A malware detector identifies malware and thus prevents it from adversely affecting a host. In order to evade detection by malware detectors, malware writers use various obfuscation techniques to transform their malware. There is strong evidence that commercial malware detectors are susceptible to these evasion tactics. In this paper, we describe the design and implementation of a malware normalizer ...

  17. Skin color - patchy

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/003224.htm Skin color - patchy To use the sharing features on this page, please enable JavaScript. Patchy skin color is areas where the skin color is irregular. ...

  18. Histoplasma skin test

    Science.gov (United States)

    Histoplasmosis skin test ... health care provider cleans an area of your skin, usually the forearm. An allergen is injected just below the cleaned skin surface. An allergen is a substance that causes ...

  19. Skin Condition Finder

    Science.gov (United States)

    ... SKIN CONDITIONS HEALTH TOPICS FOR PROFESSIONALS Rash and Skin Condition Finder 1 Select Age Group Infant Child ... Toe Toe Webspace Toe Nail CLOSE About the Skin Condition Finder Have a health question or concern? ...

  20. Skin Complications of IBD

    Science.gov (United States)

    ... Home > Resources > Skin Complications of IBD Go Back Skin Complications of IBD Email Print + Share After arthritis, ... about 5% of people with inflammatory bowel disease. SKIN DISORDERS COMMONLY SEEN IN IBD ERHTHEMA NODOSUM The ...

  1. Skin Peeling Syndrome

    Directory of Open Access Journals (Sweden)

    Sharma Rajeev

    2000-01-01

    Full Text Available Peeling of the skin is an uncommonly encountered disorder. Occurrence of vesicles and bullae in peeling skin syndrome is very rare. We report a case of idiopathic peeling skin syndrome with vesicular lesions.

  2. Merkel cells are long-lived cells whose production is stimulated by skin injury✰

    Science.gov (United States)

    Wright, Margaret C.; Logan, Gregory J.; Bolock, Alexa M.; Kubicki, Adam C.; Hemphill, Julie A.; Sanders, Timothy A.; Maricich, Stephen M.

    2017-01-01

    Mechanosensitive Merkel cells are thought to have finite lifespans, but controversy surrounds the frequency of their replacement and which precursor cells maintain the population. We found by embryonic EdU administration that Merkel cells undergo terminal cell division in late embryogenesis and survive long into adulthood. We also found that new Merkel cells are produced infrequently during normal skin homeostasis and that their numbers do not change during natural or induced hair cycles. In contrast, live imaging and EdU experiments showed that mild mechanical injury produced by skin shaving dramatically increases Merkel cell production. We confirmed with genetic cell ablation and fate-mapping experiments that new touch dome Merkel cells in adult mice arise from touch dome keratinocytes. Together, these independent lines of evidence show that Merkel cells in adult mice are long-lived, are replaced rarely during normal adult skin homeostasis, and that their production can be induced by repeated shaving. These results have profound implications for understanding sensory neurobiology and human diseases such as Merkel cell carcinoma. PMID:27998808

  3. Merkel cells are long-lived cells whose production is stimulated by skin injury.

    Science.gov (United States)

    Wright, Margaret C; Logan, Gregory J; Bolock, Alexa M; Kubicki, Adam C; Hemphill, Julie A; Sanders, Timothy A; Maricich, Stephen M

    2017-02-01

    Mechanosensitive Merkel cells are thought to have finite lifespans, but controversy surrounds the frequency of their replacement and which precursor cells maintain the population. We found by embryonic EdU administration that Merkel cells undergo terminal cell division in late embryogenesis and survive long into adulthood. We also found that new Merkel cells are produced infrequently during normal skin homeostasis and that their numbers do not change during natural or induced hair cycles. In contrast, live imaging and EdU experiments showed that mild mechanical injury produced by skin shaving dramatically increases Merkel cell production. We confirmed with genetic cell ablation and fate-mapping experiments that new touch dome Merkel cells in adult mice arise from touch dome keratinocytes. Together, these independent lines of evidence show that Merkel cells in adult mice are long-lived, are replaced rarely during normal adult skin homeostasis, and that their production can be induced by repeated shaving. These results have profound implications for understanding sensory neurobiology and human diseases such as Merkel cell carcinoma. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Avoiding obstacles by using a proximity infrared sensor skin

    Institute of Scientific and Technical Information of China (English)

    Cao Zhengcai; Fu Yili; Wu Qidi; Wang Shuguo; Wang Guangguo

    2007-01-01

    Placement and wiring of vast amount of sensor elements on the 3-dimensionally configured robot surface to form soft sensor skin is very difficult with the traditional technology, hi this paper we propose a new method to realize such a skin. By implanting infrared sensors array in an elastic body, we obtain an elastic and tough sensor skin that can be shaped freely. The developed sensor skin is a large-area, flexible array of infrared sensors with data processing capabilities. Depending on the skin electronics, it endows its carrier with an ability to sense its surroundings. The structure, the method of infrared sensor signal processing, and basic experiments of sensor skin are presented. The validity of the infrared sensor skin is investigated by preliminary obstacle avoidance trial.

  5. Crust Structure Data of Seas Surrounding Turkey

    International Nuclear Information System (INIS)

    Maden, N.; Gelisli, K.

    2007-01-01

    Black Sea, Aegean, Mediterranean and Marmara Sea, which surround the Turkey, have not been examined with respect to the Geological, Geophysical and other natural sciences sufficiently. In fact, it is not attach importance the Turkish seas adequately and abandoned with respect to the scientific researches. The most important reason of this situation is the lack of the education of the Marine Sciences in the Turkish Universities. In this study, it is tried to construct a crustal structure data base of the surrounding seas of the Turkey by collecting crustal structure data sets done by different authors in different times so far. The data acquired in the base are collected from different data base sources by dragging. The Moho depth in the eastern and western basin of the Black sea is 22 km and 19 km, respectively. In the Marmara Sea the Moho depth is 24 km. The moho value in the southern Aegean is 20 km, in the northern Aegean the moho depth is 30 km. on the other hand, the moho depth value in the eastern and western basin of the Mediterranean Sea are 15-20 km and 25-30 km, respectively

  6. Cortical Surround Interactions and Perceptual Salience via Natural Scene Statistics.

    Directory of Open Access Journals (Sweden)

    Ruben Coen-Cagli

    Full Text Available Spatial context in images induces perceptual phenomena associated with salience and modulates the responses of neurons in primary visual cortex (V1. However, the computational and ecological principles underlying contextual effects are incompletely understood. We introduce a model of natural images that includes grouping and segmentation of neighboring features based on their joint statistics, and we interpret the firing rates of V1 neurons as performing optimal recognition in this model. We show that this leads to a substantial generalization of divisive normalization, a computation that is ubiquitous in many neural areas and systems. A main novelty in our model is that the influence of the context on a target stimulus is determined by their degree of statistical dependence. We optimized the parameters of the model on natural image patches, and then simulated neural and perceptual responses on stimuli used in classical experiments. The model reproduces some rich and complex response patterns observed in V1, such as the contrast dependence, orientation tuning and spatial asymmetry of surround suppression, while also allowing for surround facilitation under conditions of weak stimulation. It also mimics the perceptual salience produced by simple displays, and leads to readily testable predictions. Our results provide a principled account of orientation-based contextual modulation in early vision and its sensitivity to the homogeneity and spatial arrangement of inputs, and lends statistical support to the theory that V1 computes visual salience.

  7. Spectral Detection of Human Skin in VIS-SWIR Hyperspectral Imagery without Radiometric Calibration

    Science.gov (United States)

    2012-03-01

    6 Spectral reflectance of human skin at VIS-SWIR wavelengths. Skin with less melanin appears brighter because it has higher reflectance...6 illustrates the spectral reflectance of human skin with different melanin levels. One paper proposes a Normalized Difference Skin Index (NDSI), a...1.4% Melanin 12.6% Melanin 23.2% Melanin 34.3% Melanin 45% Melanin Figure 6. Spectral reflectance of human skin at VIS-SWIR wavelengths. Skin with less

  8. p63 in skin development and ectodermal dysplasias

    Science.gov (United States)

    Koster, Maranke I.

    2010-01-01

    The transcription factor p63 is critically important for skin development and maintenance. Processes that require p63 include epidermal lineage commitment, epidermal differentiation, cell adhesion, and basement membrane formation. Not surprisingly, alterations in the p63 pathway underlie a subset of ectodermal dysplasias, developmental syndromes in which the skin and skin appendages do not develop normally. This review summarizes the current understanding of the role of p63 in normal development and ectodermal dysplasias. PMID:20445549

  9. Normal accidents

    International Nuclear Information System (INIS)

    Perrow, C.

    1989-01-01

    The author has chosen numerous concrete examples to illustrate the hazardousness inherent in high-risk technologies. Starting with the TMI reactor accident in 1979, he shows that it is not only the nuclear energy sector that bears the risk of 'normal accidents', but also quite a number of other technologies and industrial sectors, or research fields. The author refers to the petrochemical industry, shipping, air traffic, large dams, mining activities, and genetic engineering, showing that due to the complexity of the systems and their manifold, rapidly interacting processes, accidents happen that cannot be thoroughly calculated, and hence are unavoidable. (orig./HP) [de

  10. A Simple Device For Measuring Skin Friction

    Directory of Open Access Journals (Sweden)

    Gupta A.B

    1995-01-01

    Full Text Available A simple device for measuring skin friction in vivo is described. The frictional coefficient of normal Indian skin and the effect of hydration and application of talc and glycerol on the frictional coefficient and also the friction of ichthyotic skin have been determined with its help. The average value of friction of friction of normal India skin at forearm is found to be 0.41 +- 0.08, the hydration raises the value to 0.71 +- 0.11 and the effect of glycerol is also to school it up to 0.70+- 0.05, almost equal to that of water. The effect of talc however is opposite and its application lowers the friction to 0.21+-0.07. The mean coeff of friction for ichthyotic skin is found to be 0.21+- 0.0.5, which closely agrees with talc-treated normal skin. A good positive correlation (p<0.01 between friction and sebum level at skin site, with r = 0.64, has been observed.

  11. A Meta-ethnography: Skin-to-Skin Holding From the Caregiver's Perspective.

    Science.gov (United States)

    Vittner, Dorothy; Casavant, Sharon; McGrath, Jacqueline M

    2015-06-01

    Although the benefits of skin-to-skin care (SSC) are well documented in the literature, practices in the clinical setting remain inconsistent. Although nurses' reported knowledge about SSC has improved, confusion still exists regarding safety and appropriateness. Existing qualitative literature primarily focuses on parents' experiences; yet it is crucial to describe the essence of professional caregivers' experiences to enhance facilitation and implementation of SSC. Most studies surrounding the caregiver's perspective and SSC have focused on barriers that impede implementation or examined the experience from the organizational perspective and general group experiences rather than individual personal experiences with SSC. This meta-ethnography integrated the findings from several discrete studies into a salient interpretative perspective, creating a relevant understanding of the process of SSC as a means of enhancing facilitation and implementation of SSC with hospitalized infants. An ethnographic meta-synthesis of qualitative literature was completed. As a result of this synthesis, the caregivers' experiences were separated into themes to articulate the phenomena juxtaposed from the 8 original studies that influence facilitation of SSC for the parent-infant dyad. Qualitative data analysis uncovered 4 overarching themes: (1) varying thresholds of getting started; (2) defining adequate resources; (3) navigating the demands and complexity of the infant; and (4) balancing parental readiness with infant needs. This ethnographic meta-synthesis confirms nurses have good intentions in supporting SSC practices, yet struggle to meet competing demands in their daily practice. Innovative and practical translations of SSC are needed to normalize SSC as the daily standard for premature infants.

  12. Clinical scoring and instrumental analysis to evaluate skin types.

    Science.gov (United States)

    Mercurio, D G; Segura, J H; Demets, M B A; Maia Campos, P M B G

    2013-04-01

    The biology of the skin is very complex, and there are a number of methods used to classify the different skin types. It is possible to measure or quantify the characteristics of the specific skin types, using a variety of techniques that can objectively evaluate the properties of the skin in a noninvasive manner. To clinically characterize different skin types by dermatological evaluation and biophysical and skin imaging techniques, and to evaluate the relationship between the different characteristics. The study recruited 26 volunteers. Clinical scoring was performed by a dermatologist who classified the volunteers' skin as normal or dry (group 1) and combination or oily (group 2). Objective measurements included skin microrelief, pH, oiliness, water content of the stratum corneum and transepidermal water loss (TEWL). Positive correlations were found between the level of skin oiliness and skin texture obtained from both instrumental analysis and clinical scoring. The combination and oily skin types had higher clinical scores for shine intensity, oiliness and tendency to pigmentation, and also had higher objective scores for sebum secretion, TEWL and roughness. Biophysical and skin imaging techniques are effective tools to help characterize skin type and assist in clinical dermatology. We found that different skin types had different characteristics related to skin microrelief, oiliness and TEWL, and therefore require specific dermatological treatments. © The Author(s) CED © 2013 British Association of Dermatologists.

  13. Opportunity's Surroundings on Sol 1798 (Polar)

    Science.gov (United States)

    2009-01-01

    NASA's Mars Exploration Rover Opportunity used its navigation camera to take the images combined into this 180-degree view of the rover's surroundings during the 1,798th Martian day, or sol, of Opportunity's surface mission (Feb. 13, 2009). North is on top. This view is presented as a polar projection with geometric seam correction. The rover had driven 111 meters (364 feet) southward on the preceding sol. Tracks from that drive recede northward in this view. For scale, the distance between the parallel wheel tracks is about 1 meter (about 40 inches). The terrain in this portion of Mars' Meridiani Planum region includes dark-toned sand ripples and lighter-toned bedrock.

  14. Opportunity's Surroundings After Sol 1820 Drive (Polar)

    Science.gov (United States)

    2009-01-01

    NASA's Mars Exploration Rover Opportunity used its navigation camera to take the images combined into this full-circle view of the rover's surroundings during the 1,820th to 1,822nd Martian days, or sols, of Opportunity's surface mission (March 7 to 9, 2009). This view is presented as a polar projection with geometric seam correction. North is at the top. The rover had driven 20.6 meters toward the northwest on Sol 1820 before beginning to take the frames in this view. Tracks from that drive recede southwestward. For scale, the distance between the parallel wheel tracks is about 1 meter (about 40 inches). The terrain in this portion of Mars' Meridiani Planum region includes dark-toned sand ripples and small exposures of lighter-toned bedrock.

  15. Opportunity's Surroundings on Sol 1798 (Vertical)

    Science.gov (United States)

    2009-01-01

    NASA's Mars Exploration Rover Opportunity used its navigation camera to take the images combined into this 180-degree view of the rover's surroundings during the 1,798th Martian day, or sol, of Opportunity's surface mission (Feb. 13, 2009). North is on top. This view is presented as a vertical projection with geometric seam correction. The rover had driven 111 meters (364 feet) southward on the preceding sol. Tracks from that drive recede northward in this view. For scale, the distance between the parallel wheel tracks is about 1 meter (about 40 inches). The terrain in this portion of Mars' Meridiani Planum region includes dark-toned sand ripples and lighter-toned bedrock.

  16. Opportunity's Surroundings on Sol 1687 (Vertical)

    Science.gov (United States)

    2009-01-01

    NASA's Mars Exploration Rover Opportunity used its navigation camera to take the images combined into this 360-degree view of the rover's surroundings on the 1,687th Martian day, or sol, of its surface mission (Oct. 22, 2008). Opportunity had driven 133 meters (436 feet) that sol, crossing sand ripples up to about 10 centimeters (4 inches) tall. The tracks visible in the foreground are in the east-northeast direction. Opportunity's position on Sol 1687 was about 300 meters southwest of Victoria Crater. The rover was beginning a long trek toward a much larger crater, Endeavour, about 12 kilometers (7 miles) to the southeast. This view is presented as a vertical projection with geometric seam correction.

  17. Opportunity's Surroundings After Sol 1820 Drive (Vertical)

    Science.gov (United States)

    2009-01-01

    NASA's Mars Exploration Rover Opportunity used its navigation camera to take the images combined into this full-circle view of the rover's surroundings during the 1,820th to 1,822nd Martian days, or sols, of Opportunity's surface mission (March 7 to 9, 2009). This view is presented as a vertical projection with geometric seam correction. North is at the top. The rover had driven 20.6 meters toward the northwest on Sol 1820 before beginning to take the frames in this view. Tracks from that drive recede southwestward. For scale, the distance between the parallel wheel tracks is about 1 meter (about 40 inches). The terrain in this portion of Mars' Meridiani Planum region includes dark-toned sand ripples and small exposures of lighter-toned bedrock.

  18. Opportunity's Surroundings on Sol 1687 (Polar)

    Science.gov (United States)

    2009-01-01

    NASA's Mars Exploration Rover Opportunity used its navigation camera to take the images combined into this 360-degree view of the rover's surroundings on the 1,687th Martian day, or sol, of its surface mission (Oct. 22, 2008). Opportunity had driven 133 meters (436 feet) that sol, crossing sand ripples up to about 10 centimeters (4 inches) tall. The tracks visible in the foreground are in the east-northeast direction. Opportunity's position on Sol 1687 was about 300 meters southwest of Victoria Crater. The rover was beginning a long trek toward a much larger crater, Endeavour, about 12 kilometers (7 miles) to the southeast. This view is presented as a polar projection with geometric seam correction.

  19. Opportunity's Surroundings After Sol 1820 Drive

    Science.gov (United States)

    2009-01-01

    NASA's Mars Exploration Rover Opportunity used its navigation camera to take the images combined into this full-circle view of the rover's surroundings during the 1,820th to 1,822nd Martian days, or sols, of Opportunity's surface mission (March 7 to 9, 2009). South is at the center; north at both ends. The rover had driven 20.6 meters toward the northwest on Sol 1820 before beginning to take the frames in this view. Tracks from that drive recede southwestward. For scale, the distance between the parallel wheel tracks is about 1 meter (about 40 inches). The terrain in this portion of Mars' Meridiani Planum region includes dark-toned sand ripples and small exposures of lighter-toned bedrock. This view is presented as a cylindrical projection with geometric seam correction.

  20. Towards Semantic Understanding of Surrounding Vehicular Maneuvers

    DEFF Research Database (Denmark)

    Kristoffersen, Miklas Strøm; Dueholm, Jacob Velling; Satzoda, Ravi K.

    2016-01-01

    This paper proposes the use of multiple low-cost visual sensors to obtain a surround view of the ego-vehicle for semantic understanding. A multi-perspective view will assist the analysis of naturalistic driving studies (NDS), by automating the task of data reduction of the observed sequences...... into events. A user-centric vision-based framework is presented using a vehicle detector and tracker in each separate perspective. Multi-perspective trajectories are estimated and analyzed to extract 14 different events, including potential dangerous behaviors such as overtakes and cut-ins. The system...... is tested on ten sequences of real-world data collected on U. S. highways. The results show the potential use of multiple low-cost visual sensors for semantic understanding around the ego-vehicle....

  1. Lovelock black holes surrounded by quintessence

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Sushant G. [University of KwaZulu-Natal, Astrophysics and Cosmology Research Unit, School of Mathematics, Statistics and Computer Science, Durban (South Africa); Centre for Theoretical Physics, Multidisciplinary Centre for Advanced Research and Studies (MCARS), New Delhi (India); Maharaj, Sunil D.; Baboolal, Dharmanand; Lee, Tae-Hun [University of KwaZulu-Natal, Astrophysics and Cosmology Research Unit, School of Mathematics, Statistics and Computer Science, Durban (South Africa)

    2018-02-15

    Lovelock gravity consisting of the dimensionally continued Euler densities is a natural generalization of general relativity to higher dimensions such that equations of motion are still second order, and the theory is free of ghosts. A scalar field with a positive potential that yields an accelerating universe has been termed quintessence. We present exact black hole solutions in D-dimensional Lovelock gravity surrounded by quintessence matter and also perform a detailed thermodynamical study. Further, we find that the mass, entropy and temperature of the black hole are corrected due to the quintessence background. In particular, we find that a phase transition occurs with a divergence of the heat capacity at the critical horizon radius, and that specific heat becomes positive for r{sub h} < r{sub c} allowing the black hole to become thermodynamically stable. (orig.)

  2. Lovelock black holes surrounded by quintessence

    Science.gov (United States)

    Ghosh, Sushant G.; Maharaj, Sunil D.; Baboolal, Dharmanand; Lee, Tae-Hun

    2018-02-01

    Lovelock gravity consisting of the dimensionally continued Euler densities is a natural generalization of general relativity to higher dimensions such that equations of motion are still second order, and the theory is free of ghosts. A scalar field with a positive potential that yields an accelerating universe has been termed quintessence. We present exact black hole solutions in D-dimensional Lovelock gravity surrounded by quintessence matter and also perform a detailed thermodynamical study. Further, we find that the mass, entropy and temperature of the black hole are corrected due to the quintessence background. In particular, we find that a phase transition occurs with a divergence of the heat capacity at the critical horizon radius, and that specific heat becomes positive for r_h

  3. Differential susceptibility of primary cultured human skin cells to hypericin PDT in an in vitro model.

    Science.gov (United States)

    Popovic, A; Wiggins, T; Davids, L M

    2015-08-01

    Skin cancer is the most common cancer worldwide, and its incidence rate in South Africa is increasing. Photodynamic therapy (PDT) has been shown to be an effective treatment modality, through topical administration, for treatment of non-melanoma skin cancers. Our group investigates hypericin-induced PDT (HYP-PDT) for the treatment of both non-melanoma and melanoma skin cancers. However, a prerequisite for effective cancer treatments is efficient and selective targeting of the tumoral cells with minimal collateral damage to the surrounding normal cells, as it is well established that cancer therapies have bystander effects on normal cells in the body, often causing undesirable side effects. The aim of this study was to investigate the cellular and molecular effects of HYP-PDT on normal primary human keratinocytes (Kc), melanocytes (Mc) and fibroblasts (Fb) in an in vitro tissue culture model which represented both the epidermal and dermal cellular compartments of human skin. Cell viability analysis revealed a differential cytotoxic response to a range of HYP-PDT doses in all the human skin cell types, showing that Fb (LD50=1.75μM) were the most susceptible to HYP-PDT, followed by Mc (LD50=3.5μM) and Kc (LD50>4μM HYP-PDT) These results correlated with the morphological analysis which displayed distinct morphological changes in Fb and Mc, 24h post treatment with non-lethal (1μM) and lethal (3μM) doses of HYP-PDT, but the highest HYP-PDT doses had no effect on Kc morphology. Fluorescent microscopy displayed cytoplasmic localization of HYP in all the 3 skin cell types and additionally, HYP was excluded from the nuclei in all the cell types. Intracellular ROS levels measured in Fb at 3μM HYP-PDT, displayed a significant 3.8 fold (phuman skin cells thus highlighting the efficacy and indeed, the potential bystander effect of if administered in vivo. This study contributes toward our knowledge of the cellular response of the epidermis to photodynamic therapies and

  4. Comparative human cellular radiosensitivity: I. The effect of SV40 transformation and immortalisation on the gamma-irradiation survival of skin derived fibroblasts from normal individuals and from ataxia-telangiectasia patients and heterozygotes.

    Science.gov (United States)

    Arlett, C F; Green, M H; Priestley, A; Harcourt, S A; Mayne, L V

    1988-12-01

    We have compared cell killing following 60Co gamma irradiation in 22 primary human fibroblast strains, nine SV40-immortalized human fibroblast lines and seven SV40-transformed pre-crisis human fibroblast cultures. We have examined material from normal individuals, from ataxia-telangiectasia (A-T) patients and from A-T heterozygotes. We have confirmed the greater sensitivity of A-T derived cells to gamma radiation. The distinction between A-T and normal cells is maintained in cells immortalized by SV40 virus but the immortal cells are more gamma radiation resistant than the corresponding primary fibroblasts. Cells transformed by plasmids (pSV3gpt and pSV3neo) expressing SV40 T-antigen, both pre- and post-crisis, show this increased resistance, indicating that it is expression of SV40 T-antigen, rather than immortalization per se which is responsible for the change. We use D0, obtained from a straight line fit, and D, estimated from a multitarget curve, as parameters to compare radiosensitivity. We suggest that both have their advantages; D0 is perhaps more reproducible, but D is more realistic when comparing shouldered and non-shouldered data.

  5. Stereological quantification of lymphocytes in skin biopsies from atopic dermatitis patients

    DEFF Research Database (Denmark)

    Ellingsen, A R; Sørensen, F B; Larsen, Jytte Overgaard

    2001-01-01

    with active eczema in 8 adults with AD and from clinically normal skin from 4 of the patients. Five persons without allergy or skin disease served as controls. The mean number of lymphocytes in 4-mm skin biopsies was 469,000 and 124,000 in active eczema and in clinically normal skin, respectively. Compared......Atopic dermatitis (AD) is histologically characterized by lymphocytic infiltration of the skin and quantitative assessment is required. This study introduces stereological techniques to quantify the number of lymphocytes in skin biopsies. Four-millimetre punch biopsies were taken from skin...... with controls, the number of lymphocytes in biopsies increased by a factor of 6.8 in active eczema and a factor of 1.8 in clinically normal skin. If 20% of skin is affected by eczema the total number of lymphocytes located in the affected skin can be estimated to 1.27 x 10(10). A patient with clinically...

  6. Reconstructing Normality

    DEFF Research Database (Denmark)

    Gildberg, Frederik Alkier; Bradley, Stephen K.; Fristed, Peter Billeskov

    2012-01-01

    Forensic psychiatry is an area of priority for the Danish Government. As the field expands, this calls for increased knowledge about mental health nursing practice, as this is part of the forensic psychiatry treatment offered. However, only sparse research exists in this area. The aim of this study...... was to investigate the characteristics of forensic mental health nursing staff interaction with forensic mental health inpatients and to explore how staff give meaning to these interactions. The project included 32 forensic mental health staff members, with over 307 hours of participant observations, 48 informal....... The intention is to establish a trusting relationship to form behaviour and perceptual-corrective care, which is characterized by staff's endeavours to change, halt, or support the patient's behaviour or perception in relation to staff's perception of normality. The intention is to support and teach the patient...

  7. Pursuing Normality

    DEFF Research Database (Denmark)

    Madsen, Louise Sofia; Handberg, Charlotte

    2018-01-01

    implying an influence on whether to participate in cancer survivorship care programs. Because of "pursuing normality," 8 of 9 participants opted out of cancer survivorship care programming due to prospects of "being cured" and perceptions of cancer survivorship care as "a continuation of the disease......BACKGROUND: The present study explored the reflections on cancer survivorship care of lymphoma survivors in active treatment. Lymphoma survivors have survivorship care needs, yet their participation in cancer survivorship care programs is still reported as low. OBJECTIVE: The aim of this study...... was to understand the reflections on cancer survivorship care of lymphoma survivors to aid the future planning of cancer survivorship care and overcome barriers to participation. METHODS: Data were generated in a hematological ward during 4 months of ethnographic fieldwork, including participant observation and 46...

  8. Biological Rhythms in the Skin

    Directory of Open Access Journals (Sweden)

    Mary S. Matsui

    2016-05-01

    Full Text Available Circadian rhythms, ≈24 h oscillations in behavior and physiology, are reflected in all cells of the body and function to optimize cellular functions and meet environmental challenges associated with the solar day. This multi-oscillatory network is entrained by the master pacemaker located in the suprachiasmatic nucleus (SCN of the hypothalamus, which directs an organism’s rhythmic expression of physiological functions and behavior via a hierarchical system. This system has been highly conserved throughout evolution and uses transcriptional–translational autoregulatory loops. This master clock, following environmental cues, regulates an organism’s sleep pattern, body temperature, cardiac activity and blood pressure, hormone secretion, oxygen consumption and metabolic rate. Mammalian peripheral clocks and clock gene expression have recently been discovered and are present in all nucleated cells in our body. Like other essential organ of the body, the skin also has cycles that are informed by this master regulator. In addition, skin cells have peripheral clocks that can function autonomously. First described in 2000 for skin, this review summarizes some important aspects of a rapidly growing body of research in circadian and ultradian (an oscillation that repeats multiple times during a 24 h period cutaneous rhythms, including clock mechanisms, functional manifestations, and stimuli that entrain or disrupt normal cycling. Some specific relationships between disrupted clock signaling and consequences to skin health are discussed in more depth in the other invited articles in this IJMS issue on Sleep, Circadian Rhythm and Skin.

  9. Volumetric Visualization of Human Skin

    Science.gov (United States)

    Kawai, Toshiyuki; Kurioka, Yoshihiro

    We propose a modeling and rendering technique of human skin, which can provide realistic color, gloss and translucency for various applications in computer graphics. Our method is based on volumetric representation of the structure inside of the skin. Our model consists of the stratum corneum and three layers of pigments. The stratum corneum has also layered structure in which the incident light is reflected, refracted and diffused. Each layer of pigment has carotene, melanin or hemoglobin. The density distributions of pigments which define the color of each layer can be supplied as one of the voxel values. Surface normals of upper-side voxels are fluctuated to produce bumps and lines on the skin. We apply ray tracing approach to this model to obtain the rendered image. Multiple scattering in the stratum corneum, reflective and absorptive spectrum of pigments are considered. We also consider Fresnel term to calculate the specular component for glossy surface of skin. Some examples of rendered images are shown, which can successfully visualize a human skin.

  10. Friction and durability of virgin and damaged skin with and without skin cream treatment using atomic force microscopy

    Directory of Open Access Journals (Sweden)

    Bharat Bhushan

    2012-11-01

    Full Text Available Skin can be damaged by the environment easily. Skin cream is an effective and rapid way to moisten the skin by changing the skin surface properties. Rat skin and pig skin are common animal models for studies and were used as skin samples in this study. The nano- and macroscale friction and durability of damaged skin were measured and compared with those of virgin (intact/undamaged skin. The effect of skin cream on friction and durability of damaged and virgin skin samples is discussed. The effects of velocity, normal load, relative humidity and number of cycles were studied. The nanoscale studies were performed by using atomic force microscope (AFM, and macroscale studies were performed by using a pin-on-disk (POD reciprocating tribometer. It was found that damaged skin has different mechanical properties, surface roughness, contact angle, friction and durability compared to that of virgin skin. But similar changes occur after skin cream treatment. Rat and pig skin show similar trends in friction and durability.

  11. Cosmeceuticals: efficacy and influence on skin tone.

    Science.gov (United States)

    Draelos, Zoe Diana

    2014-04-01

    Cosmeceuticals are understood to be active cosmetics that are sold over-the-counter, but have profound effects on skin appearance and functioning. This term has no legal meaning in the United States, because only cosmetics and pharmaceuticals are recognized by regulatory bodies. Cosmeceuticals are carefully developed and tested by the cosmetics industry to deliver consumer-recognizable benefits, with an excellent safety profile. Persons use these products worldwide, including those of African descent, for improvement of skin tone. This article discusses the issues surrounding cosmeceutical use by persons of African descent. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. Skin, Hair, and Nails

    Science.gov (United States)

    ... Safe Videos for Educators Search English Español Skin, Hair, and Nails KidsHealth / For Parents / Skin, Hair, and ... piel, el cabello y las uñas About Skin, Hair and Nails Skin is our largest organ. If ...

  13. Estrogens and aging skin

    OpenAIRE

    Thornton, M. Julie

    2013-01-01

    Estrogen deficiency following menopause results in atrophic skin changes and acceleration of skin aging. Estrogens significantly modulate skin physiology, targeting keratinocytes, fibroblasts, melanocytes, hair follicles and sebaceous glands, and improve angiogenesis, wound healing and immune responses. Estrogen insufficiency decreases defense against oxidative stress; skin becomes thinner with less collagen, decreased elasticity, increased wrinkling, increased dryness and reduced vascularity...

