WorldWideScience

Sample records for surrounding normal skin

  1. Resonance Raman of BCC and normal skin

    Science.gov (United States)

    Liu, Cheng-hui; Sriramoju, Vidyasagar; Boydston-White, Susie; Wu, Binlin; Zhang, Chunyuan; Pei, Zhe; Sordillo, Laura; Beckman, Hugh; Alfano, Robert R.

    2017-02-01

    The Resonance Raman (RR) spectra of basal cell carcinoma (BCC) and normal human skin tissues were analyzed using 532nm laser excitation. RR spectral differences in vibrational fingerprints revealed skin normal and cancerous states tissues. The standard diagnosis criterion for BCC tissues are created by native RR biomarkers and its changes at peak intensity. The diagnostic algorithms for the classification of BCC and normal were generated based on SVM classifier and PCA statistical method. These statistical methods were used to analyze the RR spectral data collected from skin tissues, yielding a diagnostic sensitivity of 98.7% and specificity of 79% compared with pathological reports.

  2. On the transition to the normal phase for superconductors surrounded by normal conductors

    DEFF Research Database (Denmark)

    Fournais, Søren; Kachmar, Ayman

    2009-01-01

    For a cylindrical superconductor surrounded by a normal material, we discuss transition to the normal phase of stable, locally stable and critical configurations. Associated with those phase transitions, we define critical magnetic fields and we provide a sufficient condition for which those...

  3. Mast cell distribution in normal adult skin.

    Science.gov (United States)

    Janssens, A S; Heide, R; den Hollander, J C; Mulder, P G M; Tank, B; Oranje, A P

    2005-03-01

    To investigate mast cell distribution in normal adult skin to provide a reference range for comparison with mastocytosis. Mast cells (MCs) were counted in uninvolved skin adjacent to basal cell carcinomas and other dermatological disorders in adults. There was an uneven distribution of MCs in different body sites using the anti-tryptase monoclonal antibody technique. Numbers of MCs on the trunk, upper arm, and upper leg were similar, but were significantly different from those found on the lower leg and forearm. Two distinct groups were formed--proximal and distal. There were 77.0 MCs/mm2 at proximal body sites and 108.2 MCs/mm2 at distal sites. Adjusted for the adjacent diagnosis and age, this difference was consistent. The numbers of MCs in uninvolved skin adjacent to basal cell carcinomas and other dermatological disorders were not different from those in the control group. Differences in the numbers of MCs between the distal and the proximal body sites must be considered when MCs are counted for a reliable diagnosis of mastocytosis. A pilot study in patients with mastocytosis underlined the variation in the numbers of MCs in mastocytosis and normal skin, but showed a considerable overlap. The observed numbers of MCs in adults cannot be extrapolated to children. MC numbers varied significantly between proximal and distal body sites and these differences must be considered when MCs are counted for a reliable diagnosis of mastocytosis. There was a considerable overlap between the numbers of MCs in mastocytosis and normal skin.

  4. Reproducible pattern of microRNA in normal human skin

    DEFF Research Database (Denmark)

    Holst, Line; Kaczkowski, Bogumil; Gniadecki, Robert

    2010-01-01

    MicroRNAs (miRNAs) regulate cell growth, differentiation and apoptosis via specific targeting of messenger RNA (mRNA). Aberrant mRNA expression contributes to pathological processes such as carcinogenesis. To take advantage of miRNA profiling in skin disease it is essential to investigate miRNA...... expression pattern in normal human skin. Here we investigated miRNA expression profiles from skin biopsies of 8 healthy volunteers taken from sun protected and mildly photo damaged skin using the modified protocol for miRNA extraction. We were able to show a constant pattern of miRNA expression between...... different individuals. We did not find any significant differences in miRNA expression between sun protected and mildly photodamaged skin. These results may be valuable for future design of studies on miRNA expression in skin disease....

  5. Reproducible pattern of microRNA in normal human skin

    DEFF Research Database (Denmark)

    Holst, Line; Kaczkowski, Bogumil; Gniadecki, Robert

    2010-01-01

    MicroRNAs (miRNAs) regulate cell growth, differentiation and apoptosis via specific targeting of messenger RNA (mRNA). Aberrant mRNA expression contributes to pathological processes such as carcinogenesis. To take advantage of miRNA profiling in skin disease it is essential to investigate miRNA...... expression pattern in normal human skin. Here we investigated miRNA expression profiles from skin biopsies of 8 healthy volunteers taken from sun protected and mildly photo damaged skin using the modified protocol for miRNA extraction. We were able to show a constant pattern of miRNA expression between...... different individuals. We did not find any significant differences in miRNA expression between sun protected and mildly photodamaged skin. These results may be valuable for future design of studies on miRNA expression in skin disease....

  6. Using infrared and Raman microspectroscopies to compare ex vivo involved psoriatic skin with normal human skin

    Science.gov (United States)

    Leroy, Marie; Lefèvre, Thierry; Pouliot, Roxane; Auger, Michèle; Laroche, Gaétan

    2015-06-01

    Psoriasis is a chronic dermatosis that affects around 3% of the world's population. The etiology of this autoimmune pathology is not completely understood. The barrier function of psoriatic skin is known to be strongly altered, but the structural modifications at the origin of this dysfunction are not clear. To develop strategies to reduce symptoms of psoriasis or adequate substitutes for modeling, a deep understanding of the organization of psoriatic skin at a molecular level is required. Infrared and Raman microspectroscopies have been used to obtain direct molecular-level information on psoriatic and healthy human skin biopsies. From the intensities and positions of specific vibrational bands, the lipid and protein distribution and the lipid order have been mapped in the different layers of the skin. Results showed a similar distribution of lipids and collagen for normal and psoriatic human skin. However, psoriatic skin is characterized by heterogeneity in lipid/protein composition at the micrometer scale, a reduction in the definition of skin layer boundaries and a decrease in lipid chain order in the stratum corneum as compared to normal skin. A global decrease of the structural organization is exhibited in psoriatic skin that is compatible with an alteration of its barrier properties.

  7. Numerical modelling of salt diapirism and the surrounding temperature field during thin-skinned extension

    Science.gov (United States)

    Thieulot, Cedric; Harms, Guido

    2016-04-01

    The occurrence of salt diapirs is strongly associated with potential geothermal and hydrocarbon energy sources. Many numerical modelling studies of diapirism have been done in the past, though very few of these in fact use geologically realistic settings and materials. Besides, only analogue and structural studies have been done on full scale diapirism during thin-skinned extension. Two-dimensional numerical modelling of this problem using a Finite Element code aims at addressing the following questions: which geometrical or material parameters affect the growth rate and shape of the diapir and how? what is the effect of this diapirism on the temperature field and surface heat flux? How does the inclusion of simple surface processes influence these observations to first order ? Our results show that, in compliance with both analogue modelling and structural geological studies, a diapir formed during thin-skinned extension undergoes three phases: reactional piercement, active piercement and passive piercement. Extension rates directly influence the total time required for the diapir to reach the surface, as well as how long the system remains in a state of reactional diapirism, which both affect the shape of the resulting diapir. Erosion efficiency is found to affect the growth rate of the diapir during its active stage and the total rising time, which affects in turn its the shape. The density contrast between the salt and the sediments also influences the growth rate during active and passive piercement. Finally, the temperature surrounding a rising diapir (especially in the region above it) is found to be heightened by a few dozens of degrees.

  8. Upregulation of hypoxia-inducible factors in normal and psoriatic skin.

    Science.gov (United States)

    Rosenberger, Christian; Solovan, Caius; Rosenberger, Alina D; Jinping, Li; Treudler, Regina; Frei, Ulrich; Eckardt, Kai-Uwe; Brown, Lawrence F

    2007-10-01

    Angiogenesis induced by vascular endothelial growth factor (VEGF) plays an important role in psoriasis. Hypoxic adaptation is conferred through hypoxia-inducible transcription factors (HIFs). VEGF and its receptor Flt-1 are HIF target genes. Growth factors and inflammatory cytokines activate the phosphoinositol-3 kinase pathway, and via activated protein kinase B (phospho-Akt) augment HIF activity. Here, we demonstrate that the major oxygen-dependent HIF isoforms are strongly upregulated in psoriatic skin: HIF-1alpha mainly in the epidermis, in an expression pattern similar to VEGF mRNA; HIF-2alpha in both the epidermis and in capillary endothelial cells of the dermis. In contrast, normal human skin shows low expression of HIF-alpha proteins, with the exception of hair follicles, and glands, which strongly express HIF-1alpha. In normal human skin, phospho-Akt appeared in the basal epidermal layer, in hair follicles, and in dermal glands. In contrast, in psoriasis, phospho-Akt expression was low in the epidermis, but markedly enhanced in the dermal capillaries and in surrounding interstitial/inflammatory cells. Our data suggest that hypoxia initiates a potentially self-perpetuating cycle involving HIF, VEGF, and Akt activation, which could drive physiologic growth of hair follicles and skin glands. Furthermore, such a cycle may exist in psoriasis in dermal capillaries and contribute to disease progression.

  9. Collagen IV in Normal Skin and in Pathological Processes.

    Science.gov (United States)

    Abreu-Velez, Ana Maria; Howard, Michael S

    2012-01-01

    Type IV collagen is a type of collagen found primarily in the skin within the basement membrane zone. The type IV collagen C4 domain at the C-terminus is not removed in post-translational processing, and the fibers are thus link head-to-head, rather than in a parallel fashion. Also, type IV collagen lacks a glycine in every third amino-acid residue necessary for the tight collagen helix. Thus, the overall collagen-IV conformation is structurally more pliable and kinked, relative to other collagen subtypes. These structural features allow collagen IV to form sheets, which is the primary structural form found in the cutaneous basal lamina. There are six human genes associated with collagen IV, specifically COL4A1, COL4A2, COL4A3, COL4A4, COL4A5 and COL4A6. The aim of this review is to highlight the significance of this protein in normal skin, and in selected diseases. The alpha 3 protein constituent of type IV collagen is thought to be the antigen implicated in Goodpasture's syndrome, wherein the immune system attacks the basement membranes of the renal glomeruli and pulmonary alveoli. In addition, mutations to the genes coding for type IV collagen lead to the Alport syndrome. Furthermore, autoantibodies directed against denatured human type IV collagen have been described in rheumatoid arthritis, scleroderma, and SLE. Structural studies of collagen IV have been utilized to differentiate between subepidermal blistering diseases, including bullous pemphigoid, acquired epidermolysis bullosa, anti-epiligrin cicatricial pemphigoid, and bullous lupus erythematosus. Collagen IV is also of importance in wound healing and in embryogenesis. Pathological studies have demonstrated that minor structural differences in collagen IV can lead to distinct, clinically different diseases.

  10. Collagen IV in normal skin and in pathological processes

    Directory of Open Access Journals (Sweden)

    Ana Maria Abreu-Velez

    2012-01-01

    Full Text Available Context: Type IV collagen is a type of collagen found primarily in the skin within the basement membrane zone. The type IV collagen C4 domain at the C-terminus is not removed in post-translational processing, and the fibers are thus link head-to-head, rather than in a parallel fashion. Also, type IV collagen lacks a glycine in every third amino-acid residue necessary for the tight collagen helix. Thus, the overall collagen-IV conformation is structurally more pliable and kinked, relative to other collagen subtypes. These structural features allow collagen IV to form sheets, which is the primary structural form found in the cutaneous basal lamina. There are six human genes associated with collagen IV, specifically COL4A1, COL4A2, COL4A3, COL4A4, COL4A5 and COL4A6. The aim of this review is to highlight the significance of this protein in normal skin, and in selected diseases. Results: The alpha 3 protein constituent of type IV collagen is thought to be the antigen implicated in Goodpasture′s syndrome, wherein the immune system attacks the basement membranes of the renal glomeruli and pulmonary alveoli. In addition, mutations to the genes coding for type IV collagen lead to the Alport syndrome. Furthermore, autoantibodies directed against denatured human type IV collagen have been described in rheumatoid arthritis, scleroderma, and SLE. Structural studies of collagen IV have been utilized to differentiate between subepidermal blistering diseases, including bullous pemphigoid, acquired epidermolysis bullosa, anti-epiligrin cicatricial pemphigoid, and bullous lupus erythematosus. Collagen IV is also of importance in wound healing and in embryogenesis. Conclusions: Pathological studies have demonstrated that minor structural differences in collagen IV can lead to distinct, clinically different diseases.

  11. Reactive molecule species and antioxidative mechanisms in normal skin and skin aging.

    Science.gov (United States)

    Wölfle, Ute; Seelinger, Günter; Bauer, Georg; Meinke, Martina C; Lademann, Jürgen; Schempp, Christoph M

    2014-01-01

    Reactive oxygen and nitrogen species (ROS/RNS) which may exist as radicals or nonradicals, as well as reactive sulfur species and reactive carbon species, play a major role in aging processes and in carcinogenesis. These reactive molecule species (RMS), often referred to as 'free radicals' or oxidants, are partly by-products of the physiological metabolism. When RMS concentrations exceed a certain threshold, cell compartments and cells are injured and destroyed. Endogenous physiological mechanisms are able to neutralize RMS to some extent, thereby limiting damage. In the skin, however, pollutants and particularly UV irradiation are able to produce additional oxidants which overload the endogenous protection system and cause early aging, debilitation of immune functions, and skin cancer. The application of antioxidants from various sources in skin care products and food supplements is therefore widespread, with increasingly effective formulations being introduced. The harmful effects of RMS (aside from impaired structure and function of DNA, proteins, and lipids) are: interference with specific regulatory mechanisms and signaling pathways in cell metabolism, resulting in chronic inflammation, weakening of immune functions, and degradation of tissue. Important control mechanisms are: MAP-kinases, the aryl-hydrocarbon receptor (AhR), the antagonistic transcription factors nuclear factor-κB and Nrf2 (nuclear factor erythroid 2-related factor 2), and, especially important, the induction of matrix metalloproteinases which degrade dermal connective tissue. Recent research, however, has revealed that RMS and in particular ROS/RNS are apparently also produced by specific enzyme reactions in an evolutionarily adapted manner. They may fulfill important physiologic functions such as the activation of specific signaling chains in the cell metabolism, defense against infectious pathogens, and regulation of the immune system. Normal physiological conditions are characterized by

  12. Muscle biopsies off-set normal cellular signaling in surrounding musculature

    DEFF Research Database (Denmark)

    Krag, Thomas O; Hauerslev, Simon; Dahlqvist, Julia R

    2013-01-01

    muscle tissue for at least 3 weeks after the biopsy was performed and magnetic resonance imaging suggests that an effect of a biopsy may persist for at least 5 months. Cellular signaling after a biopsy resembles what is seen in severe limb-girdle muscular dystrophy type 2I with respect to protein......Studies of muscle physiology and muscular disorders often require muscle biopsies to answer questions about muscle biology. In this context, we have often wondered if muscle biopsies, especially if performed repeatedly, would affect interpretation of muscle morphology and cellular signaling. We...... hypothesized that muscle morphology and cellular signaling involved in myogenesis/regeneration and protein turnover can be changed by a previous muscle biopsy in close proximity to the area under investigation. Here we report a case where a past biopsy or biopsies affect cellular signaling of the surrounding...

  13. Morphology and epidermal thickness of normal skin imaged by optical coherence tomography

    DEFF Research Database (Denmark)

    Mogensen, Mette; Morsy, Hanan A.; Thrane, Lars;

    2008-01-01

    Background: Optical coherence tomography (OCT) is an optical imaging technology with a potential in the non-invasive diagnosis of skin cancer. To identify skin pathologies using OCT, it is of prime importance to establish baseline morphological features of normal skin. Aims: The aim of this study....... In glabrous skin the stratum corneum is visible. Children had larger ET (p skin-type-related differences in ET were found. Conclusion: This study contributes to understanding OCT and PS-OCT images of normal skin and indicates that OCT...... is to describe normal skin morphology using OCT and polarization-sensitive OCT (PS-OCT), which is a way of representing birefringent tissue such as collagen in OCT images. Anatomical locations in 20 healthy volunteers were imaged, and epidermal thickness (ET) was measured and compared to age, gender and skin...

  14. Low-Molecular-Weight Hydrophilic and Lipophilic Antioxidants in Nonmelanoma Skin Carcinomas and Adjacent Normal-Looking Skin.

    Science.gov (United States)

    Grammenandi, Konstantina; Kyriazi, Maria; Katsarou-Katsari, Alexandra; Papadopoulos, Othon; Anastassopoulou, Ioanna; Papaioannou, Georgios T; Sagriotis, Alexandros; Rallis, Michail; Maibach, Howard I

    2016-01-01

    Low-molecular-weight antioxidants are some of the most efficient agents of the skin defense mechanism against environmental factors, such as cosmic rays, smoke, and pollutants. The total skin concentrations of hydrophilic ascorbic and uric acids, as well as lipophilic α-tocopherol, β-carotene, and ubiquinol-10 antioxidants were determined by an HPLC-EC detector from 18 biopsies of human nonmelanoma skin carcinomas and 18 biopsies from skin areas adjacent to carcinomas. No significant differences in the concentrations of lipophilic antioxidants in both carcinomas and normal-looking skin areas adjacent to carcinomas were observed. On the contrary, ascorbic and uric acid concentrations were found to be 18 and 36% lower in carcinomas than in normal-looking skin areas, respectively. No statistical significance was observed between antioxidant concentrations and age, sex, phototype, profession, site of tumor, frequency, and time of UV light exposure either. Accordingly the antioxidant concentrations in both cancerous skin and adjacent normal-looking areas were found to be much higher than in normal skin, in contrast to literature data.

  15. Asiaticoside enhances normal human skin cell migration, attachment and growth in vitro wound healing model.

    Science.gov (United States)

    Lee, Jeong-Hyun; Kim, Hye-Lee; Lee, Mi Hee; You, Kyung Eun; Kwon, Byeong-Ju; Seo, Hyok Jin; Park, Jong-Chul

    2012-10-15

    Wound healing proceeds through a complex collaborative process involving many types of cells. Keratinocytes and fibroblasts of epidermal and dermal layers of the skin play prominent roles in this process. Asiaticoside, an active component of Centella asiatica, is known for beneficial effects on keloid and hypertrophic scar. However, the effects of this compound on normal human skin cells are not well known. Using in vitro systems, we observed the effects of asiaticoside on normal human skin cell behaviors related to healing. In a wound closure seeding model, asiaticoside increased migration rates of skin cells. By observing the numbers of cells attached and the area occupied by the cells, we concluded that asiaticoside also enhanced the initial skin cell adhesion. In cell proliferation assays, asiaticoside induced an increase in the number of normal human dermal fibroblasts. In conclusion, asiaticoside promotes skin cell behaviors involved in wound healing; and as a bioactive component of an artificial skin, may have therapeutic value.

  16. Histopathology of normal skin and melanomas after nanosecond pulsed electric field treatment.

    Science.gov (United States)

    Chen, Xinhua; James Swanson, R; Kolb, Juergen F; Nuccitelli, Richard; Schoenbach, Karl H

    2009-12-01

    Nanosecond pulsed electric fields (nsPEFs) can affect the intracellular structures of cells in vitro. This study shows the direct effects of nsPEFs on tumor growth, tumor volume, and histological characteristics of normal skin and B16-F10 melanoma in SKH-1 mice. A melanoma model was set up by injecting B16-F10 into female SKH-1 mice. After a 100-pulse treatment with an nsPEF (40-kV/cm field strength; 300-ns duration; 30-ns rise time; 2-Hz repetition rate), tumor growth and histology were studied using transillumination, light microscopy with hematoxylin and eosin stain and transmission electron microscopy. Melanin and iron within the melanoma tumor were also detected with specific stains. After nsPEF treatment, tumor development was inhibited with decreased volumes post-nsPEF treatment compared with control tumors (Pcell contraction and nuclear shrinkage while concurrently, but not permanently, damaging peripheral healthy skin tissue in the treated area, which we attribute to the highly localized electric fields surrounding the needle electrodes.

  17. Skin pigmentation and texture changes after hair removal with the normal-mode ruby laser.

    Science.gov (United States)

    Haedersdal, M; Egekvist, H; Efsen, J; Bjerring, P

    1999-11-01

    Promising clinical results have been obtained with the normal mode ruby laser for removal of unwanted hair. Melanin within the hair follicles is thought to act as target for the ruby laser pulses, whereas epidermal melanin is thought to be a competitive chromophore, responsible for potential side effects. This study aimed (i) to objectify postoperative changes in skin pigmentation and texture and (ii) to evaluate the importance of variations in preoperative skin pigmentation for the development of side effects 12 weeks after 1 treatment with the normal-mode ruby laser. A total of 17 volunteers (skin types I-IV) were laser-treated in the hairy pubic region (n = 51 test areas). A shaved test area served as control. Skin reflectance spectroscopical measurements, 3-dimensional surface contour analysis and ultrasonography objectified postoperative changes in skin pigmentation and texture. Blinded clinical assessments revealed postoperative hyperpigmentation (2% of test areas) and hypopigmentation (10%), whereas no textural changes were seen. Reflectance spectroscopically-determined pigmentary changes depended on the degree of preoperative skin pigmentation, fairly pigmented skin types experiencing subclinical hyperpigmentation and darkly pigmented skin types experiencing subclinical hypopigmentation. Three-dimensional surface profilometry documented similar pre- and postoperative surface contour parameters, indicating that the skin surface texture is preserved after laser exposure. Ultrasonography revealed similar skin thicknesses in laser-exposed and untreated control areas. It is concluded that normal-mode ruby laser treatment is safe for hair removal in skin types I-IV.

  18. Subcellular Raman Microspectroscopy Imaging of Nucleic Acids and Tryptophan for Distinction of Normal Human Skin Cells and Tumorigenic Keratinocytes.

    Science.gov (United States)

    Piredda, Paola; Berning, Manuel; Boukamp, Petra; Volkmer, Andreas

    2015-07-07

    At present, tumor diagnostic imaging is commonly based on hematoxylin and eosin or immunohistochemical staining of biopsies, which requires tissue excision, fixation, and staining with exogenous marker molecules. Here, we report on label-free tumor imaging using confocal spontaneous Raman scattering microspectroscopy, which exploits the intrinsic vibrational contrast of endogenous biomolecular species. We present a chemically specific and quantitative approach to monitoring normal human skin cells (keratinocytes and fibroblasts) as well as the human HaCaT in vitro skin carcinogenesis model and the tumor-derived MET in vivo skin cancer progression model. Mapping the amplitudes of two spectrally well isolated Raman bands at 752 and 785 cm(-1) allowed for direct visualization of the distributions representative of tryptophan-rich proteins and nucleic acids, respectively, with subcellular spatial resolution. Using these Raman markers, it was feasible to discriminate between normal human epidermal keratinocytes (NHEK) and dermal fibroblasts (NHDF) and to confine all tumorigenic cells from both the NHEK and NHDF. First evidence for the successful application of the proposed intracellular nucleic acid and tryptophan Raman signatures for skin cancer diagnosis was further demonstrated in an organotypic cutaneous squamous cell carcinomas model, allowing for the identification of tumor cells and their surrounding stroma in the tissue context.

  19. Comparison of the histological morphology between normal skin and scar tissue.

    Science.gov (United States)

    Yang, Shao-wei; Geng, Zhi-jun; Ma, Kui; Sun, Xiao-yan; Fu, Xiao-bing

    2016-04-01

    Skin wound healing is a complex event, and interrupted wound healing process could lead to scar formation. The aim of this study was to examine the morphological changes of scar tissue. Pathological staining (HE staining, Masson's trichrome staining, methenamine silver staining) was used to evaluate the morphological changes of regenerating epidermis in normal skin and scar tissue, and immunofluorescence staining to detect the expression of collagen IV, a component of basement membrane (BM), and the expression of integrinβ4, a receptor for BM laminins. Additionally, the expression of CK14, CK5, and CK10 was measured to evaluate the proliferation and differentiation of keratinocytes in normal skin and scar tissue. The results showed that the structure of the skin was histologically changed in scar tissue. Collagen IV, expressed under the epidermis of normal skin, was reduced distinctly in scar tissue. Integrinβ4, expressed in the basal layer of normal skin, was found absent in the basal layer of scar tissue. Additionally, it was found that keratinocytes in scarring epidermis were more proliferative than in normal skin. These results indicate that during the skin wound healing, altered formation of BM may affect the proliferation of keratinocytes, reepithelial and tissue remodeling, and then result in scar formation. Thus, remodeling BM structure during wound repair may be beneficial for improving healing in cutaneous wounds during clinical practice.

  20. Lipidomic differentiation between human kidney tumors and surrounding normal tissues using HILIC-HPLC/ESI-MS and multivariate data analysis.

    Science.gov (United States)

    Cífková, Eva; Holčapek, Michal; Lísa, Miroslav; Vrána, David; Melichar, Bohuslav; Študent, Vladimír

    2015-09-01

    The characterization of differences among polar lipid classes in tumors and surrounding normal tissues of 20 kidney cancer patients is performed by hydrophilic interaction liquid chromatography (HILIC) coupled to electrospray ionization mass spectrometry (ESI-MS). The detailed analysis of identified lipid classes using relative abundances of characteristic ions in negative- and positive-ion modes is used for the determination of more than 120 individual lipid species containing attached fatty acyls of different chain length and double bond number. Lipid species are described using relative abundances, providing a better visualization of lipidomic differences between tumor and normal tissues. The multivariate data analysis methods using unsupervised principal component analysis (PCA) and supervised orthogonal partial least square (OPLS) are used for the characterization of statistically significant differences in identified lipid species. Ten most significant up- and down-regulated lipids in OPLS score plots are also displayed by box plots. A notable increase of relative abundances of lipids containing four and more double bonds is detected in tumor compared to normal tissues. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Topical distribution of acyclovir in normal equine skin and equine sarcoids: An in vitro study.

    Science.gov (United States)

    Haspeslagh, M; Taevernier, L; Maes, A A; Vlaminck, L E M; De Spiegeleer, B; Croubels, S M; Martens, A M

    2016-06-01

    Topical acyclovir application is an owner-friendly treatment for occult equine sarcoids, without the caustic side-effects other topical treatments have. Variable clinical success rates have been described, but it is not known to what rate and extent acyclovir penetrates in and through equine skin from a topical formulation. In the current study, an in vitro Franz diffusion model was used to determine the permeation parameters for a generic 5% acyclovir cetomacrogol cream for both healthy and sarcoid equine skin. The distribution of acyclovir between different layers of both skin types was also evaluated. While acyclovir penetrated through both skin types, significantly less acyclovir permeated to the deep dermis of sarcoid skin (197.62ng/mm(3)) compared to normal skin (459.41ng/mm(3)). Within sarcoid skin samples, significantly higher acyclovir concentrations were found in the epidermis (983.59ng/mm(3)) compared to the superficial dermis (450.02ng/mm(3)) and the deep dermis. At each sample point, significantly more acyclovir permeated to the receptor fluid through normal skin compared to sarcoid skin, which is reflected in the significantly higher permeation parameters of normal skin. Normal skin was found to be more permissive for acyclovir, but even in sarcoid skin, enough acyclovir reached the deep dermis to treat a Herpes simplex virus infection. In the case of equine sarcoids, the treatment is aimed at the Bovine papillomavirus and no information is available on the susceptibility of the DNA polymerase of this virus for acyclovir. Therefore, further research is needed to determine the efficacy of acyclovir to treat equine sarcoids.

  2. Modulation of pro-inflammatory cytokines in normal and inflamed skin

    NARCIS (Netherlands)

    A.R. Companjen (Arjen)

    2001-01-01

    textabstractThis thesis describes the expression and modulation of pro-inflammatory cytokines in normal and inflamed skin. During the last few decades it has become clear that the skin comprises a complex network of interacting cells including keratinocytes (KC). dendritic cells (such as Langerhans

  3. Study on Mucin in Normal-Appearing Leg Skin.

    Science.gov (United States)

    Fernandez-Flores, Angel

    2017-03-01

    Dermal deposits of mucin in the legs have been described associated with venous insufficiency. However, some degree of stasis dermatitis is generally common in aged individuals. Therefore, some amount of mucin is expected a priori in the reticular dermis of aged patients, even in the absence of clinical lesions. To test this hypothesis, the authors investigated the mucin in the legs of aged individuals without any dermatologic disease. Cutaneous samples were taken from the legs of 15 autopsy cases. A sample of the skin of the legs (either from the left or the right leg without any distinction being made) was randomly taken (without selecting any specific area or attending to macroscopical features). The skin samples were fixed in formaldehyde, and sections obtained from all samples were stained with hematoxylin and eosin, iron, and Alcian blue. Iron deposits were graded as 0/4 in 7 cases, as 1/4 in 4 cases, as 2/4 in 2 cases, and as 4/4 in 2 cases. Cases with greater deposits of iron also had other signs of stasis, such as neovascularization. All the samples scored 0 for dermal mucin deposits in the reticular dermis. The authors conclude that mucin deposits in the legs are not inherent to aging. Therefore, any mucin deposit in the reticular dermis, as well as expansion of the periadnexal dermis by mucin deposits, should be considered abnormal.

  4. Epidermal stem cells - role in normal, wounded and pathological psoriatic and cancer skin

    DEFF Research Database (Denmark)

    Kamstrup, M.; Faurschou, A.; Gniadecki, R.

    2008-01-01

    in the basal layer of the interfollicular epidermis and in the bulge region of the hair follicle play a critical role for normal tissue maintenance. In wound healing, multipotent epidermal stem cells contribute to re-epithelization. It is possible that defects in growth control of either epidermal stem cells......In this review we focus on epidermal stem cells in the normal regeneration of the skin as well as in wounded and psoriatic skin. Furthermore, we discuss current data supporting the idea of cancer stem cells in the pathogenesis of skin carcinoma and malignant melanoma. Epidermal stem cells present...

  5. Exposure to Varying Strain Magnitudes Influences the Conversion of Normal Skin Fibroblasts Into Hypertrophic Scar Cells.

    Science.gov (United States)

    Kuang, Ruixia; Wang, Zhiguo; Xu, Quanchen; Cai, Xia; Liu, Tao

    2016-04-01

    Mechanical strain is a key contributor in the pathogenesis of hypertrophic scarring, whose optimal stretch magnitudes to initiate the differentiation of normal skin fibroblasts into aberrant fibroblasts phenotype remains largely unresolved. Influence of varying cyclic strain magnitudes on cultured human normal skin fibroblasts and its transformation into hypertrophic scar fibroblast-like phenotype is investigated in this study. Cultured fibroblasts isolated from hypertrophic scar and normal skin tissue were subjected to cyclic mechanical stretching under individual 10%, 15%, and 20% strain magnitudes at a frequency of 0.1 Hz for 24 hours. Stretched normal skin fibroblasts demonstrated significantly increased rates of cell proliferation, and also apparently oriented away nearly perpendicular to the applied stretching direction. Interestingly, the applied 10% strains magnitude resulted in a markedly enhanced cell proliferative ability compared with that of 20% strain magnitude. Parameters involving the mechanotransduction signaling, such as integrin β1 and P130Cas, were significantly improved at both mRNA and protein levels in the stretched normal skin fibroblasts, which was demonstrated in a negative magnitude-dependent manner. In addition, 10% strains magnitude triggered the highest expression levels of growth factor TGF-β1 and collagen matrix in stretched normal skin fibroblasts. Collectively, these results indicate that the 10% stretching magnitude, of the 3 strain magnitudes studied, is most effective for triggering the optimal mechanotransduction effects and biological responses inside cultured skin fibroblasts. The demonstrable conversion of normal skin fibroblasts into hypertrophic scar fibroblasts was also observed when 10% stretching magnitude was applied to cultured fibroblasts in vitro.

  6. Atomic Hydrogen Surrounded by Water Molecules, H(H2O)m, Modulates Basal and UV-Induced Gene Expressions in Human Skin In Vivo

    Science.gov (United States)

    Shin, Mi Hee; Park, Raeeun; Nojima, Hideo; Kim, Hyung-Chel; Kim, Yeon Kyung; Chung, Jin Ho

    2013-01-01

    Recently, there has been much effort to find effective ingredients which can prevent or retard cutaneous skin aging after topical or systemic use. Here, we investigated the effects of the atomic hydrogen surrounded by water molecules, H(H2O)m, on acute UV-induced responses and as well as skin aging. Interestingly, we observed that H(H2O)m application to human skin prevented UV-induced erythema and DNA damage. And H(H2O)m significantly prevented UV-induced MMP-1, COX-2, IL-6 and IL-1β mRNA expressions in human skin in vivo. We found that H(H2O)m prevented UV-induced ROS generation and inhibited UV-induced MMP-1, COX-2 and IL-6 expressions, and UV-induced JNK and c-Jun phosphorylation in HaCaT cells. Next, we investigated the effects of H(H2O)m on intrinsically aged or photoaged skin of elderly subjects. In intrinsically aged skin, H(H2O)m application significantly reduced constitutive expressions of MMP-1, IL-6, and IL-1β mRNA. Additionally, H(H2O)m significantly increased procollagen mRNA and also decreased MMP-1 and IL-6 mRNA expressions in photoaged facial skin. These results demonstrated that local application of H(H2O)m may prevent UV-induced skin inflammation and can modulate intrinsic skin aging and photoaging processes. Therefore, we suggest that modifying the atmospheric gas environment within a room may be a new way to regulate skin functions or skin aging. PMID:23637886

  7. Microbial colonization of normal skin: Direct visualization of 194 skin biopsies.

    Science.gov (United States)

    Jahns, Anika C; Alexeyev, Oleg A

    2016-04-01

    Recent genetic studies have suggested the presence of numerous microbial species on and in the skin. We characterised microbial colonization of a large collection of skin biopsies from 194 healthy subjects by fluorescence assay. Forty per cent of all biopsies did not show any evidence for microbial colonization. Propionibacterium acnes was the sole predominant bacterial species in both sebaceous and non-sebaceous areas. Non- P. acnes species were present in approximately 30% of all colonized samples. . Only hair follicles and stratum corneum were colonized. Understanding of cutaneous microbiota requires validation from a variety of approaches and techniques.

  8. The Influence of Normal Load and Sliding Speed on Frictional Properties of Skin

    Institute of Scientific and Technical Information of China (English)

    Wei Tang; Shi-rong Ge; Hua Zhu; Xi-chuan Cao; Ning Li

    2008-01-01

    The study of frictional properties of human skin is important for medical research, skin care products and textile exploitation. In order to investigate the influence of normal load and sliding speed on the frictional properties of skin and its possible mechanism, tests were carried out on a multi-specimen friction tester. When the normal load increases from 0.1 N to 0.9 N,normal displacement and the friction coefficient of skin increase. The friction coefficient is dependent on the load, indicating that both adhesion and deformation contribute to the friction behaviour. The deformation friction was interpreted using the plough model of fiiction. When sliding speed increases from 0.5 mm·s-1 to 4 mm·s-1,the friction coefficient increases and "stick-slip" phenomena increase, indicating that hysteretic friction contributes to the friction. The hysteretic friction was interpreted using schematic of energy translation during the rigid spherical probe sliding on the soft skin surface, which provides an explanation for the influence of the sliding speed on the frictional characteristics of the skin.

  9. Validation of a diagnostic algorithm for the discrimination of actinic keratosis from normal skin and squamous cell carcinoma by means of high-definition optical coherence tomography.

    Science.gov (United States)

    Marneffe, Alice; Suppa, Mariano; Miyamoto, Makiko; Del Marmol, Véronique; Boone, Marc

    2016-09-01

    Actinic keratoses (AKs) commonly arise on sun-damaged skin. Visible lesions are often associated with subclinical lesions on surrounding skin, giving rise to field cancerization. To avoid multiple biopsies to diagnose subclinical/early invasive lesions, there is an increasing interest in non-invasive diagnostic tools, such as high-definition optical coherence tomography (HD-OCT). We previously developed a HD-OCT-based diagnostic algorithm for the discrimination of AK from squamous cell carcinoma (SCC) and normal skin. The aim of this study was to test the applicability of HD-OCT for non-invasive discrimination of AK from SCC and normal skin using this algorithm. Three-dimensional (3D) HD-OCT images of histopathologically proven AKs and SCCs and images of normal skin were collected. All images were shown in a random sequence to three independent observers with different experience in HD-OCT, blinded to the clinical and histopathological data and with different experience with HD-OCT. Observers classified each image as AK, SCC or normal skin based on the diagnostic algorithm. A total of 106 (38 AKs, 16 SCCs and 52 normal skin sites) HD-OCT images from 71 patients were included. Sensitivity and specificity for the most experienced observer were 81.6% and 92.6% for AK diagnosis and 93.8% and 98.9% for SCC diagnosis. A moderate interobserver agreement was demonstrated. HD-OCT represents a promising technology for the non-invasive diagnosis of AKs. Thanks to its high potential in discriminating SCC from AK, HD-OCT could be used as a relevant tool for second-level examination, increasing diagnostic confidence and sparing patients unnecessary excisions.

  10. Normal range and lateral symmetry in the skin temperature profile of pregnant women

    Science.gov (United States)

    Pereira, Tânia; Nogueira-Silva, Cristina; Simoes, Ricardo

    2016-09-01

    Body skin temperature is a useful parameter for diagnosing diseases and infrared thermography can be a powerful tool in providing important information to detect body temperature changes in a noninvasive way. The aim of this work was to study the pattern of skin temperature during pregnancy, to establish skin temperature reference values and to find correlations between these and the pregnant population characteristics. Sixty-one healthy pregnant women (mean age 30.6 ± 5.1 years) in the 8th-40th gestational week with normal pregnancies were examined in 31 regions of interest (ROI). The ROIs were defined all over the body in order to determine the most influenced by factors such as age or body mass index (BMI). The results obtained in this work highlight that in normal pregnant women the skin temperature is symmetrically distributed, with the symmetrical areas differing less than 0.5 °C , with a mean value of 0.25 ± 0.23 °C . This study identified a significant negative correlation between the BMI and temperature. Age has been shown to have great influence on the skin temperature, with a significant increase of temperature observed with age. This work explores a novel medical application of infrared thermography and provides a characterization of thermal skin profile in human pregnancy for a large set of ROIs while also evaluating the effects of age and BMI.

  11. High-resolution magnetic resonance imaging in study of the skin: Normal patterns

    Energy Technology Data Exchange (ETDEWEB)

    Sans, Nicolas, E-mail: sans.n@chu-toulouse.fr [Service de Radiologie et Imagerie Medicale, Centre Hospitalier Universitaire Purpan, Place du Dr Baylac, TSA 40031, 31059 Toulouse Cedex 9 (France); Faruch, Marie; Chiavassa-Gandois, Helene; Ribes, Catherine Lalande Champetier de [Service de Radiologie et Imagerie Medicale, Centre Hospitalier Universitaire Purpan, Place du Dr Baylac, TSA 40031, 31059 Toulouse Cedex 9 (France); Paul, Carle [Service de Dermatologie, Centre Hospitalier Universitaire Larrey, Toulouse (France); Railhac, Jean-Jacques [Service de Radiologie et Imagerie Medicale, Centre Hospitalier Universitaire Purpan, Place du Dr Baylac, TSA 40031, 31059 Toulouse Cedex 9 (France)

    2011-11-15

    Purpose: To validate quantitative and qualitative criteria of normal healthy skin using high-resolution MR imaging. Materials and methods: FIESTA and spin echo sequences of the skin of the heel, back and calf were obtained in 31 healthy volunteers. A dedicated 3-in. coil for study of the skin was used to optimize reception sensitivity. Quantitative analysis was performed to measure skin thickness in these three sites and qualititative analysis aimed to differentiate the various skin layers. Results: With both sequences, the stratum corneum appeared as a hyperintense layer. The epidermis was visualized appeared as a fine, homogeneous, hyperintense line. The dermoepidermal junction was clearer particularly in the calf. The dermis was also identified in each sequence and in each anatomic site. The signal was hypointense in both sequences, homogeneous with spin echo and more heterogeneous with FIESTA. Moreover the interface between the papillary and the reticular dermis could be distinguished. The hypodermis was visualized in both sequences and in all sites and hypodermal inclusions in the dermis were seen particularly in the back and calf. Lastly, the pilosebaceous follicles and the deep vascular network of the reticular dermis were more clearly seen with FIESTA sequence. Measures of overall skin thickness and for each layer according to site, sex and MRI sequence were performed. Statistical analysis was then performed to seek significant differences between the results according to these parameters. Conclusion: MR imaging provides global analysis with high resolution of the various skin layers down to the hypodermis and the muscular fascia.

  12. [Modified method of constructing tissue microarray which contains keloid and normal skin].

    Science.gov (United States)

    Zhang, Zhenyu; Chen, Junjie; Cen, Ying; Zhao, Sha; Liao, Dianying; Gong, Jing

    2010-08-01

    To seek for a method of constructing the tissue microarray which contains keloid, skin around keloid, and normal skin. The specimens were gained from patients of voluntary donation between March and May 2009, including the tissues of keloid (27 cases), skin around keloid (13 cases), and normal skin (27 cases). The specimens were imbedded by paraffin as donor blocks. The traditional method of constructing the tissue microarray and section were modified according to the histological characteristics of the keloid and skin tissue and the experimental requirement. The tissue cores were drilled from donor blocks and attached securely on the adhesive platform which was prepared. The adhesive platform with tissue cores in situ was placed into an imbedding mold, which then was preheated briefly. Paraffin at approximately 70 degrees C was injected to fill the mold and then cooled to room temperature. Then HE staining, immunohistochemistry staining were performed and the results were observed by microscope. The constructed tissue microarray block contained 67 cores as designed and displayed smooth surface with no crack. All the cores distributed regularly, had no disintegration or manifest shift. HE staining of tissue microarray section showed that all cores had equal thickness, distinct layer, manifest contradistinction, well-defined edge, and consistent with original pathological diagnosis. Immunohistochemistry staining results demonstrated that all cores contained enough tissue dose to apply group comparison. However, in tissue microarray which was made as traditional method, many cores missed and a few cores shifted obviously. Applying modified method can successfully construct tissue microarray which is composed of keloid, skin around keloid, and normal skin. This tissue microarray will become an effective tool of researching the pathogenesis of keloid.

  13. Skin-pass rolling I – Studies on roughness transfer and elongation under pure normal loading

    DEFF Research Database (Denmark)

    Kijima, Hideo; Bay, Niels

    2008-01-01

    The influence of tool roughness in skin-pass or temper rolling of steel strip is investigated focusing on roughness transfer and strip elongation under pure normal loading, i.e. with no tangential shear between tool and workpiece. The process is simulated by an elasto-plastic FE simulation of plane...

  14. Development of gene microarray in screening differently expressed genes in keloid and normal-control skin

    Institute of Scientific and Technical Information of China (English)

    陈伟; 付小兵; 葛世丽; 孙晓庆; 周岗; 赵志力; 盛志勇

    2004-01-01

    Background Keloid is an intricate lesion that is probably regulated by many genes. In this study, the authors used the technique of complementary DNA (cDNA) microarray to analyse abnormal gene expression in keloids and normal control skins. Methods The polymerase chain reaction (PCR) products of 8400 genes were spotted in an array on chemical-material-coated-glass plates. The DNAs were fixed on the glass plates. The total RNAs were isolated from freshly excised human keloid and normal control skins, and the mRNAs were then purified. The mRNA from both keloid and normal control skins were reversely transcribed to cDNAs, with the incorporation of fluorescent dUTP, for preparing the hybridisation probes. The mixed probes were then hybridised to the cDNA microarray. After thorough washing, the cDNA microarray was scanned for differing fluorescent signals from two types of tissues. Gene expression of tissue growth factor-β1 (TGF-β1) and of c-myc was detected with both RT-PCR and Northern blot hybridisation to confirm the effectiveness of cDNA microarray. Results Among the 8400 human genes, 402 were detected with different expression levels between keloid and normal control skins. Two hundred and fifty genes, including TGF-β1 and c-myc, were up-regulated and 152 genes were down-regulated. Higher expressions of TGF-β1 and c-myc in keloid were also revealed using RT-PCR and Northern blot methods. Conclusion cDNA microarray analysis provides a powerful tool for investigating differential gene expression in keloid and normal control skins. Keloid is a complicated lesion with many genes involved.

  15. Frequency of apoptotic keratinocytes in the feline epidermis: a retrospective light-microscopic study of skin-biopsy specimens from 327 cats with normal skin or inflammatory dermatoses.

    Science.gov (United States)

    Vogel, Jeff W; Scott, Danny W; Erb, Hollis N

    2009-12-01

    A retrospective light-microscopic study was performed on 294 biopsy specimens of haired skin from cats with various feline inflammatory dermatoses and specimens from cats with normal skin. Conditions expected to frequently have apoptotic epidermal keratinocytes (AKs) (including erythema multiforme, systemic lupus erythematosus, thymoma-associated exfoliative dermatitis, solar dermatitis, and viral dermatopathies) were found to have significantly more AKs than other types of inflammatory dermatoses. Nevertheless, we found more than two AKs in many skin-biopsy specimens from inflammatory conditions not expected to have frequent AKs (especially those from ectoparasitic dermatoses). Only a single AK was found in 1/33 cats with normal skin.

  16. Spectral analysis of delayed luminescence as a tool to discriminate between normal and cancer skin cells

    Science.gov (United States)

    Musumeci, F.; Scordino, A.; Tudisco, S.; Privitera, S.; Applegate, L. A.; Niggli, H. J.

    2005-08-01

    Photobiological research in the last decades has shown the existence of Delayed Luminescence in biological tissue, which presents an excitation spectrum with a peak within the UVA region and can be detected with sophisticated photomultiplier systems. Based on these findings, a new and powerful tool able to measure the UV-A-laser-induced Delayed Luminescence emission of cultured cells was developed, with the intention to detect biophysical changes between carcinogenic and normal cells. Indeed noticeable differences have been found in the time resolved emission spectrum of delayed luminescence of cell cultures of human fibroblast and human melanoma. This new, powerful and non-invasive technique, in principle, could be applied in all fields of skin research, such as the investigation of skin abnormalities and to test the effect of products involved in regeneration, anti-aging and UV-light protection in order to prevent skin cancer.

  17. Assessment of Optical Coherence Tomography Imaging in the Diagnosis of Non-Melanoma Skin Cancer and Benign Lesions Versus Normal Skin:

    DEFF Research Database (Denmark)

    Mogensen, Mette; Jørgensen, Thomas Martini; Nürnberg, Birgit Meincke

    2009-01-01

    BACKGROUND Optical coherence tomography (OCT) is an optical imaging technique that may be useful in diagnosis of non-melanoma skin cancer (NMSC). OBJECTIVES To describe OCT features in NMSC such as actinic keratosis (AK) and basal cell carcinoma (BCC) and in benign lesions and to assess...... the diagnostic accuracy of OCT in differentiating NMSC from benign lesions and normal skin. METHODS AND MATERIALS OCT and polarization-sensitive (PS) OCT from 104 patients were studied. Observer-blinded evaluation of OCT images from 64 BCCs, 1 baso-squamous carcinoma, 39 AKs, two malignant melanomas, nine benign...... lesions, and 105 OCT images from perilesional skin was performed; 50 OCT images of NMSC and 50 PS-OCT images of normal skin were evaluated twice. RESULTS Sensitivity was 79% to 94% and specificity 85% to 96% in differentiating normal skin from lesions. Important features were absence of well...

  18. Absorption spectra and light penetration depth of normal and pathologically altered human skin

    Science.gov (United States)

    Barun, V. V.; Ivanov, A. P.; Volotovskaya, A. V.; Ulashchik, V. S.

    2007-05-01

    A three-layered skin model (stratum corneum, epidermis, and dermis) and engineering formulas for radiative transfer theory are used to study absorption spectra and light penetration depths of normal and pathologically altered skin. The formulas include small-angle and asymptotic approximations and a layer-addition method. These characteristics are calculated for wavelengths used for low-intensity laser therapy. We examined several pathologies such as vitiligo, edema, erythematosus lupus, and subcutaneous wound, for which the bulk concentrations of melanin and blood vessels or tissue structure (for subcutaneous wound) change compared with normal skin. The penetration depth spectrum is very similar to the inverted blood absorption spectrum. In other words, the depth is minimal at blood absorption maxima. The calculated absorption spectra enable the power and irradiation wavelength providing the required light effect to be selected. Relationships between the penetration depth and the diffuse reflectance coefficient of skin (unambiguously expressed through the absorption coefficient) are analyzed at different wavelengths. This makes it possible to find relationships between the light fields inside and outside the tissue.

  19. Protoporphyrin IX formation and photobleaching in different layers of normal human skin

    DEFF Research Database (Denmark)

    Togsverd-Bo, Katrine; Idorn, Luise W; Philipsen, Peter A

    2012-01-01

    human skin was tape-stripped and incubated with 20% methylaminolevulinate (MAL) or 20% hexylaminolevulinate (HAL) for 3 h. Fluorescence microscopy quantified PpIX accumulation in epidermis, superficial, mid and deep dermis, down to 2 mm. PpIX photobleaching by light-emitting diode (LED, 632 nm, 18......Topical photodynamic therapy (PDT) is used for various skin disorders, and selective targeting of specific skin structures is desirable. The objective was to assess accumulation of PpIX fluorescence and photobleaching within skin layers using different photosensitizers and light sources. Normal...... and 37 J/cm(2)), intense pulsed light (IPL, 500-650 nm, 36 and 72 J/cm(2)) and long-pulsed dye laser (LPDL, 595 nm, 7.5 and 15 J/cm(2)) was measured using fluorescence photography and microscopy. We found higher PpIX fluorescence intensities in epidermis and superficial dermis in HAL-incubated skin than...

  20. Experiment K-7-29: Connective Tissue Studies. Part 1; Rat Skin, Normal and Repair

    Science.gov (United States)

    Vailas, A. C.; Grindeland, R.; Ashman, R.; Choy, V.; Durnova, G.; Graf, B.; Griffith, P.; Kaplansky, A. S.; Kolis, S.; Martinez, D.; Rao, J. S.; Rayford, A. R.; Reddy, B. R.; Sears, J.; Thielke, R.; Ulm, M.; Vanderby, R.

    1994-01-01

    The skin repair studies started to be problematic for the following reasons: (1) It was very difficult to locate the wound and many lesions were not of the same dimensions. A considerable amount of time was devoted to the identification of the wound using polarized light. We understand that this experiment was added on to the overall project. Marking of the wound site and standard dimensions should be recommended for the next flight experiment. (2) The tissue was frozen, therefore thawing and fixation caused problems with some of the immunocytochemical staining for obtaining better special resolution with light microscopy image processing. Despite these problems, we were unable to detect any significant qualitative differences for the following wound markers: (1) Collagen Type 3, (2) Hematotoxylin and Eosin, and (3) Macrophage Factor 13. All protein markers were isolated from rat sources and antibodies prepared and tested for cross reactivity with other molecules at the University of Wisconsin Hybridoma Facility. However, rat skin from the non lesioned site 'normal' showed interesting biochemical results. Skin was prepared for the following measurements: (1) DNA content, (2) Collagen content by hydroxyproline, and (3) uronic acid content and estimation of ground substance. The results indicated there was a non-significant increase (10%) in the DNA concentration of skin from flight animals. However, the data expressed as a ratio DNA/Collagen estimates the cell or nuclear density that supports a given quantity of collagen showed a dramatic increase in the flight group (33%). This means flight conditions may have slowed down collagen secretion and/or increased cell proliferation in adult rat skin. Further biochemical tests are being done to determine the crosslinking of elastin which will enhance the insight to assessing changes in skin turnover.

  1. Experiment K-7-29: Connective Tissue Studies. Part 1; Rat Skin, Normal and Repair

    Science.gov (United States)

    Vailas, A. C.; Grindeland, R.; Ashman, R.; Choy, V.; Durnova, G.; Graf, B.; Griffith, P.; Kaplansky, A. S.; Kolis, S.; Martinez, D.; hide

    1994-01-01

    The skin repair studies started to be problematic for the following reasons: (1) It was very difficult to locate the wound and many lesions were not of the same dimensions. A considerable amount of time was devoted to the identification of the wound using polarized light. We understand that this experiment was added on to the overall project. Marking of the wound site and standard dimensions should be recommended for the next flight experiment. (2) The tissue was frozen, therefore thawing and fixation caused problems with some of the immunocytochemical staining for obtaining better special resolution with light microscopy image processing. Despite these problems, we were unable to detect any significant qualitative differences for the following wound markers: (1) Collagen Type 3, (2) Hematotoxylin and Eosin, and (3) Macrophage Factor 13. All protein markers were isolated from rat sources and antibodies prepared and tested for cross reactivity with other molecules at the University of Wisconsin Hybridoma Facility. However, rat skin from the non lesioned site 'normal' showed interesting biochemical results. Skin was prepared for the following measurements: (1) DNA content, (2) Collagen content by hydroxyproline, and (3) uronic acid content and estimation of ground substance. The results indicated there was a non-significant increase (10%) in the DNA concentration of skin from flight animals. However, the data expressed as a ratio DNA/Collagen estimates the cell or nuclear density that supports a given quantity of collagen showed a dramatic increase in the flight group (33%). This means flight conditions may have slowed down collagen secretion and/or increased cell proliferation in adult rat skin. Further biochemical tests are being done to determine the crosslinking of elastin which will enhance the insight to assessing changes in skin turnover.

  2. T-Cadherin Expression in the Epidermis and Adnexal Structures of Normal Skin

    Science.gov (United States)

    Buechner, Stanislaw; Erne, Paul; Resink, Therese J.

    2016-01-01

    Background T-cadherin is an atypical glycosylphosphatidylinositol-anchored member of the cadherin superfamily of adhesion molecules. The role of T-cadherin in biology of the skin is poorly understood. Expression of T-cadherin in basal keratinocytes and dermal blood vessels of the healthy epidermis has been demonstrated, but studies on expression in skin appendages are rare. Methods We conducted an immunohistochemical analysis of T-cadherin expression in the epidermis and adnexal structures of normal skin. Results T-cadherin expression is restricted to basal keratinocytes of the epidermis. The basal cell layer of sebaceous glands was T-cadherin positive, whereas sebocytes were negative. Within apocrine glands, only myoepithelial cells were T-cadherin positive. In contrast, both the secretory coils and excretory ducts of eccrine glands were T-cadherin positive. In terminal hair follicles, the outer root sheath layers strongly expressed T-cadherin throughout different regions of the follicle, with the strongest immunoreactivity at the bulge and suprabulbar regions. T-cadherin and CK15 stem cell marker similarly localized within the bulge and suprabulbar region. T-cadherin and CD34 stem cell marker similarly localized at the suprabulbar level. Conclusion The specific patterns of T-cadherin expression in the epidermis and adnexal structures suggest an important guardian role in skin homeostasis. PMID:27904857

  3. Connective tissue growth factor promoter activity in normal and wounded skin

    Directory of Open Access Journals (Sweden)

    Kapoor Mohit

    2008-10-01

    Full Text Available Abstract In skin, connective tissue growth factor (CTGF/CCN2 is induced during tissue repair. However, what the exact cell types are that express CTGF in normal and wounded skin remain controversial. In this report, we use transgenic knock-in mice in which the Pacific jellyfish Aequorea victoria enhanced green fluorescent protein (E-GFP gene has been inserted between the endogenous CTGF promoter and gene. Unwounded (day 0 and wounded (days 3 and 7 skin was examined for GFP to detect cells in which the CTGF promoter was active, α-smooth muscle actin (α-SMA to detect myofibroblasts, and NG2 expression to detect pericytes. In unwounded mice, CTGF expression was absent in epidermis and was present in a few cells in the dermis. Upon wounding, CTGF expression was induced in the dermis. Double immunolabeling revealed that CTGF-expressing cells also expressed α-SMA, indicating the CTGF was expressed in myofibroblasts. A subset (~30% of myofibroblasts were also NG2 positive, indicating that pericytes significantly contributed to the number of myofibroblasts in the wound. Pericytes also expressed CTGF. Collectively, these results indicate that CTGF expression in skin correlates with myofibroblast induction, and that CTGF-expressing pericytes are significant contributors to myofibroblast activity during cutaneous tissue repair.

  4. CD133 Expression in Normal Skin and in Epithelial Cutaneous Tumors

    Directory of Open Access Journals (Sweden)

    S. H. Nam-Cha

    2013-01-01

    Full Text Available Background. Expression of human CD133 (human prominin-1 in cancer cells has been postulated to be a marker of stemness and is considered as a putative marker of cancer stem cells (CSCs. We designed a study to describe the expression pattern of CD133 in normal skin and in epithelial cutaneous neoplasms. Methods. The CD133 immunohistochemical expression of forty-three eccrine and apocrine tumors was compared to that observed in other epithelial tumors of the skin. In addition, flow cytometry was used to detect the CD133 expression of four epithelial skin neoplasms, including one porocarcinoma. Results. CD133 immunoreactivity at the apical or at the apicolateral surface of cells forming glandular structures was observed. Cells from solid areas of benign or malignant tumors were not stained. The porocarcinoma derived culture cells showed a 22% of CD133 positive cells using flow cytometry, while squamous cell carcinoma cultures contained less than 0.1%. Conclusions. These observations indicate that CD133 is a specific marker of glandular differentiation that could be included in the diagnostic panel of cutaneous tumors with possible eccrine or apocrine differentiation. However, the use of CD133 expression as a marker of CSCs should be interpreted with caution in experiments of skin.

  5. PAX3 expression in normal skin melanocytes and melanocytic lesions (naevi and melanomas.

    Directory of Open Access Journals (Sweden)

    Sandra Medic

    Full Text Available BACKGROUND: Cutaneous Malignant Melanoma is an aggressive form of skin cancer, arising in cutaneous melanocytes. The transcription factor PAX3 regulates melanocyte specification from neural crest cells during development but expression in differentiated melanocytes is uncertain. By contrast it is frequently found in melanomas and naevi and is a marker for melanoma staging and detection. In this study we analysed the expression of PAX3 across the spectrum of melanocytic cells, from normal melanocytes to cells of benign and malignant lesions to better assess its function in these various tissues. Pax3 and PAX3 (italicized refer to the mouse and human gene, respectively; whereas Pax3 and PAX3 (non-italicized refer to the corresponding mouse and human protein. METHODOLOGY AND PRINCIPAL FINDINGS: PAX3 expression was analysed by immunohistochemistry and qRT-PCR. Immunofluorescence was used for co-expression with differentiation, migration and survival markers. As expected PAX3 expression was observed in naevi and melanoma cells. It was also found in melanocytes of normal skin where it co-expressed with melanocyte markers, MITF and MLANA. Co-expression with its downstream target, antiapoptotic factor BCL2L1 confirms PAX3 as a cell survival regulator. PAX3 was also co-expressed with melanoma cell migration marker MCAM in dermal naevi and melanoma cell nests, but this downstream target of PAX3 was not present in normal epidermal melanocytes, suggesting differential roles for PAX3 in normal epidermal melanocytes and melanoma cells. Most interestingly, a proportion of PAX3-positive epidermal melanocytes in normal skin show HES1 and Ki67 co-expression, indicating their less differentiated proliferative phenotype. CONCLUSIONS AND SIGNIFICANCE: Our results suggest that a previously identified role for PAX3, that of regulator of an undifferentiated plastic state, may operate in melanocytes of normal skin. This role, possibly required for cellular response to

  6. Are newly discovered drivers of immune-mediated skin disorders expressed in normal skin regenerating from standardized surface injury?

    NARCIS (Netherlands)

    Hendriks, A.G.M.; Keijsers, R.R.M.C.; Seyger, M.M.B.; Erp, P.E.J. van; Kerkhof, P.C.M. van de

    2014-01-01

    Background: In healthy skin, tape stripping induces a transient wave of histological changes resembling immune-mediated skin diseases, such as psoriasis. The response to surface trauma may harbor mechanisms which are also relevant to the development of Koebner-positive skin disorders. However, studi

  7. Canine epidermal lipid sampling by skin scrub revealed variations between different body sites and normal and atopic dogs.

    Science.gov (United States)

    Angelbeck-Schulze, Mandy; Mischke, Reinhard; Rohn, Karl; Hewicker-Trautwein, Marion; Naim, Hassan Y; Bäumer, Wolfgang

    2014-07-10

    Previously, we evaluated a minimally invasive epidermal lipid sampling method called skin scrub, which achieved reproducible and comparable results to skin scraping. The present study aimed at investigating regional variations in canine epidermal lipid composition using the skin scrub technique and its suitability for collecting skin lipids in dogs suffering from certain skin diseases. Eight different body sites (5 highly and 3 lowly predisposed for atopic lesions) were sampled by skin scrub in 8 control dogs with normal skin. Additionally, lesional and non-lesional skin was sampled from 12 atopic dogs and 4 dogs with other skin diseases by skin scrub. Lipid fractions were separated by high performance thin layer chromatography and analysed densitometrically. No significant differences in total lipid content were found among the body sites tested in the control dogs. However, the pinna, lip and caudal back contained significantly lower concentrations of ceramides, whereas the palmar metacarpus and the axillary region contained significantly higher amounts of ceramides and cholesterol than most other body sites. The amount of total lipids and ceramides including all ceramide classes were significantly lower in both lesional and non-lesional skin of atopic dogs compared to normal skin, with the reduction being more pronounced in lesional skin. The sampling by skin scrub was relatively painless and caused only slight erythema at the sampled areas but no oedema. Histological examinations of skin biopsies at 2 skin scrubbed areas revealed a potential lipid extraction from the transition zone between stratum corneum and granulosum. The present study revealed regional variations in the epidermal lipid and ceramide composition in dogs without skin abnormalities but no connection between lipid composition and predilection sites for canine atopic dermatitis lesions. The skin scrub technique proved to be a practicable sampling method for canine epidermal lipids, revealed

  8. Skin-pass rolling II - Studies of roughness transfer under combined normal and tangential loading

    DEFF Research Database (Denmark)

    Kijima, Hideo; Bay, Niels

    2008-01-01

    The influence of tool roughness on roughness transfer in skin-pass or temper rolling of steel strip is investigated, focusing on loading under combined normal and tangential displacement of tool relative to the workpiece. The calculated roughness transfer by an elasto-plastic finite element (FE...... measurements in this paper. The experiment shows a significant influence on roughness transfer of tangential displacement of workpiece in the sticking and the sliding region. The FE calculations modelling the sticking and sliding region reveal the mechanisms of plastic deformation and roughness transfer....

  9. Elemental concentration in normal skin and fibroepithelial polip lesions by synchrotron radiation total reflection X-ray fluorescence technique

    Energy Technology Data Exchange (ETDEWEB)

    Soares, Julio C.A.C.R.; Canellas, Catarine G.L.; Lopes, Ricardo T., E-mail: ricardo@lin.ufrj.br, E-mail: jcorsini@lin.ufrj.br [Nuclear Laboratory Instrumentation/COPPE, Federal University of Rio de Janeiro (UFRJ), Rio de Janeiro, RJ (Brazil); Anjos, Marcelino J., E-mail: marcelin@lin.ufrj.br [Physics Institute, State University of Rio de Janeiro (UERJ), Rio de Janeiro, RJ (Brazil)

    2011-07-01

    In this work, the concentrations of trace elements were measured in acrochordon, a skin lesion also known as skin tag or fibroepithelial polyp, as well as in normal skin from the same patient. The samples were analysed by Synchrotron Radiation Total Reflection X- ray Fluorescence (SRTXRF) in the Synchrotron Light National Laboratory (LNLS) in Campinas/Sao Paulo-Brazil. The collection of lesion and healthy skin samples, including papillary dermis and epidermis, has involved 17 patients. It was evaluated the presence of P, S, Cl, K, Ca, Cr, Mn, Fe, Cu, Zn, Br and Rb in the paired samples, which were compared, and significant differences were found in some of them. (author)

  10. Accumulation of C-reactive protein in basal keratinocytes of normal skins.

    Science.gov (United States)

    Ono, Koji; Fujimoto, Norihiro; Akiyama, Minoru; Satoh, Takahiro; Tajima, Shingo

    2016-07-01

    C-reactive protein (CRP) is a prototypic acute phase protein which increases dramatically in the blood during the first 48h of tissue inflammation and has been recognized as a risk factor for atherosclerosis. CRP interacts with a variety of proteins. To know the role of accumulated CRP in the skin. Interaction of CRP with basal keratinocytes was studied using immunohistochemical method and keratinocyte culture system. We found an immunohistochemical deposition of CRP on the basal keratinocyte membrane in some normal human skins (23 out of 46 skins). When added to cultured keratinocytes, heat-denatured but not native CRP was found to adhere to keratinocyte cell membrane after 1h, then internalized into cytoplasm after 24h. The heat-denatured CRP recognized at least four keratinocyte polypeptides with the molecular weights of 56, 42, 32 and 24kDa. Ligand binding assays suggested that multiple populations of receptor-ligand interactions were involved in the binding between CRP and keratinocyte. Cultured dermal microvascular endothelial cells were found to express CRP of which expression was greatly induced by interleukin-1β (IL-1β) treatment, suggesting that the deposited CRP in the basal keratinocytes can be derived from local dermal microvasculatures as well as from systemic circulation (serum). Treatment of cultured keratinocytes with heat-denatured CRP induced interleukin-8 (IL-8) expression, a potent leukocyte chemotactic cytokine. CRP in the medium (liquid phase) and CRP-coated dishes (solid phase) both inhibited the adhesion of keratinocytes in culture. Accumulation of CRP may regulate the skin inflammation and keratinocyte proliferation by modulating keratinocyte cytokine expression and adhesion to substrate. Copyright © 2016 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  11. Dynamic infrared imaging of cutaneous melanoma and normal skin in patients treated with BNCT

    Energy Technology Data Exchange (ETDEWEB)

    Santa Cruz, G.A. [Dpto. de Instrumentacion y Control, Comision Nacional de Energia Atomica, Av. del Libertador 8250 (1429), Buenos Aires (Argentina)], E-mail: santacr@cnea.gov.ar; Bertotti, J.; Marin, J. [Universidad Favaloro, Solis 453 (1078), Buenos Aires (Argentina); Gonzalez, S.J. [Dpto. de Instrumentacion y Control, Comision Nacional de Energia Atomica, Av. del Libertador 8250 (1429), Buenos Aires (Argentina); CONICET, Avda. Rivadavia 1917 (1033), Buenos Aires (Argentina); Gossio, S. [FCEyN, Pabellon II, Ciudad Universitaria (1428), Buenos Aires (Argentina); Alvarez, D. [Fundacion Favaloro, Av. Belgrano 1746 (1093), Buenos Aires (Argentina); Roth, B.M.C.; Menendez, P. [Instituto de Oncologia Angel H. Roffo, Av. San Martin 5481 (1417), Buenos Aires (Argentina); Pereira, M.D. [Agencia Nacional de Promocion Cientifica y Tecnologica, PAV 22393 (Argentina); Albero, M.; Cubau, L.; Orellano, P. [INVAP S.E., F.P. Moreno 1089 (R8400AMU), S.C. de Bariloche, Rio Negro (Argentina); Liberman, S.J. [Dpto. de Instrumentacion y Control, Comision Nacional de Energia Atomica, Av. del Libertador 8250 (1429), Buenos Aires (Argentina)

    2009-07-15

    We recently initiated a program aimed to investigate the suitability of dynamic infrared imaging for following-up nodular melanoma patients treated with BNCT. The reason that makes infrared imaging attractive is the fact that it constitutes a functional and non-invasive imaging method, providing information on the normal and abnormal physiologic response of the nervous and vascular systems, as well as the local metabolic rate and inflammatory processes that ultimately appear as differences in the skin temperature. An infrared camera, with a focal plane array of 320x240 uncooled ferroelectric detectors is employed, which provides a video stream of the infrared emission in the 7-14 {mu}m wavelength band. A double blackbody is used as reference for absolute temperature calibration. After following a protocol for patient preparation and acclimatization, a basal study is performed. Subsequently, the anatomic region of interest is subjected to a provocation test (a cold stimulus), which induces an autonomic vasoconstriction reflex in normal structures, thus enhancing the thermal contrast due to the differences in the vasculature of the different skin regions. Radiation erythema reactions and melanoma nodules possess typically a faster temperature recovery than healthy, non-irradiated skin. However, some other non-pathological structures are also detectable by infrared imaging, (e.g. scars, vessels, arteriovenous anastomoses and injuries), thus requiring a multi-study comparison in order to discriminate the tumor signal. Besides the superficial nodules, which are readily noticeable by infrared imaging, we have detected thermal signals that are coincident with the location of non-palpable nodules, which are observable by CT and ultrasound. Diffuse regions of fast temperature recovery after a cold stimulus were observed between the third and sixth weeks post-BNCT, concurrent with the clinical manifestation of radiation erythema. The location of the erythematous visible and

  12. Single skinned muscle fibers in Duchenne muscular dystrophy generate normal force.

    Science.gov (United States)

    Horowits, R; Dalakas, M C; Podolsky, R J

    1990-06-01

    We measured the intrinsic mechanical properties and protein content of single skinned muscle fibers obtained from patients who had Duchenne muscular dystrophy. To check for possible nonspecific changes caused by muscle disease per se, we also studied the properties of muscle fibers obtained from patients exhibiting severe muscle weakness due to polymyositis. Relative to control fibers obtained from 4 patients with normal or nonmyopathic muscle, we found no significant changes in the ability of muscle fibers from the patients with Duchenne muscular dystrophy or polymyositis to generate active tension in response to calcium or resting tension in response to stretch. In addition, we found no significant changes in the concentrations of the major contractile proteins myosin and actin, of the elastic protein titin, or of the structural proteins nebulin and alpha-actinin. In contrast, immunocytochemical studies showed that dystrophin was absent in the biopsy specimens from the patients with Duchenne muscular dystrophy, but localized at the cell membrane in all of the other muscle biopsy specimens used in this study. These results indicate that myofibrils assemble and function normally in Duchenne muscular dystrophy. Therefore, the absence of dystrophin, which is the primary biochemical defect in this disease, leads to clinical weakness by causing the breakdown of muscle fibers that were once capable of generating normal force, while the surviving fibers exhibit normal contractility.

  13. Dramatic Increase in Oxidative Stress in Carbon-Irradiated Normal Human Skin Fibroblasts

    Science.gov (United States)

    Laurent, Carine; Leduc, Alexandre; Pottier, Ivannah; Prévost, Virginie; Sichel, François; Lefaix, Jean-Louis

    2013-01-01

    Skin complications were recently reported after carbon-ion (C-ion) radiation therapy. Oxidative stress is considered an important pathway in the appearance of late skin reactions. We evaluated oxidative stress in normal human skin fibroblasts after carbon-ion vs. X-ray irradiation. Survival curves and radiobiological parameters were calculated. DNA damage was quantified, as were lipid peroxidation (LPO), protein carbonylation and antioxidant enzyme activities. Reduced and oxidized glutathione ratios (GSH/GSSG) were determined. Proinflammatory cytokine secretion in culture supernatants was evaluated. The relative biological effectiveness (RBE) of C-ions vs. X-rays was 4.8 at D0 (irradiation dose corresponding to a surviving fraction of 37%). Surviving fraction at 2 Gy (SF2) was 71.8% and 7.6% for X-rays and C-ions, respectively. Compared with X-rays, immediate DNA damage was increased less after C-ions, but a late increase was observed at D10% (irradiation dose corresponding to a surviving fraction of 10%). LPO products and protein carbonyls were only increased 24 hours after C-ions. After X-rays, superoxide dismutase (SOD) activity was strongly increased immediately and on day 14 at D0% (irradiation dose corresponding to a surviving fraction of around 0%), catalase activity was unchanged and glutathione peroxidase (GPx) activity was increased only on day 14. These activities were decreased after C-ions compared with X-rays. GSH/GSSG was unchanged after X-rays but was decreased immediately after C-ion irradiation before an increase from day 7. Secretion of IL-6 was increased at late times after X-ray irradiation. After C-ion irradiation, IL-6 concentration was increased on day 7 but was lower compared with X-rays at later times. C-ion effects on normal human skin fibroblasts seemed to be harmful in comparison with X-rays as they produce late DNA damage, LPO products and protein carbonyls, and as they decrease antioxidant defences. Mechanisms leading to this

  14. Content of Androgen Receptor in Cultured Genital Skin Fibroblast From Different Ages of Chinese Normal Men

    Institute of Scientific and Technical Information of China (English)

    卢建; 何立敏; 张金山; 杨震; 周云

    1995-01-01

    A ratpid, simple, reliable method is described for assaying androgen receptor (AR) in dispersed, whole, cultured human genital skin fibroblasts (GSF) with a synthetic androgen, 3H-methyltrienolone (3H-R1881). Receptors for androgen in GSF exhiblt high affinity (Kd=3.0±0.1 nmol/L), low binding capacity and androgen specificity. The content of AR in cultured GSF from 40 normal men varying in age from 1.5—60 years u:as also investigated by this assay. Scatchard analysis and slngle plot revealed the presence of 4.500-8500 binding sites per cell, mean number of AR in GSF of these men is 6288±1082 binding sites/cell. No significant difference was observed in the content of AR in different age groups. This result showed that the content of AR in these ceils did not change with age.

  15. Site-Specific Differentiation of Fibroblasts in Normal and Scleroderma Skin

    Science.gov (United States)

    2009-06-01

    noncoding RNA expression in scleroderma ● Construction of skin tissue microarrays ● Use of skin diversity TMA to interrogate site-specific gene...disrupted during disease. Tissue microarray: genomics and proteo- mics in the context of skin architecture Gene and tiling microarrays are useful for

  16. Mast cells and atopic dermatitis. Stereological quantification of mast cells in atopic dermatitis and normal human skin

    DEFF Research Database (Denmark)

    Damsgaard, T E; Olesen, A B; Sørensen, Flemming Brandt

    1997-01-01

    Stereological quantification of mast cell numbers was applied to sections of punch biopsies from lesional and nonlesional skin of atopic dermatitis patients and skin of healthy volunteers. We also investigated whether the method of staining and/or the fixative influenced the results of the determ...... the clinical score and the number of mast cell profiles per millimetre squared. Using stereological techniques, this study indicated that mast cells might participate in the inflammatory process in skin leading to atopic dermatitis.......Stereological quantification of mast cell numbers was applied to sections of punch biopsies from lesional and nonlesional skin of atopic dermatitis patients and skin of healthy volunteers. We also investigated whether the method of staining and/or the fixative influenced the results...... of the determination of the mast cell profile numbers. The punch biopsies were taken from the same four locations in both atopic dermatitis patients and normal individuals. The locations were the scalp, neck and flexure of the elbow (lesional skin), and nates (nonlesional skin). Clinical scoring was carried out...

  17. Distribution and ultrastructure of pigment cells in the skins of normal and albino adult turbot, Scophthalmus Maximus

    Institute of Scientific and Technical Information of China (English)

    GUO Huarong; HUANG Bing; QI Fei; ZHANG Shicui

    2007-01-01

    The distribution and ultrastructure of pigment cells in skins of normal and albino adult turbots were examined with transmission electron microscopy (TEM). Three types of pigment cells of melanophore, iridophore and xanthophore have been recognized in adult turbot skins. The skin color depends mainly on the amount and distribution of melanophore and iridophore, as xanthophore is quite rare. No pigment cells can be found in the epidermis of the skins. In the pigmented ocular skin of the turbot, melanophore and iridophore are usually co-localized in the dermis. This is quite different from the distribution in larvae skin. In albino and white blind skins of adult turbots, however, only iridophore monolayer still exists, while the melanophore monolayer disappears. This cytological evidence explains why the albino adult turbot, unlike its larvae, could never resume its body color no matter what environmental and nutritional conditions were provided. Endocytosis is quite active in the cellular membrane of the iridophore. This might be related to the formation of reflective platelet and stability of the iridophore.

  18. Gene expression profiles normalized in psoriatic skin by treatment with brodalumab, a human anti-IL-17 receptor monoclonal antibody.

    Science.gov (United States)

    Russell, Chris B; Rand, Hugh; Bigler, Jeannette; Kerkof, Keith; Timour, Martin; Bautista, Edgar; Krueger, James G; Salinger, David H; Welcher, Andrew A; Martin, David A

    2014-04-15

    The IL-17 pathway is an established driver of psoriasis pathogenesis. We examined the detailed molecular and cellular effects of blockade of IL-17 signaling in human psoriatic skin before and following treatment with brodalumab, a competitive inhibitor of the IL-17 Receptor A subunit. Thousands of aberrantly expressed genes in lesional skin normalized within 2 weeks following brodalumab treatment, with conversion of the lesional psoriasis transcriptome to resemble that seen in nonlesional skin. Keratinocyte-expressed genes appeared to normalize rapidly, whereas T cell-specific normalization occurred over six weeks. The three IL-17 ligand genes that are upregulated in lesional skin, IL17A, IL17C, and IL17F, were all downregulated in a dose-dependent manner following brodalumab treatment. Cellular measures also showed a similar pattern with dramatic decreases in keratinocyte hyperplasia within one week, and decreases in infiltrating leukocytes occurred over a longer timescale. Individuals with the highest brodalumab exposure showed normalization of both IL-17-responsive genes and the psoriasis transcriptome, whereas subjects with lower exposures showed transient or incomplete molecular responses. Clinical and molecular response appeared dependent on the extent of brodalumab exposure relative to the expression of IL-17 ligand genes, and reduction of IL-17 signaling into the nonlesional range was strongly correlated with normalization of the psoriasis transcriptome. These data indicate that blockade of IL-17 signaling in psoriatic skin leads to rapid transcriptomal changes initially in keratinocyte-expressed genes, followed by normalization in the leukocyte abnormalities, and demonstrates the essential role of the IL-17R on keratinocytes in driving disease pathogenesis.

  19. Photobiomodulation on the proliferation and collagen synthesis of normal human skin fibroblast cells

    Science.gov (United States)

    Cheng, Lei; Liu, Timon Cheng-Yi; Chi, Jin-Quan; Li, Yan; Jin, Hua

    2006-01-01

    Background and Objective: Cultured normal human skin fibroblast cells (HSFs) were once used to study the mechanism of the effects of low intensity He-Ne laser irradiation (LHNL) on wound healing. The proliferation and collagen synthesis of HFSs were modulated by LHNL in different papers, respectively, and both of them are studied in this paper. Study Design/Materials and Methods: The dosage was studied for the same radiation time 300s. The proliferation and collagen synthesis were measured by 3-[4,5-Dimethylthiazol-2-yl]-2, 5-diphenyltetrazolium bromide (MTT) assay and the spectrophotometric method for the determination of hydroxyproline, respectively. Results: The dose zones were called dose 1, dose 2 and dose 3 from low dose on so that HSF proliferation was inhibited in dose 1 (16, 24 mJ/cm2), and promoted in dose 2 (298, 503, 597mJ/cm2), and the collagen synthesis was inhibited in dose 2 (401, 526 mJ/cm2), and promoted in dose 3 (714, 926, 1539, 1727mJ/cm2), which supports our biological model of photobiomodulation. It was found there is the linear relationship of the effect with dose with dose in each dose zone. Conclusions: The photobiomodulation on the proliferation and collagen synthesis of HSFs might be linearly dose-dependent in limited dosage with radiation time kept constant, which provides a foundation to discuss photobiomodulation on wound healing.

  20. Comparative proteomic analysis of extracellular matrix proteins secreted by hypertrophic scar with normal skin fibroblasts

    Directory of Open Access Journals (Sweden)

    Li Ma

    2014-04-01

    Full Text Available The formation of hypertrophic scars (HSs is a fibroproliferative disorder of abnormal wound healing. HSs usually characterize excessive proliferation of fibroblasts, abnormal deposition of extracellular matrix (ECM during wound healing, associated with cosmetic, functional, and psychological problems. Owing to the role of ECM proteins in scar formation, we comparatively analyzed matrix proteins secreted by normal skin fibroblasts (NSFs and HS fibroblasts (HSFs. The acetone-extracted secreted proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE, and identified by mass spectrometry (MS. Based on Go annotation of MS data, the profiling of ECM proteins was established and scar-related proteins have been screened out. The functions of several ECM proteins identified by MS have been discussed, such as collagens I, VI, XII, fibronectin, decorin, lumican, and protein procollagen C endopeptidase enhancer 1 (PCPE-1. Among them, the MS result of PCPE-1 was supported by Western blotting that PCPE-1 from HSFs were significantly upregulated than that from NSFs. It is suggested that PCPE-1 could be a potential target for scar treatment. The exploration of scar related proteins may provide new perspectives on understanding the mechanism of scar formation and open a new way to scar treatment and prevention.

  1. Differences in collagen architecture between keloid, hypertrophic scar, normotrophic scar, and normal skin: An objective histopathological analysis.

    Science.gov (United States)

    Verhaegen, Pauline D H M; van Zuijlen, Paul P M; Pennings, Noor M; van Marle, Jan; Niessen, Frank B; van der Horst, Chantal M A M; Middelkoop, Esther

    2009-01-01

    Normotrophic, hypertrophic, and keloidal scars are different types of scar formation, which all need a different approach in treatment. Therefore, it is important to differentiate between these types of scar, not only clinically but also histopathologically. Differences were explored for collagen orientation and bundle thickness in 25 normal skin, 57 normotrophic scar, 56 hypertrophic scar, and 56 keloid biopsies, which were selected on clinical diagnosis. Image analysis was performed by fast fourier transformation. The calculated collagen orientation index ranged from 0 (random orientation) to 1 (parallel orientation). The bundle distance was calculated by the average distance between the centers of the collagen bundles. The results showed that compared with all three types of scars, the collagen orientation index was significantly lower in normal skin, which indicates that scars are organized in a more parallel manner. No differences were found between the different scars. Secondly, compared with normal skin, normotrophic scar, and hypertrophic scar, the bundle distance was significantly larger in keloidal scar, which suggests that thicker collagen bundles are present in keloidal scar. This first extensive histological study showed objective differences between normal skin, normotrophic, hypertrophic, and keloidal scar.

  2. Analysis of differences of gene expressions in keloid and normal skin with the aid of cDNA microarray

    Institute of Scientific and Technical Information of China (English)

    Chen Wei; Fu Xiaobing; Sun Xiaoqing; Sun Tongzhu; Zhao Zhili; Yang Yinhui; Sheng Zhiyong

    2003-01-01

    Background: Microarray analysis is a popular tool to investigate the function of genes that are responsible for the phenotype of the disease. Keloid is a intricate lesion which is probably modulated by interplay of many genes. We ventured to study the differences of gene expressions between keloids and normal skins with the aid of cDNA microarray in order to explore the molecular mechanism underlying keloid formation. Methods: The PCR products of 8400 human genes were spotted on a chip in array. The DNAs were then fixed on the glass plate by a series of treatments. Total RNAs was isolated from freshly excised human keloids and normal skin, and then was purified to mRNA by Oligotex. Both the mRNA from keloids and normal skin was reversely transcribed to cDNAs with the incorporations of fluorescent dUTP, for preparing the hybridization probes. The mixed probes were then hybridized to the cDNA microarray. After highly stringent washing, the cDNA microarray was scanned for the fluorescent signals to display the differences between two kinds of tissues. Results: Among 8400 human genes, there were 402 genes (4.79%) with different expression levels between the keloids and normal skins in all cases, 250were up-regulated (2.98%) and 152 down-regulated (1.81%). Analyses of collagen, fibronectin, proteoglycan,growth factors and apoptosis related molecule gene expression confirmed that our molecular data obtained by cDNA microarray were consistent with published biochemical and clinical observations of keloids. Conclusions: DNA microarray technology is an effective technique in screening for differences in gene expression between keloid and normal skin. Many genes are involved in the formation of keloids. Further analysis of the obtained genes will help understand the molecular mechanism of keloid formation.

  3. Protoporphyrin IX formation and photobleaching in different layers of normal human skin: methyl- and hexylaminolevulinate and different light sources.

    Science.gov (United States)

    Togsverd-Bo, Katrine; Idorn, Luise W; Philipsen, Peter A; Wulf, Hans Christian; Hædersdal, Merete

    2012-10-01

    Topical photodynamic therapy (PDT) is used for various skin disorders, and selective targeting of specific skin structures is desirable. The objective was to assess accumulation of PpIX fluorescence and photobleaching within skin layers using different photosensitizers and light sources. Normal human skin was tape-stripped and incubated with 20% methylaminolevulinate (MAL) or 20% hexylaminolevulinate (HAL) for 3 h. Fluorescence microscopy quantified PpIX accumulation in epidermis, superficial, mid and deep dermis, down to 2 mm. PpIX photobleaching by light-emitting diode (LED, 632 nm, 18 and 37 J/cm(2)), intense pulsed light (IPL, 500-650 nm, 36 and 72 J/cm(2)) and long-pulsed dye laser (LPDL, 595 nm, 7.5 and 15 J/cm(2)) was measured using fluorescence photography and microscopy. We found higher PpIX fluorescence intensities in epidermis and superficial dermis in HAL-incubated skin than MAL-incubated skin (P dermis, fluorescence intensities were higher (37%) in HAL-treated skin than MAL-treated skin, although not significant (P = ns). At skin surface, photobleaching was significantly higher (90-98%) after LED illumination (18 and 37 J/cm²) than IPL (29-53%, 36 and 72 J/cm²) and LPDL (43-62%, 7 and 15 J/cm²) (P epidermis to deep dermis by LED illumination (37 J/cm², P = ns), but declined from epidermis to mid and deep dermis for IPL-treated skin and LPDL-treated skin (IPL 72 J/cm²: 26-15%; LPDL 15 J/cm²: 37-23%) (P < 0.04). Clinically, erythema correlated linearly with MAL and HAL-induced photobleaching (r² = 0.175, P < 0.001). In conclusion, selective PpIX accumulation indicates HAL as an alternative to MAL for epidermal-targeted PDT. In clinically relevant doses, PpIX photobleaching throughout the skin was more profound following LED than LPDL and IPL exposure.

  4. Normal Skin Microbiota is Altered in Pre-clinical Hidradenitis Suppurativa.

    Science.gov (United States)

    Ring, Hans Christian; Bay, Lene; Kallenbach, Klaus; Miller, Iben M; Prens, Errol; Saunte, Ditte M; Bjarnsholt, Thomas; Jemec, Gregor B E

    2017-02-08

    Hidradenitis suppurativa (HS) is a chronic inflammatory skin disease defined by recurrent nodules, tunnels (sinus tracts) and scarring involving the intertriginous regions. The clinical course of HS is compatible with a biofilm-driven disease, and biofilm has been described in lesional HS skin. We therefore hypothesized that clinically unaffected HS skin would also have an increased presence of biofilm compared with that of healthy controls. We conducted a case-control study, investigating the morphology of the axillary skin microbiota. Peptide nucleic acid - fluorescence in situ hybridization probes were used in combination with confocal laser scanning microscopy. Significant differences were found in both distribution and quantity of the cutaneous microbiota in clinically non-affected axillary skin of patients with HS compared with healthy controls. Surprisingly, we detected fewer bacteria and less biofilm in patients with HS. The reduced microbiota in patients with HS may play an important role in the early course of the disease.

  5. Spectral analysis of blood perfusion in the free latissimus dorsi myocutaneous flap and in normal skin

    Energy Technology Data Exchange (ETDEWEB)

    Liu Xudong [Department of Orthopaedic Surgery, Shanghai No. 6 People' s Hospital, Shanghai Jiao Tong University, 600 Yishan Road, Shanghai 200233 (China); Zeng Bingfang [Department of Orthopaedic Surgery, Shanghai No. 6 People' s Hospital, Shanghai Jiao Tong University, 600 Yishan Road, Shanghai 200233 (China); Fan Cunyi [Department of Orthopaedic Surgery, Shanghai No. 6 People' s Hospital, Shanghai Jiao Tong University, 600 Yishan Road, Shanghai 200233 (China); Jiang Peizhu [Department of Orthopaedic Surgery, Shanghai No. 6 People' s Hospital, Shanghai Jiao Tong University, 600 Yishan Road, Shanghai 200233 (China); Hu Xiao [Department of Biomedical Engineering, Shanghai Jiao Tong University, Shanghai 200030 (China)

    2006-01-07

    To find the properties in the oscillatory components of the cutaneous blood flow on the successful free flap, a wavelet transform was applied to the laser Doppler flowmetry (LDF) signals which were measured simultaneously on the surfaces of the free latissimus dorsi myocutaneous flap and on the adjacent intact skin of the healthy limb, of 18 patients. The frequency interval from 0.0095 to 1.6 Hz was examined and was divided into five subintervals (I: 0.0095-0.021 Hz; II: 0.021-0.052 Hz; III: 0.052-0.145 Hz; IV: 0.145-0.6 Hz and V: 0.6-1.6 Hz) corresponding to endothelial metabolic, neurogenic, myogenic, respiratory and cardiac origins. The average amplitude and total power in the frequency range 0.0095-1.6 Hz as well as within subintervals I, II, IV and V were significantly lower for signals measured on the free flap than those obtained in the healthy limb. However in interval III, they were significantly higher. The normalized spectral amplitude and power in the free flap were significantly lower in only two intervals, I and II, yet in interval III they were significantly higher; no statistical significance was observed in intervals IV and V. The distinctive finding made in this study, aside from the decrease of endothelial metabolic processes and sympathetic control, was the significant increase of myogenic activity in the free flap. It is hoped that this work will contribute towards knowledge on blood circulation in free flaps and make the monitoring by LDF more reliable.

  6. Cultured skin keratinocytes from both normal individuals and basal cell naevus syndrome patients are more resistant to. gamma. -rays and UV light compared with cultured skin fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Stacey, M.; Thacker, S.; Taylor, A.M.R. (Birmingham Univ. (UK). Cancer Research Campaign Labs.)

    1989-07-01

    Measurement of colony-forming ability following exposure to {gamma}-rays was performed on cultured skin keratinocytes and skin fibroblasts from normal individuals, basal cell naevus syndrome patients (BCNS) and ataxia telangiectasia (A-T) patients. The most striking observation was the radiation resistance of 8/8 keratinocyte strains compared with fibroblasts whether from BCNS patients or normals. The single A-T keratinocyte cell strain showed the same radiosensitivity as A-T fibroblast cell strains. The differential survival of keratinocytes and fibroblasts was also observed following exposure to 254 nm UV light. Survival curves of SV40 immortalized keratinocytes and retinoblasts derived from normal individuals or BCNS patients showed large shoulder regions following exposure to {gamma}-rays or 254 nm UV light. An increased D{sub 37} rather than an increased D{sub o} was therefore the feature of such curves, contrasting with SV40 immortalized A-T keratinocytes or fibroblasts which showed a minimal shoulder effect and an increased D{sub o}. No difference in survival was observed between BCNS and normal cells following exposure to either UV or {gamma}-rays. (author).

  7. Normal Skin Microbiota is Altered in Pre-clinical Hidradenitis Suppurativa

    DEFF Research Database (Denmark)

    Ring, Hans Christian; Bay, Lene; Kallenbach, Klaus

    2017-01-01

    therefore hypothesized that clinically unaffected HS skin would also have an increased presence of biofilm compared with that of healthy controls. We conducted a case-control study, investigating the morphology of the axillary skin microbiota. Peptide nucleic acid – fluorescence in situ hybridization probes...... were used in combination with confocal laser scanning microscopy. Significant differences were found in both distribution and quantity of the cutaneous microbiota in clinically non-affected axillary skin of patients with HS compared with healthy controls. Surprisingly, we detected fewer bacteria...... and less biofilm in patients with HS. The reduced microbiota in patients with HS may play an important role in the early course of the disease....

  8. The dosimetric impact of daily setup error on target volumes and surrounding normal tissue in the treatment of prostate cancer with intensity-modulated radiation therapy

    Energy Technology Data Exchange (ETDEWEB)

    Algan, Ozer, E-mail: oalgan@ouhsc.edu [Department of Radiation Oncology, Biostatistics and Epidemiology, University of Oklahoma Health Sciences Center, Oklahoma City, OK (United States); Jamgade, Ambarish; Ali, Imad; Christie, Alana; Thompson, J. Spencer; Thompson, David; Ahmad, Salahuddin; Herman, Terence [Department of Radiation Oncology, Biostatistics and Epidemiology, University of Oklahoma Health Sciences Center, Oklahoma City, OK (United States)

    2012-01-01

    parameter for the surrounding normal tissue except for the dose received by the penile bulb and the right hip. Our dosimetric evaluation suggests significant underdosing with inaccurate target localization and emphasizes the importance of accurate patient setup and target localization. Further studies are needed to evaluate the impact of intrafraction organ motion, rotation, and deformation on doses delivered to target volumes.

  9. The dosimetric impact of daily setup error on target volumes and surrounding normal tissue in the treatment of prostate cancer with intensity-modulated radiation therapy.

    Science.gov (United States)

    Algan, Ozer; Jamgade, Ambarish; Ali, Imad; Christie, Alana; Thompson, J Spencer; Thompson, David; Ahmad, Salahuddin; Herman, Terence

    2012-01-01

    The purpose of this study was to evaluate the impact of daily setup error and interfraction organ motion on the overall dosimetric radiation treatment plans. Twelve patients undergoing definitive intensity-modulated radiation therapy (IMRT) treatments for prostate cancer were evaluated in this institutional review board-approved study. Each patient had fiducial markers placed into the prostate gland before treatment planning computed tomography scan. IMRT plans were generated using the Eclipse treatment planning system. Each patient was treated to a dose of 8100 cGy given in 45 fractions. In this study, we retrospectively created a plan for each treatment day that had a shift available. To calculate the dose, the patient would have received under this plan, we mathematically "negated" the shift by moving the isocenter in the exact opposite direction of the shift. The individualized daily plans were combined to generate an overall plan sum. The dose distributions from these plans were compared with the treatment plans that were used to treat the patients. Three-hundred ninety daily shifts were negated and their corresponding plans evaluated. The mean isocenter shift based on the location of the fiducial markers was 3.3 ± 6.5 mm to the right, 1.6 ± 5.1 mm posteriorly, and 1.0 ± 5.0 mm along the caudal direction. The mean D95 doses for the prostate gland when setup error was corrected and uncorrected were 8228 and 7844 cGy (p 1200 cGy and for the PTV8100 could approach almost 2000 cGy when comparing corrected against uncorrected plans. There was no statistically significant difference in the D35 parameter for the surrounding normal tissue except for the dose received by the penile bulb and the right hip. Our dosimetric evaluation suggests significant underdosing with inaccurate target localization and emphasizes the importance of accurate patient setup and target localization. Further studies are needed to evaluate the impact of intrafraction organ motion, rotation

  10. Assessment of Optical Coherence Tomography Imaging in the Diagnosis of Non-Melanoma Skin Cancer and Benign Lesions Versus Normal Skin:

    DEFF Research Database (Denmark)

    Mogensen, Mette; Jørgensen, Thomas Martini; Nürnberg, Birgit Meincke;

    2009-01-01

    BACKGROUND Optical coherence tomography (OCT) is an optical imaging technique that may be useful in diagnosis of non-melanoma skin cancer (NMSC). OBJECTIVES To describe OCT features in NMSC such as actinic keratosis (AK) and basal cell carcinoma (BCC) and in benign lesions and to assess the diagn......BACKGROUND Optical coherence tomography (OCT) is an optical imaging technique that may be useful in diagnosis of non-melanoma skin cancer (NMSC). OBJECTIVES To describe OCT features in NMSC such as actinic keratosis (AK) and basal cell carcinoma (BCC) and in benign lesions and to assess...... the diagnostic accuracy of OCT in differentiating NMSC from benign lesions and normal skin. METHODS AND MATERIALS OCT and polarization-sensitive (PS) OCT from 104 patients were studied. Observer-blinded evaluation of OCT images from 64 BCCs, 1 baso-squamous carcinoma, 39 AKs, two malignant melanomas, nine benign......-defined layering in OCT and PS-OCT images and dark lobules in BCC. Discrimination of AK from BCC had an error rate of 50% to 52%. CONCLUSION OCT features in NMSC are identified, but AK and BCC cannot be differentiated. OCT diagnosis is less accurate than clinical diagnosis, but high accuracy in distinguishing...

  11. Cold urticaria patients exhibit normal skin levels of functional mast cells and histamine after tolerance induction

    DEFF Research Database (Denmark)

    Kring Tannert, Line; Stahl Skov, Per; Bjerremann Jensen, Louise

    2012-01-01

    Cold urticaria is a skin condition characterized by rapid appearance of itchy wheals and occasionally angioedema in response to cold stimulation. Antihistamines do not sufficiently protect all patients from symptoms, even when used in higher than standard doses. In these patients, desensitization...... to cold can be beneficial. The aim was to investigate whether desensitization can lower temperature thresholds and reduce release of histamine in the skin. Cold urticaria patients were subjected to desensitization and assessed for skin responses to cold stimulation and codeine before and after. Histamine...... levels mediated by cold and codeine were determined by cutaneous microdialysis before and after desensitization in patients and healthy controls. Desensitization to cold resulted in protection from cold-induced symptoms and lower temperature thresholds in six out of nine patients. Desensitization also...

  12. Studies on 133Xe wash-out from human skin: quantitative measurements of blood flow in normal and corticosteroid-treated skin.

    Science.gov (United States)

    Kristensen, J K; Wadskov, S

    1977-04-01

    Blood flow was measured by the 133Xe technique in normal and corticosteroid-treated skin. Epicutaneous and intracutaneous methods of tracer application were compared in normal skin. The two labeling methods were equally suitable for measuring cutaneous blood flow provided calculations in both cases were based on a biexponential resolution of the wash-out curve in its cutaneous and subcutaneous components and provided the traumatic hyperemia phase was considered, when intracutaneous application of the tracer was used. Results were invalidated if calculations were based on initial slope of the wash-out curves.Topical application of beta-methasone valerate in a reduction in cutaneous blood flow as measured by the intracutaneous technique with curve resolution, whereas no effect could be demonstrated when calculations were based on the initial slopes of the curves. The 133Xe technique is a simple and reliable method for measuring cutaneous blood flow, which might prove useful in estimations of penetration ability and potency of topical corticosteroids.

  13. Macro-environment of breast carcinoma: frequent genetic alterations in the normal appearing skins of patients with breast cancer.

    Science.gov (United States)

    Moinfar, Farid; Beham, Alfred; Friedrich, Gerhard; Deutsch, Alexander; Hrzenjak, Andelko; Luschin, Gero; Tavassoli, Fattaneh A

    2008-05-01

    Genetic abnormalities in microenvironmental tissues with subsequent alterations of reciprocal interactions between epithelial and mesenchymal cells play a key role in the breast carcinogenesis. Although a few reports have demonstrated abnormal fibroblastic functions in normal-appearing fibroblasts taken from the skins of breast cancer patients, the genetic basis of this phenomenon and its implication for carcinogenesis are unexplored. We analyzed 12 mastectomy specimens showing invasive ductal carcinomas. In each case, morphologically normal epidermis and dermis, carcinoma, normal stroma close to carcinoma, and stroma at a distant from carcinoma were microdissected. Metastatic-free lymphatic tissues from lymph nodes served as a control. Using PCR, DNA extracts were examined with 11 microsatellite markers known for a high frequency of allelic imbalances in breast cancer. Losses of heterozygosity and/or microsatellite instability were detected in 83% of the skin samples occurring either concurrently with or independently from the cancerous tissues. In 80% of these cases at least one microsatellite marker displayed loss of heterozygosity or microsatellite instability in the skin, which was absent in carcinoma. A total of 41% of samples showed alterations of certain loci observed exclusively in the carcinoma but not in the skin compartments. Our study suggests that breast cancer is not just a localized genetic disorder, but rather part of a larger field of genetic alterations/instabilities affecting multiple cell populations in the organ with various cellular elements, ultimately contributing to the manifestation of the more 'localized' carcinoma. These data indicate that more global assessment of tumor micro- and macro-environment is crucial for our understanding of breast carcinogenesis.

  14. Molecular pathway activation features linked with transition from normal skin to primary and metastatic melanomas in human.

    Science.gov (United States)

    Shepelin, Denis; Korzinkin, Mikhail; Vanyushina, Anna; Aliper, Alexander; Borisov, Nicolas; Vasilov, Raif; Zhukov, Nikolay; Sokov, Dmitry; Prassolov, Vladimir; Gaifullin, Nurshat; Zhavoronkov, Alex; Bhullar, Bhupinder; Buzdin, Anton

    2016-01-01

    Melanoma is the most aggressive and dangerous type of skin cancer, but its molecular mechanisms remain largely unclear. For transcriptomic data of 478 primary and metastatic melanoma, nevi and normal skin samples, we performed high-throughput analysis of intracellular molecular networks including 592 signaling and metabolic pathways. We showed that at the molecular pathway level, the formation of nevi largely resembles transition from normal skin to primary melanoma. Using a combination of bioinformatic machine learning algorithms, we identified 44 characteristic signaling and metabolic pathways connected with the formation of nevi, development of primary melanoma, and its metastases. We created a model describing formation and progression of melanoma at the level of molecular pathway activation. We discovered six novel associations between activation of metabolic molecular pathways and progression of melanoma: for allopregnanolone biosynthesis, L-carnitine biosynthesis, zymosterol biosynthesis (inhibited in melanoma), fructose 2, 6-bisphosphate synthesis and dephosphorylation, resolvin D biosynthesis (activated in melanoma), D-myo-inositol hexakisphosphate biosynthesis (activated in primary, inhibited in metastatic melanoma). Finally, we discovered fourteen tightly coordinated functional clusters of molecular pathways. This study helps to decode molecular mechanisms underlying the development of melanoma.

  15. A study on electrical skin resistance in the lateral and medial forearm skin among normal skin cases%正常儿童和老年人前臂内外侧皮肤电阻值对比分析

    Institute of Scientific and Technical Information of China (English)

    许昌春; 张怀亮; 陈正琴

    2011-01-01

    目的 了解正常儿童皮肤与老年人光老化皮肤电阻值水平差异.方法 研制皮肤表面电阻值测定仪,对照检测41例12岁以下儿童与25例60岁以上的人群组前臂皮肤自然光暴露侧和非光暴露侧部位皮肤表面电阻值.结果 前臂光暴露部位皮肤电阻值显著高于非光暴露部位电阻值(P< 0.001),且老年组电阻值显著高于儿童组(P< 0.001).结论 不同部位不同年龄皮肤电阻值不同,皮肤电阻值与年龄的增加呈正相关.%Objective To study the electrical skin resistance between children's normal skin and the elderly photoagjng skin. Methods Using new developed electrical resistance value testers, the electrical resistance value of lateral and medial forearm skin were evaluated in groups of under 12 years old and above 60 years old. Results The electrical skin resistance of light exposured sites are significantly higher than that of non exposured sites (P<0.001). The electrical skin resistance of elder group is significantly higher than that of the children under 12 years old. (P<0.001). Conclusion Electrical skin resistance is changed with age and anatomy sites.

  16. Noninvasive evaluation of collagen and hemoglobin contents and scattering property of in vivo keloid scars and normal skin using diffuse reflectance spectroscopy: pilot study

    Science.gov (United States)

    Tseng, Sheng-Hao; Hsu, Chao-Kai; Yu-Yun Lee, Julia; Tzeng, Shih-Yu; Chen, Wan-Rung; Liaw, Yu-Kai

    2012-07-01

    Collagen is a rich component in skin that provides skin structure integrity; however, its contribution to the absorption and scattering properties of various types of skin has not been extensively studied. We considered the contribution of the collagen to the absorption spectrum of in vivo normal skin and keloids of 12 subjects derived from our diffuse reflectance spectroscopy (DRS) system in the wavelength range from 550 to 860 nm. It was found that the collagen concentration, the hemoglobin oxygen saturation, and the reduced scattering coefficient of keloids were remarkably different from that of normal skin. Our results suggest that our DRS system could assist clinicians in understanding the functional and structural condition of keloid scars. In the future, we will evaluate the accuracy of our system in the keloid diagnosis and investigate the applicability of our system for other skin-collagen-related studies.

  17. Melatonin reduces oxidative damage to skin and normalizes blood coagulation in a rat model of thermal injury.

    Science.gov (United States)

    Tunali, Tugba; Sener, Goksel; Yarat, Aysen; Emekli, Nesrin

    2005-01-28

    This study was designed to determine the effect of melatonin treatment on the glutathione (GSH) and lipid peroxidation (LPO) levels in the skin as well as prothrombin time (PT) and fibrin degradation products (FDPs) in the blood of rats with thermal injury. Under ether anaesthesia, the shaved dorsum of the rats was exposed to 90 degrees C bath for 10 s to induce burn injury. Rats were decapitated either 3 or 24 hours after burn injury. Melatonin (10 mg/kg) was administered i.p. immediately after burn injury to same animals. In the 24 hour burn group, melatonin injections were repeated for two more occasions 8 and 16 h after burn injury. In the control group the same protocol was applied except that the dorsum was exposed to a 25 degrees C water bath for 10 s. Severe skin scald injury (30% of total body surface area) caused a significant decrease in PT at post burn 3 and 24 hours. FDPs was not increased at post burn 3 hour but was significantly increased at post burn 24 hour. GSH levels were significantly depressed at post burn 3 hour but were not changed at post burn 24 hour. LPO levels were significantly increased both at post burn 3 and 24 hours. Skin protein levels were significantly reduced at post burn 24 hour as evidenced by electrophoresis. Treatment of rats with melatonin normalized PT levels both at post burn 3 and 24 hours. FDP decreased at post burn 24 hour due to melatonin treatment. GSH levels significantly increased as a result of melatonin treatment both at post burn 3 and 24 hours melatonin treatment. LPO levels were not changed by melatonin at post burn 3 hour; however, the melatonin significantly decreased LPO values at post burn 24 hours. In conclusion, exogenously administered melatonin reduced skin oxidant damage and normalized the activated blood coagulation induced by thermal trauma.

  18. Occurrence of vascular IgA deposits in clinically normal skin of patients with renal disease.

    Science.gov (United States)

    Faille-Kuyper, E H; Kater, L; Kuijten, R H; Kooiker, C J; Wagenaar, S S; van der Zouwen, P; Mees, E J

    1976-05-01

    Skin and kidney biopsies were performed on 262 patients with various nephropathies. In 45 skin biopsy specimens finely granular deposits of predominantly IgA and late-acting complement factors were detected in the walls of superficial capillaries, sometimes concomitantly with IgM, IgG, C4 or a combination of these proteins. Twelve of the 45 patients presented with anaphylactoid purpura and the majority of the other 33 patients had either recurrent macroscopic or microscopic hematuria. The renal lesions in 32 of these 45 patients consisted of focal segmental intracapillary proliferation. In 35 the kidney biopsy specimen showed mesangial deposits of IgA; in one case IgA was deposited along the glomerular basement membrane. In only three of the remaining 217 patients without cutaneous IgA deposits were typical mesangial IgA deposits found. The close correlation between IgA deposits in cutaneous vessels and focal segmental intracapillary proliferation with mesangial IgA deposits suggests that immunofluorescence examination of skin biopsy specimens could prove of diagnostic value. The results provide additional evidence for a close pathogenic relationship between IgA-associated glomerulonephritis and anaphylactoid purpura.

  19. Percutaneous absorption of estradiol and progesterone in normal and appendage-free skin of the hairless rat: lack of importance of nutritional blood flow.

    Science.gov (United States)

    Hueber, F; Besnard, M; Schaefer, H; Wepierre, J

    1994-01-01

    Percutaneous absorption occurs after passive diffusion through the different layers of the skin and its appendages. Thereafter, a resorption process into the cutaneous microcirculation brings the compounds into the systemic circulation. The objective of this in vivo study in the hairless rat was to compare the percutaneous absorption of two steroids on normal and appendage-free (scar) skin and to show if differences in absorption result only from the lack of hair follicles and sebaceous glands and/or from a modification of local blood flow. Percutaneous absorption was evaluated with estradiol and progesterone after 30 min, 2 and 6 h. Except after 30 min, the reservoir function of the stratum corneum of scar skin was approximately twice as high as in normal skin. Eighty to ninety percent of the estradiol and progesterone found in the stratum corneum were located in its superficial layers. Inversely, whatever the application time was, the concentrations of both steroids in the epidermis and dermis were significantly higher in normal skin than in scar skin with maximal difference between about 40 and 400 microns, the area of sebaceous gland localization. Cutaneous blood flow in full-thickness skin, assessed by the thallium-201 method, was globally identical in normal and in scar skin. In scar skin, at the level of papillary dermis, a decrease in blood flow due to the thicker viable epidermis and the flat dermoepidermal junction has been shown without implying an accumulation of drug in the epidermis and superficial dermis. Under these conditions, our results clearly demonstrate that the nutritional blood flow does not interfere with the percutaneous absorption of estradiol and progesterone in normal and scar skin. Thus, they confirm the significant contribution of hair follicles and sebaceous glands to drug penetration into the skin and subsequently the systemic circulation.

  20. CD3+ and BLA.36+ cells do not occur in the epidermis and adnexal epithelia of normal skin from the dorsolateral trunk of cats.

    Science.gov (United States)

    Tranchina, Michelle M; Scott, Danny W; McDonough, Sean P

    2010-10-01

    A small population of resident T-lymphocytes is present in the normal epidermis of humans, mice, and rats. However, resident epidermal lymphocytes have not been reported in the normal skin of the cat. Skin-biopsy specimens from the normal skin of the dorsolateral trunk from 30 cats were examined histologically and immunohistochemically for the presence of lymphocytes, CD3+ cells, and BLA.36+ cells in epidermis and adnexal epithelia. All examinations were negative. It appears that lymphocytes occur rarely, if at all, in the epidermis and adnexal epithelial of normal cat skin. Hence, the presence of lymphocytes in these structures should be considered abnormal. Copyright © 2010 ISFM and AAFP. Published by Elsevier Ltd. All rights reserved.

  1. An Assessment of Normalized Difference Skin Index Robustness in Aquatic Environments

    Science.gov (United States)

    2014-03-27

    lower back portion of the hand . Prior to each data collect, the hand is washed with soap and water. Between each sample, the hand is dried before...shown in 32 Figure 4.1(a). Prior to each data collect, the skin sample area is washed with soap and water. Samples are taken as the subject moves their...with soap and water. Droplets of distilled water are added to the back of the hand with a pipette. For each sample, the reflectance spectrum of the

  2. Localization and activity of tissue bound cyclic nucleotide phosphodiesterase in normal and lack of changes in psoriatic human skin.

    Science.gov (United States)

    Mahrle, G; Organos, C E

    1976-12-01

    This study has been undertaken to elucidate the localization and the activity of cyclic nucleotide phosphodiesterase (PDE) in psoriatic epidermis compared to normal. The results showed that the evaluation of cytochemical methods may be difficult because of the various factors which interfere with the reaction and the considerable amount of background staining. Additionally, only the tissue bound particulate enzyme fraction may be demonstrated by cytochemical means. Nevertheless, the method did reveal that the activity of PDE, if any, is localized on the cytoplasmic membranes of the cells, independent of their origin, and not on the cell surface. Moreover, no differences were found between normal and psoriatic skin. It seems, therefore, that the intracellular degradation of cAMP remains unaltered in psoriasis.

  3. Effect of capping agents on the cytotoxicity of silver nanoparticles in human normal and cancer skin cell lines

    Science.gov (United States)

    Netchareonsirisuk, Ponsawan; Puthong, Songchan; Dubas, Stephan; Palaga, Tanapat; Komolpis, Kittinan

    2016-11-01

    Silver nanoparticles (AgNPs) are among the most widely used nanomaterials in medical and consumer products. However, safety in the uses of AgNPs is still controversial. The toxicity of AgNPs toward various cell types has been reported to depend on the surface properties of the nanoparticles. In this study, the effect of AgNPs with the average size of 5-15 nm on the viability of the CCD-986SK human normal skin fibroblast cell line and A375 human malignant melanoma cell line was evaluated. Comparative toxicity studies, based on MTT assay, were performed by using either sodium alginate or poly (4-styrenesulfonic acid-co-maleic acid) sodium salt (PSSMA) as capping agent in the nanoparticle preparation. The cytotoxicity tests revealed that AgNO3 alone was highly toxic to both cell types while both alginate and PSSMA alone were not toxic. AgNPs capped with alginate were selectively toxic to the cancer cell line but not to the normal cell line while AgNPs capped with PSSMA were toxic to both cancer and normal cell lines. Judging from the 50 % inhibition concentration (IC50), it was found that the cancer cell line was more sensitive to AgNPs than the normal cell line. Study on the mode of cell death by annexin V and propidium iodide staining revealed that AgNPs induced more apoptotic cell death (84-90 %) than necrosis (8-12 %) in the skin cancer cell line. These results suggest that the toxicity of AgNPs depended on the type of capping agent and the type of cell line.

  4. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

    Energy Technology Data Exchange (ETDEWEB)

    Yamakoshi, Takako [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Makino, Teruhiko, E-mail: tmakino@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Ur Rehman, Mati; Yoshihisa, Yoko [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Sugimori, Michiya [Department of Integrative Neuroscience, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Shimizu, Tadamichi, E-mail: shimizut@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan)

    2013-03-01

    Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes.

  5. Characterisation of a behavioural protocol for the assessment of nociception in normal and inflamed porcine skin

    DEFF Research Database (Denmark)

    di Giminiani, Pierpaolo

    2012-01-01

    pain sensitivity following ultraviolet-B and capsaicin-induced inflammation in porcine skin. A series of experiments was performed to characterise the new experimental protocol, which included (1) the identification and quantification of reflexive behavioural responses indicative of the nociceptive...... of behavioural cutaneous nociception was performed via the assessment of differences in cutaneous pain sensitivity as determined by the body size of the animals, the anatomical locations of interest and the sensory modalities involved. Consequently, this new protocol allowed measuring the change in cutaneous...... the performance of spontaneous behaviours. Different levels of cutaneous pain sensitivity were linked to differences in the anatomy of the animals and in the specific features of two distinct anatomical locations receiving the thermal and the mechanical challenges. Furthermore, the two sensory modalities under...

  6. Abnormally dark or light skin

    Science.gov (United States)

    Hyperpigmentation; Hypopigmentation; Skin - abnormally light or dark ... Normal skin contains cells called melanocytes. These cells produce melanin , the substance that gives skin its color. Skin with ...

  7. LIPH expression in skin and hair follicles of normal coat and Rex rabbits.

    Science.gov (United States)

    Diribarne, Mathieu; Mata, Xavier; Rivière, Julie; Bouet, Stéphan; Vaiman, Anne; Chapuis, Jérôme; Reine, Fabienne; Fleurot, Renaud; Auvinet, Gérard; Deretz, Séverine; Allain, Daniel; Schibler, Laurent; Cribiu, Edmond-Paul; Guérin, Gérard

    2012-01-01

    Natural mutations in the LIPH gene were shown to be responsible for hair growth defects in humans and for the rex short hair phenotype in rabbits. In this species, we identified a single nucleotide deletion in LIPH (1362delA) introducing a stop codon in the C-terminal region of the protein. We investigated the expression of LIPH between normal coat and rex rabbits during critical fetal stages of hair follicle genesis, in adults and during hair follicle cycles. Transcripts were three times less expressed in both fetal and adult stages of the rex rabbits than in normal rabbits. In addition, the hair growth cycle phases affected the regulation of the transcription level in the normal and mutant phenotypes differently. LIPH mRNA and protein levels were higher in the outer root sheath (ORS) than in the inner root sheath (IRS), with a very weak signal in the IRS of rex rabbits. In vitro transfection shows that the mutant protein has a reduced lipase activity compared to the wild type form. Our results contribute to the characterization of the LIPH mode of action and confirm the crucial role of LIPH in hair production.

  8. Dermal fibroblast expression of stromal cell-derived factor-1 (SDF-1) promotes epidermal keratinocyte proliferation in normal and diseased skin.

    Science.gov (United States)

    Quan, Chunji; Cho, Moon Kyun; Shao, Yuan; Mianecki, Laurel E; Liao, Eric; Perry, Daniel; Quan, Taihao

    2015-12-01

    Stromal cells provide a crucial microenvironment for overlying epithelium. Here we investigated the expression and function of a stromal cell-specific protein, stromal cell-derived factor-1 (SDF-1), in normal human skin and in the tissues of diseased skin. Immunohistology and laser capture microdissection (LCM)-coupled quantitative real-time RT-PCR revealed that SDF-1 is constitutively and predominantly expressed in dermal stromal cells in normal human skin in vivo. To our surprise, an extremely high level of SDF-1 transcription was observed in the dermis of normal human skin in vivo, evidenced by much higher mRNA expression level than type I collagen, the most abundant and highly expressed protein in human skin. SDF-1 was also upregulated in the tissues of many human skin disorders including psoriasis, basal cell carcinoma (BCC), and squamous cell carcinoma (SCC). Double immunostaining for SDF-1 and HSP47 (heat shock protein 47), a marker of fibroblasts, revealed that fibroblasts were the major source of stroma-cell-derived SDF-1 in both normal and diseased skin. Functionally, SDF-1 activates the ERK (extracellular-signal-regulated kinases) pathway and functions as a mitogen to stimulate epidermal keratinocyte proliferation. Both overexpression of SDF-1 in dermal fibroblasts and treatment with rhSDF-1 to the skin equivalent cultures significantly increased the number of keratinocyte layers and epidermal thickness. Conversely, the stimulative function of SDF-1 on keratinocyte proliferation was nearly completely eliminated by interfering with CXCR4, a specific receptor of SDF-1, or by knock-down of SDF-1 in fibroblasts. Our data reveal that extremely high levels of SDF-1 provide a crucial microenvironment for epidermal keratinocyte proliferation in both physiologic and pathologic skin conditions.

  9. From Normal Skin to Squamous Cell Carcinoma: A Quest for Novel Biomarkers

    Directory of Open Access Journals (Sweden)

    Vlad Voiculescu

    2016-01-01

    Full Text Available Squamous cells carcinoma (SCC is the second most frequent of the keratinocyte-derived malignancies after basal cell carcinoma and is associated with a significant psychosocial and economic burden for both the patient himself and society. Reported risk factors for the malignant transformation of keratinocytes and development of SCC include ultraviolet light exposure, followed by chronic scarring and inflammation, exposure to chemical compounds (arsenic, insecticides, and pesticides, and immune-suppression. Despite various available treatment methods and recent advances in noninvasive or minimal invasive diagnostic techniques, the risk recurrence and metastasis are far from being negligible, even in patients with negative histological margins and lymph nodes. Analyzing normal, dysplastic, and malignant keratinocyte proteome holds special promise for novel biomarker discovery in SCC that could be used in the future for early detection, risk assessment, tumor monitoring, and development of targeted therapeutic strategies.

  10. From Normal Skin to Squamous Cell Carcinoma: A Quest for Novel Biomarkers

    Science.gov (United States)

    Ghita, Mihaela; Moraru, Liliana; Voiculescu, Suzana; Greabu, Maria

    2016-01-01

    Squamous cells carcinoma (SCC) is the second most frequent of the keratinocyte-derived malignancies after basal cell carcinoma and is associated with a significant psychosocial and economic burden for both the patient himself and society. Reported risk factors for the malignant transformation of keratinocytes and development of SCC include ultraviolet light exposure, followed by chronic scarring and inflammation, exposure to chemical compounds (arsenic, insecticides, and pesticides), and immune-suppression. Despite various available treatment methods and recent advances in noninvasive or minimal invasive diagnostic techniques, the risk recurrence and metastasis are far from being negligible, even in patients with negative histological margins and lymph nodes. Analyzing normal, dysplastic, and malignant keratinocyte proteome holds special promise for novel biomarker discovery in SCC that could be used in the future for early detection, risk assessment, tumor monitoring, and development of targeted therapeutic strategies. PMID:27642215

  11. Canine epidermal lipid sampling by skin scrub revealed variations between different body sites and normal and atopic dogs

    OpenAIRE

    Angelbeck-Schulze, Mandy; Mischke, Reinhard; Rohn, Karl; Hewicker-Trautwein, Marion; Naim, Hassan Y.; Bäumer, Wolfgang

    2014-01-01

    Background Previously, we evaluated a minimally invasive epidermal lipid sampling method called skin scrub, which achieved reproducible and comparable results to skin scraping. The present study aimed at investigating regional variations in canine epidermal lipid composition using the skin scrub technique and its suitability for collecting skin lipids in dogs suffering from certain skin diseases. Eight different body sites (5 highly and 3 lowly predisposed for atopic lesions) were sampled by ...

  12. Canine epidermal lipid sampling by skin scrub revealed variations between different body sites and normal and atopic dogs

    OpenAIRE

    Angelbeck-Schulze, Mandy; Mischke, Reinhard; Rohn, Karl; Hewicker-Trautwein, Marion; Naim, Hassan Y.; Bäumer, Wolfgang

    2014-01-01

    Background Previously, we evaluated a minimally invasive epidermal lipid sampling method called skin scrub, which achieved reproducible and comparable results to skin scraping. The present study aimed at investigating regional variations in canine epidermal lipid composition using the skin scrub technique and its suitability for collecting skin lipids in dogs suffering from certain skin diseases. Eight different body sites (5 highly and 3 lowly predisposed for atopic lesions) were sampled by ...

  13. Alp Rose stem cells, olive oil squalene and a natural alkyl polyglucoside emulsifier: Are they appropriate ingredients of skin moisturizers - in vivo efficacy on normal and sodium lauryl sulfate - irritated skin?

    Directory of Open Access Journals (Sweden)

    Filipović Mila

    2016-01-01

    Full Text Available Background/Aim. Since skin moisturization may be achieved by both actives and chosen carrier, plant stem cells, squalene and natural alkyl polyglucoside emulsifier may be potential components of contemporary cosmetic products. The aim of the study was in vivo evaluation of the skin irritation potential and the efficacy of Alpine Rose stem cells incorporated into li-posomes and olive oil squalene as ingredients of moisturizing creams, with respect to the novel emulsifier used for creams’ stabilization. Methods. With the employment of noninvasive skin biophysical measurements, skin hydration (EC, transepi-dermal water loss (TEWL, erythema index (EI and viscoelas-ticity were measured on 76 healthy volunteers. In the first phase, skin irritation after a 24-hour occlusion and the long-term efficacy of creams (a 21-day study on healthy skin were evaluated. Phase II of the study focused on the cream efficacy assessment after a 6-day treatment of sodium lauryl sulfate-irritated skin. Results. After a 24-hour occlusion, there were no significant changes in the EI for any tested sample. In the second phase of the study, the EI was not significantly altered for the cream containing squalene, while the application of all active samples resulted in a significant reduction of TEWL. In both phases of the study an EC increase was recorded, espe-cially for the squalene-containing cream. Conclusion. Due to the lack of skin irritation and skin barrier impairment along with the marked hydration effect, it could be said that the in-vestigated actives incorporated into alkyl polyglucoside emulsi-fier-stabilized creams may be safely applied as ingredients for "tailor-made" cosmetic moisturizers intended for normal and dry skin care, whereas olive oil squalene could be used for the treatment of irritated or sensitive skin as well. [Projekat Ministarstva nauke Republike Srbije, br. TR34031

  14. Nonlinear spectral imaging of human normal skin, basal cell carcinoma and squamous cell carcinoma based on two-photon excited fluorescence and second-harmonic generation

    Science.gov (United States)

    Xiong, S. Y.; Yang, J. G.; Zhuang, J.

    2011-10-01

    In this work, we use nonlinear spectral imaging based on two-photon excited fluorescence (TPEF) and second harmonic generation (SHG) for analyzing the morphology of collagen and elastin and their biochemical variations in basal cell carcinoma (BCC), squamous cell carcinoma (SCC) and normal skin tissue. It was found in this work that there existed apparent differences among BCC, SCC and normal skin in terms of their thickness of the keratin and epithelial layers, their size of elastic fibers, as well as their distribution and spectral characteristics of collagen. These differences can potentially be used to distinguish BCC and SCC from normal skin, and to discriminate between BCC and SCC, as well as to evaluate treatment responses.

  15. Comparison of skin barrier function and sensory nerve electric current perception threshold between IgE-high extrinsic and IgE-normal intrinsic types of atopic dermatitis.

    Science.gov (United States)

    Mori, T; Ishida, K; Mukumoto, S; Yamada, Y; Imokawa, G; Kabashima, K; Kobayashi, M; Bito, T; Nakamura, M; Ogasawara, K; Tokura, Y

    2010-01-01

    Background Two types of atopic dermatitis (AD) have been proposed, with different pathophysiological mechanisms underlying this seemingly heterogeneous disorder. The extrinsic type shows high IgE levels presumably as a consequence of skin barrier damage and feasible allergen permeation, whereas the intrinsic type exhibits normal IgE levels and is not mediated by allergen-specific IgE. Objectives To investigate the relationship between pruritus perception threshold and skin barrier function of patients with AD in a comparison between the extrinsic and intrinsic types. Methods Enrolled in this study were 32 patients with extrinsic AD, 17 with intrinsic AD and 24 healthy individuals. The barrier function of the stratum corneum was assessed by skin surface hydration and transepidermal water loss (TEWL), and pruritus perception was evaluated by the electric current perception threshold (CPT) of sensory nerves upon neuroselective transcutaneous electric stimulation. Results Skin surface hydration was significantly lower and TEWL was significantly higher in extrinsic AD than intrinsic AD or normal controls. Although there was no statistically significant difference in CPT among extrinsic AD, intrinsic AD and normal controls, CPT was significantly correlated with skin surface hydration and inversely with TEWL in intrinsic AD and normal controls, but not extrinsic AD. Finally, CPT was correlated with the visual analogue scale of itch in the nonlesional skin of patients with extrinsic but not intrinsic AD. Conclusions Patients with extrinsic AD have an impaired barrier, which increases the pre-existing pruritus but rather decreases sensitivity to external stimuli. In contrast, patients with intrinsic AD retain a normal barrier function and sensory reactivity to external pruritic stimuli.