  14. Preliminary experiments on quantification of skin condition

    Science.gov (United States)

    Kitajima, Kenzo; Iyatomi, Hitoshi

    2014-03-01

    In this study, we investigated a preliminary assessment method for skin conditions such as a moisturizing property and its fineness of the skin with an image analysis only. We captured a facial images from volunteer subjects aged between 30s and 60s by Pocket Micro (R) device (Scalar Co., Japan). This device has two image capturing modes; the normal mode and the non-reflection mode with the aid of the equipped polarization filter. We captured skin images from a total of 68 spots from subjects' face using both modes (i.e. total of 136 skin images). The moisture-retaining property of the skin and subjective evaluation score of the skin fineness in 5-point scale for each case were also obtained in advance as a gold standard (their mean and SD were 35.15 +/- 3.22 (μS) and 3.45 +/- 1.17, respectively). We extracted a total of 107 image features from each image and built linear regression models for estimating abovementioned criteria with a stepwise feature selection. The developed model for estimating the skin moisture achieved the MSE of 1.92 (μS) with 6 selected parameters, while the model for skin fineness achieved that of 0.51 scales with 7 parameters under the leave-one-out cross validation. We confirmed the developed models predicted the moisture-retaining property and fineness of the skin appropriately with only captured image.

  15. Urostomy - stoma and skin care

    Science.gov (United States)

    ... it well before you attach the pouch. Avoid skin care products that contain alcohol. These can make your skin ... the pouch to your skin. Use fewer special skin care products. This will make problems with your skin less ...

  16. Risks of Skin Cancer Screening

    Science.gov (United States)

    ... factors increase or decrease the risk of skin cancer. Skin cancer is a disease in which malignant (cancer) ... following PDQ summaries for more information about skin cancer: Skin Cancer Prevention Skin Cancer Treatment Melanoma Treatment Genetics ...

  17. Terahertz pulse imaging in reflection geometry of human skin cancer and skin tissue

    International Nuclear Information System (INIS)

    Woodward, Ruth M; Cole, Bryan E; Wallace, Vincent P; Pye, Richard J; Arnone, Donald D; Linfield, Edmund H; Pepper, Michael

    2002-01-01

    We demonstrate the application of terahertz pulse imaging (TPI) in reflection geometry for the study of skin tissue and related cancers both in vitro and in vivo. The sensitivity of terahertz radiation to polar molecules, such as water, makes TPI suitable for studying the hydration levels in the skin and the determination of the lateral spread of skin cancer pre-operatively. By studying the terahertz pulse shape in the time domain we have been able to differentiate between diseased and normal tissue for the study of basal cell carcinoma (BCC). Basal cell carcinoma has shown a positive terahertz contrast, and inflammation and scar tissue a negative terahertz contrast compared to normal tissue. In vivo measurements on the stratum corneum have enabled visualization of the stratum corneum-epidermis interface and the study of skin hydration levels. These results demonstrate the potential of terahertz pulse imaging for the study of skin tissue and its related disorders, both in vitro and in vivo

  18. OCT imaging of skin cancer and other dermatological diseases

    DEFF Research Database (Denmark)

    Mogensen, Mette; Thrane, Lars; Jørgensen, Thomas Martini

    2009-01-01

    Optical coherence tomography (OCT) provides clinicians and researchers with micrometer-resolution, in vivo, cross-sectional images of human skin up to several millimeter depth. This review of OCT imaging applied within dermatology covers the application of OCT to normal skin, and reports on a lar...... number of applications in the fields of non-melanoma skin cancer, malignant melanomas, psoriasis and dermatitis, infestations, bullous skin diseases, tattoos, nails, haemangiomas, and other skin diseases. (© 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim)......Optical coherence tomography (OCT) provides clinicians and researchers with micrometer-resolution, in vivo, cross-sectional images of human skin up to several millimeter depth. This review of OCT imaging applied within dermatology covers the application of OCT to normal skin, and reports on a large...

  19. Opportunity's Surroundings on Sol 1798 (Stereo)

    Science.gov (United States)

    2009-01-01

    [figure removed for brevity, see original site] Left-eye view of a color stereo pair for PIA11850 [figure removed for brevity, see original site] Right-eye view of a color stereo pair for PIA11850 NASA's Mars Exploration Rover Opportunity used its navigation camera to take the images combined into this stereo 180-degree view of the rover's surroundings during the 1,798th Martian day, or sol, of Opportunity's surface mission (Feb. 13, 2009). North is on top. This view combines images from the left-eye and right-eye sides of the navigation camera. It appears three-dimensional when viewed through red-blue glasses with the red lens on the left. The rover had driven 111 meters (364 feet) southward on the preceding sol. Tracks from that drive recede northward in this view. For scale, the distance between the parallel wheel tracks is about 1 meter (about 40 inches). The terrain in this portion of Mars' Meridiani Planum region includes dark-toned sand ripples and lighter-toned bedrock. This view is presented as a cylindrical-perspective projection with geometric seam correction.

  20. Opportunity's Surroundings on Sol 1818 (Stereo)

    Science.gov (United States)

    2009-01-01

    [figure removed for brevity, see original site] Left-eye view of a color stereo pair for PIA11846 [figure removed for brevity, see original site] Right-eye view of a color stereo pair for PIA11846 NASA's Mars Exploration Rover Opportunity used its navigation camera to take the images combined into this full-circle view of the rover's surroundings during the 1,818th Martian day, or sol, of Opportunity's surface mission (March 5, 2009). South is at the center; north at both ends. This view combines images from the left-eye and right-eye sides of the navigation camera. It appears three-dimensional when viewed through red-blue glasses with the red lens on the left. The rover had driven 80.3 meters (263 feet) southward earlier on that sol. Tracks from the drive recede northward in this view. The terrain in this portion of Mars' Meridiani Planum region includes dark-toned sand ripples and lighter-toned bedrock. This view is presented as a cylindrical-perspective projection with geometric seam correction.

  1. Opportunity's Surroundings on Sol 1687 (Stereo)

    Science.gov (United States)

    2009-01-01

    [figure removed for brevity, see original site] Left-eye view of a color stereo pair for PIA11739 [figure removed for brevity, see original site] Right-eye view of a color stereo pair for PIA11739 NASA's Mars Exploration Rover Opportunity used its navigation camera to take the images combined into this stereo, 360-degree view of the rover's surroundings on the 1,687th Martian day, or sol, of its surface mission (Oct. 22, 2008). The view appears three-dimensional when viewed through red-blue glasses. Opportunity had driven 133 meters (436 feet) that sol, crossing sand ripples up to about 10 centimeters (4 inches) tall. The tracks visible in the foreground are in the east-northeast direction. Opportunity's position on Sol 1687 was about 300 meters southwest of Victoria Crater. The rover was beginning a long trek toward a much larger crater, Endeavour, about 12 kilometers (7 miles) to the southeast. This panorama combines right-eye and left-eye views presented as cylindrical-perspective projections with geometric seam correction.

  2. Opportunity's Surroundings After Sol 1820 Drive (Stereo)

    Science.gov (United States)

    2009-01-01

    [figure removed for brevity, see original site] Left-eye view of a color stereo pair for PIA11841 [figure removed for brevity, see original site] Right-eye view of a color stereo pair for PIA11841 NASA's Mars Exploration Rover Opportunity used its navigation camera to take the images combined into this full-circle view of the rover's surroundings during the 1,820th to 1,822nd Martian days, or sols, of Opportunity's surface mission (March 7 to 9, 2009). This view combines images from the left-eye and right-eye sides of the navigation camera. It appears three-dimensional when viewed through red-blue glasses with the red lens on the left. The rover had driven 20.6 meters toward the northwest on Sol 1820 before beginning to take the frames in this view. Tracks from that drive recede southwestward. For scale, the distance between the parallel wheel tracks is about 1 meter (about 40 inches). The terrain in this portion of Mars' Meridiani Planum region includes dark-toned sand ripples and small exposures of lighter-toned bedrock. This view is presented as a cylindrical-perspective projection with geometric seam correction.

  3. The lithosphere-asthenosphere: Italy and surroundings

    International Nuclear Information System (INIS)

    Panza, G.F.; Aoudia, A.; Pontevivo, A.; Chimera, G.; Raykova, R.

    2003-02-01

    The velocity-depth distribution of the lithosphere-asthenosphere in the Italian region and surroundings is imaged, with a lateral resolution of about 100 km, by surface wave velocity tomography and non-linear inversion. Maps of the Moho depth, of the thickness of the lithosphere and of the shear-wave velocities, down to depths of 200 km and more, are constructed. A mantle wedge, identified in the uppermost mantle along the Apennines and the Calabrian Arc, underlies the principal recent volcanoes, and partial melting can be relevant in this part of the uppermost mantle. In Calabria a lithospheric doubling is seen, in connection with the subduction of the Ionian lithosphere. The asthenosphere is shallow in the Southern Tyrrhenian Sea. High velocity bodies, cutting the asthenosphere, outline the Adria-lonian subduction in the Tyrrhenian Sea and the deep-reaching lithospheric root in the Western Alps. Less deep lithospheric roots are seen in the Central Apennines. The lithosphere-asthenosphere properties delineate a differentiation between the northern and the southern sectors of the Adriatic Sea, likely attesting the fragmentation of Adria. (author)

  4. The lithosphere-asthenosphere Italy and surroundings

    CERN Document Server

    Panza, G F; Chimera, G; Pontevivo, A; Raykova, R

    2003-01-01

    The velocity-depth distribution of the lithosphere-asthenosphere in the Italian region and surroundings is imaged, with a lateral resolution of about 100 km, by surface wave velocity tomography and non-linear inversion. Maps of the Moho depth, of the thickness of the lithosphere and of the shear-wave velocities, down to depths of 200 km and more, are constructed. A mantle wedge, identified in the uppermost mantle along the Apennines and the Calabrian Arc, underlies the principal recent volcanoes, and partial melting can be relevant in this part of the uppermost mantle. In Calabria a lithospheric doubling is seen, in connection with the subduction of the Ionian lithosphere. The asthenosphere is shallow in the Southern Tyrrhenian Sea. High velocity bodies, cutting the asthenosphere, outline the Adria-lonian subduction in the Tyrrhenian Sea and the deep-reaching lithospheric root in the Western Alps. Less deep lithospheric roots are seen in the Central Apennines. The lithosphere-asthenosphere properties delineat...

  5. INTERSTELLAR MAGNETIC FIELD SURROUNDING THE HELIOPAUSE

    International Nuclear Information System (INIS)

    Whang, Y. C.

    2010-01-01

    This paper presents a three-dimensional analytical solution, in the limit of very low plasma β-ratio, for the distortion of the interstellar magnetic field surrounding the heliopause. The solution is obtained using a line dipole method that is the integration of point dipole along a semi-infinite line; it represents the magnetic field caused by the presence of the heliopause. The solution allows the variation of the undisturbed magnetic field at any inclination angle. The heliosphere is considered as having blunt-nosed geometry on the upwind side and it asymptotically approaches a cylindrical geometry having an open exit for the continuous outflow of the solar wind on the downwind side. The heliopause is treated as a magnetohydrodynamic tangential discontinuity; the interstellar magnetic field lines at the boundary are tangential to the heliopause. The interstellar magnetic field is substantially distorted due to the presence of the heliopause. The solution shows the draping of the field lines around the heliopause. The magnetic field strength varies substantially near the surface of the heliopause. The effect on the magnetic field due to the presence of the heliopause penetrates very deep into the interstellar space; the depth of penetration is of the same order of magnitude as the scale length of the heliosphere.

  6. Eyelid skin as a potential site for drug delivery to conjunctiva and ocular tissues.

    Science.gov (United States)

    See, Gerard Lee; Sagesaka, Ayano; Sugasawa, Satoko; Todo, Hiroaki; Sugibayashi, Kenji

    2017-11-25

    The feasibility of topical application onto the (lower) eyelid skin to deliver hydrophilic and lipophilic compounds into the conjunctiva and ocular tissues was evaluated by comparing with conventional eye drop application. Skin permeation and the concentration of several model compounds, and skin impedance were determined utilizing eyelid skin from hairless rats, as well as abdominal skin in the same animals for comparison. In vitro static diffusion cells were used to assess the skin permeation in order to provide key insights into the relationship between the skin sites and drugs. The obtained results revealed that drug permeation through the eyelid skin was much higher than that through abdominal skin regardless of the drug lipophilicity. Specifically, diclofenac sodium salt and tranilast exhibited approximately 6-fold and 11-fold higher permeability coefficients, respectively, through eyelid skin compared with abdominal skin. Histomorphological evaluation and in vivo distribution of model fluorescent dyes were also examined in the conjunctiva and skin after eyelid administration by conventional microscope and confocal laser scanning microscope analyses. The result revealed that eyelid skin has a thinner stratum corneum, thereby showing lower impedance, which could be the reason for the higher drug permeation through eyelid skin. Comparative evaluation of lipophilic and hydrophilic model compounds administered via the eyelid skin over 8h revealed stronger fluorescence intensity in the skin and surrounding tissues compared with eye drop administration. These results suggested that the (lower) eyelid skin is valuable as a prospective site for ophthalmic medicines. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Effects of irradiation of skin flaps

    International Nuclear Information System (INIS)

    Sumi, Y.; Ueda, M.; Oka, T.; Torii, S.

    1984-01-01

    The reaction of skin flaps to irradiation and the optimum postoperative time for irradiation was studied in the rat. Flaps showed different reactions depending on the time of irradiation. There was a correlation between the radiosensitivity and the vascularity of the flap. Those flaps in the marginal hypovascular stage of revascularization showed reactions similar to normal skin. However, severe adverse reactions were observed in the marginal hypervascular stage

  8. The skin microbiome: Associations between altered microbial communities and disease.

    Science.gov (United States)

    Weyrich, Laura S; Dixit, Shreya; Farrer, Andrew G; Cooper, Alan J; Cooper, Alan J

    2015-11-01

    A single square centimetre of the human skin can contain up to one billion microorganisms. These diverse communities of bacteria, fungi, mites and viruses can provide protection against disease, but can also exacerbate skin lesions, promote disease and delay wound healing. This review addresses the current knowledge surrounding the healthy skin microbiome and examines how different alterations to the skin microbial communities can contribute to disease. Current methodologies are considered, changes in microbial diversity and colonisation by specific microorganisms are discussed in the context of atopic dermatitis, psoriasis, acne vulgaris and chronic wounds. The recent impact of modern Westernised lifestyles on the human skin microbiome is also examined, as well as the potential benefits and pitfalls of novel therapeutic strategies. Further analysis of the human skin microbiome, and its interactions with the host immune system and other commensal microorganisms, will undoubtedly elucidate molecular mechanisms for disease and reveal gateways for novel therapeutic treatment strategies. © 2015 The Australasian College of Dermatologists.

  9. Lymphatic albumin clearance from psoriatic skin

    International Nuclear Information System (INIS)

    Staberg, B.; Klemp, P.; Aasted, M.; Worm, A.M.; Lund, P.

    1983-01-01

    In nine patients with untreated psoriasis vulgaris, human serum albumin labelled with 125 I or 131 I was injected intradermally in symmetrically located involved and uninvolved skin. The activity of the depots was followed by external detection, and the arrival of labelled albumin in plasma was monitored. In involved psoriatic skin the local mean half-time (T1/2) for tracer disappearance was 20.8 +/- 8.2 (S.D.) hr and in clinically normal skin, 29.1 +/- 9.6 (S.D.) hr. The difference was significant (p less than 0.002). Accordingly, the tracer from involved skin reached higher plasma levels than the tracer from uninvolved skin. However, under slight lymphatic stasis the appearance rate of radiolabelled albumin in plasma from both tissues was minimal during 1 to 2 hours after the injection, indicating that a local direct transvascular drainage of plasma albumin from the interstitium of diseased and normal skin was negligible. We conclude that the previously demonstrated increased extravasation of plasma proteins in involved psoriatic skin is compensated by an increased lymphatic drainage of plasma proteins, and not by an increased local transvascular return

  10. Oily skin: an overview.

    Science.gov (United States)

    Sakuma, Thais H; Maibach, Howard I

    2012-01-01

    Oily skin (seborrhea) is a common cosmetic problem that occurs when oversized sebaceous glands produce excessive amounts of sebum giving the appearance of shiny and greasy skin. This paper overviews the main concepts of sebaceous gland anatomy and physiology, including the biosynthesis, storage and release of sebum, as well as its relationship to skin hydration and water barrier function. We also address how skin oiliness may vary according to diet, age, gender, ethnicity and hot humid climates. The deeper understanding of this skin type provides the opportunity to better guide patients regarding skin care and also assist in the development of sebosuppressive agents. Copyright © 2012 S. Karger AG, Basel.

  11. Impacts of Artificial Reefs on Surrounding Ecosystems

    Science.gov (United States)

    Manoukian, Sarine

    Artificial reefs are becoming a popular biological and management component in shallow water environments characterized by soft seabed, representing both important marine habitats and tools to manage coastal fisheries and resources. An artificial reef in the marine environment acts as an open system with exchange of material and energy, altering the physical and biological characteristics of the surrounding area. Reef stability will depend on the balance of scour, settlement, and burial resulting from ocean conditions over time. Because of the unstable nature of sediments, they require a detailed and systematic investigation. Acoustic systems like high-frequency multibeam sonar are efficient tools in monitoring the environmental evolution around artificial reefs, whereas water turbidity can limit visual dive and ROV inspections. A high-frequency multibeam echo sounder offers the potential of detecting fine-scale distribution of reef units, providing an unprecedented level of resolution, coverage, and spatial definition. How do artificial reefs change over time in relation to the coastal processes? How accurately does multibeam technology map different typologies of artificial modules of known size and shape? How do artificial reefs affect fish school behavior? What are the limitations of multibeam technology for investigating fish school distribution as well as spatial and temporal changes? This study addresses the above questions and presents results of a new approach for artificial reef seafloor mapping over time, based upon an integrated analysis of multibeam swath bathymetry data and geoscientific information (backscatter data analysis, SCUBA observations, physical oceanographic data, and previous findings on the geology and sedimentation processes, integrated with unpublished data) from Senigallia artificial reef, northwestern Adriatic Sea (Italy) and St. Petersburg Beach Reef, west-central Florida continental shelf. A new approach for observation of fish

  12. Skin Stem Cells in Skin Cell Therapy

    Directory of Open Access Journals (Sweden)

    Mollapour Sisakht

    2015-12-01

    Full Text Available Context Preclinical and clinical research has shown that stem cell therapy is a promising therapeutic option for many diseases. This article describes skin stem cells sources and their therapeutic applications. Evidence Acquisition Compared with conventional methods, cell therapy reduces the surgical burden for patients because it is simple and less time-consuming. Skin cell therapy has been developed for variety of diseases. By isolation of the skin stem cell from the niche, in vitro expansion and transplantation of cells offers a surprising healing capacity profile. Results Stem cells located in skin cells have shown interesting properties such as plasticity, transdifferentiation, and specificity. Mesenchymal cells of the dermis, hypodermis, and other sources are currently being investigated to promote regeneration. Conclusions Because skin stem cells are highly accessible from autologous sources and their immunological profile is unique, they are ideal for therapeutic approaches. Optimization of administrative routes requires more investigation own to the lack of a standard protocol.

  13. Study of mast cell count in skin tags

    Directory of Open Access Journals (Sweden)

    Zaher Hesham

    2007-01-01

    Full Text Available Background: Skin tags or acrochordons are common tumors of middle-aged and elderly subjects. They consist of loose fibrous tissue and occur mainly on the neck and major flexures as small, soft, pedunculated protrusions. Objectives: The aim was to compare the mast cells count in skin tags to adjacent normal skin in diabetic and nondiabetic participants in an attempt to elucidate the possible role of mast cells in the pathogenesis of skin tags. Participants and Methods: Thirty participants with skin tags were divided into group I (15 nondiabetic participants and group II (15 diabetic participants. Three biopsies were obtained from each participant: a large skin tag, a small skin tag and adjacent normal skin. Mast cell count from all the obtained sections was carried out, and the mast cell density was expressed as the average mast cell count/high power field (HPF. Results: A statistically significant increase in mast cells count in skin tags in comparison to normal skin was detected in group I and group II. There was no statistically significant difference between mast cell counts in skin tags of both the groups. Conclusion: Both the mast cell mediators and hyperinsulinemia are capable of inducing fibroblast proliferation and epidermal hyperplasia that are the main pathologic abnormalities seen in all types of skin tags. However, the presence of mast cells in all examined skin tags regardless of diabetes and obesity may point to the possible crucial role of mast cells in the etiogenesis of skin tags through its interaction with fibroblasts and keratinocytes.

  14. Infrared imaging of skin lesions

    Science.gov (United States)

    McIntosh, Laura M.; Mansfield, James R.; Jackson, Michael; Crowson, A. Neil; Mantsch, Henry H.

    2002-02-01

    IR spectroscopy produces spectra in which detailed information concerning chemical structure is inherent. Numerous studies have demonstrated that the most useful IR methods for analysis of biological tissues are microscopic image-based techniques in which fine-scaled spatial and high-quality spectral information is integrated. Unlike traditional visible microscopic methods, the contrast in IR imaging is gained by differences in spectra and the spatial heterogeneity of biochemical components, not by the addition of stains. In order for IR imaging to be more broadly accepted, non-subjective data processing methods are being developed to extract the most out of the large spectral images that are acquired. This paper demonstrates data processing techniques that have been extremely useful in the analysis of normal and abnormal skin. Analysis of skin specimens is of particular clinical importance due to the difficulty in rendering a differential diagnosis. Unstained frozen skin sections were mapped using an IR microscope. Functional group mapping, clustering routines and linear discriminant analysis were used to process the data. Functional group mapping and clustering routines were useful in the initial interpretation of images and to research for trends in uncharacterized spectral images. LDA was useful for differentiating normal from abnormal tissue once a well- defined training spectral set was established. Representative spectroscopic images are shown that demonstrate the power of IR imaging.

  15. Examine Your Skin

    Science.gov (United States)

    ... Support Donate Share Facebook Twitter Newsletter Examine Your Skin Watch the video below and in only two minutes, you can learn to examine your skin. A special thanks to Dr. Martin Weinstock, MD, ...

  16. Examine Your Skin

    Medline Plus

    Full Text Available ... Support Donate Share Facebook Twitter Newsletter Examine Your Skin Watch the video below and in only two minutes, you can learn to examine your skin. A special thanks to Dr. Martin Weinstock, MD, ...

  17. Bleeding into the skin

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/003235.htm Bleeding into the skin To use the sharing features on this page, please enable JavaScript. Bleeding into the skin can occur from broken blood ...

  18. Mantoux Tuberculin Skin Test

    Centers for Disease Control (CDC) Podcasts

    Learn how to evaluate people for latent TB infection with the Mantoux tuberculin skin test. This podcast includes sections on administering and reading the Mantoux tuberculin skin test, the standard method for detecting latent TB infection since the 1930s.

  19. Laser surgery - skin

    Science.gov (United States)

    ... Bleeding Problem not going away Infection Pain Scarring Skin color changes Some laser surgery is done when you are asleep and ... TG, Elston DM, eds. Andrews' Diseases of the Skin: Clinical ... lasers, lights, and tissue interactions. In: Hruza GJ, Avram ...

  20. Examine Your Skin

    Medline Plus

    Full Text Available ... Suggestions Examine Your Skin Newly Diagnosed? Understanding Your Pathology Biopsy: The First Step Sentinel Node Biopsy Melanoma ... Suggestions Examine Your Skin Newly Diagnosed? Understanding Your Pathology Biopsy: The First Step Sentinel Node Biopsy Melanoma ...

  1. Skin self-exam

    Science.gov (United States)

    Skin cancer - self-exam; Melanoma - self-exam; Basal cell cancer - self-exam; Squamous cell - self-exam; Skin mole - self-exam ... Checking your skin regularly can help you notice any unusual changes. Follow your health care provider's recommendations on how often to ...

  2. Skin Conditions during Pregnancy

    Science.gov (United States)

    ... during pregnancy. For most skin changes, however, health care providers are not sure of the exact cause. Why do dark spots and patches appear on the skin during pregnancy? Dark spots and patches are caused by an increase in the body’s melanin—a natural substance that gives color to the skin and ...

  3. Skin layer mechanics

    NARCIS (Netherlands)

    Geerligs, M.

    2010-01-01

    The human skin is composed of several layers, each with an unique structure and function. Knowledge about the mechanical behavior of these skin layers is important for clinical and cosmetic research, such as the development of personal care products and the understanding of skin diseases. Until

  4. Hyperelastic Material Properties of Mouse Skin under Compression.

    Directory of Open Access Journals (Sweden)

    Yuxiang Wang

    Full Text Available The skin is a dynamic organ whose complex material properties are capable of withstanding continuous mechanical stress while accommodating insults and organism growth. Moreover, synchronized hair cycles, comprising waves of hair growth, regression and rest, are accompanied by dramatic fluctuations in skin thickness in mice. Whether such structural changes alter skin mechanics is unknown. Mouse models are extensively used to study skin biology and pathophysiology, including aging, UV-induced skin damage and somatosensory signaling. As the skin serves a pivotal role in the transfer function from sensory stimuli to neuronal signaling, we sought to define the mechanical properties of mouse skin over a range of normal physiological states. Skin thickness, stiffness and modulus were quantitatively surveyed in adult, female mice (Mus musculus. These measures were analyzed under uniaxial compression, which is relevant for touch reception and compression injuries, rather than tension, which is typically used to analyze skin mechanics. Compression tests were performed with 105 full-thickness, freshly isolated specimens from the hairy skin of the hind limb. Physiological variables included body weight, hair-cycle stage, maturity level, skin site and individual animal differences. Skin thickness and stiffness were dominated by hair-cycle stage at young (6-10 weeks and intermediate (13-19 weeks adult ages but by body weight in mature mice (26-34 weeks. Interestingly, stiffness varied inversely with thickness so that hyperelastic modulus was consistent across hair-cycle stages and body weights. By contrast, the mechanics of hairy skin differs markedly with anatomical location. In particular, skin containing fascial structures such as nerves and blood vessels showed significantly greater modulus than adjacent sites. Collectively, this systematic survey indicates that, although its structure changes dramatically throughout adult life, mouse skin at a given

  5. Main approaches for delivering antioxidant vitamins through the skin to prevent skin ageing.

    Science.gov (United States)

    Gašperlin, Mirjana; Gosenca, Mirjam

    2011-07-01

    One of the major contributions to skin photoageing and diseases is oxidative stress, caused by UV radiation inducing reactive oxygen and nitrogen species. Successful prophylaxis and therapy would necessitate control of the oxidant/antioxidant balance at the affected site, which can be achieved through the external supply of endogenous antioxidants. This review discusses possible strategies for dermal delivery of the antioxidant vitamins E and C, as oral supplementation has proved insufficient. These antioxidants have low skin bioavailability, owing to their poor solubility, inefficient skin permeability, or instability during storage. These drawbacks can be overcome by various approaches, such as chemical modification of the vitamins and the use of new colloidal drug delivery systems. New knowledge is included about the importance of: enhancing the endogenous skin antioxidant defense through external supply; the balance between various skin antioxidants; factors that can improve the skin bioavailability of antioxidants; and new delivery systems, such as microemulsions, used to deliver vitamins C and E into the skin simultaneously. A promising strategy for enhancing skin protection from oxidative stress is to support the endogenous antioxidant system, with antioxidants containing products that are normally present in the skin.

  6. Hyperpigmentation of the skin associated with minocycline therapy

    International Nuclear Information System (INIS)

    Gordon, G.; Sparano, B.M.; Iatropoulos, M.J.

    1985-01-01

    Skin biopsy specimens and discolored fingernails from minocycline-treated patients were examined by light and electron microscopy, histochemistry, and energy-dispersive x-ray analysis. Both hyperpigmented and adjacent normally pigmented skin samples contained pigment-laden macrophages in the dermis, although these cells were more numerous in the hyperpigmented skin samples. Elemental analysis showed that both pigment deposits and stratum corneum of hyperpigmented skin samples contained iron and calcium. Discolored areas of fingernails from a minocycline-treated patient also contained iron and calcium. Both skin and nail discoloration were possibly due to the presence of an iron chelate of minocycline and/or quinoid derivatives of minocycline. The presence of iron-containing pigment in normal as well as hyperpigmented skin may have predisposed to formation of minocycline-associated pigment in these patients

  7. Taking Care of Your Skin

    Science.gov (United States)

    ... Educators Search English Español Taking Care of Your Skin KidsHealth / For Kids / Taking Care of Your Skin ... you're in. Why Be Nice to Your Skin? Like the heart, stomach, and brain, your skin ...

  8. High resolution skin colorimetry, strain mapping and mechanobiology.

    Science.gov (United States)

    Devillers, C; Piérard-Franchimont, C; Schreder, A; Docquier, V; Piérard, G E

    2010-08-01

    Skin colours are notoriously different between individuals. They are governed by ethnicities and phototypes, and further influenced by a variety of factors including photoexposures and sustained mechanical stress. Indeed, mechanobiology is a feature affecting the epidermal melanization. High-resolution epiluminescence colorimetry helps in deciphering the effects of forces generated by Langer's lines or relaxed skin tension lines on the melanocyte activity. The same procedure shows a prominent laddering pattern of melanization in striae distensae contrasting with the regular honeycomb pattern in the surrounding skin.

  9. Diagnosis of malignant melanoma and basal cell carcinoma by in vivo NIR-FT Raman spectroscopy is independent of skin pigmentation

    DEFF Research Database (Denmark)

    Philipsen, P A; Knudsen, L; Gniadecka, M

    2013-01-01

    and skin tumour diagnostics in vivo. We obtained Raman spectra in vivo from the normal skin of 55 healthy persons with different skin pigmentation (Fitzpatrick skin type I-VI) and in vivo from 25 basal cell carcinomas, 41 pigmented nevi and 15 malignant melanomas. Increased skin pigmentation resulted...

  10. Analytical Solution of Tunnel Surrounding Rock for Stress and Displacement Based on Lade–Duncan Criterion

    Directory of Open Access Journals (Sweden)

    MingZheng Zhu

    2018-01-01

    Full Text Available The deformation and failure of tunnel surrounding rock is the result of tunnel excavation disturbance and rock stress release. When the local stress of surrounding rock exceeds the elastic limit of rock mass, the plastic analysis of surrounding rock must be carried out to judge the stability of tunnel. In this study, the Lade–Duncan yield criterion is used to calculate the analytic solutions for the surrounding rock in a tunnel, and the radius and displacement of the plastic zone are deduced using an equilibrium equation. The plastic zone radius and displacement based on Lade–Duncan criterion and Mohr–Coulomb criterion were compared by using single-factor analysis method under the different internal friction angles, in situ stresses, and support resistances. The results show that the solutions of the radius and displacement of plastic zone calculated by the Lade–Duncan criterion are close to those of Mohr–Coulomb criterion under the high internal friction angle and support resistance or low in situ rock stress; however, the radius and displacement of the plastic zone calculated by the Lade–Duncan criterion are larger under normal circumstances, and the Lade–Duncan criterion is more applicable to the stability analysis of the surrounding rock in a tunnel.

  11. SKIN CARE IN INFANTS

    Directory of Open Access Journals (Sweden)

    I. N. Zakharova

    2014-01-01

    Full Text Available Human skin is a complex organ in its structure. Numerous functions of the skin may be impaired in its pathology. Anatomical and physiological characteristics of the skin in children predispose to common diseases of the skin. Diaper dermatitis is one of the most common skin diseases during infancy and childhood. Diapered skin is exposed to friction and excessive hydration, has a higher pH than nondiapered skin, and is repeatedly soiled with feces that contains enzymes with high irritation potential for the skin. Diaper dermatitis may vary in clinical severity and course. Therapeutically, frequent diaper changes and adequate skin care are most important. Appropriate skin care can help to prevent the occurrence of diaper dermatitis and to speed up the healing of affected skin. This includes frequent diaper changes and aeration, gentle cleansing, and the use of a barrier cream. For the treatment of diaper dermatitis agents selected depending on the presence and severity of complications. For prevention and treatment of uncomplicated diaper dermatitis effective means of containing dexpantenol.