  16. Selection of a set of reliable reference genes for quantitative real-time PCR in normal equine skin and in equine sarcoids

    Directory of Open Access Journals (Sweden)

    Gasthuys Frank

    2006-04-01

    Full Text Available Abstract Background Real-time quantitative PCR can be a very powerful and accurate technique to examine gene transcription patterns in different biological conditions. One of the critical steps in comparing transcription profiles is accurate normalisation. In most of the studies published on real-time PCR in horses, normalisation occurred against only one reference gene, usually GAPDH or ACTB, without validation of its expression stability. This might result in unreliable conclusions, because it has been demonstrated that the expression levels of so called "housekeeping genes" may vary considerably in different tissues, cell types or disease stages, particularly in clinical samples associated with malignant disease. The goal of this study was to establish a reliable set of reference genes for studies concerning normal equine skin and equine sarcoids, which are the most common skin tumour in horses. Results In the present study the gene transcription levels of 6 commonly used reference genes (ACTB, B2M, HPRT1, UBB, TUBA1 and RPL32 were determined in normal equine skin and in equine sarcoids. After applying the geNorm applet to this set of genes, TUBA1, ACTB and UBB were found to be most stable in normal skin and B2M, ACTB and UBB in equine sarcoids. Conclusion Based on these results, TUBA1, ACTB and UBB, respectively B2M, ACTB and UBB can be proposed as reference gene panels for accurate normalisation of quantitative data for normal equine skin, respectively equine sarcoids. When normal skin and equine sarcoids are compared, the use of the geometric mean of UBB, ACTB and B2M can be recommended as a reliable and accurate normalisation factor.

  17. Low doses of nanodiamonds and silica nanoparticles have beneficial hormetic effects in normal human skin fibroblasts in culture.

    Science.gov (United States)

    Mytych, Jennifer; Wnuk, Maciej; Rattan, Suresh I S

    2016-04-01

    Nanodiamonds (ND) and silica nanoparticles (SiO2-NP) have been much investigated for their toxicity at high doses, little is known about their biological activity at low concentrations. Here we report the biphasic dose response of ND and SiO2-NP in modulating normal human facial skin fibroblasts (FSF1) in culture. ND and SiO2-NP at low concentration (up to 0.5 μg/ml) had beneficial effects on FSF1 in terms of increasing their proliferation and metabolic activity. Exposure of FSF1 cells to low levels of NP enhanced their wound healing ability in vitro and slowed down aging during serial passaging as measured by maintenance of youthful morphology, reduction in the rate of loss of telomeres, and the over all proliferative characteristics. Furthermore, NP treatment induced the activation of Nrf2- and FOXO3A-mediated cellular stress responses, including an increased expression of heme oxygenease (HO-1), sirtuin (SIRT1), and DNA methyltransferase II (DNMT2). These results imply that ND and SiO2-NP at low doses are potential hormetins, which exert mild stress-induced beneficial hormetic effects through improved survival, longevity, maintenance, repair and function of human cells.

  18. Normal tissue tolerance to external beam radiation therapy: Skin; Dose de tolerance des tissus sains: la peau et les phaneres

    Energy Technology Data Exchange (ETDEWEB)

    Ginot, A.; Doyen, J.; Hannoun-Levi, J.M.; Courdi, A. [Service d' oncologie-radiotherapie, centre Antoine-Lacassagne, 06 - Nice (France)

    2010-07-15

    Acute skin toxicity is frequent during radiation therapy and can lead to temporary arrest of the treatment. Chronic toxicity can occur and conduct to cosmetic problems. Alopecia is the most frequent toxicity concerning hair and is most of the time reversible. Several factors linked to patients influence skin toxicity, such as under-nutrition, old age, obesity, smoking, skin diseases, autoimmune diseases, failure of DNA reparation. Skin, hair and nail toxicities depend also on radiation schedule. Acute toxicity is greater when dose per fraction increases. Chronic and acute toxicities are more often when total dose increases. Under 45 Gy, the risk of severe skin toxicity is low, and begins above 50 Gy. Skin toxicity depends also on the duration of radiotherapy and split course schedules are associated with less toxicities. Irradiation surface seems to influence skin toxicity but interaction is more complex. Reirradiation is often feasible in case of cancer recurrence but with a risk of grade 3-4 toxicity above all in head and neck cancer. The benefit/risk ratio has to be always precisely evaluated. Permanent alopecia is correlated with the follicle dose. Modern techniques of radiation therapy allow to spare skin. (authors)

  19. Normal skin and hypertrophic scar fibroblasts differentially regulate collagen and fibronectin expression as well as mitochondrial membrane potential in response to basic fibroblast growth factor

    Directory of Open Access Journals (Sweden)

    Rui Song

    2011-05-01

    Full Text Available Basic fibroblast growth factor (bFGF regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-inducedeffects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts from tissue biopsies of patients who underwent plastic surgery for repairing hypertrophic scars. The fibroblasts were then treated with different concentrations of bFGF (ranging from 0.1 to 1000 ng/mL. The growth of hypertrophic scar fibroblasts became slower with selective inhibition of type I collagen production after exposure to bFGF. However, type III collagen expression was affected in both normal and hypertrophic scar fibroblasts. Moreover, fibronectin expression in the normal fibroblasts was up-regulated after bFGF treatment. bFGF (1000 ng/mL also induced mitochondrial depolarization in hypertrophic scar fibroblasts (P < 0.01. The cellular ATP level decreased in hypertrophic scar fibroblasts (P < 0.05, while it increased in the normal fibroblasts following treatment with bFGF (P < 0.01. These data suggest that bFGF has differential effects and mechanisms on fibroblasts of the normal skin and hypertrophic scars, indicating that bFGF may play a role in the early phase of skin wound healing and post-burn scar formation.

  20. 联合止痛消炎膏外敷治疗血管周围皮肤肿胀疗效观察%Combination of analgesic antiphlogistic cream topical treatment curative effect observation of blood vessels surrounding skin swelling

    Institute of Scientific and Technical Information of China (English)

    张华; 张业光

    2013-01-01

    Objective To observe the combination of anti-inflammatory plaster topical treatment of fistula puncture failure within blood extravasation around blood vessels caused by swelling the clinical effect of skin. Methods 34 patients blood extravasation of xylene-induced ear edema blood vessels surrounding skin of patients, randomly divided into observation group and control group, each group of 17 cases, observation group with potato chips+xi liao completed + analgesic antiphlogistic cream topical side limb injury in fistula. In the control group with cold + 50%magnesium sulfate wet-apply internal fistula side body. Results The observation group 8 cases cured, accounted for 47%, 6 cases had marked effect, 35%, 3 cases(18%). And Control group recovered in 3 cases, accounting for 18%, 5 cases had marked effect, 29%, 7 cases (41%), and ineffective in 2 cases, accounting for 12%. Observation group of patients satisfaction 95%, control group patients' satisfaction was 80%. Observation group significantly reduce pain, swelling, eliminate time significantly shortened, subcutaneous ecchymosis dissipate quickly, no internal fistula embolism. Conclusion The combined application of analgesic antiphlogistic cream, fistula puncture failure blood extravasation to surrounding skin swelling blood vessels more effective.%目的:观察联合使用消炎止痛膏外敷治疗内瘘穿刺失败血液外渗致血管周围皮肤肿胀的临床效果。方法将34例血液外渗致血管周围皮肤肿胀的患者随机分为观察组和对照组,每组17例,观察组用土豆片+喜辽妥+止痛消炎膏外敷损伤内瘘侧肢体;对照组用冷敷+50%硫酸镁湿敷内瘘侧肢体。观察2组疗效及患者满意度情况。结果观察组痊愈8例,占47%,显效6例,占35%,有效3例,占18%;对照组痊愈3例,占18%,显效5例,占29%,有效7例,占41%,无效2例,占12%。观察组患者满意度为95%,对照组患者满意度为80%。观察组疼痛

  1. Skin fold thickness at abdomen: a simple anthropometric measurement may compliment metabolic syndrome definition in patients with normal waist circumference

    Institute of Scientific and Technical Information of China (English)

    Toan C Nguyen; Thai Q Ngo; Son V Nguyen; Hieu T Luong; Khoa TA Pham; Cong D Nguyen

    2006-01-01

    Backgroud and Objectives Previous studies have reported that skin fold thickness (SF) strongly correlated with insulin resistance in the metabolic syndrome (MetS). In this study, we developed a MetS definition by SF at A8 point (SFA8) on Erdheim diagram(MetSSFA8) in essential hypertensive patients. Subjects and Methods Medical records of 268 essential hypertensive patients (126males and 122 females) were analyzed, including 210 non-diabetic patients (NDM group) and 58 patients with diabetes (DM group).The mean age was 61.4 ± 9.9 and 59.0 ± 11.0 years, respectively. The control group consisted of 90 non-diabetic, non-hypertensive patients with a mean age of 58.0 ± 11.3 years. The proposed MetSSFA8 definition included SFA8 specific values ( ≥30 mm in female and ≥27 mm in male) and at least two of the following: raised triglyceride levels ( ≥1.7 mmol/L), or specific treatment for this lipid abnormality; raised blood pressure (SBP≥130 mmHg and/or DBP≥85 mmHg), or treatment of previously diagnosed hypertension;reduced HDL-cholesterol (< 1.03 mmol/L in men, <1.29 mmol/L in women), or specific treatment for this lipid abnormality; raised fasting plasma glucose (≥5.6 mmol/l), or previously diagnosed DM. Metabolic Syndrome by the National Cholesterol Education Program and International Diabetes Federation definitions were determined with abdominal obesity defined by Asia-Pacific criteria for waist circumference (NCEPA and IDFA). Results The percentage of MetS as defined by NCEPA, IDFA and MetSSFA8 in NDM group was lower than that of NCEPA, IDFA and MetSSFA8 in DM group [OR=7.7 (95%CI, 2.9-20.2) and 2.5 (95%CI, 1.4-4.8) and 2.7(95%CI, 1.3-5.6), respectively] and higher than that of the control group [OR=53.3 (95%CI, 16.7-170.6), 5.8 (95%CI, 2.6-13.2) and18.8 (95%CI, 7.3-48.7), respectively]. The percentage of MetS by NCEPA, IDFA and MetSSFA8 in males in NDM group was lower than the percentage of MetS by NCEPA, IDFA and MetSSFA8 in females in NDM group (50

  2. High prevalence of cutaneous warts in elementary school children and the ubiquitous presence of wart-associated human papillomavirus on clinically normal skin.

    Science.gov (United States)

    de Koning, M N C; Quint, K D; Bruggink, S C; Gussekloo, J; Bouwes Bavinck, J N; Feltkamp, M C W; Quint, W G V; Eekhof, J A H

    2015-01-01

    One-third of Dutch primary school children have cutaneous warts; each year around 20% of them seek medical treatment. However, little is known about the epidemiology of the types of human papillomavirus (HPV) causing these warts. To investigate the distribution of cutaneous wart-associated HPV types in three primary school classes by analysing skin swabs taken from warts, and the forehead, hand dorsum and sole of the foot of included children. Using the hyperkeratotic skin lesion polymerase chain reaction/multiplex genotyping assay, each swab sample was used to genotype for 23 cutaneous wart-associated HPV types. Thirty-one (44%) of the 71 children had a total of 69 warts, with a maximum of six warts per child. In the wart swabs, HPV2, HPV27 and HPV57, members of Alphapapillomavirus species 4, were most frequently detected (27%, 32% and 14%, respectively), whereas HPV1 was only found in two plantar warts. The prevalence of HPV carriage, detected in swabs of clinically normal skin of the forehead, left hand and left sole was 80%, with the most prevalent types being HPV1 (59%), HPV2 (42%), HPV63 (25%) and HPV27 (21%). Cutaneous wart-associated HPV types were highly prevalent in primary school children, but did not correlate with the HPV types in warts. In contrast to the existing literature, HPV1 was frequently detected on clinically normal skin but was much less frequent in warts. © 2014 British Association of Dermatologists.

  3. Effects of dietary flax seed and sunflower seed supplementation on normal canine serum polyunsaturated fatty acids and skin and hair coat condition scores.

    Science.gov (United States)

    Rees, C A; Bauer, J E; Burkholder, W J; Kennis, R A; Dunbar, B L; Bigley, K E

    2001-04-01

    This prospective study involved supplementing 18 normal dogs with flax seed (FLX) and sunflower seed (SUN) and evaluating their effects on skin and hair coat condition scores and serum polyunsaturated fatty acids (PUFA) concentrations. Skin and hair coat were evaluated in a double-blinded fashion using a numeric scoring system and serum PUFA concentrations were determined. Our hypothesis was that changes in serum PUFA concentrations are associated with improvements in skin and hair coat and that serum PUFA would provide an objective method for making dietary fatty acid supplement recommendations. Although a numerical improvement was found in hair coat quality in both groups, this improvement was not sustained beyond 28 days. The relative per cent of 18:3n-3 concentrations in serum phospholipids increased in the FLX treated dogs but these concentrations remained unchanged in the SUN treated dogs. Also, elevations in relative per cent of 18:2n-6 concentrations in serum phospholipids were seen in the FLX group. The ratio of serum polyunsaturated to saturated fatty acids also showed a transient increase. These increases preceded the peak skin condition score peak value by approximately 14 days. It was concluded that a 1-month supplementation with either flax seed or sunflower seed in dogs provides temporary improvement in skin and hair coat. These changes appeared to be associated with increased serum 18 carbon PUFA.

  4. Expression and localization of peroxisome proliferator-activated receptors and nuclear factor kappaB in normal and lesional psoriatic skin

    DEFF Research Database (Denmark)

    Westergaard, Majken; Henningsen, Jeanette; Johansen, Claus

    2003-01-01

    activators of PPARdelta. The expression levels of NF-kappaB p50 and p65 were not significantly altered in lesional compared with nonlesional psoriatic skin. In the basal layer of normal epidermis both p50 and p65 were sequestered in the cytoplasm, whereas p50, but not p65, localized to nuclei...... in the suprabasal layers, and this distribution was maintained in lesional psoriatic skin. In normal human keratinocytes PPAR agonists neither impaired IL-1beta-induced translocation of p65 nor IL-1beta-induced NF-kappaB DNA binding. We show that PPARdelta physically interacts with the N-terminal Rel homology......-mediated transactivation was partially relieved by forced expression of the coactivators p300 or CBP. We suggest that deficient NF-kappaB activation in chronic psoriatic plaques permitting unabated PPARdelta-mediated transactivation contributes to the pathologic phenotype of psoriasis....

  5. Effects of polymorphisms of NOS3 and GNB3 genes on skin microvascular reactivity in normal pregnancy.

    Science.gov (United States)

    Radkov, O V; Volf, Ju V

    2013-05-01

    We studied the relationship between endothelial NO-synthase gene (NOS3) and G protein β3 subunit gene (GNB3) polymorphisms and reactivity of skin microvessels during physiological gestation. T-786C NOS3 polymorphism influenced the maximum blood flow rate in skin microvessels and the severity of postocclusive reactive hyperemia during the third trimester of pregnancy. The relationship between G894T NOS3 polymorphism and the duration of postocclusive reactive hyperemia was revealed. C825T GNB3 polymorphism affects the duration and severity of postocclusive reactive hyperemia during the first and third trimesters of pregnancy. Thus, NOS3 and GNB3 polymorphisms affect blood flow in the skin microvessels during physiological gestation.

  6. Measurement of serum immunoglobulin E (IgE) specific for house dust mite antigens in normal cats and cats with allergic skin disease.

    Science.gov (United States)

    Taglinger, K; Helps, C R; Day, M J; Foster, A P

    2005-05-01

    The purpose of this study was to determine whether cats with allergic skin disease have significant concentrations of serum Immunoglobulin E (IgE) specific for antigens derived from the house dust mites (HDM) Dermatophagoides farinae (DF) and Dermatophagoides pteronyssinus (DP). Enzyme-linked immunosorbent assays (ELISA) were developed for this purpose. Binding of serum allergen-specific IgE was detected via the use of biotinylated Fc-epsilon receptor alpha chain protein (FcvarepsilonRIalpha). Following optimisation of the assay, serum samples from 59 cats with allergic skin disease and 54 clinically normal cats were screened. Results were expressed as ELISA units per ml (EU/ml) compared to a standard curve. Serological findings were correlated with the clinical presentation of affected cats. Cats with symptoms of feline allergic skin disease were grouped as follows: self-induced alopecia without lesions (group 1), papulocrusting dermatitis (group 2), eosinophilic granuloma complex (group 3), papular/ulcerative dermatitis of head and neck/facial dermatitis (group 4), and a combination of symptoms (group 5). Control normal cats comprised the final group (group 6). The Kruskal-Wallis test was used for statistical analysis. There was no significant difference between groups for DF- and DP-specific IgE concentrations with a p-value of 0.875 and 0.705, respectively. Although the FcvarepsilonRIalpha-based ELISA was able to detect house dust mite-specific feline IgE, the presence of this allergen-specific IgE correlates poorly with the presence of clinical manifestations of allergic skin disease. The results of this study question the clinical relevance of house dust mite-specific IgE in feline allergic skin disease.

  7. Loss of normal profilaggrin and filaggrin in flaky tail (ft/ft) mice: an animal model for the filaggrin-deficient skin disease ichthyosis vulgaris.

    Science.gov (United States)

    Presland, R B; Boggess, D; Lewis, S P; Hull, C; Fleckman, P; Sundberg, J P

    2000-12-01

    Flaky tail (gene symbol ft) is an autosomal recessive mutation in mice that results in a dry, flaky skin, and annular tail and paw constrictions in the neonatal period. Previous studies demonstrated that the ft mutation maps to the central region of mouse chromosome 3, in the vicinity of the epidermal differentiation complex, a gene locus that includes many nonkeratin genes expressed in epidermis. In this study we report a detailed characterization of the flaky tail mouse. Affected homozygous ft/ft mice exhibit large, disorganized scales on tail and paw skin, marked attenuation of the epidermal granular layer, mild acanthosis, and orthokeratotic hyperkeratosis. Biochemical analysis demonstrated that ft/ft mice lacked normal high molecular profilaggrin (approximately 500 kDa), and instead expressed a lower molecular weight form of profilaggrin (220 kDa) that is not proteolytically processed to profilaggrin intermediates or filaggrin. Mutant mice lacked the large, irregular F-type keratohyalin granules that contain profilaggrin, and filaggrin was absent from the cornified layers of ft/ft epidermis. The expression of epidermal keratins was unchanged, whereas the cornified envelope proteins involucrin and loricrin were increased in ft/ft epidermis. Cultured ft/ft keratinocytes also synthesized reduced amounts of profilaggrin mRNA and protein, demonstrating that the defect in profilaggrin expression is intrinsic to epidermal cells. These findings demonstrate that flaky tail mice express an abnormal profilaggrin polypeptide that does not form normal keratohyalin F-granules and is not proteolytically processed to filaggrin. We propose that the absence of filaggrin, and in particular the hygroscopic, filaggrin-derived amino acids that are thought to function in epidermal hydration, underlies the dry, scaly skin characteristic of ft/ft mice. This animal model provides a tool for understanding the role of filaggrin in normal epidermal function and may provide insight into

  8. Redox-dependent induction of antioxidant defenses by phenolic diterpenes confers stress tolerance in normal human skin fibroblasts: Insights on replicative senescence.

    Science.gov (United States)

    Carvalho, Ana C; Gomes, Andreia C; Pereira-Wilson, Cristina; Lima, Cristovao F

    2015-06-01

    Mild stress-induced hormesis represents a promising strategy for targeting the age-related accumulation of molecular damage and, therefore, for preventing diseases and achieving healthy aging. Fruits, vegetables, and spices contain a wide variety of hormetic phytochemicals, which may explain the beneficial health effects associated with the consumption of these dietary components. In the present study, the induction of cellular antioxidant defenses by the phenolic diterpenes carnosic acid (CA) and carnosol (CS) were studied in normal human skin fibroblasts, and insights into the aging process at the cellular level investigated. We observed that CA and CS induced several cytoprotective enzymes and antioxidant defenses in human fibroblasts, whose induction was dependent on the cellular redox state for CS and associated with Nrf2 signaling for both compounds. The stress response elicited by preincubation with CS conferred a cytoprotective action against a following oxidant challenge with tert-butyl hydroperoxide, confirming its hormetic effect. Preincubation of normal fibroblasts with CS also protected against hydrogen peroxide-induced premature senescence. Furthermore, cultivation of middle passage normal human skin fibroblasts in the presence of CS ameliorated the physiological state of cells during replicative senescence. Our results support the view that mild stress-induced antioxidant defenses by CS can confer stress tolerance in normal cells and may have important implications in the promotion of healthy aging.

  9. IgG and IgA with Potential Microbial-Binding Activity Are Expressed by Normal Human Skin Epidermal Cells

    Directory of Open Access Journals (Sweden)

    Dongyang Jiang

    2015-01-01

    Full Text Available The innate immune system of the skin is thought to depend largely on a multi-layered mechanical barrier supplemented by epidermis-derived antimicrobial peptides. To date, there are no reports of antimicrobial antibody secretion by the epidermis. In this study, we report the expression of functional immunoglobulin G (IgG and immunoglobulin A (IgA, previously thought to be only produced by B cells, in normal human epidermal cells and the human keratinocyte line HaCaT. While B cells express a fully diverse Ig, epidermal cell-expressed IgG or IgA showed one or two conservative VHDJH rearrangements in each individual. These unique VDJ rearrangements in epidermal cells were found neither in the B cell-derived Ig VDJ databases published by others nor in our positive controls. IgG and IgA from epidermal cells of the same individual had different VDJ rearrangement patterns. IgG was found primarily in prickle cells, and IgA was mainly detected in basal cells. Both epidermal cell-derived IgG and IgA showed potential antibody activity by binding pathogens like Staphylococcus aureus, the most common pathogenic skin bacteria, but the microbial-binding profile was different. Our data indicates that normal human epidermal cells spontaneously express IgG and IgA, and we speculate that these Igs participate in skin innate immunity.

  10. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  11. Pharmacokinetic/pharmacodynamic analysis to evaluate ceftaroline fosamil dosing regimens for the treatment of community-acquired bacterial pneumonia and complicated skin and skin-structure infections in patients with normal and impaired renal function.

    Science.gov (United States)

    Canut, A; Isla, A; Rodríguez-Gascón, A

    2015-04-01

    In this study, the probability of pharmacokinetic/pharmacodynamic target attainment (PTA) of ceftaroline against clinical isolates causing community-acquired bacterial pneumonia (CABP) and complicated skin and skin-structure infection (cSSSI) in Europe was evaluated. Three dosing regimens were assessed: 600 mg every 12 h (q12 h) as a 1-h infusion (standard dose) or 600 mg every 8 h (q8 h) as a 2-h infusion in virtual patients with normal renal function; and 400 mg q12 h as a 1-h infusion in patients with moderate renal impairment. Pharmacokinetic and microbiological data were obtained from the literature. The PTA and the cumulative fraction of response (CFR) were calculated by Monte Carlo simulation. In patients with normal renal function, the ceftaroline standard dose (600 mg q12 h as a 1-h infusion) can be sufficient to treat CABP due to ceftazidime-susceptible (CAZ-S) Escherichia coli, CAZ-S Klebsiella pneumoniae, meticillin-susceptible Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis (CFR>90%). However, against meticillin-resistant S. aureus (MRSA), the CFR was 72%. In cSSSI, the CFR was also <80% for MRSA. Administration of ceftaroline 600 mg q8 h as a 2-h infusion or 400 mg q12 h as a 1-h infusion in patients with moderate renal insufficiency provided a high probability of treatment success (CFR ca. 100%) for most micro-organisms causing CABP and cSSSI, including MRSA and penicillin-non-susceptible S. pneumoniae. These results suggest that in patients with normal renal function, ceftaroline 600 mg q8 h as a 2-h infusion may be a better option than the standard dose, especially if the MRSA rate is high.

  12. Vibrotactile Presentation of Musical Notes to the Glabrous Skin for Adults with Normal Hearing or a Hearing Impairment: Thresholds, Dynamic Range and High-Frequency Perception

    Science.gov (United States)

    Maté-Cid, Saúl; Fulford, Robert; Seiffert, Gary; Ginsborg, Jane

    2016-01-01

    Presentation of music as vibration to the skin has the potential to facilitate interaction between musicians with hearing impairments and other musicians during group performance. Vibrotactile thresholds have been determined to assess the potential for vibrotactile presentation of music to the glabrous skin of the fingertip, forefoot and heel. No significant differences were found between the thresholds for sinusoids representing notes between C1 and C6 when presented to the fingertip of participants with normal hearing and with a severe or profound hearing loss. For participants with normal hearing, thresholds for notes between C1 and C6 showed the characteristic U-shape curve for the fingertip, but not for the forefoot and heel. Compared to the fingertip, the forefoot had lower thresholds between C1 and C3, and the heel had lower thresholds between C1 and G2; this is attributed to spatial summation from the Pacinian receptors over the larger contactor area used for the forefoot and heel. Participants with normal hearing assessed the perception of high-frequency vibration using 1s sinusoids presented to the fingertip and were found to be more aware of transient vibration at the beginning and/or end of notes between G4 and C6 when stimuli were presented 10dB above threshold, rather than at threshold. An average of 94% of these participants reported feeling continuous vibration between G4 and G5 with stimuli presented 10dB above threshold. Based on the experimental findings and consideration of health effects relating to vibration exposure, a suitable range of notes for vibrotactile presentation of music is identified as being from C1 to G5. This is more limited than for human hearing but the fundamental frequencies of the human voice, and the notes played by many instruments, lie within it. However, the dynamic range might require compression to avoid the negative effects of amplitude on pitch perception. PMID:27191400

  13. Vibrotactile Presentation of Musical Notes to the Glabrous Skin for Adults with Normal Hearing or a Hearing Impairment: Thresholds, Dynamic Range and High-Frequency Perception.

    Directory of Open Access Journals (Sweden)

    Carl Hopkins

    Full Text Available Presentation of music as vibration to the skin has the potential to facilitate interaction between musicians with hearing impairments and other musicians during group performance. Vibrotactile thresholds have been determined to assess the potential for vibrotactile presentation of music to the glabrous skin of the fingertip, forefoot and heel. No significant differences were found between the thresholds for sinusoids representing notes between C1 and C6 when presented to the fingertip of participants with normal hearing and with a severe or profound hearing loss. For participants with normal hearing, thresholds for notes between C1 and C6 showed the characteristic U-shape curve for the fingertip, but not for the forefoot and heel. Compared to the fingertip, the forefoot had lower thresholds between C1 and C3, and the heel had lower thresholds between C1 and G2; this is attributed to spatial summation from the Pacinian receptors over the larger contactor area used for the forefoot and heel. Participants with normal hearing assessed the perception of high-frequency vibration using 1s sinusoids presented to the fingertip and were found to be more aware of transient vibration at the beginning and/or end of notes between G4 and C6 when stimuli were presented 10dB above threshold, rather than at threshold. An average of 94% of these participants reported feeling continuous vibration between G4 and G5 with stimuli presented 10dB above threshold. Based on the experimental findings and consideration of health effects relating to vibration exposure, a suitable range of notes for vibrotactile presentation of music is identified as being from C1 to G5. This is more limited than for human hearing but the fundamental frequencies of the human voice, and the notes played by many instruments, lie within it. However, the dynamic range might require compression to avoid the negative effects of amplitude on pitch perception.

  14. Frequent detection of papillomavirus DNA in clinically normal skin of cats infected and noninfected with feline immunodeficiency virus.

    Science.gov (United States)

    Munday, John S; Witham, Adrian I

    2010-06-01

    Feline cutaneous squamous cell carcinomas (SCCs) often contain felis domesticus papillomavirus type 2 (FdPV-2) DNA. While this may suggest FdPV-2 causes feline SCC development, the proportion of cats that are asymptomatically infected by this PV is unknown. Infection by feline immunodeficiency virus (FIV) is associated with high rates of cutaneous SCC development, possibly due to increased PV infection. This study examines the frequency of cutaneous asymptomatic FdPV-2 infections in cats and compares the rate of FdPV-2 infection in 22 FIV-positive cats with that in 22 FIV-negative cats. FdPV-2 sequences were detected in 39% of skin swabs. One or both swabs contained FdPV-2 DNA from 52% of the cats. FIV status, age or sex of the cat did not significantly influence FdPV-2 infection. Cats that shared a household with a PV-infected cat could remain uninfected suggesting infection depends more on host factors than exposure to the PV. These results indicate that asymptomatic FdPV-2 infections are common in cats, but do not provide evidence that FdPV-2 causes feline SCC development.

  15. Hair and skin sterols in normal mice and those with deficient dehydrosterol reductase (DHCR7), the enzyme associated with Smith-Lemli-Opitz syndrome

    Science.gov (United States)

    Serra, Montserrat; Matabosch, Xavier; Ying, Lee; Watson, Gordon; Shackleton, Cedric

    2010-01-01

    Our recent studies have focused on cholesterol synthesis in mouse models for 7-dehydrosterolreductase (DHCR7) deficiency, also known as Smith-Lemli-Opitz syndrome. Investigations of such mutants have relied on tissue and blood levels of the cholesterol precursor 7-dehydrocholesterol (7DHC) and its 8-dehydro isomer. In this investigation by gas chromatography/mass spectrometry (GC/MS) we have identified and quantified cholesterol and its precursors (7DHC, desmosterol, lathosterol, lanosterol and cholest-7,24-dien-3β-ol) in mouse hair. The components were characterized and their concentrations were compared to those found in mouse skin and serum. Hair appeared unique in that desmosterol was a major sterol component, almost matching in concentration cholesterol itself. In DHCR7 deficient mice, dehydrodesmosterol (DHD) was the dominant hair Δ7 sterol. Mutant mouse hair had much higher concentrations of 7-dehydrosterols relative to cholesterol than did serum or tissue at all ages studied. The 7DHC/C ratio in hair was typically about sevenfold the value in serum or skin and the DHD/D ratio was 100X that of the serum 7DHC/C ratio. Mutant mice compensate for their DHCR7 deficiency with maturity, and the tissue and blood 7DHC/C become close to normal. That hair retains high relative concentrations of the dehydro precursors suggests that the apparent up-regulation of Dhcr7 seen in liver is slower to develop at the site of hair cholesterol synthesis. PMID:20804844

  16. Practices Surrounding Event Photos

    NARCIS (Netherlands)

    Vyas, Dhaval; Nijholt, Antinus; van der Veer, Gerrit C.; Kotzé, P.; Marsden, G.; Lindgaard, G.; Wesson, J.; Winckler, M.

    Sharing photos through mobile devices has a great potential for creating shared experiences of social events between co-located as well as remote participants. In order to design novel event sharing tools, we need to develop indepth understanding of current practices surrounding these so called

  17. Quantification of Sunscreen Ethylhexyl Triazone in Topical Skin-Care Products by Normal-Phase TLC/Densitometry

    Directory of Open Access Journals (Sweden)

    Anna W. Sobanska

    2012-01-01

    Full Text Available Ethylhexyl triazone (ET was separated from other sunscreens such as avobenzone, octocrylene, octyl methoxycinnamate, and diethylamino hydroxybenzoyl hexyl benzoate and from parabens by normal-phase HPTLC on silica gel 60 as stationary phase. Two mobile phases were particularly effective: (A cyclohexane-diethyl ether 1 : 1 (v/v and (B cyclohexane-diethyl ether-acetone 15 : 1 : 2 (v/v/v since apart from ET analysis they facilitated separation and quantification of other sunscreens present in the formulations. Densitometric scanning was performed at 300 nm. Calibration curves for ET were nonlinear (second-degree polynomials, with R > 0.998. For both mobile phases limits of detection (LOD were 0.03 and limits of quantification (LOQ 0.1 μg spot−1. Both methods were validated.

  18. Sagging Skin

    Science.gov (United States)

    ... Skin Scars Skin Growths Skin Lesions Spider Veins Stretch Marks Sun-damaged Skin Unwanted Hair Unwanted Tattoos Varicose ... Skin Scars Skin Growths Skin Lesions Spider Veins Stretch Marks Sun-damaged Skin Unwanted Hair Unwanted Tattoos Varicose ...

  19. Suitability of single tissue dielectric constant measurements to assess local tissue water in normal and lymphedematous skin.

    Science.gov (United States)

    Mayrovitz, Harvey N; Davey, Suzanne; Shapiro, Elizabeth

    2009-04-01

    Previous reports described the use of average tissue dielectric constant (TDC) measurements to assess local tissue water and its change. Our goal was to determine if a single TDC measurement could be used in place of the average of multiple measurements. The comparison criteria used to test this was the extent to which single and averaged measurements yielded similar TDC values in both normal and lymphedematous tissue. Measurements were made in two groups of women; a control group (n = 20) and a group with unilateral arm lymphedema (n = 10). In the control group, TDC was measured to multiple depths (0.5-5.0 mm) on both ventral forearms and to a depth of 2.5 mm on the lateral thorax on both body sides. In the lymphedematous group, TDC was measured on both ventral forearms to a depth of 2.5 mm. Results showed that the 95% confidence interval for differences between single and averaged TDC values was less than +/-1 TDC unit and that the limits of agreement between methods was less than +/-2.5 TDC units (+/-6.5%) for each condition, site and depth measured. This finding suggests that where this level of agreement is acceptable suitable clinical assessments can be made using a single TDC measurement.

  20. 轻中度痤疮患者痤疮部位与正常部位皮肤生理参数的差异%Differences of physiological indicators between healthy normal skin and acne site of mild and moderateacne patients

    Institute of Scientific and Technical Information of China (English)

    陶宇; 王艳东; 李杰; 杨雪松

    2016-01-01

    目的:研究轻中度痤疮患者痤疮部位与健康正常皮肤部位生理指标的差异。方法选取75例痤疮患者检测痤疮部位皮脂分泌量、表皮含水量、皮肤pH值。另外检测63例轻中度痤疮患者痤疮部位与痤疮周围10 cm健康皮肤部位的皮脂分泌量、表皮含水量、皮肤pH值。结果根据每个痤疮患者痤疮部位皮脂分泌量增多、表皮含水量减少的程度不同,可分为轻中重度痤疮;轻中度痤疮患者痤疮部位与健康皮肤比较,痤疮部位皮脂分泌量显著高于周围健康皮肤(t=2.786,P=0.006<0.05),表皮角质层含水量明显低于皮肤健康部位(t=2.648,P=0.009<0.05),痤疮部位皮肤pH值与健康皮肤相比减小(t=3.028,P=0.003<0.05)。结论轻中度痤疮患者痤疮部位与其周围10 cm健康部位比较,皮脂分泌量显著增多、表皮含水量明显降低、皮肤pH值下降。%Objective To investigate the differences of physiological indicators between healthy normal skin and acne site of mild and moderate acne patients. Methods The 75 acne patients were enrolled in this study. Sebum secretion, moisture of skin, and skin PH value in acne site and the surrounding 10cm healthy skin of the 63 mild and moderate acne patients were tested. Results According to the different degree of an increase of sebum secretion, a reduction of skin moisture content in acne site of each acne patient, the acne were divided into the mild, moderate and severe acne. Sebum secretion of the mild and moderate acne was significantly higher than the healthy skin ( t=2.786,P=0.006,P<0.05) , moisture of skin was lower than the control ( t=2.648,P=0.009,P<0.05), skin PH value was decreased (t=3.028,P=0.003,P<0.05). Conclusions Compared the acne site with the surrounding 10cm healthy skin of the mild and moderate acne, we find the amount of sebum secretion increased significantly, the skin moisture content decreased, the skin pH value decreased.

  1. Expression of iNOS, CD163 and ARG-1 taken as M1 and M2 markers of microglial polarization in human glioblastoma and the surrounding normal parenchyma.

    Science.gov (United States)

    Lisi, L; Ciotti, G M P; Braun, D; Kalinin, S; Currò, D; Dello Russo, C; Coli, A; Mangiola, A; Anile, C; Feinstein, D L; Navarra, P

    2017-04-03

    Microglia and macrophages appear to be the most common cells in the GBM microenvironment. In the present study we investigated the status of macrophages/microglia activation in surgical specimens from 41 patients diagnosed with grade IV GBM. For each patient we analyzed both the center of tumor and the parenchyma surrounding the tumor. The specimens were stained for: i) IBA1, a 17-kDa EF hand protein specifically expressed in microglia/macrophages ii) CD163, a cell surface antigen associated with M2 phenotype; iii) iNOS, taken as a functional marker of M1 phenotype, and iv) ARG-I, taken as a functional marker of M2 phenotype. Staining was scored in a double-blinded score on a scale from 0 to 5. Our results suggest that CD163 expression is higher within the tumor than in surrounding periphery in both male and female patients; while iNOS is higher within the tumor in males, no significant difference was found for ARG-1. In addition, analyzing the data in TGCA database, we found that CD163 expression was significantly and inversely correlated with mean survival times, with average survival times ranging from 448days in patients having low expression, to 319 in mid, and 353 in patients with high CD163 expressing tumors. In contrast, no significant association was found between survival time and ARG-1 or iNOS expression. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Reduced surround inhibition in musicians.

    Science.gov (United States)

    Shin, Hae-Won; Kang, Suk Y; Hallett, Mark; Sohn, Young H

    2012-06-01

    To investigate whether surround inhibition (SI) in the motor system is altered in professional musicians, we performed a transcranial magnetic stimulation (TMS) study in 10 professional musicians and 15 age-matched healthy non-musicians. TMS was set to be triggered by self-initiated flexion of the index finger at different intervals ranging from 3 to 1,000 ms. Average motor evoked potential (MEP) amplitudes obtained from self-triggered TMS were normalized to average MEPs of the control TMS at rest and expressed as a percentage. Normalized MEP amplitudes of the abductor digiti minimi (ADM) muscles were compared between the musicians and non-musicians with the primary analysis being the intervals between 3 and 80 ms (during the movement). A mixed-design ANOVA revealed a significant difference in normalized ADM MEPs during the index finger flexion between groups, with less SI in the musicians. This study demonstrated that the functional operation of SI is less strong in musicians than non-musicians, perhaps due to practice of movement synergies involving both muscles. Reduced SI, however, could lead susceptible musicians to be prone to develop task-specific dystonia.

  3. of the stomach (ID 345), neutralisation of gastric acid (ID 345), contribution to normal formation of collagen and connective tissue (ID 287, 288, 333, 334, 335, 1405, 1652, 1718, 1719, 1945), maintenance of normal bone (ID 287, 335, 1652, 1718, 1945), maintenance of normal joints (ID 1405, 1652, 1945, ), maintenance of normal appearance and elasticity of the skin (ID 288, 333), and contribution to normal formation of hair and nails (ID 334, 1652, 1719) pursuant to Article 13(1) of Regulation (EC) No 1924/2006

    DEFF Research Database (Denmark)

    Tetens, Inge

    claims in relation to silicon and protection against aluminium accumulation in the brain, cardiovascular health, forming a protective coat on the mucous membrane of the stomach, neutralisation of gastric acid, contribution to normal formation of collagen and connective tissue, maintenance of normal bone......, maintenance of normal joints, maintenance of normal appearance and elasticity of the skin, and contribution to normal formation of hair and nails. The scientific substantiation is based on the information provided by the Member States in the consolidated list of Article 13 health claims and references...

  4. Effects of sulfate deprivation on the production of chondroitin/dermatan sulfate by cultures of skin fibroblasts from normal and diabetic individuals

    Energy Technology Data Exchange (ETDEWEB)

    Silbert, C.K.; Humphries, D.E.; Palmer, M.E.; Silbert, J.E. (Veterans Administration Outpatient Clinic, Boston, MA (USA))

    1991-02-15

    Human skin fibroblast monolayer cultures from two normal men, three Type I diabetic men, and one Type I diabetic woman were incubated with (3H)glucosamine in the presence of diminished concentrations of sulfate. Although total synthesis of (3H)chondroitin/dermatan glycosaminoglycans varied somewhat between cell lines, glycosaminoglycan production was not affected within any line when sulfate levels were decreased from 0.3 mM to 0.06 mM to 0.01 mM to 0 added sulfate. Lowering of sulfate concentrations resulted in diminished sulfation of chondroitin/dermatan in a progressive manner, so that overall sulfation dropped to as low as 19% for one of the lines. Sulfation of chondroitin to form chondroitin 4-sulfate and chondroitin 6-sulfate was progressively and equally affected by decreasing the sulfate concentration in the culture medium. However, sulfation to form dermatan sulfate was preserved to a greater degree, so that the relative proportion of dermatan sulfate to chondroitin sulfate increased. Essentially all the nonsulfated residues were susceptible to chondroitin AC lyase, indicating that little epimerization of glucuronic acid residues to iduronic acid had occurred in the absence of sulfation. These results confirm the previously described dependency of glucuronic/iduronic epimerization on sulfation, and indicate that sulfation of the iduronic acid-containing disaccharide residues of dermatan can take place with sulfate concentrations lower than those needed for 6-sulfation and 4-sulfation of the glucuronic acid-containing disaccharide residues of chondroitin. There were considerable differences among the six fibroblast lines in susceptibility to low sulfate medium and in the proportion of chondroitin 6-sulfate, chondroitin 4-sulfate, and dermatan sulfate. However, there was no pattern of differences between normals and diabetics.

  5. Comprehensive two-dimensional normal-phase liquid chromatography × reversed-phase liquid chromatography for analysis of toad skin.

    Science.gov (United States)

    Li, Jia-Fu; Yan, Xia; Wu, Yun-Long; Fang, Mei-Juan; Wu, Zhen; Qiu, Ying-Kun

    2017-04-15

    An analytical two-dimensional normal-phase liquid chromatography × reversed-phase liquid chromatography (2D NPLC × RPLC) system was constructed with a newly developed thermal evaporation assisted adsorption (TEAA) interface. This novel TEAA interface with heating temperature above solvent boiling point allowed fast removal of organic NPLC solvent and successfully solved the solvent incompatibility problem between NPLC and RPLC. The system achieved rapid on-line solvent exchange between the two dimensions within a short modulation time of 190 s and was applied in the analysis of an extract from the skin of Bufo bufo gargarizans. This is the first time to realize the on-line comprehensive analysis of a moderate polar natural product by coupling NPLC with reversed phase ultra-high performance liquid chromatography (UHPLC). To be highlighted, with the TEAA interface, the 2D NPLC × RPLC system provided excellent resolution and orthogonality (75.2%), when compared with that of 2D RPLC × RPLC.

  6. The Use of Matriderm and Autologous Skin Graft in the Treatment of Full Thickness Skin Defects

    Directory of Open Access Journals (Sweden)

    Jang Hwan Min

    2014-07-01

    Full Text Available Background For patients with full thickness skin defects, autologous Split-thickness skin grafts (STSG are generally regarded as the mainstay of treatment. However, skin grafts have some limitations, including undesirable outcomes resulting from scars, poor elasticity, and limitations in joint movement due to contractures. In this study, we present outcomes of Matriderm grafts used for various skin tissue defects whether it improves on these drawbacks. Methods From January 2010 to March 2012, a retrospective review of patients who had undergone autologous STSG with Matriderm was performed. We assessed graft survival to evaluate the effectiveness of Matriderm. We also evaluated skin quality using a Cutometer, Corneometer, Tewameter, or Mexameter, approximately 12 months after surgery. Results A total of 31 patients underwent STSG with Matriderm during the study period. The success rate of skin grafting was 96.7%. The elasticity value of the portion on which Matriderm was applied was 0.765 (range, 0.635-0.800, the value of the trans-epidermal water loss (TEWL was 10.0 (range, 8.15-11.00 g/hr/m2, and the humidification value was 24.0 (range, 15.5-30.0. The levels of erythema and melanin were 352.0 arbitrary unit (AU (range, 299.25-402.75 AU and 211.0 AU (range, 158.25-297.00 AU, respectively. When comparing the values of elasticity and TEWL of the skin treated with Matriderm to the values of the surrounding skin, there was no statistically significant difference between the groups. Conclusions The results of this study demonstrate that a dermal substitute (Matriderm with STSG was adopted stably and with minimal complications. Furthermore, comparing Matriderm grafted skin to normal skin using Cutometer, Matriderm proved valuable in restoring skin elasticity and the skin barrier.

  7. Psychoneuroimmunology and the Skin.

    Science.gov (United States)

    Honeyman, Juan F

    2016-08-23

    The nervous, immune, endocrine and integumentary systems are closely related and interact in a number of normal and pathological conditions. Nervous system mediators may bring about direct changes to the skin or may induce the release of immunological or hormonal mediators that cause pathological changes to the skin. This article reviews the psychological mechanisms involved in the development of skin diseases.

  8. Presence of non-fibrillar amyloid beta protein in skin biopsies of Alzheimer's disease (AD), Down's syndrome and non-AD normal persons

    DEFF Research Database (Denmark)

    Wen, G Y; Wisniewski, H M; Blondal, H

    1994-01-01

    A total of 66 skin biopsies from persons with Alzheimer's disease (AD) or Down's syndrome (DS) and from persons without AD were used in this study. The age range was from 7 to 89 years. Positive immunoreactivity of skin biopsies to monoclonal antibody 4G8, which is reactive to amino acid residue 17...

  9. Skin Diseases: Skin Health and Skin Diseases

    Science.gov (United States)

    Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Skin Health and Skin Diseases Past Issues / Fall 2008 Table of Contents ... acne to wrinkles Did you know that your skin is the largest organ of your body? It ...

  10. 超声生物显微镜在正常人及银屑病患者皮肤研究中的应用%Application of ultrasound biomicroscopy on skin assessment in normal adults and psoriasis patients

    Institute of Scientific and Technical Information of China (English)

    李硕; 梁晓宁; 张岩; 刘翠霞; 黄雅丽; 卢瑞刚; 郭瑞君

    2015-01-01

    ObjectiveTo investigate the features of normal and psoriasis skin on ultrasound biomicroscopy (UBM) and explore the method of thickness measurement.MethodsUsing 50 MHz ultrasound probe of biological microscope, ultrasonographic observation and ultrasonic thickness measurement were conducted in 90 normal adults and 40 psoriasis patients. Innormal patients, ultrasound evaluations were performed at 10 different parts of the body skin.ResultsOn sonogram, the normal skin showed a “sandwich” structure with two parallel hyperechoic bands and the middle isoechoic dots and short liens. The sonograms of the psoriasis skin showed obviously thickened epidermis and dermis, disordered internal structure and clear boundary from adjacent normal skin. The range of the epidermis’ thickness measurement was between the medial forearm (0.12±0.03) mm and the palm (0.29±0.15) mm. The range of dermal thickness measurement was between the back hand (1.18±0.32) mm and parasternal (1.55±0.21) mm. Psoriasis skin was thicker than the uninvolved skin (P<0.001). And the dermis’ thickness of uninvolved skin in psoriasis patients was thicker than that of the normal adults (P<0.001).ConclusionNormal adult’s epidermis, dermis and skin appendages can be shown clearly using 50 MHz ultrasound biomicroscopy. And ultrasound biomicroscopy canaccurately measure the thickness of dermis and epidermis, which provides the basis for the diagnosis and treatment of psoriasis.%目的探讨正常人皮肤及银屑病患者皮肤超声生物显微镜声像图特征及厚度测量方法。方法使用50 MHz探头的超声生物显微镜,对90例正常成人全身10个不同部位的皮肤以及40例银屑病患者皮肤进行声像观察及超声测厚。结果正常皮肤声像图表现为两条平行的强回声细带,中间为密集点状中等回声及稍强线样回声带。银屑病患者皮肤声像图表现为表皮、真皮明显增厚,结构紊乱,与正常皮肤界限清晰。测量

  11. A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Madsen, Peder; Rasmussen, H H

    1991-01-01

    proteins in alphabetical order), "basal cell markers", "differentiation markers", "proteins highly up-regulated in psoriatic skin", "microsequenced proteins" and "human autoantigens". For reference, we have also included 2-D gel (isoelectric focusing) patterns of cultured normal and psoriatic keratinocytes......A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved...

  12. Aquaporins in the Skin.

    Science.gov (United States)

    Patel, Ravi; Kevin Heard, L; Chen, Xunsheng; Bollag, Wendy B

    2017-01-01

    The skin is the largest organ of the body, serving as an important barrier between the internal milieu and the external environment. The skin is also one of the first lines of defense against microbial infection and other hazards, and thus, the skin has important immune functions . This organ is composed of many cell types, including immune-active dendritic cells (epidermal Langerhans cells and dermal dendritic cells), connective tissue-generating dermal fibroblasts and pigment-producing melanocytes. Comprising the outer skin layer are the epidermal keratinocytes, the predominant cell of this layer, the epidermis , which provides both a mechanical barrier and a water -permeability barrier. Recent data suggest that aquaporins, a family of barrel-shaped proteins surrounding internal pores that allow the passage of water and, in some family members, small solutes such as glycerol , play critical roles in regulating various skin parameters. The involvement of different aquaporin family members in skin function is discussed.

  13. Clinical Application of Surrounding Puncture

    Institute of Scientific and Technical Information of China (English)

    GUO Yao-jie; HAN Chou-ping

    2003-01-01

    Surrounding puncture can stop pathogenic qi from spreading, consolidate the connection between local meridians and enrich local qi and blood, which can eventually supplement anti-pathogenic qi and remove pathogenic qi, and consequently remedy diseases. The author of this article summrized and analyzed the clinical application of surrounding puncture for the purpose of studying this technique and improving the therapeutic effect.

  14. 脂多糖对正常人皮肤成纤维细胞胶原合成的影响%Influence of lipopolysaccharide on the collagen synthesis of normal human skin fibroblasts

    Institute of Scientific and Technical Information of China (English)

    纪少军; 万立; 李凤玉; 贾国洪; 闫永宏; 石军

    2012-01-01

    Objective: To investigate the influence of lipopolysaccharide ( LPS ) on the collagen synthesis of normal human skin fibroblasts and its relation with wound healing. Methods: Normal skin fibroblasts were exposed to LPS for a certain period of time. Then the collagen synthesis of fibroblasts in culture medium was measured with the method of pepsin digestion after incorporation of H-proline into stable, single-layered, confluent fibroblasts. Results: Collagen synthesis of normal skin fibroblasts increased when challenged with LPS at the concentration of 0.005 μg·ml‐1 , and the increase showed a concentration dependent manner. However, when the concentration of LPS was 0. 5 μg·ml‐1 ,the influence of LPS on the collagen synthesis of normal skin fibroblasts began to decrease; when the concentration of LPS reached 1.0 μg·ml‐1 , collagen synthesis of fibroblasts were inhibited. Conclusion: LPS could promote collagen synthesis of normal human skin fibroblasts within a certain extent, suggesting that LPS might play an important role in wound healing.%目的:研究脂多糖(lipopolysaccharide,LPS)对正常人皮肤成纤维细胞胶原合成的影响,以阐明LPS在皮肤创伤愈合中的可能作用.方法:体外培养正常人皮肤成纤维细胞,采用3H-脯氨酸掺入法观察不同浓度(0、0.005、0.01、0.05、0.1、0.5和1.0 μg·ml-1)的LPS对成纤维细胞胶原合成的影响.结果:LPS刺激浓度在0.005 μg·ml-1时,皮肤成纤维细胞胶原蛋白合成增加;随着刺激浓度增加,刺激作用增强;但当LPS浓度为0.5 μg·ml-1时,促胶原合成作用开始降低;当浓度达到1.0 μg·ml-1时则呈现抑制效应.结论:在一定浓度范围内LPS促进成纤维细胞胶原合成,表明LPS在皮肤创伤愈合中可能具有重要作用.

  15. Visual surround suppression in schizophrenia

    Directory of Open Access Journals (Sweden)

    Marc Samuel Tibber

    2013-02-01

    Full Text Available Compared to unaffected observers patients with schizophrenia show characteristic differences in visual perception, including a reduced susceptibility to the influence of context on judgements of contrast - a manifestation of weaker surround suppression. To examine the generality of this phenomenon we measured the ability of 24 individuals with schizophrenia to judge the luminance, contrast, orientation and size of targets embedded in contextual surrounds that would typically influence the target’s appearance. Individuals with schizophrenia demonstrated weaker surround suppression compared to matched controls for stimuli defined by contrast or size, but not for those defined by luminance or orientation. As perceived luminance is thought to be regulated at the earliest stages of visual processing our findings are consistent with a suppression deficit that is predominantly cortical in origin. In addition, we propose that preserved orientation surround suppression in schizophrenia may reflect the sparing of broadly tuned mechanisms of suppression. We attempt to reconcile these data with findings from previous studies.

  16. Educational Success and Surrounding Culture

    Science.gov (United States)

    Walters, Garrison

    2016-01-01

    The curriculum, instruction, and services we provide in schools, colleges, and universities matter a lot, but if we continue to ignore our students' "surrounding culture," progress toward a more educated nation will continue to be disappointing.

  17. Educational Success and Surrounding Culture

    Science.gov (United States)

    Walters, Garrison

    2016-01-01

    The curriculum, instruction, and services we provide in schools, colleges, and universities matter a lot, but if we continue to ignore our students' "surrounding culture," progress toward a more educated nation will continue to be disappointing.

  18. Multichannel spatial surround sound system

    Institute of Scientific and Technical Information of China (English)

    RAO Dan; XIE Bosun

    2004-01-01

    Based on the consideration of being compatible with 5.1 channel horizontal surround sound system, a spatial surround sound system is proposed. Theoretical and experimental results show that the system has a wide listening area. It can not only recreate stable image in the front and rear direction, but also eliminate the defect of poor lateral image of 5.1 channel system. The system can be used to reproduce special 3D sound effect and the spaciousness of hall.

  19. Your Skin

    Science.gov (United States)

    ... Room? What Happens in the Operating Room? Your Skin KidsHealth > For Kids > Your Skin Print A A ... are really dead skin cells. continue Bye-Bye Skin Cells These old cells are tough and strong, ...

  20. Presence of non-fibrillar amyloid beta protein in skin biopsies of Alzheimer's disease (AD), Down's syndrome and non-AD normal persons

    DEFF Research Database (Denmark)

    Wen, G Y; Wisniewski, H M; Blondal, H;

    1994-01-01

    A total of 66 skin biopsies from persons with Alzheimer's disease (AD) or Down's syndrome (DS) and from persons without AD were used in this study. The age range was from 7 to 89 years. Positive immunoreactivity of skin biopsies to monoclonal antibody 4G8, which is reactive to amino acid residue 17....../38 (37%) non-AD control cases. The Fisher exact probability test revealed a significant difference (P = 0.0415 one-tailed) in immunoreactivity between AD and age-matched controls. There was also a significant difference (P = 0.0152 one-tailed; P = 0.0200 two-tailed) between DS and age-matched control...

  1. Skin graft - slideshow

    Science.gov (United States)

    ... ency/presentations/100100.htm Skin graft - series—Normal anatomy To use the sharing features on this page, ... 2017 Updated by: Debra G. Wechter, MD, FACS, general surgery practice specializing in breast cancer, Virginia Mason ...

  2. Fractionated illumination after topical application of 5-aminolevulinic acid on normal skin of hairless mice: the influence of the dark interval.

    Science.gov (United States)

    de Bruijn, H S; van der Ploeg-van den Heuvel, A; Sterenborg, H J C M; Robinson, D J

    2006-12-01

    We have previously shown that light fractionation during topical aminolevulinic acid based photodynamic therapy (ALA-PDT) with a dark interval of 2h leads to a significant increase in efficacy in both pre-clinical and clinical PDT. However this fractionated illumination scheme required an extended overall treatment time. Therefore we investigated the relationship between the dark interval and PDT response with the aim of reducing the overall treatment time without reducing the efficacy. Five groups of mice were treated with ALA-PDT using a single light fraction or the two-fold illumination scheme with a dark interval of 30 min, 1, 1.5 and 2h. Protoporphyrin IX fluorescence kinetics were monitored during illumination. Visual skin response was monitored in the first seven days after PDT and assessed as PDT response. The PDT response decreases with decreasing length of the dark interval. Only the dark interval of 2h showed significantly more damage compared to all the other dark intervals investigated (Pdark interval used. We conclude that in the skin of the hairless mouse the dark interval cannot be reduced below 2h without a significant reduction in PDT efficacy.

  3. The Interstellar Cloud Surrounding the Solar System

    Science.gov (United States)

    Frisch, P. C.

    Ultraviolet spectral data of nearby stars indicate that the cloud surrounding the solar system has an average neutral density n(HI)~0.1 cm-3, temperature ~6800 K, and turbulence ~1.7 km/s. Comparisons between the anomalous cosmic ray data and ultraviolet data suggest that the electron density is in the range n(e-)~0.22 to 0.44 cm-3. This cloud is flowing past the Sun from a position centered in the Norma-Lupis region. The cloud properties are consistent with interstellar gas which originated as material evaporated from the surfaces of embedded clouds in the Scorpius-Centaurus Association, and which was then displaced towards the Sun by a supernova event about 4 Myrs ago. The Sun and surrounding cloud velocities are nearly perpendicular in space, and this cloud is sweeping past the Sun. The morphology of this cloud can be reconstructed by assuming that the cloud moves in a direction parallel to the surface normal. With this assumption, the Sun entered the surrounding cloud 2000 to 8000 years ago, and is now about 0.05 to 0.16 pc from the cloud surface. Prior to its recent entry into the surrounding cloud complex, the Sun was embedded in a region of space with average density lower than 0.0002 cm-3. If a denser cloud velocity component seen towards alpha Cen A,B is real, it will encounter the solar system within 50,000 yr. The nearby magnetic field seen upwind has a spatial orientation that is parallel to the cloud surface. The nearby star Sirius is viewed through the wake of the solar system, but this direction also samples the hypothetical cloud interface. Comparisons of anomalous cosmic ray and interstellar absorption line data suggest that trace elements in the surrounding cloud are in ionization equilibrium. Data towards nearby white dwarfs indicate partial helium ionization, N(N(HI)(/N(HeI)>~13.7, which is consistent with pickup ion data within the solar system if less than 40% hydrogen ionization occurs in the heliopause region. However, the white dwarfs may

  4. The biochemical basis of changes in normal and mutant human skin fibroblasts during ageing in culture : an investigation into the free radical theory of ageing

    NARCIS (Netherlands)

    M. Poot

    1989-01-01

    textabstractFrom the pattern of inheritance of normal ageing, this process inevitably results from either abnormal aggregation of subunits of enzymes, abnormal feedback inhibition of enzymes, receptor mutations, membrane defects, or deposition of abnormal fibrillar proteins (Vogel and Motulsky, 1986

  5. Skin Biopsy

    Science.gov (United States)

    ... I Help Someone Who's Being Bullied? Volunteering Skin Biopsy KidsHealth > For Teens > Skin Biopsy Print A A ... español Biopsia de piel What Is a Skin Biopsy and Who Would Need One? In a biopsy, ...

  6. Skin Conditions

    Science.gov (United States)

    Your skin is your body's largest organ. It covers and protects your body. Your skin Holds body fluids in, preventing dehydration Keeps harmful ... it Anything that irritates, clogs, or inflames your skin can cause symptoms such as redness, swelling, burning, ...

  7. Visual Surround Suppression in Schizophrenia

    Science.gov (United States)

    Tibber, Marc S.; Anderson, Elaine J.; Bobin, Tracy; Antonova, Elena; Seabright, Alice; Wright, Bernice; Carlin, Patricia; Shergill, Sukhwinder S.; Dakin, Steven C.

    2013-01-01

    Compared to unaffected observers patients with schizophrenia (SZ) show characteristic differences in visual perception, including a reduced susceptibility to the influence of context on judgments of contrast – a manifestation of weaker surround suppression (SS). To examine the generality of this phenomenon we measured the ability of 24 individuals with SZ to judge the luminance, contrast, orientation, and size of targets embedded in contextual surrounds that would typically influence the target’s appearance. Individuals with SZ demonstrated weaker SS compared to matched controls for stimuli defined by contrast or size, but not for those defined by luminance or orientation. As perceived luminance is thought to be regulated at the earliest stages of visual processing our findings are consistent with a suppression deficit that is predominantly cortical in origin. In addition, we propose that preserved orientation SS in SZ may reflect the sparing of broadly tuned mechanisms of suppression. We attempt to reconcile these data with findings from previous studies. PMID:23450069

  8. Skin abscess

    Science.gov (United States)

    Abscess - skin; Cutaneous abscess; Subcutaneous abscess; MRSA - abscess; Staph infection - abscess ... Skin abscesses are common and affect people of all ages. They occur when an infection causes pus ...

  9. Texture analysis of collagen second-harmonic generation images based on local difference local binary pattern and wavelets differentiates human skin abnormal scars from normal scars.

    Science.gov (United States)

    Liu, Yao; Zhu, Xiaoqin; Huang, Zufang; Cai, Jianyong; Chen, Rong; Xiong, Shuyuan; Chen, Guannan; Zeng, Haishan

    2015-01-01

    Quantitative methods for noninvasive diagnosis of scars are a challenging issue in medicine. This work aims to implement a texture analysis method for quantitatively discriminating abnormal scars from normal scars based on second-harmonic generation (SHG) images. A local difference local binary pattern (LD-LBP) operator combined with a wavelet transform was explored to extract diagnosis features from scar SHG images that were related to the alteration in collagen morphology. Based on the quantitative parameters including the homogeneity, directional and coarse features in SHG images, the scar collagen SHG images were classified into normal or abnormal scars by a support vector machine classifier in a leave-one-out cross-validation procedure. Our experiments and data analyses demonstrated apparent differences between normal and abnormal scars in terms of their morphological structure of collagen. By comparing with gray level co-occurrence matrix, wavelet transform, and combined basic local binary pattern and wavelet transform with respect to the accuracy and receiver operating characteristic analysis, the method proposed herein was demonstrated to achieve higher accuracy and more reliable classification of SHG images. This result indicated that the extracted texture features with the proposed method were effective in the classification of scars. It could provide assistance for physicians in the diagnostic process.

  10. Skin Infections

    Science.gov (United States)

    ... Old Feeding Your 8- to 12-Month-Old Feeding Your 1- to 2-Year-Old First Aid: Skin ... (bacterial infection of the deeper layers of the skin and tissues beneath) are typical childhood skin infections. The usual bacterial culprits in skin ...

  11. Effect of Equal Daily Doses Achieved by Different Power Densities of Low-Level Laser Therapy at 635 nm on Open Skin Wound Healing in Normal and Diabetic Rats

    Directory of Open Access Journals (Sweden)

    Róbert Kilík

    2014-01-01

    Full Text Available Background and Objective. Despite the fact that the molecular mechanism of low-level laser therapy (LLLT is not yet known, the exploitation of phototherapy in clinical medicine and surgery is of great interest. The present study investigates the effects of LLLT on open skin wound healing in normal and diabetic rats. Materials and Methods. Four round full-thickness skin wounds on dorsum were performed in male adult nondiabetic (n=24 and diabetic (n=24 Sprague–Dawley rats. AlGaInP (635 nm, wavelength; 5 J/cm2, daily dose was used to deliver power densities of 1, 5, and 15 mW/cm2 three times daily until euthanasia. Results. PMNL infiltration was lower in the irradiated groups (15 mW/cm2. The synthesis and organisation of collagen fibres were consecutively enhanced in the 5 mW/cm2 and 15 mW/cm2 groups compared to the others in nondiabetic rats. In the diabetic group the only significant difference was recorded in the ratio PMNL/Ma at 15 mW/cm2. A significant difference in the number of newly formed capillaries in the irradiated group (5, 15 mW/cm2 was recorded on day six after injury compared to the control group. Conclusion. LLLT confers a protective effect against excessive inflammatory tissue response; it stimulates neovascularization and the early formation of collagen fibres.

  12. Fluorescence photobleaching of ALA and ALA-heptyl ester induced protoporphyrin IX during photodynamic therapy of normal hairless mouse skin: a comparison of two light sources and different illumination schemes.