  12. Attention and normalization circuits in macaque V1

    Science.gov (United States)

    Sanayei, M; Herrero, J L; Distler, C; Thiele, A

    2015-01-01

    Attention affects neuronal processing and improves behavioural performance. In extrastriate visual cortex these effects have been explained by normalization models, which assume that attention influences the circuit that mediates surround suppression. While normalization models have been able to explain attentional effects, their validity has rarely been tested against alternative models. Here we investigate how attention and surround/mask stimuli affect neuronal firing rates and orientation tuning in macaque V1. Surround/mask stimuli provide an estimate to what extent V1 neurons are affected by normalization, which was compared against effects of spatial top down attention. For some attention/surround effect comparisons, the strength of attentional modulation was correlated with the strength of surround modulation, suggesting that attention and surround/mask stimulation (i.e. normalization) might use a common mechanism. To explore this in detail, we fitted multiplicative and additive models of attention to our data. In one class of models, attention contributed to normalization mechanisms, whereas in a different class of models it did not. Model selection based on Akaike's and on Bayesian information criteria demonstrated that in most cells the effects of attention were best described by models where attention did not contribute to normalization mechanisms. This demonstrates that attentional influences on neuronal responses in primary visual cortex often bypass normalization mechanisms. PMID:25757941

  13. Attention and normalization circuits in macaque V1.

    Science.gov (United States)

    Sanayei, M; Herrero, J L; Distler, C; Thiele, A

    2015-04-01

    Attention affects neuronal processing and improves behavioural performance. In extrastriate visual cortex these effects have been explained by normalization models, which assume that attention influences the circuit that mediates surround suppression. While normalization models have been able to explain attentional effects, their validity has rarely been tested against alternative models. Here we investigate how attention and surround/mask stimuli affect neuronal firing rates and orientation tuning in macaque V1. Surround/mask stimuli provide an estimate to what extent V1 neurons are affected by normalization, which was compared against effects of spatial top down attention. For some attention/surround effect comparisons, the strength of attentional modulation was correlated with the strength of surround modulation, suggesting that attention and surround/mask stimulation (i.e. normalization) might use a common mechanism. To explore this in detail, we fitted multiplicative and additive models of attention to our data. In one class of models, attention contributed to normalization mechanisms, whereas in a different class of models it did not. Model selection based on Akaike's and on Bayesian information criteria demonstrated that in most cells the effects of attention were best described by models where attention did not contribute to normalization mechanisms. This demonstrates that attentional influences on neuronal responses in primary visual cortex often bypass normalization mechanisms. © 2015 The Authors. European Journal of Neuroscience published by Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  14. Nutrition and skin.

    Science.gov (United States)

    Pappas, Apostolos; Liakou, Aikaterini; Zouboulis, Christos C

    2016-09-01

    Nutrition has long been associated with skin health, including all of its possible aspects from beauty to its integrity and even the aging process. Multiple pathways within skin biology are associated with the onset and clinical course of various common skin diseases, such as acne, atopic dermatitis, aging, or even photoprotection. These conditions have been shown to be critically affected by nutritional patterns and dietary interventions where well-documented studies have demonstrated beneficial effects of essential nutrients on impaired skin structural and functional integrity and have restored skin appearance and health. Although the subject could be vast, the intention of this review is to provide the most relevant and the most well-documented information on the role of nutrition in common skin conditions and its impact on skin biology.

  15. Skin absorption through atopic dermatitis skin

    DEFF Research Database (Denmark)

    Halling-Overgaard, A-S; Kezic, S; Jakasa, I

    2017-01-01

    Patients with atopic dermatitis have skin barrier impairment in both lesional and non-lesional skin. They are typically exposed to emollients daily and topical anti-inflammatory medicaments intermittently, hereby increasing the risk of developing contact allergy and systemic exposed to chemicals...... ingredients found in these topical preparations. We systematically searched for studies that investigated skin absorption of various penetrants, including medicaments, in atopic dermatitis patients, but also animals with experimentally induced dermatitis. We identified 40 articles, i.e. 11 human studies...... examining model penetrants, 26 human studies examining atopic dermatitis drugs and 3 animal studies. We conclude that atopic dermatitis patients have nearly two-fold increased skin absorption when compared to healthy controls. There is a need for well-designed epidemiological and dermato...

  16. Visual attention and flexible normalization pools

    Science.gov (United States)

    Schwartz, Odelia; Coen-Cagli, Ruben

    2013-01-01

    Attention to a spatial location or feature in a visual scene can modulate the responses of cortical neurons and affect perceptual biases in illusions. We add attention to a cortical model of spatial context based on a well-founded account of natural scene statistics. The cortical model amounts to a generalized form of divisive normalization, in which the surround is in the normalization pool of the center target only if they are considered statistically dependent. Here we propose that attention influences this computation by accentuating the neural unit activations at the attended location, and that the amount of attentional influence of the surround on the center thus depends on whether center and surround are deemed in the same normalization pool. The resulting form of model extends a recent divisive normalization model of attention (Reynolds & Heeger, 2009). We simulate cortical surround orientation experiments with attention and show that the flexible model is suitable for capturing additional data and makes nontrivial testable predictions. PMID:23345413

  17. Clinical efficacy of artificial skin combined with vacuum sealing drainage in treating large-area skin defects

    Institute of Scientific and Technical Information of China (English)

    TANG Jin; GUO Wei-chun; YU Ling; ZHAO Sheng-hao

    2010-01-01

    Objective: To observe the clinical efficacy of artificial skin combined with vacuum sealing drainage (VSD) in treating large-area skin defects.Methods: Totally 18 patients with skin defects, treated with artificial skin combined with VSD from September 2008to May 2009 in our hospital, were retrospectively analyzed in this study. There were 15 males and 3 females, aged 7-66years, 34.3 years on average. Among them, 10 cases had skin laceration caused by traffic accidents (7 with open fractures), 1 mangled injury, 1 blast injury, 1 stump infection combined with skin defects after amputation and 5 heel ulcers.Results: All skin grafts in 16 cases survived after being controlled by VSD for one time. For the rest 2 patients,one with skin avulsion on the left foot was given median thickness skin grafts after three times of VSD, the other with open fractures in the left tibia and fibula caused by a traffic accident was given free flap transplantation. Skin grafts of both patients survived, with normal color and rich blood supply.Conclusion: Skin grafting in conjunction with artificial skin and VSD is much more effective than traditional dressing treatment and worth wide application in clinic.

  18. Skin care products can aggravate epidermal function: studies in a murine model suggest a pathogenic role in sensitive skin.

    Science.gov (United States)

    Li, Zhengxiao; Hu, Lizhi; Elias, Peter M; Man, Mao-Qiang

    2018-02-01

    Sensitive skin is defined as a spectrum of unpleasant sensations in response to a variety of stimuli. However, only some skin care products provoke cutaneous symptoms in individuals with sensitive skin. Hence, it would be useful to identify products that could provoke cutaneous symptoms in individuals with sensitive skin. To assess whether vehicles, as well as certain branded skin care products, can alter epidermal function following topical applications to normal mouse skin. Following topical applications of individual vehicle or skin care product to C57BL/6J mice twice daily for 4 days, transepidermal water loss (TEWL) rates, stratum corneum (SC) hydration and skin surface pH were measured on treated versus untreated mouse skin with an MPA5 device and pH 900 pH meter. Our results show that all tested products induced abnormalities in epidermal functions of varying severity, including elevations in TEWL and skin surface pH, and reduced SC hydration. Our results suggest that mice can serve as a predictive model that could be used to evaluate the potential safety of skin care products in humans with sensitive skin. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. Differentiation of involved and uninvolved psoriatic skin from healthy skin using noninvasive visual, colorimeter and evaporimeter methods.

    Science.gov (United States)

    Pershing, L K; Bakhtian, S; Wright, E D; Rallis, T M

    1995-08-01

    Uninvolved skin of psoriasis may not be entirely normal. The object was to characterize healthy, uninvolved psoriatic skin and lesional skin by biophysical methods. Involved and uninvolved psoriatic and age-gender matched healthy skin was measured objectively with a colorimeter and evaporimeter and subjectively with visual assessment in 14 subjects. Visual assessment of erythema (E), scaling (S) and induration (I) as well as the target lesion score at the involved psoriatic skin sites were significantly elevated (puninvolved psoriatic skin >healthy skin (pcolorimeter L* and a* scale values at uninvolved psoriatic skin sites were lower and higher (pcolorimeter description (L*× b*)/a* significantly differentiated healthy skin from both involved and uninvolved psoriatic skin. These collective data highlight that even visually appearing uninvolved psoriatic skin is compromised compared with healthy skin. These objective, noninvasive but differential capabilities of the colorimeter and evaporimeter will aid in the mechanistic quantification of new psoriatic drug therapies and in conjuction with biochemical studies, add to understanding of the multifactorial pathogenesis of psoriasis.

  20. Aerial radiological survey of the San Onofre Nuclear Generating Station and surrounding area, San Clemente, California

    International Nuclear Information System (INIS)

    Hilton, L.K.

    1980-12-01

    An airborne radiological survey of an 11 km 2 area surrounding the San Onofre Nuclear Generating Station was made 9 to 17 January 1980. Count rates observed at 60 m altitude were converted to exposure rates at 1 m above the ground and are presented in the form of an isopleth map. Detected radioisotopes and their associated gamma ray exposure rates were consistent with that expected from normal background emitters, except directly over the plant

  1. Ectodermal dysplasia-skin fragility syndrome

    Directory of Open Access Journals (Sweden)

    Vijay S Adhe

    2011-01-01

    Full Text Available Ectodermal dysplasia-skin fragility (EDSF syndrome is a rare and first described inherited disorder of desmosomes. It occurs due to loss-of-function mutations in PKP1 gene resulting in poorly formed desmosomes and loss of desmosomal and epidermal integrity. We report a case of a 2-year-old Indian male child who presented with palmoplantar hyperkeratosis with fissuring, short, sparse, and easily pluckable scalp hair, nail dystrophy, and multiple erosions over the skin. Skin biopsy showed epidermal hyperplasia with widening of intercellular spaces. His developmental milestones were delayed but intelligence was normal. Echocardiography, X-ray chest, and electrocardiogram were normal. Very few cases of this syndrome have been reported in the literature. We consider this as the first case report from India.

  2. CT after gastrectomy for gastric carcinoma : significance of soft tissue surrounding the celiac axis

    International Nuclear Information System (INIS)

    Baek, Seung Yon; Kim, Hae Young; Choi, Hye Young; Lee, Sun Wha; Ko, Eun Joo; Lee, Myung Sook

    1997-01-01

    To evaluate whether soft tissue surrounding the celiac axis, as seen on abdominal CT imaging after gastrectomy for gastric carcinoma, should be considered as the recurrence of carcinoma or postoperative change. One hundred and forty-one abdominal CT examinations of 71 patients who had undergone subtotal or total gastrectomy for gastric carcinoma were included in our study. Conventional CT scans were obtained with 1cm thickness and interval from the diaphragm to the kidneys after contrast enhancement. It was considered that carcinoma had not recurred if findings were negative on UGI series, endoscopy with biopsy and a normal level of carcinoembryonic antigen except for soft tissue surrounding the celiac axis on abdominal CT. We then divided subjects into a recurrence group(N=20) and normal group(N=51) and on initial follow-up CT(FU-CT), analyzed the incidence, margin, shape, extent, degree and pattern of attenuation of the soft tissue surrounding the celiac axis in both groups. Since the second FU-CT examination, we observed changes in the soft tissue surrounding the celiac axis. On initial follow-up CT, at mean 308 days after surgery, fifty-five percent(39/71) of total patients (70%(14/20) of the recurrence group and 49%(25/51) of the normal group) showed soft tissue surrounding the celiac axis. The margin was distinct in 12(86%) of the recurrence group and indistinct in 21(84%) of the normal group(p<0.001). Twelve (86%) of the recurrence group showed a nodular or confluent nodular shape and 21(84%) of the normal group showed a permeative shape (p<0.001). Extent was unilateral in eight (57%) of the recurrence group and bilateral in 16(64%) of the normal group. Attenuation was similar to that of the spleen and muscle in seven(50%) of the recurrence group and was similar to that of muscle in 18(72%) of the normal group. The pattern of attenuation was homogeneous in 13(93%) of the recurrence group and 21(84%) of the normal group. There was no significant difference in

  3. In vivo study of human skin using pulsed terahertz radiation

    International Nuclear Information System (INIS)

    Pickwell, E; Cole, B E; Fitzgerald, A J; Pepper, M; Wallace, V P

    2004-01-01

    Studies in terahertz (THz) imaging have revealed a significant difference between skin cancer (basal cell carcinoma) and healthy tissue. Since water has strong absorptions at THz frequencies and tumours tend to have different water content from normal tissue, a likely contrast mechanism is variation in water content. Thus, we have previously devised a finite difference time-domain (FDTD) model which is able to closely simulate the interaction of THz radiation with water. In this work we investigate the interaction of THz radiation with normal human skin on the forearm and palm of the hand in vivo. We conduct the first ever systematic in vivo study of the response of THz radiation to normal skin. We take in vivo reflection measurements of normal skin on the forearm and palm of the hand of 20 volunteers. We compare individual examples of THz responses with the mean response for the areas of skin under investigation. Using the in vivo data, we demonstrate that the FDTD model can be applied to biological tissue. In particular, we successfully simulate the interaction of THz radiation with the volar forearm. Understanding the interaction of THz radiation with normal skin will form a step towards developing improved imaging algorithms for diagnostic detection of skin cancer and other tissue disorders using THz radiation

  4. In vivo study of human skin using pulsed terahertz radiation

    Energy Technology Data Exchange (ETDEWEB)

    Pickwell, E [Semiconductor Physics Group, Cavendish Laboratory, Cambridge University, Madingley Road, Cambridge CB3 0HE (United Kingdom); Cole, B E [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom); Fitzgerald, A J [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom); Pepper, M [Semiconductor Physics Group, Cavendish Laboratory, Cambridge University, Madingley Road, Cambridge CB3 0HE (United Kingdom); Wallace, V P [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom)

    2004-05-07

    Studies in terahertz (THz) imaging have revealed a significant difference between skin cancer (basal cell carcinoma) and healthy tissue. Since water has strong absorptions at THz frequencies and tumours tend to have different water content from normal tissue, a likely contrast mechanism is variation in water content. Thus, we have previously devised a finite difference time-domain (FDTD) model which is able to closely simulate the interaction of THz radiation with water. In this work we investigate the interaction of THz radiation with normal human skin on the forearm and palm of the hand in vivo. We conduct the first ever systematic in vivo study of the response of THz radiation to normal skin. We take in vivo reflection measurements of normal skin on the forearm and palm of the hand of 20 volunteers. We compare individual examples of THz responses with the mean response for the areas of skin under investigation. Using the in vivo data, we demonstrate that the FDTD model can be applied to biological tissue. In particular, we successfully simulate the interaction of THz radiation with the volar forearm. Understanding the interaction of THz radiation with normal skin will form a step towards developing improved imaging algorithms for diagnostic detection of skin cancer and other tissue disorders using THz radiation.

  5. Detection of human papillomavirus in nonmelanoma skin cancer lesions and healthy perilesional skin in kidney transplant recipients and immunocompetent patients.

    Science.gov (United States)

    Bernat-García, J; Morales Suárez-Varela, M; Vilata-Corell, J J; Marquina-Vila, A

    2014-04-01

    The influence of human papillomavirus (HPV) on the development of nonmelanoma skin cancer (NMSC) is a topic of debate. HPV types from the beta genus (HPV-β) have been most frequently associated with the development of skin cancer. To analyze the prevalence and range of HPV types in NMSC lesions and healthy perilesional skin in immunodepressed and immunocompetent patients and to evaluate the influence of various clinical factors on the prevalence of HPV in skin cancer. Nested polymerase chain reaction and sequencing were used to detect HPV in 120 NMSC samples obtained by biopsy from 30 kidney transplant recipients and 30 immunocompetent patients. In all cases, a sample was taken from the tumor site and the surrounding healthy skin. Potential confounders were assessed and the data analyzed by multivariate logistic regression. HPV DNA was detected in 44 (73.3%) of the 60 samples from immunodepressed patients and in 32 (53.3%) of the 60 samples from immunocompetent patients (adjusted odds ratio, 3.4; 95% CI, 1.2-9.6). In both groups of patients, HPV was more common in healthy perilesional skin than in lesional skin. HPV-β was the most common type isolated. We found a wide range of HPV types (mostly HPV-β) in the skin of kidney transplant recipients and immunocompetent patients with skin cancer. Copyright © 2013 Elsevier España, S.L. and AEDV. All rights reserved.

  6. Use of autologous tissue engineered skin to treat porcine full-thickness skin defects

    Institute of Scientific and Technical Information of China (English)

    CAI Xia; CAO Yi-lin; CUI Lei; LIU Wei; GUAN Wen-xiang

    2005-01-01

    Objective: To explore a feasible method to repair full-thickness skin defects utilizing tissue engineered techniques. Methods: The Changfeng hybrid swines were used and the skin specimens were cut from the posterior limb girdle region, from which the keratinocytes and fibroblasts were isolated and harvested by trypsin, EDTA, and type II collagenase. The cells were seeded in Petri dishes for primary culture. When the cells were in logarithmic growth phase, they were treated with trypsin to separate them from the floor of the tissue culture dishes. A biodegradable material, Pluronic F-127, was prefabricated and mixed with these cells, and then the cell-Pluronic compounds were seeded evenly into a polyglycolic acid (PGA). Then the constructs were replanted to the autologous animals to repair the full-thickness skin defects. Histology and immunohistochemistry of the neotissue were observed in 1, 2, 4, and 8 postoperative weeks. Results: The cell-Pluronic F-127-PGA compounds repaired autologous full-thickness skin defects 1 week after implantation. Histologically, the tissue engineered skin was similar to the normal skin with stratified epidermis overlying a moderately thick collageneous dermis. Three of the structural proteins in the epidermal basement membrane zone, type IV collagen, laminin, and type VII collagen were detected using immunohistochemical methods. Conclusions: By studying the histology and immunohistochemistry of the neotissue, the bioengineered skin graft holds great promise for improving healing of the skin defects.

  7. Cutaneous Leishmaniasis Induces a Transmissible Dysbiotic Skin Microbiota that Promotes Skin Inflammation.

    Science.gov (United States)

    Gimblet, Ciara; Meisel, Jacquelyn S; Loesche, Michael A; Cole, Stephen D; Horwinski, Joseph; Novais, Fernanda O; Misic, Ana M; Bradley, Charles W; Beiting, Daniel P; Rankin, Shelley C; Carvalho, Lucas P; Carvalho, Edgar M; Scott, Phillip; Grice, Elizabeth A

    2017-07-12

    Skin microbiota can impact allergic and autoimmune responses, wound healing, and anti-microbial defense. We investigated the role of skin microbiota in cutaneous leishmaniasis and found that human patients infected with Leishmania braziliensis develop dysbiotic skin microbiota, characterized by increases in the abundance of Staphylococcus and/or Streptococcus. Mice infected with L. major exhibit similar changes depending upon disease severity. Importantly, this dysbiosis is not limited to the lesion site, but is transmissible to normal skin distant from the infection site and to skin from co-housed naive mice. This observation allowed us to test whether a pre-existing dysbiotic skin microbiota influences disease, and we found that challenging dysbiotic naive mice with L. major or testing for contact hypersensitivity results in exacerbated skin inflammatory responses. These findings demonstrate that a dysbiotic skin microbiota is not only a consequence of tissue stress, but also enhances inflammation, which has implications for many inflammatory cutaneous diseases. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. HIV behavioural surveillance among refugees and surrounding host ...

    African Journals Online (AJOL)

    We used a standardised behavioural surveillance survey (BSS), modified to be directly relevant to populations in conflict and post-conflict settings as well as to their surrounding host populations, to survey the populations of a refugee settlement in south-western Uganda and its surrounding area. Two-stage probability ...

  9. Investigation of the readout electronics of DELPHI surround muon chamber

    International Nuclear Information System (INIS)

    Khovanskij, N.; Krumshtejn, Z.; Ol'shevskij, A.; Sadovskij, A.; Sedykh, Yu.; Molnar, J.; Sicho, P.; Tomsa, Z.

    1995-01-01

    The characteristics of the readout electronics of the DELPHI surround muon chambers with various AMPLEX chips (AMPLEX 16 and AMPLEX-SICAL) are presented. This electronics is studied in a cosmic rays test of the real surround muon chamber model. 4 refs., 6 figs., 1 tab

  10. Real significance of skin contamination is

    International Nuclear Information System (INIS)

    Sudmann, R.H.

    1983-01-01

    For five decades, health physicists have discussed the thickness, area, significance of radioactive contamination and the exposures to various portions of the skin. Concern about instances of skin contamination extend beyond the resultant organ dose simply because it is a recognizable and quantifiable event. As such, there is a tendency for management and regulatory agencies to use it as a trend indicator. The final result is a score card similar to the list of OSHA reportable accidents. In fact, the skin contamination incidence rate has a somewhat different meaning to the health physicist, to the manager, and to the regulator. The question must then be asked, What is the true significance of skin contamination, Is it the resultant skin dose, Is it an indicator of loss of control, Is it both or neither. In order to answer these questions, Rockwell Hanford Operations began analysis of the previous five years records of skin contamination cases. Since by policy each incidence of skin contamination is documented, a large percentage of the 425 records analyzed were of low level activity (less than 100 dpm/cm 2 ) on the extremeties, primarily hands and fingers. Most of these cases were readily decontaminated with soap and water. Individual elements studied included: detection/monitoring methods and limits; impact of type of operation on the incidence rate; causes of and methods for reduction of the incidence rate; reporting and documentation; and dose assessment. Results of the study indicate that skin contamination rarely presents a beta dose problem because it is normally highly localized on the extremeties. Only in unusual cases does it represent a potential for internal deposition. Thus, the real importance of skin contamination incidence is as an indicator of deteriorating conditions and should be reviewed by health physicists, managers and regulators as such

  11. Normal Pressure Hydrocephalus (NPH)

    Science.gov (United States)

    ... local chapter Join our online community Normal Pressure Hydrocephalus (NPH) Normal pressure hydrocephalus is a brain disorder ... Symptoms Diagnosis Causes & risks Treatments About Normal Pressure Hydrocephalus Normal pressure hydrocephalus occurs when excess cerebrospinal fluid ...

  12. Skin barrier function

    DEFF Research Database (Denmark)

    2016-01-01

    Renowned experts present the latest knowledge Although a very fragile structure, the skin barrier is probably one of the most important organs of the body. Inward/out it is responsible for body integrity and outward/in for keeping microbes, chemicals, and allergens from penetrating the skin. Since...... the role of barrier integrity in atopic dermatitis and the relationship to filaggrin mutations was discovered a decade ago, research focus has been on the skin barrier, and numerous new publications have become available. This book is an interdisciplinary update offering a wide range of information...... on the subject. It covers new basic research on skin markers, including results on filaggrin and on methods for the assessment of the barrier function. Biological variation and aspects of skin barrier function restoration are discussed as well. Further sections are dedicated to clinical implications of skin...

  13. Recommendations for skin decontamination

    International Nuclear Information System (INIS)

    1989-01-01

    Further to the reecommendations for determining the surface contamination of the skin and estimating the radiation exposure of the skin after contamination (SAAS-Mitt--89-16), measures for skin decontamination are recommended. They are necessary if (1) after simple decontamination by means of water, soap and brush without damaging the skin the surface contamination limits are exceeded and the radiation exposure to be expected for the undamaged healthy skin is estimated as to high, and if (2) a wound is contaminated. To remove skin contaminations, in general universally applicable, non-aggressive decontamination means and methods are sufficient. In special cases, nuclide-specific decontamination is required taking into account the properties of the radioactive substance

  14. Human normal tissue reactions in radiotherapy

    International Nuclear Information System (INIS)

    Taniike, Keiko

    1990-01-01

    Acute and late normal tissue reactions in radiotherapy have not been considered to be major problems with conventional fractionation. But they may cause certain problems when newer schedules such as hyperfractionation or accelerated fractionation are used. In opposing parallel radiotherapy, the dose fractionation of skin or subcutaneous connective tissue are different between in one portal and two portals daily. So we examined acute skin erythema and late connective tissue fibrosis in the two groups (one and two portals) of the patients with uterus cancer. Acute skin erythema and late connective tissue fibrosis were slightly stronger in case of one portal daily. In relation to the anatomical site of skin, acute skin erythema was stronger at the buttocks than the lower abdomen, but late fibrosis was reverse to that. So the degree of acute skin erythema did not predict the degree of late connective tissue fibrosis. The number of Time Dose Fractionation Factor could roughly estimate the degree of erythema and fibrosis. Late fibrosis in 36 fractions increased with an increase of abdominal thickness, but acute erythema did not. (author)

  15. Modeling of skin cancer dermatoscopy images

    Science.gov (United States)

    Iralieva, Malica B.; Myakinin, Oleg O.; Bratchenko, Ivan A.; Zakharov, Valery P.

    2018-04-01

    An early identified cancer is more likely to effective respond to treatment and has a less expensive treatment as well. Dermatoscopy is one of general diagnostic techniques for skin cancer early detection that allows us in vivo evaluation of colors and microstructures on skin lesions. Digital phantoms with known properties are required during new instrument developing to compare sample's features with data from the instrument. An algorithm for image modeling of skin cancer is proposed in the paper. Steps of the algorithm include setting shape, texture generation, adding texture and normal skin background setting. The Gaussian represents the shape, and then the texture generation based on a fractal noise algorithm is responsible for spatial chromophores distributions, while the colormap applied to the values corresponds to spectral properties. Finally, a normal skin image simulated by mixed Monte Carlo method using a special online tool is added as a background. Varying of Asymmetry, Borders, Colors and Diameter settings is shown to be fully matched to the ABCD clinical recognition algorithm. The asymmetry is specified by setting different standard deviation values of Gaussian in different parts of image. The noise amplitude is increased to set the irregular borders score. Standard deviation is changed to determine size of the lesion. Colors are set by colormap changing. The algorithm for simulating different structural elements is required to match with others recognition algorithms.

  16. Discovery of skin lymphocytes was a game changer in experimental dermatology

    NARCIS (Netherlands)

    Matos, Tiago R.; de Rie, Menno A.

    2017-01-01

    A substantial part of ongoing research in experimental dermatology focuses on skin T cellsfor that reason, we find important to highlight the pioneering work of Jan D. Bos et al. from 1987 (The skin immune system (SIS): Distribution and immunophenotype of lymphocyte subpopulations in normal skin)

  17. Changes in unique hues induced by chromatic surrounds.

    Science.gov (United States)

    Klauke, Susanne; Wachtler, Thomas

    2016-03-01

    A chromatic surround can have a strong influence on the perceived hue of a stimulus. We investigated whether chromatic induction has similar effects on the perception of colors that appear pure and unmixed (unique red, green, blue, and yellow) as on other colors. Subjects performed unique hue settings of stimuli in isoluminant surrounds of different chromaticities. Compared with the settings in a neutral gray surround, unique hue settings altered systematically with chromatic surrounds. The amount of induced hue shift depended on the difference between stimulus and surround hues, and was similar for unique hue settings as for settings of nonunique hues. Intraindividual variability in unique hue settings was roughly twice as high as for settings obtained in asymmetric matching experiments, which may reflect the presence of a reference stimulus in the matching task. Variabilities were also larger with chromatic surrounds than with neutral gray surrounds, for both unique hue settings and matching of nonunique hues. The results suggest that the neural representations underlying unique hue percepts are influenced by the same neural processing mechanisms as the percepts of other colors.

  18. Normalization: A Preprocessing Stage

    OpenAIRE

    Patro, S. Gopal Krishna; Sahu, Kishore Kumar

    2015-01-01

    As we know that the normalization is a pre-processing stage of any type problem statement. Especially normalization takes important role in the field of soft computing, cloud computing etc. for manipulation of data like scale down or scale up the range of data before it becomes used for further stage. There are so many normalization techniques are there namely Min-Max normalization, Z-score normalization and Decimal scaling normalization. So by referring these normalization techniques we are ...

  19. Photoactivation of corticosteroids in UVB-exposed skin.

    Science.gov (United States)

    Miolo, G; Caffieri, S; Dalzoppo, D; Gallocchio, F; Fasani, E; Beyersbergen van Henegouwen, G M J

    2011-04-04

    The photodegradation of flumethasone (FM) and fluocinolone acetonide (FC) was studied in solution and in the pig skin. Both glucocorticosteroids applied to the pig skin were unstable under UVB light. The photoproducts formed in the skin were the lumi-, photolumi- and andro-derivatives for FM, the same found in vitro. Instead, FC hydroperoxide formed in solution was not found in the skin: the reactivity and oxidative ability of this photoproduct towards biological substrates (lipids, proteins) seems the reason of the lack of its detection in the ex vivo model. In fact, it demonstrated to quickly oxidize amino acids and peptides, and to react with BSA both in the dark and under irradiation. Moreover, the presence in the irradiated pig skin of the FC andro-derivative, which usually forms in H-donating environment, seems consistent with the mechanism of Norrish I fragmentation followed by H-abstraction, likely from the surrounding biological substrates. These findings indicate that photoreactivity of these compounds may take place in the skin of patients exposing themselves to sunlight and is a warning about possible skin damage as a result of that. Furthermore, photolability of these drugs in the skin might cause loss of their therapeutic activity. Copyright © 2011 Elsevier B.V. All rights reserved.

  20. Three-Dimensional In Vitro Skin and Skin Cancer Models Based on Human Fibroblast-Derived Matrix.

    Science.gov (United States)

    Berning, Manuel; Prätzel-Wunder, Silke; Bickenbach, Jackie R; Boukamp, Petra

    2015-09-01

    Three-dimensional in vitro skin and skin cancer models help to dissect epidermal-dermal and tumor-stroma interactions. In the model presented here, normal human dermal fibroblasts isolated from adult skin self-assembled into dermal equivalents with their specific fibroblast-derived matrix (fdmDE) over 4 weeks. The fdmDE represented a complex human extracellular matrix that was stabilized by its own heterogeneous collagen fiber meshwork, largely resembling a human dermal in vivo architecture. Complemented with normal human epidermal keratinocytes, the skin equivalent (fdmSE) thereof favored the establishment of a well-stratified and differentiated epidermis and importantly allowed epidermal regeneration in vitro for at least 24 weeks. Moreover, the fdmDE could be used to study the features of cutaneous skin cancer. Complementing fdmDE with HaCaT cells in different stages of malignancy or tumor-derived cutaneous squamous cell carcinoma cell lines, the resulting skin cancer equivalents (fdmSCEs) recapitulated the respective degree of tumorigenicity. In addition, the fdmSCE invasion phenotypes correlated with their individual degree of tissue organization, disturbance in basement membrane organization, and presence of matrix metalloproteinases. Together, fdmDE-based models are well suited for long-term regeneration of normal human epidermis and, as they recapitulate tumor-specific growth, differentiation, and invasion profiles of cutaneous skin cancer cells, also provide an excellent human in vitro skin cancer model.

  1. Skin Diseases: Skin and Sun—Not a good mix

    Science.gov (United States)

    Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Skin and Sun —Not a good mix Past Issues / ... of this page please turn Javascript on. Good skin care begins with sun safety. Whether it is ...

  2. Skin tribology: Science friction?

    NARCIS (Netherlands)

    van der Heide, Emile; Zeng, Xiangqiong; Masen, Marc Arthur

    2013-01-01

    The application of tribological knowledge is not just restricted to optimizing mechanical and chemical engineering problems. In fact, effective solutions to friction and wear related questions can be found in our everyday life. An important part is related to skin tribology, as the human skin is

  3. Examine Your Skin

    Medline Plus

    Full Text Available ... Facebook Twitter Newsletter Examine Your Skin Watch the video below and in only two minutes, you can learn to examine your skin. A special thanks to Dr. Martin Weinstock, MD, PhD, Professor of Dermatology, Brown University, for permission to use this video. UPDATED: ... Melanoma Facts Melanoma Prevention ...

  4. Pathological skin picking: case presentation and review of the literature

    Directory of Open Access Journals (Sweden)

    Maria Isabela Sarbu

    2015-04-01

    Full Text Available Pathological skin picking is a condition in which patients induce skin lesions through repetitive, compulsive excoriations of normal skin or skin with minor surface irregularities and they admit their role in the production of the lesions, but are unable to stop their behavior. Psychiatric comorbidities most often associated with skin picking include obsessive-compulsive disorder (OCD, anxiety disorders, mood disorders, body dysmorphic disorders, trichotillomania and compulsive-buying disorder. We report the case of a 17 year old female patient who addressed the dermatology department of our hospital with an eruption consisting of erythematous papules and plaques. The local examination revealed several clues of paramount importance in drawing the final conclusion and the psychiatric examination helped establish the diagnosis of pathological skin picking in a patient with obsessive-compulsive disorder.

  5. A study on the quantitative evaluation of skin barrier function

    Science.gov (United States)

    Maruyama, Tomomi; Kabetani, Yasuhiro; Kido, Michiko; Yamada, Kenji; Oikaze, Hirotoshi; Takechi, Yohei; Furuta, Tomotaka; Ishii, Shoichi; Katayama, Haruna; Jeong, Hieyong; Ohno, Yuko

    2015-03-01

    We propose a quantitative evaluation method of skin barrier function using Optical Coherence Microscopy system (OCM system) with coherency of near-infrared light. There are a lot of skin problems such as itching, irritation and so on. It has been recognized skin problems are caused by impairment of skin barrier function, which prevents damage from various external stimuli and loss of water. To evaluate skin barrier function, it is a common strategy that they observe skin surface and ask patients about their skin condition. The methods are subjective judgements and they are influenced by difference of experience of persons. Furthermore, microscopy has been used to observe inner structure of the skin in detail, and in vitro measurements like microscopy requires tissue sampling. On the other hand, it is necessary to assess objectively skin barrier function by quantitative evaluation method. In addition, non-invasive and nondestructive measuring method and examination changes over time are needed. Therefore, in vivo measurements are crucial for evaluating skin barrier function. In this study, we evaluate changes of stratum corneum structure which is important for evaluating skin barrier function by comparing water-penetrated skin with normal skin using a system with coherency of near-infrared light. Proposed method can obtain in vivo 3D images of inner structure of body tissue, which is non-invasive and non-destructive measuring method. We formulate changes of skin ultrastructure after water penetration. Finally, we evaluate the limit of performance of the OCM system in this work in order to discuss how to improve the OCM system.

  6. Skin Fungi from Colonization to Infection.

    Science.gov (United States)

    de Hoog, Sybren; Monod, Michel; Dawson, Tom; Boekhout, Teun; Mayser, Peter; Gräser, Yvonne

    2017-07-01

    Humans are exceptional among vertebrates in that their living tissue is directly exposed to the outside world. In the absence of protective scales, feathers, or fur, the skin has to be highly effective in defending the organism against the gamut of opportunistic fungi surrounding us. Most (sub)cutaneous infections enter the body by implantation through the skin barrier. On intact skin, two types of fungal expansion are noted: (A) colonization by commensals, i.e., growth enabled by conditions prevailing on the skin surface without degradation of tissue, and (B) infection by superficial pathogens that assimilate epidermal keratin and interact with the cellular immune system. In a response-damage framework, all fungi are potentially able to cause disease, as a balance between their natural predilection and the immune status of the host. For this reason, we will not attribute a fixed ecological term to each species, but rather describe them as growing in a commensal state (A) or in a pathogenic state (B).

  7. Bionanomaterials for skin regeneration

    CERN Document Server

    Leonida, Mihaela D

    2016-01-01

    This book gives a concise overview of bionanomaterials with applications for skin regeneration. The advantages and challenges of nanoscale materials are covered in detail, giving a basic view of the skin structure and conditions that require transdermal or topical applications. Medical applications, such as wound healing, care for burns, skin disease, and cosmetic care, such as aging of the skin and photodamage, and how they benefit from bionanomaterials, are described in detail. A final chapter is devoted to the ethical and social issues related to the use of bionanomaterials for skin regeneration. This is an ideal book for researchers in materials science, medical scientists specialized in dermatology, and cosmetic chemists working in formulations. It can also serve as a reference for nanotechnologists, dermatologists, microbiologists, engineers, and polymer chemists, as well as students studying in these fields.

  8. A synchronous surround increases the motion strength gain of motion.

    Science.gov (United States)

    Linares, Daniel; Nishida, Shin'ya

    2013-11-12

    Coherent motion detection is greatly enhanced by the synchronous presentation of a static surround (Linares, Motoyoshi, & Nishida, 2012). To further understand this contextual enhancement, here we measured the sensitivity to discriminate motion strength for several pedestal strengths with and without a surround. We found that the surround improved discrimination of low and medium motion strengths, but did not improve or even impaired discrimination of high motion strengths. We used motion strength discriminability to estimate the perceptual response function assuming additive noise and found that the surround increased the motion strength gain, rather than the response gain. Given that eye and body movements continuously introduce transients in the retinal image, it is possible that this strength gain occurs in natural vision.

  9. Surrounding Moving Obstacle Detection for Autonomous Driving Using Stereo Vision

    Directory of Open Access Journals (Sweden)

    Hao Sun

    2013-06-01

    Full Text Available Detection and tracking surrounding moving obstacles such as vehicles and pedestrians are crucial for the safety of mobile robotics and autonomous vehicles. This is especially the case in urban driving scenarios. This paper presents a novel framework for surrounding moving obstacles detection using binocular stereo vision. The contributions of our work are threefold. Firstly, a multiview feature matching scheme is presented for simultaneous stereo correspondence and motion correspondence searching. Secondly, the multiview geometry constraint derived from the relative camera positions in pairs of consecutive stereo views is exploited for surrounding moving obstacles detection. Thirdly, an adaptive particle filter is proposed for tracking of multiple moving obstacles in surrounding areas. Experimental results from real-world driving sequences demonstrate the effectiveness and robustness of the proposed framework.

  10. Contamination of nebulisers and surrounding air at the bedside of ...

    African Journals Online (AJOL)

    An air sampler was used to collect air samples from the surrounding bedside environment. .... individualised resealable plastic bags and stored upside down in a cooler .... conventional and mesh technology nebulisers used at home by adults.

  11. Glow phenomenon surrounding the vertical stabilizer and OMS pods

    Science.gov (United States)

    1994-01-01

    This 35mm frame, photographed as the Space Shuttle Columbia was orbiting Earth during a 'night' pass, documents the glow phenomenon surrounding the vertical stabilizer and the Orbital Maneuvering System (OMS) pods of the spacecraft.

  12. The Relative Utility of Skin Resistance and Skin Conductance

    National Research Council Canada - National Science Library

    Barland, Gordon

    1990-01-01

    The effectiveness of two circuits (constant current = skin resistance; constant voltage = skin conductance) used for measuring electrodermal activity during a psychophysiological detection of deception...

  13. Chromatic induction from surrounding stimuli under perceptual suppression.

    Science.gov (United States)

    Horiuchi, Koji; Kuriki, Ichiro; Tokunaga, Rumi; Matsumiya, Kazumichi; Shioiri, Satoshi

    2014-11-01

    The appearance of colors can be affected by their spatiotemporal context. The shift in color appearance according to the surrounding colors is called color induction or chromatic induction; in particular, the shift in opponent color of the surround is called chromatic contrast. To investigate whether chromatic induction occurs even when the chromatic surround is imperceptible, we measured chromatic induction during interocular suppression. A multicolor or uniform color field was presented as the surround stimulus, and a colored continuous flash suppression (CFS) stimulus was presented to the dominant eye of each subject. The subjects were asked to report the appearance of the test field only when the stationary surround stimulus is invisible by interocular suppression with CFS. The resulting shifts in color appearance due to chromatic induction were significant even under the conditions of interocular suppression for all surround stimuli. The magnitude of chromatic induction differed with the surround conditions, and this difference was preserved regardless of the viewing conditions. The chromatic induction effect was reduced by CFS, in proportion to the magnitude of chromatic induction under natural (i.e., no-CFS) viewing conditions. According to an analysis with linear model fitting, we revealed the presence of at least two kinds of subprocesses for chromatic induction that reside at higher and lower levels than the site of interocular suppression. One mechanism yields different degrees of chromatic induction based on the complexity of the surround, which is unaffected by interocular suppression, while the other mechanism changes its output with interocular suppression acting as a gain control. Our results imply that the total chromatic induction effect is achieved via a linear summation of outputs from mechanisms that reside at different levels of visual processing.

  14. Stratum corneum integrity as a predictor for peristomal skin problems in ostomates

    DEFF Research Database (Denmark)

    Nybaek, H; Lophaven, Søren Nymand; Karlsmark, T

    2010-01-01

    BACKGROUND: Peristomal skin problems are common, most often the result is disruption of the skin barrier and this may account for more than one in three visits to ostomy nurses. Therefore a specific assessment of individual risk factors relating to the skin barrier function would be of great...... interest. METHODS: Skin barrier integrity in ostomy patients with peristomal skin problems (PSP) was compared with that of ostomy patients with normal skin (controls) using transepidermal water loss (TEWL). Mechanical barrier disruption was determined by a tape stripping test and chemical barrier...

  15. Hydrocortisone Diffusion Through Synthetic Membrane, Mouse Skin, and Epiderm™ Cultured Skin.

    Science.gov (United States)

    Christensen, John Mark; Chuong, Monica Chang; Le, Hang; Pham, Loan; Bendas, Ehab

    2011-03-01

    OBJECTIVES: The penetration of hydrocortisone (HC) from six topical over-the-counter products along with one prescription cream through cultured normal human-derived epidermal keratinocytes (Epiderm™), mouse skin and synthetic nylon membrane was performed as well as the effect hydrating the skin by pre-washing was explored using the Upright Franz Cell. METHOD AND RESULTS: Permeation of HC through EpiDerm™, mouse skin and synthetic membrane was highest with the topical HC gel formulation with prewash treatment of the membranes among seven products evaluated, 198 ± 32 µg/cm(2), 746.32 ± 12.43 µg/cm(2), and 1882 ± 395.18 µg/cm(2), respectively. Pre-washing to hydrate the skin enhanced HC penetration through EpiDerm™ and mouse skin. The 24-hour HC released from topical gel with prewash treatment was 198.495 ± 32 µg/cm(2) and 746.32 ± 12.43 µg/cm(2) while without prewash, the 24-h HC released from topical gel was 67.2 ± 7.41 µg/cm(2) and 653.43 ± 85.62 µg/cm(2) though EpiDerm™ and mouse skin, respectively. HC penetration through synthetic membrane was ten times greater than through mouse skin and EpiDerm™. Generally, the shape, pattern, and rank order of HC diffusion from each commercial product was similar through each membrane.

  16. Dry skin - self-care

    Science.gov (United States)

    ... pat skin dry then apply your moisturizer. Avoid skin care products and soaps that contain alcohol, fragrances, dyes, or other chemicals. Take short, warm baths or showers. Limit your ... gentle skin cleansers or soap with added moisturizers. Only use ...

  17. 6 Common Cancers - Skin Cancer

    Science.gov (United States)

    ... Bar Home Current Issue Past Issues 6 Common Cancers - Skin Cancer Past Issues / Spring 2007 Table of Contents ... AP Photo/Herald-Mail, Kevin G. Gilbert Skin Cancer Skin cancer is the most common form of cancer ...

  18. Cryogen therapy of skin cancer

    International Nuclear Information System (INIS)

    Zikiryakhodjaev, D.Z.; Sanginov, D.R.

    2001-01-01

    In this chapter authors studied the cure of skin cancer in particular cryogen therapy of skin cancer. They noted that cryogen therapy of skin cancer carried new possibilities and improved results of neoplasms treatment

  19. Aerial radiological survey of the area surrounding the St. Lucie Power Plant, Fort Pierce, Florida

    International Nuclear Information System (INIS)

    Feimster, E.L.

    1979-06-01

    An airborne radiological survey of an 1100 km 2 area surrounding the St. Lucie Power Plant was conducted 1 to 8 March 1977. Detected radioisotopes and their associated gamma ray exposure rates were consistent with that expected from the normal background emitters. Count rates observed at 150 m altitude are converted to equivalent exposure rates at 1 m above the ground and are presented in the form of an isopleth map. Ground exposure rates measured with small portable instruments and soil sample analysis agreed with the airborne data. Geological data are presented in an isopleth map of rock and soil types. Also included is a brief description of the vegetation and terrain surrounding the site

  20. Synthesis and kinetics of [18F]4'-fluoroantipyrine in normal mice

    International Nuclear Information System (INIS)

    Robbins, P.J.; Fortman, D.L.; Scholz, K.L.; Fusaro, G.A.; Sodd, V.J.

    1978-01-01

    Antipyrine labeled with radioiodine has proven useful for studying the symmetry of human brain perfusion by gamma-camera techniques. The feasibility of preparing F-18-labeled antipyrine for eventual use with a positron camera was investigated. The preparation of [ 18 F] 4'-fluoroantipyrine and its distribution in normal mice were used to evaluate this potential. 4'-Fluoroantipyrine was prepared in 7 to 20% chemical yield by the pyrolysis of the 4'-diazonium fluoroborate salt of antipyrine. This Schiemann salt was prepared by a five-step synthesis from 1-(4'-nitrophenyl)-3-methyl-5-chloro-pyrazole. Fluorine-18 labeling of the diazonium fluoroborate salt by exchange with aqueous F-18 and pyrolysis of the dried labeled salt produced [ 18 F] 4'-fluoroantipyrine with specific activities of 0.83 to 2.7 μCi/mg. The incorporated F-18 activity ranged from 0.53 to 1.9%. The labeling procedure took about 3 hr. The labeled antipyrine was administered by tail vein to fasting female Swiss-Cox mice. Distribution of F-18 at 12, 30, 60, and 120 sec, and 10 min, after injection showed that radioactivity persisted in the brain up to 120 sec at a level greater than that of the skin and the bone. (Skin and bone samples were chosen as representative of activities in the scalp and skull surrounding the brain.) Thus, perfusion imaging of the CNS should be possible when greater quantities of high-specific-activity F-18-labeled antipyrine becomes available

  1. Electromagnetic effects on the biological tissue surrounding a transcutaneous transformer for an artificial anal sphincter system*

    Science.gov (United States)

    Zan, Peng; Yang, Bang-hua; Shao, Yong; Yan, Guo-zheng; Liu, Hua

    2010-01-01

    This paper reports on the electromagnetic effects on the biological tissue surrounding a transcutaneous transformer for an artificial anal sphincter. The coupling coils and human tissues, including the skin, fat, muscle, liver, and blood, were considered. Specific absorption rate (SAR) and current density were analyzed by a finite-length solenoid model. First, SAR and current density as a function of frequency (10–107 Hz) for an emission current of 1.5 A were calculated under different tissue thickness. Then relations between SAR, current density, and five types of tissues under each frequency were deduced. As a result, both the SAR and current density were below the basic restrictions of the International Commission on Non-Ionizing Radiation Protection (ICNIRP). The results show that the analysis of these data is very important for developing the artificial anal sphincter system. PMID:21121071

  2. Mouse Genetic Models Reveal Surprising Functions of IκB Kinase Alpha in Skin Development and Skin Carcinogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Xia, Xiaojun [The Methodist Hospital Research Institute, Houston, TX 77030 (United States); Park, Eunmi [Department of Radiation Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA 02115 (United States); Fischer, Susan M. [Department of Molecular Carcinogenesis, The University of Texas MD Anderson Cancer Center, Smithville, TX 78967 (United States); Hu, Yinling, E-mail: huy2@mail.nih.gov [Cancer and Inflammation Program, Center for Cancer Research, Frederick National Laboratory for Cancer Research, Frederick, MD 21701 (United States)

    2013-02-15

    Gene knockout studies unexpectedly reveal a pivotal role for IκB kinase alpha (IKKα) in mouse embryonic skin development. Skin carcinogenesis experiments show that Ikkα heterozygous mice are highly susceptible to chemical carcinogen or ultraviolet B light (UVB) induced benign and malignant skin tumors in comparison to wild-type mice. IKKα deletion mediated by keratin 5 (K5).Cre or K15.Cre in keratinocytes induces epidermal hyperplasia and spontaneous skin squamous cell carcinomas (SCCs) in Ikkα floxed mice. On the other hand, transgenic mice overexpressing IKKα in the epidermis, under the control of a truncated loricrin promoter or K5 promoter, develop normal skin and show no defects in the formation of the epidermis and other epithelial organs, and the transgenic IKKα represses chemical carcinogen or UVB induced skin carcinogenesis. Moreover, IKKα deletion mediated by a mutation, which generates a stop codon in the Ikkα gene, has been reported in a human autosomal recessive lethal syndrome. Downregulated IKKα and Ikkα mutations and deletions are found in human skin SCCs. The collective evidence not only highlights the importance of IKKα in skin development, maintaining skin homeostasis, and preventing skin carcinogenesis, but also demonstrates that mouse models are extremely valuable tools for revealing the mechanisms underlying these biological events, leading our studies from bench side to bedside.

  3. Mouse Genetic Models Reveal Surprising Functions of IκB Kinase Alpha in Skin Development and Skin Carcinogenesis

    International Nuclear Information System (INIS)

    Xia, Xiaojun; Park, Eunmi; Fischer, Susan M.; Hu, Yinling

    2013-01-01

    Gene knockout studies unexpectedly reveal a pivotal role for IκB kinase alpha (IKKα) in mouse embryonic skin development. Skin carcinogenesis experiments show that Ikkα heterozygous mice are highly susceptible to chemical carcinogen or ultraviolet B light (UVB) induced benign and malignant skin tumors in comparison to wild-type mice. IKKα deletion mediated by keratin 5 (K5).Cre or K15.Cre in keratinocytes induces epidermal hyperplasia and spontaneous skin squamous cell carcinomas (SCCs) in Ikkα floxed mice. On the other hand, transgenic mice overexpressing IKKα in the epidermis, under the control of a truncated loricrin promoter or K5 promoter, develop normal skin and show no defects in the formation of the epidermis and other epithelial organs, and the transgenic IKKα represses chemical carcinogen or UVB induced skin carcinogenesis. Moreover, IKKα deletion mediated by a mutation, which generates a stop codon in the Ikkα gene, has been reported in a human autosomal recessive lethal syndrome. Downregulated IKKα and Ikkα mutations and deletions are found in human skin SCCs. The collective evidence not only highlights the importance of IKKα in skin development, maintaining skin homeostasis, and preventing skin carcinogenesis, but also demonstrates that mouse models are extremely valuable tools for revealing the mechanisms underlying these biological events, leading our studies from bench side to bedside

  4. Age influences the skin reaction pattern to mechanical stress and its repair level through skin care products.

    Science.gov (United States)

    Zouboulis, Christos C; Elewa, Rana; Ottaviani, Monica; Fluhr, Joachim; Picardo, Mauro; Bernois, Armand; Heusèle, Catherine; Camera, Emanuela

    2018-03-01

    Skin aging is associated with alterations of surface texture, sebum composition and immune response. Mechanical stress induces repair mechanisms, which may be dependent on the age and quality of the skin. The response to mechanical stress in young and aged individuals, their subjective opinion and the objective effectiveness of skin care products were evaluated by biophysical skin quality parameters (stratum corneum hydration, transepidermal water loss, skin pH, pigmentation and erythema) at baseline, 1, 6, 24h and 7days at the forearms of 2 groups of healthy volunteers, younger than 35 years (n=11) and older than 60 years (n=13). In addition, casual surface lipid composition was studied under the same conditions at the baseline and day 7 after mechanical stress induction. Evaluations were also performed in stressed skin areas treated daily with skin care products and the subjective opinion of the volunteers was additionally documented. The tested groups exhibited age-associated baseline skin functions as well as casual surface lipid composition and different reaction patterns to mechanical stress. Skin care was more effective in normalizing skin reaction to stress in the young than in the aged group. The subjective volunteer opinion correlated with the objective measurements. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Skin and antioxidants.

    Science.gov (United States)

    Poljsak, Borut; Dahmane, Raja; Godic, Aleksandar

    2013-04-01

    It is estimated that total sun exposure occurs non-intentionally in three quarters of our lifetimes. Our skin is exposed to majority of UV radiation during outdoor activities, e.g. walking, practicing sports, running, hiking, etc. and not when we are intentionally exposed to the sun on the beach. We rarely use sunscreens during those activities, or at least not as much and as regular as we should and are commonly prone to acute and chronic sun damage of the skin. The only protection of our skin is endogenous (synthesis of melanin and enzymatic antioxidants) and exogenous (antioxidants, which we consume from the food, like vitamins A, C, E, etc.). UV-induced photoaging of the skin becomes clinically evident with age, when endogenous antioxidative mechanisms and repair processes are not effective any more and actinic damage to the skin prevails. At this point it would be reasonable to ingest additional antioxidants and/or to apply them on the skin in topical preparations. We review endogenous and exogenous skin protection with antioxidants.

  6. Occupational skin cancers

    Energy Technology Data Exchange (ETDEWEB)

    Gawkrodger, D.J. [Royal Hallamshire Hospital, Sheffield (United Kingdom). Dept. of Dermatology

    2004-10-01

    Skin cancer due to occupation is more common than is generally recognized, although it is difficult to obtain an accurate estimate of its prevalence. Over the past two centuries, occupational skin cancers have particularly been due to industrial exposure of men (it seems more so than women) to chemical carcinogens such as polycyclic hydrocarbons (e.g. from coal tar products) or to arsenic. Industrial processes have improved in most Western countries to limit this type of exposure, but those with outdoor occupations are still exposed to solar ultraviolet irradiation without this being widely recognized as an industrial hazard. Ionizing radiation such as X-rays can also cause skin cancer. Occupational skin cancers often resemble skin tumours found in non-occupational subjects, e.g. basal cell carcinoma, squamous cell carcinoma and malignant melanoma, but some pre-malignant lesions can be more specific and point to an occupational origin, e.g. tar keratoses or arsenical keratoses. An uncommon but well-recognized cause of occupational skin cancer is that which results from scar formation following an industrial burn. In the future it will be necessary to focus on preventative measures, e.g. for outdoor workers, the need to cover up in the sun and use sun protective creams and a campaign for earlier recognition of skin cancers, which are usually curable if treated in their early stages.

  7. Forest Fragments Surrounded by Sugar Cane Are More Inhospitable to Terrestrial Amphibian Abundance Than Fragments Surrounded by Pasture

    Directory of Open Access Journals (Sweden)

    Paula Eveline Ribeiro D’Anunciação

    2013-01-01

    Full Text Available In recent years, there has been increasing interest in matrix-type influence on forest fragments. Terrestrial amphibians are good bioindicators for this kind of research because of low vagility and high philopatry. This study compared richness, abundance, and species composition of terrestrial amphibians through pitfall traps in two sets of semideciduous seasonal forest fragments in southeastern Brazil, according to the predominant surrounding matrix (sugar cane and pasture. There were no differences in richness, but fragments surrounded by sugar cane had the lowest abundance of amphibians, whereas fragments surrounded by pastures had greater abundance. The most abundant species, Rhinella ornata, showed no biometric differences between fragment groups but like many other amphibians sampled showed very low numbers of individuals in fragments dominated by sugar cane fields. Our data indicate that the sugar cane matrix negatively influences the community of amphibians present in fragments surrounded by this type of land use.

  8. Tribology of human skin and mechanical skin equivalents in contact with textiles

    NARCIS (Netherlands)

    Derler, S.; Schrade, G.U.; Gerhardt, L.C.

    2007-01-01

    The friction of untreated human skin (finger) against a reference textile was investigated with 12 subjects using a force plate. In touch experiments, in which the subjects assessed the surface roughness of the textile at normal loads of 1.5 ± 0.7 N, the average friction coefficients ranged from

  9. Corticocortical feedback increases the spatial extent of normalization.

    Science.gov (United States)

    Nassi, Jonathan J; Gómez-Laberge, Camille; Kreiman, Gabriel; Born, Richard T

    2014-01-01

    Normalization has been proposed as a canonical computation operating across different brain regions, sensory modalities, and species. It provides a good phenomenological description of non-linear response properties in primary visual cortex (V1), including the contrast response function and surround suppression. Despite its widespread application throughout the visual system, the underlying neural mechanisms remain largely unknown. We recently observed that corticocortical feedback contributes to surround suppression in V1, raising the possibility that feedback acts through normalization. To test this idea, we characterized area summation and contrast response properties in V1 with and without feedback from V2 and V3 in alert macaques and applied a standard normalization model to the data. Area summation properties were well explained by a form of divisive normalization, which computes the ratio between a neuron's driving input and the spatially integrated activity of a "normalization pool." Feedback inactivation reduced surround suppression by shrinking the spatial extent of the normalization pool. This effect was independent of the gain modulation thought to mediate the influence of contrast on area summation, which remained intact during feedback inactivation. Contrast sensitivity within the receptive field center was also unaffected by feedback inactivation, providing further evidence that feedback participates in normalization independent of the circuit mechanisms involved in modulating contrast gain and saturation. These results suggest that corticocortical feedback contributes to surround suppression by increasing the visuotopic extent of normalization and, via this mechanism, feedback can play a critical role in contextual information processing.

  10. Corticocortical feedback increases the spatial extent of normalization

    Science.gov (United States)

    Nassi, Jonathan J.; Gómez-Laberge, Camille; Kreiman, Gabriel; Born, Richard T.

    2014-01-01

    Normalization has been proposed as a canonical computation operating across different brain regions, sensory modalities, and species. It provides a good phenomenological description of non-linear response properties in primary visual cortex (V1), including the contrast response function and surround suppression. Despite its widespread application throughout the visual system, the underlying neural mechanisms remain largely unknown. We recently observed that corticocortical feedback contributes to surround suppression in V1, raising the possibility that feedback acts through normalization. To test this idea, we characterized area summation and contrast response properties in V1 with and without feedback from V2 and V3 in alert macaques and applied a standard normalization model to the data. Area summation properties were well explained by a form of divisive normalization, which computes the ratio between a neuron's driving input and the spatially integrated activity of a “normalization pool.” Feedback inactivation reduced surround suppression by shrinking the spatial extent of the normalization pool. This effect was independent of the gain modulation thought to mediate the influence of contrast on area summation, which remained intact during feedback inactivation. Contrast sensitivity within the receptive field center was also unaffected by feedback inactivation, providing further evidence that feedback participates in normalization independent of the circuit mechanisms involved in modulating contrast gain and saturation. These results suggest that corticocortical feedback contributes to surround suppression by increasing the visuotopic extent of normalization and, via this mechanism, feedback can play a critical role in contextual information processing. PMID:24910596

  11. Ultrastructure of elastosis in facial rhytidectomy skin

    International Nuclear Information System (INIS)

    Rudolph, R.; Woodward, M.

    1981-01-01

    Skin from 19 facial rhytidectomies performed in patients with chronic solar damage was compared with postauricular skin from patients of similar age. Light microscopy demonstrated large areas of amorphous material that stained PAS positive in all 19 face-lift specimens, while none of the controls had such material. Electron microscopy of the ''elastotic'' material revealed large amorphous masses of granular material, with loss of the microfilament component of normal elastin. Current theories suggest that the elastotic material in solar-damaged skin is a product of radiation-damaged fibroblasts, rather than being either collagen or degenerated elastin. Such knowledge may help the plastic surgeons encourage rhytidectomy patients to protect themselves from solar radiation

  12. Pros and cons of fish skin cells in culture: long-term full skin and short-term scale cell culture from rainbow trout, Oncorhynchus mykiss.

    Science.gov (United States)

    Rakers, Sebastian; Klinger, Matthias; Kruse, Charli; Gebert, Marina

    2011-12-01

    Here, we report the establishment of a permanent skin cell culture from rainbow trout (Oncorhynchus mykiss). The cells of the fish skin cell culture could be propagated over 60 passages so far. Furthermore, we show for the first time that it is possible to integrate freshly harvested rainbow trout scales into this new fish skin cell culture. We further demonstrated that epithelial cells derived from the scales survived in the artificial micro-environment of surrounding fibroblast-like cells. Also, antibody staining indicated that both cell types proliferated and started to build connections with the other cell type. It seems that it is possible to generate an 'artificial skin' with two different cell types. This could lead to the development of a three-dimensional test system, which might be a better in vitro representative of fish skin in vivo than individual skin cell lines. Copyright © 2011 Elsevier GmbH. All rights reserved.

  13. Ultrasound skin tightening.

    Science.gov (United States)

    Minkis, Kira; Alam, Murad

    2014-01-01

    Ultrasound skin tightening is a noninvasive, nonablative method that allows for energy deposition into the deep dermal and subcutaneous tissue while avoiding epidermal heating. Ultrasound coagulation is confined to arrays of 1-mm(3) zones that include the superficial musculoaponeurotic system and connective tissue. This technology gained approval from the Food and Drug Administration as the first energy-based skin "lifting" device, specifically for lifting lax tissue on the neck, submentum, and eyebrows. Ultrasound has the unique advantage of direct visualization of treated structures during treatment. Ultrasound is a safe and efficacious treatment for mild skin tightening and lifting. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. PREPARATIVE SKIN PREPARATION AND SURGICAL WOUND INFECTION

    Directory of Open Access Journals (Sweden)

    Anjanappa

    2015-01-01

    Full Text Available BACKGROUND AND OBJECTIVE: It is an established fact now that the normal skin of healthy human beings harbours a rich bacterial fl ora. Normally considered non - pathogenic , these organisms way be a potential source of infection of the surgical wound. Approximately 20% of the resident flora is beyond the reach of surgical scrubs and antiseptics. The goal of surgical preparation of the skin with antiseptics is to remove transient and pathogenic microorganisms on the skin surface and to reduce the resident flora to a low level. Povidone iodine (I odophors and chlorhexidine are most often used antiseptics for pre - operative skin preparation. OBJECTIVES : To evaluate the efficacy of povidone iodine alone and in combination with antiseptic agent containing alcoholic chlorhexidine in preoperative skin p reparation by taking swab culture. (2 To compare the rate of postoperative wound infection in both the groups. METHODS: One hundred patients (fifty in each group undergoing clean elective surgery with no focus of infection on the body were included in th e study. The pre - operative skin preparation in each group is done with the respective antiseptic regimen. In both the groups after application of antiseptics , sterile saline swab culture was taken immediately from site of incision. In cases which showed gr owth of organisms , the bacteria isolated were identified by their morphological and cultural characteristics. Grams staining , coagulase test and antibiotic sensitivity test were done wherever necessary and difference in colonization rates was determined as a measure of efficacy of antiseptic regimen. RESULTS: The results of the study showed that when compared to povidone iodine alone , using a combination of povidone iodine and alcoholic solution of chlorhexidine , the colonization rates of the site of incisi on were reduced significantly. As for the rate of post - operative wound infection , it is also proven that wound infections are also

  15. Skin acceptability of a cosmetic moisturizer formulation in female subjects with sensitive skin

    Directory of Open Access Journals (Sweden)

    Nisbet SJ

    2018-04-01

    Full Text Available Stephanie J Nisbet Skin Health Medical Affairs, GSK Consumer Healthcare, Weybridge, Surrey, UK Purpose: This 3-week, open-label, noncomparative clinical study evaluated the skin acceptability of a cosmetic moisturizer in subjects with sensitive skin, by monitoring adverse events (AEs and cutaneous discomfort related to normal usage.Materials and methods: Female subjects aged between 18–60 years, with Fitzpatrick phototype classification I–IV and sensitive skin, verified by a positive reaction on the stinging test at screening, were included. Subjects applied the moisturizer to their face and body twice daily for 21±2 days at home and recorded study product usage and feelings of cutaneous discomfort (eg, dryness, prickling, stinging, and itching in a diary; any AEs were reported to the clinic. At study end, skin acceptability of the moisturizer was investigator-assessed based on the nature of AEs and subjects’ self-reported feelings of discomfort, and by clinical evaluation of skin reactions in the area of moisturizer application (appearance of erythema, formation of edema, and skin desquamation; scored according to an adapted Draize and Kligman scale. Only subjects with a treatment compliance of ≥80% were included in the final analysis.Results: In total, 35 subjects initiated and completed the study; all were compliant to the minimum study product usage. Per investigator clinical dermatological assessment at study end, none of the 35 subjects had skin reactions in the area of moisturizer application and there were no reported AEs. One subject reported sensations of mild prickling and itching immediately after applying the moisturizer (not classified as AEs, which spontaneously remitted after complete absorption of the product and were noted only in exposed areas. These events were considered by the investigator as being possibly/probably related to the use of study product; however, no clinical signs of skin reaction were observed in

  16. Management of defects on lower extremities with the use of matriderm and skin graft.

    Science.gov (United States)

    Choi, Jun-Young; Kim, Seong-Hun; Oh, Gwang-Jin; Roh, Si-Gyun; Lee, Nae-Ho; Yang, Kyung-Moo

    2014-07-01

    The reconstruction of large skin and soft tissue defects on the lower extremities is challenging. The skin graft is a simple and frequently used method for covering a skin defect. However, poor skin quality and architecture are well-known problems that lead to scar contracture. The collagen-elastin matrix, Matriderm, has been used to improve the quality of skin grafts; however, no statistical and objective review of the results has been reported. Thirty-four patients (23 male and 11 female) who previously received a skin graft and simultaneous application of Matriderm between January 2010 and June 2012 were included in this study. The quality of the skin graft was evaluated using Cutometer, occasionally accompanied by pathologic findings. All 34 patients showed good skin quality compared to a traditional skin graft and were satisfied with their results. The statistical data for the measurement of the mechanical properties of the skin were similar to those for normal skin. In addition, there was no change in the engraftment rate. The biggest problem of a traditional skin graft is scar contracture. However, the dermal matrix presents an improvement in skin quality with elastin and collagen. Therefore, a skin graft along with a simultaneous application of Matriderm is safe and effective and leads to a significantly better outcome from the perspective of skin elasticity.