    Science.gov (United States)

    Pudroma, Xiao; Juzeniene, Asta; Ma, Li-Wei; Iani, Vladimir; Moan, Johan

    2011-01-01

    This study investigated photobleaching of protoporphyrin IX (PpIX) induced by 5-aminolevulinic acid (ALA) and ALA-heptyl ester during superficial photodynamic therapy (PDT) in normal skin of the female BALB/c-nu/nu athymic mouse. We examined the effects of two light sources (laser and broadband lamp) and two different illumination schemes (fractionated light and continuous irradiation) on the kinetics of photobleaching. Our results show that light exposure (0-30 minutes, 10 mW/cm2) of wavelengths of approximately 420 nm (blue light) and 635 nm (red light) induced time-dependent PpIX photobleaching for mouse skin of 2% ALA and ALA-heptyl ester. Blue light (10 mW/cm2) caused more rapid PpIX photobleaching than did red light (100 mW/cm2), which is attributed to stronger absorption at 407 nm than at 632 nm for PpIX. In the case of light fractionation, fractionated light induced faster photobleaching compared with continuous light exposure after topical application of 2% ALA and ALA-heptyl ester in vivo. These have been suggested to allow reoxygenation of the irradiated tissue, with a consequent enhancement of singlet oxygen production in the second and subsequent fractions.

  13. Skin Biomes.

    Science.gov (United States)

    Fyhrquist, N; Salava, A; Auvinen, P; Lauerma, A

    2016-05-01

    The cutaneous microbiome has been investigated broadly in recent years and some traditional perspectives are beginning to change. A diverse microbiome exists on human skin and has a potential to influence pathogenic microbes and modulate the course of skin disorders, e.g. atopic dermatitis. In addition to the known dysfunctions in barrier function of the skin and immunologic disturbances, evidence is rising that frequent skin disorders, e.g. atopic dermatitis, might be connected to a dysbiosis of the microbial community and changes in the skin microbiome. As a future perspective, examining the skin microbiome could be seen as a potential new diagnostic and therapeutic target in inflammatory skin disorders.

  14. An elastic second skin

    Science.gov (United States)

    Yu, Betty; Kang, Soo-Young; Akthakul, Ariya; Ramadurai, Nithin; Pilkenton, Morgan; Patel, Alpesh; Nashat, Amir; Anderson, Daniel G.; Sakamoto, Fernanda H.; Gilchrest, Barbara A.; Anderson, R. Rox; Langer, Robert

    2016-08-01

    We report the synthesis and application of an elastic, wearable crosslinked polymer layer (XPL) that mimics the properties of normal, youthful skin. XPL is made of a tunable polysiloxane-based material that can be engineered with specific elasticity, contractility, adhesion, tensile strength and occlusivity. XPL can be topically applied, rapidly curing at the skin interface without the need for heat- or light-mediated activation. In a pilot human study, we examined the performance of a prototype XPL that has a tensile modulus matching normal skin responses at low strain (<40%), and that withstands elongations exceeding 250%, elastically recoiling with minimal strain-energy loss on repeated deformation. The application of XPL to the herniated lower eyelid fat pads of 12 subjects resulted in an average 2-grade decrease in herniation appearance in a 5-point severity scale. The XPL platform may offer advanced solutions to compromised skin barrier function, pharmaceutical delivery and wound dressings.

  15. Diffuse reflectance imaging for non-melanoma skin cancer detection using laser feedback interferometry

    Science.gov (United States)

    Mowla, Alireza; Taimre, Thomas; Lim, Yah L.; Bertling, Karl; Wilson, Stephen J.; Prow, Tarl W.; Soyer, H. P.; Rakić, Aleksandar D.

    2016-04-01

    We propose a compact, self-aligned, low-cost, and versatile infrared diffuse-reflectance laser imaging system using a laser feedback interferometry technique with possible applications in in vivo biological tissue imaging and skin cancer detection. We examine the proposed technique experimentally using a three-layer agar skin phantom. A cylindrical region with a scattering rate lower than that of the surrounding normal tissue was used as a model for a non-melanoma skin tumour. The same structure was implemented in a Monte Carlo computational model. The experimental results agree well with the Monte Carlo simulations validating the theoretical basis of the technique. Results prove the applicability of the proposed technique for biological tissue imaging, with the capability of depth sectioning and a penetration depth of well over 1.2 mm into the skin phantom.

  16. 脂多糖干预后人皮肤成纤维细胞的胶原代谢%Influence of Lipopolysaccharide on Collagen Metabolism of Normal Skin Fibroblasts of Human

    Institute of Scientific and Technical Information of China (English)

    李凤玉; 王舒琦; 贾国洪; 万立; 杨红明

    2012-01-01

    目的 探讨脂多糖(lipopolysaccharide,LPS)对皮肤成纤维细胞胶原代谢的影响,以了解LPS在增生性瘢痕形成中的生物学作用.方法 取正常皮肤行成纤维细胞培养后,分为1个对照组及6个实验组.实验组终浓度分别为0.005、0.010、0.050、0.100、0.500和1.000 μg/ml大肠杆菌LPS(E.coli055:B5)培养,对照组为DMEM培养.用逆转录-聚合酶链反应(reverse transcription-polymerase chain reaction,RT-PCR)测定成纤维细胞Ⅰ、Ⅲ型前胶原mRNA及胶原酶mRNA的表达,并以同一个体相同代数的瘢痕组织成纤维细胞做对照.结果 与对照组比较,0.005~0.500μg/ml组促进细胞胶原合成,且0.100 μg/ml组作用达高峰(P<0.05),1.000μg/ml LPS抑制细胞胶原合成(P≮0.05).LPS刺激浓度在0.005 μg/ml~0.100μg/ml时,促进正常皮肤成纤维细胞I、Ⅲ型前胶原mRNA表达,抑制胶原酶mRNA表达,且呈一定的剂量依赖性;当LPS刺激浓度为0.500 μg/ml,上述作用下降;而当LPS刺激浓度到达1.000 μg/ml时,抑制正常皮肤成纤维细胞Ⅰ、Ⅲ型前胶原mRNA表达,促进胶原酶mRNA表达.LPS刺激浓度在0.100 μg/ml时,成纤维细胞Ⅰ、Ⅲ型前胶原mRNA和胶原酶mRNA表达与同一个体增生性瘢痕组织成纤维细胞近似.结论 LPS对人皮肤成纤维细胞Ⅰ、Ⅲ型前胶原mRNA和胶原酶mRNA表达的直接调节,可能是其参与增生性瘢痕形成的重要机制.%Objective To observe the influence of lipopolysaccharide (LPS) on collagen metabolism of normal human skin fibroblasts and its biological role in the formation of hypertrophic scar. Methods Fibroblasts were isolated and cultured in vitro, and then exposed to different doses of LPS (0. 005, 0. 010, 0. 050, 0. 100, 0. 500 and 1. 000 jug/ml) from E. coli055: B5 respectively. The expression of procollagen type I , HI and collagenase mRNAs was tested by reverse transcription-polymerase chain reaction (RT-PCR). The fibroblasts from hypertrophic scar tissue

  17. Neuromodulators for Aging Skin

    Science.gov (United States)

    ... Skin Scars Skin Growths Skin Lesions Spider Veins Stretch Marks Sun-damaged Skin Unwanted Hair Unwanted Tattoos Varicose ... Skin Scars Skin Growths Skin Lesions Spider Veins Stretch Marks Sun-damaged Skin Unwanted Hair Unwanted Tattoos Varicose ...

  18. Targeted Therapy in Nonmelanoma Skin Cancers

    Energy Technology Data Exchange (ETDEWEB)

    Spallone, Giulia; Botti, Elisabetta; Costanzo, Antonio, E-mail: antonio.costanzo@uniroma2.it [Department of Dermatology, University of Rome “Tor Vergata”, Via Montpellier 1, 00199, Rome (Italy)

    2011-05-03

    Nonmelanoma skin cancer (NMSC) is the most prevalent cancer in light-skinned populations, and includes mainly Basal Cell Carcinomas (BCC), representing around 75% of NMSC and Squamous Cell Carcinomas (SCC). The incidence of these tumors is continuously growing. It was found that the overall number of procedures for NMSC in US rose by 76%, from 1,158,298 in 1992 to 2,048,517 in 2006. Although mortality from NMSC tends to be very low, clearly the morbidity related to these skin cancers is very high. Treatment options for NMSC include both surgical and nonsurgical interventions. Surgery was considered the gold standard therapy, however, advancements in the knowledge of pathogenic mechanisms of NMSCs led to the identification of key targets for drug intervention and to the consequent development of several targeted therapies. These represent the future in treatment of these common forms of cancer ensuring a high cure rate, preservation of the maximal amount of normal surrounding tissue and optimal cosmetic outcome. Here, we will review recent advancements in NMSC targeted therapies focusing on BCC and SCC.

  19. Targeted Therapy in Nonmelanoma Skin Cancers

    Directory of Open Access Journals (Sweden)

    Giulia Spallone

    2011-05-01

    Full Text Available Nonmelanoma skin cancer (NMSC is the most prevalent cancer in light-skinned populations, and includes mainly Basal Cell Carcinomas (BCC, representing around 75% of NMSC and Squamous Cell Carcinomas (SCC. The incidence of these tumors is continuously growing. It was found that the overall number of procedures for NMSC in US rose by 76%, from 1,158,298 in 1992 to 2,048,517 in 2006. Although mortality from NMSC tends to be very low, clearly the morbidity related to these skin cancers is very high. Treatment options for NMSC include both surgical and nonsurgical interventions. Surgery was considered the gold standard therapy, however, advancements in the knowledge of pathogenic mechanisms of NMSCs led to the identification of key targets for drug intervention and to the consequent development of several targeted therapies. These represent the future in treatment of these common forms of cancer ensuring a high cure rate, preservation of the maximal amount of normal surrounding tissue and optimal cosmetic outcome. Here, we will review recent advancements in NMSC targeted therapies focusing on BCC and SCC.

  20. Cytokines and the Skin Barrier

    Directory of Open Access Journals (Sweden)

    Jens Malte Baron

    2013-03-01

    Full Text Available The skin is the largest organ of the human body and builds a barrier to protect us from the harmful environment and also from unregulated loss of water. Keratinocytes form the skin barrier by undergoing a highly complex differentiation process that involves changing their morphology and structural integrity, a process referred to as cornification. Alterations in the epidermal cornification process affect the formation of the skin barrier. Typically, this results in a disturbed barrier, which allows the entry of substances into the skin that are immunologically reactive. This contributes to and promotes inflammatory processes in the skin but also affects other organs. In many common skin diseases, including atopic dermatitis and psoriasis, a defect in the formation of the skin barrier is observed. In these diseases the cytokine composition within the skin is different compared to normal human skin. This is the result of resident skin cells that produce cytokines, but also because additional immune cells are recruited. Many of the cytokines found in defective skin are able to influence various processes of differentiation and cornification. Here we summarize the current knowledge on cytokines and their functions in healthy skin and their contributions to inflammatory skin diseases.

  1. Skin Cancer

    Science.gov (United States)

    ... are round and lie directly under squamous cells. Melanocytes are specialized skin cells that produce pigment called melanin. The melanin pigment produced by melanocytes gives skin its color. It also protects the ...

  2. Skin turgor

    Science.gov (United States)

    ... arm or abdomen is checked. The skin is held for a few seconds then released. Skin with ... University of Washington, Seattle, WA. Also reviewed by David Zieve, MD, MHA, Isla Ogilvie, PhD, and the ...

  3. Skin Cancer

    Science.gov (United States)

    Skin cancer is the most common form of cancer in the United States. The two most common types ... face, neck, hands, and arms. Another type of skin cancer, melanoma, is more dangerous but less common. Anyone ...

  4. Fluorescence and reflectance properties of hemoglobin-pigmented skin disorders

    Science.gov (United States)

    Troyanova, P.; Borisova, E.; Avramov, L.

    2007-06-01

    There has been growing interest in clinical application of laser-induced autofluorescence (LIAF) and reflectance spectroscopy (RS) to differentiate disease from normal surrounding tissue, including skin pathologies. Pigmented cutaneous lesions diagnosis plays important role in clinical practice, as malignant melanoma, which is characterized with greatest mortality from all skin cancer types, must be carefully discriminated form other colorized pathologies. The goals of this work were investigation of cutaneous hemoglobin-pigmented lesions (heamangioma, angiokeratoma, and fibroma) by the methods of LIAFS and RS. Spectra from healthy skin areas near to the lesion were detected to be used posteriori in analysis. Fluorescence and reflectance of cutaneous hemoglobin-pigmented lesions are used to develop criterion for differentiation from other pigmented pathologies. Origins of the spectral features obtained are discussed and determination of lesion types is achieved using selected spectral features. The spectral results, obtained were used to develop multispectral diagnostic algorithms based on the most prominent spectral features from the fluorescence and reflectance spectra of the lesions investigated. In comparison between normal skin and different cutaneous lesion types and between lesion types themselves sensitivities and specificities higher than 90 % were achieved. These results show a perspective possibility to differentiate hemoglobin-pigmented lesions from other pigmented pathologies using non-invasive and real time discrimination procedure.

  5. Binaural Rendering in MPEG Surround

    Directory of Open Access Journals (Sweden)

    Kristofer Kjörling

    2008-04-01

    Full Text Available This paper describes novel methods for evoking a multichannel audio experience over stereo headphones. In contrast to the conventional convolution-based approach where, for example, five input channels are filtered using ten head-related transfer functions, the current approach is based on a parametric representation of the multichannel signal, along with either a parametric representation of the head-related transfer functions or a reduced set of head-related transfer functions. An audio scene with multiple virtual sound sources is represented by a mono or a stereo downmix signal of all sound source signals, accompanied by certain statistical (spatial properties. These statistical properties of the sound sources are either combined with statistical properties of head-related transfer functions to estimate “binaural parameters” that represent the perceptually relevant aspects of the auditory scene or used to create a limited set of combined head-related transfer functions that can be applied directly on the downmix signal. Subsequently, a binaural rendering stage reinstates the statistical properties of the sound sources by applying the estimated binaural parameters or the reduced set of combined head-related transfer functions directly on the downmix. If combined with parametric multichannel audio coders such as MPEG Surround, the proposed methods are advantageous over conventional methods in terms of perceived quality and computational complexity.

  6. Binaural Rendering in MPEG Surround

    Science.gov (United States)

    Breebaart, Jeroen; Villemoes, Lars; Kjörling, Kristofer

    2008-12-01

    This paper describes novel methods for evoking a multichannel audio experience over stereo headphones. In contrast to the conventional convolution-based approach where, for example, five input channels are filtered using ten head-related transfer functions, the current approach is based on a parametric representation of the multichannel signal, along with either a parametric representation of the head-related transfer functions or a reduced set of head-related transfer functions. An audio scene with multiple virtual sound sources is represented by a mono or a stereo downmix signal of all sound source signals, accompanied by certain statistical (spatial) properties. These statistical properties of the sound sources are either combined with statistical properties of head-related transfer functions to estimate "binaural parameters" that represent the perceptually relevant aspects of the auditory scene or used to create a limited set of combined head-related transfer functions that can be applied directly on the downmix signal. Subsequently, a binaural rendering stage reinstates the statistical properties of the sound sources by applying the estimated binaural parameters or the reduced set of combined head-related transfer functions directly on the downmix. If combined with parametric multichannel audio coders such as MPEG Surround, the proposed methods are advantageous over conventional methods in terms of perceived quality and computational complexity.

  7. Skin Aging

    Science.gov (United States)

    Your skin changes as you age. You might notice wrinkles, age spots and dryness. Your skin also becomes thinner and loses fat, making it ... heal, too. Sunlight is a major cause of skin aging. You can protect yourself by staying out ...

  8. 脂多糖对人皮肤成纤维细胞胶原代谢的影响%Influence of lipopolysaccharide on collagen metabolism of normal skin fibroblasts of human

    Institute of Scientific and Technical Information of China (English)

    李凤玉; 王舒琦; 贾国洪; 万立; 杨红明

    2012-01-01

    Objective To observe the influence of lipopolysaccharide (LPS) on collagen metabolism of normal human skin fibroblasts and its biological role in the formation of hypertrophic scar.Methods Fibroblasts were isolated and cultured in vitro,and then exposed to different doses of LPS (0.005,0.01,0.05,0.1,0.5,1.0 μg/ml) from E.coli.055:B5 respectively.The expression of proccllagen type Ⅰ,Ⅲand collagenase mRNAs was tested by RT -PCR.Fibroblasts from hypertrophic scar tissue obtained from the same patients in the same culture passage were used as control.Results Compared with control group,the expression of procollagen type Ⅰ,Ⅲ mRNAs in normal skin fibroblasts increased (0.323 ± 0.041,0.303 ± 0.063,0.391 ± 0.071,0.344 ± 0.086,0.488 ± 0.059,0.401 ± 0.087,0.616 ± 0.107,0.434 ±0.084,0.823 ±0.092,0.542 ± 0.082),while the expression of collagenase mRNAs of normal skin fibroblasts depressed(0.598 ± 0.068,0.556 ± 0.049,0.441 ± 0.043,0.372 ± 0.083,0.260 ± 0.027 ).When LPS was set to the concentration of 0.005 μg/ml,it showed a concentration dependent manner.However,when the concentration of LPS was set to 0.5 μg/ml,the expression of procollagen type Ⅰ,Ⅲ and collagenase mRNAs of normal skin fibroblasts began to decrease (0.451 ± 0.063,0.374 ± 0.072,0.360 ± 0.062).When the concentration of LPS was set to 1.0 μg/ml,the expression of procollagen type Ⅰ,Ⅲ mRNAs (0.162 ± 0.025,0.171 ± 0.061 )were inhibited and the expression of collagenase mRNAs began to increase (0.444 ±0.114).When the concentration of LPS was set to 0.1 μg/ml,the expression of procollagen type Ⅰ,Ⅲ and collagenase mRNAs of normal skin fibroblasts(0.823 ±0.092,0.542 ±0.082,0.260 ±0.027)was similar to that of hypertrophic scar tissue fibroblasts(0.829 ±0.049,0.569 ±0.038,0.277 ±0.059).Conclusions This result supported that LPS may be an important factor in collagen metabolism of normal skin fibroblasts and it plays an important role in hypertrophic scar formation.%目

  9. Quantification of thermal damage in skin tissue

    Institute of Scientific and Technical Information of China (English)

    Xu Feng; Wen Ting; Lu Tianjian; Seffen Keith

    2008-01-01

    Skin thermal damage or skin burns are the most commonly encountered type of trauma in civilian and military communities. Besides, advances in laser, microwave and similar technologies have led to recent developments of thermal treatments for disease and damage involving skin tissue, where the objective is to induce thermal damage precisely within targeted tissue structures but without affecting the surrounding, healthy tissue. Further, extended pain sensation induced by thermal damage has also brought great problem for burn patients. Thus, it is of great importance to quantify the thermal damage in skin tissue. In this paper, the available models and experimental methods for quantification of thermal damage in skin tissue are discussed.

  10. Skin Picking Disorder

    Directory of Open Access Journals (Sweden)

    Pinar Cetinay Aydin

    2014-08-01

    Full Text Available Skin picking disorder is not a dermatological disorder and it is a table characterized with picking skin excessively and repetitively, leading to damage in skin tissue. Unlike normal picking behaviour, psychogenic skin picking is repetitive and it can lead to severe damage in the skin and even complications which constitute vital danger. While some patients define frequent but short lasting picking attacks, others define rarer attacks which last a few hours. Skin picking disorder, which is not included in the classification systems up to DSM-5 as a separate diagnosis category, is included as an independent diagnosis in Obsessive Compulsive Disorder and Associated Disorders category in DSM-5. In case reports, open label studies and double blind studies selective serotonin reuptake inhibitors are shown to be effective in the treatment of skin picking disorder. Mostly, cognitive-behaviourial techniques are used and have been proven to be useful in psychotherapy. Habit reversal is one of the behaviourial techniques which are frequently applied, give positive results in which well-being state can be maintained. [Psikiyatride Guncel Yaklasimlar - Current Approaches in Psychiatry 2014; 6(4.000: 401-428

  11. Quantification of thermal damage in skin tissue

    Institute of Scientific and Technical Information of China (English)

    徐峰; 文婷; 卢天健; Seffen; Keith

    2008-01-01

    Skin thermal damage or skin burns are the most commonly encountered type of trauma in civilian and military communities. Besides, advances in laser, microwave and similar technologies have led to recent developments of thermal treatments for disease and damage involving skin tissue, where the objective is to induce thermal damage precisely within targeted tissue structures but without affecting the surrounding, healthy tissue. Further, extended pain sensation induced by thermal damage has also brought great...

  12. Observation of roof of suction blister from normal skin of patients with vitiligo by Masson-Fontana stain%正常皮肤负压吸疱疱顶Masson Fontana染色分析

    Institute of Scientific and Technical Information of China (English)

    康尔恂; 毛玲娥; 罗邦国; 郑捷

    2001-01-01

    为研究负压吸疱法表皮移植治疗白癜风的机理,对16例来自白癜风病人色素正常部位皮肤负压吸引产生水疱的 疱顶组织进行HE和MassonFontana染色,观察水疱的位置及有无黑素细胞的存在。结果负压吸引产生的水疱位于棘细胞 层,无黑素细胞存在。治疗白癜风表皮移植的机理黑素细胞被移植这一假说不能成立。%To study the mechanism of treating vitiligo by epidermaltransplantation, the roof of suction blister from normal skin of 16 cases of vitiligo with HE and Masson-Fontana stain was observed to study the position of the vesicles and the presence of melanocytes in the roof of suction blisters、 The results showed that the vesicles were located in the spinous layer and no melanocytes were found. lt is concluded that the hypothesis that in epidermal transplantation melanocytes are transplanted is untenable.

  13. Optical coherence tomography for imaging of skin and skin diseases

    DEFF Research Database (Denmark)

    Mogensen, Mette; Thrane, Lars; Jørgensen, Thomas Martini

    2009-01-01

    , as have many diseases. The method can provide accurate measures of epidermal and nail changes in normal tissue. Skin cancer and other tumors, as well as inflammatory diseases, have been studied and good agreement found between OCT images and histopathological architecture. OCT also allows noninvasive......Optical coherence tomography (OCT) is an emerging imaging technology based on light reflection. It provides real-time images with up to 2-mm penetration into the skin and a resolution of approximately 10 μm. It is routinely used in ophthalmology. The normal skin and its appendages have been studied...... monitoring of morphologic changes in skin diseases and may have a particular role in the monitoring of medical treatment of nonmelanoma skin cancer. The technology is however still evolving and continued technological development will necessitate an ongoing evaluation of its diagnostic accuracy. Several...

  14. Oily skin

    Science.gov (United States)

    ... keep your skin clean using warm water and soap, or a soapless cleanser. Clean your face with astringent pads if frequent face washing causes irritation. Use only water-based or oil-free cosmetics if you have oily skin. Your ...

  15. Your Skin

    Science.gov (United States)

    ... your body. Without skin, people's muscles, bones, and organs would be hanging out all over the place. Skin holds everything together. It also: protects our bodies helps keep our bodies at just the right temperature allows us to have the sense of touch Don't Miss Your Epidermis The ...

  16. Combined normal-phase and reversed-phase liquid chromatography/ESI-MS as a tool to determine the molecular diversity of A-type procyanidins in peanut skins

    NARCIS (Netherlands)

    Appeldoorn, M.M.; Vincken, J.P.; Sanders, M.B.; Hollman, P.C.H.; Gruppen, H.

    2009-01-01

    Peanut skins, a byproduct of the peanut butter industry, are a rich source of proanthocyanidins, which might be used in food supplements. Data on the molecular diversity of proanthocyanidins in peanut skins is limited and conflicting with respect to the ratio of double- (A-type) versus single-linked

  17. Contour detection by surround suppression of texture

    NARCIS (Netherlands)

    Petkov, Nicolai; Tavares, JMRS; Jorge, RMN

    2007-01-01

    Based on a keynote lecture at Complmage 2006, Coimbra, Oct. 20-21, 2006, an overview is given of our activities in modelling and using surround inhibition for contour detection. The effect of suppression of a line or edge stimulus by similar surrounding stimuli is known from visual perception studie

  18. Percutaneous irreversible electroporation for breast tissue and breast cancer: safety, feasibility, skin effects and radiologic-pathologic correlation in an animal study.

    Science.gov (United States)

    Li, Sheng; Chen, Fei; Shen, Lujun; Zeng, Qi; Wu, Peihong

    2016-08-05

    To study the safety, feasibility and skin effects of irreversible electroporation (IRE) for breast tissue and breast cancer in animal models. Eight pigs were used in this study. IRE was performed on the left breasts of the pigs with different skin-electrode distances, and the right breasts were used as controls. The electrodes were placed 1-8 mm away from the skin, with an electrode spacing of 1.5-2 cm. Imaging and pathological examinations were performed at specific time points for follow-up evaluation. Vital signs, skin damage, breast tissue changes and ablation efficacy were also closely observed. Eight rabbit models with or without VX2 breast tumor implantations were used to further assess the damage caused by and the repair of thin skin after IRE treatment for breast cancer. Contrast-enhanced ultrasound and elastosonography were used to investigate ablation efficacy and safety. During IRE, the color of the pig breast skin reversibly changed. When the skin-electrode distance was 3 mm, the breast skin clearly changed, becoming white in the center and purple in the surrounding region during IRE. One small purulent skin lesion was detected several days after IRE. When the skin-electrode distance was 5-8 mm, the breast skin became red during IRE. However, the skin architecture was normal when evaluated using gross pathology and hematoxylin-eosin staining. When the skin-electrode distance was 1 mm, skin atrophy and yellow glabrescence occurred in the rabbit breasts after IRE. When the skin-electrode distance was ≥5 mm, there was no skin damage in the rabbit model regardless of breast cancer implantation. After IRE, complete ablation of the targeted breast tissue or cancer was confirmed, and apoptosis was detected in the target tissue and outermost epidermal layer. In the ablated breasts of the surviving animals, complete mammary regeneration with normal skin and hair was observed. Furthermore, no massive fibrosis or mass formation were detected on

  19. The Hunt for Natural Skin Whitening Agents

    Directory of Open Access Journals (Sweden)

    Stan Pavel

    2009-12-01

    Full Text Available Skin whitening products are commercially available for cosmetic purposes in order to obtain a lighter skin appearance. They are also utilized for clinical treatment of pigmentary disorders such as melasma or postinflammatory hyperpigmentation. Whitening agents act at various levels of melanin production in the skin. Many of them are known as competitive inhibitors of tyrosinase, the key enzyme in melanogenesis. Others inhibit the maturation of this enzyme or the transport of pigment granules (melanosomes from melanocytes to surrounding keratinocytes. In this review we present an overview of (natural whitening products that may decrease skin pigmentation by their interference with the pigmentary processes.

  20. Aging skin.

    Science.gov (United States)

    Bolognia, J L

    1995-01-16

    Aging of the skin is a composite of actinic damage, chronologic aging, and hormonal influences. The majority of changes associated with aging, such as wrinkles and solar lentigines ("liver spots"), are due to photoaging and reflect cumulative sun exposure as well as skin pigmentation. Classically, chronologic aging includes those cutaneous changes that occur in non-sun-exposed areas, such as the buttocks, and are observed in both men and women. A clinical example would be soft tissue sagging due to elastic fiber degeneration. In women, investigations into the effect of hormones on aging of the skin have concentrated on estrogens; in men, there have been a limited number of studies on the influence of testosterone. The latter have shown an age-dependent decrease in tissue androgens in pubic skin, but not scrotal or thigh skin. To date, age has not been shown to have an effect on androgen receptor binding, although a decrease in foreskin 5 alpha-reductase activity with increasing age has been described. In fibroblast cultures from foreskins, there have been conflicting results as to whether 5 alpha-reductase activity decreases in an age-dependent manner. Some of the skin changes that have been categorized as secondary to chronologic aging, such as decreased sebaceous gland activity and decreased hair growth, may actually represent a decline in the concentration of tissue androgens with increasing age. The influence of androgens on age-related changes in keratinocyte and fibroblast function remains speculative.

  1. Skin cleansing in children.

    Science.gov (United States)

    Gelmetti, C

    2001-09-01

    The problems of skin cleansing in infants have been re-evaluated in recent years on the basis of current understanding of cosmetology and skin physiology. The anatomical and functional peculiarities of infant's skin have been elucidated and, although it is known that the barrier function is established at birth in normal babies, it remains the case that children's skin is more delicate and therefore more prone to irritant and allergic contact dermatitis. These factors determine the choice of cleansing agents during infancy. The products available on the market differ markedly. Indeed detergents, bath oils, bath powders, due to their distinctive properties, have different indications and different benefits. The method of cleansing the skin, i.e. bathing or showering, is also important. The frequency of cleansing should take into account the age and the degree of exposure to pollutants. For special purposes, e.g. impetiginized dermatoses, antiseptics such as potassium permanganate or chlorhexidine can be added to the water in appropriate concentrations. The ideal paediatric detergent should be very mild to avoid irritant dermatitis, and very simple to avoid allergic dermatitis.

  2. Agroforestry practice in villages surrounding Nyamure former ...

    African Journals Online (AJOL)

    cntaganda

    Key words: Agroforestry, fuel wood, tree products, woodlot, forest plantation. INTRODUCTION ... The study area included three administrative cells in the surroundings of Nyamure ..... Table 6: Distance and time spent on firewood collection.

  3. Explaining preferences for home surroundings and locations

    Directory of Open Access Journals (Sweden)

    Hans Skifter Andersen

    2011-01-01

    Full Text Available This article is based on a survey carried out in Denmark that asked a random sample of the population about their preferences for home surroundings and locations. It shows that the characteristics of social surroundings are very important and can be divided into three independent dimensions: avoiding social nuisances, preferring social homogeneity and living close to one’s social network and place of origin. The study shows that most people have many detailed preferences, whereas some have very few. This confirms an earlier theory that some people are very connected to certain places with given characteristics and thus do not have priorities regarding home surroundings and locations. For others, mostly young people and singles, home is just a place to sleep and relax, whereas life is lived elsewhere. For this group, there are only preferences for location and there are few specific preferences for surroundings.

  4. Skin Cancer Prevention

    Science.gov (United States)

    ... Genetics of Skin Cancer Skin Cancer Screening Research Skin Cancer Prevention (PDQ®)–Patient Version What is prevention? ... prevent cancer are being studied. General Information About Skin Cancer Key Points Skin cancer is a disease ...

  5. Skin Cancer Screening

    Science.gov (United States)

    ... Genetics of Skin Cancer Skin Cancer Screening Research Skin Cancer Screening (PDQ®)–Patient Version What is screening? ... These are called diagnostic tests . General Information About Skin Cancer Key Points Skin cancer is a disease ...

  6. Dry Skin Relief

    Science.gov (United States)

    ... Advocacy priorities AADA Health System Reform Principles Drug pricing and availability CVS dermatologic formulary restrictions Access to ... Skin care for men Skin care on a budget Skin care products Skin care secrets Skin of ...

  7. Surround-Masking Affects Visual Estimation Ability

    Science.gov (United States)

    Jastrzebski, Nicola R.; Hugrass, Laila E.; Crewther, Sheila G.; Crewther, David P.

    2017-01-01

    Visual estimation of numerosity involves the discrimination of magnitude between two distributions or perceptual sets that vary in number of elements. How performance on such estimation depends on peripheral sensory stimulation is unclear, even in typically developing adults. Here, we varied the central and surround contrast of stimuli that comprised a visual estimation task in order to determine whether mechanisms involved with the removal of unessential visual input functionally contributes toward number acuity. The visual estimation judgments of typically developed adults were significantly impaired for high but not low contrast surround stimulus conditions. The center and surround contrasts of the stimuli also differentially affected the accuracy of numerosity estimation depending on whether fewer or more dots were presented. Remarkably, observers demonstrated the highest mean percentage accuracy across stimulus conditions in the discrimination of more elements when the surround contrast was low and the background luminance of the central region containing the elements was dark (black center). Conversely, accuracy was severely impaired during the discrimination of fewer elements when the surround contrast was high and the background luminance of the central region was mid level (gray center). These findings suggest that estimation ability is functionally related to the quality of low-order filtration of unessential visual information. These surround masking results may help understanding of the poor visual estimation ability commonly observed in developmental dyscalculia.

  8. β-内啡肽与μ-阿片受体在正常皮肤与增生性瘢痕组织中的分布特征与生物学意义%The significance and characteristics of distribution of β-endorphin and μ-opioid receptors in normal skin and hyperplastic scar

    Institute of Scientific and Technical Information of China (English)

    程飚; 刘宏伟; 李勤; 付小兵; 盛志勇; 曹荣

    2008-01-01

    Objective To detect the distribution of β-endorphin and mu-opioid receptors(MOR)in normal skin tissue and scar tissue from healthy volunteers and patients with hypertrophic scar.Methods Normal skin samples from 10 healthy individuals and 10 patients with hypertrophic scar,and scar samples from the same 10 patients were investigated.The β-endorphin and MOR pmtem in the samples were detected by immunofluorescence(IF).The reverse transeriptiOn polymerase chain reaction (RT-PCR)was used to detect MOB mRNA.Results β-endorphin and MOR protein were expressed in all samples.There were no significant differences in the expression of β-endorphin and MOB pmtem between normal skin from healthy volunteers and patients with hypertrophic scar(P>0.05).The expression of β-endorphin,MOR protein and mPNA in hyperplastic scar was significantly stronger than that in normal skin(P0.05);而增生性瘢痕患处组织真皮与表皮内β-内啡肽和MOR的表达明显强于其他两组(P<0.01).同时,PCR的结果显示,瘢痕组织中MORmRNA的含量也远远高于正常皮肤.结论 β-内啡肽和MOB在正常皮肤与增生性瘢痕组织中的分布存在差异,这可能是造成瘢痕愈合后感觉异常的重要因素.

  9. Common skin conditions during pregnancy.

    Science.gov (United States)

    Tunzi, Marc; Gray, Gary R

    2007-01-15

    Common skin conditions during pregnancy generally can be separated into three categories: hormone-related, preexisting, and pregnancy-specific. Normal hormone changes during pregnancy may cause benign skin conditions including striae gravidarum (stretch marks); hyperpigmentation (e.g., melasma); and hair, nail, and vascular changes. Preexisting skin conditions (e.g., atopic dermatitis, psoriasis, fungal infections, cutaneous tumors) may change during pregnancy. Pregnancy-specific skin conditions include pruritic urticarial papules and plaques of pregnancy, prurigo of pregnancy, intrahepatic cholestasis of pregnancy, pemphigoid gestationis, impetigo herpetiformis, and pruritic folliculitis of pregnancy. Pruritic urticarial papules and plaques of pregnancy are the most common of these disorders. Most skin conditions resolve postpartum and only require symptomatic treatment. However, there are specific treatments for some conditions (e.g., melasma, intrahepatic cholestasis of pregnancy, impetigo herpetiformis, pruritic folliculitis of pregnancy). Antepartum surveillance is recommended for patients with intrahepatic cholestasis of pregnancy, impetigo herpetiformis, and pemphigoid gestationis.

  10. Analysis of entrance skin radiation dose in mammography equipment in Rio Grande do Sul state (Ijui municipality and surroundings) and Rio de Janeiro (metropolitan area); Analise de dose de entrada na pele em mamografos, no Estado do Rio Grande do Sul (Municipio de Ijui e cercanias) e Rio de Janeiro (area metropolitana)

    Energy Technology Data Exchange (ETDEWEB)

    Araujo, Geovane Silva; Padilha Filho, Lucas Gomes, E-mail: geovane.araujo@ftesm.edu.br, E-mail: lucaspadilhaemec@gmail.com [Universidade Estacio de Sa (UNESA), Rio de Janeiro, RJ (Brazil); Sousa, Carlos Henrique Simoes de, E-mail: chenriques2@gmail.com [Instituto de Radioprotecao e Dosimetria (IRD/CNEN-RJ), Rio de Janeiro, RJ (Brazil); Feldmann, Gerson; Albrecht, Marcos R.A., E-mail: gersonpraxis@gmail.com, E-mail: marcosboom@yahoo.com.br [PRAXIS Protecao Radiologica, Ijui, RS (Brazil); Souza, Sergio Augusto Lopes de, E-mail: sergioalsouza@gmail.com [Universidade Federal do Rio de Janeiro (UFRJ), RJ (Brazil)

    2016-07-01

    Mammography is the technique widely used to the early detection of breast cancer, despite of not being a consensus the ideal age to initiate the radiologic examinations, it is recommended that women with the age of forty realize the examinations periodically. With the objective to analyze the entrance skin dose (ESD) in different mammography equipment, Were analyzed in the Estate of Rio Grande do Sul (Ijui City and neighborhoods) and in Rio de Janeiro (metropolitan area) 24 mammography equipment. Among them included in the study, just one presented ESD higher than the established limit of ANVISA. It was observed in the mammography equipment of Ijui and neighborhoods high levels of mAs to achieve the values of ESD next to the limit. (author)

  11. Filaggrin and Skin Barrier Function.

    Science.gov (United States)

    Kezic, Sanja; Jakasa, Ivone

    2016-01-01

    The skin barrier function is greatly dependent on the structure and composition of the uppermost layer of the epidermis, the stratum corneum (SC), which is made up of flattened anucleated cells surrounded by highly organized and continuous lipid matrix. The interior of the corneocytes consists mainly of keratin filaments aggregated by filaggrin (FLG) protein. Next, together with several other proteins, FLG is cross-linked into a mechanically robust cornified cell envelope providing a scaffold for the extracellular lipid matrix. In addition to its role for the SC structural and mechanical integrity, FLG degradation products account in part for the water-holding capacity and maintenance of acidic pH of the SC, both crucial for the epidermal barrier homoeostasis by regulating activity of multiple enzymes that control desquamation, lipid synthesis and inflammation. The major determinant of FLG expression in the skin are loss-of-function mutations in FLG, the strongest genetic risk factor for atopic dermatitis (AD), an inflammatory skin disease characterized by a reduced skin barrier function. The prevalence of FLG mutations varies greatly among different populations and ranges from about 10% in Northern Europeans to less than 1% in the African populations. An impaired skin barrier facilitates absorption of potentially hazardous chemicals, which might cause adverse effects in the skin, such as contact dermatitis, or systemic toxicity after their passage into blood. In another direction, a leaky epidermal barrier will lead to enhanced loss of water from the skin. A recent study has shown that even subtle increase in epidermal water loss in newborns increases the risk for AD. Although there are multiple modes of action by which FLG might affect skin barrier it is still unclear whether and how FLG deficiency leads to the reduced skin barrier function. This chapter summarizes the current knowledge in this field obtained from clinical studies, and animal and in vitro models

  12. Tactile perception of skin and skin cream by friction induced vibrations.

    Science.gov (United States)

    Ding, Shuyang; Bhushan, Bharat

    2016-11-01

    Skin cream smooths, softens, and moistens skin by altering surface roughness and tribological properties of skin. Sliding generates vibrations that activate mechanoreceptors located in skin. The brain interprets tactile information to identify skin feel. Understanding the tactile sensing mechanisms of skin with and without cream treatment is important to numerous applications including cosmetics, textiles, and robotics sensors. In this study, frequency spectra of friction force and friction induced vibration signals were carried out to investigate tactile perception by an artificial finger sliding on skin. The influence of normal load, velocity, and cream treatment time were studied. Coherence between friction force and vibration signals were found. The amplitude of vibration decreased after cream treatment, leading to smoother perception. Increasing normal load or velocity between contacting surfaces generated a smoother perception with cream treatment, but rougher perception without treatment. As cream treatment time increases, skin becomes smoother. The related mechanisms are discussed.

  13. Skin perfusion pressure measured with a photo sensor in an air-filled plastic balloon: validity and reproducibility on the lower leg in normal subjects and patients suspected of obliterative arterial disease

    DEFF Research Database (Denmark)

    Nielsen, Steen Levin; Nielsen, Anne Lerberg; Vind, Susanne Haase

    2011-01-01

    An inflatable small plastic bag including a photo sensor was constructed for measurement of skin perfusion pressure avoiding the rim of the photo sensor over bony and tendineous surfaces of the tibia below the knee, at the ankle, and on the dorsal forefoot. Compression was obtained using a conical...... pressure device thus had acceptable validity and reproducibility for estimation of the skin perfusion pressure and can be used on bony and tendineous sites on the lower limb in regions where critical wound healing is frequent, e.g. ankle and forefoot....

  14. (ID 1688), contribution to normal muscle function (ID 1685), and “immune system” (ID 1689, 1919, 1980) pursuant to Article 13(1) of Regulation (EC) No 1924/2006, EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA); Scientific Opinion on the substantiation of health claims related to astaxanthin and protection of the skin from UV-induced damage (ID 1687, 1979), defence against Helicobacter pylori (ID 1686), contribution to normal spermatogenesis

    DEFF Research Database (Denmark)

    Tetens, Inge

    claims in relation to astaxanthin and protection of the skin from UV-induced damage, defence against Helicobacter pylori, contribution to normal spermatogenesis, contribution to normal muscle function, and “immune system”. The scientific substantiation is based on the information provided by the Member......Following a request from the European Commission, the Panel on Dietetic Products, Nutrition and Allergies was asked to provide a scientific opinion on a list of health claims pursuant to Article 13 of Regulation (EC) No 1924/2006. This opinion addresses the scientific substantiation of health...... States in the consolidated list of Article 13 health claims and references that EFSA has received from Member States or directly from stakeholders. The food constituent that is the subject of the health claims is astaxanthin. The Panel considers that astaxanthin is sufficiently characterised....

  15. Clarifying Normalization

    Science.gov (United States)

    Carpenter, Donald A.

    2008-01-01

    Confusion exists among database textbooks as to the goal of normalization as well as to which normal form a designer should aspire. This article discusses such discrepancies with the intention of simplifying normalization for both teacher and student. This author's industry and classroom experiences indicate such simplification yields quicker…

  16. Squamous cell skin cancer

    Science.gov (United States)

    ... that reflect light more, such as water, sand, concrete, and areas that are painted white. The higher ... - skin - squamous cell; Skin cancer - squamous cell; Nonmelanoma skin cancer - squamous ...

  17. Immunopathology of skin lesions

    Directory of Open Access Journals (Sweden)

    Khan Nazoora

    2001-09-01

    Full Text Available A study was conducted on 130 patients suffering from skin lesions which included psoriasis, lichen planus, DLE, pemphigus, vitiligo and alopecia areata. Forty age-and-sex-matched healthy individuals served as control. Serum IgG, IgM, and circulating immune complexes (CIC were estimated. Significant increase in serum IgG (1937.2 ± 1030.43 mg% and IgM (232.12 ± 136.98 mg% was observed in all the skin lesions when compared with controls except in lichen planus where they were significantly lowered, values being 580.61± 77.35 mg% and 66.88 ± 6.59mg% respectively. CIC levels were significantly raised (P<0.00 1 in various skin lesions (40.49±23.29 when compared with controls (17.68± 3.21, but no significance was observed in lichen planus( 17.72 ± 4.28. Serum IgG, IgM and CIC were statistically significantly altered depending on the extent of the lesion and lowered significantly to almost normal values following treatment, thereby confirming the role of immunity in the pathogenesis of these skin disorders.

  18. Smart Chips for Smart Surroundings - 4S

    NARCIS (Netherlands)

    Schuler, Eberhard; König, Ralf; Becker, Jürgen; Rauwerda, Gerard; Burgwal, van de Marcel; Smit, Gerard J.M.; Cardoso, João M.P.; Hübner, Michael

    2011-01-01

    The overall mission of the 4S project (Smart Chips for Smart Surroundings) was to define and develop efficient flexible, reconfigurable core building blocks, including the supporting tools, for future Ambient System Devices. Reconfigurability offers the needed flexibility and adaptability, it provid

  19. Skin Cancer Treatment

    Science.gov (United States)

    ... of Skin Cancer Skin Cancer Screening Research Skin Cancer Treatment (PDQ®)–Patient Version General Information About Skin Cancer ... clinical trials before, during, or after starting their cancer treatment. Some clinical trials only include patients who have ...

  20. Skin Pigmentation Disorders

    Science.gov (United States)

    Pigmentation means coloring. Skin pigmentation disorders affect the color of your skin. Your skin gets its color from a pigment called melanin. Special cells in the skin make melanin. When these cells become damaged or ...

  1. Skin Cancer Foundation

    Science.gov (United States)

    ... Host a Fundraising Event | About Us | Store The Skin Cancer Foundation The Skin Cancer Foundation is the only ... Handbook A "Sunscreen Gene"? Skin Cancer Facts & Statistics Skin Cancer Treatment Glossary Information on medications and procedures The ...

  2. Skin Bleaching

    OpenAIRE

    Ahmed, Samira M.

    2015-01-01

    In this project, I aim to investigate the reasoning behind the practice of skin bleaching by analyzing the documentary ”Dark Girls”, to gain a better understanding of race and colorism issues. Also this project tries to see if there is a connection with history and if this has been a part of making the european beauty ideal determine the choices black’s make in regards to beauty.

  3. Cutaneous skin tag

    Science.gov (United States)

    Skin tag; Acrochordon; Fibroepithelial polyp ... have diabetes. They are thought to occur from skin rubbing against skin. ... The tag sticks out of the skin and may have a short, narrow stalk connecting it to the surface of the skin. Some skin tags are as long as ...

  4. Spectroscopic analysis of catechins in peanut seed skins

    Science.gov (United States)

    Peanuts, Arachis hypogaea, are cultivated as a source of edible seed oil and protein. The peanut seed testa or skin that surrounds the seed is typically removed after the shelling process by blanching. Several phenolic compounds such as catechins may be isolated as co-products from peanut seed skins...

  5. Skin deposits in hereditary cystatin C amyloidosis

    DEFF Research Database (Denmark)

    Benedikz, Eirikur; Blöndal, H; Gudmundsson, G

    1990-01-01

    Clinically normal skin from 47 individuals aged 9-70 years was investigated. Cystatin C amyloid deposits were found in various locations of the skin by light and/or electron microscopy, in all 12 patients with a clinical history of hereditary cystatin C amyloidosis (HCCA). Six asymptomatic...... individuals, who had the Alu 1 restriction fragment length polymorphism (RFLP) marker reported to cosegregate with the disease, also had cystatin C amyloid deposits in the skin. Three asymptomatic individuals (age 17-46) belonging to the HCCA families were without amyloid in the skin but had Alu 1 RFLP marker....... Skin from 12 individuals who served as controls and skin from 14 close relatives of the patients was negative for amyloid. Punch biopsy of the skin is a simple procedure which is of value for the diagnosis of HCCA, even before the appearance of clinical symptoms. This method might also be of use...

  6. Persistent Confusion and Controversy Surrounding Gene Patents

    Science.gov (United States)

    Guerrini, Christi J.; Majumder, Mary A.; McGuire, Amy L.

    2016-01-01

    There is persistent confusion and controversy surrounding basic issues of patent law relevant to the genomics industry. Uncertainty and conflict can lead to the adoption of inefficient practices and exposure to liability. The development of patent-specific educational resources for industry members, as well as the prompt resolution of patentability rules unsettled by recent U.S. Supreme Court decisions, are therefore urgently needed. PMID:26849516

  7. Birkhoff normalization

    NARCIS (Netherlands)

    Broer, H.; Hoveijn, I.; Lunter, G.; Vegter, G.

    2003-01-01

    The Birkhoff normal form procedure is a widely used tool for approximating a Hamiltonian systems by a simpler one. This chapter starts out with an introduction to Hamiltonian mechanics, followed by an explanation of the Birkhoff normal form procedure. Finally we discuss several algorithms for comput

  8. Structure and Function of Your Skin

    Science.gov (United States)

    ... Favorite Name: Category: Share: Yes No, Keep Private Structure & Function of Your Skin Share | What It Looks Like . . . Skin is a waterproof, flexible, but tough protective covering for your body. Normally the surface is smooth, punctuated only with hair and pores for sweat. A cross-section of ...

  9. Microphthalmia with linear skin defects syndrome.

    Science.gov (United States)

    García-Rabasco, Ana; De-Unamuno, Blanca; Martínez, Francisco; Febrer-Bosch, Isabel; Alegre-de-Miquel, Víctor

    2013-01-01

    Microphthalmia with linear skin defects (MLS) or microcornea, dermal aplasia and sclerocornea (MIDAS) syndrome is a rare X-linked-dominant disorder. We present a patient with agenesis of corpus callosum, ocular abnormalities, and multiple skin defects. The cytogenetic studies of the MLS critical region (Xp22.2) were normal, but a skewed X-chromosome inactivation pattern (85:15) was observed.

  10. Histological Study on the Skin of Japanese Flounder Paralichthys olivaceus

    Institute of Scientific and Technical Information of China (English)

    ZHU Jie; ZHANG Xiumei; GAO Tianxiang

    2005-01-01

    Histological development of Japanese flounder Paralichthys olivaceus larval skin and ultrastructural difference of skin between reared normal and malpigmented Japanese flounder were studied with light microscopy (LM) and transmission electron microscopy (TEM). The results show that the skin develops slowly before the metamorphosis, while at the onset of metamorphosis, the skin develops quickly and becomes complete in structure till about 50 d after being hatched. Ultrastructural observation on the normal and malpigmented skins shows that the iridophore and melanophore are adjacent to each other. Profile and structure of the two kinds of pigment cells are more complete in the skin of normal ocular side than in the skin of pigmented blind side. The ultrastructure of typical chloride cell was observed in the skin of Japanese flounder larvae for the first time.

  11. Focal skin defect, limb anomalies and microphthalmia.

    NARCIS (Netherlands)

    Jackson, K.E.; Andersson, H.C.

    2004-01-01

    We describe two unrelated female patients with congenital single focal skin defects, unilateral microphthalmia and limb anomalies. Growth and psychomotor development were normal and no brain malformation was detected. Although eye and limb anomalies are commonly associated, clinical anophthalmia and

  12. Identification of -SiC surrounded by relatable surrounding diamond medium using weak Raman surface phonons

    Indian Academy of Sciences (India)

    Mohan Kumar Kuntumalla; Harish Ojha; Vadali Venkata Satya Siva Srikanth

    2013-11-01

    It is difficult to detect -SiC using micro-Raman scattering, if it is surrounded by carbon medium. Here, -SiC is identified in the presence of a relatable surrounding diamond medium using subtle, but discernible Raman surface phonons. In this study, diamond/-SiC nanocomposite thin film system is considered in which nanosized -SiC crystallites are surrounded by a relatable nanodiamond medium that leads to the appearance of a weak Raman surface phonon band at about 855 cm-1. Change in the nature of the surrounding material structure and its volume content when relatable, will affect the resultant Raman response of -SiC phase as seen in the present case of diamond/-SiC nanocomposite thin films.

  13. Preparation of Inactivated Human Skin Using High Hydrostatic Pressurization for Full-Thickness Skin Reconstruction.

    Directory of Open Access Journals (Sweden)

    Pham Hieu Liem

    Full Text Available We have reported that high-hydrostatic-pressure (HHP technology is safe and useful for producing various kinds of decellularized tissue. However, the preparation of decellularized or inactivated skin using HHP has not been reported. The objective of this study was thus to prepare inactivated skin from human skin using HHP, and to explore the appropriate conditions of pressurization to inactivate skin that can be used for skin reconstruction. Human skin samples of 8 mm in diameter were packed in bags filled with normal saline solution (NSS or distilled water (DW, and then pressurized at 0, 100, 150, 200 and 1000 MPa for 10 minutes. The viability of skin after HHP was evaluated using WST-8 assay. Outgrowth cells from pressurized skin and the viability of pressurized skin after cultivation for 14 days were also evaluated. The pressurized skin was subjected to histological evaluation using hematoxylin and eosin staining, scanning electron microscopy (SEM, immunohistochemical staining of type IV collagen for the basement membrane of epidermis and capillaries, and immunohistochemical staining of von Willebrand factor (vWF for capillaries. Then, human cultured epidermis (CE was applied on the pressurized skin and implanted into the subcutis of nude mice; specimens were subsequently obtained 14 days after implantation. Skin samples pressurized at more than 200 MPa were inactivated in both NSS and DW. The basement membrane and capillaries remained intact in all groups according to histological and immunohistological evaluations, and collagen fibers showed no apparent damage by SEM. CE took on skin pressurized at 150 and 200 MPa after implantation, whereas it did not take on skin pressurized at 1000 MPa. These results indicate that human skin could be inactivated after pressurization at more than 200 MPa, but skin pressurized at 1000 MPa had some damage to the dermis that prevented the taking of CE. Therefore, pressurization at 200 MPa is optimal for

  14. Skin changes in menopause.

    Science.gov (United States)

    Bolognia, J L; Braverman, I M; Rousseau, M E; Sarrel, P M

    1989-12-01

    Skin signs and symptoms were examined in 46 menopausal women prior to estrogen replacement therapy. Several symptoms such as pruritus, bruising, dryness and thinning were seen more frequently in sun-exposed skin emphasizing the contribution of photoaging. At the end of a 6-mth treatment period, no significant difference was observed in the prevalence or severity of the cutaneous signs and symptoms when patients receiving transdermal 17 beta-estradiol (Estraderm) were compared with controls (the only exception was cutaneous flushing). Elastic fibers from sun-protected (buttock) skin of menopausal women were studied by light and electron microscopy. In 3 women (ages 30-37) with a history of premature menopause, the elastic fibers had several degenerative changes including coalescence of cystic spaces into lacunae, peripheral fragmentation, granular degeneration and splitting of the fibers into strands. Similar age-related ultrastructural changes are normally found in individuals that are at least 20 yrs older than these patients. These findings are suggestive of a relationship between premature aging of the dermal elastic fibers and estrogen deprivation.

  15. Skin Keratins.

    Science.gov (United States)

    Wang, Fengrong; Zieman, Abigail; Coulombe, Pierre A

    2016-01-01

    Keratins comprise the type I and type II intermediate filament-forming proteins and occur primarily in epithelial cells. They are encoded by 54 evolutionarily conserved genes (28 type I, 26 type II) and regulated in a pairwise and tissue type-, differentiation-, and context-dependent manner. Keratins serve multiple homeostatic and stress-enhanced mechanical and nonmechanical functions in epithelia, including the maintenance of cellular integrity, regulation of cell growth and migration, and protection from apoptosis. These functions are tightly regulated by posttranslational modifications as well as keratin-associated proteins. Genetically determined alterations in keratin-coding sequences underlie highly penetrant and rare disorders whose pathophysiology reflects cell fragility and/or altered tissue homeostasis. Moreover, keratin mutation or misregulation represents risk factors or genetic modifiers for several acute and chronic diseases. This chapter focuses on keratins that are expressed in skin epithelia, and details a number of basic protocols and assays that have proven useful for analyses being carried out in skin.

  16. A preliminary study of skin ultrasound in diffuse cutaneous systemic sclerosis: Does skin echogenicity matter?

    Science.gov (United States)

    Xu, Dong; Wang, Liang; Li, Jian-chu; Jiang, Yu-xin; Wang, Qian; Li, Meng-tao; Zhang, Feng-chun; Zeng, Xiao-feng

    2017-01-01

    Objective To evaluate the usefulness of skin ultrasound and acoustic radiation force impulse (ARFI) quantification in diffuse cutaneous systemic sclerosis (dcSSc). Patients and methods 28 patients with dcSSc, and 15 age gender matched normal controls were recruited. Skin echogenicity, thickness, and ARFI quantification were measured by ultrasound at 17 sites corresponding to the modified Rodnan skin score (mRSS) in each participant. Compared with controls, skin echogenicity of dcSSc patients was classified into isoechoic, hypoechoic, and hyperechoic. The skin thickness, ARFI quantification and mRSS were compared between isoechoic, hypoechoic, hyperechoic and controls. Results In patients with dcSSc, the skin thickness increased as the echogenicity changed on the order of isoechoic, hypoechoic and hyperechoic. ARFI quantification was significantly higher in hyperechoic than isoechoic (p<0.001). The mRSS were significantly higher in hyperechoic and/or hypoechoic than isoechoic. For isoechoic patients and healthy controls, the skin echogenicity or thickness was no significant different, however, the ARFI quantification was significantly higher in isoechoic than controls. Conclusion Skin ultrasound is feasible for assessing the skin involvement in dcSSc. Skin echogenicity correlates with skin thickness, stiffness, and mRSS. ARFI quantification may be more sensitive to detect skin changes, compared with skin echogenicity and thickness. PMID:28339492

  17. SKIN AND HAIR CHANGES AFTER FORTY

    Directory of Open Access Journals (Sweden)

    Manisha

    2014-04-01

    Full Text Available Aging is a continuous, dynamic, and an irreversible process. Direct exposure to ultra-violet radiations, skin is particularly prone to early aging, known as photo aging. Skin aging is particularly important because of its visibility and social impact. As women age we will notice changes to our skin and hair during the menopause. Dry, thinning, fragile, less tolerant and sagging skin are common complaints. The main reasons for the change in skin is the loss of estrogen, testosterone and dehydroepiandrosterone (DHEA etc, 1, 2, 3 from the age of 35 onwards up to menopause, the more we have had long-term exposure to the elements, such as sun and wind the more this becomes evident. Estrogen is very involved in the normal function of the skin. It directly affects the function of key cells in the skin, like the fibroblast (produces collagen and elastin, keratinocyte (closely involved in skin protection and melanocytes (involved in evenness of skin color, etc.. It also helps regulate hair follicle function (hair production as well as sebaceous gland activity (producing skin oils. After the age of forty most of women enters menopause, during which estrogens levels decreases, which leads to different types of hair and skin changes which has been described in this article.

  18. Explaining preferences for home surroundings and locations

    DEFF Research Database (Denmark)

    Andersen, Hans Skifter

    2011-01-01

    : avoiding social nuisances, preferring social homogeneity and living close to one’s social network and place of origin. The study shows that most people have many detailed preferences, whereas some have very few. This confirms an earlier theory that some people are very connected to certain places...... with given characteristics and thus do not have priorities regarding home surroundings and locations. For others, mostly young people and singles, home is just a place to sleep and relax, whereas life is lived elsewhere. For this group, there are only preferences for location and there are few specific...

  19. Normalized mean glandular dose computation from mammography using GATE: a validation study

    Science.gov (United States)

    Myronakis, Marios E.; Zvelebil, Marketa; Darambara, Dimitra G.

    2013-04-01

    Mean glandular dose (MGD) is the figure of merit to assess breast dose after a mammographic acquisition. The use of normalized MGD obtained from Monte Carlo computations with measured incident air kerma determines the MGD delivered to patients. The Geant4 Application for Tomographic Emission (GATE) toolkit is a modern Monte Carlo application specifically designed for medical imaging systems modelling. Although there is an increasing number of publications using GATE worldwide for a wide range of medical imaging and therapeutic applications, there is currently no means to obtain normalized MGD. In this work, the GATE toolkit is extended, through the development of two new modules, to provide normalized MGD information for compressed breast phantoms based on simple geometries. The normalized MGD values were validated against published work and provided results at half value layers lower than 0.3 and greater than 0.6 mmAl. In addition, the skin thickness and composition were considered. Normalized MGD was computed after substitution of the adipose layer surrounding the standard breast phantom with skin tissue and the relative difference is reported. Spectrum generation was facilitated by further development of previously published work by other authors. Validation of the new GATE extension showed good agreement with published data and can be used to assess breast dose from mammographic as well as more complex x-ray imaging techniques. Changing skin thickness and composition revealed substantial changes in normalized MGD specifically for compressed breast thickness different than 5 cm and a possible revision of the structure of the standard breast model may be necessary.

  20. Skin deposits in hereditary cystatin C amyloidosis

    DEFF Research Database (Denmark)

    Benedikz, Eirikur; Blöndal, H; Gudmundsson, G

    1990-01-01

    Clinically normal skin from 47 individuals aged 9-70 years was investigated. Cystatin C amyloid deposits were found in various locations of the skin by light and/or electron microscopy, in all 12 patients with a clinical history of hereditary cystatin C amyloidosis (HCCA). Six asymptomatic...... individuals, who had the Alu 1 restriction fragment length polymorphism (RFLP) marker reported to cosegregate with the disease, also had cystatin C amyloid deposits in the skin. Three asymptomatic individuals (age 17-46) belonging to the HCCA families were without amyloid in the skin but had Alu 1 RFLP marker...

  1. Anyone Can Get Skin Cancer

    Science.gov (United States)

    ... of Skin Cancer Skin Cancer Screening Research Anyone Can Get Skin Cancer Order the free Anyone Can ... rarely, younger children can develop skin cancer. How can people with dark skin get skin cancer? Although ...

  2. Multiphoton STED and FRET in human skin: Resolving the skin barrier

    DEFF Research Database (Denmark)

    Antonescu, Irina; Dreier, Jes; Brewer, Jonathan R.

    Understanding the penetration properties of substances across biological bar- riers and membranes is vital for many areas of research. In the case of human skin, the barrier is primarily found in the stratum corneum and consists of protein-enriched cells surrounded by a lipid membrane -enriched...... excited STED and Forster Resonance Energy Transfer (FRET) microscopy to probe the structure of human skin. Super resolution optical microscopy enables resolving structures in the skin below to 60 nm allowing visualization of the stratum corneum intercellular lipid matrix and individual proteins...

  3. Interaction between a normal shock wave and a turbulent boundary layer at high transonic speeds. Part 1: Pressure distribution. Part 2: Wall shear stress. Part 3: Simplified formulas for the prediction of surface pressures and skin friction

    Science.gov (United States)

    Adamson, T. C., Jr.; Liou, M. S.; Messiter, A. F.

    1980-01-01

    An asymptotic description is derived for the interaction between a shock wave and a turbulent boundary layer in transonic flow, for a particular limiting case. The dimensionless difference between the external flow velocity and critical sound speed is taken to be much smaller than one, but large in comparison with the dimensionless friction velocity. The basic results are derived for a flat plate, and corrections for longitudinal wall curvature and for flow in a circular pipe are also shown. Solutions are given for the wall pressure distribution and the shape of the shock wave. Solutions for the wall shear stress are obtained, and a criterion for incipient separation is derived. Simplified solutions for both the wall pressure and skin friction distributions in the interaction region are given. These results are presented in a form suitable for use in computer programs.

  4. Topical PDT in the Treatment of Benign Skin Diseases: Principles and New Applications

    Directory of Open Access Journals (Sweden)

    Miri Kim

    2015-09-01

    Full Text Available Photodynamic therapy (PDT uses a photosensitizer, light energy, and molecular oxygen to cause cell damage. Cells exposed to the photosensitizer are susceptible to destruction upon light absorption because excitation of the photosensitizing agents leads to the production of reactive oxygen species and, subsequently, direct cytotoxicity. Using the intrinsic cellular heme biosynthetic pathway, topical PDT selectively targets abnormal cells, while preserving normal surrounding tissues. This selective cytotoxic effect is the basis for the use of PDT in antitumor treatment. Clinically, PDT is a widely used therapeutic regimen for oncologic skin conditions such as actinic keratosis, squamous cell carcinoma in situ, and basal cell carcinoma. PDT has been shown, under certain circumstances, to stimulate the immune system and produce antibacterial, and/or regenerative effects while protecting cell viability. Thus, it may be useful for treating benign skin conditions. An increasing number of studies support the idea that PDT may be effective for treating acne vulgaris and several other inflammatory/infective skin diseases, including psoriasis, rosacea, viral warts, and aging-related changes. This review provides an overview of the clinical investigations of PDT and discusses each of the essential aspects of the sequence: its mechanism of action, common photosensitizers, light sources, and clinical applications in dermatology. Of the numerous clinical trials of PDT in dermatology, this review focuses on those studies that have reported remarkable therapeutic benefits following topical PDT for benign skin conditions such as acne vulgaris, viral warts, and photorejuvenation without causing severe side effects.