  17. Tissue engineered skin substitutes created by laser-assisted bioprinting form skin-like structures in the dorsal skin fold chamber in mice.

    Directory of Open Access Journals (Sweden)

    Stefanie Michael

    Full Text Available Tissue engineering plays an important role in the production of skin equivalents for the therapy of chronic and especially burn wounds. Actually, there exists no (cellularized skin equivalent which might be able to satisfactorily mimic native skin. Here, we utilized a laser-assisted bioprinting (LaBP technique to create a fully cellularized skin substitute. The unique feature of LaBP is the possibility to position different cell types in an exact three-dimensional (3D spatial pattern. For the creation of the skin substitutes, we positioned fibroblasts and keratinocytes on top of a stabilizing matrix (Matriderm®. These skin constructs were subsequently tested in vivo, employing the dorsal skin fold chamber in nude mice. The transplants were placed into full-thickness skin wounds and were fully connected to the surrounding tissue when explanted after 11 days. The printed keratinocytes formed a multi-layered epidermis with beginning differentiation and stratum corneum. Proliferation of the keratinocytes was mainly detected in the suprabasal layers. In vitro controls, which were cultivated at the air-liquid-interface, also exhibited proliferative cells, but they were rather located in the whole epidermis. E-cadherin as a hint for adherens junctions and therefore tissue formation could be found in the epidermis in vivo as well as in vitro. In both conditions, the printed fibroblasts partly stayed on top of the underlying Matriderm® where they produced collagen, while part of them migrated into the Matriderm®. In the mice, some blood vessels could be found to grow from the wound bed and the wound edges in direction of the printed cells. In conclusion, we could show the successful 3D printing of a cell construct via LaBP and the subsequent tissue formation in vivo. These findings represent the prerequisite for the creation of a complex tissue like skin, consisting of different cell types in an intricate 3D pattern.

  18. Spiritual and religious aspects of skin and skin disorders

    Directory of Open Access Journals (Sweden)

    Shenefelt PD

    2014-08-01

    Full Text Available Philip D Shenefelt,1 Debrah A Shenefelt2 1Dermatology and Cutaneous Surgery, University of South Florida, Tampa, 2Congregation Or Ahavah, Lutz, FL, USA Abstract: Skin and skin disorders have had spiritual aspects since ancient times. Skin, hair, and nails are visible to self and others, and touchable by self and others. The skin is a major sensory organ. Skin also expresses emotions detectable by others through pallor, coldness, "goose bumps", redness, warmth, or sweating. Spiritual and religious significances of skin are revealed through how much of the skin has been and continues to be covered with what types of coverings, scalp and beard hair cutting, shaving and styling, skin, nail, and hair coloring and decorating, tattooing, and intentional scarring of skin. Persons with visible skin disorders have often been stigmatized or even treated as outcasts. Shamans and other spiritual and religious healers have brought about healing of skin disorders through spiritual means. Spiritual and religious interactions with various skin disorders such as psoriasis, leprosy, and vitiligo are discussed. Religious aspects of skin and skin diseases are evaluated for several major religions, with a special focus on Judaism, both conventional and kabbalistic. Keywords: skin, skin disorders, spiritual, religious

  19. Skin Diseases: Cross-section of human skin

    Science.gov (United States)

    Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Cross-section of human skin Past Issues / Fall 2008 Table of Contents For ... Logical Images, Inc. I n the areas of skin health and skin diseases, the NIH's National Institute ...

  20. Cure of skin cancer. Surgical cure of skin cancer

    International Nuclear Information System (INIS)

    Zikiryakhodjaev, D.Z.; Sanginov, D.R.

    2001-01-01

    In this chapter authors studied the cure of skin cancer in particular the surgical cure of skin cancer. They noted that surgical cure of skin cancer is remain one of the primary and most important methods in treatment of skin cancer

  1. Artificial skin and patient simulator comprising the artificial skin

    NARCIS (Netherlands)

    2011-01-01

    The invention relates to an artificial skin (10, 12, 14), and relates to a patient simulator (100) comprising the artificial skin. The artificial skin is a layered structure comprising a translucent cover layer (20) configured for imitating human or animal skin, and comprising a light emitting layer

  2. Radiosensitization of mouse skin by oxygen and depletion of glutathione

    International Nuclear Information System (INIS)

    Stevens, Graham; Joiner, Michael; Joiner, Barbara; Johns, Helen; Denekamp, Juliana

    1995-01-01

    Purpose: To determine the oxygen enhancement ratio (OER) and shape of the oxygen sensitization curve of mouse foot skin, the extent to which glutathione (GSH) depletion radiosensitized skin, and the dependence of such sensitization on the ambient oxygen tension. Methods and Materials: The feet of WHT mice were irradiated with single doses of 240 kVp x-rays while mice were exposed to carbogen or gases with oxygen/nitrogen mixtures containing 8-100% O 2 . The anoxic response was obtained by occluding the blood supply to the leg of anesthetized mice with a tourniquet, surrounding the foot with nitrogen, and allowing the mice to breathe 10% O 2 . Further experiments were performed to assess the efficacy of this method to obtain an anoxic response. Radiosensitivity of skin was assessed using the acute skin-reaction assay. Glutathione levels were modified using two schedules of dl-buthionine sulphoximine (BSO) and diethylmaleate (DEM), which were considered to produce extensive and intermediate levels of GSH depletion in the skin of the foot during irradiation. Results: Carbogen caused the greatest radiosensitization of skin, with a reproducible enhancement of 2.2 relative to the anoxic response. The OER of 2.2 is lower than other reports for mouse skin. This may indicate that the extremes of oxygenation were not produced, although there was no direct evidence for this. When skin radiosensitivity was plotted against the logarithm of the oxygen tension in the ambient gas, a sigmoid curve with a K value of 17-21% O 2 in the ambient gas was obtained. Depletion of GSH caused minimal radiosensitization when skin was irradiated under anoxic or well-oxygenated conditions. Radiosensitization by GSH depletion was maximal at intermediate oxygen tensions of 10-21% O 2 in the ambient gas. Increasing the extent of GSH depletion led to increasing radiosensitization, with sensitization enhancement ratios of 1.2 and 1.1, respectively, for extensive and intermediate levels of GSH

  3. Allergy Skin Tests

    Science.gov (United States)

    ... and symptoms. Medications can interfere with results Before scheduling a skin test, bring your doctor a list ... of Privacy Practices Notice of Nondiscrimination Manage Cookies Advertising Mayo Clinic is a not-for-profit organization ...

  4. Caring for Tattooed Skin

    Science.gov (United States)

    ... Registration General information Housing & travel Education Exhibit hall Mobile app 2019 Annual Meeting Derm Exam Prep Course ... SkinPAC State societies Scope of practice Truth in advertising NP/PA laws Action center Public and patients ...

  5. Dry Skin (Xerosis)

    Science.gov (United States)

    ... Registration General information Housing & travel Education Exhibit hall Mobile app 2019 Annual Meeting Derm Exam Prep Course ... SkinPAC State societies Scope of practice Truth in advertising NP/PA laws Action center Public and patients ...

  6. Impairments in Skin Integrity.

    Science.gov (United States)

    Murphree, Rose W

    2017-09-01

    Altered skin integrity increases the chance of infection, impaired mobility, and decreased function and may result in the loss of limb or, sometimes, life. Skin is affected by both intrinsic and extrinsic factors. Intrinsic factors can include altered nutritional status, vascular disease issues, and diabetes. Extrinsic factors include falls, accidents, pressure, immobility, and surgical procedures. Ensuring skin integrity in the elderly requires a team approach and includes the individual, caregivers, and clinicians. The twenty-first century clinician has several online, evidence-based tools to assist with optimal treatment plans. Understanding best practices in addressing skin integrity issues can promote positive outcomes with the elderly. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Allergy testing - skin

    Science.gov (United States)

    Patch tests - allergy; Scratch tests - allergy; Skin tests - allergy; RAST test; Allergic rhinitis - allergy testing; Asthma - allergy testing; Eczema - allergy testing; Hayfever - allergy testing; Dermatitis - allergy testing; Allergy testing; ...

  8. Examine Your Skin

    Medline Plus

    Full Text Available ... Store In Memory Melanoma Info Melanoma Facts Melanoma Prevention Sunscreen Suggestions Examine Your Skin Newly Diagnosed? Understanding ... Biopsy: The First Step Sentinel Node Biopsy Melanoma Treatment: Stages I & II Melanoma Treatment: Stage III Melanoma ...

  9. Examine Your Skin

    Medline Plus

    Full Text Available ... We Are Be On Our PAGE MIF Staff Programs & Services Scientific Advisory Board Advisory Board Patrons & Sponsors ... us for One-on-One Support Donate Share Facebook Twitter Newsletter Examine Your Skin Watch the video ...

  10. Occupational skin diseases

    DEFF Research Database (Denmark)

    Mahler, V; Aalto-Korte, K; Alfonso, J H

    2017-01-01

    BACKGROUND: Work-related skin diseases (WSD) are caused or worsened by a professional activity. Occupational skin diseases (OSD) need to fulfil additional legal criteria which differ from country to country. OSD range amongst the five most frequently notified occupational diseases (musculoskeletal...... diseases, neurologic diseases, lung diseases, diseases of the sensory organs, skin diseases) in Europe. OBJECTIVE: To retrieve information and compare the current state of national frameworks and pathways to manage patients with occupational skin disease with regard to prevention, diagnosis, treatment...... in Science and Technology (COST) Action TD 1206 (StanDerm) (www.standerm.eu). RESULTS: Besides a national health service or a statutory health insurance, most European member states implemented a second insurance scheme specifically geared at occupational diseases [insurance against occupational risks...

  11. Skin care and incontinence

    Science.gov (United States)

    ... skin care; Incontinence - pressure sore; Incontinence - pressure ulcer Patient Instructions Preventing pressure ulcers Images Male urinary system References Holroyd S. Incontinence-associated dermatitis: identification, prevention and care. Br J Nurs . 2015;24( ...

  12. Healthy Skin Matters

    Science.gov (United States)

    ... skin. If you’re helping out in the kitchen, make sure you use hot pads or wear ... in humans, plants, and animals, while others are essential for a healthy life. Propionibacterium acnes (P. acnes) ( ...

  13. Tuberculin Skin Testing

    Science.gov (United States)

    ... Appendix 1 Appendix 2 Appendix 3 Interim Laboratory Biosafety Guidance for XDR Mycobacterium tuberculosis strains Data & Statistics ... The Mantoux tuberculin skin test (TST) is the standard method of determining whether a person is infected ...

  14. [Currently available skin substitutes].

    Science.gov (United States)

    Oravcová, Darina; Koller, Ján

    2014-01-01

    The current trend of burn wound care has shifted to more holistic approach of improvement in the long-term form and function of the healed burn wounds and quality of life. Autologous split or full-thickness skin graft are the best definitive burn wound coverage, but it is constrained by the limited available sources, especially in major burns. Donor site morbidities in term of additional wounds and scarring are also of concern of the autograft application. This has demanded the emergence of various skin substitutes in the management of acute burn injury as well as post burn reconstructions. This paper reviews currently available skin substitutes, produced in not for-profit skin banks as well as commercially available. They are divided according to type of material included, as biological, biosynthetic and synthetic and named respectively.

  15. Parasites and the skin

    African Journals Online (AJOL)

    2009-06-11

    Jun 11, 2009 ... those conditions that are encountered in daily practice and to remind you of those ... care conditions. Parasitic infections can be solely confined to the skin, as seen ..... endemic areas or may become chronic and disseminate.

  16. Skin or nail culture

    Science.gov (United States)

    Mucosal culture; Culture - skin; Culture - mucosal; Nail culture; Culture - fingernail; Fingernail culture ... There, it is placed in a special dish (culture). It is then watched to see if bacteria, ...

  17. Fungal Skin Infections

    Science.gov (United States)

    ... Abbreviations Weights & Measures ENGLISH View Professional English Deutsch Japanese Espaniol Find information on medical topics, symptoms, drugs, ... touching the infected area. Diagnosis Skin scrapings or cultures Doctors may suspect a fungal infection when they ...

  18. Examine Your Skin

    Medline Plus

    Full Text Available ... Download a Skin Self-Exam Card Download a Patient Navigation Card Events, Webinars & Videos Events, Webinars & Videos Melanoma Patient Video Events Host an Event Past Webinars Upcoming ...

  19. Allergic Skin Conditions

    Science.gov (United States)

    ... most common types are atopic dermatitis (often called eczema) and contact dermatitis. Atopic Dermatitis (Eczema) Eczema is a chronic ... contact with your skin, they may cause a rash called contact dermatitis. There are two kinds of contact dermatitis: ...

  20. Examine Your Skin

    Medline Plus

    Full Text Available ... Doctor Glossary of Terms Resources Resources Global Resources Cancer Centers Online Resources The Melanoma Book Clinical Trials Download a Skin Self-Exam Card Download a Patient Navigation Card ...

  1. In vivo assessment of the structure of skin microcirculation by reflectance confocal-laser-scanning microscopy

    Science.gov (United States)

    Sugata, Keiichi; Osanai, Osamu; Kawada, Hiromitsu

    2012-02-01

    One of the major roles of the skin microcirculation is to supply oxygen and nutrition to the surrounding tissue. Regardless of the close relationship between the microcirculation and the surrounding tissue, there are few non-invasive methods that can evaluate both the microcirculation and its surrounding tissue at the same site. We visualized microcapillary plexus structures in human skin using in vivo reflectance confocal-laser-scanning microscopy (CLSM), Vivascope 3000® (Lucid Inc., USA) and Image J software (National Institutes of Health, USA) for video image processing. CLSM is a non-invasive technique that can visualize the internal structure of the skin at the cellular level. In addition to internal morphological information such as the extracellular matrix, our method reveals capillary structures up to the depth of the subpapillary plexus at the same site without the need for additional optical systems. Video images at specific depths of the inner forearm skin were recorded. By creating frame-to-frame difference images from the video images using off-line video image processing, we obtained images that emphasize the brightness depending on changes of intensity coming from the movement of blood cells. Merging images from different depths of the skin elucidates the 3-dimensional fine line-structure of the microcirculation. Overall our results show the feasibility of a non-invasive, high-resolution imaging technique to characterize the skin microcirculation and the surrounding tissue.

  2. Study of skin markers for magnetic resonance imaging examinations

    International Nuclear Information System (INIS)

    Takatsu, Yasuo; Umezaki, Yoshie; Miyati, Tosiaki; Yamamura, Kenichirou

    2013-01-01

    In magnetic resonance imaging (MRI), skin markers are used as a landmark in order to make plans for examinations. However, there isn't a lot of research about the material and shape of skin markers. The skin marker's essential elements are safety, good cost performance, high signal intensity for T 1 weighted image (T 1 WI) and T 2 weighted image (T 2 WI), and durable. In order to get a high signal-to-noise ratio (SNR) of T 1 WI and T 2 WI, baby oil, salad oil and olive oil were chosen, because these materials were easy to obtain and safe for the skin. The SNR of baby oil was the best. Baby oil was injected into the infusion tube, and the tube was solvent welded and cut by a heat sealer. In order to make ring shaped skin markers, both ends of the tube were stuck with adhesive tape. Three different diameters of markers were made (3, 5, 10 cmφ). Ring shaped skin markers were put on to surround the examination area, therefore, the edge of the examination area could be seen at every cross section. Using baby oil in the ring shaped infusion tube is simple, easy, and a highly useful skin marker. (author)

  3. ReciPlySkin

    DEFF Research Database (Denmark)

    Popovic Larsen, Olga; Andersen, Mikkel; Munk-Andersen, Niklas

    2017-01-01

    The report presents process that enbabled the production of the ReciPlySkin structure exhibited at the Circular Economy Exhibition at KADK during the Autumn 2017. The concept, design, detailed design and production are presented in this report.......The report presents process that enbabled the production of the ReciPlySkin structure exhibited at the Circular Economy Exhibition at KADK during the Autumn 2017. The concept, design, detailed design and production are presented in this report....

  4. Adnexal Tumours Of Skin

    Directory of Open Access Journals (Sweden)

    Parate Sanjay N

    1998-01-01

    Full Text Available A total 120 cases of epidermal appendage tumours of skin were analysed and classified according to the classification provided by WHO’. Epidermal appendage tumours accounted for 12.87% of all skin tumours, of which 29.17% were benign and 70.83% were malignant. Most of the tumours (75.83% were in the head and face region. The most common tumour was basal cell epithelioma (55%.

  5. Mantoux Tuberculin Skin Test

    Centers for Disease Control (CDC) Podcasts

    2006-11-22

    Learn how to evaluate people for latent TB infection with the Mantoux tuberculin skin test. This podcast includes sections on administering and reading the Mantoux tuberculin skin test, the standard method for detecting latent TB infection since the 1930s.  Created: 11/22/2006 by National Center for HIV, STD and TB Prevention (NCHHSTP).   Date Released: 12/12/2006.

  6. Stressed skin panels

    Energy Technology Data Exchange (ETDEWEB)

    Anon

    2001-07-01

    Advantages and disadvantages of stressed skin panels, also known as structural insulated panels (SIPs), are discussed as material and labour-saving alternatives to traditional stick framing. Stressed skin panels are manufactured 'sandwich' assemblies with a rigid insulating polystyrene foam core, whose interior and exterior surfaces are bonded into panels. The skins distribute and carry the structural loading while the bonded foam core provides insulation and keeps the two skins aligned. Since there are fewer framing members, there is little thermal bridging and the R-value remains high. SIPs are usually manufactured in four feet by eight feet panels, although some manufacturers can produce panels up to eight feet by forty feet. SIPs are resource efficient as they use less wood than conventional framing (about 25 per cent less); can structurally cover large spans, requiring less supplementary framing. Use of SIPs eliminate the need for headers over small openings; provide the ability to nail anywhere; create less scrap and waste; lessen vulnerability to unfavourable weather and other job-site hazards, can reduce delays, and often can produce significant savings in material and labour costs. Limitations include the more complex approaches to plumbing and electrical systems, although this can be minimized by designers by incorporating much of the plumbing and electrical work on interior (non-panel) walls. Most stressed skin panels require one-half inch interior gypsum drywall. If become wet, stressed skin panels take a long time to dry out and may harbour mold growth. Larger stressed-skin panels used in floors and roofs, may require cranes or other machinery for handling because of their weight. Although not without some environmental impact, overall, stressed skin panels are judged to be a resource-efficient building technology with significant energy-efficiency benefits and distinct advantages over stick framing. 3 photos.

  7. Piezoresistive pressure sensor array for robotic skin

    Science.gov (United States)

    Mirza, Fahad; Sahasrabuddhe, Ritvij R.; Baptist, Joshua R.; Wijesundara, Muthu B. J.; Lee, Woo H.; Popa, Dan O.

    2016-05-01

    Robots are starting to transition from the confines of the manufacturing floor to homes, schools, hospitals, and highly dynamic environments. As, a result, it is impossible to foresee all the probable operational situations of robots, and preprogram the robot behavior in those situations. Among human-robot interaction technologies, haptic communication is an intuitive physical interaction method that can help define operational behaviors for robots cooperating with humans. Multimodal robotic skin with distributed sensors can help robots increase perception capabilities of their surrounding environments. Electro-Hydro-Dynamic (EHD) printing is a flexible multi-modal sensor fabrication method because of its direct printing capability of a wide range of materials onto substrates with non-uniform topographies. In past work we designed interdigitated comb electrodes as a sensing element and printed piezoresistive strain sensors using customized EHD printable PEDOT:PSS based inks. We formulated a PEDOT:PSS derivative ink, by mixing PEDOT:PSS and DMSO. Bending induced characterization tests of prototyped sensors showed high sensitivity and sufficient stability. In this paper, we describe SkinCells, robot skin sensor arrays integrated with electronic modules. 4x4 EHD-printed arrays of strain sensors was packaged onto Kapton sheets and silicone encapsulant and interconnected to a custom electronic module that consists of a microcontroller, Wheatstone bridge with adjustable digital potentiometer, multiplexer, and serial communication unit. Thus, SkinCell's electronics can be used for signal acquisition, conditioning, and networking between sensor modules. Several SkinCells were loaded with controlled pressure, temperature and humidity testing apparatuses, and testing results are reported in this paper.

  8. Aerial radiological survey of the area surrounding the Edwin I. Hatch Nuclear Plant, Baxley, Georgia

    International Nuclear Information System (INIS)

    Hilton, L.K.

    1978-11-01

    An airborne radiological survey of a 2146 km 2 area surrounding the Edwin I. Hatch Nuclear Plant was made 28-31 March 1977. Detected radioisotopes, and their associated gamma ray exposure rates, were consistent with that expected from the normal background emitters. Count rates observed at 152 m altitude are converted to equivalent exposure rates at 1 m above the ground, and are presented in the form of an isopleth map. Exposure rates measured with small portable instruments and soil sample analysis showed agreement with the airborne data

  9. Placental vascular responses are dependent on surrounding tissue

    DEFF Research Database (Denmark)

    Brøgger, Torbjørn Halle

    -depth understanding of the mechanism regulating blood flow and perfusion is necessary if we are to come up with new ideas for intervention and treatment. Method: From fresh born placentas stem villi arteries were carefully dissected. The artery branches were divided. The surrounding tissue was removed from one end...... and was left untouched in the other end. Then using wire myography they were investigated in terms of contractility and sensitivity to physiological relevant human-like agonists. Results: Sensitivity to PGF2α, Tx-analog, 5-HT and endothelin-1 was significantly lower in arteries with intact surrounding tissue...... compared to arteries stripped of the tissue. The maximal force development was also significantly lower in arteries with surrounding tissue, when they were depolarized high extracellular [K+] or stimulated with PGF2α or endotheline-1. Conclusion: The perivascular tissue significantly alters stem villi...

  10. Placental vascular responses are dependent on surrounding tissue

    DEFF Research Database (Denmark)

    Brøgger, Torbjørn Halle

    . Materials and methods. From fresh born placentas, stem villi arteries were carefully dissected. The artery branches were divided. The surrounding tissue was removed from one end and was left untouched in the other end.Then, using wire myography, they were investigated in terms of contractility...... and sensitivity to physiological relevant human-like agonists. Results. Sensitivity to PGF2α, Tx-analog, 5-HT and endothelin-1 was significantly lower in arteries with intact surrounding tissue compared to arteries stripped of the tissue. The maximal force development was also significantly lower in arteries...... with surrounding tissue when they were depolarized high extracellular [K+] or stimulated with PGF2α or endotheline-1. Conclusion. The perivascular tissue significantly alters stem villi arteries' sensitivity and force development in a suppressive way. This implicates a new aspect of blood flow regulation...

  11. Surrounding rock stress analysis of underground high level waste repository

    International Nuclear Information System (INIS)

    Liu Wengang; Wang Ju; Wang Guangdi

    2006-01-01

    During decay of nuclear waste, enormous energy was released, which results in temperature change of surrounding rock of depository. Thermal stress was produced because thermal expansion of rock was controlled. Internal structure of surrounding rock was damaged and strength of rock was weakened. So, variation of stress was a dynamic process with the variation of temperature. BeiShan region of Gansu province was determined to be the depository field in the future, it is essential to make research on granite in this region. In the process of experiment, basic physical parameters of granite were analyzed preliminary with MTS. Long range temperature and stress filed was simulated considering the damage effect of surrounding rock, and rules of temperature and stress was achieved. (authors)

  12. EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA); Scientific Opinion on the substantiation of health claims related to a combination of lycopene, proanthocyanidins, vitamin C, vitamin E, selenium and beta-carotene and contribution to normal collagen formation (ID 1669) and protection, of the skin from UV-induced damage (ID 1669) pursuant to Article 13(1) of Regulation (EC) No 1924/2006

    DEFF Research Database (Denmark)

    Tetens, Inge

    claims in relation to a combination of lycopene, proanthocyanidins, vitamin C, vitamin E, selenium and beta-carotene and contribution to normal collagen formation and protection of the skin from UV-induced damage. The scientific substantiation is based on the information provided by the Member States...... in the consolidated list of Article 13 health claims and references that EFSA has received from Member States or directly from stakeholders. The food constituent that is the subject of the health claim is a combination of lycopene, proanthocyanidins, vitamin C, vitamin E, selenium, and beta-carotene. The Panel...... considers that the combination of lycopene, proanthocyanidins, vitamin C, vitamin E, selenium, and beta-carotene is sufficiently characterised....

  13. New analysis methods for skin fine-structure via optical image and development of 3D skin Cycloscan(™).

    Science.gov (United States)

    Han, J Y; Nam, G W; Lee, H K; Kim, M J; Kim, E J

    2015-11-01

    This study was conducted to develop methods for measuring skin fine-structure via optical image and apparatus for photographing to analyze efficacy of anti-aging. We developed an apparatus named 3D Skin CycloScan(™) to evaluate the efficacy of cosmetics by imagification of skin fine-structure such as wrinkles, pores, and skin texture. The semi-sphere shaped device has 12 different sequential flashing light sources captures optical image simultaneously in one second to exclude the influence of the subject's movement. The normal map that is extracted through shape from shading method is composed of face contour and skin fine-structure parts. When the low-frequency component which is the result of the Gaussian Filter application is eliminated, we can get only skin fine-structure. In this normal map, it is possible to extract two-dimensional vector map called direction map and we can regulate the intensity of the image of wrinkles, pores, and skin texture after filtering the direction map. We performed a clinical study to apply this new apparatus and methods to evaluate an anti-aging efficacy of cosmetics visually and validate with other conventional methods. After using anti-aging cream including 2% adenosine for 8 weeks, the total amount of fine wrinkle around eye area detected via 3D Skin CycloScan(™) was reduced by 12.1%. Also, wrinkles on crow's feet measured by PRIMOS COMPACT(®) (GFMesstechnik GmbH, Germany) reduced 11.7%. According to an aspect of the present study, by changing the direction of the lights toward to subject's skin, we can obtain the information about the fine structures present on the skin such as wrinkles, pores, or skin texture and represent it as an image. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Skin manifestations of growth hormone-induced diseases.

    Science.gov (United States)

    Kanaka-Gantenbein, Christina; Kogia, Christina; Abdel-Naser, Mohamed Badawy; Chrousos, George P

    2016-09-01

    The human skin is a well-organized organ bearing different types of cells in a well-structured interference to each other including epidermal and follicular keratinocytes, sebocytes, melanocytes, dermal papilla cells and fibroblasts, endothelial cells, sweat gland cells as well as nerves. Several hormones act on different cell types of the skin, while it is also considered an endocrine organ secreting hormones that act at several sites of the organism. GH receptors are found in almost all cell types forming the skin, while IGF-1 receptors' expression is restricted to the epidermal keratinocytes. Both Growth Hormone (GH) excess, as in the case of Acromegaly in adults, or Gigantism in growing children, and GH deficiency states lead to skin manifestations. In case of GH excess the main dermatological findings are skin thickening, coarsening of facial features, acrochordons, puffy hands and feet, oily skin and hyperhidrosis, while GH deficiency, on the contrary, is characterized by thin, dry skin and disorder of normal sweating. Moreover, special disorders associated with GH excess may have specific characteristics, as is the case of café-au-lait spots in Neurofibromatosis, or big café-au-lait skin hyperpigmented regions with irregular margins, as is the case in McCune-Albright syndrome. Meticulous examination of the skin may therefore contribute to the final diagnosis in cases of GH-induced disorders.

  15. Normalized modes at selected points without normalization

    Science.gov (United States)

    Kausel, Eduardo

    2018-04-01

    As every textbook on linear algebra demonstrates, the eigenvectors for the general eigenvalue problem | K - λM | = 0 involving two real, symmetric, positive definite matrices K , M satisfy some well-defined orthogonality conditions. Equally well-known is the fact that those eigenvectors can be normalized so that their modal mass μ =ϕT Mϕ is unity: it suffices to divide each unscaled mode by the square root of the modal mass. Thus, the normalization is the result of an explicit calculation applied to the modes after they were obtained by some means. However, we show herein that the normalized modes are not merely convenient forms of scaling, but that they are actually intrinsic properties of the pair of matrices K , M, that is, the matrices already "know" about normalization even before the modes have been obtained. This means that we can obtain individual components of the normalized modes directly from the eigenvalue problem, and without needing to obtain either all of the modes or for that matter, any one complete mode. These results are achieved by means of the residue theorem of operational calculus, a finding that is rather remarkable inasmuch as the residues themselves do not make use of any orthogonality conditions or normalization in the first place. It appears that this obscure property connecting the general eigenvalue problem of modal analysis with the residue theorem of operational calculus may have been overlooked up until now, but which has in turn interesting theoretical implications.Á

  16. Micro-fractional ablative skin resurfacing with two novel erbium laser systems.

    Science.gov (United States)

    Dierickx, Christine C; Khatri, Khalil A; Tannous, Zeina S; Childs, James J; Cohen, Richard H; Erofeev, Andrei; Tabatadze, David; Yaroslavsky, Ilya V; Altshuler, Gregory B

    2008-02-01

    Fractional ablation offers the potential benefits of full-surface ablative skin resurfacing while minimizing adverse effects. The purpose of this study was to evaluate the safety, damage profile, and efficacy of erbium fractional lasers. Histology from animal and human skin as well as clinical evaluations were conducted with erbium YAG (2,940 nm) and erbium YSGG (2,790 nm) fractional lasers varying pulse width, microbeam (microb) energy, number of passes, and stacking of pulses. Single-pulse treatment parameters from 1 to 12 mJ per 50-70 microm diameter microbeam and 0.25-5 milliseconds pulse widths produced microcolumns of ablation with border coagulation of up to 100 microm width and 450 microm depth. Stacking of pulses generated deeper microcolumns. Clinical observations and in vivo histology demonstrate rapid re-epithelization and limited adverse side effects. Facial treatments were performed in the periorbital and perioral areas using 1-8 passes of single and stacked pulses. Treatments were well-tolerated and subjects could resume their normal routine in 4 days. A statistically significant reduction in wrinkle scores at 3 months was observed for both periorbital and perioral wrinkles using blinded grading. For periorbital treatments of four passes or more, over 90% had > or =1 score wrinkle reduction (0-9 scale) and 42% had > or =2. For perioral wrinkles, over 50% had substantial improvements (> or =2). The clinical observations and histology findings demonstrate that micro-fractional ablative treatment with 2,790 and 2,940 nm erbium lasers resulted in safe and effective wrinkle reduction with minimal patient downtime. The depth and width of the ablated microcolumns and varying extent of surrounding coagulation can be controlled and used to design new treatment procedures targeted for specific indications and areas such as moderate to severe rhytides and photodamaged skin.

  17. Permeability of commercial solvents through living human skin

    DEFF Research Database (Denmark)

    Ursin, C; Hansen, C M; Van Dyk, J W

    1995-01-01

    A procedure has been developed for measuring the steady state rate of permeation of commercial solvents through living human skin. To get the most consistent results, it was necessary with some solvents to normalize the solvent permeation rate of a given skin sample with its [3H]water permeation...... rate. For other solvents this was not necessary, so the un-normalized data were used. High [3H]water permeation rate also was used as a criterion for "defective" skin samples that gave erroneous permeability rates, especially for solvents having slow permeability. The linearity of the steady state data...... of DMSO and octyl acetate were measured. No octyl acetate was detected and the permeability of DMSO was proportional to its mole fraction in the mixture. The effect of two hours of solvent exposure on the viability of skin (based on DNA synthesis) was measured and found to be very dependent on the solvent....

  18. Polarization singularities of the object field of skin surface

    International Nuclear Information System (INIS)

    Angelsky, O V; Ushenko, A G; Ushenko, Yu A; Ushenko, Ye G

    2006-01-01

    The paper deals with the investigation of formation mechanisms of laser radiation polarization structure scattered by an optically thin surface layer of human skin in two registration zones: a boundary field and a far zone of Fraunhofer diffraction. The conditions of forming polarization singularities by such an object in the scattered radiation field have been defined. Statistical and fractal polarization structure of object fields of physiologically normal and pathologically changed skin has been studied. It has been shown that polarization singularities of radiation scattered by physiologically normal skin samples have a fractal coordinate structure. It is characteristic for fields of pathologically changed skin to have a statistical coordinate structure of polarization singularities in all diffraction zones

  19. Comparison of differences in knowledge about skin care bettwen young women and man

    Directory of Open Access Journals (Sweden)

    Katarzyna Bojarczuk

    2017-08-01

    Full Text Available Introduction: The skin of modern people is exposed daily to a number of irritants like stress, consequences of inadequate diet, exposure to chemicals and plastics. Those factors can pose a challenge not only for delicate skin of a child, or a woman, but also for more resistant skin of men. Every type of complexion requires individual care, adjusted to different conditions and life circumstances. The choice of proper skin care products should be based on basic skin type and also one's gender. Objectives: Evaluation of differences in students' knowledge about skin care in relation to their gender. Material and methods: Evaluation of students' knowledge concerning proper skin care guidelines was conducted among 210 students (150 women and 60 men using anonymous survey. Results: Majority of male respondents determined their skin type as a normal one (56.6%, majority of female respondents as a combination type (51.3%. Men in contrast to women are more often unable to evaluate the type of their own skin (16.7% vs 4.0%.  Acne was the most common skin condition students of both sexes complained about. Daily skin care activities are performed by 96.6% interviewed women and 63.3% men. The regular use of face skin care products was reported by 87.3% of women and 31.6% of men. Conclusions: 1. Majority of women evaluate their basic skin type as combination one, most men regarded their skin type as normal . 2. Women more often than men take care of their skin and use adequate skin care products. 3. Facial moisturizing lotion is the most frequently chosen skin care product by both women and men.

  20. Applications of positron annihilation to dermatology and skin cancer

    International Nuclear Information System (INIS)

    Liu, Guang; Chen, Hongmin; Chakka, Lakshmi; Gadzia, Joseph E.; Jean, Y.C.

    2007-01-01

    Positronium annihilation lifetime experiments have been performed to investigate the interaction between skin cancer and positronium for human skin samples. Positronium annihilation lifetime is found to be shorter and intensity is found to be less for the samples with basal cell carcinoma and squamous cell carcinoma than the normal skin samples. These results indicate a reduction of free volume in the molecular level for the skin with cancer with respect to the skin without cancer. Positron annihilation spectroscopy may be potentially developed as a new noninvasive and external method for dermatology clinics, early detection of cancer, and nano-PET technology in the future. (copyright 2007 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  1. Field enhancement due to anomalous skin effect inside a target

    International Nuclear Information System (INIS)

    Ma, G.; Tan, W.

    1996-01-01

    A new method based on Fourier transformation to study the skin effects is presented. Using this method, the field amplitude in plasma is represented in terms of electric conductivity, and the normal and anomalous skin effects are described through one formula by omitting the plasma dispersion or not. The results are in agreement with other publications [e.g., J. P. Matte and K. Aguenaou, Phys. Rev. A 45, 2558 (1992)] for equivalent parameters. But for deeper positions inside a target, which have not been studied by others, it is found that the field amplitude is considerably enhanced due to an anomalous skin effect, even for constant collision frequency. In addition, the skin absorptions and some calculations on an anomalous skin effect for different collision frequencies are also presented. copyright 1996 American Institute of Physics

  2. Resveratrol anti-ultraviolet-induced guinea pig skin injury

    International Nuclear Information System (INIS)

    Li Wenxing; Zhao Ying

    2014-01-01

    Objective: To Estimate on the protection effect of Stilbene on skin damage induced by ultraviolet radiation. Methods: After the normal skin in guinea pig under the intervene of Resveratrol was irradiated with over- dose of ultraviolet rays (UVB and UVA), the samples in every group were matched and compared. Results: The skin tissue in the Resveratrol intervene group irradiated by ultraviolet rays didn't change obviously as compared with that in the self-control group. But, the damage skin tissue in the control group irradiated by ultraviolet did change significantly as compared with that in the Stilbene intervene group. Conclusion: Resveratrol is a good material to protect the skin from damage effect by ultraviolet radiation. (authors)

  3. Applications of positron annihilation to dermatology and skin cancer

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Guang; Chen, Hongmin; Chakka, Lakshmi [Department of Chemistry, University of Missouri-Kansas City, Kansas City, MO 64110 (United States); Gadzia, Joseph E. [Dermatology, Department of Internal Medicine, University of Kansas Medical Center, Kansas City, KS 66103 and Kansas Medical Clinic, Topeka, KS 66614 (United States); Jean, Y.C. [Department of Chemistry, University of Missouri-Kansas City, Kansas City, MO 64110 (United States); R and D Center for Membrane Technology, Chung Yuan Christian University, Chung-Li (China)

    2007-07-01

    Positronium annihilation lifetime experiments have been performed to investigate the interaction between skin cancer and positronium for human skin samples. Positronium annihilation lifetime is found to be shorter and intensity is found to be less for the samples with basal cell carcinoma and squamous cell carcinoma than the normal skin samples. These results indicate a reduction of free volume in the molecular level for the skin with cancer with respect to the skin without cancer. Positron annihilation spectroscopy may be potentially developed as a new noninvasive and external method for dermatology clinics, early detection of cancer, and nano-PET technology in the future. (copyright 2007 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  4. Care and management of a stoma: maintaining peristomal skin health.

    Science.gov (United States)

    Boyles, Anna; Hunt, Sharon

    2016-09-22

    It is estimated that around one in 500 people in the UK are living with a stoma, with approximately 21 000 operations that result in stoma formation being performed each year ( Colostomy Association, 2016 ). These people face a unique set of challenges in maintaining the integrity of their peristomal skin. This article explores the normal structure and function of skin and how the care and management of a stoma presents challenges for maintaining peristomal skin health. Particular focus is paid to the incidence of skin problems for those living with a stoma, whether it is temporary or permanent, and the factors that contribute to skin breakdown in this population. Wider factors such as the central role of the clinical nurse specialist and the impact of product usage on positive outcomes and health economics are also considered.

  5. Ornitocenosis of the Sursky pond and its close the surroundings

    International Nuclear Information System (INIS)

    Lacko, J.; Ambrus, B.; Fupso, A.

    2013-01-01

    The paper focuses on the qualitative-quantitative research of fishpond bird community of the Sursky and its surroundings as well as on analysis of seasonal population dynamics of the avifauna as well as on placing the determined species into environmental groups and guilds. Another object is the comparison of our results with recent work focused on research of bird communities on this site.

  6. Review of Ordered Anarchy: Jasay and his Surroundings

    Directory of Open Access Journals (Sweden)

    Aschwin de Wolf

    2009-02-01

    Full Text Available Anthony de Jasay is among the most important social thinkers of our time. His oeuvre offers a sustained critique of government and its defenders. In the book Ordered Anarchy: Jasay and His Surroundings, colleagues and friends pay tribute to the man in the form of an inspiring collection of essays.

  7. Neutron spectrum in small iron pile surrounded by lead reflector

    International Nuclear Information System (INIS)

    Kimura, Itsuro; Hayashi, S.A.; Kobayashi, Katsuhei; Matsumura, Tetsuo; Nishihara, Hiroshi.

    1978-01-01

    In order to save the quantity of sample material, a possibility to assess group constants of a reactor material through measurement and analysis of neutron spectrum in a small sample pile surrounded by a reflector of heavy moderator, was investigated. As the sample and the reflector, we chose iron and lead, respectively. Although the time dispersion in moderation of neutrons was considerably prolonged by the lead reflector, this hardly interferes with the assessment of group constants. Theoretical calculation revealed that both the neutron flux spectrum and the sensitivity coefficient of group constants in an iron sphere, 35 cm in diameter surrounded by the lead reflector, 25 cm thick, were close to those of the bare iron sphere, 108 cm in diameter. The neutron spectra in a small iron pile surrounded by a lead reflector were experimentally obtained by the time-of-flight method with an electron linear accelerator and the result was compared with the predicted values. It could be confirmed that a small sample pile surrounded by a reflector, such as lead, was as useful as a much larger bulk pile for the assessment of group constants of a reactor material. (auth.)

  8. Linking disadvantaged housing areas to the surrounding city

    DEFF Research Database (Denmark)

    Stender, Marie

    Several disadvantaged social housing areas in Denmark are currently undergo-ing thorough physical refurbishments, aiming to integrate them better with the surrounding city. The ambition is to attract new users and residents by opening up the borders of the area and establish attractive, new...

  9. Ecological mechanisms linking protected areas to surrounding lands.

    Science.gov (United States)

    Hansen, Andrew J; DeFries, Ruth

    2007-06-01

    Land use is expanding and intensifying in the unprotected lands surrounding many of the world's protected areas. The influence of this land use change on ecological processes is poorly understood. The goal of this paper is to draw on ecological theory to provide a synthetic framework for understanding how land use change around protected areas may alter ecological processes and biodiversity within protected areas and to provide a basis for identifying scientifically based management alternatives. We first present a conceptual model of protected areas embedded within larger ecosystems that often include surrounding human land use. Drawing on case studies in this Invited Feature, we then explore a comprehensive set of ecological mechanisms by which land use on surrounding lands may influence ecological processes and biodiversity within reserves. These mechanisms involve changes in ecosystem size, with implications for minimum dynamic area, species-area effect, and trophic structure; altered flows of materials and disturbances into and out of reserves; effects on crucial habitats for seasonal and migration movements and population source/sink dynamics; and exposure to humans through hunting, poaching, exotics species, and disease. These ecological mechanisms provide a basis for assessing the vulnerability of protected areas to land use. They also suggest criteria for designing regional management to sustain protected areas in the context of surrounding human land use. These design criteria include maximizing the area of functional habitats, identifying and maintaining ecological process zones, maintaining key migration and source habitats, and managing human proximity and edge effects.

  10. The bird species of pandam wildlife park and the surrounding ...

    African Journals Online (AJOL)

    The effect of time of day as well as vegetation variables on bird species diversity in the park and surrounding farmlands was also conducted. 10 transects in each study site were surveyed twice between during the dry season and vegetation variables (trees, fingers, finger-rings two- hand, grazing, farming, canopy cover, ...

  11. Experiences during the decontamination process of areas surrounding to Fukushima

    International Nuclear Information System (INIS)

    Molina, G.

    2014-10-01

    In this work the experience gained during the decontamination of areas surrounding to Fukushima NPP, rugged during the earthquake and tsunami in 2011 and caused the contamination with fission products in these areas is described. Actions taken by the Japanese government are reported and some of the techniques used, the intervention levels and the progress made and disposal techniques considered are presented. (Author)

  12. Traditional Indian customs surrounding birth A review | Chalmers ...

    African Journals Online (AJOL)

    Since 1960, only a few studies have been made of traditional custOIns surrounding birth in Indian culture. Very few of these have described customs followed by Indians in South Africa. A review of these publications is presented here. Customs described include religious, social and psychological aspects of behaviour in ...

  13. Deformation-strain field in Sichuan and its surrounding areas based on GPS data

    Directory of Open Access Journals (Sweden)

    Fuchao Chen

    2015-05-01

    Full Text Available The strain rate in Sichuan and its surrounding areas, and the activity rate and strain rate in two block boundary fault zones were calculated according to the block movement parameters estimated using the station speed obtained from regional GPS station observation data in these areas for 2009–2011 and GPS continuous station data for 2011–2013. The movement field characteristics in these areas were analyzed with the Sichuan Basin as the reference. Results show that the principal strain rate and maximum shear strain rate of the Bayan Har block were the largest, followed by those of the Sichuan–Yunnan block and Sichuan Basin. The deep normal strain rate in the Longmenshan fault zone was compressive and large over the study period. The normal strain rate in the Xianshuihe fault zone was tensile.

  14. Magnetosensitive e-skins with directional perception for augmented reality

    Science.gov (United States)

    Cañón Bermúdez, Gilbert Santiago; Karnaushenko, Dmitriy D.; Karnaushenko, Daniil; Lebanov, Ana; Bischoff, Lothar; Kaltenbrunner, Martin; Fassbender, Jürgen; Schmidt, Oliver G.; Makarov, Denys

    2018-01-01

    Electronic skins equipped with artificial receptors are able to extend our perception beyond the modalities that have naturally evolved. These synthetic receptors offer complimentary information on our surroundings and endow us with novel means of manipulating physical or even virtual objects. We realize highly compliant magnetosensitive skins with directional perception that enable magnetic cognition, body position tracking, and touchless object manipulation. Transfer printing of eight high-performance spin valve sensors arranged into two Wheatstone bridges onto 1.7-μm-thick polyimide foils ensures mechanical imperceptibility. This resembles a new class of interactive devices extracting information from the surroundings through magnetic tags. We demonstrate this concept in augmented reality systems with virtual knob-turning functions and the operation of virtual dialing pads, based on the interaction with magnetic fields. This technology will enable a cornucopia of applications from navigation, motion tracking in robotics, regenerative medicine, and sports and gaming to interaction in supplemented reality. PMID:29376121

  15. The contribution of skin blood flow in warming the skin after the application of local heat; the duality of the Pennes heat equation.

    Science.gov (United States)

    Petrofsky, Jerrold; Paluso, Dominic; Anderson, Devyn; Swan, Kristin; Yim, Jong Eun; Murugesan, Vengatesh; Chindam, Tirupathi; Goraksh, Neha; Alshammari, Faris; Lee, Haneul; Trivedi, Moxi; Hudlikar, Akshay N; Katrak, Vahishta

    2011-04-01

    As predicted by the Pennes equation, skin blood flow is a major contributor to the removal of heat from an external heat source. This protects the skin from erythema and burns. But, for a person in a thermally neutral room, the skin is normally much cooler than arterial blood. Therefore, if skin blood flow (BF) increases, it should initially warm the skin paradoxically. To examine this phenomenon, 10 young male and female subjects participated in a series of experiments to examine the contribution of skin blood flow in the initial warming the skin after the application of local heat. Heat flow was measured by the use of a thermode above the brachioradialis muscle. The thermode was warmed by constant temperature water at 44°C entering the thermode at a water flow rate of 100 cm(3)/min. Skin temperature was measured by a thermistor and blood flow in the underlying skin was measured by a laser Doppler imager in single point mode. The results of the experiments showed that, when skin temperature is cool (31-32°C), the number of calories being transferred to the skin from the thermode cannot account for the rise in skin temperature alone. A significant portion of the rise in skin temperature is due to the warm arterialized blood traversing the skin from the core areas of the body. However, as skin temperature approaches central core temperature, it becomes less of a heat source and more of a heat sync such that when skin temperature is at or above core temperature, the blood flow to the skin, as predicted by Pennes, becomes a heat sync pulling heat from the thermode. Copyright © 2010 IPEM. Published by Elsevier Ltd. All rights reserved.

  16. Screening for skin cancer.

    Science.gov (United States)

    Helfand, M; Mahon, S M; Eden, K B; Frame, P S; Orleans, C T

    2001-04-01

    Malignant melanoma is often lethal, and its incidence in the United States has increased rapidly over the past 2 decades. Nonmelanoma skin cancer is seldom lethal, but, if advanced, can cause severe disfigurement and morbidity. Early detection and treatment of melanoma might reduce mortality, while early detection and treatment of nonmelanoma skin cancer might prevent major disfigurement and to a lesser extent prevent mortality. Current recommendations from professional societies regarding screening for skin cancer vary. To examine published data on the effectiveness of routine screening for skin cancer by a primary care provider, as part of an assessment for the U.S. Preventive Services Task Force. We searched the MEDLINE database for papers published between 1994 and June 1999, using search terms for screening, physical examination, morbidity, and skin neoplasms. For information on accuracy of screening tests, we used the search terms sensitivity and specificity. We identified the most important studies from before 1994 from the Guide to Clinical Preventive Services, second edition, and from high-quality reviews. We used reference lists and expert recommendations to locate additional articles. Two reviewers independently reviewed a subset of 500 abstracts. Once consistency was established, the remainder were reviewed by one reviewer. We included studies if they contained data on yield of screening, screening tests, risk factors, risk assessment, effectiveness of early detection, or cost effectiveness. We abstracted the following descriptive information from full-text published studies of screening and recorded it in an electronic database: type of screening study, study design, setting, population, patient recruitment, screening test description, examiner, advertising targeted at high-risk groups or not targeted, reported risk factors of participants, and procedure for referrals. We also abstracted the yield of screening data including probabilities and numbers

  17. Traumatic degloving lesion of penile and scrotal skin

    Directory of Open Access Journals (Sweden)

    Luiz A. Zanettini

    2005-06-01

    Full Text Available Avulsions of penile and scrotal skin are uncommon events and are caused mainly by accidents with industrial machines and agricultural machine belts. We report the case of a 30-year old patient with avulsion and traumatic degloving of the penile and scrotal skin, with exposure of the cavernous bodies, spongy body, and testes due to an industrial machine accident. Reconstruction was performed in steps, achieving a satisfactory esthetic result, normal voiding and reestablished sexual function.

  18. Vasculature surrounding a nodule: A novel lung cancer biomarker.

    Science.gov (United States)

    Wang, Xiaohua; Leader, Joseph K; Wang, Renwei; Wilson, David; Herman, James; Yuan, Jian-Min; Pu, Jiantao

    2017-12-01

    To investigate whether the vessels surrounding a nodule depicted on non-contrast, low-dose computed tomography (LDCT) can discriminate benign and malignant screen detected nodules. We collected a dataset consisting of LDCT scans acquired on 100 subjects from the Pittsburgh Lung Screening study (PLuSS). Fifty subjects were diagnosed with lung cancer and 50 subjects had suspicious nodules later proven benign. For the lung cancer cases, the location of the malignant nodule in the LDCT scans was known; while for the benign cases, the largest nodule in the LDCT scan was used in the analysis. A computer algorithm was developed to identify surrounding vessels and quantify the number and volume of vessels that were connected or near the nodule. A nonparametric receiver operating characteristic (ROC) analysis was performed based on a single nodule per subject to assess the discriminability of the surrounding vessels to provide a lung cancer diagnosis. Odds ratio (OR) were computed to determine the probability of a nodule being lung cancer based on the vessel features. The areas under the ROC curves (AUCs) for vessel count and vessel volume were 0.722 (95% CI=0.616-0.811, plung cancer group 9.7 (±9.6) compared to the non-lung cancer group 4.0 (±4.3) CONCLUSION: Our preliminary results showed that malignant nodules are often surrounded by more vessels compared to benign nodules, suggesting that the surrounding vessel characteristics could serve as lung cancer biomarker for indeterminate nodules detected during LDCT lung cancer screening using only the information collected during the initial visit. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Calibration of thermoluminescence skin dosemeter response to beta emitters found in Ontario Hydro nuclear power stations

    International Nuclear Information System (INIS)

    Walsh, M.L.; Agnew, D.A.; Donnelly, K.E.

    1984-01-01

    The response of the Ontario Hydro Thermoluminescence Dosimetry System to beta radiation in nuclear power station environments was evaluated. Synthetic beta spectra were constructed, based on activity samples from heat transport systems and fuelling machine contamination smears at nuclear power stations. Using these spectra and dosemeter energy response functions, an overall response factor for the skin dosemeter relative to skin dose at 7 mg.cm -2 was calculated. This calculation was done assuming three specific geometries: (1) an infinite uniformly contaminated plane source at a distance of 33 cm (50 mg.cm -2 total shielding) from the receptor; (2) an infinite cloud surrounding the receptor; (3) a point source at 33 cm. Based on these calculations, a conservative response factor of 0.7 has been chosen. This provides an equation for skin dose assignment, i.e. Skin Dose = 1.4 x Skin Dosemeter Reading when the skin dosemeter is directly calibrated in mGy(gamma). (author)

  20. Changes in Transepidermal Water Loss and Skin Hydration according to Expression of Aquaporin-3 in Psoriasis

    Science.gov (United States)

    Lee, Young; Je, Young-Jin; Lee, Sang-Sin; Li, Zheng Jun; Choi, Dae-Kyoung; Kwon, Yoo-Bin; Sohn, Kyung-Cheol; Im, Myung; Seo, Young Joon

    2012-01-01

    Background Aquaporins (AQPs) are a family of water transporting proteins present in many mammalian epithelial and endothelial cell types. Among the AQPs, AQP3 is known to be a water/glycerol transporter expressed in human skin. Objective The relationship between the expression level of AQP3 and transpidermal water loss (TEWL) in the lesional and peri-lesional skin of psoriasis-affected patients, and skin hydration in the lesional and peri-lesional skin of psoriasis patients, was investigated. Methods The expression of AQP3 in psoriasis-affected and healthy control skin was determined using immunohistochemical and immunofluroscence staining. TEWL and skin hydration were measured using a Tewameter® TM210 (Courage & Khazaka, Cologne, Germany) and a Corneometer® CM 820 (Courage & Khazaka), respectively. Results AQP3 was mainly expressed in the plasma membrane of stratum corneum and the stratum spinosum in normal epidermis. Unlike the normal epidermis, AQP3 showed decreased expression in the lesional and peri-lesional epidermis of psoriasis. TEWL was increased, and skin hydration was decreased, in the lesional and peri-lesional skin of psoriasis patients, compared with the healthy control sample. Conclusion Although various factors contribute to reduced skin hydration in the lesional and peri-lesional skin of psoriasis, AQP3 appears to be a key factor in the skin dehydration of psoriasis-affected skin. PMID:22577267

  1. Friction coefficient of skin in real-time.

    Science.gov (United States)

    Sivamani, Raja K; Goodman, Jack; Gitis, Norm V; Maibach, Howard I

    2003-08-01

    Friction studies are useful in quantitatively investigating the skin surface. Previous studies utilized different apparatuses and materials for these investigations but there was no real-time test parameter control or monitoring. Our studies incorporated the commercially available UMT Series Micro-Tribometer, a tribology instrument that permits real-time monitoring and calculation of the important parameters in friction studies, increasing the accuracy over previous tribology and friction measurement devices used on skin. Our friction tests were performed on four healthy volunteers and on abdominal skin samples. A stainless steel ball was pressed on to the skin with at a pre-set load and then moved across the skin at a constant velocity of 5 mm/min. The UMT continuously monitored the friction force of the skin and the normal force of the ball to calculate the friction coefficient in real-time. Tests investigated the applicability of Amonton's law, the impact of increased and decreased hydration, and the effect of the application of moisturizers. The friction coefficient depends on the normal load applied, and Amonton's law does not provide an accurate description for the skin surface. Application of water to the skin increased the friction coefficient and application of isopropyl alcohol decreased it. Fast acting moisturizers immediately increased the friction coefficient, but did not have the prolonged effect of the slow, long lasting moisturizers. The UMT is capable of making real-time measurements on the skin and can be used as an effective tool to study friction properties. Results from the UMT measurements agree closely with theory regarding the skin surface.

  2. Linking student performance in Massachusetts elementary schools with the "greenness" of school surroundings using remote sensing.

    Science.gov (United States)

    Wu, Chih-Da; McNeely, Eileen; Cedeño-Laurent, J G; Pan, Wen-Chi; Adamkiewicz, Gary; Dominici, Francesca; Lung, Shih-Chun Candice; Su, Huey-Jen; Spengler, John D

    2014-01-01

    Various studies have reported the physical and mental health benefits from exposure to "green" neighborhoods, such as proximity to neighborhoods with trees and vegetation. However, no studies have explicitly assessed the association between exposure to "green" surroundings and cognitive function in terms of student academic performance. This study investigated the association between the "greenness" of the area surrounding a Massachusetts public elementary school and the academic achievement of the school's student body based on standardized tests with an ecological setting. Researchers used the composite school-based performance scores generated by the Massachusetts Comprehensive Assessment System (MCAS) to measure the percentage of 3rd-grade students (the first year of standardized testing for 8-9 years-old children in public school), who scored "Above Proficient" (AP) in English and Mathematics tests (Note: Individual student scores are not publically available). The MCAS results are comparable year to year thanks to an equating process. Researchers included test results from 2006 through 2012 in 905 public schools and adjusted for differences between schools in the final analysis according to race, gender, English as a second language (proxy for ethnicity and language facility), parent income, student-teacher ratio, and school attendance. Surrounding greenness of each school was measured using satellite images converted into the Normalized Difference Vegetation Index (NDVI) in March, July and October of each year according to a 250-meter, 500-meter, 1,000-meter, and 2000-meter circular buffer around each school. Spatial Generalized Linear Mixed Models (GLMMs) estimated the impacts of surrounding greenness on school-based performance. Overall the study results supported a relationship between the "greenness" of the school area and the school-wide academic performance. Interestingly, the results showed a consistently positive significant association between the

  3. "Ser diferente é normal?"/"Being different: is it normal?"

    Directory of Open Access Journals (Sweden)

    Viviane Veras

    2007-01-01

    Full Text Available A pergunta título deste trabalho retoma o slogan “Ser diferente é normal”, que é parte da campanha criada para uma organização não-governamental que atende portadores de Síndrome de Down. O objetivo é a inclusão social da pessoa com deficiência e o primeiro passo foi propor a inclusão de um grupo de diferentes no grupo dito normal. No vídeo de lançamento da campanha, o diferente, identificado como normal, é mostrado por meio de exemplos – um negro com cabelo black-power, um skin-head, um corpo tatuado, um corpo feminino halterofílico, uma família hippie, uma garota com síndrome de Down. A visão da adolescente dançando reduz, de certo modo, o efeito imaginário que vai além da síndrome, uma vez que apenas o corpo com seus olhinhos puxados se destacam, e não se interrogam questões cognitivas. Minha proposta é refletir sobre o estatuto paradoxal do exemplo, tal como é trabalhado nesse vídeo: se, por definição, um exemplo mostra de fato seu pertencimento a uma classe, pode-se concluir que é exatamente por ser exemplar que ele se encontra fora dela, no exato momento em que a exibe e define. The question in the title of this paper refers to the slogan "ser diferente é normal" ("It´s normal to be different", which is part of a campaign created for a NGO that supports people with Down syndrome. The objective of the campaign is to promote the social inclusion of individuals with Down syndrome, and the first step was to propose the inclusion of a group of "differents" in the so-called normal group. The film launching the campaign shows the different identified as normal by means of examples: a black man exhibiting blackpower haircut, a skin-head, a tattooed body, an over-athletic female body, a hippie family and a girl with Down syndrome. The vision of the dancing teenager lessens the imaginary effect that surpasses the syndrome, since only her body and her little oriental eyes stand out and no cognitive issues are

  4. Tubuloreticular inclusions in skin biopsies from patients with HIV infection

    DEFF Research Database (Denmark)

    Pedersen, C; Horn, T; Junge, Jette

    1989-01-01

    Skin biopsies obtained from apparently normal skin from 15 HIV infected patients and 6 anti-HIV negative patients were examined by electron microscopy. Tubuloreticular inclusions (TRI) were detected within the cytoplasm of capillary endothelial cells in 5/5 AIDS patients and in 2/5 patients...... of the patients without TRI, interferon activity was below detection level. The occurrence of TRI was not dependent on the presence of free p24 antigen in serum. It is concluded that the occurrence of TRI in entothelial cells of skin capillaries is associated with late stages of HIV infection and this may...

  5. Normal foot and ankle

    International Nuclear Information System (INIS)

    Weissman, S.D.

    1989-01-01

    The foot may be thought of as a bag of bones tied tightly together and functioning as a unit. The bones re expected to maintain their alignment without causing symptomatology to the patient. The author discusses a normal radiograph. The bones must have normal shape and normal alignment. The density of the soft tissues should be normal and there should be no fractures, tumors, or foreign bodies

  6. [A case of skin autograft for skin ulcers in ichthyosis].

    Science.gov (United States)

    Li, Shiwei; Yang, Xiaodong; Liu, Lijun; Tang, Xueyang

    2017-10-28

    Ichthyosis refers to a group of skin diseases characterized by abnormal keratinization of the epidermis, resulting in dryness, roughness and scale of the skin. A girl with ichthyosis, who presented with skin ulcers and infection of the right dorsal foot, was admitted to our department. An autologous razor-thin skin grafting procedure was performed to repair the skin ulcers after debridement and vacuum sealing drain. After 8 months of follow-up, both the donor and recipient site healed well and there were no newly formed ulcers or infections. Although the skin quality of ichthyosis is poor, the lesion area can still be used as donor or recipient cite.

  7. ATF3 activates Stat3 phosphorylation through inhibition of p53 expression in skin cancer cells.

    Science.gov (United States)

    Hao, Zhen-Feng; Ao, Jun-Hong; Zhang, Jie; Su, You-Ming; Yang, Rong-Ya

    2013-01-01

    ATF3, a member of the ATF/CREB family of transcription factors, has been found to be selectively induced by calcineurin/NFAT inhibition and to enhance keratinocyte tumor formation, although the precise role of ATF3 in human skin cancer and possible mechanisms remain unknown. In this study, clinical analysis of 30 skin cancer patients and 30 normal donors revealed that ATF3 was accumulated in skin cancer tissues. Functional assays demonstrated that ATF3 significantly promoted skin cancer cell proliferation. Mechanically, ATF3 activated Stat3 phosphorylation in skin cancer cell through regulation of p53 expression. Moreover, the promotion effect of ATF3 on skin cancer cell proliferation was dependent on the p53-Stat3 signaling cascade. Together, the results indicate that ATF3 might promote skin cancer cell proliferation and enhance skin keratinocyte tumor development through inhibiting p53 expression and then activating Stat3 phosphorylation.