  5. Near-infrared autofluorescence imaging of cutaneous melanins and human skin in vivo

    Science.gov (United States)

    Han, Xiao; Lui, Harvey; McLean, David I.; Zeng, Haishan

    2009-03-01

    In recent years, near-infrared (NIR) autofluorescence imaging has been explored as a novel technique for tissue evaluation and diagnosis. We present an NIR fluorescence imaging system optimized for the dermatologic clinical setting, with particular utility for the direct characterization of cutaneous melanins in vivo. A 785-nm diode laser is coupled into a ring light guide to uniformly illuminate the skin. A bandpass filter is used to purify the laser light for fluorescence excitation, while a long-pass filter is used to block the main laser wavelength but pass the spontaneous components for NIR reflectance imaging. A computer-controlled filter holder is used to switch these two filters to select between reflectance and fluorescence imaging modes. Both the reflectance and fluorescence photons are collected by an NIR-sensitive charge-coupled device (CCD) camera to form the respective images. Preliminary results show that cutaneous melanin in pigmented skin disorders emits higher NIR autofluorescence than surrounding normal tissue. This confirmed our previous findings from NIR fluorescence spectroscopy study of cutaneous melanins and provides a new approach to directly image the distributions of cutaneous melanins in the skin. In-vivo NIR autofluorescence images may be useful for clinical evaluation and diagnosis of pigmented skin lesions, including melanoma.

  6. Skin color - patchy

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/003224.htm Skin color - patchy To use the sharing features on this page, please enable JavaScript. Patchy skin color is areas where the skin color is irregular. ...

  7. Characterizing the Microenvironment Surrounding Phosphorylated Protein Sites

    Institute of Scientific and Technical Information of China (English)

    Shi-Cai Fan; Xue-Gong Zhang

    2005-01-01

    Protein phosphorylation plays an important role in various cellular processes. Due to its high complexity, the mechanism needs to be further studied. In the last few years, many methods have been contributed to this field, but almost all of them investigated the mechanism based on protein sequences around protein sites. In this study, we implement an exploration by characterizing the microenvironment surrounding phosphorylated protein sites with a modified shell model, and obtain some significant properties by the rank-sum test, such as the lack of some classes of residues, atoms, and secondary structures. Furthermore, we find that the depletion of some properties affects protein phosphorylation remarkably. Our results suggest that it is a meaningful direction to explore the mechanism of protein phosphorylation from microenvironment and we expect further findings along with the increasing size of phosphorylation and protein structure data.

  8. Opportunity's Surroundings After Sol 1820 Drive

    Science.gov (United States)

    2009-01-01

    NASA's Mars Exploration Rover Opportunity used its navigation camera to take the images combined into this full-circle view of the rover's surroundings during the 1,820th to 1,822nd Martian days, or sols, of Opportunity's surface mission (March 7 to 9, 2009). South is at the center; north at both ends. The rover had driven 20.6 meters toward the northwest on Sol 1820 before beginning to take the frames in this view. Tracks from that drive recede southwestward. For scale, the distance between the parallel wheel tracks is about 1 meter (about 40 inches). The terrain in this portion of Mars' Meridiani Planum region includes dark-toned sand ripples and small exposures of lighter-toned bedrock. This view is presented as a cylindrical projection with geometric seam correction.

  9. Exploiting Surrounding Text for Retrieving Web Images

    Directory of Open Access Journals (Sweden)

    S. A. Noah

    2008-01-01

    Full Text Available Web documents contain useful textual information that can be exploited for describing images. Research had been focused on representing images by means of its content (low level description such as color, shape and texture, little research had been directed to exploiting such textual information. The aim of this research was to systematically exploit the textual content of HTML documents for automatically indexing and ranking of images embedded in web documents. A heuristic approach for locating and assigning weight surrounding web images and a modified tf.idf weighting scheme was proposed. Precision-recall measures of evaluation had been conducted for ten queries and promising results had been achieved. The proposed approach showed slightly better precision measure as compared to a popular search engine with an average of 0.63 and 0.55 relative precision measures respectively.

  10. Avoiding obstacles by using a proximity infrared sensor skin

    Institute of Scientific and Technical Information of China (English)

    Cao Zhengcai; Fu Yili; Wu Qidi; Wang Shuguo; Wang Guangguo

    2007-01-01

    Placement and wiring of vast amount of sensor elements on the 3-dimensionally configured robot surface to form soft sensor skin is very difficult with the traditional technology, hi this paper we propose a new method to realize such a skin. By implanting infrared sensors array in an elastic body, we obtain an elastic and tough sensor skin that can be shaped freely. The developed sensor skin is a large-area, flexible array of infrared sensors with data processing capabilities. Depending on the skin electronics, it endows its carrier with an ability to sense its surroundings. The structure, the method of infrared sensor signal processing, and basic experiments of sensor skin are presented. The validity of the infrared sensor skin is investigated by preliminary obstacle avoidance trial.

  11. Severe combined immunodeficiency mouse and human psoriatic skin chimeras. Validation of a new animal model.

    OpenAIRE

    1995-01-01

    Research into the cause and pathophysiological mechanisms underlying expression of psoriatric skin lesions has been hampered by lack of an appropriate animal model for this common and enigmatic cutaneous disease. These studies characterize normal skin, pre-psoriatic skin, and psoriatic plaque skin samples transplanted onto severe combined immunodeficiency mice. In this report we document that 1), normal, prepsoriatic, and psoriatic plaque keratome skin samples can be transplanted onto severe ...

  12. Experimental study of error sources in skin-friction balance measurements

    Science.gov (United States)

    Allen, J. M.

    1977-01-01

    An experimental study has been performed to determine potential error sources in skin-friction balance measurements. A floating-element balance, large enough to contain the instrumentation needed to systematically investigate these error sources has been constructed and tested in the thick turbulent boundary layer on the sidewall of a large supersonic wind tunnel. Test variables include element-to-case misalignment, gap size, and Reynolds number. The effects of these variables on the friction, lip, and normal forces have been analyzed. It was found that larger gap sizes were preferable to smaller ones; that small element recession below the surrounding test surface produced errors comparable to the same amount of protrusion above the test surface; and that normal forces on the element were, in some cases, large compared to the friction force.

  13. Optical detection of carotenoid antioxidants in human bone and surrounding tissue.

    Science.gov (United States)

    Ermakov, Igor V; Ermakova, Maia R; Rosenberg, Thomas D; Gellermann, Werner

    2013-11-01

    Carotenoids are known to play an important role in health and disease state of living human tissue based on their antioxidant and optical filtering functions. In this study, we show that carotenoids exist in human bone and surrounding fatty tissue both in significant and individually variable concentrations. Measurements of biopsied tissue samples with molecule-specific Raman spectroscopy and high-performance liquid chromatography reveal that all carotenoids that are known to exist in human skin are also present in human bone. This includes all carotenes, lycopene, β-cryptoxanthin, lutein, and zeaxanthin. We propose quantitative reflection imaging as a noncontact optical method suitable for the measurement of composite carotenoid levels in bone and surrounding tissue exposed during open surgeries such as total knee arthroplasty, and as a proof of concept, demonstrate carotenoid measurements in biopsied bone samples. This will allow one to establish potential correlations between internal tissue carotenoid levels and levels in skin and to potentially use already existing optical skin carotenoid tests as surrogate marker for bone carotenoid status.

  14. The lithosphere-asthenosphere Italy and surroundings

    CERN Document Server

    Panza, G F; Chimera, G; Pontevivo, A; Raykova, R

    2003-01-01

    The velocity-depth distribution of the lithosphere-asthenosphere in the Italian region and surroundings is imaged, with a lateral resolution of about 100 km, by surface wave velocity tomography and non-linear inversion. Maps of the Moho depth, of the thickness of the lithosphere and of the shear-wave velocities, down to depths of 200 km and more, are constructed. A mantle wedge, identified in the uppermost mantle along the Apennines and the Calabrian Arc, underlies the principal recent volcanoes, and partial melting can be relevant in this part of the uppermost mantle. In Calabria a lithospheric doubling is seen, in connection with the subduction of the Ionian lithosphere. The asthenosphere is shallow in the Southern Tyrrhenian Sea. High velocity bodies, cutting the asthenosphere, outline the Adria-lonian subduction in the Tyrrhenian Sea and the deep-reaching lithospheric root in the Western Alps. Less deep lithospheric roots are seen in the Central Apennines. The lithosphere-asthenosphere properties delineat...

  15. The lithosphere-asthenosphere: Italy and surroundings

    Institute of Scientific and Technical Information of China (English)

    GiulianoF.Panza; AntonellaPontevivo; GiordanoChimera; RenetaRaykova; AbdelkrimAoudia

    2003-01-01

    The velocity-depth distribution of the lithosphere-asthenosphere in the Italian region and surroundings is imaged, with a lateral resolution of about 100 km, by sur-face wave velocity tomography and non-linear inversion.Maps of the Moho depth, of the thickness of the lithos-phere and of the shear-wave velocities, down to depths of 200 km and more, are constructed. A mantle wedge, iden-tified in the uppermost mantle along the Apennines and the Calabrian Arc, underlies the prmctpat recent votca-noes, and partial melting can be relevant in this part of the uppermost mantle. In Calabria, a lithospheric dou-bling is seen, in connection with the subduction of the Ionian lithosphere. The asthenosphere is shallow in the Southern Tyrrhenian Sea. High velocity bodies, cutting the asthenosphere, outline the Adria-lonian subduction in the Tyrrhenian Sea and the deep-reaching lithospheric root in the Western Alps. Less deep lithospheric roots are seen in the Central Apennines. The lithosphere-asthenos-phere properties delineate a differentiation between the northern and the southern sectors of the Adriatic Sea,likely attesting the fragmentation of Adria.

  16. Preliminary design of surrounding heliostat fields

    Energy Technology Data Exchange (ETDEWEB)

    Collado, Francisco J. [Zaragoza University, Dpto. de Ingenieria Mecanica, CPS-B, Maria de Luna 3, 50018 Zaragoza (Spain)

    2009-05-15

    Recently, the author has shown elsewhere a simplified model that allows quick evaluations of the annual overall energy collected by a surrounding heliostat field. This model is the combination of an analytical flux density function produced by a heliostat, developed by the own author, and an optimized mirror density distribution developed by University of Houston for the Solar One Project. As main conclusion of this previous work, it was recognized that such pseudo-continuous simplified model should not substitute much more accurate discrete evaluations, which manage thousands of individual heliostat coordinates. Here in this work, the difficulty of generating a preliminary discrete layout of a large number of heliostats is addressed. The main novelty is the direct definition of thousands of heliostat coordinates through basically two parameters i.e. a simplified blocking factor and an additional security distance. Such procedure, which was formerly theoretically suggested by the author, is put into practice here, showing examples and commenting their problems and advantages. Getting a previous set of thousands of heliostat coordinates would be a major first step in the complex process of designing solar power tower (SPT). (author)

  17. Contents and ratios of type I and type III collagens in normal skin and hypertrophic scar in people of different ages%正常皮肤与增生性瘢痕中Ⅰ型和Ⅲ型胶原的含量与比例

    Institute of Scientific and Technical Information of China (English)

    王成; 荣艳华; 沈余明; 张国安

    2016-01-01

    Objective To quantify the contents of type I and III collagens and their ratios in normal skin and hyper-trophic scar in people of different ages,and to explore the rule and cause of changes.Methods Normal human skin specimens and hypertrophic scar specimens were obtained from spontaneously aborted fetus and people of different ages, including the children and adolescent group (≤18 years),adult group (19-50 years),elderly group (>50 years). The total collagen contents were determined by hydroxyproline method.The ratios of types I and III collagens were ex-amined by immunohistochemistry,and their contents were calculated.Results The difference of the contents of types I and III collagens and their ratios in normal skin were statistically significant among different age groups (P=0.01 ). Their ratios increased with the increase of age,and the differences were statistically significant among different age groups (P=0.02).The difference of contents of types I and III collagens and their ratios in hypertrophic scars were statistically significant among all groups,also between any two groups (P=0.03).In every age group,the difference of the contents of types I and III collagens and their ratios between normal skin and hypertrophic scar was statistically significant (P=0.02).Conclusion With age increasing,the changes of the ratios of types I and III collagens in the normal skin changes,which results in changes of the tension and elasticity of skin and the healing process after injury. The contents of types I and III collagens and their ratios significantly changes in hypertrophic scars,resulting in different structure of scar from normal skin.%目的:测定各年龄组人正常皮肤及增生性瘢痕中Ⅰ、Ⅲ型胶原的含量及比值,分析其变化规律和原因。方法采集流产胎儿的皮肤标本及儿童青少年组、成年组、老年组的正常皮肤标本和增生性瘢痕标本,采用免疫组织化学染色法测定Ⅰ、Ⅲ型胶原比值

  18. Genital skin fibroblasts (GF) of patients with androgen insensitivity syndrome express higher insulin-like growth factor binding protein (IGFBP)-2, -3 and -5 than GF of normally virilized males.

    Science.gov (United States)

    Diesing, D; Elmlinger, M W; Schuett, B S; Weidemann, W; Romalo, G; Schweikert, H U; Spindler, K-D; Ranke, M B

    2003-01-01

    We investigated the effects of androgens, estradiol (E2) and insulin-like growth factor (IGF)-I on IGF-II, insulin-like growth factor binding protein (IGFBP)-2, -3 and -5 and mRNA in genital fibroblasts (GF) from patients with complete androgen insensitivity (CAIS) and normally virilized males (C). Proteins were measured by specific RIA and Western ligand blot, and specific mRNA levels by RT-PCR normalized by GAPDH levels. Secretion of IGF-II was lowered in CAIS (pGF and by testosterone + IGF-I in C GF. Secretion of IGFBP-2 was higher (pGF and IGFBP-2 mRNA levels were increased by E2 in C GF (pGF. CAIS GF also secreted more IGFBP-3 (pGF (pGF, the availability of IGF-II in CAIS GF is apparently decreased by two facts: by the decreased expression and by increased expression of IGFBP-2, -3 and -5. Furthermore, E2 and IGF-I modulate the expression of IGF-II and IGFBP in GF. This may play a role in the failure to develop male external genitals in CAIS patients. Copyright 2003 S. Karger AG, Basel

  19. Stereological quantification of lymphocytes in skin biopsies from atopic dermatitis patients

    DEFF Research Database (Denmark)

    Ellingsen, A R; Sørensen, Flemming Brandt; Larsen, J O;

    2001-01-01

    Atopic dermatitis (AD) is histologically characterized by lymphocytic infiltration of the skin and quantitative assessment is required. This study introduces stereological techniques to quantify the number of lymphocytes in skin biopsies. Four-millimetre punch biopsies were taken from skin...... with active eczema in 8 adults with AD and from clinically normal skin from 4 of the patients. Five persons without allergy or skin disease served as controls. The mean number of lymphocytes in 4-mm skin biopsies was 469,000 and 124,000 in active eczema and in clinically normal skin, respectively. Compared...... with controls, the number of lymphocytes in biopsies increased by a factor of 6.8 in active eczema and a factor of 1.8 in clinically normal skin. If 20% of skin is affected by eczema the total number of lymphocytes located in the affected skin can be estimated to 1.27 x 10(10). A patient with clinically...

  20. Friction and durability of virgin and damaged skin with and without skin cream treatment using atomic force microscopy

    Directory of Open Access Journals (Sweden)

    Bharat Bhushan

    2012-11-01

    Full Text Available Skin can be damaged by the environment easily. Skin cream is an effective and rapid way to moisten the skin by changing the skin surface properties. Rat skin and pig skin are common animal models for studies and were used as skin samples in this study. The nano- and macroscale friction and durability of damaged skin were measured and compared with those of virgin (intact/undamaged skin. The effect of skin cream on friction and durability of damaged and virgin skin samples is discussed. The effects of velocity, normal load, relative humidity and number of cycles were studied. The nanoscale studies were performed by using atomic force microscope (AFM, and macroscale studies were performed by using a pin-on-disk (POD reciprocating tribometer. It was found that damaged skin has different mechanical properties, surface roughness, contact angle, friction and durability compared to that of virgin skin. But similar changes occur after skin cream treatment. Rat and pig skin show similar trends in friction and durability.

  1. Skin Care and Aging

    Science.gov (United States)

    ... version of this page please turn Javascript on. Skin Care and Aging How Aging Affects Skin Your skin changes with age. It becomes thinner, ... to make it feel and look better. Dry Skin and Itching Click for more information Many older ...

  2. PIXE analysis in uninvolved skin of atopic patients and in aged skin

    Energy Technology Data Exchange (ETDEWEB)

    Bunse, T.; Steigleder, K. (Universitaets-Hautklinik, Koeln (Germany)); Hoefert, M.; Gonsior, B. (Institut fuer Experimentalphysik, Ruhr-Universitaet, Bochum (Germany))

    1991-01-01

    PIXE analysis was used to determine the elemental distribution in normal-appearing skin of patients suffering from atopic eczema and in the skin of elderly people. With this technique, elements with atomic numbers {>=} 14 can be detected simultaneously in cryosections of skin biopsies down to a concentration of 1 ppm. Compared with a control group, the epidermal concentrations of Zn and CU, which are constituent parts of a variety of enzymes, were increased in uninvolved skin of patients with atopic eczema. In the epidermis of elderly people the level of K was lower and that of Ca was higher than in the epidermis of a younger age group. (au).

  3. Preliminary experiments on quantification of skin condition

    Science.gov (United States)

    Kitajima, Kenzo; Iyatomi, Hitoshi

    2014-03-01

    In this study, we investigated a preliminary assessment method for skin conditions such as a moisturizing property and its fineness of the skin with an image analysis only. We captured a facial images from volunteer subjects aged between 30s and 60s by Pocket Micro (R) device (Scalar Co., Japan). This device has two image capturing modes; the normal mode and the non-reflection mode with the aid of the equipped polarization filter. We captured skin images from a total of 68 spots from subjects' face using both modes (i.e. total of 136 skin images). The moisture-retaining property of the skin and subjective evaluation score of the skin fineness in 5-point scale for each case were also obtained in advance as a gold standard (their mean and SD were 35.15 +/- 3.22 (μS) and 3.45 +/- 1.17, respectively). We extracted a total of 107 image features from each image and built linear regression models for estimating abovementioned criteria with a stepwise feature selection. The developed model for estimating the skin moisture achieved the MSE of 1.92 (μS) with 6 selected parameters, while the model for skin fineness achieved that of 0.51 scales with 7 parameters under the leave-one-out cross validation. We confirmed the developed models predicted the moisture-retaining property and fineness of the skin appropriately with only captured image.

  4. Terahertz pulse imaging in reflection geometry of human skin cancer and skin tissue

    Energy Technology Data Exchange (ETDEWEB)

    Woodward, Ruth M [Cavendish Laboratory, University of Cambridge, Madingley Road, Cambridge (United Kingdom); Cole, Bryan E [TeraView Limited, 302/304 Cambridge Science Park, Milton Road, Cambridge (United Kingdom); Wallace, Vincent P [TeraView Limited, 302/304 Cambridge Science Park, Milton Road, Cambridge (United Kingdom); Pye, Richard J [Department of Dermatology, Addenbrooke' s Hospital, Cambridge (United Kingdom); Arnone, Donald D [TeraView Limited, 302/304 Cambridge Science Park, Milton Road, Cambridge (United Kingdom); Linfield, Edmund H [Cavendish Laboratory, University of Cambridge, Madingley Road, Cambridge (United Kingdom); Pepper, Michael [Cavendish Laboratory, University of Cambridge, Madingley Road, Cambridge (United Kingdom)

    2002-11-07

    We demonstrate the application of terahertz pulse imaging (TPI) in reflection geometry for the study of skin tissue and related cancers both in vitro and in vivo. The sensitivity of terahertz radiation to polar molecules, such as water, makes TPI suitable for studying the hydration levels in the skin and the determination of the lateral spread of skin cancer pre-operatively. By studying the terahertz pulse shape in the time domain we have been able to differentiate between diseased and normal tissue for the study of basal cell carcinoma (BCC). Basal cell carcinoma has shown a positive terahertz contrast, and inflammation and scar tissue a negative terahertz contrast compared to normal tissue. In vivo measurements on the stratum corneum have enabled visualization of the stratum corneum-epidermis interface and the study of skin hydration levels. These results demonstrate the potential of terahertz pulse imaging for the study of skin tissue and its related disorders, both in vitro and in vivo.

  5. The gentle touch receptors of mammalian skin

    OpenAIRE

    Zimmerman, Amanda; Bai, Ling; Ginty, David D.

    2014-01-01

    The skin is our largest sensory organ, transmitting pain, temperature, itch, and touch information to the central nervous system. Touch sensations are conveyed by distinct combinations of mechanosensory end organs and the low-threshold mechanoreceptors (LTMRs) that innervate them. Here we explore the various structures underlying the diverse functions of cutaneous LTMR end organs. Beyond anchoring of LTMRs to the surrounding dermis and epidermis, recent evidence suggests that the non-neuronal...

  6. HAM56 and CD68 antigen presenting cells surrounding a sarcoidal granulomatous tattoo

    Directory of Open Access Journals (Sweden)

    Ana Maria Abreu Velez

    2011-01-01

    Full Text Available Context : Tattoos are produced by introducing colorants of various compositions into the skin, either accidentally or for cosmetic purposes. Case Report: A 62-year-old male presented with a cosmetic tattoo and requested a total excision of the lesion. Dermatopathologic analysis of the excised tissue with hematoxylin and eosin examination, as well as immunohistochemistry was performed. H&E staining demonstrated classic histologic features of a tattoo. Utilizing immunohistochemistry, dermal histiocytic antigen presenting cells stained with HAM56 and CD68 antibodies; the staining was present surrounding the tattoo pigment. Conclusions : We identified two macrophage markers (HAM56 and CD68 surrounding dermal tattoo pigment. A minimal dermal inflammatory immune was noted to the tattoo pigment. Moreover, the immune response and/or tolerance to tattoos is not well characterized. We suggest that tattoo materials and techniques could be utilized in therapeutic delivery for diseases such recessive dystrophic epidermolysis bullosa, potentially preventing immune rejection of gene therapy agents.

  7. The skin microbiome: Associations between altered microbial communities and disease.

    Science.gov (United States)

    Weyrich, Laura S; Dixit, Shreya; Farrer, Andrew G; Cooper, Alan J; Cooper, Alan J

    2015-11-01

    A single square centimetre of the human skin can contain up to one billion microorganisms. These diverse communities of bacteria, fungi, mites and viruses can provide protection against disease, but can also exacerbate skin lesions, promote disease and delay wound healing. This review addresses the current knowledge surrounding the healthy skin microbiome and examines how different alterations to the skin microbial communities can contribute to disease. Current methodologies are considered, changes in microbial diversity and colonisation by specific microorganisms are discussed in the context of atopic dermatitis, psoriasis, acne vulgaris and chronic wounds. The recent impact of modern Westernised lifestyles on the human skin microbiome is also examined, as well as the potential benefits and pitfalls of novel therapeutic strategies. Further analysis of the human skin microbiome, and its interactions with the host immune system and other commensal microorganisms, will undoubtedly elucidate molecular mechanisms for disease and reveal gateways for novel therapeutic treatment strategies.

  8. Impacts of Artificial Reefs on Surrounding Ecosystems

    Science.gov (United States)

    Manoukian, Sarine

    Artificial reefs are becoming a popular biological and management component in shallow water environments characterized by soft seabed, representing both important marine habitats and tools to manage coastal fisheries and resources. An artificial reef in the marine environment acts as an open system with exchange of material and energy, altering the physical and biological characteristics of the surrounding area. Reef stability will depend on the balance of scour, settlement, and burial resulting from ocean conditions over time. Because of the unstable nature of sediments, they require a detailed and systematic investigation. Acoustic systems like high-frequency multibeam sonar are efficient tools in monitoring the environmental evolution around artificial reefs, whereas water turbidity can limit visual dive and ROV inspections. A high-frequency multibeam echo sounder offers the potential of detecting fine-scale distribution of reef units, providing an unprecedented level of resolution, coverage, and spatial definition. How do artificial reefs change over time in relation to the coastal processes? How accurately does multibeam technology map different typologies of artificial modules of known size and shape? How do artificial reefs affect fish school behavior? What are the limitations of multibeam technology for investigating fish school distribution as well as spatial and temporal changes? This study addresses the above questions and presents results of a new approach for artificial reef seafloor mapping over time, based upon an integrated analysis of multibeam swath bathymetry data and geoscientific information (backscatter data analysis, SCUBA observations, physical oceanographic data, and previous findings on the geology and sedimentation processes, integrated with unpublished data) from Senigallia artificial reef, northwestern Adriatic Sea (Italy) and St. Petersburg Beach Reef, west-central Florida continental shelf. A new approach for observation of fish

  9. Detection of follicular transport of lidocaine and metabolism in adipose tissue in pig ear skin by DESI mass spectrometry imaging

    DEFF Research Database (Denmark)

    D'Alvise, Janina; Mortensen, Rasmus; Hansen, Steen H;

    2014-01-01

    of lidocaine into the deeper skin layers is demonstrated for the first time. Furthermore, metabolism of lidocaine to 3-OH-lidocaine was observed in subcutaneous tissue as well as in lobules of white adipose tissue surrounding the hair follicles. These results suggest that it is advantageous to use full...... thickness skin, including subcutaneous tissue, for skin metabolism studies....

  10. [Sarcoidosis of the skin].

    Science.gov (United States)

    Suga, Y; Ogawa, H

    1994-06-01

    Sarcoidosis is characterized by formation of epithelioid-cell tubercules, without caseation, of the affected organ systems. The mediastinum, peripheral lymph nodes and eyes, in addition to the skin, are most frequently affected. Between 10% and 30% of patients with systemic sarcoidosis in Japan have skin lesions. Skin sarcoidosis is morphologically classified into three basic groups, erythema nodosum, scar sarcoidosis and skin sarcoid. Skin sarcoid is characterized by specific cutaneous lesions of sarcoidosis, and may take nodular, plaque, angiolupoid, subcutaneous and some other forms. Clinical manifestations of the cutaneous lesions are usually asymptomatic and polymorphous. Skin biopsy is, however, often highly useful for confirming a diagnosis of sarcoidosis.

  11. OCT imaging of skin cancer and other dermatological diseases

    DEFF Research Database (Denmark)

    Mogensen, Mette; Thrane, Lars; Jørgensen, Thomas Martini;

    2009-01-01

    Optical coherence tomography (OCT) provides clinicians and researchers with micrometer-resolution, in vivo, cross-sectional images of human skin up to several millimeter depth. This review of OCT imaging applied within dermatology covers the application of OCT to normal skin, and reports on a lar...... number of applications in the fields of non-melanoma skin cancer, malignant melanomas, psoriasis and dermatitis, infestations, bullous skin diseases, tattoos, nails, haemangiomas, and other skin diseases. (© 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim)...

  12. Deepening our understanding of immune sentinels in the skin.

    Science.gov (United States)

    Nestle, Frank O; Nickoloff, Brian J

    2007-09-01

    Advances in our understanding of the skin immune system have a major impact on studies of skin autoimmunity, graft-versus-host disease, inflammation, and cancer as well as on the development of novel vaccines and immunotherapy approaches. In this issue of the JCI, Zaba et al. carefully dissected the complex network of DCs and macrophages residing in normal human skin and defined novel phenotypic markers for these immunocytes (see the related article beginning on page 2517). These studies provide the basis for better insight into the role of important immune sentinels contributing to the maintenance of skin tissue homeostasis and lay the foundation for future studies of the skin immune system.

  13. Skin-lightening effects of a new face care product in patients with melasma.

    Science.gov (United States)

    Scherdin, U; Bürger, Anette; Bielfeldt, Stephan; Filbry, Alexander; Weber, Teresa; Schölermann, Andrea; Wigger-Alberti, Walter; Rippke, Frank; Wilhelm, Klaus-Peter

    2008-03-01

    Melasma is a common pigmentation disorder having considerable effect on patients' emotional and psychological well-being. Assessment of efficacy and tolerability of a new face care product for the targeted spot treatment of darker pigmented areas in subjects with melasma and evaluation of effects on patients' quality of life. Twenty subjects with melasma were enrolled in this study. Data of 19 participants were available for analysis. Melasma severity was evaluated at baseline, after 4 weeks, and after 8 weeks by using the Melasma Area and Severity Index (MASI). Furthermore, chromametry and digital image analysis of videomicroscopic photographs were performed, and quality of life was measured using the Melasma Quality of Life Scale. The application of the product resulted in a significant lightening of melasma in comparison with baseline and to untreated control areas. The MASI score dropped by more than 40% after 8 weeks. Measurement of skin color by chromametry revealed lightening of pigmented areas and a significant decrease in contrast between melasma and normal-pigmented surrounding skin. These results were confirmed by digital image analysis. Tolerability of the product was rated to be excellent, and patients experienced a significant gain in quality of life. The data demonstrate that the new face care product is effective and highly skin tolerable and clearly improves quality of life of patients with melasma.

  14. Skin Stem Cells in Skin Cell Therapy

    Directory of Open Access Journals (Sweden)

    Mollapour Sisakht

    2015-12-01

    Full Text Available Context Preclinical and clinical research has shown that stem cell therapy is a promising therapeutic option for many diseases. This article describes skin stem cells sources and their therapeutic applications. Evidence Acquisition Compared with conventional methods, cell therapy reduces the surgical burden for patients because it is simple and less time-consuming. Skin cell therapy has been developed for variety of diseases. By isolation of the skin stem cell from the niche, in vitro expansion and transplantation of cells offers a surprising healing capacity profile. Results Stem cells located in skin cells have shown interesting properties such as plasticity, transdifferentiation, and specificity. Mesenchymal cells of the dermis, hypodermis, and other sources are currently being investigated to promote regeneration. Conclusions Because skin stem cells are highly accessible from autologous sources and their immunological profile is unique, they are ideal for therapeutic approaches. Optimization of administrative routes requires more investigation own to the lack of a standard protocol.

  15. Learning about Skin Cancer

    Science.gov (United States)

    ... information, in skin cells, creating "misspellings" in their genetic code and, as a result, alter the function of those cells. Cancers generally are caused by a combination of environmental and genetic factors. With skin cancer, the environment plays a ...

  16. Examine Your Skin

    Medline Plus

    Full Text Available ... Items Awareness Store In Memory Melanoma Info Melanoma Facts Melanoma Prevention Sunscreen Suggestions Examine Your Skin Newly ... use this video. UPDATED: November 23, 2016 Melanoma Facts Melanoma Prevention Sunscreen Suggestions Examine Your Skin Newly ...

  17. Examine Your Skin

    Medline Plus

    Full Text Available ... Support Donate Share Facebook Twitter Newsletter Examine Your Skin Watch the video below and in only two minutes, you can learn to examine your skin. A special thanks to Dr. Martin Weinstock, MD, ...

  18. Examine Your Skin

    Medline Plus

    Full Text Available ... Support Donate Share Facebook Twitter Newsletter Examine Your Skin Watch the video below and in only two minutes, you can learn to examine your skin. A special thanks to Dr. Martin Weinstock, MD, ...

  19. Bleeding into the skin

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/003235.htm Bleeding into the skin To use the sharing features on this page, please enable JavaScript. Bleeding into the skin can occur from broken blood ...

  20. Examine Your Skin

    Medline Plus

    Full Text Available ... Store In Memory Melanoma Info Melanoma Facts Melanoma Prevention Sunscreen Suggestions Examine Your Skin Newly Diagnosed? Understanding ... video. UPDATED: November 23, 2016 Melanoma Facts Melanoma Prevention Sunscreen Suggestions Examine Your Skin Newly Diagnosed? Understanding ...

  1. Examine Your Skin

    Medline Plus

    Full Text Available ... Store In Memory Melanoma Info Melanoma Facts Melanoma Prevention Sunscreen Suggestions Examine Your Skin Newly Diagnosed? Understanding ... video. UPDATED: November 23, 2016 Melanoma Facts Melanoma Prevention Sunscreen Suggestions Examine Your Skin Newly Diagnosed? Understanding ...

  2. Study of mast cell count in skin tags

    Directory of Open Access Journals (Sweden)

    Zaher Hesham

    2007-01-01

    Full Text Available Background: Skin tags or acrochordons are common tumors of middle-aged and elderly subjects. They consist of loose fibrous tissue and occur mainly on the neck and major flexures as small, soft, pedunculated protrusions. Objectives: The aim was to compare the mast cells count in skin tags to adjacent normal skin in diabetic and nondiabetic participants in an attempt to elucidate the possible role of mast cells in the pathogenesis of skin tags. Participants and Methods: Thirty participants with skin tags were divided into group I (15 nondiabetic participants and group II (15 diabetic participants. Three biopsies were obtained from each participant: a large skin tag, a small skin tag and adjacent normal skin. Mast cell count from all the obtained sections was carried out, and the mast cell density was expressed as the average mast cell count/high power field (HPF. Results: A statistically significant increase in mast cells count in skin tags in comparison to normal skin was detected in group I and group II. There was no statistically significant difference between mast cell counts in skin tags of both the groups. Conclusion: Both the mast cell mediators and hyperinsulinemia are capable of inducing fibroblast proliferation and epidermal hyperplasia that are the main pathologic abnormalities seen in all types of skin tags. However, the presence of mast cells in all examined skin tags regardless of diabetes and obesity may point to the possible crucial role of mast cells in the etiogenesis of skin tags through its interaction with fibroblasts and keratinocytes.

  3. Ultrasound skin imaging.

    Science.gov (United States)

    Alfageme Roldán, F

    2014-12-01

    The interaction of high-frequency ultrasound waves with the skin provides the basis for noninvasive, fast, and accessible diagnostic imaging. This tool is increasingly used in skin cancer and inflammatory conditions as well as in cosmetic dermatology. This article reviews the basic principles of skin ultrasound and its applications in the different areas of dermatology.

  4. Skin self-exam

    Science.gov (United States)

    Skin cancer - self-exam; Melanoma - self-exam; Basal cell cancer - self-exam; Squamous cell - self-exam; Skin mole - self-exam ... Experts do not agree on whether or not skin self-exams should be performed. So there is ...

  5. Microbiome and skin diseases

    NARCIS (Netherlands)

    Zeeuwen, P.L.J.M.; Kleerebezem, M.; Timmerman, H.M.; Schalkwijk, J.

    2013-01-01

    PURPOSE OF REVIEW: This article reviews recent findings on the skin microbiome. It provides an update on the current understanding of the role of microbiota in healthy skin and in inflammatory and allergic skin diseases. RECENT FINDINGS: Advances in computing and high-throughput sequencing technolog

  6. Microbiome and skin diseases

    NARCIS (Netherlands)

    Zeeuwen, P.L.; Kleerebezem, M.; Timmerman, H.M.; Schalkwijk, J.

    2013-01-01

    Purpose of review: This article reviews recent findings on the skin microbiome. It provides an update on the current understanding of the role of microbiota in healthy skin and in inflammatory and allergic skin diseases. Recent findings: Advances in computing and high-throughput sequencing technolog

  7. Microbiome and skin diseases

    NARCIS (Netherlands)

    Zeeuwen, P.L.J.M.; Kleerebezem, M.; Timmerman, H.M.; Schalkwijk, J.

    2013-01-01

    PURPOSE OF REVIEW: This article reviews recent findings on the skin microbiome. It provides an update on the current understanding of the role of microbiota in healthy skin and in inflammatory and allergic skin diseases. RECENT FINDINGS: Advances in computing and high-throughput sequencing

  8. Microbiome and skin diseases

    NARCIS (Netherlands)

    Zeeuwen, P.L.; Kleerebezem, M.; Timmerman, H.M.; Schalkwijk, J.

    2013-01-01

    Purpose of review: This article reviews recent findings on the skin microbiome. It provides an update on the current understanding of the role of microbiota in healthy skin and in inflammatory and allergic skin diseases. Recent findings: Advances in computing and high-throughput sequencing

  9. On skin expansion.

    Science.gov (United States)

    Pamplona, Djenane C; Velloso, Raquel Q; Radwanski, Henrique N

    2014-01-01

    This article discusses skin expansion without considering cellular growth of the skin. An in vivo analysis was carried out that involved expansion at three different sites on one patient, allowing for the observation of the relaxation process. Those measurements were used to characterize the human skin of the thorax during the surgical process of skin expansion. A comparison between the in vivo results and the numerical finite elements model of the expansion was used to identify the material elastic parameters of the skin of the thorax of that patient. Delfino's constitutive equation was chosen to model the in vivo results. The skin is considered to be an isotropic, homogeneous, hyperelastic, and incompressible membrane. When the skin is extended, such as with expanders, the collagen fibers are also extended and cause stiffening in the skin, which results in increasing resistance to expansion or further stretching. We observed this phenomenon as an increase in the parameters as subsequent expansions continued. The number and shape of the skin expanders used in expansions were also studied, both mathematically and experimentally. The choice of the site where the expansion should be performed is discussed to enlighten problems that can lead to frustrated skin expansions. These results are very encouraging and provide insight into our understanding of the behavior of stretched skin by expansion. To our knowledge, this study has provided results that considerably improve our understanding of the behavior of human skin under expansion.

  10. PPD skin test

    Science.gov (United States)

    ... test; Mantoux test Images Tuberculosis in the kidney Tuberculosis in the lung Positive PPD skin test PPD skin test References Chernecky CC, Berger ... test, purified protein derivative test, Tb test, tuberculin skin test, TST, tuberculosis test) - diagnostic. In: Chernecky CC, Berger BJ, eds. ...

  11. The water exchange between Chinchorro Bank and its surroundings

    Science.gov (United States)

    Candela, Julio; Ochoa, Jose Luis; Sheinbaum, Julio; Lopez, Manuel; Cornado, Cesar

    2015-04-01

    Chinchorro Bank is a relatively large (~500 km^ 2) atoll situated 33 km in front of the Yucatan Peninsula in the Caribbean coast of Mexico. Two years of continuous measurements of the subsurface pressure field inside and around Chinchorro Bank, along with currents and waves observed outside, suggest four major processes governing the water exchange of the Bank with its surroundings: 1) surface wave pumping of water into the Bank through its eastern edge, 2) the large scale circulation in the region that drives the sea level changes through geostrophy, 3) the tidal pumping with imposed cyclic flows into and out of the Bank and 4) the imposed drift by the wind. Waves impinging all along the eastern barrier reef induce water inflows (from overtopping the reef) and generate a pressure gradient that drives a drift from east to west throughout the Bank. This western drift can normally replenish the water over the Bank with a time scale of ~10 days. However, extreme wave events, lasting around 24 hours, can replenish the whole Bank's water in the order of day. The region's large scale circulation is dominated by the zonal Cayman Current impinging on the Yucatan Peninsula becoming the Yucatan Current as it turns northward. Variability in the strength and impacting latitude of this current causes sea level gradients within the Bank, i.e., a Yucatan Current increase of 1 m/s, over a period of a couple of weeks, sets up a zonal sea level gradient within that can replenish the whole Bank's water in a time scale of ~14 days. At such times, the large scale current around the Bank is at a maximum thus ensuring an effective removal and dispersal of the exported waters. The Bank has a micro-tidal regime with a semidiurnal amplitude of ~12 cm during spring tides and a diurnal of ~2 cm, these imply that the Bank is exchanging ~10% of its waters with its surroundings daily. However small, this tidal pumping is effective for the ventilation of the Banks' waters in ~10 days due to the

  12. High resolution skin colorimetry, strain mapping and mechanobiology.

    Science.gov (United States)

    Devillers, C; Piérard-Franchimont, C; Schreder, A; Docquier, V; Piérard, G E

    2010-08-01

    Skin colours are notoriously different between individuals. They are governed by ethnicities and phototypes, and further influenced by a variety of factors including photoexposures and sustained mechanical stress. Indeed, mechanobiology is a feature affecting the epidermal melanization. High-resolution epiluminescence colorimetry helps in deciphering the effects of forces generated by Langer's lines or relaxed skin tension lines on the melanocyte activity. The same procedure shows a prominent laddering pattern of melanization in striae distensae contrasting with the regular honeycomb pattern in the surrounding skin.

  13. Nanofibers Offer Alternative Ways to the Treatment of Skin Infections

    Directory of Open Access Journals (Sweden)

    T. D. J. Heunis

    2010-01-01

    Full Text Available Injury to the skin causes a breach in the protective layer surrounding the body. Many pathogens are resistant to antibiotics, rendering conventional treatment less effective. This led to the use of alternative antimicrobial compounds, such as silver ions, in skin treatment. In this review nanofibers, and the incorporation of natural antimicrobial compounds in these scaffolds, are discussed as an alternative way to control skin infections. Electrospinning as a technique to prepare nanofibers is discussed. The possibility of using these structures as drug delivery systems is investigated.

  14. Hyperelastic Material Properties of Mouse Skin under Compression.

    Directory of Open Access Journals (Sweden)

    Yuxiang Wang

    Full Text Available The skin is a dynamic organ whose complex material properties are capable of withstanding continuous mechanical stress while accommodating insults and organism growth. Moreover, synchronized hair cycles, comprising waves of hair growth, regression and rest, are accompanied by dramatic fluctuations in skin thickness in mice. Whether such structural changes alter skin mechanics is unknown. Mouse models are extensively used to study skin biology and pathophysiology, including aging, UV-induced skin damage and somatosensory signaling. As the skin serves a pivotal role in the transfer function from sensory stimuli to neuronal signaling, we sought to define the mechanical properties of mouse skin over a range of normal physiological states. Skin thickness, stiffness and modulus were quantitatively surveyed in adult, female mice (Mus musculus. These measures were analyzed under uniaxial compression, which is relevant for touch reception and compression injuries, rather than tension, which is typically used to analyze skin mechanics. Compression tests were performed with 105 full-thickness, freshly isolated specimens from the hairy skin of the hind limb. Physiological variables included body weight, hair-cycle stage, maturity level, skin site and individual animal differences. Skin thickness and stiffness were dominated by hair-cycle stage at young (6-10 weeks and intermediate (13-19 weeks adult ages but by body weight in mature mice (26-34 weeks. Interestingly, stiffness varied inversely with thickness so that hyperelastic modulus was consistent across hair-cycle stages and body weights. By contrast, the mechanics of hairy skin differs markedly with anatomical location. In particular, skin containing fascial structures such as nerves and blood vessels showed significantly greater modulus than adjacent sites. Collectively, this systematic survey indicates that, although its structure changes dramatically throughout adult life, mouse skin at a given

  15. Retinoic acid synergistically enhances the melanocytotoxic and depigmenting effects of monobenzylether of hydroquinone in black guinea pig skin.

    Science.gov (United States)

    Kasraee, Behrooz; Fallahi, Mohammad Reza; Ardekani, Gholamreza Safaee; Ebrahimi, Saeed; Doroudchi, Gholamreza; Omrani, Gholamhossein R; Handjani, Farhad; Amini, Mitra; Tanideh, Nader; Haddadi, Marzieh; Nikbakhsh, Mohammad; Jahanbani, Saeedeh; Tran, Christian; Sorg, Olivier; Saurat, Jean-Hilaire

    2006-07-01

    Monobenzylether of hydroquinone (MBEH) has long been utilized for the depigmentation therapy of patients with extensive vitiligo. In this approach, the normally pigmented areas surrounding vitiligo lesions are depigmented to achieve a uniform skin tone. One of the important disadvantages of MBEH therapy, however, is the resistance of a considerable number of vitiligo patients against the depigmenting effect of this agent. We have previously proposed that the glutathione-dependent cytoprotection of melanocytes can be impaired through the inhibition of the enzyme glutathione S-transferase by retinoic acid (RA). The combination of RA with melanocytotoxic agents could thus lead to increased susceptibility of melanocytes to such compounds. In this study we have shown, for the first time, that the melanocytotoxic and depigmenting effects of MBEH are synergistically enhanced when it is combined with RA. The treatment of black guinea pig skin with RA (0.025%) alone induced no significant changes in the number of epidermal melanocytes and no skin depigmentation. On the other hand, MBEH (10%) produced mild to moderate skin depigmentation and reduced the average number of melanocytes from 76 (+/-5)/field (magnification: x 40) in control sites, to 42 (+/-6)/field in the depigmented skin. The RA (0.025%)-MBEH (10%) combination, however, produced a complete degree of depigmentation in the majority of treated sites after 10 days of application and reduced the average number of melanocytes to only 6 (+/-6)/field. RA-MBEH combination serves as a very potent skin depigmenting formula and now awaits future assessments of its potential use for the treatment of extensive vitiligo.

  16. 生理盐水联合酒精应用的不同方式对皮试消毒的效果分析%An Analysis on Effect of Different Application Ways of Normal Saline plus Alcohol on Skin Test

    Institute of Scientific and Technical Information of China (English)

    罗艳; 孔碧华; 李冬芬

    2015-01-01

    Objective:To study the sterilizing effect of different application ways of sodium chloride(0 .9% ) plus alcohol(75% ) in the area of skin test .Methods:Select a total of 600 cases of patients who were infused in clinic and has to have a allergy skin test of tetanus antitoxin in some hospital during the period from January 2013 to December , randomly divide them into wiping group and spraying group .The wiping group were wiped with sodium chloride (0 .9% ) firstly ,and then were sterilized with alcohol(75% ) in the same way ,finally took the skin test .The spraying group were sterilized with alcohol(75% ) in the same way above first ,and then were sprayed with the spray bottle containing sodium chloride(0 .9% ) towards the area wiped with alcohol ,dry the sterilized area with sterile swabs and take the skin test .20 minutes later ,Compare and observe the false positive rate after skin test ,infection rate ,the prev‐alence of anaphylactic reaction after medication in the two groups ,sterilizing quantity in sterilized area .Results:False positive rate of the wiping group and spraying group was 0 .7% and 3 .3 respectively (P< 0 .05) .None of them showed any skin infection and allergy in both group .As for the quantity of sterilized bacteria in the two groups after medicating ,the quantity of the wiping group was less than that of spraying group ,the difference was comparatively obvious (P<0 .05) .Conclusion:The safety application of the wipe and spray of normal saline plus and alcohol in the sterilization of skin test lower the false positive rate resulted from skin sanitizer ,alleviate patients'suffering and it is more effective ,saves health resources ,reduces the workload and improves clinical working efficiency .%目的:探讨运用0.9%氯化钠(即生理盐水)联合75%乙醇应用的不同方式对皮试区皮肤消毒效果的研究。方法:选取某院2013年1~12月的门诊输液需进行过伤风抗病毒素过敏皮试的患者共600

  17. Pursuing prosthetic electronic skin

    Science.gov (United States)

    Chortos, Alex; Liu, Jia; Bao, Zhenan

    2016-09-01

    Skin plays an important role in mediating our interactions with the world. Recreating the properties of skin using electronic devices could have profound implications for prosthetics and medicine. The pursuit of artificial skin has inspired innovations in materials to imitate skin's unique characteristics, including mechanical durability and stretchability, biodegradability, and the ability to measure a diversity of complex sensations over large areas. New materials and fabrication strategies are being developed to make mechanically compliant and multifunctional skin-like electronics, and improve brain/machine interfaces that enable transmission of the skin's signals into the body. This Review will cover materials and devices designed for mimicking the skin's ability to sense and generate biomimetic signals.

  18. Skin manifestations in a case of trisomy 16 mosaicism

    DEFF Research Database (Denmark)

    Ousager, Lilian Bomme; Brandrup, Flemming; Andersen, Charlotte Brasch;

    2006-01-01

    We present a 48-year-old man with unilateral dermatological manifestations including hypertrichosis, telangiectasia, hyperkeratosis and hyperpigmentation. Additional findings included skeletal abnormalities and left-sided hearing loss. Skin biopsies showed changes characteristic of porokeratosis........ Fibroblast karyotyping from affected skin demonstrated trisomy 16 mosaicism, in contrast to the normal karyotype in unaffected skin and blood lymphocytes. The possible role of trisomy 16 in porokeratosis is discussed....

  19. Tactile-direction-sensitive and stretchable electronic skins based on human-skin-inspired interlocked microstructures.

    Science.gov (United States)

    Park, Jonghwa; Lee, Youngoh; Hong, Jaehyung; Lee, Youngsu; Ha, Minjeong; Jung, Youngdo; Lim, Hyuneui; Kim, Sung Youb; Ko, Hyunhyub

    2014-12-23

    Stretchable electronic skins with multidirectional force-sensing capabilities are of great importance in robotics, prosthetics, and rehabilitation devices. Inspired by the interlocked microstructures found in epidermal-dermal ridges in human skin, piezoresistive interlocked microdome arrays are employed for stress-direction-sensitive, stretchable electronic skins. Here we show that these arrays possess highly sensitive detection capability of various mechanical stimuli including normal, shear, stretching, bending, and twisting forces. Furthermore, the unique geometry of interlocked microdome arrays enables the differentiation of various mechanical stimuli because the arrays exhibit different levels of deformation depending on the direction of applied forces, thus providing different sensory output patterns. In addition, we show that the electronic skins attached on human skin in the arm and wrist areas are able to distinguish various mechanical stimuli applied in different directions and can selectively monitor different intensities and directions of air flows and vibrations.

  20. Skin absorption through atopic dermatitis skin

    DEFF Research Database (Denmark)

    Halling-Overgaard, A-S; Kezic, S; Jakasa, I

    2017-01-01

    Patients with atopic dermatitis have skin barrier impairment in both lesional and non-lesional skin. They are typically exposed to emollients daily and topical anti-inflammatory medicaments intermittently, hereby increasing the risk of developing contact allergy and systemic exposed to chemicals...... ingredients found in these topical preparations. We systematically searched for studies that investigated skin absorption of various penetrants, including medicaments, in atopic dermatitis patients, but also animals with experimentally induced dermatitis. We identified 40 articles, i.e. 11 human studies...... examining model penetrants, 26 human studies examining atopic dermatitis drugs and 3 animal studies. We conclude that atopic dermatitis patients have nearly two-fold increased skin absorption when compared to healthy controls. There is a need for well-designed epidemiological and dermato...

  1. What Is Melanoma Skin Cancer?

    Science.gov (United States)

    ... Z About Melanoma Skin Cancer What Is Melanoma Skin Cancer? Key Statistics for Melanoma Skin Cancer What’s New in Melanoma ... Policy . About Melanoma Skin Cancer What Is Melanoma Skin Cancer? Key Statistics for Melanoma Skin Cancer What’s New in Melanoma ...

  2. THE CLASSIFICATION OF THE SURROUNDINGS OF COAL MINING ROADWAYS

    Institute of Scientific and Technical Information of China (English)

    邹喜正; 侯朝炯; 李华祥

    1996-01-01

    This introduces the calculation of opaper the deformationg .the Surroundings of coaowaysand the divisi of surroundings into 5 levels by means or !fuzzy integral assess mairrx, wnlcnserves-asthe scientific basis for selecting supporting pattern of roadways and determining the, pa-rameters of support.

  3. Personnel decontamination and preventive skin care; Personendekontamination und Hautprophylaxe

    Energy Technology Data Exchange (ETDEWEB)

    Henning, Klaus; Gojowczyk, Peter [AKA Kunz GmbH, Waldenbuch (Germany)

    2010-07-15

    Skin contamination arises from contact with contaminated aqueous solutions and from transmission of radioactively contaminated dirt particles. As long as the surface of the skin is neither inflamed nor showing any lesions, normally only a limited part of the top layer (epidermis), i.e. the upper layers of the stratum corneum, is contaminated. The intact horny layer has a barrier function protecting against the penetration of chemicals and dirt particles. The horny layer can be damaged by water, solvents, alkaline substances, and acids. In general, it is safe to say that the horny layer acts as a natural barrier to the penetration of liquid and particulate impurities into lower layers of the skin. As long as the horny layer is intact and free from lesions, the risk of incorporation can be considered low. When decontaminating and cleansing the skin, also in daily skin cleansing, care must be taken to prevent the acid protective layer and the horny layer from being compromised. Daily cleansing and cleansing for decontamination must be carried out with a mild, weakly acidic detergent. In addition, prevention should be achieved daily by applying a non-greasy skin lotion to protect the skin. Following a systematic regular regimen in skin cleansing and preventive skin care as well as a specific approach in skin decontamination and cleansing will avoid damage to the skin and remove any contamination incurred. This approach comprises a three-pronged concept, namely skin protection, cleansing and care. (orig.)

  4. Attention and normalization circuits in macaque V1.

    Science.gov (United States)

    Sanayei, M; Herrero, J L; Distler, C; Thiele, A

    2015-04-01

    Attention affects neuronal processing and improves behavioural performance. In extrastriate visual cortex these effects have been explained by normalization models, which assume that attention influences the circuit that mediates surround suppression. While normalization models have been able to explain attentional effects, their validity has rarely been tested against alternative models. Here we investigate how attention and surround/mask stimuli affect neuronal firing rates and orientation tuning in macaque V1. Surround/mask stimuli provide an estimate to what extent V1 neurons are affected by normalization, which was compared against effects of spatial top down attention. For some attention/surround effect comparisons, the strength of attentional modulation was correlated with the strength of surround modulation, suggesting that attention and surround/mask stimulation (i.e. normalization) might use a common mechanism. To explore this in detail, we fitted multiplicative and additive models of attention to our data. In one class of models, attention contributed to normalization mechanisms, whereas in a different class of models it did not. Model selection based on Akaike's and on Bayesian information criteria demonstrated that in most cells the effects of attention were best described by models where attention did not contribute to normalization mechanisms. This demonstrates that attentional influences on neuronal responses in primary visual cortex often bypass normalization mechanisms.

  5. Attention and normalization circuits in macaque V1

    Science.gov (United States)

    Sanayei, M; Herrero, J L; Distler, C; Thiele, A

    2015-01-01

    Attention affects neuronal processing and improves behavioural performance. In extrastriate visual cortex these effects have been explained by normalization models, which assume that attention influences the circuit that mediates surround suppression. While normalization models have been able to explain attentional effects, their validity has rarely been tested against alternative models. Here we investigate how attention and surround/mask stimuli affect neuronal firing rates and orientation tuning in macaque V1. Surround/mask stimuli provide an estimate to what extent V1 neurons are affected by normalization, which was compared against effects of spatial top down attention. For some attention/surround effect comparisons, the strength of attentional modulation was correlated with the strength of surround modulation, suggesting that attention and surround/mask stimulation (i.e. normalization) might use a common mechanism. To explore this in detail, we fitted multiplicative and additive models of attention to our data. In one class of models, attention contributed to normalization mechanisms, whereas in a different class of models it did not. Model selection based on Akaike's and on Bayesian information criteria demonstrated that in most cells the effects of attention were best described by models where attention did not contribute to normalization mechanisms. This demonstrates that attentional influences on neuronal responses in primary visual cortex often bypass normalization mechanisms. PMID:25757941

  6. Clinical efficacy of artificial skin combined with vacuum sealing drainage in treating large-area skin defects

    Institute of Scientific and Technical Information of China (English)

    TANG Jin; GUO Wei-chun; YU Ling; ZHAO Sheng-hao

    2010-01-01

    Objective: To observe the clinical efficacy of artificial skin combined with vacuum sealing drainage (VSD) in treating large-area skin defects.Methods: Totally 18 patients with skin defects, treated with artificial skin combined with VSD from September 2008to May 2009 in our hospital, were retrospectively analyzed in this study. There were 15 males and 3 females, aged 7-66years, 34.3 years on average. Among them, 10 cases had skin laceration caused by traffic accidents (7 with open fractures), 1 mangled injury, 1 blast injury, 1 stump infection combined with skin defects after amputation and 5 heel ulcers.Results: All skin grafts in 16 cases survived after being controlled by VSD for one time. For the rest 2 patients,one with skin avulsion on the left foot was given median thickness skin grafts after three times of VSD, the other with open fractures in the left tibia and fibula caused by a traffic accident was given free flap transplantation. Skin grafts of both patients survived, with normal color and rich blood supply.Conclusion: Skin grafting in conjunction with artificial skin and VSD is much more effective than traditional dressing treatment and worth wide application in clinic.

  7. OCT imaging of skin cancer and other dermatological diseases

    DEFF Research Database (Denmark)

    Mogensen, Mette; Thrane, Lars; Jørgensen, Thomas Martini

    2009-01-01

    Optical coherence tomography (OCT) provides clinicians and researchers with micrometer-resolution, in vivo, cross-sectional images of human skin up to several millimeter depth. This review of OCT imaging applied within dermatology covers the application of OCT to normal skin, and reports on a large...

  8. Visual attention and flexible normalization pools

    Science.gov (United States)

    Schwartz, Odelia; Coen-Cagli, Ruben

    2013-01-01

    Attention to a spatial location or feature in a visual scene can modulate the responses of cortical neurons and affect perceptual biases in illusions. We add attention to a cortical model of spatial context based on a well-founded account of natural scene statistics. The cortical model amounts to a generalized form of divisive normalization, in which the surround is in the normalization pool of the center target only if they are considered statistically dependent. Here we propose that attention influences this computation by accentuating the neural unit activations at the attended location, and that the amount of attentional influence of the surround on the center thus depends on whether center and surround are deemed in the same normalization pool. The resulting form of model extends a recent divisive normalization model of attention (Reynolds & Heeger, 2009). We simulate cortical surround orientation experiments with attention and show that the flexible model is suitable for capturing additional data and makes nontrivial testable predictions. PMID:23345413

  9. Simultaneous spectrophotometric and mechanical property characterization of skin

    Science.gov (United States)

    Bunegin, Leonid; Moore, Jeffery B.

    2006-02-01

    Both reflectance spectroscopy and the determination Young's Modulus of skin have shown promise for identifying skin pathology. At present, these determinations are carried out using separate methodologies. This study demonstrates a new technology combining digital UV/VIS reflectance spectroscopy and vacuum aspiration for simultaneously determining the reflectance spectrum and mechanical properties of human skin tissue. A small hand held prototype device incorporating fiber-optic light guides into a vacuum channel was calibrated using various elastic materials subjected to increments of stress by vacuum from 0 to 25 in Hg. The intensity of a UV/VIS light beam reflected from the material at each vacuum increment was compared to the resulting material strain. The reflected beam was also spectrophotometrically analyzed. Skin types were similarly evaluated comparing normal and scar tissue and skin of various ages and coloration. An exponential relationship between reflected beam intensity and the amount of strain resulting from vacuum increments was observed. Young's Modulus (calculated from Aoki et. al equation) and spectra from normal skin and scar tissue were in agreement with previously published observations. Age related decreases in skin elasticity were also demonstrated. In the reflectance spectra, oxy and deoxy-hemoglobin absorbance bands were detected, becoming significantly enhanced at increased levels of vacuum. Melanin absorbance was also easily detected and appeared to correlate with skin coloration. Since superficial skin pathologies have characteristic spectroscopic and mechanical properties, this technique may provide a promising new approach for rapid, non-invasive method for the evaluation of skin lesions.

  10. Subcutaneous injection of normal saline prevents cutaneous complications of ethanol sclerotherapy for superficial vascular lesions: an experimental study.

    Science.gov (United States)

    Ihara, Aki; Kurita, Masakazu; Ozaki, Mine; Fujiki, Masahide; Kaji, Nobuyuki; Takushima, Akihiko; Harii, Kiyonori

    2011-08-01

    Percutaneous sclerotherapy is an effective therapeutic option for the treatment of venous malformations. Absolute ethanol is used as a sclerotic agent because of its effectiveness but is often avoided for treatment of superficial lesions because of the possible risk of cutaneous necrosis. A preclinical experimental study was performed to validate whether the cytotoxic effects of ethanol on surrounding healthy tissues could be diminished with prophylactic subcutaneous injection of normal saline above the vascular lesion immediately after intraluminal injection of ethanol by dilution. The effect of normal saline dilution on cytotoxicity of ethanol to the main cells of the skin (fibroblasts and keratinocytes) were assessed using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide colorimetric assay. Effects of subcutaneous injection of normal saline immediately after intraluminal ethanol injection were assessed in a newly developed animal experimental model using the rabbit auricular vein. Cytotoxic effects of ethanol were decreased by saline dilution in vitro. Subcutaneous injection of normal saline after intraluminal injection of ethanol prevented the cutaneous ulceration observed in all cases without subcutaneous injection of normal saline in our animal model. Subcutaneous injection of normal saline appears effective for preventing cutaneous complications after ethanol sclerotherapy for superficial vascular lesions. © 2011 by the American Society for Dermatologic Surgery, Inc.

  11. Expression of human skin-specific genes defined by transcriptomics and antibody-based profiling.

    Science.gov (United States)

    Edqvist, Per-Henrik D; Fagerberg, Linn; Hallström, Björn M; Danielsson, Angelika; Edlund, Karolina; Uhlén, Mathias; Pontén, Fredrik

    2015-02-01

    To increase our understanding of skin, it is important to define the molecular constituents of the cell types and epidermal layers that signify normal skin. We have combined a genome-wide transcriptomics analysis, using deep sequencing of mRNA from skin biopsies, with immunohistochemistry-based protein profiling to characterize the landscape of gene and protein expression in normal human skin. The transcriptomics and protein expression data of skin were compared to 26 (RNA) and 44 (protein) other normal tissue types. All 20,050 putative protein-coding genes were classified into categories based on patterns of expression. We found that 417 genes showed elevated expression in skin, with 106 genes expressed at least five-fold higher than that in other tissues. The 106 genes categorized as skin enriched encoded for well-known proteins involved in epidermal differentiation and proteins with unknown functions and expression patterns in skin, including the C1orf68 protein, which showed the highest relative enrichment in skin. In conclusion, we have applied a genome-wide analysis to identify the human skin-specific proteome and map the precise localization of the corresponding proteins in different compartments of the skin, to facilitate further functional studies to explore the molecular repertoire of normal skin and to identify biomarkers related to various skin diseases.

  12. Detection of human papillomavirus in nonmelanoma skin cancer lesions and healthy perilesional skin in kidney transplant recipients and immunocompetent patients.

    Science.gov (United States)

    Bernat-García, J; Morales Suárez-Varela, M; Vilata-Corell, J J; Marquina-Vila, A

    2014-04-01

    The influence of human papillomavirus (HPV) on the development of nonmelanoma skin cancer (NMSC) is a topic of debate. HPV types from the beta genus (HPV-β) have been most frequently associated with the development of skin cancer. To analyze the prevalence and range of HPV types in NMSC lesions and healthy perilesional skin in immunodepressed and immunocompetent patients and to evaluate the influence of various clinical factors on the prevalence of HPV in skin cancer. Nested polymerase chain reaction and sequencing were used to detect HPV in 120 NMSC samples obtained by biopsy from 30 kidney transplant recipients and 30 immunocompetent patients. In all cases, a sample was taken from the tumor site and the surrounding healthy skin. Potential confounders were assessed and the data analyzed by multivariate logistic regression. HPV DNA was detected in 44 (73.3%) of the 60 samples from immunodepressed patients and in 32 (53.3%) of the 60 samples from immunocompetent patients (adjusted odds ratio, 3.4; 95% CI, 1.2-9.6). In both groups of patients, HPV was more common in healthy perilesional skin than in lesional skin. HPV-β was the most common type isolated. We found a wide range of HPV types (mostly HPV-β) in the skin of kidney transplant recipients and immunocompetent patients with skin cancer. Copyright © 2013 Elsevier España, S.L. and AEDV. All rights reserved.

  13. In vivo study of human skin using pulsed terahertz radiation

    Energy Technology Data Exchange (ETDEWEB)

    Pickwell, E [Semiconductor Physics Group, Cavendish Laboratory, Cambridge University, Madingley Road, Cambridge CB3 0HE (United Kingdom); Cole, B E [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom); Fitzgerald, A J [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom); Pepper, M [Semiconductor Physics Group, Cavendish Laboratory, Cambridge University, Madingley Road, Cambridge CB3 0HE (United Kingdom); Wallace, V P [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom)

    2004-05-07

    Studies in terahertz (THz) imaging have revealed a significant difference between skin cancer (basal cell carcinoma) and healthy tissue. Since water has strong absorptions at THz frequencies and tumours tend to have different water content from normal tissue, a likely contrast mechanism is variation in water content. Thus, we have previously devised a finite difference time-domain (FDTD) model which is able to closely simulate the interaction of THz radiation with water. In this work we investigate the interaction of THz radiation with normal human skin on the forearm and palm of the hand in vivo. We conduct the first ever systematic in vivo study of the response of THz radiation to normal skin. We take in vivo reflection measurements of normal skin on the forearm and palm of the hand of 20 volunteers. We compare individual examples of THz responses with the mean response for the areas of skin under investigation. Using the in vivo data, we demonstrate that the FDTD model can be applied to biological tissue. In particular, we successfully simulate the interaction of THz radiation with the volar forearm. Understanding the interaction of THz radiation with normal skin will form a step towards developing improved imaging algorithms for diagnostic detection of skin cancer and other tissue disorders using THz radiation.

  14. Black hole solutions surrounded by perfect fluid in Rastall theory

    Science.gov (United States)

    Heydarzade, Y.; Darabi, F.

    2017-08-01

    In this work, we obtain uncharged∖charged Kiselev-like black holes as a new class of black hole solutions surrounded by perfect fluid in the context of Rastall theory. Then, we study the specific cases of the uncharged∖charged black holes surrounded by regular matter like dust and radiation, or exotic matter like quintessence, cosmological constant and phantom fields. By comparing the Kiselev-like black hole solutions in Rastall theory with the Kiselev black hole solutions in GR, we find an effective perfect fluid behavior for the black hole's surrounding field. It is shown that the corresponding effective perfect fluid has interesting characteristic features depending on the different ranges of the parameters in Rastall theory. For instance, Kiselev-like black holes surrounded by regular matter in Rastall theory may be considered as Kiselev black holes surrounded by exotic matter in GR, or Kiselev-like black holes surrounded by exotic matter in Rastall theory may be considered as Kiselev black holes surrounded by regular matter in GR.

  15. Surround suppression and sparse coding in visual and barrel cortices

    Directory of Open Access Journals (Sweden)

    Robert N S Sachdev

    2012-07-01

    Full Text Available During natural vision the entire retina is stimulated. Likewise, during natural tactile behaviors, spatially extensive regions of the somatosensory surface are co-activated. The large spatial extent of naturalistic stimulation means that surround suppression, a phenomenon whose neural mechanisms remain a matter of debate, must arise during natural behavior. To identify common neural motifs that might instantiate surround suppression across modalities, we review models of surround suppression and compare the evidence supporting the competing ideas that surround suppression has either cortical or sub-cortical origins in visual and barrel cortex. In the visual system there is general agreement lateral inhibitory mechanisms contribute to surround suppression, but little direct experimental evidence that intracortical inhibition plays a major role. Two intracellular recording studies of V1, one using naturalistic stimuli (Haider et al., 2010, the other sinusoidal gratings (Ozeki et al., 2009, sought to identify the causes of reduced activity in V1 with increasing stimulus size, a hallmark of surround suppression. The former attributed this effect to increased inhibition, the latter to largely balanced withdrawal of excitation and inhibition. In rodent primary somatosensory barrel cortex, multi-whisker responses are generally weaker than single whisker responses, suggesting multi-whisker stimulation engages similar surround suppressive mechanisms. The origins of suppression in S1 remain elusive: studies have implicated brainstem lateral/internuclear interactions and both thalamic and cortical inhibition. Although the anatomical organization and instantiation of surround suppression in the visual and somatosensory systems differ, we consider the idea that one common function of surround suppression, in both modalities, is to remove the statistical redundancies associated with natural stimuli by increasing the sparseness or selectivity of sensory

  16. Skin barrier function

    DEFF Research Database (Denmark)

    2016-01-01

    Renowned experts present the latest knowledge Although a very fragile structure, the skin barrier is probably one of the most important organs of the body. Inward/out it is responsible for body integrity and outward/in for keeping microbes, chemicals, and allergens from penetrating the skin. Since...... the role of barrier integrity in atopic dermatitis and the relationship to filaggrin mutations was discovered a decade ago, research focus has been on the skin barrier, and numerous new publications have become available. This book is an interdisciplinary update offering a wide range of information...... on the subject. It covers new basic research on skin markers, including results on filaggrin and on methods for the assessment of the barrier function. Biological variation and aspects of skin barrier function restoration are discussed as well. Further sections are dedicated to clinical implications of skin...

  17. Use of autologous tissue engineered skin to treat porcine full-thickness skin defects

    Institute of Scientific and Technical Information of China (English)

    CAI Xia; CAO Yi-lin; CUI Lei; LIU Wei; GUAN Wen-xiang

    2005-01-01

    Objective: To explore a feasible method to repair full-thickness skin defects utilizing tissue engineered techniques. Methods: The Changfeng hybrid swines were used and the skin specimens were cut from the posterior limb girdle region, from which the keratinocytes and fibroblasts were isolated and harvested by trypsin, EDTA, and type II collagenase. The cells were seeded in Petri dishes for primary culture. When the cells were in logarithmic growth phase, they were treated with trypsin to separate them from the floor of the tissue culture dishes. A biodegradable material, Pluronic F-127, was prefabricated and mixed with these cells, and then the cell-Pluronic compounds were seeded evenly into a polyglycolic acid (PGA). Then the constructs were replanted to the autologous animals to repair the full-thickness skin defects. Histology and immunohistochemistry of the neotissue were observed in 1, 2, 4, and 8 postoperative weeks. Results: The cell-Pluronic F-127-PGA compounds repaired autologous full-thickness skin defects 1 week after implantation. Histologically, the tissue engineered skin was similar to the normal skin with stratified epidermis overlying a moderately thick collageneous dermis. Three of the structural proteins in the epidermal basement membrane zone, type IV collagen, laminin, and type VII collagen were detected using immunohistochemical methods. Conclusions: By studying the histology and immunohistochemistry of the neotissue, the bioengineered skin graft holds great promise for improving healing of the skin defects.

  18. Human papillomaviruses and skin cancer.

    Science.gov (United States)

    Smola, Sigrun

    2014-01-01

    Human papillomaviruses (HPVs) infect squamous epithelia and can induce hyperproliferative lesions. More than 120 different HPV types have been characterized and classified into five different genera. While mucosal high-risk HPVs have a well-established causal role in anogenital carcinogenesis, the biology of cutaneous HPVs is less well understood. The clinical relevance of genus beta-PV infection has clearly been demonstrated in patients suffering from epidermodysplasia verruciformis (EV), a rare inherited disease associated with ahigh rate of skin cancer. In the normal population genus beta-PV are suspected to have an etiologic role in skin carcinogenesis as well but this is still controversially discussed. Their oncogenic potency has been investigated in mouse models and in vitro. In 2009, the International Agency for Research on Cancer (IARC) classified the genus beta HPV types 5 and 8 as "possible carcinogenic" biological agents (group 2B) in EV disease. This chapter will give an overview on the knowns and unknowns of infections with genus beta-PV and discuss their potential impact on skin carcinogenesis in the general population.

  19. Development of fractures in soft rock surrounding a roadway and their control

    Institute of Scientific and Technical Information of China (English)

    Li Xuehua; Yao Qiangling; Man Jiankang; Chen Chaoqun; He Lihui

    2011-01-01

    As the excavation of roadway,new fractures will be formed and the pre-existing fractures extend with the redistribution of stress in surrounding rocks.Eventually,fracture zone and bed separation are formed in rocks because of the developed fractures.Therefore,mastering the fracture evolution of surrounding rocks is very important to maintain the stability of roadway.The surrounding rocks of main haulage roadway in a certain coal mine is so broken and loose that the supporting is very difficult.Based on comprehensive analysis of the engineering geological conditions,a sight instrument was used to observe the fractures of internal surrounding rocks.Four indices,i.e.,the width of fracture zone W,the number of fractures n,the width of fractures d and rock fracture designation RFD,are put forward to evaluate the fracture development.According to the evolution rules of the soft rock roadway from this paper,control principles by stages and by regions are presented through the research.At the same time,the best time of grouting reinforcement is determined on the basis of fracture saturation.Field practice shows that the roadway can satisfy normal production during service periods by suitable first support and grouting reinforcement.

  20. Center-surround antagonism in spatial vision: retinal or cortical locus?

    Science.gov (United States)

    Westheimer, Gerald

    2004-01-01

    Mach and Hering had early advanced a model of spatial visual processing featuring an antagonistic interaction between adjoining areas in the visual field. Spatial opponency was one of the first findings when single-unit studies of the retina were begun. Not long afterwards psychophysical experiments revealed a center-surround organization closely matching that found in the mammalian retina. It hinged on the demonstration of reduction of sensitivity in a small patch of the visual field when its surround was changed from dark to bright. Because such patterns inevitably produce borders, well-known phenomena of border interaction could be seen as providing alternative explanations, whose substrate would most likely be in the visual cortex. These competing viewpoints are discussed especially as they pertain to the recent demonstration of spatial differences in the center/surround organization between the normal and affected eyes of amblyopes. To the extent that most findings favor a retinal site for the psychophysically measured antagonism, and that evidence is accumulating for a direct effect on the mammalian retina of stimulus manipulation during visual development, the difference in spatial parameters of center/surround antagonism in amblyopia suggests that the dysfunction in amblyopia begins already in the retina.

  1. Basophils and skin disorders.

    Science.gov (United States)

    Borriello, Francesco; Granata, Francescopaolo; Marone, Gianni

    2014-05-01

    Since their discovery in 1879, basophils have been viewed as circulating blood granulocytes with limited immune function. New research tools for their functional analysis in vivo have revealed previously unrecognized roles for basophils in several skin disorders. Human basophils infiltrate different skin lesions and have been implicated in the pathogenesis of diseases ranging from chronic idiopathic urticaria to systemic lupus erythematosus. In mouse models, basophils participate in IgE-mediated chronic allergic inflammation of the skin and have a protective role in tick infestation. In this review, we discuss critical advances in our understanding of basophil biology and their roles in the pathophysiology of skin disorders.

  2. Skin Images Segmentation

    Directory of Open Access Journals (Sweden)

    Ali E. Zaart

    2010-01-01

    Full Text Available Problem statement: Image segmentation is a fundamental step in many applications of image processing. Skin cancer has been the most common of all new cancers detected each year. At early stage detection of skin cancer, simple and economic treatment can cure it mostly. An accurate segmentation of skin images can help the diagnosis to define well the region of the cancer. The principal approach of segmentation is based on thresholding (classification that is lied to the problem of the thresholds estimation. Approach: The objective of this study is to develop a method to segment the skin images based on a mixture of Beta distributions. We assume that the data in skin images can be modeled by a mixture of Beta distributions. We used an unsupervised learning technique with Beta distribution to estimate the statistical parameters of the data in skin image and then estimate the thresholds for segmentation. Results: The proposed method of skin images segmentation was implemented and tested on different skin images. We obtained very good results in comparing with the same techniques with Gamma distribution. Conclusion: The experiment showed that the proposed method obtained very good results but it requires more testing on different types of skin images.

  3. Characterization of hair follicle development in engineered skin substitutes.

    Directory of Open Access Journals (Sweden)

    Penkanok Sriwiriyanont

    Full Text Available Generation of skin appendages in engineered skin substitutes has been limited by lack of trichogenic potency in cultured postnatal cells. To investigate the feasibility and the limitation of hair regeneration, engineered skin substitutes were prepared with chimeric populations of cultured human keratinocytes from neonatal foreskins and cultured murine dermal papilla cells from adult GFP transgenic mice and grafted orthotopically to full-thickness wounds on athymic mice. Non-cultured dissociated neonatal murine-only skin cells, or cultured human-only skin keratinocytes and fibroblasts without dermal papilla cells served as positive and negative controls respectively. In this study, neonatal murine-only skin substitutes formed external hairs and sebaceous glands, chimeric skin substitutes formed pigmented hairs without sebaceous glands, and human-only skin substitutes formed no follicles or glands. Although chimeric hair cannot erupt readily, removal of upper skin layer exposed keratinized hair shafts at the skin surface. Development of incomplete pilosebaceous units in chimeric hair corresponded with upregulation of hair-related genes, LEF1 and WNT10B, and downregulation of a marker of sebaceous glands, Steroyl-CoA desaturase. Transepidermal water loss was normal in all conditions. This study demonstrated that while sebaceous glands may be involved in hair eruption, they are not required for hair development in engineered skin substitutes.

  4. Effects of basic fibroblast growth factor on expressions of collagen and fibronectin in normal skin and hypertrophic scar fibroblasts%碱性成纤维细胞生长因子对增生性瘢痕与正常皮肤成纤维细胞胶原、纤维连接蛋白表达的影响

    Institute of Scientific and Technical Information of China (English)

    宋瑞; 卞徽宁; 赖文; 陈德华; 赵克森

    2010-01-01

    背景:碱性成纤维细胞生长因子能促进愈合伤口产生胶原蛋白、纤维连接蛋白和基质酶的基质成分.然而,细胞增殖、细胞外基质及新生血管的形成或伤口基质重塑过程失调,会导致瘢痕组织过度增殖.目的:观察碱性成纤维细胞生长因子在正常皮肤创面愈合和增生性瘢痕形成中的作用.方法:从5例进行瘢痕修复手术患者身上同时取正常皮肤和增生性瘢痕组织,分离培养正常人皮肤成纤维细胞和增生性瘢痕成纤维细胞.应用RT-PCR和酶联免疫吸附法检测两种成纤维细胞胶原、纤维连接蛋白基因表达和蛋白合成.采用JC-1染色和流式细胞术测定成纤维细胞线粒体膜电位改变,采用化学发光法检测细胞内ATP水平改变.观察碱性成纤维细胞生长因子对两种细胞的上述指标的影响.结果与结论:不同浓度碱性成纤维细胞生长因子可减慢增生性瘢痕成纤维细胞生长,抑制增生性瘢痕成纤维细胞Ⅰ型胶原表达和合成(P<0.05).碱性成纤维细胞生长因子对正常皮肤和增生性瘢痕成纤维细胞Ⅲ型胶原表达和合成均无影响.然而可上调正常皮肤成纤维细胞表达纤维连接蛋白(P<0.05).此外,10,100 μg/L碱性成纤维细胞生长因子处理后增生性瘢痕成纤维细胞线粒体膜电位呈去极化趋势,正常皮肤成纤维细胞中ATP水平显著增高(P<0.05).结果表明,碱性成纤维细胞生长因子在正常皮肤创面愈合和增生性瘢痕形成中可能有不同的作用和机制.%BACKGROUND:Basic fibroblast growth factor(bFGF)can promote production of collagen,fibronectin and matrix enzyme in healing wounds.However,dysregulation of this process,such as the abnormal coordination of cell proliferation,extracellular.matrix and neovasculadzation formation,or remodeling of the wound matrix will lead to excess accumulation of scar tissues.OBJECTIVE:To investigate effects of bFGF on normal skin wound healing and

  5. Surrounding Moving Obstacle Detection for Autonomous Driving Using Stereo Vision

    Directory of Open Access Journals (Sweden)

    Hao Sun

    2013-06-01

    Full Text Available Detection and tracking surrounding moving obstacles such as vehicles and pedestrians are crucial for the safety of mobile robotics and autonomous vehicles. This is especially the case in urban driving scenarios. This paper presents a novel framework for surrounding moving obstacles detection using binocular stereo vision. The contributions of our work are threefold. Firstly, a multiview feature matching scheme is presented for simultaneous stereo correspondence and motion correspondence searching. Secondly, the multiview geometry constraint derived from the relative camera positions in pairs of consecutive stereo views is exploited for surrounding moving obstacles detection. Thirdly, an adaptive particle filter is proposed for tracking of multiple moving obstacles in surrounding areas. Experimental results from real‐world driving sequences demonstrate the effectiveness and robustness of the proposed framework.

  6. Surrounding Moving Obstacle Detection for Autonomous Driving Using Stereo Vision

    Directory of Open Access Journals (Sweden)

    Hao Sun

    2013-06-01

    Full Text Available Detection and tracking surrounding moving obstacles such as vehicles and pedestrians are crucial for the safety of mobile robotics and autonomous vehicles. This is especially the case in urban driving scenarios. This paper presents a novel framework for surrounding moving obstacles detection using binocular stereo vision. The contributions of our work are threefold. Firstly, a multiview feature matching scheme is presented for simultaneous stereo correspondence and motion correspondence searching. Secondly, the multiview geometry constraint derived from the relative camera positions in pairs of consecutive stereo views is exploited for surrounding moving obstacles detection. Thirdly, an adaptive particle filter is proposed for tracking of multiple moving obstacles in surrounding areas. Experimental results from real-world driving sequences demonstrate the effectiveness and robustness of the proposed framework.

  7. Traditional Indian custOInS surrounding birth

    African Journals Online (AJOL)

    traditional custOIns surrounding birth in Indian culture. ... conception, pregnancy, birth and the early months ofparenthood. .... house attended by a traditional birth attendant of a ..... Spiritual components play a dominant role in traditional.

  8. Glow phenomenon surrounding the vertical stabilizer and OMS pods

    Science.gov (United States)

    1994-01-01

    This 35mm frame, photographed as the Space Shuttle Columbia was orbiting Earth during a 'night' pass, documents the glow phenomenon surrounding the vertical stabilizer and the Orbital Maneuvering System (OMS) pods of the spacecraft.

  9. Effects of repeated skin exposure to low nickel concentrations

    DEFF Research Database (Denmark)

    Nielsen, N H; Menné, T; Kristiansen, J

    1999-01-01

    and nickel allergy, either on normal or on SLS-treated forearm skin. The present study strongly suggests that the changes observed were specific to nickel exposure. Standardized methods to assess trace to moderate nickel exposure on the hands, and the associated effects in nickel-sensitized subjects...... with a group of patients who immersed a finger into water. The nickel concentrations used also provoked significant inflammatory skin changes on sodium lauryl sulphate (SLS)-treated forearm skin of the patients, whereas inflammatory skin changes were not observed in healthy volunteers without hand eczema...

  10. Surrounding Moving Obstacle Detection for Autonomous Driving Using Stereo Vision

    OpenAIRE

    Hao Sun; Huanxin Zou; Shilin Zhou; Cheng Wang; Naser El-Sheimy

    2013-01-01

    Detection and tracking surrounding moving obstacles such as vehicles and pedestrians are crucial for the safety of mobile robotics and autonomous vehicles. This is especially the case in urban driving scenarios. This paper presents a novel framework for surrounding moving obstacles detection using binocular stereo vision. The contributions of our work are threefold. Firstly, a multiview feature matching scheme is presented for simultaneous stereo correspondence and motion correspondence searc...

  11. Normal Pressure Hydrocephalus (NPH)

    Science.gov (United States)

    ... your local chapter Join our online community Normal Pressure Hydrocephalus (NPH) Normal pressure hydrocephalus is a brain ... About Symptoms Diagnosis Causes & risks Treatments About Normal Pressure Hydrocephalus Normal pressure hydrocephalus occurs when excess cerebrospinal ...

  12. "Tilt" in color space: Hue changes induced by chromatic surrounds.

    Science.gov (United States)

    Klauke, Susanne; Wachtler, Thomas

    2015-01-01

    The perceived color of a chromatic stimulus is influenced by the chromaticity of its surround. To investigate these influences along the dimension of hue, we measured hue changes induced in stimuli of different hues by isoluminant chromatic surrounds. Generally, induced hue changes were directed in color space away from the hue of the inducing surround and depended on the magnitude on the hue difference between stimulus and surround. With increasing difference in hue between stimulus and surround, induced hue changes increased up to a maximum and then decreased for larger differences. This qualitative pattern was similar for different inducers, but quantitatively, induction was weaker along some directions in cone-opponent color space than along other directions. The strongest induction effects were found along an oblique, blue-yellow axis that corresponds to the daylight axis. The overall pattern of the induction effect shows similarities to the well-known tilt effect, where shifts in perceived angle of oriented stimuli are induced by oriented surrounds. This suggests analogous neural representations and similar mechanisms of contextual processing for different visual features such as orientation and color.

  13. Control of Formation of Lithological Reservoirs by Surrounding Mudstone

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Taking the Jiyang depression as an example, this paper discusses the control of the formation of lithological reservoir by surrounding rocks by integrated application of geological analysis, physical simulation, and the analysis of oil & gas accumulation mechanism. Geological statistical shows that the major burial depth and interval of lithological reservoirs in the Jiyang depression are related to the hydrocarbon generation in and expulsion from the Lower Tertiary source rocks and the time of the formation of most lithological reservoirs coincides with the peak of hydrocarbon generation and expulsion. The lithological traps located in the center of effective source rocks are propitious to high oil saturation than those located on the margin of effective source rocks. The hydrocarbon charge degree of the lithological reservoir has a positive correlation with the intensity of hydrocarbon expulsion from surrounding source rocks.Geological analyses and NMR experiments also show that the oil saturation of surrounding source rocks control the hydrocarbon potential of lithological traps, and a critical value for oil saturation of surrounding mudstone is required, that is, when the oil saturation of surrounding mudstone is lower than this critical value, no oil and gas accumulate in the lithological trap. The control of surrounding mudstone on the oil-bearing properties of lithological reservoirs is also analyzed by the mechanisms of hydrocarbon generation and expulsion as well as accumulation.

  14. Effect of Systemic Antioxidant Allopurinol Therapy on Skin Flap Survival

    Science.gov (United States)

    Rasti Ardakani, Mehdi; Al-Dam, Ahmed; Rashad, Ashkan; Shayesteh Moghadam, Ali

    2017-01-01

    BACKGROUND It has been reported that systemic administration of allopurinol improves cell survival. This study was aimed to evaluate effects of allopurinol on skin flaps in dogs. METHODS Twenty dogs underwent one skin flap surgery with a 2-week interval. The first procedure was performed according to the standard protocols. The second phase was started by a 1-week pretreatment with allopurinol. Length of the necrotic zone was measured and recorded daily. At each phase, flaps were removed and sent for histopathological study after 1 week observation. RESULTS Mean length of the necrotic zone in allopurinol treated skin flaps has been significantly less than normal flaps over all 7 days of observation (p<0.0001). Histopathology study showed less inflammation and more normal tissue structure in the allopurinol treated skin flaps. CONCLUSION It was demonstrated that systemic administration of allopurinol significantly improved skin flap survival. PMID:28289614

  15. Immediate Changes to Skin and Subcutaneous Tissue Strains Following Manual Lymph Drainage in Legs with Lymphedema

    Science.gov (United States)

    Kakutani, Hiromi; Nakamura, Kaori; Morikage, Noriyasu; Yamashita, Osamu; Harada, Takasuke; Ueda, Koshiro; Samura, Makoto; Tanaka, Yuya; Takeuchi, Yuriko; Hamano, Kimikazu

    2016-01-01

    Objectives: To study the immediate impact of manual lymph drainage (MLD) on skin and subcutaneous tissue strains in legs with lymphedema using free-hand real-time tissue elastography (RTE). Methods: Skin and subcutaneous tissue strain measurements were taken at the middle of the inner thigh and calf by RTE in 20 legs with lymphedema of 18 patients (stage II: 11, late stage II: 7, stage III: 2) and in 70 legs of 35 normal subjects. In patients with lymphedema, the same measurements were repeated immediately following MLD. Results: Significant negative correlations were found between pre-MLD strains and the MLD-induced changes in thigh and calf skin strains (thigh skin: p <0.01, calf skin: p = 0.05), but not in subcutaneous tissue strains. Pre-MLD intercepts of these regression lines were closer to normal values as compared to mean pre-MLD values (normal thigh skin: 0.54% ± 0.30%, calf skin: 0.25% ± 0.18%, Pre-MLD thigh skin: 0.39% ± 0.20%, calf skin: 0.17% ± 0.12%, Pre-MLD intercept of thigh skin: 0.48%, Pre-MLD intercept of calf skin: 0.31%). Conclusions: It appears that MLD did not simply soften the skin, but rather normalized it in terms of strain. However, this was not confirmed in the subcutaneous tissue. PMID:27087870

  16. Use of previously burned skin as random cutaneous local flaps in pediatric burn reconstruction

    NARCIS (Netherlands)

    Barret, JP; Herndon, DN; McCauley, RL

    2002-01-01

    Reconstruction after post-burn scarring remains a challenge. It is especially true in the severely burned patient, who normally presents with a paucity of donor sites Healed skin from areas that had been burned and skin from grafted areas (termed as previously burned skin) have been occasionally use

  17. Use of previously burned skin as random cutaneous local flaps in pediatric burn reconstruction

    NARCIS (Netherlands)

    Barret, JP; Herndon, DN; McCauley, RL

    Reconstruction after post-burn scarring remains a challenge. It is especially true in the severely burned patient, who normally presents with a paucity of donor sites Healed skin from areas that had been burned and skin from grafted areas (termed as previously burned skin) have been occasionally

  18. Skin Diseases: Skin and Sun—Not a good mix

    Science.gov (United States)

    Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Skin and Sun —Not a good mix Past Issues / ... of this page please turn Javascript on. Good skin care begins with sun safety. Whether it is ...

  19. Dark Skin No Shield from Deadly Skin Cancer

    Science.gov (United States)

    ... https://medlineplus.gov/news/fullstory_166194.html Dark Skin No Shield From Deadly Skin Cancer Death rates from melanoma are higher for people of color, skin expert says To use the sharing features on ...

  20. Parasites and the skin

    African Journals Online (AJOL)

    2009-06-11

    Jun 11, 2009 ... remind you of those rare and wonderful infestations that you might never see. ... from a burrow, mounted on a glass slide. The findings are ... Parasitic infections may be confined to the skin or may have skin involvement as part ...

  1. Skin tribology: Science friction?

    NARCIS (Netherlands)

    Heide, van der E.; Zeng, X.; Masen, M.A.

    2013-01-01

    The application of tribological knowledge is not just restricted to optimizing mechanical and chemical engineering problems. In fact, effective solutions to friction and wear related questions can be found in our everyday life. An important part is related to skin tribology, as the human skin is fre

  2. Deformable skinning on bones

    DEFF Research Database (Denmark)

    Larsen, Bent Dalgaard; Petersen, Kim Steen; Jakobsen, Bjarke

    2001-01-01

    Applying skin to a model is a relatively simple task to implement. Nonetheless it seems that no good resource exists that describes both the concepts and math necessary to understand and implement skinning. The intention of this article is an attempt to give a thoroughly description...

  3. Thermodynamics and Phase transition of the Reissner-Nordstr\\"om Black Hole surrounded by quintessence

    CERN Document Server

    Saleh, Mahamat; Crepin, Kofane Timoleon

    2016-01-01

    We investigate thermodynamics and Phase transition of the Reissner-Nordstr\\"om black hole surrounded by quintessence. Using thermodynamical laws of black holes, we derive the expressions of some thermodynamics quantities for the Reissner-Nordstr\\"om black hole surrounded by quintessence. The variations of the temperature and heat capacity with the entropy were plotted for different values of the state parameter related to the quintessence, $\\omega_{q}$, and the normalization constant related to the density of quintessence $c$. We show that when varying the entropy of the black hole a phase transition is observed in the black hole. Moreover, when increasing the density of quintessence, the transition point is shifted to lower entropy and the temperature of the black hole decreases.

  4. Forest Fragments Surrounded by Sugar Cane Are More Inhospitable to Terrestrial Amphibian Abundance Than Fragments Surrounded by Pasture

    Directory of Open Access Journals (Sweden)

    Paula Eveline Ribeiro D’Anunciação

    2013-01-01

    Full Text Available In recent years, there has been increasing interest in matrix-type influence on forest fragments. Terrestrial amphibians are good bioindicators for this kind of research because of low vagility and high philopatry. This study compared richness, abundance, and species composition of terrestrial amphibians through pitfall traps in two sets of semideciduous seasonal forest fragments in southeastern Brazil, according to the predominant surrounding matrix (sugar cane and pasture. There were no differences in richness, but fragments surrounded by sugar cane had the lowest abundance of amphibians, whereas fragments surrounded by pastures had greater abundance. The most abundant species, Rhinella ornata, showed no biometric differences between fragment groups but like many other amphibians sampled showed very low numbers of individuals in fragments dominated by sugar cane fields. Our data indicate that the sugar cane matrix negatively influences the community of amphibians present in fragments surrounded by this type of land use.

  5. Bionanomaterials for skin regeneration

    CERN Document Server

    Leonida, Mihaela D

    2016-01-01

    This book gives a concise overview of bionanomaterials with applications for skin regeneration. The advantages and challenges of nanoscale materials are covered in detail, giving a basic view of the skin structure and conditions that require transdermal or topical applications. Medical applications, such as wound healing, care for burns, skin disease, and cosmetic care, such as aging of the skin and photodamage, and how they benefit from bionanomaterials, are described in detail. A final chapter is devoted to the ethical and social issues related to the use of bionanomaterials for skin regeneration. This is an ideal book for researchers in materials science, medical scientists specialized in dermatology, and cosmetic chemists working in formulations. It can also serve as a reference for nanotechnologists, dermatologists, microbiologists, engineers, and polymer chemists, as well as students studying in these fields.

  6. Three-Dimensional In Vitro Skin and Skin Cancer Models Based on Human Fibroblast-Derived Matrix.

    Science.gov (United States)

    Berning, Manuel; Prätzel-Wunder, Silke; Bickenbach, Jackie R; Boukamp, Petra

    2015-09-01

    Three-dimensional in vitro skin and skin cancer models help to dissect epidermal-dermal and tumor-stroma interactions. In the model presented here, normal human dermal fibroblasts isolated from adult skin self-assembled into dermal equivalents with their specific fibroblast-derived matrix (fdmDE) over 4 weeks. The fdmDE represented a complex human extracellular matrix that was stabilized by its own heterogeneous collagen fiber meshwork, largely resembling a human dermal in vivo architecture. Complemented with normal human epidermal keratinocytes, the skin equivalent (fdmSE) thereof favored the establishment of a well-stratified and differentiated epidermis and importantly allowed epidermal regeneration in vitro for at least 24 weeks. Moreover, the fdmDE could be used to study the features of cutaneous skin cancer. Complementing fdmDE with HaCaT cells in different stages of malignancy or tumor-derived cutaneous squamous cell carcinoma cell lines, the resulting skin cancer equivalents (fdmSCEs) recapitulated the respective degree of tumorigenicity. In addition, the fdmSCE invasion phenotypes correlated with their individual degree of tissue organization, disturbance in basement membrane organization, and presence of matrix metalloproteinases. Together, fdmDE-based models are well suited for long-term regeneration of normal human epidermis and, as they recapitulate tumor-specific growth, differentiation, and invasion profiles of cutaneous skin cancer cells, also provide an excellent human in vitro skin cancer model.

  7. Electromagnetic effects on the biological tissue surrounding a transcutaneous transformer for an artificial anal sphincter system*

    Science.gov (United States)

    Zan, Peng; Yang, Bang-hua; Shao, Yong; Yan, Guo-zheng; Liu, Hua

    2010-01-01

    This paper reports on the electromagnetic effects on the biological tissue surrounding a transcutaneous transformer for an artificial anal sphincter. The coupling coils and human tissues, including the skin, fat, muscle, liver, and blood, were considered. Specific absorption rate (SAR) and current density were analyzed by a finite-length solenoid model. First, SAR and current density as a function of frequency (10–107 Hz) for an emission current of 1.5 A were calculated under different tissue thickness. Then relations between SAR, current density, and five types of tissues under each frequency were deduced. As a result, both the SAR and current density were below the basic restrictions of the International Commission on Non-Ionizing Radiation Protection (ICNIRP). The results show that the analysis of these data is very important for developing the artificial anal sphincter system. PMID:21121071

  8. A comparative study of mitochondrial ultrastructure in melanocytes from perilesional vitiligo skin and perilesional halo nevi skin.

    Science.gov (United States)

    Ding, Gao-Zhong; Zhao, Wen-E; Li, Xue; Gong, Qing-Li; Lu, Yan

    2015-04-01

    Vitiligo and halo nevi are both pigmentary disorders of the skin characterized by the acquired loss of functional epidermal melanocytes manifesting as white macules and patches. The cellular mechanism(s) and biochemical changes that result in the appearance of these two types of achromic lesions are still uncertain; and the relationship between vitiligo and halo nevi has been in dispute. In this study, we investigated the ultrastructure of mitochondria in melanocytes and in keratinocytes from perilesional vitiligo skin and from perilesional halo nevi skin using Transmission Electron Microscopy. Furthermore, we performed a quantitative analysis of mitochondrial morphology through a stereological study. As previously reported, we found that melanocytes from perilesional active vitiligo skin were loosely connected with their surroundings by their retracted dendrites. The surface density and the volume density of mitochondria in melanocytes and in keratinocytes from perilesional vitiligo skin are increased significantly compared with the controls, especially in active vitiligo. In contrast, there are no significant differences in mitochondria in melanocytes and in keratinocytes from perilesional halo nevi skin compared with the controls. In summary, the tendency of different morphologic alterations in mitochondria from perilesional vitiligo skin and from perilesional halo nevi skin reflect heterogeneous backgrounds between the two diseases, revealing that vitiligo and halo nevi may have separate pathogenic mechanisms. These findings may help elucidate the relationship of these two diseases and their underlying mechanisms.

  9. Pathological skin picking: case presentation and review of the literature

    Directory of Open Access Journals (Sweden)

    Maria Isabela Sarbu

    2015-04-01

    Full Text Available Pathological skin picking is a condition in which patients induce skin lesions through repetitive, compulsive excoriations of normal skin or skin with minor surface irregularities and they admit their role in the production of the lesions, but are unable to stop their behavior. Psychiatric comorbidities most often associated with skin picking include obsessive-compulsive disorder (OCD, anxiety disorders, mood disorders, body dysmorphic disorders, trichotillomania and compulsive-buying disorder. We report the case of a 17 year old female patient who addressed the dermatology department of our hospital with an eruption consisting of erythematous papules and plaques. The local examination revealed several clues of paramount importance in drawing the final conclusion and the psychiatric examination helped establish the diagnosis of pathological skin picking in a patient with obsessive-compulsive disorder.

  10. A study on the quantitative evaluation of skin barrier function

    Science.gov (United States)

    Maruyama, Tomomi; Kabetani, Yasuhiro; Kido, Michiko; Yamada, Kenji; Oikaze, Hirotoshi; Takechi, Yohei; Furuta, Tomotaka; Ishii, Shoichi; Katayama, Haruna; Jeong, Hieyong; Ohno, Yuko

    2015-03-01

    We propose a quantitative evaluation method of skin barrier function using Optical Coherence Microscopy system (OCM system) with coherency of near-infrared light. There are a lot of skin problems such as itching, irritation and so on. It has been recognized skin problems are caused by impairment of skin barrier function, which prevents damage from various external stimuli and loss of water. To evaluate skin barrier function, it is a common strategy that they observe skin surface and ask patients about their skin condition. The methods are subjective judgements and they are influenced by difference of experience of persons. Furthermore, microscopy has been used to observe inner structure of the skin in detail, and in vitro measurements like microscopy requires tissue sampling. On the other hand, it is necessary to assess objectively skin barrier function by quantitative evaluation method. In addition, non-invasive and nondestructive measuring method and examination changes over time are needed. Therefore, in vivo measurements are crucial for evaluating skin barrier function. In this study, we evaluate changes of stratum corneum structure which is important for evaluating skin barrier function by comparing water-penetrated skin with normal skin using a system with coherency of near-infrared light. Proposed method can obtain in vivo 3D images of inner structure of body tissue, which is non-invasive and non-destructive measuring method. We formulate changes of skin ultrastructure after water penetration. Finally, we evaluate the limit of performance of the OCM system in this work in order to discuss how to improve the OCM system.

  11. EGFR-inhibitors, radiotherapy and normal tissue toxicity

    DEFF Research Database (Denmark)

    Eriksen, J. G.

    2015-01-01

    will be explained with references to the current knowledge of the biology of skin toxicity. Treatment options for acute side-effects in skin and mucosa after bio-radiotherapy is rarely causal. A few attempts have been done; some of them aiming to rephosphorylate the EGFreceptor in the skin with vitamin K3. The talk......EGFR-inhibitors have been used in several clinical settings during the last decade and side-effects related to normal tissues like the skin, mucosa and kidney has been well described. However, when EGFR-inhibitors are combined with radiotherapy, then different skin and mucosa toxicity profiles can...... will discuss the available data from these studies. Across several tumour sites and for different EGFR-inhibitors, a correlation between skin toxicity and tumour response has also been documented. The reason for this correlation is not obvious but probably related to genetic alterations or certain genetic...

  12. 6 Common Cancers - Skin Cancer

    Science.gov (United States)

    ... Navigation Bar Home Current Issue Past Issues 6 Common Cancers - Skin Cancer Past Issues / Spring 2007 Table ... Gilbert Skin Cancer Skin cancer is the most common form of cancer in the United States. The ...

  13. Skin Cancer Can Strike Anyone

    Science.gov (United States)

    ... of this page please turn Javascript on. Feature: Skin Cancer Skin Cancer Can Strike Anyone Past Issues / Summer 2013 Table ... removed. That is the most common form of skin cancer and not as dangerous as melanoma. Photo: Corbis ...

  14. Role of transepidermal and transfollicular routes in percutaneous absorption of steroids: in vitro studies on human skin.

    Science.gov (United States)

    Hueber, F; Schaefer, H; Wepierre, J

    1994-01-01

    Percutaneous absorption theoretically comprises two components: the transepidermal and the transfollicular routes. The aim of the present work was to confirm this hypothesis in the human skin by comparing the in vitro percutaneous absorption of four steroids through scar skin without hair follicles and sebaceous glands and through normal adjacent skin from abdominal or mammary plasties. In all cases, the absorption of the four steroids was significantly higher in normal skin than in scar skin. The cumulative percentages of progesterone and testosterone after 8 h of application were, respectively, 3.1- and 2.4-fold higher in normal skin than in scar skin. After 24 h of application, the cumulative percentages of estradiol and hydrocortisone were 1.7- and 2.4-fold higher in normal skin than in scar skin. At the end of the experiments, the quantities of drugs remaining in the skin after 8 or 24 h of application were the same in normal skin and in scar skin except for progesterone for which they were 2-fold greater in normal than in scar skin. In each case, a histological characterization of the scar skin was made in comparison with the normal adjacent skin. The main modifications observed on scar skin were the following: absence of hair follicles and sebaceous glands, thinning of the collagenous fibers with parallel orientation to the dermoepidermal junction and decrease in the number or disappearance of the elastic fibers. These experiments confirmed that human skin appendages, hair follicles and sebaceous glands, constitute a route of penetration for steroids and thus probably for other chemicals of similar molecular weight and properties.

  15. Normalization: A Preprocessing Stage

    OpenAIRE

    Patro, S. Gopal Krishna; Sahu, Kishore Kumar

    2015-01-01

    As we know that the normalization is a pre-processing stage of any type problem statement. Especially normalization takes important role in the field of soft computing, cloud computing etc. for manipulation of data like scale down or scale up the range of data before it becomes used for further stage. There are so many normalization techniques are there namely Min-Max normalization, Z-score normalization and Decimal scaling normalization. So by referring these normalization techniques we are ...

  16. Migraine increases centre-surround suppression for drifting visual stimuli.

    Directory of Open Access Journals (Sweden)

    Josephine Battista

    Full Text Available BACKGROUND: The pathophysiology of migraine is incompletely understood, but evidence points to hyper-responsivity of cortical neurons being a key feature. The basis of hyper-responsiveness is not clear, with an excitability imbalance potentially arising from either reduced inhibition or increased excitation. In this study, we measure centre-surround contrast suppression in people with migraine as a perceptual analogue of the interplay between inhibition and excitation in cortical areas responsible for vision. We predicted that reduced inhibitory function in migraine would reduce perceptual surround suppression. Recent models of neuronal surround suppression incorporate excitatory feedback that drives surround inhibition. Consequently, an increase in excitation predicts an increase in perceptual surround suppression. METHODS AND FINDINGS: Twenty-six people with migraine and twenty approximately age- and gender-matched non-headache controls participated. The perceived contrast of a central sinusoidal grating patch (4 c/deg stationary grating, or 2 c/deg drifting at 2 deg/sec, 40% contrast was measured in the presence and absence of a 95% contrast annular grating (same orientation, spatial frequency, and drift rate. For the static grating, similar surround suppression strength was present in control and migraine groups with the presence of the surround resulting in the central patch appearing to be 72% and 65% of its true contrast for control and migraine groups respectively (t(44 = 0.81, p = 0.42. For the drifting stimulus, the migraine group showed significantly increased surround suppression (t(44 = 2.86, p<0.01, with perceived contrast being on average 53% of actual contrast for the migraine group and 68% for non-headache controls. CONCLUSIONS: In between migraines, when asymptomatic, visual surround suppression for drifting stimuli is greater in individuals with migraine than in controls. The data provides evidence for a

  17. Skin perfusion pressure on the legs measured as the external pressure required for skin reddening after blanching

    DEFF Research Database (Denmark)

    Holstein, P; Nielsen, P.E.; Lund, P

    1980-01-01

    Hg (SD 8.7). As compared to the intra-arterial blood pressure the BTEP was found to lie close to the mean blood pressure in normal subjects as well as in hypertensive subjects. The present data indicate that the skin perfusion pressure on the legs can be measured by the rapid photo-electric technique......The skin perfusion on the calf was measured photo-electrically and by isotope washout technique using external counter pressure by a blood pressure cuff. By the photocell the skin blanching threshold external pressure (BTEP) was recorded on histamine flared red skin. By isotope washout technique...... the skin blood flow cessation external pressure (FCEP) was recorded using intra-dermal [131I-]-antipyrine mixed with histamine in estimating the skin blood flow. The external pressure was measured with an airfilled plastic cushion connected to a mercury manometer. Over a wide range of pressures as obtained...

  18. Archaea on human skin.

    Directory of Open Access Journals (Sweden)

    Alexander J Probst

    Full Text Available The recent era of exploring the human microbiome has provided valuable information on microbial inhabitants, beneficials and pathogens. Screening efforts based on DNA sequencing identified thousands of bacterial lineages associated with human skin but provided only incomplete and crude information on Archaea. Here, we report for the first time the quantification and visualization of Archaea from human skin. Based on 16 S rRNA gene copies Archaea comprised up to 4.2% of the prokaryotic skin microbiome. Most of the gene signatures analyzed belonged to the Thaumarchaeota, a group of Archaea we also found in hospitals and clean room facilities. The metabolic potential for ammonia oxidation of the skin-associated Archaea was supported by the successful detection of thaumarchaeal amoA genes in human skin samples. However, the activity and possible interaction with human epithelial cells of these associated Archaea remains an open question. Nevertheless, in this study we provide evidence that Archaea are part of the human skin microbiome and discuss their potential for ammonia turnover on human skin.

  19. Skin and antioxidants.

    Science.gov (United States)

    Poljsak, Borut; Dahmane, Raja; Godic, Aleksandar

    2013-04-01

    It is estimated that total sun exposure occurs non-intentionally in three quarters of our lifetimes. Our skin is exposed to majority of UV radiation during outdoor activities, e.g. walking, practicing sports, running, hiking, etc. and not when we are intentionally exposed to the sun on the beach. We rarely use sunscreens during those activities, or at least not as much and as regular as we should and are commonly prone to acute and chronic sun damage of the skin. The only protection of our skin is endogenous (synthesis of melanin and enzymatic antioxidants) and exogenous (antioxidants, which we consume from the food, like vitamins A, C, E, etc.). UV-induced photoaging of the skin becomes clinically evident with age, when endogenous antioxidative mechanisms and repair processes are not effective any more and actinic damage to the skin prevails. At this point it would be reasonable to ingest additional antioxidants and/or to apply them on the skin in topical preparations. We review endogenous and exogenous skin protection with antioxidants.

  20. Unsupervised Skin cancer detection by combination of texture and shape features in dermoscopy images

    Directory of Open Access Journals (Sweden)

    Hamed aghapanah rudsari

    2014-05-01

    Full Text Available In this paper a novel unsupervised feature extraction method for detection of melanoma in skin images is presented. First of all, normal skin surrounding the lesion is removed in a segmentation process. In the next step, some shape and texture features are extracted from the output image of the first step: GLCM, GLRLM, the proposed directional-frequency features, and some parameters of Ripplet transform are used as texture features; Also, NRL features and Zernike moments are used as shape features. Totally, 63 texture features and 31 shape features are extracted. Finally, the number of extracted features is reduced using PCA method and a proposed method based on Fisher criteria. Extracted features are classified using the Perceptron Neural Networks, Support Vector Machine, 4-NN, and Naïve Bayes. The results show that SVM has the best performance. The proposed algorithm is applied on a database that consists of 160 labeled images. The overall results confirm the superiority of the proposed method in both accuracy and reliability over previous works.

  1. Immunoelectron microscopy study of superficial skin nerves in drug-induced acute urticaria

    OpenAIRE

    Criado, Paulo Ricardo; CRIADO, Roberta Fachini Jardim; TAKAKURA, CLEUSA F.H.; Pagliari, Carla; SOTTO, Mirian Nacagami; Cidia VASCONCELLOS

    2012-01-01

    BACKGROUND: Few studies have evaluated the ultrastructure of the superficial skin nerves in urticaria. OBJECTIVE: The objective of this study was to describe findings in superficial skin nerves in cases of drug-induced acute urticaria. METHODS: Seven patients with drug-induced acute urticaria were included in the study. Skin biopsies were obtained from the urticarial lesion and from the apparently normal skin. The 14 fragments collected were processed for immunogold electron microscopy using ...

  2. New treatments for restoring impaired epidermal barrier permeability: skin barrier repair creams.

    Science.gov (United States)

    Draelos, Zoe Diana

    2012-01-01

    Skin health depends on an intact barrier composed of protein-rich corneocytes surrounded by the lamellar intercellular lipids. This barrier provides waterproof protection for the body, preventing infection, regulating electrolyte balance, maintaining body temperature, and providing a mechanism for sensation. Damage to the skin barrier results in skin disease that can be treated by a variety of externally applied substances, such as ceramides, hyaluronic acid, licorice extracts, dimethicone, petrolatum, and paraffin wax. These substances are found in moisturizers that are sold as cosmetics and in prescriptions as 510(k) devices. This contribution examines the formulation and effect of skin barrier creams.

  3. Eicosanoids in skin inflammation.

    Science.gov (United States)

    Nicolaou, Anna

    2013-01-01

    Eicosanoids play an integral part in homeostatic mechanisms related to skin health and structural integrity. They also mediate inflammatory events developed in response to environmental factors, such as exposure to ultraviolet radiation, and inflammatory and allergic disorders, including psoriasis and atopic dermatitis. This review article discusses biochemical aspects related to cutaneous eicosanoid metabolism, the contribution of these potent autacoids to skin inflammation and related conditions, and considers the importance of nutritional supplementation with bioactives such as omega-3 and omega-6 polyunsaturated fatty acids and plant-derived antioxidants as means of addressing skin health issues.

  4. Ultrasound skin tightening.

    Science.gov (United States)

    Minkis, Kira; Alam, Murad

    2014-01-01

    Ultrasound skin tightening is a noninvasive, nonablative method that allows for energy deposition into the deep dermal and subcutaneous tissue while avoiding epidermal heating. Ultrasound coagulation is confined to arrays of 1-mm(3) zones that include the superficial musculoaponeurotic system and connective tissue. This technology gained approval from the Food and Drug Administration as the first energy-based skin "lifting" device, specifically for lifting lax tissue on the neck, submentum, and eyebrows. Ultrasound has the unique advantage of direct visualization of treated structures during treatment. Ultrasound is a safe and efficacious treatment for mild skin tightening and lifting.

  5. Leishmania Skin Test

    Science.gov (United States)

    2010-03-01

    2009, a dose of 50µg will be used in the design of a phase III clinical trial. 15. SUBJECT TERMS LtSTA = Leishmania tropica Skin Test Antigen 16...2010 on a Leishmania Skin Test (LtSTA) developed from the promastigotes of Leishmania tropica . During this period a phase IIB study was in progress...diluent. The final product is referred to as Leishmania tropica Skin Test Antigen (LtSTA). Figure 3 is a schematic diagram of the Drug Product

  6. Mouse Genetic Models Reveal Surprising Functions of IκB Kinase Alpha in Skin Development and Skin Carcinogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Xia, Xiaojun [The Methodist Hospital Research Institute, Houston, TX 77030 (United States); Park, Eunmi [Department of Radiation Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA 02115 (United States); Fischer, Susan M. [Department of Molecular Carcinogenesis, The University of Texas MD Anderson Cancer Center, Smithville, TX 78967 (United States); Hu, Yinling, E-mail: huy2@mail.nih.gov [Cancer and Inflammation Program, Center for Cancer Research, Frederick National Laboratory for Cancer Research, Frederick, MD 21701 (United States)

    2013-02-15

    Gene knockout studies unexpectedly reveal a pivotal role for IκB kinase alpha (IKKα) in mouse embryonic skin development. Skin carcinogenesis experiments show that Ikkα heterozygous mice are highly susceptible to chemical carcinogen or ultraviolet B light (UVB) induced benign and malignant skin tumors in comparison to wild-type mice. IKKα deletion mediated by keratin 5 (K5).Cre or K15.Cre in keratinocytes induces epidermal hyperplasia and spontaneous skin squamous cell carcinomas (SCCs) in Ikkα floxed mice. On the other hand, transgenic mice overexpressing IKKα in the epidermis, under the control of a truncated loricrin promoter or K5 promoter, develop normal skin and show no defects in the formation of the epidermis and other epithelial organs, and the transgenic IKKα represses chemical carcinogen or UVB induced skin carcinogenesis. Moreover, IKKα deletion mediated by a mutation, which generates a stop codon in the Ikkα gene, has been reported in a human autosomal recessive lethal syndrome. Downregulated IKKα and Ikkα mutations and deletions are found in human skin SCCs. The collective evidence not only highlights the importance of IKKα in skin development, maintaining skin homeostasis, and preventing skin carcinogenesis, but also demonstrates that mouse models are extremely valuable tools for revealing the mechanisms underlying these biological events, leading our studies from bench side to bedside.

  7. Corticocortical feedback increases the spatial extent of normalization.

    Science.gov (United States)

    Nassi, Jonathan J; Gómez-Laberge, Camille; Kreiman, Gabriel; Born, Richard T

    2014-01-01

    Normalization has been proposed as a canonical computation operating across different brain regions, sensory modalities, and species. It provides a good phenomenological description of non-linear response properties in primary visual cortex (V1), including the contrast response function and surround suppression. Despite its widespread application throughout the visual system, the underlying neural mechanisms remain largely unknown. We recently observed that corticocortical feedback contributes to surround suppression in V1, raising the possibility that feedback acts through normalization. To test this idea, we characterized area summation and contrast response properties in V1 with and without feedback from V2 and V3 in alert macaques and applied a standard normalization model to the data. Area summation properties were well explained by a form of divisive normalization, which computes the ratio between a neuron's driving input and the spatially integrated activity of a "normalization pool." Feedback inactivation reduced surround suppression by shrinking the spatial extent of the normalization pool. This effect was independent of the gain modulation thought to mediate the influence of contrast on area summation, which remained intact during feedback inactivation. Contrast sensitivity within the receptive field center was also unaffected by feedback inactivation, providing further evidence that feedback participates in normalization independent of the circuit mechanisms involved in modulating contrast gain and saturation. These results suggest that corticocortical feedback contributes to surround suppression by increasing the visuotopic extent of normalization and, via this mechanism, feedback can play a critical role in contextual information processing.

  8. Changes of color coordinates of biological tissue with superficial skin damage due to mechanical trauma

    Science.gov (United States)

    Pteruk, Vail; Mokanyuk, Olexander; Kvaternuk, Olena; Yakenina, Lesya; Kotyra, Andrzej; Romaniuk, Ryszard S.; Dussembayeva, Shynar

    2015-12-01

    Change of color coordinates of normal and pathological biological tissues is based on calculated spectral diffuse reflection. The proposed color coordinates of normal and pathological biological tissues of skin provided using standard light sources, allowing accurately diagnose skin damage due to mechanical trauma with a blunt object for forensic problems.

  9. 6.1 channel general planar surround sound system

    Institute of Scientific and Technical Information of China (English)

    XIE Bosun

    2001-01-01

    A new 6.1 channel surround sound system and its two signal mixing methods are proposed. Theoretical and experimental results show that the system is able to recreate 360°sound image in horizontal plane. Especially, compared with current 5.1 channel system, lateral and rear image of the new system is improved obviously. Therefore it is suitable to be used as a general surround sound system. It is also proved that, the new system is fully compatible with 5.1 channel system, and current methods are available to record 6.1 channel signals.

  10. Linking disadvantaged housing areas to the surrounding city

    DEFF Research Database (Denmark)

    Stender, Marie

    Several disadvantaged social housing areas in Denmark are currently undergo-ing thorough physical refurbishments, aiming to integrate them better with the surrounding city. The ambition is to attract new users and residents by opening up the borders of the area and establish attractive, new...... that especially eve-ryday-route strategies adding new public functions within the area can pave the way for integration with the surroundings. The applicability of such strategies is however highly dependent on the context, location and existing image of the ar-ea. Social distance may sustain though physical...

  11. Testing for normality

    CERN Document Server

    Thode, Henry C

    2002-01-01

    Describes the selection, design, theory, and application of tests for normality. Covers robust estimation, test power, and univariate and multivariate normality. Contains tests ofr multivariate normality and coordinate-dependent and invariant approaches.

  12. Tissue engineered skin substitutes created by laser-assisted bioprinting form skin-like structures in the dorsal skin fold chamber in mice.

    Science.gov (United States)

    Michael, Stefanie; Sorg, Heiko; Peck, Claas-Tido; Koch, Lothar; Deiwick, Andrea; Chichkov, Boris; Vogt, Peter M; Reimers, Kerstin

    2013-01-01

    Tissue engineering plays an important role in the production of skin equivalents for the therapy of chronic and especially burn wounds. Actually, there exists no (cellularized) skin equivalent which might be able to satisfactorily mimic native skin. Here, we utilized a laser-assisted bioprinting (LaBP) technique to create a fully cellularized skin substitute. The unique feature of LaBP is the possibility to position different cell types in an exact three-dimensional (3D) spatial pattern. For the creation of the skin substitutes, we positioned fibroblasts and keratinocytes on top of a stabilizing matrix (Matriderm®). These skin constructs were subsequently tested in vivo, employing the dorsal skin fold chamber in nude mice. The transplants were placed into full-thickness skin wounds and were fully connected to the surrounding tissue when explanted after 11 days. The printed keratinocytes formed a multi-layered epidermis with beginning differentiation and stratum corneum. Proliferation of the keratinocytes was mainly detected in the suprabasal layers. In vitro controls, which were cultivated at the air-liquid-interface, also exhibited proliferative cells, but they were rather located in the whole epidermis. E-cadherin as a hint for adherens junctions and therefore tissue formation could be found in the epidermis in vivo as well as in vitro. In both conditions, the printed fibroblasts partly stayed on top of the underlying Matriderm® where they produced collagen, while part of them migrated into the Matriderm®. In the mice, some blood vessels could be found to grow from the wound bed and the wound edges in direction of the printed cells. In conclusion, we could show the successful 3D printing of a cell construct via LaBP and the subsequent tissue formation in vivo. These findings represent the prerequisite for the creation of a complex tissue like skin, consisting of different cell types in an intricate 3D pattern.

  13. Tissue engineered skin substitutes created by laser-assisted bioprinting form skin-like structures in the dorsal skin fold chamber in mice.

    Directory of Open Access Journals (Sweden)

    Stefanie Michael

    Full Text Available Tissue engineering plays an important role in the production of skin equivalents for the therapy of chronic and especially burn wounds. Actually, there exists no (cellularized skin equivalent which might be able to satisfactorily mimic native skin. Here, we utilized a laser-assisted bioprinting (LaBP technique to create a fully cellularized skin substitute. The unique feature of LaBP is the possibility to position different cell types in an exact three-dimensional (3D spatial pattern. For the creation of the skin substitutes, we positioned fibroblasts and keratinocytes on top of a stabilizing matrix (Matriderm®. These skin constructs were subsequently tested in vivo, employing the dorsal skin fold chamber in nude mice. The transplants were placed into full-thickness skin wounds and were fully connected to the surrounding tissue when explanted after 11 days. The printed keratinocytes formed a multi-layered epidermis with beginning differentiation and stratum corneum. Proliferation of the keratinocytes was mainly detected in the suprabasal layers. In vitro controls, which were cultivated at the air-liquid-interface, also exhibited proliferative cells, but they were rather located in the whole epidermis. E-cadherin as a hint for adherens junctions and therefore tissue formation could be found in the epidermis in vivo as well as in vitro. In both conditions, the printed fibroblasts partly stayed on top of the underlying Matriderm® where they produced collagen, while part of them migrated into the Matriderm®. In the mice, some blood vessels could be found to grow from the wound bed and the wound edges in direction of the printed cells. In conclusion, we could show the successful 3D printing of a cell construct via LaBP and the subsequent tissue formation in vivo. These findings represent the prerequisite for the creation of a complex tissue like skin, consisting of different cell types in an intricate 3D pattern.

  14. Detection of follicular transport of lidocaine and metabolism in adipose tissue in pig ear skin by DESI mass spectrometry imaging.

    Science.gov (United States)

    D'Alvise, Janina; Mortensen, Rasmus; Hansen, Steen H; Janfelt, Christian

    2014-06-01

    Desorption electrospray ionization (DESI) mass spectrometry imaging is demonstrated as a detection technique for penetration experiments of drugs in skin. Lidocaine ointment was used as the model compound in ex vivo experiments with whole pig ears as the skin model. Follicular transport of lidocaine into the deeper skin layers is demonstrated for the first time. Furthermore, metabolism of lidocaine to 3-OH-lidocaine was observed in subcutaneous tissue as well as in lobules of white adipose tissue surrounding the hair follicles. These results suggest that it is advantageous to use full thickness skin, including subcutaneous tissue, for skin metabolism studies.

  15. [Skin-picking disorder].

    Science.gov (United States)

    Niemeier, V; Peters, E; Gieler, U

    2015-10-01

    The disorder is characterized by compulsive repetitive skin-picking (SP), resulting in skin lesions. The patients must have undertaken several attempts to reduce or stop SP. The disorder must have led to clinically significant limitations in social, professional, or other important areas of life. The symptoms cannot be better explained by another emotional disorder or any other dermatological disease. In the new DSM-V, skin-picking disorder has been included in the diagnostic system as an independent disorder and describes the self-injury of the skin by picking or scratching with an underlying emotional disorder. SP is classified among the impulse-control disorders and is, thus, differentiated from compulsive disorders as such. There are often emotional comorbidities. In cases of pronounced psychosocial limitation, interdisciplinary cooperation with a psychotherapist and/or psychiatrist is indicated.

  16. Skin picking disorder.

    Science.gov (United States)

    Grant, Jon E; Odlaug, Brian L; Chamberlain, Samuel R; Keuthen, Nancy J; Lochner, Christine; Stein, Dan J

    2012-11-01

    Although skin picking has been documented in the medical literature since the 19th century, only now is it receiving serious consideration as a DSM psychiatric disorder in discussions for DSM-5. Recent community prevalence studies suggest that skin picking disorder appears to be as common as many other psychiatric disorders, with reported prevalences ranging from 1.4% to 5.4%. Clinical evaluation of patients with skin picking disorder entails a broad physical and psychiatric examination, encouraging an interdisciplinary approach to evaluation and treatment. Approaches to treatment should include cognitive-behavioral therapy (including habit reversal or acceptance-enhanced behavior therapy) and medication (serotonin reuptake inhibitors, N-acetylcysteine, or naltrexone). Based on clinical experience and research findings, the authors recommend several management approaches to skin picking disorder.

  17. Aging changes in skin

    Science.gov (United States)

    ... Stress Other causes of skin changes: Allergies to plants and other substances Climate Clothing Exposures to industrial and household chemicals Indoor heating Sunlight can cause: Loss of elasticity (elastosis) ...

  18. Radiation therapy -- skin care

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/patientinstructions/000735.htm Radiation therapy - skin care To use the sharing features ... this page, please enable JavaScript. When you have radiation treatment for cancer, you may have some changes ...

  19. Scalded skin syndrome

    Science.gov (United States)

    ... Severe bloodstream infection ( septicemia ) Spread to deeper skin infection ( cellulitis ) When to Contact a Medical Professional Call your provider or go to the emergency room if you have symptoms of this disorder. Prevention ... Alternative Names Ritter disease; Staphylococcal ...

  20. Skin Cancer Trends

    Science.gov (United States)

    ... Potential Partners for Comprehensive Cancer Control Coalitions References Statistics Rates by Race and Ethnicity Rates by State Trends Behavior Rates What CDC Is Doing Skin Cancer Prevention Progress Report The Burning Truth Initiative A ...

  1. Skin, Hair, and Nails

    Science.gov (United States)

    ... Development Infections Diseases & Conditions Pregnancy & Baby Nutrition & Fitness Emotions & Behavior School & Family Life First Aid & Safety Doctors & ... produce melanin, the pigment that gives skin its color. All people have roughly the same number of ...

  2. Skin or nail culture

    Science.gov (United States)

    Mucosal culture; Culture - skin; Culture - mucosal; Nail culture; Culture - fingernail; Fingernail culture ... There, it is placed in a special dish (culture). It is then watched to see if bacteria, ...

  3. Allergy testing - skin

    Science.gov (United States)

    Patch tests - allergy; Scratch tests - allergy; Skin tests - allergy; RAST test; Allergic rhinitis - allergy testing; Asthma - allergy testing; Eczema - allergy testing; Hayfever - allergy testing; Dermatitis - allergy testing; Allergy testing; ...