  8. [ROLE OF microRNA IN SKIN DEVELOPMENT AND WOUND HEALING].

    Science.gov (United States)

    Song, Zhifang; Liu, Dewu

    2014-07-01

    To review the role of microRNA (miRNA) in skin development and wound healing. The recent literature about miRNA in skin development and wound healing was reviewed and analyzed. miRNA extensively involved in the development of the skin, including epidermal cell proliferation, differentiation, aging and hair follicle development; miR-203 known as the "skin-specific miRNA" can directly inhibit the expression of p63 and promote the differentiation of the epidermis. Meanwhile, miRNA also involved in various stages of skin regeneration and wound healing. Abnormal expression of miRNA is closely related with abnormal wound healing. miRNA play an important role in maintaining normal skin physiology and skin regeneration. To explore their roles in the healing of skin wounds and their regulatory mechanism can provide a new target for the treatment, which has a potential value and broad prospects.

  9. Determination of the pollution with lead in the batteries factory in Al-Saffera (Aleppo) and surrounding area

    International Nuclear Information System (INIS)

    Al-Oudat, M.; Al-Kharfan, K.; Al-Shamali, K.

    2007-10-01

    The study aimed to determine the lead concentrations in the ecosystem surrounding the batteries factory in Al-Saffera. The results showed that the lead levels were very high in both factory area and the surrounding agricultural area. Lead levels in air varied between 12 and 34 μg/m3 in the area outside the factory. The same trends were in both soil and plant samples, and normal washing does not decrease the lead level in plant samples to acceptable levels. Mean lead levels in blood was also high and ranged between 55 and 28 μg /dl for factory workers and village inhabitants respectively. In conclusion the authorities administration must take all necessary procedures to reduce the lead levels in the factory area and in the surrounding area.(Author)

  10. Determination of the pollution with lead in the batteries factory in Al-Saffera (Aleppo) and surrounding area

    Energy Technology Data Exchange (ETDEWEB)

    Al-Oudat, M; Al-Kharfan, K; Al-Shamali, K [Atomic Energy Commission, Damascus (Syrian Arab Republic), Dept. of Protection and Safety

    2007-10-15

    The study aimed to determine the lead concentrations in the ecosystem surrounding the batteries factory in Al-Saffera. The results showed that the lead levels were very high in both factory area and the surrounding agricultural area. Lead levels in air varied between 12 and 34 {mu}g/m3 in the area outside the factory. The same trends were in both soil and plant samples, and normal washing does not decrease the lead level in plant samples to acceptable levels. Mean lead levels in blood was also high and ranged between 55 and 28 {mu}g /dl for factory workers and village inhabitants respectively. In conclusion the authorities administration must take all necessary procedures to reduce the lead levels in the factory area and in the surrounding area.(Author)

  11. Smoking and skin disease

    DEFF Research Database (Denmark)

    Thomsen, S F; Sørensen, L T

    2010-01-01

    Tobacco smoking is a serious and preventable health hazard that can cause or exacerbate a number of diseases and shorten life expectancy, but the role of smoking as an etiologic factor in the development of skin disease is largely unknown. Although epidemiological evidence is sparse, findings...... suggest that tobacco smoking is a contributing factor in systemic lupus erythematosus, psoriasis, palmoplantar pustulosis, cutaneous squamous cell carcinoma, hidradenitis suppurativa, and genital warts. In contrast, smoking may confer some protective effects and mitigate other skin diseases, notably...... pemphigus vulgaris, pyoderma gangrenosum, aphthous ulcers, and Behçet's disease. Various degenerative dermatologic conditions are also impacted by smoking, such as skin wrinkling and dysregulated wound healing, which can result in post-surgical complications and delayed or even arrested healing of chronic...

  12. Sprayed skin turbine component

    Science.gov (United States)

    Allen, David B

    2013-06-04

    Fabricating a turbine component (50) by casting a core structure (30), forming an array of pits (24) in an outer surface (32) of the core structure, depositing a transient liquid phase (TLP) material (40) on the outer surface of the core structure, the TLP containing a melting-point depressant, depositing a skin (42) on the outer surface of the core structure over the TLP material, and heating the assembly, thus forming both a diffusion bond and a mechanical interlock between the skin and the core structure. The heating diffuses the melting-point depressant away from the interface. Subsurface cooling channels (35) may be formed by forming grooves (34) in the outer surface of the core structure, filling the grooves with a fugitive filler (36), depositing and bonding the skin (42), then removing the fugitive material.

  13. Thyroid and skin

    Directory of Open Access Journals (Sweden)

    Dogra Alka

    2006-01-01

    Full Text Available The association of thyroid disorders with skin manifestations is complex. Both hypothryoidism and hyperthyroidism are known to cause these changes. In order to study this association of skin changes in relation to hypothyroidism, a study was carried out in the outpatients department of Dermatology of Dayanand Medical College and Hospital, Ludhiana, over a period of 3 months from Jan-March 2005. Thirty two patients were enrolled in the study and parameters were noted regarding history, general symptoms, cutaneous signs and associated diseases. We found gain in weight (71.85% and lethargy (65.62% to be the most common complaints. On cutaneous examination, dry, coarse texture of the skin (56%, pigmentary disorders (37.5% and telogen effluvium (40.62% were the most common findings. Other associated disorders were vitiligo, melasma, pemphigus, alopecia areata, xanthelasma palpebrarum, etc.

  14. Environment and the skin

    International Nuclear Information System (INIS)

    Suskind, R.R.

    1990-01-01

    The skin is an important organ of defense adaptation and a portal of entry for xenobiotics. It is vulnerable to physical, chemical, and biologic agents and capable of expressing responses to these agents in a variety of pathologic patterns. These patterns are characterized by morphologic and functional features which are elicited by careful examination and test procedures. Cutaneous cancer may result from exposure to nonionizing as well as ionizing radiation, to specific identifiable chemical hazards, and may be enhanced by trauma. Cutaneous hazards of chemical sources are largely found in the workplace and among consumer products, including drugs and toilet goods. Environmental skin diseases and injuries are preventable. Prior to use assessment for safety and for possible risks from exposure to an agent, product, or process is of primary importance in the prevention and control of environmental skin disease and injury

  15. Precancerous Skin Lesions.

    Science.gov (United States)

    Ferrándiz, C; Malvehy, J; Guillén, C; Ferrándiz-Pulido, C; Fernández-Figueras, M

    Certain clinically and histologically recognizable skin lesions with a degree of risk of progression to squamous cell carcinoma have been traditionally grouped as precancerous skin conditions but now tend to be classified as in situ carcinomas. This consensus statement discusses various aspects of these lesions: their evaluation by means of clinical and histopathologic features, the initial evaluation of the patient, the identification of risk factors for progression, and the diagnostic and treatment strategies available today. Copyright © 2016 AEDV. Publicado por Elsevier España, S.L.U. All rights reserved.

  16. Skin innate immune system

    Directory of Open Access Journals (Sweden)

    Berna Aksoy

    2013-06-01

    Full Text Available All multicellular organisms protect themselves from external universe and microorganisms by innate immune sytem that is constitutively present. Skin innate immune system has several different components composed of epithelial barriers, humoral factors and cellular part. In this review information about skin innate immune system and its components are presented to the reader. Innate immunity, which wasn’t adequately interested in previously, is proven to provide a powerfull early protection system, control many infections before the acquired immunity starts and directs acquired immunity to develop optimally

  17. Safety of radiofrequency treatment over human skin previously injected with medium-term injectable soft-tissue augmentation materials: a controlled pilot trial.

    Science.gov (United States)

    Alam, Murad; Levy, Ross; Pajvani, Urvi; Pavjani, Urvi; Ramierez, James A; Guitart, Joan; Veen, Heather; Gladstone, Hayes B

    2006-03-01

    Several soft-tissue augmentation materials are now available for reduction of nasolabial fold creases and perioral rhytides. Nasolabial folds and perioral rhytides can also be improved by skin tightening delivered by non-ablative radiofrequency (RF) treatment. The purpose of this study was to assess the safety of RF treatment over skin areas recently injected with medium-term injectable soft-tissue augmentation materials. Five subjects were assigned to the experimental arm (augmentation materials plus RF) and one to the control arm (augmentation materials alone). Each subject received injections of 0.3 mL of hyaluronic acid derivative (Restylane) and calcium hydroxylapatite (Radiesse) 3 cm apart on the upper inner arm. Two weeks later, two non-overlapping passes of RF (Thermage ThermaCool TC) were delivered at 63.5 setting with medium-fast 1.5 cm2 tip over injected sites in all of the experimental subjects. Punch skin biopsies were obtained 3 days later from each of the two injection sites on each subject. Light microscopy and digital photomicrographs obtained at low, medium, and high power showed no difference between filler materials in experimental and control subjects. In both cases filler was evident at the deep dermal-subcutaneous junction. Nodule formation, foreign body extravasation, or hemorrhage/clot was not observed grossly or histologically. Subjects and physicians did not report any difference in signs and symptoms between the experimental and control arms. Slightly increased transitory pain was noted when RF was delivered over filler versus over normal skin. Applying RF treatment over the same area 2 weeks after deep dermal injection with hyaluronic acid derivatives or calcium hydroxylapatite does not appear to cause gross morphological changes in the filler material or surrounding skin. Further studies with different parameters are necessary to confirm these findings. 2006 Wiley-Liss, Inc.

  18. Cyclic peptides as potential therapeutic agents for skin disorders.

    Science.gov (United States)

    Namjoshi, Sarika; Benson, Heather A E

    2010-01-01

    There is an increasing understanding of the role of peptides in normal skin function and skin disease. With this knowledge, there is significant interest in the application of peptides as therapeutics in skin disease or as cosmeceuticals to enhance skin appearance. In particular, antimicrobial peptides and those involved in inflammatory processes provide options for the development of new therapeutic directions in chronic skin conditions such as psoriasis and dermatitis. To exploit their potential, it is essential that these peptides are delivered to their site of action in active form and in sufficient quantity to provide the desired effect. Many polymers permeate the skin poorly and are vulnerable to enzymatic degradation. Synthesis of cyclic peptide derivatives can substantially alter the physicochemical characteristics of the peptide with the potential to improve its skin permeation. In addition, cyclization can stabilize the peptide structure and thereby increase its stability. This review describes the role of cyclic peptides in the skin, examples of current cyclic peptide therapeutic products, and the potential for cyclic peptides as dermatological therapeutics and cosmeceuticals.

  19. Morphogenesis and Biomechanics of Engineered Skin Cultured Under Uniaxial Strain.

    Science.gov (United States)

    Blackstone, Britani N; Powell, Heather M

    2012-04-01

    Split-thickness autograft is the standard wound treatment for full-thickness burns. In large burns, sparse availability of uninjured skin prevents rapid closure of the wound, resulting in increased scar tissue formation or mortality. Tissue-engineered skin (ES) offers promise when autografts are not available. ES, constructed from a polymeric scaffold and skin cells, has been shown to reduce donor site area required to permanently close wounds, mortality, and morbidity from scarring but cannot restore all skin functions. Current generations of ES are orders of magnitude weaker than normal human skin, leading to difficulty in surgical application, greater susceptibility to mechanical damage during fabrication and application, and less elasticity and strength once engrafted. Previous studies to improve ES biomechanics focus on altering the scaffolding material, which resulted in modest improvements but often inhibited proper skin development. As the skin is naturally under static strain, adding these mechanical cues to the culture environment is hypothesized to improve ES biomechanics. ES was cultured under applied static strains ranging from 0% to 40% strain for a total of 10 days. Strain magnitudes of 10% and 20% strain resulted in significantly stronger ES than unstrained controls, showed upregulation of many genes encoding structural extracellular matrix proteins, and exhibited increased epidermal cell proliferation and differentiation. Enhanced biomechanical properties of ES can allow for facile surgical application and less damage during dressing changes. These findings suggest that mechanical cues play a significant role in skin development and should be further explored.

  20. Early skin tumor detection from microscopic images through image processing

    International Nuclear Information System (INIS)

    Siddiqi, A.A.; Narejo, G.B.; Khan, A.M.

    2017-01-01

    The research is done to provide appropriate detection technique for skin tumor detection. The work is done by using the image processing toolbox of MATLAB. Skin tumors are unwanted skin growth with different causes and varying extent of malignant cells. It is a syndrome in which skin cells mislay the ability to divide and grow normally. Early detection of tumor is the most important factor affecting the endurance of a patient. Studying the pattern of the skin cells is the fundamental problem in medical image analysis. The study of skin tumor has been of great interest to the researchers. DIP (Digital Image Processing) allows the use of much more complex algorithms for image processing, and hence, can offer both more sophisticated performance at simple task, and the implementation of methods which would be impossibly by analog means. It allows much wider range of algorithms to be applied to the input data and can avoid problems such as build up of noise and signal distortion during processing. The study shows that few works has been done on cellular scale for the images of skin. This research allows few checks for the early detection of skin tumor using microscopic images after testing and observing various algorithms. After analytical evaluation the result has been observed that the proposed checks are time efficient techniques and appropriate for the tumor detection. The algorithm applied provides promising results in lesser time with accuracy. The GUI (Graphical User Interface) that is generated for the algorithm makes the system user friendly. (author)

  1. Comparison of skin responses from macroscopic and microscopic UV challenges

    Science.gov (United States)

    Seo, InSeok; Bargo, Paulo R.; Chu, Melissa; Ruvolo, Eduardo; Kollias, Nikiforos

    2011-03-01

    The minimal erythema dose induced by solar-simulated radiation is a useful measure of UV sensitivity of skin. Most skin phototests have been conducted by projecting a flat field of UV radiation onto the skin in an area greater than 15 cm × 15 cm with an increment of radiation doses. In this study, we investigated the responses of human skin to solar-simulated radiation of different field sizes. Twelve human subjects of skin phototype I-IV were exposed to solar-simulated radiation (SSR) on their upper inner arm or on their lower back with a series of doses in increments of 20% in order to determine the threshold dose to induce a minimal perceptible erythema response (MED). Each dose was delivered with a liquid light guide (8 mm diameter on the back or 6 mm on the upper inner arm) and with quartz optical fibers of 200 μm diameter. The resulting skin responses were evaluated visually and investigated with a reflectance confocal microscope and imaging. The erythema response to the microscopic challenge was always diffuse with no clear boundaries extending to several times the exposed site diameter at doses greater than 2 MED. The skin returned to normal appearance from the microscopic challenge after two weeks of exposure while change in appearance for the larger areas persisted for several weeks to months. This new modality of testing provides the possibility to study skin at the microscopic level with a rapid recovery following challenge.

  2. Biocompounds from rapeseed oil industry co-stream as active ingredients for skin care applications

    OpenAIRE

    Rivera Rodríguez, Diana Marcela; Rommi, Katariina; Macedo Fernandes, Margarida Maria; Lantto, Raija; Tzanov, Tzanko

    2015-01-01

    OBJECTIVE: Despite the great number of substances produced by the skincare industry, very few of them seem to truly have an effect on the skin. Therefore, given the social implications surrounding physical appearance, the search for new bioactive compounds to prevent or attenuate skin ageing and enhance self-image is a priority of current research. In this context, being rich in valuable compounds, such as proteins, phenolics, lipids and vitamins, this study is focused on the potential activi...

  3. Ultrastructural relationship of the phagophore with surrounding organelles.

    Science.gov (United States)

    Biazik, Joanna; Ylä-Anttila, Päivi; Vihinen, Helena; Jokitalo, Eija; Eskelinen, Eeva-Liisa

    2015-01-01

    Phagophore nucleates from a subdomain of the endoplasmic reticulum (ER) termed the omegasome and also makes contact with other organelles such as mitochondria, Golgi complex, plasma membrane and recycling endosomes during its formation. We have used serial block face scanning electron microscopy (SB-EM) and electron tomography (ET) to image phagophore biogenesis in 3 dimensions and to determine the relationship between the phagophore and surrounding organelles at high resolution. ET was performed to confirm whether membrane contact sites (MCSs) are evident between the phagophore and those surrounding organelles. In addition to the known contacts with the ER, we identified MCSs between the phagophore and membranes from putative ER exit sites, late endosomes or lysosomes, the Golgi complex and mitochondria. We also show that one phagophore can have simultaneous MCSs with more than one organelle. Future membrane flux experiments are needed to determine whether membrane contacts also signify lipid translocation.

  4. Trajectories and Maneuvers of Surrounding Vehicles with Panoramic Camera Arrays

    DEFF Research Database (Denmark)

    Dueholm, Jacob Velling; Kristoffersen, Miklas Strøm; Satzoda, Ravi K.

    2016-01-01

    Vision-based research for intelligent vehicles have traditionally focused on specific regions around a vehicle, such as a front looking camera for, e.g., lane estimation. Traffic scenes are complex and vital information could be lost in unobserved regions. This paper proposes a framework that uses...... four visual sensors for a full surround view of a vehicle in order to achieve an understanding of surrounding vehicle behaviors. The framework will assist the analysis of naturalistic driving studies by automating the task of data reduction of the observed trajectories. To this end, trajectories...... are estimated using a vehicle detector together with a multiperspective optimized tracker in each view. The trajectories are transformed to a common ground plane, where they are associated between perspectives and analyzed to reveal tendencies around the ego-vehicle. The system is tested on sequences from 2.5 h...

  5. Mechanical Characteristics Analysis of Surrounding Rock on Anchor Bar Reinforcement

    Science.gov (United States)

    Gu, Shuan-cheng; Zhou, Pan; Huang, Rong-bin

    2018-03-01

    Through the homogenization method, the composite of rock and anchor bar is considered as the equivalent material of continuous, homogeneous, isotropic and strength parameter enhancement, which is defined as reinforcement body. On the basis of elasticity, the composite and the reinforcement are analyzed, Based on strengthening theory of surrounding rock and displacement equivalent conditions, the expression of reinforcement body strength parameters and mechanical parameters is deduced. The example calculation shows that the theoretical results are close to the results of the Jia-mei Gao[9], however, closer to the results of FLAC3D numerical simulation, it is proved that the model and surrounding rock reinforcement body theory are reasonable. the model is easy to analyze and calculate, provides a new way for determining reasonable bolt support parameters, can also provides reference for the stability analysis of underground cavern bolting support.

  6. Diversity of vascular plants of Piestany and surroundings (presentation)

    International Nuclear Information System (INIS)

    Penzesova, A.; Galusova, T.

    2013-01-01

    In this presentation is a summary of the results of floristic research aimed at determining diversity of vascular plants of Piestany and its surroundings. Plant taxa we determined using the designation keys. We have compiled a list of plant species occurring in the monitored area, we evaluated the selected botanical-phytogeographical characteristics of flora, we've put together a list of local protected, endangered and rare species and a list of local invasive and expansive species according to sources. (Authors)

  7. Methods of Assessing Noise Nuisance of Real Estate Surroundings

    Directory of Open Access Journals (Sweden)

    Szopińska Kinga

    2016-03-01

    Full Text Available Testing what factors create the market value of real estate is key information when preparing property valuations as well as other opinions and professional evaluations on the basis of which court verdicts or administrative decisions are made. One of the factors influencing the value of some real estate is the level of noise present in the surroundings, which can lead to the occurrence of noise nuisance negatively affecting social relations.

  8. Skin dosimetry - radiological protection aspects of skin dosimetry

    International Nuclear Information System (INIS)

    Dennis, J.A.

    1991-01-01

    Following a Workshop in Skin Dosimetry, a summary of the radiological protection aspects is given. Aspects discussed include routine skin monitoring and dose limits, the need for careful skin dosimetry in high accidental exposures, techniques for assessing skin dose at all relevant depths and the specification of dose quantities to be measured by personal dosemeters and the appropriate methods to be used in their calibration. (UK)

  9. Dissipation of Impact Stress Waves within the Artificial Blasting Damage Zone in the Surrounding Rocks of Deep Roadway

    Directory of Open Access Journals (Sweden)

    Jianguo Ning

    2016-01-01

    Full Text Available Artificial explosions are commonly used to prevent rockburst in deep roadways. However, the dissipation of the impact stress wave within the artificial blasting damage zone (ABDZ of the rocks surrounding a deep roadway has not yet been clarified. The surrounding rocks were divided into the elastic zone, blasting damage zone, plastic zone, and anchorage zone in this research. Meanwhile, the ABDZ was divided into the pulverizing area, fractured area, and cracked area from the inside out. Besides, the model of the normal incidence of the impact stress waves in the ABDZ was established; the attenuation coefficient of the amplitude of the impact stress waves was obtained after it passed through the intact rock mass, and ABDZ, to the anchorage zone. In addition, a numerical simulation was used to study the dynamic response of the vertical stress and impact-induced vibration energy in the surrounding rocks. By doing so, the dissipation of the impact stress waves within the ABDZ of the surrounding rocks was revealed. As demonstrated in the field application, the establishment of the ABDZ in the surrounding rocks reduced the effect of the impact-induced vibration energy on the anchorage support system of the roadway.

  10. Skin blood flow from gas transport: helium xenon and laser Doppler compared

    International Nuclear Information System (INIS)

    Neufeld, G.R.; Galante, S.R.; Whang, J.M.; DeVries, D.; Baumgardner, J.E.; Graves, D.J.; Quinn, J.A.

    1988-01-01

    A study was designed to compare three independent measures of cutaneous blood flow in normal healthy volunteers: xenon-133 washout, helium flux, and laser velocimetry. All measurements were confined to the volar aspect of the forearm. In a large group of subjects we found that helium flux through intact skin changes nonlinearly with the controlled local skin temperature whereas helium flux through stripped skin, which is directly proportional to skin blood flow, changes linearly with cutaneous temperature over the range 33 degrees to 42 degrees. In a second group of six volunteers we compared helium flux through stripped skin to xenon-133 washout (intact skin) at a skin temperature of 33 degrees, and we found an essentially linear relationship between helium flux and xenon measured blood flow. In a third group of subjects we compared helium flux blood flow (stripped skin) to laser doppler velocimetric (LDV) measurements (intact skin) at adjacent skin sites and found a nonlinear increase in the LDV skin blood flow compared to that determined by helium over the same temperature range. A possible explanation for the nonlinear increases of helium flux through intact skin and of LDV output with increasing local skin temperature is that they reflect more than a change in blood flow. They may also reflect physical changes in the stratum corneum, which alters its diffusional resistance to gas flux and its optical characteristics

  11. Skin blood flow from gas transport: helium xenon and laser Doppler compared

    Energy Technology Data Exchange (ETDEWEB)

    Neufeld, G.R.; Galante, S.R.; Whang, J.M.; DeVries, D.; Baumgardner, J.E.; Graves, D.J.; Quinn, J.A.

    1988-03-01

    A study was designed to compare three independent measures of cutaneous blood flow in normal healthy volunteers: xenon-133 washout, helium flux, and laser velocimetry. All measurements were confined to the volar aspect of the forearm. In a large group of subjects we found that helium flux through intact skin changes nonlinearly with the controlled local skin temperature whereas helium flux through stripped skin, which is directly proportional to skin blood flow, changes linearly with cutaneous temperature over the range 33 degrees to 42 degrees. In a second group of six volunteers we compared helium flux through stripped skin to xenon-133 washout (intact skin) at a skin temperature of 33 degrees, and we found an essentially linear relationship between helium flux and xenon measured blood flow. In a third group of subjects we compared helium flux blood flow (stripped skin) to laser doppler velocimetric (LDV) measurements (intact skin) at adjacent skin sites and found a nonlinear increase in the LDV skin blood flow compared to that determined by helium over the same temperature range. A possible explanation for the nonlinear increases of helium flux through intact skin and of LDV output with increasing local skin temperature is that they reflect more than a change in blood flow. They may also reflect physical changes in the stratum corneum, which alters its diffusional resistance to gas flux and its optical characteristics.

  12. Numerical Simulation on Zonal Disintegration in Deep Surrounding Rock Mass

    Directory of Open Access Journals (Sweden)

    Xuguang Chen

    2014-01-01

    Full Text Available Zonal disintegration have been discovered in many underground tunnels with the increasing of embedded depth. The formation mechanism of such phenomenon is difficult to explain under the framework of traditional rock mechanics, and the fractured shape and forming conditions are unclear. The numerical simulation was carried out to research the generating condition and forming process of zonal disintegration. Via comparing the results with the geomechanical model test, the zonal disintegration phenomenon was confirmed and its mechanism is revealed. It is found to be the result of circular fracture which develops within surrounding rock mass under the high geostress. The fractured shape of zonal disintegration was determined, and the radii of the fractured zones were found to fulfill the relationship of geometric progression. The numerical results were in accordance with the model test findings. The mechanism of the zonal disintegration was revealed by theoretical analysis based on fracture mechanics. The fractured zones are reportedly circular and concentric to the cavern. Each fracture zone ruptured at the elastic-plastic boundary of the surrounding rocks and then coalesced into the circular form. The geometric progression ratio was found to be related to the mechanical parameters and the ground stress of the surrounding rocks.

  13. Numerical simulation on zonal disintegration in deep surrounding rock mass.

    Science.gov (United States)

    Chen, Xuguang; Wang, Yuan; Mei, Yu; Zhang, Xin

    2014-01-01

    Zonal disintegration have been discovered in many underground tunnels with the increasing of embedded depth. The formation mechanism of such phenomenon is difficult to explain under the framework of traditional rock mechanics, and the fractured shape and forming conditions are unclear. The numerical simulation was carried out to research the generating condition and forming process of zonal disintegration. Via comparing the results with the geomechanical model test, the zonal disintegration phenomenon was confirmed and its mechanism is revealed. It is found to be the result of circular fracture which develops within surrounding rock mass under the high geostress. The fractured shape of zonal disintegration was determined, and the radii of the fractured zones were found to fulfill the relationship of geometric progression. The numerical results were in accordance with the model test findings. The mechanism of the zonal disintegration was revealed by theoretical analysis based on fracture mechanics. The fractured zones are reportedly circular and concentric to the cavern. Each fracture zone ruptured at the elastic-plastic boundary of the surrounding rocks and then coalesced into the circular form. The geometric progression ratio was found to be related to the mechanical parameters and the ground stress of the surrounding rocks.

  14. Enhanced sources of acoustic power surrounding AR 11429

    International Nuclear Information System (INIS)

    Donea, Alina; Hanson, Christopher

    2013-01-01

    Multi-frequency power maps of the local acoustic oscillations show acoustic enhancements (''acoustic-power halos'') at high frequencies surrounding large active region. Computational seismic holography reveals a high-frequency ''acoustic-emission halo'', or ''seismic glory'' surrounding large active regions. In this study, we have applied computational seismic holography to map the seismic seismic source density surrounding AR 11429. Studies of HMI/SDO Doppler data, shows that the ''acoustic halos'' and the ''seismic glories'' are prominent at high frequencies 5–8 mHz. We investigate morphological properties of acoustic-power and acoustic emission halos around an active region to see if they are spatially correlated. Details about the local magnetic field from vectormagnetograms of AR 11429 are included. We identify a 15'' region of seismic deficit power (dark moat) shielding the white-light boundary of the active region. The size of the seismic moat is related to region of intermediate magnetic field strength. The acoustic moat is circled by the halo of enhanced seismic amplitude as well as enhanced seismic emission. Overall, the results suggest that features are related. However, if we narrow the frequency band to 5.5 – 6.5 mHz, we find that the seismic source density dominates over the local acoustic power, suggesting the existence of sources that emit more energy downward into the solar interior than upward toward the solar surface.

  15. Tissue reaction surrounding miniscrews for orthodontic anchorage: An animal experiment

    Directory of Open Access Journals (Sweden)

    Stephanie Shih-Hsuan Chen

    2012-03-01

    Results and conclusions: (1 Tissue surrounding roots damaged by a miniscrew showed a significant inflammatory response. (2 Root resorption was occasionally observed after 3 weeks following insertion of a miniscrew even if the miniscrew was not in direct contact with the root. (3 Root repair was noted with a cementoblast lining along the resorption surface at as early as 3 weeks after miniscrew insertion. Alveolar bone filled in the lesion when the root damage was large so that the contour of the alveolar bone followed that of the damaged root, with the width of the periodontal ligament space being maintained. (4 Stable miniscrews were mainly those which did not contact adjacent roots, and for which the surrounding tissue showed only a small inflammatory response with some extent of direct bone contact around the miniscrew. On the contrary, most of the failed miniscrews were those which had direct contact with adjacent roots, and which exhibited severe tissue inflammation and were covered by thick layers of soft tissue. Failure was detected 3 weeks after insertion. Surprisingly, the epithelial lining surrounding the miniscrews might not have spontaneously resolved 6 weeks after screw removal. Persistent infection in the sinus tract was noted, and this would require attention.

  16. A permeability barrier surrounds taste buds in lingual epithelia

    Science.gov (United States)

    Dando, Robin; Pereira, Elizabeth; Kurian, Mani; Barro-Soria, Rene; Chaudhari, Nirupa

    2014-01-01

    Epithelial tissues are characterized by specialized cell-cell junctions, typically localized to the apical regions of cells. These junctions are formed by interacting membrane proteins and by cytoskeletal and extracellular matrix components. Within the lingual epithelium, tight junctions join the apical tips of the gustatory sensory cells in taste buds. These junctions constitute a selective barrier that limits penetration of chemosensory stimuli into taste buds (Michlig et al. J Comp Neurol 502: 1003–1011, 2007). We tested the ability of chemical compounds to permeate into sensory end organs in the lingual epithelium. Our findings reveal a robust barrier that surrounds the entire body of taste buds, not limited to the apical tight junctions. This barrier prevents penetration of many, but not all, compounds, whether they are applied topically, injected into the parenchyma of the tongue, or circulating in the blood supply, into taste buds. Enzymatic treatments indicate that this barrier likely includes glycosaminoglycans, as it was disrupted by chondroitinase but, less effectively, by proteases. The barrier surrounding taste buds could also be disrupted by brief treatment of lingual tissue samples with DMSO. Brief exposure of lingual slices to DMSO did not affect the ability of taste buds within the slice to respond to chemical stimulation. The existence of a highly impermeable barrier surrounding taste buds and methods to break through this barrier may be relevant to basic research and to clinical treatments of taste. PMID:25209263

  17. A permeability barrier surrounds taste buds in lingual epithelia.

    Science.gov (United States)

    Dando, Robin; Pereira, Elizabeth; Kurian, Mani; Barro-Soria, Rene; Chaudhari, Nirupa; Roper, Stephen D

    2015-01-01

    Epithelial tissues are characterized by specialized cell-cell junctions, typically localized to the apical regions of cells. These junctions are formed by interacting membrane proteins and by cytoskeletal and extracellular matrix components. Within the lingual epithelium, tight junctions join the apical tips of the gustatory sensory cells in taste buds. These junctions constitute a selective barrier that limits penetration of chemosensory stimuli into taste buds (Michlig et al. J Comp Neurol 502: 1003-1011, 2007). We tested the ability of chemical compounds to permeate into sensory end organs in the lingual epithelium. Our findings reveal a robust barrier that surrounds the entire body of taste buds, not limited to the apical tight junctions. This barrier prevents penetration of many, but not all, compounds, whether they are applied topically, injected into the parenchyma of the tongue, or circulating in the blood supply, into taste buds. Enzymatic treatments indicate that this barrier likely includes glycosaminoglycans, as it was disrupted by chondroitinase but, less effectively, by proteases. The barrier surrounding taste buds could also be disrupted by brief treatment of lingual tissue samples with DMSO. Brief exposure of lingual slices to DMSO did not affect the ability of taste buds within the slice to respond to chemical stimulation. The existence of a highly impermeable barrier surrounding taste buds and methods to break through this barrier may be relevant to basic research and to clinical treatments of taste. Copyright © 2015 the American Physiological Society.