  4. Impairments in Skin Integrity.

    Science.gov (United States)

    Murphree, Rose W

    2017-09-01

    Altered skin integrity increases the chance of infection, impaired mobility, and decreased function and may result in the loss of limb or, sometimes, life. Skin is affected by both intrinsic and extrinsic factors. Intrinsic factors can include altered nutritional status, vascular disease issues, and diabetes. Extrinsic factors include falls, accidents, pressure, immobility, and surgical procedures. Ensuring skin integrity in the elderly requires a team approach and includes the individual, caregivers, and clinicians. The twenty-first century clinician has several online, evidence-based tools to assist with optimal treatment plans. Understanding best practices in addressing skin integrity issues can promote positive outcomes with the elderly. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Designing pliable structural Skins

    DEFF Research Database (Denmark)

    Tamke, Martin; Peters, Brady; Nielsen, Stig Anton;

    2013-01-01

    Structural stability can be formed through structured or seemingly unstructured approaches to fold, plead or crumble paper. This paper reports on two projects that showcase how computational design approaches can help to widen the understanding and use of structural skins....

  6. Occupational skin diseases

    DEFF Research Database (Denmark)

    Mahler, Vera; Aalto-Korte, Kristiina; Alfonso, Jose Hernan

    2017-01-01

    BACKGROUND: Work-related skin diseases (WSD) are caused or worsened by a professional activity. Occupational skin diseases (OSD) need to fulfil additional legal criteria which differ from country to country. OSD range amongst the five most frequently notified occupational diseases (musculoskeletal...... diseases, neurologic diseases, lung diseases, diseases of the sensory organs, skin diseases) in Europe. OBJECTIVE: To retrieve information and compare the current state of national frameworks and pathways to manage patients with occupational skin disease with regard to prevention, diagnosis, treatment...... in Science and Technology (COST) Action TD 1206 (StanDerm) (www.standerm.eu). RESULTS: Besides a national health service or a statutory health insurance, most European member states implemented a second insurance scheme specifically geared at occupational diseases [insurance against occupational risks...

  7. Skin lesion biopsy

    Science.gov (United States)

    ... procedure will leave a small indented area. This type of biopsy is often done when a skin cancer is ... may have stitches to close the area. This type of biopsy is often done to diagnose rashes . EXCISIONAL BIOPSY ...

  8. Examine Your Skin

    Medline Plus

    Full Text Available ... Doctor Glossary of Terms Resources Resources Global Resources Cancer Centers Online Resources The Melanoma Book Clinical Trials Download a Skin Self-Exam Card Download a Patient Navigation Card ...

  9. Skin Diseases: Cross-section of human skin

    Science.gov (United States)

    Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Cross-section of human skin Past Issues / Fall 2008 Table of Contents For ... Logical Images, Inc. I n the areas of skin health and skin diseases, the NIH's National Institute ...

  10. Spiritual and religious aspects of skin and skin disorders

    Directory of Open Access Journals (Sweden)

    Shenefelt PD

    2014-08-01

    Full Text Available Philip D Shenefelt,1 Debrah A Shenefelt2 1Dermatology and Cutaneous Surgery, University of South Florida, Tampa, 2Congregation Or Ahavah, Lutz, FL, USA Abstract: Skin and skin disorders have had spiritual aspects since ancient times. Skin, hair, and nails are visible to self and others, and touchable by self and others. The skin is a major sensory organ. Skin also expresses emotions detectable by others through pallor, coldness, "goose bumps", redness, warmth, or sweating. Spiritual and religious significances of skin are revealed through how much of the skin has been and continues to be covered with what types of coverings, scalp and beard hair cutting, shaving and styling, skin, nail, and hair coloring and decorating, tattooing, and intentional scarring of skin. Persons with visible skin disorders have often been stigmatized or even treated as outcasts. Shamans and other spiritual and religious healers have brought about healing of skin disorders through spiritual means. Spiritual and religious interactions with various skin disorders such as psoriasis, leprosy, and vitiligo are discussed. Religious aspects of skin and skin diseases are evaluated for several major religions, with a special focus on Judaism, both conventional and kabbalistic. Keywords: skin, skin disorders, spiritual, religious

  11. Memory regulatory T cells reside in human skin.

    Science.gov (United States)

    Sanchez Rodriguez, Robert; Pauli, Mariela L; Neuhaus, Isaac M; Yu, Siegrid S; Arron, Sarah T; Harris, Hobart W; Yang, Sara Hsin-Yi; Anthony, Bryan A; Sverdrup, Francis M; Krow-Lucal, Elisabeth; MacKenzie, Tippi C; Johnson, David S; Meyer, Everett H; Löhr, Andrea; Hsu, Andro; Koo, John; Liao, Wilson; Gupta, Rishu; Debbaneh, Maya G; Butler, Daniel; Huynh, Monica; Levin, Ethan C; Leon, Argentina; Hoffman, William Y; McGrath, Mary H; Alvarado, Michael D; Ludwig, Connor H; Truong, Hong-An; Maurano, Megan M; Gratz, Iris K; Abbas, Abul K; Rosenblum, Michael D

    2014-03-01

    Regulatory T cells (Tregs), which are characterized by expression of the transcription factor Foxp3, are a dynamic and heterogeneous population of cells that control immune responses and prevent autoimmunity. We recently identified a subset of Tregs in murine skin with properties typical of memory cells and defined this population as memory Tregs (mTregs). Due to the importance of these cells in regulating tissue inflammation in mice, we analyzed this cell population in humans and found that almost all Tregs in normal skin had an activated memory phenotype. Compared with mTregs in peripheral blood, cutaneous mTregs had unique cell surface marker expression and cytokine production. In normal human skin, mTregs preferentially localized to hair follicles and were more abundant in skin with high hair density. Sequence comparison of TCRs from conventional memory T helper cells and mTregs isolated from skin revealed little homology between the two cell populations, suggesting that they recognize different antigens. Under steady-state conditions, mTregs were nonmigratory and relatively unresponsive; however, in inflamed skin from psoriasis patients, mTregs expanded, were highly proliferative, and produced low levels of IL-17. Taken together, these results identify a subset of Tregs that stably resides in human skin and suggest that these cells are qualitatively defective in inflammatory skin disease.

  12. Nicotinamide and the skin.

    Science.gov (United States)

    Chen, Andrew C; Damian, Diona L

    2014-08-01

    Nicotinamide, an amide form of vitamin B3, boosts cellular energy and regulates poly-ADP-ribose-polymerase 1, an enzyme with important roles in DNA repair and the expression of inflammatory cytokines. Nicotinamide shows promise for the treatment of a wide range of dermatological conditions, including autoimmune blistering disorders, acne, rosacea, ageing skin and atopic dermatitis. In particular, recent studies have also shown it to be a potential agent for reducing actinic keratoses and preventing skin cancers.

  13. Mantoux Tuberculin Skin Test

    Centers for Disease Control (CDC) Podcasts

    2006-11-22

    Learn how to evaluate people for latent TB infection with the Mantoux tuberculin skin test. This podcast includes sections on administering and reading the Mantoux tuberculin skin test, the standard method for detecting latent TB infection since the 1930s.  Created: 11/22/2006 by National Center for HIV, STD and TB Prevention (NCHHSTP).   Date Released: 12/12/2006.

  14. Skin Cancer - Multiple Languages

    Science.gov (United States)

    ... Expand Section Skin Cancer: MedlinePlus Health Topic - English Cáncer de piel: Tema de salud de MedlinePlus - español (Spanish) National Library of Medicine Ukrainian (українська ) Expand Section Skin Cancer - українська (Ukrainian) Bilingual PDF Health Information Translations Characters ...

  15. Piezoresistive pressure sensor array for robotic skin

    Science.gov (United States)

    Mirza, Fahad; Sahasrabuddhe, Ritvij R.; Baptist, Joshua R.; Wijesundara, Muthu B. J.; Lee, Woo H.; Popa, Dan O.

    2016-05-01

    Robots are starting to transition from the confines of the manufacturing floor to homes, schools, hospitals, and highly dynamic environments. As, a result, it is impossible to foresee all the probable operational situations of robots, and preprogram the robot behavior in those situations. Among human-robot interaction technologies, haptic communication is an intuitive physical interaction method that can help define operational behaviors for robots cooperating with humans. Multimodal robotic skin with distributed sensors can help robots increase perception capabilities of their surrounding environments. Electro-Hydro-Dynamic (EHD) printing is a flexible multi-modal sensor fabrication method because of its direct printing capability of a wide range of materials onto substrates with non-uniform topographies. In past work we designed interdigitated comb electrodes as a sensing element and printed piezoresistive strain sensors using customized EHD printable PEDOT:PSS based inks. We formulated a PEDOT:PSS derivative ink, by mixing PEDOT:PSS and DMSO. Bending induced characterization tests of prototyped sensors showed high sensitivity and sufficient stability. In this paper, we describe SkinCells, robot skin sensor arrays integrated with electronic modules. 4x4 EHD-printed arrays of strain sensors was packaged onto Kapton sheets and silicone encapsulant and interconnected to a custom electronic module that consists of a microcontroller, Wheatstone bridge with adjustable digital potentiometer, multiplexer, and serial communication unit. Thus, SkinCell's electronics can be used for signal acquisition, conditioning, and networking between sensor modules. Several SkinCells were loaded with controlled pressure, temperature and humidity testing apparatuses, and testing results are reported in this paper.

  16. Pro-inflammatory Signaling in a 3D Organotypic Skin Model after Low LET Irradiation—NF-κB, COX-2 Activation, and Impact on Cell Differentiation

    Science.gov (United States)

    Acheva, Anna; Schettino, Giuseppe; Prise, Kevin M.

    2017-01-01

    Nearly 85% of radiotherapy patients develop acute radiation dermatitis, which is an inflammatory reaction of the skin at the treatment field and in the surrounding area. The aims of this study were to unravel the mechanisms of radiation-induced inflammatory responses after localized irradiation in a human 3D organotypic skin culture model. This could provide possible inflammatory targets for reduction of skin side effects. 3D organotypic skin cultures were set up and locally irradiated with 225 kVp X-rays, using a combination of full exposure and partial shielding (50%) of the cultures. The secretion of pro-inflammatory cytokines, the phenotype, and the differentiation markers expression of the cultures were assessed up to 10 days postirradiation. The pro-inflammatory transcription factor nuclear factor kappa B (NF-κB) and cyclooxygenase-2 (COX-2) pathways have been studied. The results showed fast activation of NF-κB, most likely triggered by DNA damage in the irradiated cells, followed by upregulation of p38 MAPK and COX-2 in the irradiated and surrounding, non-irradiated, areas of the 3D cultures. The application of the COX-2 inhibitor sc-236 was effective at reducing the COX-2 mRNA levels 4 h postirradiation. The same inhibitor also suppressed the PGE2 secretion significantly 72 h after the treatment. The expression of a pro-inflammatory phenotype and abnormal differentiation markers of the cultures were also reduced. However, the use of an NF-κB inhibitor (Bay 11-7085) did not have the predicted positive effect on the cultures phenotype postirradiation. Radiation-induced pro-inflammatory responses have been observed in the 3D skin model. The activated signaling pathways involved NF-κB transcription factor and its downstream target COX-2. Further experiments aiming to suppress the inflammatory response via specific inhibitors showed that COX-2 is a suitable target for reduction of the normal skin inflammatory responses at radiotherapy, while NF

  17. Determination of the chemical composition of human renal stones with MDCT: influence of the surrounding media

    Science.gov (United States)

    Grosjean, Romain; Sauer, Benoît; Guerra, Rui; Kermarrec, Isabelle; Ponvianne, Yannick; Winninger, Daniel; Daudon, Michel; Blum, Alain; Felblinger, Jacques; Hubert, Jacques

    2007-03-01

    The selection of the optimal treatment method for urinary stones diseases depends on the chemical composition of the stone and its corresponding fragility. MDCT has become the most used modality to determine rapidly and accurately the presence of stones when evaluating urinary lithiasis treatment. That is why several studies have tempted to determine the chemical composition of the stones based on the stone X-ray attenuation in-vitro and invivo. However, in-vitro studies did not reproduce the normal abdominal wall and fat, making uncertain the standardization of the obtained values. The aim of this study is to obtain X-ray attenuation values (in Hounsfield Units) of the six more frequent types of human renal stones (n=217) and to analyze the influence of the surrounding media on these values. The stones were first placed in a jelly, which X-ray attenuation is similar to that of the human kidney (30 HU at 120 kV). They were then stuck on a grid, scanned in a water tank and finally scanned in the air. Significant differences in CT-attenuation values were obtained with the three different surrounding media (jelly, water, air). Furthermore there was an influence of the surrounding media and consequently discrepancies in determination of the chemical composition of the renal stones. Consequently, CT-attenuation values found in in-vitro studies cannot really be considered as a reference for the determination of the chemical composition except if the used phantom is an anthropomorphic one.

  18. Hyperspectral imaging of skin and lung cancers

    Science.gov (United States)

    Zherdeva, Larisa A.; Bratchenko, Ivan A.; Alonova, Marina V.; Myakinin, Oleg O.; Artemyev, Dmitry N.; Moryatov, Alexander A.; Kozlov, Sergey V.; Zakharov, Valery P.

    2016-04-01

    The problem of cancer control requires design of new approaches for instrumental diagnostics, as the accuracy of cancer detection on the first step of diagnostics in clinics is slightly more than 50%. In this study, we present a method of visualization and diagnostics of skin and lung tumours based on registration and processing of tissues hyperspectral images. In a series of experiments registration of hyperspectral images of skin and lung tissue samples is carried out. Melanoma, basal cell carcinoma, nevi and benign tumours are studied in skin ex vivo and in vivo experiments; adenocarcinomas and squamous cell carcinomas are studied in ex vivo lung experiments. In a series of experiments the typical features of diffuse reflection spectra for pathological and normal tissues were found. Changes in tissues morphology during the tumour growth lead to the changes of blood and pigments concentration, such as melanin in skin. That is why tumours and normal tissues maybe differentiated with information about spectral response in 500-600 nm and 600 - 670 nm areas. Thus, hyperspectral imaging in the visible region may be a useful tool for cancer detection as it helps to estimate spectral properties of tissues and determine malignant regions for precise resection of tumours.

  19. Ultraflexible organic photonic skin.

    Science.gov (United States)

    Yokota, Tomoyuki; Zalar, Peter; Kaltenbrunner, Martin; Jinno, Hiroaki; Matsuhisa, Naoji; Kitanosako, Hiroki; Tachibana, Yutaro; Yukita, Wakako; Koizumi, Mari; Someya, Takao

    2016-04-01

    Thin-film electronics intimately laminated onto the skin imperceptibly equip the human body with electronic components for health-monitoring and information technologies. When electronic devices are worn, the mechanical flexibility and/or stretchability of thin-film devices helps to minimize the stress and discomfort associated with wear because of their conformability and softness. For industrial applications, it is important to fabricate wearable devices using processing methods that maximize throughput and minimize cost. We demonstrate ultraflexible and conformable three-color, highly efficient polymer light-emitting diodes (PLEDs) and organic photodetectors (OPDs) to realize optoelectronic skins (oe-skins) that introduce multiple electronic functionalities such as sensing and displays on the surface of human skin. The total thickness of the devices, including the substrate and encapsulation layer, is only 3 μm, which is one order of magnitude thinner than the epidermal layer of human skin. By integrating green and red PLEDs with OPDs, we fabricate an ultraflexible reflective pulse oximeter. The device unobtrusively measures the oxygen concentration of blood when laminated on a finger. On-skin seven-segment digital displays and color indicators can visualize data directly on the body.

  20. DOSHIC PHYSIOLOGY OF SKIN

    Directory of Open Access Journals (Sweden)

    Shivprasad Chiplunkar

    2013-06-01

    Full Text Available The balance of dosha  represents the healthy state and imbalance will cause various diseases. In normalcy doshas will be performing their own functions and individual doshas will be having their own specific sites. By telling the various sthana of each dosha, different function that is taken up by individual dosha in different sites has been highlighted.By mentioning ‘sparshanendriyam’ as one of the sthana of vata dosha the sensory functions of skin to vata dosha has been emphasised. By mentioning ‘sparshanam’ as one of the sthana of pittadosha, the function of colouring/pigmentation of skin, which is majorly carried out  by melanocytes by secreting melanin pigment has been highlighted. Meda is one among the sthanas of kapha dosha; this can be considered as the adipose tissue of skin/below skin. Since sweda is mala of meda it can be also considered as the secretions from the eccrine glands.With respect to skin, sensory functions, both tactile and thermal is carried out by vata dosha more specifically vyana vata, pigmentation to the skin carried out by meloncytes by secreting melanin, it is nothing but function of pitta dosha more specifically brajaka pitta with the help of udana vata and finally production of sweat in sweat glands is the function of kapha. So there is the need for further study and research regarding the sthanas of all three doshas in different structures/organs in the body and its physiology.

  1. Zinc and skin biology.

    Science.gov (United States)

    Ogawa, Youichi; Kawamura, Tatsuyoshi; Shimada, Shinji

    2016-12-01

    Of all tissues, the skin has the third highest abundance of zinc in the body. In the skin, the zinc concentration is higher in the epidermis than in the dermis, owing to a zinc requirement for the active proliferation and differentiation of epidermal keratinocytes. Here we review the dynamics and functions of zinc in the skin as well as skin disorders associated with zinc deficiency, zinc finger domain-containing proteins, and zinc transporters. Among skin disorders associated with zinc deficiency, acrodermatitis enteropathica is a disorder caused by mutations in the ZIP4 transporter and subsequent zinc deficiency. The triad acrodermatitis enteropathica is characterized by alopecia, diarrhea, and skin lesions in acral, periorificial, and anogenital areas. We highlight the underlying mechanism of the development of acrodermatitis because of zinc deficiency by describing our new findings. We also discuss the accumulating evidence on zinc deficiency in alopecia and necrolytic migratory erythema, which is typically associated with glucagonomas. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Ecological mechanisms linking protected areas to surrounding lands.

    Science.gov (United States)

    Hansen, Andrew J; DeFries, Ruth

    2007-06-01

    Land use is expanding and intensifying in the unprotected lands surrounding many of the world's protected areas. The influence of this land use change on ecological processes is poorly understood. The goal of this paper is to draw on ecological theory to provide a synthetic framework for understanding how land use change around protected areas may alter ecological processes and biodiversity within protected areas and to provide a basis for identifying scientifically based management alternatives. We first present a conceptual model of protected areas embedded within larger ecosystems that often include surrounding human land use. Drawing on case studies in this Invited Feature, we then explore a comprehensive set of ecological mechanisms by which land use on surrounding lands may influence ecological processes and biodiversity within reserves. These mechanisms involve changes in ecosystem size, with implications for minimum dynamic area, species-area effect, and trophic structure; altered flows of materials and disturbances into and out of reserves; effects on crucial habitats for seasonal and migration movements and population source/sink dynamics; and exposure to humans through hunting, poaching, exotics species, and disease. These ecological mechanisms provide a basis for assessing the vulnerability of protected areas to land use. They also suggest criteria for designing regional management to sustain protected areas in the context of surrounding human land use. These design criteria include maximizing the area of functional habitats, identifying and maintaining ecological process zones, maintaining key migration and source habitats, and managing human proximity and edge effects.

  3. Metrizamide demonstration of the subarachnoid space surrounding the Gasserian ganglion

    Energy Technology Data Exchange (ETDEWEB)

    Christmann, D.; Babin, E.

    1980-05-01

    The chance opacification of the subarachnoid space surrounding the Gasserian ganglion, observed during metrizamide basal cisternography, is reported. This is compared to similar demonstrations of the optic subarachnoid space. Such infrequently observed images should be known because they may be related to the occurrence of trigeminal neuralgia.

  4. Orientation-tuned surround suppression in mouse visual cortex

    NARCIS (Netherlands)

    Self, Matthew W; Lorteije, Jeannette A M; Vangeneugden, Joris; van Beest, Enny H; Grigore, Mihaela E; Levelt, Christiaan N; Heimel, J.A.; Roelfsema, Pieter R

    2014-01-01

    The firing rates of neurons in primary visual cortex (V1) are suppressed by large stimuli, an effect known as surround suppression. In cats and monkeys, the strength of suppression is sensitive to orientation; responses to regions containing uniform orientations are more suppressed than those contai

  5. Challenges Surrounding the Education of Children with Chronic Diseases

    Science.gov (United States)

    Gordon, Maria, Ed.

    2016-01-01

    While governing bodies have mandated that all students have the right to an education, with disabled students treated to the same rights and opportunities as non-disabled students, policymakers do not always agree on what all-inclusive education should look like. "Challenges Surrounding the Education of Children with Chronic Diseases"…

  6. Microvascular regeneration in meshed skin transplants after severe burns.

    Science.gov (United States)

    Meier, T O; Guggenheim, M; Vetter, S T; Husmann, M; Haile, S R; Amann-Vesti, B R

    2011-09-01

    Function of the skin lymphatics as well as blood perfusion of a meshed transplant is crucial for the healing. The lymphatic regeneration and arterial perfusion of skin transplants after severe burns of the extremities had been studied in eight patients by microlymphography, laser doppler perfusion imaging and transcutaneous oxygen pressure measurements 1, 6 and 18 months after transplantation. One month after transplantation, only fragmented as well as many giant lymphatic skin vessels were present in the transplant. After 6 months a normal lymphatic network had developed in all grafts. The extension of the dye in the lymphatics decreased from 4.5 (0-16) at 1 month to 3.0 (1-6) mm after 18 months, indicating improved lymph drainage capacity. The permeability of the lymphatics in the graft was normal. After 1 month, median laser flux in the transplant was 155.6% (105-246%) of the normal skin but it normalised within 18 months. By contrast, transcutaneous oxygen measurement (TcPO(2)) increased from 44 (21-47) to 55 (50-76) mmHg. In meshed transplants used to cover severely burned skin morphological and functional normal lymphatics develop within 6 months and the initially increased laser flux due to inflammatory reaction normalises. Our results provide important insights into the healing process of skin transplants after burn. Copyright © 2011 Elsevier Ltd and ISBI. All rights reserved.

  7. Military installation sequestered more carbon than surrounding areas

    Science.gov (United States)

    Zhao, S.; Liu, S.; Li, Z.; Sohl, T.

    2008-12-01

    Land use activities greatly affect the temporal trends and spatial patterns of regional land-atmospheric exchange of carbon. Military installations generally have drastically different land management strategies from surrounding areas, and the carbon consequences have never been quantified and assessed. Here, we used the General Ensemble Biogeochemical Modeling System (GEMS) to simulate and compare ecosystem carbon dynamics between Fort Benning and surrounding areas from 1992 to 2050. GEMS was driven by unique combinations of spatial and temporal dynamics of major driving forces, such as climate, soil properties, nitrogen deposition, and land use and land cover changes (predicted by FOREcasting SCEnarios of land cover change (FORE-SCE)). Our results indicated that the military installation sequestered more carbon than surrounding areas (0.77 vs. 0.16 Mg C ha-1 y-1 averaged from 1992 to 2007). Differences in land use activities were the primary cause behind the difference in carbon sequestration rates. From 1992 to 2007, no urban/residential expansion occurred at the installation, and transitional barren (primarily caused by forest harvesting) slightly increased from 0 to 0.2%. In contrast, urban land increased from 5.6 to 7.6% and transitional barren increased from 0.1 to 0.7% in the surrounding areas. Live biomass accumulation accounted for most of the carbon sink in both Fort Benning and surrounding areas (0.75 vs. 0.15 Mg C ha-1 y-1), while soil organic carbon accumulation was small (0.02 vs. 0.01 Mg C ha- 1 y-1), suggesting biomass removal caused by urbanization and harvesting resulted in much less carbon sequestration in surrounding areas. Fort Benning is likely to sequester more carbon in the future, although the rate of carbon sequestered per year will gradually reduce. The future carbon source/sink strength in the surrounding areas varied greatly, from a small sink to a strong source, depending on the path of land use change (e.g., increase of clear

  8. A subset of CD163+ macrophages displays mixed polarizations in discoid lupus skin.

    Science.gov (United States)

    Chong, Benjamin F; Tseng, Lin-Chiang; Hosler, Gregory A; Teske, Noelle M; Zhang, Song; Karp, David R; Olsen, Nancy J; Mohan, Chandra

    2015-11-13

    Lesional skin of patients with discoid lupus erythematosus (DLE) contains macrophages, whose polarization has yet to be investigated. To test our hypothesis that M1 macrophages would be increased in DLE skin, we examined transcriptome alterations in immune cell gene expression and macrophage features in DLE and normal skin by using gene expression and histochemical approaches. Gene expression of RNA from DLE lesional and normal control skin was compared by microarrays and quantitative real-time polymerase chain reaction (RT-PCR). Both skin groups were analyzed for CD163 expression by immunohistochemistry. Double immunofluorescence studies were performed to characterize protein expression of CD163+ macrophages. DLE skin had twice as many upregulated genes than downregulated genes compared with normal skin. Gene set enrichment analysis comparing differentially expressed genes in DLE and normal skin with previously published gene sets associated with M1 and M2 macrophages showed strong overlap between upregulated genes in DLE skin and M1 macrophages. Quantitative RT-PCR showed that several M1 macrophage-associated genes--e.g., chemokine (C-X-C motif) ligand 10 (CXCL10), chemokine (C-C motif) ligand 5 (CCL5), and signal transducer and activator of transcription 1 (STAT1)-had amplified mRNA levels in DLE skin. CD163+ macrophages were increased near the epidermal-dermal junction and perivascular areas in DLE skin compared with normal skin. However, double immunofluorescence studies of CD163+ macrophages revealed minor co-expression of M1 (CXCL10, tumor necrosis factor-alpha, and CD127) and M2 (CD209 and transforming growth factor-beta) macrophage-related proteins in DLE skin. Whereas a subset of CD163+ macrophages displays mixed polarizations in DLE skin, other immune cells such as T cells can contribute to the expression of these macrophage-related genes.

  9. Cellular reprogramming in skin cancer.

    Science.gov (United States)

    Song, Ihn Young; Balmain, Allan

    2015-06-01

    Early primitive stem cells have long been viewed as the cancer cells of origin (tumor initiating target cells) due to their intrinsic features of self-renewal and longevity. However, emerging evidence suggests a surprising capacity for normal committed cells to function as reserve stem cells upon reprogramming as a consequence of tissue damage resulting in inflammation and wound healing. This results in an alternative concept positing that tumors may originate from differentiated cells that can re-acquire stem cell properties due to genetic or epigenetic reprogramming. It is likely that both models are correct, and that a continuum of potential cells of origin exists, ranging from early primitive stem cells to committed progenitor or even terminally differentiated cells. A combination of the nature of the target cell and the specific types of gene mutations introduced determine tumor cell lineage, as well as potential for malignant conversion. Evidence from mouse skin models of carcinogenesis suggests that initiated cells at different stages within a stem cell hierarchy have varying degrees of requirement for reprogramming (e.g. inflammation stimuli), depending on their degree of differentiation. This article will present evidence in favor of these concepts that has been developed from studies of several mouse models of skin carcinogenesis. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Differential Inequalities, Normality and Quasi-Normality

    CERN Document Server

    Liu, Xiaojun; Pang, Xuecheng

    2011-01-01

    We prove that if D is a domain in C, alpha>1 and c>0, then the family F of functions meromorphic in D such that |f'(z)|/(1+|f(z)|^alpha)>c for every z in D is normalin D. For alpha=1, the same assumptions imply quasi-normality but not necessarily normality.

  11. EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA); Scientific Opinion on the substantiation of health claims related to a combination of lycopene, proanthocyanidins, vitamin C, vitamin E, selenium and beta-carotene and contribution to normal collagen formation (ID 1669) and protection, of the skin from UV-induced damage (ID 1669) pursuant to Article 13(1) of Regulation (EC) No 1924/2006

    DEFF Research Database (Denmark)

    Tetens, Inge

    claims in relation to a combination of lycopene, proanthocyanidins, vitamin C, vitamin E, selenium and beta-carotene and contribution to normal collagen formation and protection of the skin from UV-induced damage. The scientific substantiation is based on the information provided by the Member States...... in the consolidated list of Article 13 health claims and references that EFSA has received from Member States or directly from stakeholders. The food constituent that is the subject of the health claim is a combination of lycopene, proanthocyanidins, vitamin C, vitamin E, selenium, and beta-carotene. The Panel...... considers that the combination of lycopene, proanthocyanidins, vitamin C, vitamin E, selenium, and beta-carotene is sufficiently characterised....

  12. Skin impedance comparisons of electrodes for electro-oculography.

    Science.gov (United States)

    Lee, J B; Reinecke, R D

    1991-01-01

    In an effort to define the most comfortable electrode needing the simplest skin preparation with low and stable skin impedance, we compared the impedance between skin electrodes and Stat-Trace II St-102 EKG electrodes (Niko Med USA, New Brunswick, NJ)--the latter being renamed "dry electrodes" because they are used without electrolyte paste--on 12 normal subjects with two different skin preparations, with and without alcohol. The dry electrodes were found to have lower impedance than the skin electrodes. With each skin preparation the alcohol scored better, 7.2 kOhm vs 16.5 kOhm, respectively, and "no preparation" worse, 13.8 kOhm vs 22.7 kOhm, respectively, (but still acceptable when the dry electrode was used). The dry electrode's impedance was quite stable from the moment of application while the skin electrode's impedance drifted dramatically for 30 minutes. If the dry electrode was halved in area of skin contact, as often is necessary with the nasal electrode in children, the impedance rose proportionally but remained acceptable. We conclude that the new dry electrodes give us improved electro-oculography records and suggest their use, particularly for infants and young children where ease of application and simple skin preparation are particularly important.

  13. Linking student performance in Massachusetts elementary schools with the "greenness" of school surroundings using remote sensing.

    Science.gov (United States)

    Wu, Chih-Da; McNeely, Eileen; Cedeño-Laurent, J G; Pan, Wen-Chi; Adamkiewicz, Gary; Dominici, Francesca; Lung, Shih-Chun Candice; Su, Huey-Jen; Spengler, John D

    2014-01-01

    Various studies have reported the physical and mental health benefits from exposure to "green" neighborhoods, such as proximity to neighborhoods with trees and vegetation. However, no studies have explicitly assessed the association between exposure to "green" surroundings and cognitive function in terms of student academic performance. This study investigated the association between the "greenness" of the area surrounding a Massachusetts public elementary school and the academic achievement of the school's student body based on standardized tests with an ecological setting. Researchers used the composite school-based performance scores generated by the Massachusetts Comprehensive Assessment System (MCAS) to measure the percentage of 3rd-grade students (the first year of standardized testing for 8-9 years-old children in public school), who scored "Above Proficient" (AP) in English and Mathematics tests (Note: Individual student scores are not publically available). The MCAS results are comparable year to year thanks to an equating process. Researchers included test results from 2006 through 2012 in 905 public schools and adjusted for differences between schools in the final analysis according to race, gender, English as a second language (proxy for ethnicity and language facility), parent income, student-teacher ratio, and school attendance. Surrounding greenness of each school was measured using satellite images converted into the Normalized Difference Vegetation Index (NDVI) in March, July and October of each year according to a 250-meter, 500-meter, 1,000-meter, and 2000-meter circular buffer around each school. Spatial Generalized Linear Mixed Models (GLMMs) estimated the impacts of surrounding greenness on school-based performance. Overall the study results supported a relationship between the "greenness" of the school area and the school-wide academic performance. Interestingly, the results showed a consistently positive significant association between the

  14. Bathing in a magnesium-rich Dead Sea salt solution improves skin barrier function, enhances skin hydration, and reduces inflammation in atopic dry skin.

    Science.gov (United States)

    Proksch, Ehrhardt; Nissen, Hans-Peter; Bremgartner, Markus; Urquhart, Colin

    2005-02-01

    Magnesium salts, the prevalent minerals in Dead Sea water, are known to exhibit favorable effects in inflammatory diseases. We examined the efficacy of bathing atopic subjects in a salt rich in magnesium chloride from deep layers of the Dead Sea (Mavena(R) Dermaline Mg(46) Dead Sea salt, Mavena AG, Belp, Switzerland). Volunteers with atopic dry skin submerged one forearm for 15 min in a bath solution containing 5% Dead Sea salt. The second arm was submerged in tap water as control. Before the study and at weeks 1-6, transepidermal water loss (TEWL), skin hydration, skin roughness, and skin redness were determined. We found one subgroup with a normal and one subgroup with an elevated TEWL before the study. Bathing in the Dead Sea salt solution significantly improved skin barrier function compared with the tap water-treated control forearm in the subgroup with elevated basal TEWL. Skin hydration was enhanced on the forearm treated with the Dead Sea salt in each group, which means the treatment moisturized the skin. Skin roughness and redness of the skin as a marker for inflammation were significantly reduced after bathing in the salt solution. This demonstrates that bathing in the salt solution was well tolerated, improved skin barrier function, enhanced stratum corneum hydration, and reduced skin roughness and inflammation. We suggest that the favorable effects of bathing in the Dead Sea salt solution are most likely related to the high magnesium content. Magnesium salts are known to bind water, influence epidermal proliferation and differentiation, and enhance permeability barrier repair.

  15. Recent Progress in Electronic Skin

    OpenAIRE

    Wang, Xiandi; Dong, Lin; Zhang, Hanlu; Yu, Ruomeng; Pan, Caofeng; Wang, Zhong Lin

    2015-01-01

    The skin is the largest organ of the human body and can sense pressure, temperature, and other complex environmental stimuli or conditions. The mimicry of human skin's sensory ability via electronics is a topic of innovative research that could find broad applications in robotics, artificial intelligence, and human–machine interfaces, all of which promote the development of electronic skin (e‐skin). To imitate tactile sensing via e‐skins, flexible and stretchable pressure sensor arrays are co...

  16. Skin aging and oxidative stress

    OpenAIRE

    Sayeeda Ahsanuddin; Minh Lam; Baron, Elma D.

    2016-01-01

    Skin aging occurs through two main pathways, intrinsic and extrinsic. These pathways have significant interaction in contributing to the aging phenotype, which includes skin laxity, wrinkling, pigmentation irregularities, and the appearance of neoplastic skin lesions. Here, we review the critical role that oxidative stress plays in skin aging, including its effects on signaling pathways involved in skin matrix formation and degradation, proteasome activity, as well as DNA structure. Furthermo...

  17. Skin involvement in Dupuytren's disease.

    OpenAIRE

    Wade, R.; Igali, L; Figus, A

    2016-01-01

    Whether the palmar skin has a role in the development, propagation or recurrence of Dupuytren's disease remains unclear. Clinical assessment for skin involvement is difficult and its correlation with histology uncertain. We prospectively biopsied the palmar skin of consecutive patients undergoing single digit fasciectomy (for primary Dupuytren's disease without clinically involved skin) and dermofasciectomy (for clinically involved skin or recurrence) in order to investigate this relationship...

  18. Nerve conduction studies in upper extremities: skin temperature corrections.

    Science.gov (United States)

    Halar, E M; DeLisa, J A; Soine, T L

    1983-09-01

    The relationship of skin to near nerve (NN) temperature and to nerve conduction velocity (NCV) and distal latency (DL) was studied in 34 normal adult subjects before and after cooling both upper extremities. Median and ulnar motor and sensory NCV, DL, and NN temperature were determined at ambient temperature (mean X skin temp = 33 C) and after cooling, at approximately 26, 28, and 30 C of forearm skin temperature. Skin temperatures on the volar side of the forearm, wrist, palm, and fingers and NN temperature at the forearm, midpalm, and thenar or hypothenar eminence were compared with respective NCV and DL. Results showed a significant linear correlation between skin temperature and NN temperature at corresponding sites (r2 range, 0.4-0.84; p less than 0.005). Furthermore, both skin and NN temperatures correlated significantly with respective NCV and DL. Midline wrist skin temperature showed the best correlation to NCV and DL. Median motor and sensory NCV were altered 1.5 and 1.4m/sec/C degree and their DL 0.2 msec/C degree of wrist skin temperature change, respectively. Ulnar motor and sensory NCV were changed 2.1 and 1.6m/sec/C degree respectively, and 0.2 msec/C degree wrist temperature for motor and sensory DL. Average ambient skin temperature at the wrist (33 C) was used as a standard skin temperature in the temperature correction formula: NCV or DL(temp corrected) = CF(Tst degree - Tm degree) + obtained NCV or DL, where Tst = 33 C for wrist, Tm = the measured skin temperature, and CF = correction factor of tested nerve. Use of temperature correction formula for NCV and DL is suggested in patients with changed wrist skin temperature outside 29.6-36.4C temperature range.

  19. Normal Vulvar Histology: Variation by Site.

    Science.gov (United States)

    Day, Tania; Holland, Seán M; Scurry, James

    2016-01-01

    The aim of the study was to assess the histology of normal vulvar skin with attention to anatomic location and epithelium type. We performed a retrospective histologic review of 118 vulvar biopsies and excisions obtained between 2010 and 2014 with adjacent normal skin or mucosa. Exclusions included age younger than 18 years, vestibulectomy, labiaplasty, inflammatory dermatoses, and insufficient normal tissue for assessment. Stratum corneum morphology was assessed as basket weave, compact, or intermediate. Stratum granulosum cell layer number and epithelial thickness were recorded. Dermal lymphocytic infiltrate was described as nil, sparse, moderate, or dense. Fischer exact test, Pearson χ, and Student t test were used for statistical analysis. There were 7 cases from mons pubis, 11 from perineum, 83 from labia, and 17 from vestibule. In the skin, the stratum corneum morphology was basket weave in 31%, compact in 35%, and intermediate in 34%. Stratum corneum at the mons pubis was uniformly basket weave, whereas at perineum, it was either compact or intermediate (7/7 vs 0/11; p histological findings. Pathologists need to be aware of site-related differences of the vulvar epithelium to avoid overdiagnosis of pathological conditions.

  20. Melanocytes in the skin--comparative whole transcriptome analysis of main skin cell types.

    Science.gov (United States)

    Reemann, Paula; Reimann, Ene; Ilmjärv, Sten; Porosaar, Orm; Silm, Helgi; Jaks, Viljar; Vasar, Eero; Kingo, Külli; Kõks, Sulev

    2014-01-01

    Melanocytes possess several functions besides a role in pigment synthesis, but detailed characteristics of the cells are still unclear. We used whole transcriptome sequencing (RNA-Seq) to assess differential gene expression of cultivated normal human melanocytes with respect to keratinocytes, fibroblasts and whole skin. The present results reveal cultivated melanocytes as highly proliferative cells with possible stem cell-like properties. The enhanced readiness to regenerate makes melanocytes the most vulnerable cells in the skin and explains their high risk of developing into malignant melanoma.

  1. Spiritual and religious aspects of skin and skin disorders

    Science.gov (United States)

    Shenefelt, Philip D; Shenefelt, Debrah A

    2014-01-01

    Skin and skin disorders have had spiritual aspects since ancient times. Skin, hair, and nails are visible to self and others, and touchable by self and others. The skin is a major sensory organ. Skin also expresses emotions detectable by others through pallor, coldness, “goose bumps”, redness, warmth, or sweating. Spiritual and religious significances of skin are revealed through how much of the skin has been and continues to be covered with what types of coverings, scalp and beard hair cutting, shaving and styling, skin, nail, and hair coloring and decorating, tattooing, and intentional scarring of skin. Persons with visible skin disorders have often been stigmatized or even treated as outcasts. Shamans and other spiritual and religious healers have brought about healing of skin disorders through spiritual means. Spiritual and religious interactions with various skin disorders such as psoriasis, leprosy, and vitiligo are discussed. Religious aspects of skin and skin diseases are evaluated for several major religions, with a special focus on Judaism, both conventional and kabbalistic. PMID:25120377

  2. [The role of sonic hedgehog pathway in skin carcinogenesis].

    Science.gov (United States)

    Lesiak, Aleksandra; Sysa-Jedrzejowska, Anna; Narbutt, Joanna

    2010-08-01

    Non melanoma skin cancers (NMSC) involving basal (BCC)--and squamosus cell carcinomas (SCC) and are the most frequent skin cancers in Caucasians. Ultraviolet radiation is the main environmental risk factor for NMSC development. The aim of this paper is to review the latest opinions concerning the role of sonic hedgehog pathway in non-melanoma skin cancers development. Experimental data indicate that sonic hedgehog pathway might be involved in skin carcinogenesis. Under physiological conditions sonic hedgehog pathway is responsible for normal embryogenesis, regeneration of damaged tissues and for regulation of cell proliferation. It was revealed that UVR caused inactivated mutation in PATCHED gene encoding Ptch1 protein. These events lead to deregulation of sonic hedgehog pathway trough activation of Smo protein and Gli transcriptional factors what stimulates cell proliferation and in consequence NMSC development. Literature data indicate that understanding of molecular background of skin cancers might be a reason for introduction of new therapeutic approaches including sonic hedgehog pathway inhibitors.

  3. How to Choose the Best Skin Care Products

    Science.gov (United States)

    ... Skin Scars Skin Growths Skin Lesions Spider Veins Stretch Marks Sun-damaged Skin Unwanted Hair Unwanted Tattoos Varicose ... Skin Scars Skin Growths Skin Lesions Spider Veins Stretch Marks Sun-damaged Skin Unwanted Hair Unwanted Tattoos Varicose ...

  4. Dynamics of two-component membranes surrounded by viscoelastic media.

    Science.gov (United States)

    Komura, Shigeyuki; Yasuda, Kento; Okamoto, Ryuichi

    2015-11-01

    We discuss the dynamics of two-component fluid membranes which are surrounded by viscoelastic media. We assume that membrane-embedded proteins can diffuse laterally and induce a local membrane curvature. The mean squared displacement of a tagged membrane segment is obtained as a generalized Einstein relation. When the elasticity of the surrounding media obeys a power-law behavior in frequency, an anomalous diffusion of the membrane segment is predicted. We also consider the situation where the proteins generate active non-equilibrium forces. The generalized Einstein relation is further modified by an effective temperature that depends on the force dipole energy. The obtained generalized Einstein relations are useful for membrane microrheology experiments.

  5. Study on Temperature Fieldof Surrounding Rock with BEM

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    The authors analyzed the characteristic of surrounding rock temperature field around a drifting face, setup its mathematic model, and got its numerical result with the boundary element method(BEM). To calculate in-tra-domain integral, it was transformed into boundary integration with the DRM method. Using the similitude the-ory, the dimensionless differential equation was educed. Finally, the authors calculated two drifting faces of San-hejian Coal Mine using the computer software developed by authors based on the above principium, and got the dis-tribution characteristic of surrounding rock temperature field around a drifting face and the periodic variation intemperature with its periodic moving forward. Comparing the calculated heat dissipating-capacity of surroundingrock with the measured data shows that the computer software is proper.

  6. Experimental Study of Deformation of Surrounding Rock with Infrared Radiation

    Institute of Scientific and Technical Information of China (English)

    ZHANG Yong-jun; AN Li-qian; REN Run-hou; FAN Shi-min; MA Nian-jie; LI Jian-hui; JI Yuan-ming

    2005-01-01

    According to the practical conditions of coal roadway in Changcun Coal Mine of Lu'an Mining Group, the deformation of rock surrounding roadway was experimentally studied by means of thermal infrared (TIR) imaging system in the process of confined compressions. It is found that the model surface TIR temperature (TIRT) changes with the increase of load. Furthermore, TIRT changes non-synchronously in different ranges such as the roof, floor, wall, corners and bolted ranges. The TIRT is higher in the location of stress concentration and bolted ranges than that in the location of stress relaxation and broken ranges. The interaction ranges of bolt and rock are determined preliminarily according to the corresponding relationship of TIRT fields and the strain fields of the surrounding rock. The new method of TIR image processing has been proved to be effective for the study of bolt support and observation of roadway stability under mine pressure.

  7. Traumatic degloving lesion of penile and scrotal skin

    Directory of Open Access Journals (Sweden)

    Luiz A. Zanettini

    2005-06-01

    Full Text Available Avulsions of penile and scrotal skin are uncommon events and are caused mainly by accidents with industrial machines and agricultural machine belts. We report the case of a 30-year old patient with avulsion and traumatic degloving of the penile and scrotal skin, with exposure of the cavernous bodies, spongy body, and testes due to an industrial machine accident. Reconstruction was performed in steps, achieving a satisfactory esthetic result, normal voiding and reestablished sexual function.

  8. High resolution bathymetry of China seas and their surroundings

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Based on the oceanic lithospheric flexure and the worldwide bathymetric data ETOPO5, the high resolu tion bathymetry of the China seas and their surroundings is computed from altimeter derived gravity anomalies. The new bathymetry obtained by this study is higher resolution and accuracy than the widely used ETOPO5 data, mean while it shows clearly the seafioor, the tectonic characteristics and the geodynamical processes in the China seas.

  9. Thermodynamic stability of black holes surrounded by quintessence

    OpenAIRE

    Ma, Meng-Sen; Zhao, Ren; Ma, Ya-Qin

    2016-01-01

    We study the thermodynamic stabilities of uncharged and charged black holes surrounded by quintessence (BHQ) by means of effective thermodynamic quantities. When the state parameter of quintessence $\\omega_q$ is appropriately chosen, the structures of BHQ are something like that of black holes in de Sitter space. Constructing the effective first law of thermodynamics in two different ways, we can derive the effective thermodynamic quantities of BHQ. Especially, these effective thermodynamic q...

  10. Hidden History: A Mobile Application for Discovering Surrounding Landscapes

    OpenAIRE

    2016-01-01

    This thesis work describes the design, development and evaluation of a mobile application called Hidden History. This application lets users discover and explore three types of landscapes (Historic, Scenic and Cultural) using three different modes of discovery (Route, Explore and Tour). Before designing Hidden History, the feature set of other applications that help users explore surrounding landscapes were identified and analyzed. Hidden History was then designed to implement the best fea...

  11. Treatment of Postherpetic Neuralgia by Surround Needling with Electric Stimulation

    Institute of Scientific and Technical Information of China (English)

    FAN Jin; YANG Qin-hua

    2005-01-01

    运用电针围刺法治疗带状疱疹后遗神经痛29例,获得较好疗效,总有效率为93.1%.%Twenty-nine cases of postherpetic neuralgia of herpes zoster were treated by the surround needling with electric stimulation, and the better therapeutic effect was obtained, the total effective rate was 93.1%.

  12. Belief and Attitudes surrounding Childhood Autism in Ghana

    OpenAIRE

    2012-01-01

    Autism is a life-long invisible impairment with an unknown etiology. Current literature shows an increase in the diagnosis of autism worldwide. This qualitative study explores the attitudes and beliefs which surround childhood autism in Ghana. In-depth interviews were conducted with four (4) parents whose children have autism and three (3) key informants; a Religious Leader, a Health Worker and an Administrator of a Special school in Accra, Ghana. A semi-structured interview guide was used fo...

  13. Extreme skin depth waveguides

    CERN Document Server

    Jahani, Saman

    2014-01-01

    Recently, we introduced a paradigm shift in light confinement strategy and introduced a class of extreme skin depth (e-skid) photonic structures (S. Jahani and Z. Jacob, "Transparent sub-diffraction optics: nanoscale light confinement without metal," Optica 1, 96-100 (2014)). Here, we analytically establish that figures of merit related to light confinement in dielectric waveguides are fundamentally tied to the skin depth of waves in the cladding. We contrast the propagation characteristics of the fundamental mode of e-skid waveguides and conventional waveguides to show that the decay constant in the cladding is dramatically larger in e-skid waveguides, which is the origin of sub-diffraction confinement. Finally, we propose an approach to verify the reduced skin depth in experiment using the decrease in the Goos-H\\"anchen phase shift.

  14. Skin Cancer Detection

    Directory of Open Access Journals (Sweden)

    N. Durga Rao

    2016-06-01

    Full Text Available : In recent days, skin cancer is seen as one of the most Hazardous form of the Cancers found in Humans. Skin cancer is found in various types such as Melanoma, Basal and Squamous cell Carcinoma among which Melanoma is the most unpredictable. The detection of Melanoma cancer in early stage can be helpful to cure it. Computer vision can play important role in Medical Image Diagnosis and it has been proved by many existing systems. In this paper, we present a survey on different steps which are being to detect the Melanoma Skin Cancer using Image Processing tools. In every step, what are the different methods are be included in our paper

  15. Smoking and skin disease.

    Science.gov (United States)

    Thomsen, S F; Sørensen, L T

    2010-06-01

    Tobacco smoking is a serious and preventable health hazard that can cause or exacerbate a number of diseases and shorten life expectancy, but the role of smoking as an etiologic factor in the development of skin disease is largely unknown. Although epidemiological evidence is sparse, findings suggest that tobacco smoking is a contributing factor in systemic lupus erythematosus, psoriasis, palmoplantar pustulosis, cutaneous squamous cell carcinoma, hidradenitis suppurativa, and genital warts. In contrast, smoking may confer some protective effects and mitigate other skin diseases, notably pemphigus vulgaris, pyoderma gangrenosum, aphthous ulcers, and Behçet's disease. Various degenerative dermatologic conditions are also impacted by smoking, such as skin wrinkling and dysregulated wound healing, which can result in post-surgical complications and delayed or even arrested healing of chronic wounds. Most likely, alteration of inflammatory cell function and extracellular matrix turnover caused by smoking-induced oxidative stress are involved in the pathophysiologic mechanisms.

  16. Sprayed skin turbine component

    Science.gov (United States)

    Allen, David B

    2013-06-04

    Fabricating a turbine component (50) by casting a core structure (30), forming an array of pits (24) in an outer surface (32) of the core structure, depositing a transient liquid phase (TLP) material (40) on the outer surface of the core structure, the TLP containing a melting-point depressant, depositing a skin (42) on the outer surface of the core structure over the TLP material, and heating the assembly, thus forming both a diffusion bond and a mechanical interlock between the skin and the core structure. The heating diffuses the melting-point depressant away from the interface. Subsurface cooling channels (35) may be formed by forming grooves (34) in the outer surface of the core structure, filling the grooves with a fugitive filler (36), depositing and bonding the skin (42), then removing the fugitive material.

  17. Smoking and skin disease

    DEFF Research Database (Denmark)

    Thomsen, S F; Sørensen, L T

    2010-01-01

    Tobacco smoking is a serious and preventable health hazard that can cause or exacerbate a number of diseases and shorten life expectancy, but the role of smoking as an etiologic factor in the development of skin disease is largely unknown. Although epidemiological evidence is sparse, findings...... suggest that tobacco smoking is a contributing factor in systemic lupus erythematosus, psoriasis, palmoplantar pustulosis, cutaneous squamous cell carcinoma, hidradenitis suppurativa, and genital warts. In contrast, smoking may confer some protective effects and mitigate other skin diseases, notably...... pemphigus vulgaris, pyoderma gangrenosum, aphthous ulcers, and Behçet's disease. Various degenerative dermatologic conditions are also impacted by smoking, such as skin wrinkling and dysregulated wound healing, which can result in post-surgical complications and delayed or even arrested healing of chronic...

  18. A permeability barrier surrounds taste buds in lingual epithelia.

    Science.gov (United States)

    Dando, Robin; Pereira, Elizabeth; Kurian, Mani; Barro-Soria, Rene; Chaudhari, Nirupa; Roper, Stephen D

    2015-01-01

    Epithelial tissues are characterized by specialized cell-cell junctions, typically localized to the apical regions of cells. These junctions are formed by interacting membrane proteins and by cytoskeletal and extracellular matrix components. Within the lingual epithelium, tight junctions join the apical tips of the gustatory sensory cells in taste buds. These junctions constitute a selective barrier that limits penetration of chemosensory stimuli into taste buds (Michlig et al. J Comp Neurol 502: 1003-1011, 2007). We tested the ability of chemical compounds to permeate into sensory end organs in the lingual epithelium. Our findings reveal a robust barrier that surrounds the entire body of taste buds, not limited to the apical tight junctions. This barrier prevents penetration of many, but not all, compounds, whether they are applied topically, injected into the parenchyma of the tongue, or circulating in the blood supply, into taste buds. Enzymatic treatments indicate that this barrier likely includes glycosaminoglycans, as it was disrupted by chondroitinase but, less effectively, by proteases. The barrier surrounding taste buds could also be disrupted by brief treatment of lingual tissue samples with DMSO. Brief exposure of lingual slices to DMSO did not affect the ability of taste buds within the slice to respond to chemical stimulation. The existence of a highly impermeable barrier surrounding taste buds and methods to break through this barrier may be relevant to basic research and to clinical treatments of taste.

  19. THE DESIGN OF DYNAMIC SIMULATION SYSTEM ON EARTHQUAKE SURROUNDINGS

    Institute of Scientific and Technical Information of China (English)

    沈毅力; 杨云; 李天石

    2003-01-01

    Objective To design a system that can simulate earthquake surroundings. In the surroundings, people can be familiar with the omen, strong shock and aftershock of earthquake, thus make right choices and get away when the disaster occurs. Methods The system consists of an electro-hydraulic servo system, a whole-information sound system and some lighting device; By using the adaptive inverse control method and LMS algorithms, the inverse model (I.e. The controller) is convergent rapidly; The software based on LabVIEW makes the parameters can be modified easily; There is a double closed-loop structure in the system: an analog closed-loop and a digital closed-loop, and their parameters can be inspected in real time. Results The system is of very high reliability, and the desired vibration signal can be tracked exactly by output. Conclusion Earthquake surroundings is simulated vividly. Through the system, people can be familiar with earthquake phenomena, and know lots of knowledge of earthquake.

  20. Tissue reaction surrounding miniscrews for orthodontic anchorage: An animal experiment

    Directory of Open Access Journals (Sweden)

    Stephanie Shih-Hsuan Chen

    2012-03-01

    Results and conclusions: (1 Tissue surrounding roots damaged by a miniscrew showed a significant inflammatory response. (2 Root resorption was occasionally observed after 3 weeks following insertion of a miniscrew even if the miniscrew was not in direct contact with the root. (3 Root repair was noted with a cementoblast lining along the resorption surface at as early as 3 weeks after miniscrew insertion. Alveolar bone filled in the lesion when the root damage was large so that the contour of the alveolar bone followed that of the damaged root, with the width of the periodontal ligament space being maintained. (4 Stable miniscrews were mainly those which did not contact adjacent roots, and for which the surrounding tissue showed only a small inflammatory response with some extent of direct bone contact around the miniscrew. On the contrary, most of the failed miniscrews were those which had direct contact with adjacent roots, and which exhibited severe tissue inflammation and were covered by thick layers of soft tissue. Failure was detected 3 weeks after insertion. Surprisingly, the epithelial lining surrounding the miniscrews might not have spontaneously resolved 6 weeks after screw removal. Persistent infection in the sinus tract was noted, and this would require attention.

  1. Dissipation of Impact Stress Waves within the Artificial Blasting Damage Zone in the Surrounding Rocks of Deep Roadway

    Directory of Open Access Journals (Sweden)

    Jianguo Ning

    2016-01-01

    Full Text Available Artificial explosions are commonly used to prevent rockburst in deep roadways. However, the dissipation of the impact stress wave within the artificial blasting damage zone (ABDZ of the rocks surrounding a deep roadway has not yet been clarified. The surrounding rocks were divided into the elastic zone, blasting damage zone, plastic zone, and anchorage zone in this research. Meanwhile, the ABDZ was divided into the pulverizing area, fractured area, and cracked area from the inside out. Besides, the model of the normal incidence of the impact stress waves in the ABDZ was established; the attenuation coefficient of the amplitude of the impact stress waves was obtained after it passed through the intact rock mass, and ABDZ, to the anchorage zone. In addition, a numerical simulation was used to study the dynamic response of the vertical stress and impact-induced vibration energy in the surrounding rocks. By doing so, the dissipation of the impact stress waves within the ABDZ of the surrounding rocks was revealed. As demonstrated in the field application, the establishment of the ABDZ in the surrounding rocks reduced the effect of the impact-induced vibration energy on the anchorage support system of the roadway.

  2. Laser system for optical biopsy and in-vivo study of the human skin

    Science.gov (United States)

    Borisova, Ekaterina G.; Avramov, Lachezar A.

    2001-04-01

    The aim of this study was to perform a preliminary evaluation of the diagnostic potential of noninvasive laser-induced autofluorescence spectroscopy (LIAFS) for human skin in vivo. The autofluorescence characterization of tissue relies on different spectral properties of tissue. It was demonstrated a differentiation between normal skin and skin with vitaligo. In our experimental investigation of the autofluorescence spectrum of human skin in vivo a nitrogen laser with excitation wavelength 337 nm was used. Two fluorescence bands were observed at 440 and 490 nm, these were attributed to reduced nicotinamide adenine dinucleotide (NADH) and collagen. The intensity of the NADH emission band was markedly reduced in the skin with vitaligo compared with the normal skin, which could indicate different redox conditions in skin with vitaligo. The autofluorescence spectrum of human skin depends on the main internal absorbers, which are blood and melanin. In this study was described the effect caused by melanin content on the shape of the autofluorescence spectrum of human skin. Human skin fluorescence spectrum might provide dermatologists with important information and such investigations are successfully used now in skin disease diagnostics, in investigation of the environmental factor impact or for evaluation of treatment efficiency. The goal of this work is optimization of detection and diagnosis of hollow organs and skin.

  3. Skin Temperature Measurement

    OpenAIRE

    Sarjoghian, Siamak

    2017-01-01

    This report represents the design and implementation of a skin temperature measurement system. The system aims to measure the skin temperature from a sensor and send it to the PC using a USB cable to display on screen. The data needs to be updated every second. The PIC18F4550 microcontroller has been used in this project to obtain data from the sensor and send it to the PC using USB 2.0 that has been built into the microcontroller. The microcontroller has a 10-bit Analog Digital Converting ac...

  4. Skin innate immune system

    Directory of Open Access Journals (Sweden)

    Berna Aksoy

    2013-06-01

    Full Text Available All multicellular organisms protect themselves from external universe and microorganisms by innate immune sytem that is constitutively present. Skin innate immune system has several different components composed of epithelial barriers, humoral factors and cellular part. In this review information about skin innate immune system and its components are presented to the reader. Innate immunity, which wasn’t adequately interested in previously, is proven to provide a powerfull early protection system, control many infections before the acquired immunity starts and directs acquired immunity to develop optimally

  5. Study of surfactant-skin interactions by skin impedance measurements.

    Science.gov (United States)

    Lu, Guojin; Moore, David J

    2012-02-01

    The stratum corneum (SC) plays a very critical physiological role as skin barrier in regulating water loss through the skin and protects the body from a wide range of physical and chemical exogenous insults. Surfactant-containing formulations can induce skin damage and irritation owing to surfactant absorption and penetration. It is generally accepted that reduction in skin barrier properties occurs only after surfactants have penetrated/permeated into the skin barrier. To mitigate the harshness of surfactant-based cleansing products, penetration/permeation of surfactants should be reduced. Skin impedance measurements have been taken in vitro on porcine skin using vertical Franz diffusion cells to investigate the impact of surfactants, temperature and pH on skin barrier integrity. These skin impedance results demonstrate excellent correlation with other published methods for assessing skin damage and irritation from different surfactant chemistry, concentration, pH, time of exposure and temperature. This study demonstrates that skin impedance can be utilized as a routine approach to screen surfactant-containing formulations for their propensity to compromise the skin barrier and hence likely lead to skin irritation.

  6. THE ROLE OF UDVARTHANA ON SKIN HEALTH

    Directory of Open Access Journals (Sweden)

    Shital O. Chavan

    2013-06-01

    Full Text Available Approaching towards modern life style, every person is conscious about his/her look and using number of cosmetics which are made up of chemicals and freely available in market to make their skin looks beautiful without knowing the consequence produced by chemical (Cosmetics on the skin. To prevent such complication and to increase the beauty of one’s facial look, we selected one of the ancient techniques of daily routine Udvarthana as a subject research to know the effect of Udwartana on skin health according to Samhita’s as per modern life. Face is mirror, which perhaps reflects our individuality from others. Our face is a part of attraction and gives the image of our fitness hence application of Udvartana is done only on face. The results were assessed on manifestation of improvement in skin health, such as symptomatic changes after application. 30 normal individuals of age group 16-30 years were recruited in trial. Sample were assessed and evaluated on the basis of subjective parameters at interval of 15 days for two months. Selection of drugs for Udvarthana was done from Varnadi Gana in Astanga Sangraha Sutrasthana 15/88. Fine powder of drug was mixed with plain water and applied on face till gets dried before bath. There were significant changes in symptomatically criteria when calculated by Willcoxan’s5 test. We got significant result in symptoms of facial skin in experimental group after two month i.e. p<0.05. The finding suggests that Udvarthana is an effective, safe, easy way for healthy skin.

  7. ATF3 activates Stat3 phosphorylation through inhibition of p53 expression in skin cancer cells.

    Science.gov (United States)

    Hao, Zhen-Feng; Ao, Jun-Hong; Zhang, Jie; Su, You-Ming; Yang, Rong-Ya

    2013-01-01

    ATF3, a member of the ATF/CREB family of transcription factors, has been found to be selectively induced by calcineurin/NFAT inhibition and to enhance keratinocyte tumor formation, although the precise role of ATF3 in human skin cancer and possible mechanisms remain unknown. In this study, clinical analysis of 30 skin cancer patients and 30 normal donors revealed that ATF3 was accumulated in skin cancer tissues. Functional assays demonstrated that ATF3 significantly promoted skin cancer cell proliferation. Mechanically, ATF3 activated Stat3 phosphorylation in skin cancer cell through regulation of p53 expression. Moreover, the promotion effect of ATF3 on skin cancer cell proliferation was dependent on the p53-Stat3 signaling cascade. Together, the results indicate that ATF3 might promote skin cancer cell proliferation and enhance skin keratinocyte tumor development through inhibiting p53 expression and then activating Stat3 phosphorylation.

  8. About Skin-to-Skin Care (Kangaroo Care)

    Science.gov (United States)

    ... Size Email Print Share About Skin-to-Skin Care Page Content Article Body You may be able ... care, also called kangaroo care. What is Kangaroo Care? Kangaroo care was developed in South America as ...

  9. "Ser diferente é normal?"/"Being different: is it normal?"

    Directory of Open Access Journals (Sweden)

    Viviane Veras

    2007-01-01

    Full Text Available A pergunta título deste trabalho retoma o slogan “Ser diferente é normal”, que é parte da campanha criada para uma organização não-governamental que atende portadores de Síndrome de Down. O objetivo é a inclusão social da pessoa com deficiência e o primeiro passo foi propor a inclusão de um grupo de diferentes no grupo dito normal. No vídeo de lançamento da campanha, o diferente, identificado como normal, é mostrado por meio de exemplos – um negro com cabelo black-power, um skin-head, um corpo tatuado, um corpo feminino halterofílico, uma família hippie, uma garota com síndrome de Down. A visão da adolescente dançando reduz, de certo modo, o efeito imaginário que vai além da síndrome, uma vez que apenas o corpo com seus olhinhos puxados se destacam, e não se interrogam questões cognitivas. Minha proposta é refletir sobre o estatuto paradoxal do exemplo, tal como é trabalhado nesse vídeo: se, por definição, um exemplo mostra de fato seu pertencimento a uma classe, pode-se concluir que é exatamente por ser exemplar que ele se encontra fora dela, no exato momento em que a exibe e define. The question in the title of this paper refers to the slogan "ser diferente é normal" ("It´s normal to be different", which is part of a campaign created for a NGO that supports people with Down syndrome. The objective of the campaign is to promote the social inclusion of individuals with Down syndrome, and the first step was to propose the inclusion of a group of "differents" in the so-called normal group. The film launching the campaign shows the different identified as normal by means of examples: a black man exhibiting blackpower haircut, a skin-head, a tattooed body, an over-athletic female body, a hippie family and a girl with Down syndrome. The vision of the dancing teenager lessens the imaginary effect that surpasses the syndrome, since only her body and her little oriental eyes stand out and no cognitive issues are

  10. CCR3 is essential for skin eosinophilia and airway hyperresponsiveness in a murine model of allergic skin inflammation.