  18. Evaluation of out-in skin transparency using a colorimeter and food dye in patients with atopic dermatitis.

    Science.gov (United States)

    Mochizuki, H; Tadaki, H; Takami, S; Muramatsu, R; Hagiwara, S; Mizuno, T; Arakawa, H

    2009-05-01

    Atopic dermatitis is a disease of skin barrier dysfunction and outside stimuli can cross the skin barrier. To examine a new method for evaluating the outside to inside skin transparency with a colorimeter and yellow dyes. In study 1, a total of 28 volunteer subjects (24 normal and four with atopic dermatitis) participated. After provocation with yellow dye, the skin colour of all the subjects was measured using a colorimeter. The skin transparency index was calculated by the changes of the skin colour to yellow. Other variables of skin function, including transepidermal water loss (TEWL) and stratum corneum hydration, were also measured. In study 2, the skin transparency index was evaluated for a cohort of 38 patients with atopic dermatitis, 27 subjects with dry skin and 29 healthy controls. In study 1, the measurement of skin colour (b*) using tartrazine showed good results. There was a significant relationship between the skin transparency index with tartrazine and the atopic dermatitis score (P = 0.014). No other measurements of skin function, including the TEWL, were correlated. In study 2, the skin transparency index score obtained with tartrazine in the patients with atopic dermatitis was significantly higher than that of the controls and those with dry skin (P colorimeter and food dye, is noninvasive, safe and reliable for the evaluation of out-in skin transparency and can demonstrate the characteristic dysfunction in the skin barrier in patients with atopic dermatitis.

  19. Expression of p63 and Cyclooxygenase-2 and Their Correlation in Skin Tumors

    Institute of Scientific and Technical Information of China (English)

    WU Yan; LIU Houjun; LI Jiawen

    2007-01-01

    To study the expression of p63 and cyclooxygenase-2 (cox-2) in skin tumors and evaluate the correlation between p63 and cox-2, the expressions of cox-2 and p63 were measured by streptavidin-peroxidase complex immunohistochemical technique in 17 cases of skin squamous cell carcinoma (SCC), 19 cases of Bowen's disease(Bowen), 11 cases of actinic keratosis(AK), 12 cases of seborreic keratosis(SK) and 13 specimens of normal skin. Our results showed that the expression of p63 in skin squamous cell carcinoma, Bowen's disease and actinic keratosis were significantly higher than that in seborreic keratosis, while the expression of p63 in seborreic keratosis was significantly higher than that in normal skin. The expression of cox-2 in skin squamous cell carcinoma,Bowen's disease and actinic keratosis were significantly higher than that in seborreic keratosis, while no statistical difference was noted in the expression of cox-2 between seborreic keratosis and normal skin. Cox-2 expression was positively correlated with the high p63 expression in malignant skin tumors. The increased expression of cox-2 and p63 may play an important role in the development of skin tumors and work synergetically in malignant skin tumors.

  20. Frog skin function revisited

    DEFF Research Database (Denmark)

    Hviid Larsen, Erik; Ramløv, Hans

    2013-01-01

    of the epidermis. These mechanisms have evolved pari passu with life alternating between aquatic and terrestrial habitats associated with permeabilities of the skin controlled by external ion- and osmotic concentrations (loc. cit.). This allows for fast switching of the cutaneous uptake of chloride between active...

  1. Skin Cut Construction

    DEFF Research Database (Denmark)

    2017-01-01

    of the exhibition is to create a connection between the artistic and technological development through Danish rms and researchers who represent the newest technology in concrete treatment. The rst part exhibition (skin) will focus on the surface treatment of concrete (’graphical concrete’), the second (cut...

  2. Mechanical modeling of skin

    NARCIS (Netherlands)

    Oomens, C.W.J.; Peters, G.W.M.; Kassab, G.S.; Sacks, M.S.

    2016-01-01

    The chapter describes the work that was performed in the soft tissue biomechanics laboratory at Eindhoven University of Technology on the biomechanics of skin. A rationale is given for the changes from standard testing methods to inverse methods, from in vitro to in vivo and back to in vitro testing

  3. Preventing Skin Cancer

    Centers for Disease Control (CDC) Podcasts

    2016-05-18

    A man and a woman talk about how they’ve learned to protect their skin from the sun over the years. .  Created: 5/18/2016 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 5/18/2016.

  4. Skin Cancer Trends

    Science.gov (United States)

    ... Children from the Sun? Are There Benefits to Spending Time Outdoors? The Surgeon General’s Call to Action to Prevent Skin Cancer Related Resources Sun Safety Tips for Men Tips for Families Tips for Schools Tips for Employers Tips for ...

  5. Immunity and skin cancer

    International Nuclear Information System (INIS)

    Smith, E.B.; Brysk, M.M.

    1981-01-01

    Observations in humans and animal studies support the theory that immunologic surveillance plays an important role in limiting the development of skin malignancies. These immune responses undergo progressive diminution with age. In addition, other factors, such as bereavement, poor nutrition, and acute and chronic exposure to ultraviolet light, can further diminish immune mechanisms

  6. Examine Your Skin

    Medline Plus

    Full Text Available ... us for One-on-One Support Donate Share Facebook Twitter Newsletter Examine Your Skin Watch the video ... 29498 © 2013 Melanoma International Foundation. All Rights Reserved. Privacy Policy | Terms of Use Toll-free: 866-463- ...

  7. Skin lesion removal

    Science.gov (United States)

    ... likely to be done when there is a concern about a skin cancer. Most often, an area the shape of an ellipse is removed, as this makes it easier to close with stitches. The entire lesion is removed, going as deep as the fat, if needed, to ...

  8. Skin painting studies

    International Nuclear Information System (INIS)

    Witschi, H.P.; Smith, L.H.; Goad, M.E.; Anthony, W.B.; Gipson, L.C.; Stephens, T.J.; Whitaker, M.S.

    1987-01-01

    In order to estimate eventual risks to human health as a consequence of incidental and prolonged skin contact, it is necessary to obtain some information on the potential of coal-derived liquids to elicit skin cancer. In addition, it also must be established whether prolonged dermal exposure will produce signs of toxicity not only on the skin but to internal organs. During the past 2 years, they completed a life-long skin painting study with mice designed to answer some of these questions. The following materials were tested: Raw H-coal blend, containing 5700 ppm N; H-coal blend after low hydrotreatment (2650 ppm N); H-coal blend after high hydrotreatment (0.2 ppm N); H-coal home heating oil, a devolatilized version of the high-hydrotreatment H-coal blend; and an H-coal reformed naphtha. Two petroleum-derived references samples were used: Petroleum No. 2 fuel oil and high catalytically cracked naphtha. Benzo(a)pyrene was used as reference substance. Experimental animals were male and female C3H mice

  9. Light and skin disease

    International Nuclear Information System (INIS)

    Bauer, R.

    1991-01-01

    Because of the depletion of ozone in the stratosphere due to chlorofluorocarbons, the screening effect of this ozone layer on ultraviolet radiation (especially the so-called UV-B component) is reduced. This paper describes the impact of increased UV radiation on the human skin. Because of the 'ozone-hole', a distinct increase in the rate of skin cancer is to be expected which will affect all living beings but most of all man - an indirect consequence of the climate development. What makes the increased intensity of UV-B radiation so harmful is the fact that light-induced skin damage accumulates for the period of the life-time of the individual and cannot be reversed. A further thinning of stratospheric ozone would let through, in addition, the more short-waved ('harder') UV-C radiation. The latter, though clinically not significant currently, would then account for a further increase in the rate of malignant skin disease world-wide. (orig.) [de

  10. Skin peeling syndrome

    Directory of Open Access Journals (Sweden)

    Gharpuray Mohan

    1994-01-01

    Full Text Available We are reporting a case of skin peeling syndrome, a rare disorder in which sudden generalized exfoliation of the stratum corneum occurs. Histopathologically, there was well formed subcorneal pustule filled with polymorphs and nuclear dust, considering this to be a varient of subcorneal pustular dermatosis, we have put the patient on Dapsone.

  11. [Reconstruction of combined skin and bilateral artey defects at palmar side of fingers by free posterior interrosseous artery flap in a bridge fashion].

    Science.gov (United States)

    Xu, Bao-cheng; Liang, Gang; Chen, Fu-sheng

    2012-05-01

    To investigate the feasibility and therapeutic effect of free posterior interrosseous artery flap in a bridge fashion for combined skin and bilateral artery defects at palmar side of fingers. 6 cases with combined skin and bilateral artery defects at palmar side of fingers were treated with long-pedicled free posterior interrosseous artery flap in a bridge fashion. The flap size ranged from 3.5 cm x 2.0 cm to 6.5 em x 3.0 cm. The wounds at donor sites were closed directly. All the 6 flaps survived completely without any complication, and the wounds healed primarily. The blood supply and vein drainage in all the 6 fingers were normal. 4 cases were followed up for 1-12 months (average, 7 months). Satisfactory cosmetic and functional results were achieved. The flaps looked a little bit thicker than the surrounding tissue. The long-pedicled free posterior interrosseous artery flap in a bridge fashion is a good option for reconstruction of the combined skin and bilateral artery defects at palmar side of fingers in one stage.

  12. Skin color independent assessment of aging using skin autofluorescence

    NARCIS (Netherlands)

    Koetsier, M.; Nur, Erfan; Chunmao, Han; Lutgers, Helen L.; Links, Thera P.; Smit, Andries J.; Rakhorst, Gerhard; Graaff, Reindert

    2010-01-01

    Skin autofluorescence (AF) for the non-invasive assessment of the amount of accumulated tissue Advanced Glycation Endproducts (AGEs) increases with aging. In subjects with darker skin colors, measurements typically result in lower AF values than in subjects with fair skin colors, e.g. due to

  13. Skin color independent assessment of aging using skin autofluorescence

    NARCIS (Netherlands)

    Koetsier, M.; Nur, E.; Chunmao, H.; Lutgers, H.L.; Links, T.P.; Smit, A.J.; Rakhorst, G.; de Graaff, R.

    2010-01-01

    Skin autofluorescence (AF) for the non-invasive assessment of the amount of accumulated tissue Advanced Glycation Endproducts (AGEs) increases with aging. In subjects with darker skin colors, measurements typically result in lower AF values than in subjects with fair skin colors, e. g. due to

  14. A new method for skin color enhancement

    Science.gov (United States)

    Zeng, Huanzhao; Luo, Ronnier

    2012-01-01

    Skin tone is the most important color category in memory colors. Reproducing it pleasingly is an important factor in photographic color reproduction. Moving skin colors toward their preferred skin color center improves the skin color preference on photographic color reproduction. Two key factors to successfully enhance skin colors are: a method to detect original skin colors effectively even if they are shifted far away from the regular skin color region, and a method to morph skin colors toward a preferred skin color region properly without introducing artifacts. A method for skin color enhancement presented by the authors in the same conference last year applies a static skin color model for skin color detection, which may miss to detect skin colors that are far away from regular skin tones. In this paper, a new method using the combination of face detection and statistical skin color modeling is proposed to effectively detect skin pixels and to enhance skin colors more effectively.

  15. Masturbation, sexuality, and adaptation: normalization in adolescence.

    Science.gov (United States)

    Shapiro, Theodore

    2008-03-01

    During adolescence the central masturbation fantasy that is formulated during childhood takes its final form and paradoxically must now be directed outward for appropriate object finding and pair matching in the service of procreative aims. This is a step in adaptation that requires a further developmental landmark that I have called normalization. The path toward airing these private fantasies is facilitated by chumship relationships as a step toward further exposure to the social surround. Hartmann's structuring application of adaptation within psychoanalysis is used as a framework for understanding the process that simultaneously serves intrapsychic and social demands and permits goals that follow evolutionary principles. Variations in the normalization process from masturbatory isolation to a variety of forms of sexual socialization are examined in sociological data concerning current adolescent sexual behavior and in case examples that indicate some routes to normalized experience and practice.

  16. Impact of Particulate Matter Exposure and Surrounding “Greenness” on Chronic Absenteeism in Massachusetts Public Schools

    OpenAIRE

    MacNaughton, Piers; Eitland, Erika; Kloog, Itai; Schwartz, Joel; Allen, Joseph

    2017-01-01

    Chronic absenteeism is associated with poorer academic performance and higher attrition in kindergarten to 12th grade (K-12) schools. In prior research, students who were chronically absent generally had fewer employment opportunities and worse health after graduation. We examined the impact that environmental factors surrounding schools have on chronic absenteeism. We estimated the greenness (Normalized Difference Vegetation Index (NDVI)) and fine particulate matter air pollution (PM2.5) wit...

  17. Candida infection of the skin

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/000880.htm Candida infection of the skin To use the sharing features on this page, please enable JavaScript. Candida infection of the skin is a yeast infection ...

  18. Can thermal lasers promote skin wound healing?

    Science.gov (United States)

    Capon, Alexandre; Mordon, Serge

    2003-01-01

    Lasers are now widely used for treating numerous cutaneous lesions, for scar revision (hypertrophic and keloid scars), for tissue welding, and for skin resurfacing and remodeling (wrinkle removal). In these procedures lasers are used to generate heat. The modulation of the effect (volatilization, coagulation, hyperthermia) of the laser is obtained by using different wavelengths and laser parameters. The heat source obtained by conversion of light into heat can be very superficial, yet intense, if the laser light is well absorbed (far-infrared:CO(2) or Erbium:Yttrium Aluminum Garnet [Er:YAG] lasers), or it can be much deeper and less intense if the laser light is less absorbed by the skin (visible or near-infrared). Lasers transfer energy, in the form of heat, to surrounding tissues and, regardless of the laser used, a 45-50 degrees C temperature gradient will be obtained in the surrounding skin. If a wound healing process exists, it is a result of live cells reacting to this low temperature increase. The generated supraphysiologic level of heat is able to induce a heat shock response (HSR), which can be defined as the temporary changes in cellular metabolism. These changes are rapid and transient, and are characterized by the production of a small family of proteins termed the heat shock proteins (HSP). Recent experimental studies have clearly demonstrated that HSP 70, which is over-expressed following laser irradiation, could play a role with a coordinated expression of other growth factors such as transforming growth factor (TGF)-beta. TGF-beta is known to be a key element in the inflammatory response and the fibrogenic process. In this process, the fibroblasts are the key cells since they produce collagen and extracellular matrix. In conclusion, the analysis of the literature, and the fundamental considerations concerning the healing process when using thermal lasers, are in favor of a modification of the growth factors synthesis after laser irradiation, induced

  19. Heterogeneous Stem Cells in Skin Homeostatis and Wound Repair

    Directory of Open Access Journals (Sweden)

    Anna Meilana

    2015-08-01

    Full Text Available BACKGROUND: The skin protects mammals from insults, infection and dehydration and enables thermoregulation and sensory perception. Various skin-resident cells carry out these diverse functions. Constant turnover of cells and healing upon injury necessitate multiple reservoirs of stem cells. The skin is a complex organ harboring several distinct populations of stem cells and a rich array of cell types. Advances in genetic and imaging tools have brought new findings about the lineage relationships between skin stem cells and their progeny. Such knowledge may offer novel avenues for therapeutics and regenerative medicine. CONTENT: In the past years, our view of the mechanisms that govern skin homeostasis and regeneration have markedly changed. New populations of stem cells have been identified that behave spatio-temporally differently in healthy tissues and in situations of damage, indicating that a great level of stem cell heterogeneity is present in the skin. There are believed to be distinct populations of stem cells in different locations. The lineages that they feed are normally constrained by signals from their local environment, but they can give rise to all epidermal lineages in response to appropriate stimuli. Given the richness of structures such as blood vessels, subcutaneous fat, innervation and the accumulation of fibroblasts under the upper parts of the rete ridges (in the case of human skin, it is reasonable to speculate that the microenvironment might be essential for interfollicular epidermal homeostasis. The bloodstream is probably the main source of long-range signals reaching the skin, and cues provided by the vascular niche might be essential for skin homeostasis. SUMMARY: A key function of the interfollicular epidermis is to act as a protective interface between the body and the external environment, and it contains several architectural elements that enable it to fulfill this function. All elements of the epidermis play

  20. Laser-induced fluorescence for the detection of esophageal and skin cancer

    Science.gov (United States)

    Vo-Dinh, Tuan; Panjehpour, Masoud; Overholt, Bergein F.; Julius, Clark E.; Overholt, Suzanne; Phan, Mary N.

    2003-07-01

    Laser-induced fluorescence (LIF) is used for in-vivo cancer diagnosis of the esophagus and skin cancer. For esophageal measurements a fiberoptic probe inserted through an endoscope was used. Autofluorescence of normal and malignant tissues were measured directly on patient skin without requiring an endoscope. Measurement of the fluorescence signal from the tissue was performed using laser excitation at 410 nm. The methodology was applied to differentiate normal and malignant tumors of the esophagus and malignant skin lesions. The results of this LIF approach were compared with histopathology results of the biopsy samples and indicated excellent agreement in the classification of normal and malignant tumors for the samples investigated.

  1. Folate in Skin Cancer Prevention

    OpenAIRE

    Williams, J.D.; Jacobson, Elaine L.; Kim, H.; Kim, M.; Jacobson, M.K.

    2012-01-01

    Skin, the largest, most exposed organ of the body, provides a protective interface between humans and the environment. One of its primary roles is protection against exposure to sunlight, a major source of skin damage where the UV radiation (UVR) component functions as a complete carcinogen. Melanin pigmentation and the evolution of dark skin is an adaptive protective mechanism against high levels of UVR exposure. Recently, the hypothesis that skin pigmentation balances folate preservation an...

  2. Experimental studies on the radiation-modifying effect of bleomycin in malignant and normal mouse tissue in vivo

    International Nuclear Information System (INIS)

    Molin, J.; Sogaard, P.E.; Overgaard, J.

    1981-01-01

    The interaction between bleomycin (BLM) and radiation was studied in a C3H mammary carcinoma and its surrounding normal skin. In the skin, single and fractionated doses of sequential treatment with BLM (25 mg/kg) 24 hours prior to radiation therapy did not influence the response to irradiation, whereas simultaneous treatment with BLM given 15 minutes before radiation therapy enhanced the reaction to irradiation by a factor of 1.2 or 1.4 following treatment with one fraction or five fractions, respectively. The tumor response to irradiation was not influenced by a single sequential treatment, but five daily fractions of radiation therapy following five daily dose fractions of BLM increased the radiation dose needed to control 50% of the tumors, probably because the tumors continued to grow during the BLM treatment. Simultaneous treatment enhanced the response to irradiation by a factor of 1.2 after both single-dose and fractionated therapy. Based on these data it was concluded that none of the combined treatment schedules were able to produce a better therapeutic effect than radiation therapy alone. Furthermore, mortality due to lung fibrosis in mice treated with BLM indicated the marked toxicity of the drug. This toxicity was most pronounced after fractionated treatment and when radiation therapy and BLM were given simultaneously

  3. Skin Pedagogies and Abject Bodies

    Science.gov (United States)

    Kenway, Jane; Bullen, Elizabeth

    2011-01-01

    How does the beauty industry "narrate the skin"? What does it teach women from different cultural groups about the female body? How does skin function as a site where female subjection and abjection are produced and reproduced? In this paper we examine the skin industry pointing to its extreme commodification of the female body and to the…

  4. Maintaining Healthy Skin -- Part 2

    Science.gov (United States)

    ... and SCI • Depression and SCI • Taking Care of Pressure Sores • Maintaining Healthy Skin (Part I) • Maintaining Healthy Skin ( ... For information on establishing skin tolerance, see our “Pressure Sores” pamphlet.) Pressure releases in a wheelchair can be ...

  5. Maintaining Healthy Skin -- Part 1

    Science.gov (United States)

    ... with no breaks in the surface. It is warm (not hot or red) and neither dry and flaky nor moist and wrinkled. Healthy skin is a mirror of a healthy body. How to take care of your skin NUTRITION: To keep your skin healthy, eat a well- ...

  6. Skin Cancers of the Feet

    Science.gov (United States)

    ... Foot Health Awareness Month Diabetes Awareness What Are Skin Cancers of the Feet? Skin cancer can develop anywhere on the body, including ... cell carcinoma is the most common form of cancer on the skin of the feet. Most types of early squamous ...

  7. Elevation of telomerase activity in chronic radiation ulcer of human skin

    International Nuclear Information System (INIS)

    Li Xiaoying; Zhao Po; Wang Dewen; Yang Zhixiang

    1997-01-01

    Objective: To investigate the levels of telomerase activity in chronic radiation ulcers of human skin and the possible relationship between the enzyme and cancer transformation. Method: Using nonisotopic telomere repeat amplification protocol (TRAP), detections were performed in 20 cases of chronic radiation ulcers of human skin, 5 cases of normal skin tissues and 5 cases of carcinoma. Results: The positive rates for telomerase activity were 30.0%(6/20), 0(0/5) and 100%(5/5) in chronic radiation ulcers of human skin, normal skin and carcinoma, respectively. The telomerase activity in radiation ulcer was weaker than in carcinoma. Conclusion: The telomerase activity assay might be used as a marker for predicting the prognosis and the effect of treatment in chronic radiation ulcer of human skin

  8. The Pinking Shears: A Novel Tool for Improving Skin Graft Cosmesis

    Directory of Open Access Journals (Sweden)

    Cormac W. Joyce, MB BCh

    2014-12-01

    Full Text Available Summary: A significant aesthetic disadvantage to split skin grafts is the obvious transition between the graft and the normal skin. We report on a novel method to interrupt this transition point by using pinking shears, which are dressmaking scissors with saw-toothed blades that create a chevron pattern instead of a straight edge. We describe a case where the pinking shears were utilized on a split skin graft and Integra for reconstruction of the skin on a volar forearm. This technique allows for breaking-up of the transition point between the skin graft and normal skin and gives rise to an improved aesthetic outcome as the boundary is significantly less well-defined. This novel method shows promise and further study is certainly warranted.

  9. Gene Expression Architecture of Mouse Dorsal and Tail Skin Reveals Functional Differences in Inflammation and Cancer | Office of Cancer Genomics

    Science.gov (United States)

    Inherited germline polymorphisms can cause gene expression levels in normal tissues to differ substantially between individuals. We present an analysis of the genetic architecture of normal adult skin from 470 genetically unique mice, demonstrating the effect of germline variants, skin tissue location, and perturbation by exogenous inflammation or tumorigenesis on gene signaling pathways.

  10. Skin Cancer: Biology, Risk Factors & Treatment

    Science.gov (United States)

    ... turn Javascript on. Feature: Skin Cancer Skin Cancer: Biology, Risk Factors & Treatment Past Issues / Summer 2013 Table ... Articles Skin Cancer Can Strike Anyone / Skin Cancer: Biology, Risk Factors & Treatment / Timely Healthcare Checkup Catches Melanoma ...

  11. Behavioral Counseling to Prevent Skin Cancer

    Science.gov (United States)

    ... it might mean for you. What is skin cancer? Skin cancer is cancer that occurs in different kinds ... squamous cell carcinoma, and melanoma. Facts About Skin Cancer Skin cancer is the most common type of cancer ...

  12. Genetics Home Reference: acral peeling skin syndrome

    Science.gov (United States)

    ... Home Health Conditions Acral peeling skin syndrome Acral peeling skin syndrome Printable PDF Open All Close All ... to view the expand/collapse boxes. Description Acral peeling skin syndrome is a skin disorder characterized by ...

  13. Ultraviolet-laser ablation of skin

    Energy Technology Data Exchange (ETDEWEB)

    Lane, R.J.; Linsker, R.; Wynne, J.J.; Torres, A.; Geronemus, R.G.

    1985-05-01

    The authors report on the use of pulsed ultraviolet-laser irradiation at 193 nm from an argon-fluoride laser and at 248 nm from a krypton-fluoride laser to ablate skin. In vitro, both wavelengths performed comparably, removing tissue precisely and cleanly, and leaving minimal thermal damage to the surrounding tissue. In vivo, the 193-nm laser radiation failed to remove tissue after bleeding began. The 248-nm radiation, however, continued to remove tissue despite bleeding and left a clean incision with only minimal thermal damage. The krypton-fluoride excimer laser beam at 248 nm, which should be deliverable through a quartz optical fiber, has great potential as a surgical instrument.

  14. Elemental composition of skin tissue by PIXE and INAA analyses

    International Nuclear Information System (INIS)

    Hollands, R.; Spyrou, N.M.

    1997-01-01

    Hypertrophic scars are a particular type of scar that can form after any type of dermal injury. They are unsightly, red, elevated above normal skin level, itchy and painful. At present no-one knows why these scars form. Due to the differences between scar tissue and normal skin it was decided to analyse skin tissue which at a later date would be compared to scar tissue. Spit skin graft (epidermis) samples as well as full thickness skin (epidermis to dermis) tissue were analysed using PIXE and RBS with a 2 MeV proton beam. The epidermis was compared to the dermis to see if there were any variations between the two. In all the samples P, S, Cl, K, Ca, Fe, and Cd were detected and in a majority of the samples Zn and Ba were found, using PIXE. It was found that, between the epidermis and dermis, there was an significant increase in P in the epidermis in both full thickness and split skin graft samples. Complementary elemental analysis was also performed using neutron activation, and Br, Na and Zn were detected. (author)

  15. INTERACTIONS OF THE INFRARED BUBBLE N4 WITH ITS SURROUNDINGS

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Hong-Li; Li, Jin-Zeng; Yuan, Jing-Hua; Huang, Maohai; Huang, Ya-Fang; Zhang, Si-Ju [National Astronomical Observatories, Chinese Academy of Sciences, 20A Datun Road, Chaoyang District, Beijing 100012 (China); Wu, Yuefang [Department of Astronomy, Peking University, 100871 Beijing (China); Liu, Tie [Korea Astronomy and Space Science Institute 776, Daedeokdae-ro, Yuseong-gu, Daejeon, 305-348 (Korea, Republic of); Dubner, G.; Paron, S.; Ortega, M. E. [1Instituto de Astronomía y Física del Espacio (IAFE, CONICET-UBA), CC 67, Suc. 28, 1428 Buenos Aires (Argentina); Molinari, Sergio [Istituto di Astrofisica e Planetologia Spaziali—IAPS, Istituto Nazionale di Astrofisica—INAF, via Fosso del Cavaliere 100, I-00133 Roma (Italy); Zavagno, Annie; Samal, Manash R., E-mail: hlliu@nao.cas.cn [Aix Marseille Universit, CNRS, LAM (Laboratoire d’Astrophysique de Marseille) UMR 7326, F-13388, Marseille (France)

    2016-02-10

    The physical mechanisms that induce the transformation of a certain mass of gas in new stars are far from being well understood. Infrared bubbles associated with H ii regions have been considered to be good samples for investigating triggered star formation. In this paper we report on the investigation of the dust properties of the infrared bubble N4 around the H ii region G11.898+0.747, analyzing its interaction with its surroundings and star formation histories therein, with the aim of determining the possibility of star formation triggered by the expansion of the bubble. Using Herschel PACS and SPIRE images with a wide wavelength coverage, we reveal the dust properties over the entire bubble. Meanwhile, we are able to identify six dust clumps surrounding the bubble, with a mean size of 0.50 pc, temperature of about 22 K, mean column density of 1.7 × 10{sup 22} cm{sup −2}, mean volume density of about 4.4 × 10{sup 4} cm{sup −3}, and a mean mass of 320 M{sub ⊙}. In addition, from PAH emission seen at 8 μm, free–free emission detected at 20 cm, and a probability density function in special regions, we could identify clear signatures of the influence of the H ii region on the surroundings. There are hints of star formation, though further investigation is required to demonstrate that N4 is the triggering source.

  16. Blooming Trees: Substructures and Surrounding Groups of Galaxy Clusters

    Science.gov (United States)

    Yu, Heng; Diaferio, Antonaldo; Serra, Ana Laura; Baldi, Marco

    2018-06-01

    We develop the Blooming Tree Algorithm, a new technique that uses spectroscopic redshift data alone to identify the substructures and the surrounding groups of galaxy clusters, along with their member galaxies. Based on the estimated binding energy of galaxy pairs, the algorithm builds a binary tree that hierarchically arranges all of the galaxies in the field of view. The algorithm searches for buds, corresponding to gravitational potential minima on the binary tree branches; for each bud, the algorithm combines the number of galaxies, their velocity dispersion, and their average pairwise distance into a parameter that discriminates between the buds that do not correspond to any substructure or group, and thus eventually die, and the buds that correspond to substructures and groups, and thus bloom into the identified structures. We test our new algorithm with a sample of 300 mock redshift surveys of clusters in different dynamical states; the clusters are extracted from a large cosmological N-body simulation of a ΛCDM model. We limit our analysis to substructures and surrounding groups identified in the simulation with mass larger than 1013 h ‑1 M ⊙. With mock redshift surveys with 200 galaxies within 6 h ‑1 Mpc from the cluster center, the technique recovers 80% of the real substructures and 60% of the surrounding groups; in 57% of the identified structures, at least 60% of the member galaxies of the substructures and groups belong to the same real structure. These results improve by roughly a factor of two the performance of the best substructure identification algorithm currently available, the σ plateau algorithm, and suggest that our Blooming Tree Algorithm can be an invaluable tool for detecting substructures of galaxy clusters and investigating their complex dynamics.

  17. Baby Poop: What's Normal?

    Science.gov (United States)

    ... I'm breast-feeding my newborn and her bowel movements are yellow and mushy. Is this normal for baby poop? Answers from Jay L. Hoecker, M.D. Yellow, mushy bowel movements are perfectly normal for breast-fed babies. Still, ...

  18. Earthquakes in Switzerland and surrounding regions during 2007

    Energy Technology Data Exchange (ETDEWEB)

    Baer, M.; Deichmann, N.; Clinton, J.; Husen, S.; Faeh, D.; Giardini, D.; Kaestli, P.; Kradolfer, U.; Wiemer, S

    2008-12-15

    This report of the Swiss Seismological Service summarizes the seismic activity in Switzerland and surrounding regions during 2007. During this period, 531 earthquakes and 92 quarry blasts were detected and located in the region under consideration. Of these earthquakes, 30 are aftershocks of the stimulation of a proposed geothermal reservoir beneath the city of Basel in December of 2006. With 20 events with {mu}{sub {iota}} {>=} 2.5, four of which were artificially induced, the seismic activity in the year 2007 was far below the average over the previous 32 years. (author)

  19. Isoperimetric inequalities in surround system and space science

    OpenAIRE

    JiaJin Wen; Jun Yuan; ShanHe Wu

    2016-01-01

    Abstract By means of the algebraic, analysis, convex geometry, computer, and inequality theories we establish the following isoperimetric inequality in the centered 2-surround system S ( 2 ) { P , Γ , l } $S^{(2)} \\{P,\\varGamma ,l \\}$ : ( 1 | Γ | ∮ Γ r ¯ P p ) 1 / p ⩽ | Γ | 4 π sin l π | Γ | [ csc l π | Γ | + cot 2 l π | Γ | ln ( tan l π | Γ | + sec l π | Γ | ) ] , ∀ p ⩽ − 2 . $$\\begin{aligned}& \\biggl(\\frac{1}{|\\varGamma |} \\oint_{\\varGamma }\\bar{r}_{P}^{p} \\biggr)^{1/p}\\leqslant\\frac{|\\varG...

  20. Induced radioactivity in a 4 MW target and its surroundings

    CERN Document Server

    Agosteo, Stefano; Otto, Thomas; Silari, Marco

    2003-01-01

    An important aspect of a future CERN Neutrino Factory is the material activation arising from a 2.2 GeV, 4 MW proton beam striking a mercury target. An estimation of the hadronic inelastic interactions and the production of residual nuclei in the target, the magnetic horn, the decay tunnel, the surrounding rock and a downstream dump was performed by the Monte Carlo hadronic cascade code FLUKA. The aim was both to assess the dose equivalent rate to be expected during maintenance work and to evaluate the amount of residual radioactivity, which will have to be disposed of after the facility has ceased operation.