    Science.gov (United States)

    Ma, Weilie; Bryce, Paul J; Humbles, Alison A; Laouini, Dhafer; Yalcindag, Ali; Alenius, Harri; Friend, Daniel S; Oettgen, Hans C; Gerard, Craig; Geha, Raif S

    2002-03-01

    The CC chemokine receptor 3 (CCR3) is expressed by eosinophils, mast cells, and Th2 cells. We used CCR3(-/-) mice to assess the role of CCR3 in a murine model of allergic skin inflammation induced by repeated epicutaneous sensitization with ovalbumin (OVA), and characterized by eosinophil skin infiltration, local expression of Th2 cytokines, and airway hyperresponsiveness (AHR) to inhaled antigen. Eosinophils and the eosinophil product major basic protein were absent from the skin of sham and OVA-sensitized CCR3(-/-) mice. Mast cell numbers and expression of IL-4 mRNA were normal in skin of CCR3(-/-) mice, suggesting that CCR3 is not important for infiltration of the skin by mast cells and Th2 cells. CCR3(-/-) mice produced normal levels of OVA-specific IgE, and their splenocytes secreted normal amounts of IL-4 and IL-5 following in vitro stimulation with OVA, indicating effective generation of systemic Th2 helper responses. Recruitment of eosinophils to lung parenchyma and bronchoalveolar lavage (BAL) fluid was severely impaired in CCR3(-/-) mice, which failed to develop AHR to methacholine following antigen inhalation. These results suggest that CCR3 plays an essential role in eosinophil recruitment to the skin and the lung and in the development of AHR.

  11. Phenotypic changes of p53, HER2, and FAS system in multiple normal tissues surrounding breast cancer.

    Science.gov (United States)

    Mottolese, Marcella; Nádasi, Edit A; Botti, Claudio; Cianciulli, Anna M; Merola, Roberta; Buglioni, Simonetta; Benevolo, Maria; Giannarelli, Diana; Marandino, Ferdinando; Donnorso, Raffaele Perrone; Venturo, Irene; Natali, Pier Giorgio

    2005-07-01

    To determine whether phenotypic field changes occur in tissues adjacent to carcinoma, we assayed, by immunohistochemistry, the expression of HER-2, p53, Fas, and FasL in 72 breast cancers (BC) and multiple autologous peritumoral tissues (PTTs) sampled up to 5 cm distance and in 44 benign breast tumors (BBTs). About 5% and 3% of the PTTs and 4.5% and 6.8% of BBTs showed alterations in HER2 and p53 expression, respectively. Of interest, gene amplification was observed in 50% of HER2 positive PTTs, but not in any HER2 positive BBTs. Fas, highly expressed in BBTs and downregulated in BC, maintained its expression in PTTs, whereas FasL, usually negative in BBTs, was upregulated in BC as well as in the PTTs closest (1 cm) to the invasive lesion. Our data suggest that FasL could be a potential novel biomarker of transformation, which may identify, along with HER2 and p53, precursor lesions in a genetically altered breast tissue.

  12. Insight into the immunobiology of human skin and functional specialization of skin dendritic cell subsets to innovate intradermal vaccination design.

    Science.gov (United States)

    Teunissen, M B M; Haniffa, M; Collin, M P

    2012-01-01

    Dendritic cells (DC) are the key initiators and regulators of any immune response which determine the outcome of CD4(+) and CD8(+) T-cell responses. Multiple distinct DC subsets can be distinguished by location, phenotype, and function in the homeostatic and inflamed human skin. The function of steady-state cutaneous DCs or recruited inflammatory DCs is influenced by the surrounding cellular and extracellular skin microenvironment. The skin is an attractive site for vaccination given the extended local network of DCs and the easy access to the skin-draining lymph nodes to generate effector T cells and immunoglobulin-producing B cells for long-term protective immunity. In the context of intradermal vaccination we describe in this review the skin-associated immune system, the characteristics of the different skin DC subsets, the mechanism of antigen uptake and presentation, and how the properties of DCs can be manipulated. This knowledge is critical for the development of intradermal vaccine strategies and supports the concept of intradermal vaccination as a superior route to the conventional intramuscular or subcutaneous methods.

  13. Haemodynamics and viability of skin and muscle flaps

    Energy Technology Data Exchange (ETDEWEB)

    Clarke, H.M.

    1985-01-01

    In reconstructive surgery, occasional free flap failures occur despite the clinical and technical advances in microsurgery of the past few years. To minimize these losses a better understanding of basic flap physiology must be achieved. The objectives of this work were the investigation of the haemodynamic characteristics of skin and muscle flaps in normal and compromised circumstances, the viability of skin and muscle flaps after pedicle ligation or ischaemia, and the possible interrelationship of haemodynamics and viability. A Wistar rat groin island skin flap model was used to assess flap survival following vascular compromise produced by vessel ligation. Survival was seen earliest following loss of the artery and was not dependent on circulation through the vascular pedicle after 5 days. A study using free groin flaps in rats gave similar results. Normal free groin flaps were then transferred to irradiated Fischer F344 rats. Delayed neovascularization was shown at a time corresponding to the onset of the late phase of the response to skin radiation. A canine inferior epigastric free skin flap model was established to determine the normal haemodynamic parameters during free flap transfer. A canine gracilis free muscle flap model was developed. Normal haemodynamic parameters are given. These parameters were examined after ischaemia. Survival of the muscle followed ischaemia of 4 hours or less. Flap survival is not dependent solely on arterial input or venous drainage. More complex phenomena such as the reactive hyperaemia following ischaemia are implicated in survival.

  14. Allergy Skin Tests

    Science.gov (United States)

    ... once. This test is usually done to identify allergies to pollen, mold, pet dander, dust mites and foods. In adults, the test is usually done on the forearm. Children may be tested on the upper back. Allergy skin tests aren't painful. This type of ...

  15. Preventing Skin Cancer

    Centers for Disease Control (CDC) Podcasts

    2016-05-18

    A man and a woman talk about how they’ve learned to protect their skin from the sun over the years. .  Created: 5/18/2016 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 5/18/2016.

  16. Skin-reducing mastectomy.

    Science.gov (United States)

    Nava, Maurizio B; Cortinovis, Umberto; Ottolenghi, Joseph; Riggio, Egidio; Pennati, Angela; Catanuto, Giuseppe; Greco, Marco; Rovere, Guidubaldo Querci Della

    2006-09-01

    The authors propose a combined flap technique to reconstruct large and medium-sized ptotic breasts in a single-stage operation by use of anatomical permanent implants. The authors enrolled 28 patients fulfilling criteria for skin-sparing mastectomy and presenting with ptotic breasts whose areola-to-inframammary fold distance was more than 8 cm. All reconstructions were performed as a single-stage procedure. After preoperative planning, a large area in the lower half of the breast was deepithelialized according to the conventional Wise pattern. Mastectomy was then carried out. To perform reconstructions, the inferomedial fibers of the pectoralis major muscle were dissected and sutured to the superior border of the inferior dermal flap. An anatomical implant was then inserted into the pouch, which was closed laterally with the previously harvested serratus anterior fascia. Skin flaps were finally closed down to the inframammary fold. The authors performed 30 procedures on 28 patients. The medium size anatomical implants was 433 cc. Twelve women achieved symmetrization in a single stage ending in a symmetric inverted-T scar. The overall complication rate was 20 percent, with four cases (13 percent) complicated by severe, extensive necrosis of the skin flaps requiring implant removal. Breast cancer treatment must nowadays optimize cosmetic results. This can be accomplished in selected cases by means of a single-stage operation that the authors call "skin-reducing mastectomy." The final scars imitate those of cosmetic surgery. Careful patient selection and improvement in the learning curve may reduce the complication rate.

  17. Tuberculin Skin Testing

    Science.gov (United States)

    ... Guidance for XDR Mycobacterium tuberculosis strains Data & Statistics Trends in Tuberculosis, 2015 TB Incidence in the United ... No. RR-17). CDC. Mantoux Tuberculin Skin Test: Training Materials Kit (2003). CDC. Targeted tuberculin testing and treatment of latent tuberculosis infection . MMWR 2000; 49 (No. ... CDC Jobs Funding LEGAL Policies Privacy FOIA No Fear Act ...

  18. Frog skin function revisited

    DEFF Research Database (Denmark)

    Hviid Larsen, Erik; Ramløv, Hans

    2013-01-01

    of the epidermis. These mechanisms have evolved pari passu with life alternating between aquatic and terrestrial habitats associated with permeabilities of the skin controlled by external ion- and osmotic concentrations (loc. cit.). This allows for fast switching of the cutaneous uptake of chloride between active...

  19. Cryoglobulin induced skin ulceration

    Directory of Open Access Journals (Sweden)

    Fatima Razvi

    2015-01-01

    Full Text Available Lupus Erythematosus (LE is a multi-organ auto-immune disease which results from complex interaction of genetic and environmental factors. The clinical spectrum ranges from minor cutaneous lesions to life threatening multi-organ dysfunction. The skin manifestations are variable and common and range from LE specific to LE non-specific cutaneous disease. Vasculitis is one of the most common non-specific skin lesion of Systemic lupus erythematosus (SLE and appears as purpuric lesions, infarcts along lateral nail folds, peripheral gangrene, sub-cutaneous nodules and ulcers. Mixed cryoglobulinaemia (type II is associated with connective tissue disorders including SLE. Skin manifestations are seen in 60-100% patients and are more common in females. The most common manifestation is palpable purpura of lower extremities seen in 30-100% which often is triggered in winter or on cold exposure. Skin infarction, hemorrhagic crusts and ulcers are seen in 25% of patients. Wide spread necrotic ulcers are seen in 10-25% of patients which are often exacerbated by cold.

  20. Skin Conditions during Pregnancy

    Science.gov (United States)

    ... appear on the skin during pregnancy? • What are stretch marks? • Is acne common during pregnancy? • How can I ... runs from the navel to the pubic hair • Stretch marks •Acne • Spider veins • Varicose veins • Changes in nail ...

  1. Biophysical basis for noninvasive skin cancer detection using Raman spectroscopy

    Science.gov (United States)

    Feng, Xu; Moy, Austin J.; Markey, Mia K.; Fox, Matthew C.; Reichenberg, Jason S.; Tunnell, James W.

    2016-03-01

    Raman spectroscopy (RS) is proving to be a valuable tool for real time noninvasive skin cancer detection via optical fiber probe. However, current methods utilizing RS for skin cancer diagnosis rely on statistically based algorithms to provide tissue classification and do not elucidate the underlying biophysical changes of skin tissue. Therefore, we aim to use RS to explore skin biochemical and structural characteristics and then correlate the Raman spectrum of skin tissue with its disease state. We have built a custom confocal micro-Raman spectrometer system with an 830nm laser light. The high resolution capability of the system allows us to measure spectroscopic features from individual tissue components in situ. Raman images were collected from human skin samples from Mohs surgical biopsy, which were then compared with confocal laser scanning, two-photon fluorescence and hematoxylin and eosin-stained images to develop a linear model of skin tissue Raman spectra. In this model, macroscopic tissue spectra obtained from RS fiber probe were fit into a linear combination of individual basis spectra of primary skin constituents. The fit coefficient of the model explains the biophysical changes spanning a range of normal and various disease states. The model allows for determining parameters similar to that a pathologist is familiar reading and will be a significant guidance in developing RS diagnostic decision schemes.

  2. Impact of prebiotics and probiotics on skin health.

    Science.gov (United States)

    Al-Ghazzewi, F H; Tester, R F

    2014-06-01

    This review discusses the role of pre- and probiotics with respect to improving skin health by modulating the cutaneous microbiota. The skin ecosystem is a complex environment covered with a diverse microbiota community. These are classified as either transient or resident, where some are considered as beneficial, some essentially neutral and others pathogenic or at least have the capacity to be pathogenic. Colonisation varies between different parts of the body due to different environmental factors. Pre- and probiotic beneficial effects can be delivered topically or systemically (by ingestion). The pre- and probiotics have the capacity to optimise, maintain and restore the microbiota of the skin in different ways. Topical applications of probiotic bacteria have a direct effect at the site of application by enhancing the skin natural defence barriers. Probiotics as well as resident bacteria can produce antimicrobial peptides that benefit cutaneous immune responses and eliminate pathogens. In cosmetic formulations, prebiotics can be applied to the skin microbiota directly and increase selectively the activity and growth of beneficial 'normal' skin microbiota. Little is known about the efficacy of topically applied prebiotics. Nutritional products containing prebiotics and/or probiotics have a positive effect on skin by modulating the immune system and by providing therapeutic benefits for atopic diseases. This review underlines the potential use of pre- and probiotics for skin health.

  3. [Reconstruction of combined skin and bilateral artey defects at palmar side of fingers by free posterior interrosseous artery flap in a bridge fashion].

    Science.gov (United States)

    Xu, Bao-cheng; Liang, Gang; Chen, Fu-sheng

    2012-05-01

    To investigate the feasibility and therapeutic effect of free posterior interrosseous artery flap in a bridge fashion for combined skin and bilateral artery defects at palmar side of fingers. 6 cases with combined skin and bilateral artery defects at palmar side of fingers were treated with long-pedicled free posterior interrosseous artery flap in a bridge fashion. The flap size ranged from 3.5 cm x 2.0 cm to 6.5 em x 3.0 cm. The wounds at donor sites were closed directly. All the 6 flaps survived completely without any complication, and the wounds healed primarily. The blood supply and vein drainage in all the 6 fingers were normal. 4 cases were followed up for 1-12 months (average, 7 months). Satisfactory cosmetic and functional results were achieved. The flaps looked a little bit thicker than the surrounding tissue. The long-pedicled free posterior interrosseous artery flap in a bridge fashion is a good option for reconstruction of the combined skin and bilateral artery defects at palmar side of fingers in one stage.

  4. Skin color independent assessment of aging using skin autofluorescence

    NARCIS (Netherlands)

    Koetsier, M.; Nur, E.; Chunmao, H.; Lutgers, H.L.; Links, T.P.; Smit, A.J.; Rakhorst, G.; de Graaff, R.

    2010-01-01

    Skin autofluorescence (AF) for the non-invasive assessment of the amount of accumulated tissue Advanced Glycation Endproducts (AGEs) increases with aging. In subjects with darker skin colors, measurements typically result in lower AF values than in subjects with fair skin colors, e. g. due to select

  5. Skin color independent assessment of aging using skin autofluorescence

    NARCIS (Netherlands)

    Koetsier, M.; Nur, E.; Chunmao, H.; Lutgers, H.L.; Links, T.P.; Smit, A.J.; Rakhorst, G.; de Graaff, R.

    2010-01-01

    Skin autofluorescence (AF) for the non-invasive assessment of the amount of accumulated tissue Advanced Glycation Endproducts (AGEs) increases with aging. In subjects with darker skin colors, measurements typically result in lower AF values than in subjects with fair skin colors, e. g. due to

  6. Skin tissue engineering.

    Science.gov (United States)

    Mansbridge, Jonathan

    2008-01-01

    The major applications of tissue-engineered skin substitutes are in promoting the healing of acute and chronic wounds. Several approaches have been taken by commercial companies to develop products to address these conditions. Skin substitutes include both acellular and cellular devices. While acellular skin substitutes act as a template for dermal formation, this discussion mainly covers cellular devices. In addressing therapeutic applications in tissue engineering generally, a valuable precursor is an understanding of the mechanism of the underlying pathology. While this is straightforward in many cases, it has not been available for wound healing. Investigation of the mode of action of the tissue-engineered skin substitutes has led to considerable insight into the mechanism of formation, maintenance and treatment of chronic wounds. Four aspects mediating healing are considered here for their mechanism of action: (i) colonization of the wound bed by live fibroblasts in the implant, (ii) the secretion of growth factors, (iii) provision of a suitable substrate for cell migration, particularly keratinocytes and immune cells, and (iv) modification of the immune system by secretion of neutrophil recruiting chemokines. An early event in acute wound healing is an influx of neutrophils that destroy planktonic bacteria. However, if the bacteria are able to form biofilm, they become resistant to neutrophil action and prevent reepithelialization. In this situation the wound becomes chronic. In chronic wounds, fibroblasts show a senescence-like phenotype with decreased secretion of neutrophil chemoattractants that make it more likely that biofilms become established. Treatment of the chronic wounds involves debridement to eliminate biofilm, and the use of antimicrobials. A role of skin substitutes is to provide non-senescent fibroblasts that attract and activate neutrophils to prevent biofilm re-establishment. The emphasis of the conclusion is the importance of preventing

  7. INTERACTIONS OF THE INFRARED BUBBLE N4 WITH ITS SURROUNDINGS

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Hong-Li; Li, Jin-Zeng; Yuan, Jing-Hua; Huang, Maohai; Huang, Ya-Fang; Zhang, Si-Ju [National Astronomical Observatories, Chinese Academy of Sciences, 20A Datun Road, Chaoyang District, Beijing 100012 (China); Wu, Yuefang [Department of Astronomy, Peking University, 100871 Beijing (China); Liu, Tie [Korea Astronomy and Space Science Institute 776, Daedeokdae-ro, Yuseong-gu, Daejeon, 305-348 (Korea, Republic of); Dubner, G.; Paron, S.; Ortega, M. E. [1Instituto de Astronomía y Física del Espacio (IAFE, CONICET-UBA), CC 67, Suc. 28, 1428 Buenos Aires (Argentina); Molinari, Sergio [Istituto di Astrofisica e Planetologia Spaziali—IAPS, Istituto Nazionale di Astrofisica—INAF, via Fosso del Cavaliere 100, I-00133 Roma (Italy); Zavagno, Annie; Samal, Manash R., E-mail: hlliu@nao.cas.cn [Aix Marseille Universit, CNRS, LAM (Laboratoire d’Astrophysique de Marseille) UMR 7326, F-13388, Marseille (France)

    2016-02-10

    The physical mechanisms that induce the transformation of a certain mass of gas in new stars are far from being well understood. Infrared bubbles associated with H ii regions have been considered to be good samples for investigating triggered star formation. In this paper we report on the investigation of the dust properties of the infrared bubble N4 around the H ii region G11.898+0.747, analyzing its interaction with its surroundings and star formation histories therein, with the aim of determining the possibility of star formation triggered by the expansion of the bubble. Using Herschel PACS and SPIRE images with a wide wavelength coverage, we reveal the dust properties over the entire bubble. Meanwhile, we are able to identify six dust clumps surrounding the bubble, with a mean size of 0.50 pc, temperature of about 22 K, mean column density of 1.7 × 10{sup 22} cm{sup −2}, mean volume density of about 4.4 × 10{sup 4} cm{sup −3}, and a mean mass of 320 M{sub ⊙}. In addition, from PAH emission seen at 8 μm, free–free emission detected at 20 cm, and a probability density function in special regions, we could identify clear signatures of the influence of the H ii region on the surroundings. There are hints of star formation, though further investigation is required to demonstrate that N4 is the triggering source.

  8. On the environment surrounding close-in exoplanets

    Science.gov (United States)

    Vidotto, A. A.; Fares, R.; Jardine, M.; Moutou, C.; Donati, J.-F.

    2015-06-01

    Exoplanets in extremely close-in orbits are immersed in a local interplanetary medium (i.e. the stellar wind) much denser than the local conditions encountered around the Solar system planets. The environment surrounding these exoplanets also differs in terms of dynamics (slower stellar winds, but higher Keplerian velocities) and ambient magnetic fields (likely higher for host stars more active than the Sun). Here, we quantitatively investigate the nature of the interplanetary media surrounding the hot Jupiters HD 46375b, HD 73256b, HD 102195b, HD 130322b and HD 179949b. We simulate the three-dimensional winds of their host stars, in which we directly incorporate their observed surface magnetic fields. With that, we derive mass-loss rates (1.9-8.0 × 10-13 M⊙ yr-1) and the wind properties at the position of the hot Jupiters' orbits (temperature, velocity, magnetic field intensity and pressure). We show that these exoplanets' orbits are supermagnetosonic, indicating that bow shocks are formed surrounding these planets. Assuming planetary magnetic fields similar to Jupiter's, we estimate planetary magnetospheric sizes of 4.1-5.6 planetary radii. We also derive the exoplanetary radio emission released in the dissipation of the stellar wind energy. We find radio fluxes ranging from 0.02 to 0.13 mJy, which are challenging to be observed with present-day technology, but could be detectable with future higher sensitivity arrays (e.g. Square Kilometre Array). Radio emission from systems having closer hot Jupiters, such as from τ Boo b or HD 189733b, or from nearby planetary systems orbiting young stars, are likely to have higher radio fluxes, presenting better prospects for detecting exoplanetary radio emission.

  9. Expression of p63 and Cyclooxygenase-2 and Their Correlation in Skin Tumors

    Institute of Scientific and Technical Information of China (English)

    WU Yan; LIU Houjun; LI Jiawen

    2007-01-01

    To study the expression of p63 and cyclooxygenase-2 (cox-2) in skin tumors and evaluate the correlation between p63 and cox-2, the expressions of cox-2 and p63 were measured by streptavidin-peroxidase complex immunohistochemical technique in 17 cases of skin squamous cell carcinoma (SCC), 19 cases of Bowen's disease(Bowen), 11 cases of actinic keratosis(AK), 12 cases of seborreic keratosis(SK) and 13 specimens of normal skin. Our results showed that the expression of p63 in skin squamous cell carcinoma, Bowen's disease and actinic keratosis were significantly higher than that in seborreic keratosis, while the expression of p63 in seborreic keratosis was significantly higher than that in normal skin. The expression of cox-2 in skin squamous cell carcinoma,Bowen's disease and actinic keratosis were significantly higher than that in seborreic keratosis, while no statistical difference was noted in the expression of cox-2 between seborreic keratosis and normal skin. Cox-2 expression was positively correlated with the high p63 expression in malignant skin tumors. The increased expression of cox-2 and p63 may play an important role in the development of skin tumors and work synergetically in malignant skin tumors.

  10. Issues surrounding record keeping in district nursing practice.

    Science.gov (United States)

    Anderson, E E

    2000-07-01

    This article examines some aspects of nursing documentation following the publication of the document 'Guidelines for Records and Record Keeping' (UKCC, 1998). The importance of nursing documentation in patient care, in guiding practice and in providing information for members of the interprofessional healthcare team is highlighted. Record keeping forms an important part of the clinical governance initiative in terms of quality improvement and risk management. The issues surrounding the legal requirements of record keeping in district nursing practice are discussed. Suggestions are made for assessing the quality of nursing documentation by audit and research, in order to establish the suitability of using the present systems in the community setting.

  11. Induced radioactivity in a 4 MW target and its surroundings

    CERN Document Server

    Agosteo, Stefano; Otto, Thomas; Silari, Marco

    2003-01-01

    An important aspect of a future CERN Neutrino Factory is the material activation arising from a 2.2 GeV, 4 MW proton beam striking a mercury target. An estimation of the hadronic inelastic interactions and the production of residual nuclei in the target, the magnetic horn, the decay tunnel, the surrounding rock and a downstream dump was performed by the Monte Carlo hadronic cascade code FLUKA. The aim was both to assess the dose equivalent rate to be expected during maintenance work and to evaluate the amount of residual radioactivity, which will have to be disposed of after the facility has ceased operation.

  12. Mutual seismic interaction between tunnels and the surrounding granular soil

    Directory of Open Access Journals (Sweden)

    Mohamed Ahmed Abdel-Motaal

    2014-12-01

    Study results show that the maximum exerted straining actions in tunnel lining are directly proportional to the relative stiffness between tunnel and surrounding soil (lining thickness and soil shear modulus. Moreover, it is highly affected by the peak ground acceleration and the tunnel location (embedment depth. A comprehensive study is performed to show the effect of tunnel thickness and tunnel diameter on both the induced bending moment and lining deformation. In general, it is concluded that seismic analysis should be considered in regions subjected to peak ground acceleration greater than 0.15g.

  13. Problems Surrounding Probation In The South African Public Service

    Directory of Open Access Journals (Sweden)

    Z. Baloyi

    2006-11-01

    Full Text Available The aim of the study was to investigate problems surrounding probation periods in the South African Public Service. A qualitative study was conducted to determine the views of both probationers and supervisors managing the probation process. Data was gathered by means of focus groups and individual interviews. Nine key areas were identified as being problematic, viz. clarity regarding the purpose of probation, lack of proper guidelines, the duration of probation, rotation during probation, lack of training, poor management of probation, performance management, anxiety and stress, power and authority. Recommendations are made concerning possible interventions.

  14. SKIN DETECTION OF ANIMATION CHARACTERS

    Directory of Open Access Journals (Sweden)

    Kazi Tanvir Ahmed Siddiqui

    2015-02-01

    Full Text Available The increasing popularity of animes makes it vulnerable to unwanted usages like copyright violations and pornography. That’s why, we need to develop a method to detect and recognize animation characters. Skin detection is one of the most important steps in this way. Though there are some methods to detect human skin color, but those methods do not work properly for anime characters. Anime skin varies greatly from human skin in color, texture, tone and in different kinds of lighting. They also vary greatly among themselves. Moreover, many other things (for example leather, shirt, hair etc., which are not skin, can have color similar to skin. In this paper, we have proposed three methods that can identify an anime character’s skin more successfully as compared with Kovac, Swift, Saleh and Osman methods, which are primarily designed for human skin detection. Our methods are based on RGB values and their comparative relations.

  15. Staining of skin with dihydroxyacetone.

    Science.gov (United States)

    WITTGENSTEIN, E; BERRY, H K

    1960-09-30

    The reaction of skin with dihydroxyacetone to produce a brown "artificial tan" appears to proceed through combination with free amino groups in skin proteins, and particularly by combination of dihydroxyacetone with the free guanido group in arginine.

  16. Candida infection of the skin

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/000880.htm Candida infection of the skin To use the sharing features on this page, please enable JavaScript. Candida infection of the skin is a yeast infection ...

  17. Maintaining Healthy Skin -- Part 2

    Science.gov (United States)

    ... from seams or elastic binding. Check also for blisters, bumps, insect bites, dry flaky skin or pimples. ... always check your skin carefully after wearing new shoes or clothing. Too loose — Loose clothing can form ...

  18. Tissue Engineered Human Skin Equivalents

    Directory of Open Access Journals (Sweden)

    Zheng Zhang

    2012-01-01

    Full Text Available Human skin not only serves as an important barrier against the penetration of exogenous substances into the body, but also provides a potential avenue for the transport of functional active drugs/reagents/ingredients into the skin (topical delivery and/or the body (transdermal delivery. In the past three decades, research and development in human skin equivalents have advanced in parallel with those in tissue engineering and regenerative medicine. The human skin equivalents are used commercially as clinical skin substitutes and as models for permeation and toxicity screening. Several academic laboratories have developed their own human skin equivalent models and applied these models for studying skin permeation, corrosivity and irritation, compound toxicity, biochemistry, metabolism and cellular pharmacology. Various aspects of the state of the art of human skin equivalents are reviewed and discussed.

  19. Drugs Approved for Skin Cancer

    Science.gov (United States)

    ... Ask about Your Treatment Research Drugs Approved for Skin Cancer This page lists cancer drugs approved by the Food and Drug Administration (FDA) for skin cancer, including drugs for basal cell carcinoma, melanoma, and ...

  20. Skin Cancers of the Feet

    Science.gov (United States)

    ... cracking, bleeding, or ulceration. Frequently, individuals discover their skin cancer after unrelated ailments near the affected site. Causes We often view the sun's harmful rays as the primary cause of skin cancer; the condition is often found on parts of ...

  1. Fibrillin microfibrils are reduced in skin exhibiting striae distensae.

    Science.gov (United States)

    Watson, R E; Parry, E J; Humphries, J D; Jones, C J; Polson, D W; Kielty, C M; Griffiths, C E

    1998-06-01

    Striae distensae (striae: stretch marks) are a common disfiguring condition associated with continuous and progressive stretching of the skin--as occurs during pregnancy. The pathogenesis of striae is unknown but probably relates to changes in those structures that provide skin with its tensile strength and elasticity. Such structures are components of the extracellular matrix, including fibrillin, elastin and collagens. Using a variety of histological techniques, we assessed the distribution of these extracellular matrix components in skin affected by striae. Pregnant women were assessed for the presence of striae, and punch biopsies were obtained from lesional striae and adjacent normal skin. Biopsies were processed for electron microscopy, light microscopy and immunohistochemistry. For histological examination, 7 microns frozen sections were stained so as to identify the elastic fibre network and glycosaminoglycans. Biopsies were also examined with a panel of polyclonal antibodies against collagens I and III, and fibrillin and elastin. Ultrastructural analysis revealed alterations in the appearance of skin affected by striae compared with that of normal skin in that the dermal matrix of striae was looser and more floccular. Light microscopy revealed an increase in glycosaminoglycan content in striae. Furthermore, the number of vertical fibrillin fibres subjacent to the dermal-epidermal junction (DEJ) and elastin fibres in the papillary dermis was significantly reduced in striae compared with normal skin. The orientation of elastin and fibrillin fibres in the deep dermis showed realignment in that the fibres ran parallel to the DEJ. However, no significant alterations were observed in any other extracellular matrix components. This study identifies a reorganization and diminution of the elastic fibre network of skin affected by striae. Continuous strain on the dermal extracellular matrix, as occurs during pregnancy, may remodel the elastic fibre network in

  2. Nicotinamide for skin cancer chemoprevention.

    Science.gov (United States)

    Damian, Diona L

    2017-03-20

    Nicotinamide (vitamin B3 ) has a range of photoprotective effects in vitro and in vivo; it enhances DNA repair, reduces UV radiation-induced suppression of skin immune responses, modulates inflammatory cytokine production and skin barrier function and restores cellular energy levels after UV exposure. Pharmacological doses of nicotinamide have been shown to reduce actinic keratoses and nonmelanoma skin cancer incidence in high-risk individuals, making this a nontoxic and accessible option for skin cancer chemoprevention in this population.

  3. A REVIEW ON SKIN CANCER

    OpenAIRE

    S. Ramya Silpa; Chidvila V

    2013-01-01

    Skin cancer can be of 2 types mainly. They are malignant melanoma and non-malignant melanoma. Skin cancer mainly occurs due to exposure of sunlight. Ozone depletion and chemical exposures are other factors involved in precipitating skin cancer. Mutations of p53 gene are involved in UV- induced carcinogenesis. P53 gene acts vital in development of SCC. So, prevention of skin cancer is the main criteria. Regular application of sunscreens could be one of the primary prevention. The purpose of pr...

  4. Development of a Vascularized Skin Construct Using Adipose-Derived Stem Cells from Debrided Burned Skin

    Directory of Open Access Journals (Sweden)

    Rodney K. Chan

    2012-01-01

    Full Text Available Large body surface area burns pose significant therapeutic challenges. Clinically, the extent and depth of burn injury may mandate the use of allograft for temporary wound coverage while autografts are serially harvested from the same donor areas. The paucity of donor sites in patients with burns involving large surface areas highlights the need for better skin substitutes that can achieve early and complete coverage and retain normal skin durability with minimal donor requirements. We have isolated autologous stem cells from the adipose layer of surgically debrided burned skin (dsASCs, using a point-of-care stem cell isolation device. These cells, in a collagen—polyethylene glycol fibrin-based bilayer hydrogel, differentiate into an epithelial layer, a vascularized dermal layer, and a hypodermal layer. All-trans-retinoic acid and fenofibrate were used to differentiate dsASCs into epithelial-like cells. Immunocytochemical analysis showed a matrix- and time-dependent change in the expression of stromal, vascular, and epithelial cell markers. These results indicate that stem cells isolated from debrided skin can be used as a single autologous cell source to develop a vascularized skin construct without culture expansion or addition of exogenous growth factors. This technique may provide an alternative approach for cutaneous coverage after extensive burn injuries.

  5. Heterogeneous Stem Cells in Skin Homeostatis and Wound Repair

    Directory of Open Access Journals (Sweden)

    Anna Meilana

    2015-08-01

    Full Text Available BACKGROUND: The skin protects mammals from insults, infection and dehydration and enables thermoregulation and sensory perception. Various skin-resident cells carry out these diverse functions. Constant turnover of cells and healing upon injury necessitate multiple reservoirs of stem cells. The skin is a complex organ harboring several distinct populations of stem cells and a rich array of cell types. Advances in genetic and imaging tools have brought new findings about the lineage relationships between skin stem cells and their progeny. Such knowledge may offer novel avenues for therapeutics and regenerative medicine. CONTENT: In the past years, our view of the mechanisms that govern skin homeostasis and regeneration have markedly changed. New populations of stem cells have been identified that behave spatio-temporally differently in healthy tissues and in situations of damage, indicating that a great level of stem cell heterogeneity is present in the skin. There are believed to be distinct populations of stem cells in different locations. The lineages that they feed are normally constrained by signals from their local environment, but they can give rise to all epidermal lineages in response to appropriate stimuli. Given the richness of structures such as blood vessels, subcutaneous fat, innervation and the accumulation of fibroblasts under the upper parts of the rete ridges (in the case of human skin, it is reasonable to speculate that the microenvironment might be essential for interfollicular epidermal homeostasis. The bloodstream is probably the main source of long-range signals reaching the skin, and cues provided by the vascular niche might be essential for skin homeostasis. SUMMARY: A key function of the interfollicular epidermis is to act as a protective interface between the body and the external environment, and it contains several architectural elements that enable it to fulfill this function. All elements of the epidermis play

  6. Masturbation, sexuality, and adaptation: normalization in adolescence.

    Science.gov (United States)

    Shapiro, Theodore

    2008-03-01

    During adolescence the central masturbation fantasy that is formulated during childhood takes its final form and paradoxically must now be directed outward for appropriate object finding and pair matching in the service of procreative aims. This is a step in adaptation that requires a further developmental landmark that I have called normalization. The path toward airing these private fantasies is facilitated by chumship relationships as a step toward further exposure to the social surround. Hartmann's structuring application of adaptation within psychoanalysis is used as a framework for understanding the process that simultaneously serves intrapsychic and social demands and permits goals that follow evolutionary principles. Variations in the normalization process from masturbatory isolation to a variety of forms of sexual socialization are examined in sociological data concerning current adolescent sexual behavior and in case examples that indicate some routes to normalized experience and practice.

  7. Demonstration of characteristic skin surface contours of extramammary Paget's disease and parapsoriasis en plaque by image analysis of negative impression replicas.

    Science.gov (United States)

    Kikuchi, Katsuko; Aiba, Setsuya; O'Goshi, Ken-ichiro; Yanai, Motohiro; Takahashi, Motoji; Kasai, Hidefumi; Tagami, Hachiro

    2002-10-01

    The surface contours of lesional skin of certain skin diseases, such as parapsoriasis en plaque (PEP) and extramammary Paget's disease (EMPD), in which there is a massive infiltration by non-epidermal cells, looks somewhat different from that of the adjacent normal skin, needless to state that they are apparently different from that of ordinary chronic inflammatory dermatoses where we found acanthotic epidermis accompanied by hyperkeratosis. We attempted to objectively characterize these unique skin surface changes qualitatively and quantitatively using non-invasive methods. Negative impression replicas were taken from the lesional skin of patients with EMPD or PEP as well as from the adjacent uninvolved skin. The findings were confirmed histologically. The replicas were examined by using computerized image analysis. Several parameters were analyzed that correlate with the changes in the anisotropy of the skin furrows (VC1), average skin roughness (KSD), average length of skin furrows (LEN), and number of skin furrows (NUM). There were significant decreases in KSD and NUM in EMPD, indicating a smoother skin surface in the lesional skin than in the adjacent normal skin. In contrast, the PEP lesion had an increase in VC1 and LEN and a decrease in NUM, which suggests larger skin ridges in the lesional skin than in the uninvolved skin. Thus the unique skin surface of the cutaneous disorders accompanied by epidermal invasion by non-epidermal cells, such as EMPD and PEP, was characterized both qualitatively and quantitatively using computerized image analysis of negative impression replicas.

  8. Skin cancer: Etiology and management.

    Science.gov (United States)

    Qadir, Muhammad Imran

    2016-05-01

    Nowadays, occurrence of skin cancer is very common in humans. It is reported that the most common cause of the skin cancer is excessive exposure to sunlight as it contains harmful radiations; the ultra violet rays. Different management strategies are used for different types of skin cancers, which are chemotherapy, radiation therapy.

  9. Skin Pedagogies and Abject Bodies

    Science.gov (United States)

    Kenway, Jane; Bullen, Elizabeth

    2011-01-01

    How does the beauty industry "narrate the skin"? What does it teach women from different cultural groups about the female body? How does skin function as a site where female subjection and abjection are produced and reproduced? In this paper we examine the skin industry pointing to its extreme commodification of the female body and to the…

  10. Skin Pedagogies and Abject Bodies

    Science.gov (United States)

    Kenway, Jane; Bullen, Elizabeth

    2011-01-01

    How does the beauty industry "narrate the skin"? What does it teach women from different cultural groups about the female body? How does skin function as a site where female subjection and abjection are produced and reproduced? In this paper we examine the skin industry pointing to its extreme commodification of the female body and to the…

  11. Interactions of the Infrared bubble N4 with the surroundings

    CERN Document Server

    Liu, Hong-Li; Wu, Yuefang; Yuan, Jing-Hua; Liu, Tie; Dubner, G; Paron, S; Ortega, M E; Molinari, Sergio; Huang, Maohai; Zavagno, Annie; Samal, Manash R; Huang, Ya-Fang; Zhang, Si-Ju

    2016-01-01

    The physical mechanisms that induce the transformation of a certain mass of gas in new stars are far from being well understood. Infrared bubbles associated with HII regions have been considered to be a good sample to investigate triggered star formation. In this paper we report on the investigation of the dust properties of the infrared bubble N4 around the HII region G11.898+0.747, analyzing its interaction with the surroundings and star formation histories therein, aiming at determining the possibility of star formation triggered by the expansion of the bubble. Using Herschel PACS and SPIRE images with a wide wavelength coverage, we reveal the dust properties over the entire bubble. Meanwhile, we are able to identify six dust clumps surrounding the bubble, with a mean size of 0.50 pc, temperature of about 22 K, mean column density of 1.7 $\\times10^{22}$ cm$^{-2}$, mean volume density of about 4.4 $\\times10^{4}$ cm$^{-3}$, and a mean mass of 320 $M_{\\odot}$. In addition, from PAH emission seen at 8 $\\mu$m, ...

  12. Radio observations of Supernova Remnants and the surrounding molecular gas

    CERN Document Server

    Dubner, G

    2011-01-01

    Supernova Remnants (SNRs) are believed to be the main source of Galactic cosmic rays (CR). The strong SNR shocks provide ideal acceleration sites for particles of at least 10^14 eV/nucleon. Radio continuum studies of SNRs carried out with good sensitivity and high angular resolution convey information about three main aspects of the SNRs: morphology, polarization and spectrum. Based on this information it is possible to localize sites of higher compression and particle acceleration as well as the orientation and degree of order of the magnetic fields, and in some cases even its intensity. All this information, when complemented with the study of the distribution and kinematics of the surrounding interstellar gas, results in a very useful dataset to investigate the role of SNRs as cosmic ray accelerators. In this presentation, I analyze the radio observations of SNRs and surrounding molecular clouds, showing the contribution of these studies to the understanding of the role of SNRs as factories of CRs.

  13. Triggered Star Formation Surrounding Wolf-Rayet Star HD 211853

    Science.gov (United States)

    Liu, Tie; Wu, Yuefang; Zhang, Huawei; Qin, Sheng-Li

    2012-05-01

    The environment surrounding Wolf-Rayet (W-R) star HD 211853 is studied in molecular, infrared, as well as radio, and H I emission. The molecular ring consists of well-separated cores, which have a volume density of 103 cm-3 and kinematic temperature ~20 K. Most of the cores are under gravitational collapse due to external pressure from the surrounding ionized gas. From the spectral energy distribution modeling toward the young stellar objects, the sequential star formation is revealed on a large scale in space spreading from the W-R star to the molecular ring. A small-scale sequential star formation is revealed toward core "A," which harbors a very young star cluster. Triggered star formations are thus suggested. The presence of the photodissociation region, the fragmentation of the molecular ring, the collapse of the cores, and the large-scale sequential star formation indicate that the "collect and collapse" process functions in this region. The star-forming activities in core "A" seem to be affected by the "radiation-driven implosion" process.

  14. On the environment surrounding close-in exoplanets

    CERN Document Server

    Vidotto, A A; Jardine, M; Moutou, C; Donati, J -F

    2015-01-01

    Exoplanets in extremely close-in orbits are immersed in a local interplanetary medium (i.e., the stellar wind) much denser than the local conditions encountered around the solar system planets. The environment surrounding these exoplanets also differs in terms of dynamics (slower stellar winds, but higher Keplerian velocities) and ambient magnetic fields (likely higher for host stars more active than the Sun). Here, we quantitatively investigate the nature of the interplanetary media surrounding the hot Jupiters HD46375b, HD73256b, HD102195b, HD130322b, HD179949b. We simulate the three-dimensional winds of their host stars, in which we directly incorporate their observed surface magnetic fields. With that, we derive mass-loss rates (1.9 to 8.0 $\\times 10^{-13} M_{\\odot}$/yr) and the wind properties at the position of the hot-Jupiters' orbits (temperature, velocity, magnetic field intensity and pressure). We show that these exoplanets' orbits are super-magnetosonic, indicating that bow shocks are formed surrou...

  15. Triggered star formation surrounding Wolf-Rayet star HD 211853

    CERN Document Server

    Liu, Tie; Zhang, Huawei; Qin, Sheng-Li

    2012-01-01

    The environment surrounding Wolf-Rayet star HD 211853 is studied in molecular emission, infrared emission, as well as radio and HI emission. The molecular ring consists of well-separated cores, which have a volume density of 10$^{3}$ cm$^{-3}$ and kinematic temperature $\\sim$20 K. Most of the cores are under gravitational collapse due to external pressure from the surrounding ionized gas. From SED modeling towards the young stellar objects (YSOs), sequential star formation is revealed on a large scale in space spreading from the Wolf-Rayet star to the molecular ring. A small scale sequential star formation is revealed towards core A, which harbors a very young star cluster. Triggered star formations is thus suggested. The presence of PDR, the fragmentation of the molecular ring, the collapse of the cores, the large scale sequential star formation indicate the "Collect and Collapse" process functions in this region. The star forming activities in core A seem to be affected by the "Radiation-Driven Implosion" (...

  16. TRIGGERED STAR FORMATION SURROUNDING WOLF-RAYET STAR HD 211853

    Energy Technology Data Exchange (ETDEWEB)

    Liu Tie; Wu Yuefang; Zhang Huawei [Department of Astronomy, Peking University, 100871 Beijing (China); Qin Shengli, E-mail: liutiepku@gmail.com [I. Physikalisches Institut, Universitaet zu Koeln, Zuelpicher Str. 77, 50937 Koeln (Germany)

    2012-05-20

    The environment surrounding Wolf-Rayet (W-R) star HD 211853 is studied in molecular, infrared, as well as radio, and H I emission. The molecular ring consists of well-separated cores, which have a volume density of 10{sup 3} cm{sup -3} and kinematic temperature {approx}20 K. Most of the cores are under gravitational collapse due to external pressure from the surrounding ionized gas. From the spectral energy distribution modeling toward the young stellar objects, the sequential star formation is revealed on a large scale in space spreading from the W-R star to the molecular ring. A small-scale sequential star formation is revealed toward core 'A', which harbors a very young star cluster. Triggered star formations are thus suggested. The presence of the photodissociation region, the fragmentation of the molecular ring, the collapse of the cores, and the large-scale sequential star formation indicate that the 'collect and collapse' process functions in this region. The star-forming activities in core 'A' seem to be affected by the 'radiation-driven implosion' process.

  17. How patients experience the surroundings in relation to patient participation: a qualitative study of inpatients with intestinal failure

    Directory of Open Access Journals (Sweden)

    Thyssen GD

    2014-04-01

    Full Text Available Gunvor Dichmann Thyssen, Anne BeckDepartment of Hepatology and Gastroenterology, Aarhus University Hospital, Aarhus, DenmarkIntroduction: Patient participation is known to improve patients' motivation, compliance, treatment results, and satisfaction with the received care. It is well known that the physical environment is of great importance in supporting patient involvement. A systematic literature search has shown a lack of articles on the subject of “surroundings” in relation to patient participation, for all patient groups.Aim: We aimed to investigate how patients with intestinal failure experience their hospital surroundings in relation to patient participation.Methods: The study included eight patients admitted for at least 2 weeks at the Intestinal Failure Unit, H8, Salford Royal NHS Foundation Trust, Manchester, United Kingdom. Included patients had a good level of consciousness with no confusion. The included patients participated in a semistructured interview. The interviews were analyzed using Malterud's principles of systematic text condensation.Results: The patients described that the surroundings enabled them to participate in their treatment and care. The surroundings made it possible for them and encouraged them to participate through: the possibility to seek and get information and the possibility to participate in daily activities. This led to a feeling of independence, reassurance, normality, control, responsibility, and confidence.Conclusion: The findings in this study indicate that the hospital surroundings are essential for the patients with respect to their ability to participate in their own care and treatment. The surroundings, in relation to patient participation, should be considered when planning and organizing nursing care. Further research is needed to increase the understanding of the surroundings in relation to patient participation - this research could, for eg, include the nurse's perspective

  18. Frequency dependent attenuation of seismic waves for Delhi and surrounding area, India

    Directory of Open Access Journals (Sweden)

    Babita Sharma

    2015-06-01

    Full Text Available The attenuation properties of Delhi & surrounding region have been investigated using 62 local earthquakes recorded at nine stations. The frequency dependent quality factors Qa (using P-waves and Qb (using S-waves have been determined using the coda normalization method. Quality factor of coda-waves (Qc has been estimated using the single backscattering model in the frequency range from 1.5 Hz to 9 Hz. Wennerberg formulation has been used to estimate Qi (intrinsic attenuation parameter and Qs (scattering attenuation parameter for the region. The values Qa, Qb, Qc, Qi and Qs estimated are frequency dependent in the range of 1.5Hz-9Hz. Frequency dependent relations are estimated as Qa=52f1.03, Qb=98f1.07 and Qc=158f0.97. Qc estimates lie in between the values of Qi and Qs but closer to Qi at all central frequencies. Comparison between Qi and Qs shows that intrinsic absorption is predominant over scattering for Delhi and surrounding region. 

  19. Multivesicular Emulsion Ceramide-containing Moisturizers: An Evaluation of Their Role in the Management of Common Skin Disorders

    Science.gov (United States)

    Del Rosso, James Q.

    2016-01-01

    Proper stratum corneum function plays a pivotal role in maintenance of skin health, and improper function leads to skin disease. The stratum corneum is comprised of corneocytes surrounded by intercelluar lipids including ceramides, free fatty acids, and cholesterol. Ceramide predominant moisturizers have become a mainstay of treatment of skin disease. New technologies for delivery of ceramides include multivesicular emulsions, which deposit ceramides in a timerelease manner for a continuous rather than burst effect. Here, the authors review the available data on the use of multivesicular emulsion ceramide moisturizers in various skin diseases. PMID:28210396

  20. Skin biopsy in assessing meralgia paresthetica.

    Science.gov (United States)

    Wongmek, Arada; Shin, Susan; Zhou, Lan

    2016-04-01

    Meralgia paresthetica is a focal neuropathy caused by compression of the lateral femoral cutaneous nerve (LFCN). The disease can be difficult to assess by neurophysiological or imaging studies. We studied 5 patients who presented to our neuromuscular clinic from April 2012 to December 2014 with a clinical suspicion of meralgia paresthetica and had skin biopsies with intraepidermal nerve fiber density (IENFD) evaluation. The mean age at onset was 37.2 (range 21-59) years. There were 4 women and 1 man. Two were obese, 2 wore tight jeans, and 1 had mild diabetes mellitus. IENFD was reduced in the symptomatic proximal thigh in all 5 patients and was also reduced in the asymptomatic thigh in 2 patients. It was normal in the distal leg in 4 patients. Meralgia paresthetica is associated with loss of small intraepidermal nerve fibers. Skin biopsy with IENFD evaluation may be a useful diagnostic tool for this disease. © 2016 Wiley Periodicals, Inc.

  1. Aging-like skin changes induced by ultraviolet irradiation in an animal model of metabolic syndrome.

    Science.gov (United States)

    Akase, Tomoko; Nagase, Takashi; Huang, Lijuan; Ibuki, Ai; Minematsu, Takeo; Nakagami, Gojiro; Ohta, Yasunori; Shimada, Tsutomu; Aburada, Masaki; Sugama, Junko; Sanada, Hiromi

    2012-04-01

    Both physiological skin aging and pathologic photo-aging caused by ultraviolet (UV) irradiation are mediated by latent inflammation and oxidative stress. Although numerous animal skin-aging models have used UV irradiation, most require massive doses or long-term irradiation. To establish a more refined skin-aging model, we focused on an animal model of metabolic syndrome (MS) because MS involves damage to various organs via oxidative stress or inflammation, similar to the changes associated with aging. We hypothesized that MS skin might exhibit more aging-like changes after milder, shorter-term UV irradiation than would normal animal skin under similar conditions, thus providing a useful model for skin aging. The authors therefore examined the skin from Tsumura Suzuki obese diabetic (TSOD) mice (MS model) and control Tsumura Suzuki non-obese (TSNO) mice before and after UV irradiation. Skin from TSOD mice had a thinner epidermis and dermis, a thicker fatty layer, reduced density and convolution of the fragmented collagen fibers, and upregulated expression of tumor necrosis factor (TNF)-α, a dual marker for inflammation and aging, compared to the skin from TSNO mice. UV irradiation affected TSOD skin more severely than TSNO skin, resulting in various changes resembling those in aged human skin, including damage to the dermis and subcutaneous fatty tissue, infiltration of inflammatory cells, and further upregulation of TNF-α expression. These results suggest that UV-irradiated TSOD mice may provide a new model of skin aging and imply that skin from humans with MS is more susceptible to UV- or aging-related damage than normal human skin.

  2. Skin Cancer: Biology, Risk Factors & Treatment

    Science.gov (United States)

    ... turn Javascript on. Feature: Skin Cancer Skin Cancer: Biology, Risk Factors & Treatment Past Issues / Summer 2013 Table ... Articles Skin Cancer Can Strike Anyone / Skin Cancer: Biology, Risk Factors & Treatment / Timely Healthcare Checkup Catches Melanoma ...

  3. How Is Melanoma Skin Cancer Diagnosed?

    Science.gov (United States)

    ... Early Detection, Diagnosis, and Staging Tests for Melanoma Skin Cancer Most melanomas are brought to a doctor’s attention ... Melanoma Skin Cancer, by Stage More In Melanoma Skin Cancer About Melanoma Skin Cancer Causes, Risk Factors, and ...

  4. Serotonin in human skin

    Institute of Scientific and Technical Information of China (English)

    Jianguo Huang; Qiying Gong; Guiming Li

    2005-01-01

    In this review the authors summarize data of a potential role for serotonin in human skin physiology and pathology. The uncovering of endogenous serotonin synthesis and its transformation to melatonin underlines a putative important role of this pathway in melanocyte physiology and pathology. Pathways of the biosynthesis and biodegradation of serotonin have been characterized in human beings and its major cellular populations. Moreover, receptors of serotonin are expressed on keratinocytes, melanocytes, and fibroblasts and these mediate phenotypic actions on cellular proliferation and differentiation. And the widespread expression of a cutaneous seorotoninergic system indicates considerable selectivity of action to facilitate intra-, auto-, or paracrine mechanisms that define and influence skin function in a highly compartmentalized manner. Melatonin, in turn, can also act as a hormone, neurotransmitter, cytokine, biological modifier and immunomodulator. Thus, Serotonin local synthesis and cellular localization could thus become of great importance in the diagnosis and management of cutaneous pathology.

  5. Skin contamination dosimeter

    Science.gov (United States)

    Hamby, David M.; Farsoni, Abdollah T.; Cazalas, Edward

    2011-06-21

    A technique and device provides absolute skin dosimetry in real time at multiple tissue depths simultaneously. The device uses a phoswich detector which has multiple scintillators embedded at different depths within a non-scintillating material. A digital pulse processor connected to the phoswich detector measures a differential distribution (dN/dH) of count rate N as function of pulse height H for signals from each of the multiple scintillators. A digital processor computes in real time from the differential count-rate distribution for each of multiple scintillators an estimate of an ionizing radiation dose delivered to each of multiple depths of skin tissue corresponding to the multiple scintillators embedded at multiple corresponding depths within the non-scintillating material.

  6. Double-Skin Facade

    DEFF Research Database (Denmark)

    Kalyanova, Olena

    difficulties experienced by scientists when attempting to model DSF thermal and energy performance were examined. In addition, the lack of experimental studies and empirical validation of models was realized, many numerical models have not been empirically validated and most of them require an expert knowledge...... IEA Annex 34/43, subtask E "Double-Skin Facade". The results of empirical validation are discussed in this work. Discussion and analysis of experimental results is carried out. It has lead to hypothesis of recirculation flow phenomenon in the DSF cavity. Finally, a suggestion of a new numerical model......Double-Skin Facades (DSF) are gaining popularity that, in fact, appears to be independent from sturdy critics of the concept in the past years. DSF buildings are being built in Europe and worldwide, DSF concept is being taught at schools of architecture and fully glazed office buildings are being...

  7. Study of Interaction between Supersonic Flow and Rods Surrounded by Porous Cavity

    Institute of Scientific and Technical Information of China (English)

    Minoru YAGA; Kenji YAMAMOTO; Piotr DOERFFER; Kenyu OYAKAWA

    2006-01-01

    In this paper,some preliminary calculations and the experiments were performed to figure out the flow field,in which some rods were normally inserted into the main flow surrounded by a porous cavity.As a result,it is found that the starting shock wave severely interacts with the rods,the bow shock wave,its reflections,and the porous wall,which are numerically well predicted at some conditions.Moreover,inserting the rods makes the pressure on the upper wall in the porous region increase when the main flow in the porous region is completely supersonic.The calculations also suggest that three rods cause the widest suction area.

  8. Kinetic signatures of the region surrounding the X line in asymmetric (magnetopause) reconnection

    Science.gov (United States)

    Shay, M. A.; Phan, T. D.; Haggerty, C. C.; Fujimoto, M.; Drake, J. F.; Malakit, K.; Cassak, P. A.; Swisdak, M.

    2016-05-01

    Kinetic particle-in-cell simulations are used to identify signatures of the electron diffusion region (EDR) and its surroundings during asymmetric magnetic reconnection. A "shoulder" in the sunward pointing normal electric field (EN > 0) at the reconnection magnetic field reversal is a good indicator of the EDR and is caused by magnetosheath electron meandering orbits in the vicinity of the X line. Earthward of the X line, electrons accelerated by EN form strong currents and crescent-shaped distribution functions in the plane perpendicular to B. Just downstream of the X line, parallel electric fields create field-aligned crescent electron distribution functions. In the immediate upstream magnetosheath, magnetic field strength, plasma density, and perpendicular electron temperatures are lower than the asymptotic state. In the magnetosphere inflow region, magnetosheath ions intrude resulting in an Earthward pointing electric field and parallel heating of magnetospheric particles. Many of the above properties persist with a guide field of at least unity.

  9. Kinetic signatures of the region surrounding the X-line in asymmetric (magnetopause) reconnection

    CERN Document Server

    Shay, M A; Haggerty, C C; Fujimoto, M; Drake, J F; Malakit, K; Cassak, P A; Swisdak, M

    2016-01-01

    Kinetic particle-in-cell simulations are used to identify signatures of the electron diffusion region (EDR) and its surroundings during asymmetric magnetic reconnection. A "shoulder" in the sunward pointing normal electric field (EN > 0) at the reconnection magnetic field reversal is a good indicator of the EDR, and is caused by magnetosheath electron meandering orbits in the vicinity of the x-line. Earthward of the X-line, electrons accelerated by EN form strong currents and crescent-shaped distribution functions in the plane perpendicular to B. Just downstream of the X-line, parallel electric fields create field-aligned crescent electron distribution functions. In the immediate upstream magnetosheath, magnetic field strength, plasma density, and perpendicular electron temperatures are lower than the asymptotic state. In the magnetosphere inflow region, magnetosheath ions intrude resulting in an Earthward pointing electric field and parallel heating of magnetospheric particles. Many of the above properties p...

  10. The Pinking Shears: A Novel Tool for Improving Skin Graft Cosmesis

    Directory of Open Access Journals (Sweden)

    Cormac W. Joyce, MB BCh

    2014-12-01

    Full Text Available Summary: A significant aesthetic disadvantage to split skin grafts is the obvious transition between the graft and the normal skin. We report on a novel method to interrupt this transition point by using pinking shears, which are dressmaking scissors with saw-toothed blades that create a chevron pattern instead of a straight edge. We describe a case where the pinking shears were utilized on a split skin graft and Integra for reconstruction of the skin on a volar forearm. This technique allows for breaking-up of the transition point between the skin graft and normal skin and gives rise to an improved aesthetic outcome as the boundary is significantly less well-defined. This novel method shows promise and further study is certainly warranted.

  11. Gene Expression Architecture of Mouse Dorsal and Tail Skin Reveals Functional Differences in Inflammation and Cancer | Office of Cancer Genomics

    Science.gov (United States)

    Inherited germline polymorphisms can cause gene expression levels in normal tissues to differ substantially between individuals. We present an analysis of the genetic architecture of normal adult skin from 470 genetically unique mice, demonstrating the effect of germline variants, skin tissue location, and perturbation by exogenous inflammation or tumorigenesis on gene signaling pathways.

  12. Echo: skin stress test

    Science.gov (United States)

    1960-01-01

    Skin Stress Test of the 12-foot satellite built as a prototype of the full-scale Echo satellite. The 12-foot diameter of the sphere was chosen because that was the ceiling height in the Langley model shop. The proposal to build the 12-foot satellite was made in November 1957. - Published in James R. Hansen, Spaceflight Revolution: NASA Langley Research Center From Sputnik to Apollo, NASA SP-4308, pp. 170-171.

  13. Smoking and skin disease

    DEFF Research Database (Denmark)

    Thomsen, S F; Sørensen, L T

    2010-01-01

    pemphigus vulgaris, pyoderma gangrenosum, aphthous ulcers, and Behçet's disease. Various degenerative dermatologic conditions are also impacted by smoking, such as skin wrinkling and dysregulated wound healing, which can result in post-surgical complications and delayed or even arrested healing of chronic...... wounds. Most likely, alteration of inflammatory cell function and extracellular matrix turnover caused by smoking-induced oxidative stress are involved in the pathophysiologic mechanisms....

  14. Normalization in econometrics

    OpenAIRE

    Hamilton, James D.; Daniel F. Waggoner; Zha, Tao

    2004-01-01

    The issue of normalization arises whenever two different values for a vector of unknown parameters imply the identical economic model. A normalization does not just imply a rule for selecting which point, among equivalent ones, to call the maximum likelihood estimator (MLE). It also governs the topography of the set of points that go into a small-sample confidence interval associated with that MLE. A poor normalization can lead to multimodal distributions, disjoint confidence intervals, and v...

  15. Development of human skin equivalents to unravel the impaired skin barrier in atopic dermatitis skin

    NARCIS (Netherlands)

    Eweje, M.O.

    2016-01-01

    The studies in this thesis describes the barrier defects in Atopic Dermatitis (AD) skin and various techniques to develop AD Human Skin Equivalents (HSEs) which can be used to better understand the role of several factors in the pathogenesis of AD skin. The results described show that Inflammation p

  16. SKIN RADIATION IN PANORAMIC

    Directory of Open Access Journals (Sweden)

    Herry Irawan

    2015-06-01

    Full Text Available Dental panoramic radiograph in Indonesia has been widely used. Modern diagnostic imaging equipment with minimum radiation is still very limited. One of the conditions in nuclear safety law, UU 10/1997, is an optimization of all radiation sources with DRL through skin dose measurements. In Indonesia, the national DRL has not been established yet, and there were no reports on the study of panoramic skin dose in Indonesia. The aim of this preliminary study was to obtain a panoramic skin dose radiation as reference to establish DRL in Indonesia. Panoramic radiographs of sixteen female and fifteen male patients, aged 4 – 48 years, were taken using the standard conventional method, with TLD chips attached in location groups. The chips were then read with the detector and integrator of BATAN, in high and low temperature condition at the same time. It was revealed that behind the right and left ear were the regions with the highest radiation dose received, followed by the back of the neck, left jaw, right jaw, and chin. The result of this study has shown the importance of DRL in Indonesia since the use of modern diagnostic imaging equipement that limits radiation dose to the minimum level is still very limited.

  17. Normal cognitive aging.

    Science.gov (United States)

    Harada, Caroline N; Natelson Love, Marissa C; Triebel, Kristen L

    2013-11-01

    Even those who do not experience dementia or mild cognitive impairment may experience subtle cognitive changes associated with aging. Normal cognitive changes can affect an older adult's everyday function and quality of life, and a better understanding of this process may help clinicians distinguish normal from disease states. This article describes the neurocognitive changes observed in normal aging, followed by a description of the structural and functional alterations seen in aging brains. Practical implications of normal cognitive aging are then discussed, followed by a discussion of what is known about factors that may mitigate age-associated cognitive decline.

  18. Normalizers of Irreducible Subfactors

    CERN Document Server

    Smith, Roger R; Wiggins, Alan D

    2007-01-01

    We consider normalizers of an irreducible inclusion $N\\subseteq M$ of $\\mathrm{II}_1$ factors. In the infinite index setting an inclusion $uNu^*\\subseteq N$ can be strict, forcing us to also investigate the semigroup of one-sided normalizers. We relate these normalizers of $N$ in $M$ to projections in the basic construction and show that every trace one projection in the relative commutant $N'\\cap $ is of the form $u^*e_Nu$ for some unitary $u\\in M$ with $uNu^*\\subseteq N$. This enables us to identify the normalizers and the algebras they generate in several situations. In particular each normalizer of a tensor product of irreducible subfactors is a tensor product of normalizers modulo a unitary. We also examine normalizers of irreducible subfactors arising from subgroup--group inclusions $H\\subseteq G$. Here the normalizers are the normalizing group elements modulo a unitary from $L(H)$. We are also able to identify the finite trace $L(H)$-bimodules in $\\ell^2(G)$ as double cosets which are also finite union...

  19. Characterisation of human skin impedance at acupuncture point PC4 Ximen and pericardium meridian using the four-electrode method.

    Science.gov (United States)

    Rezaei, Shima; Khorsand, Ali; Jamali, Jamshid

    2012-06-01

    Traditional Chinese medicine offers several theories to explain the mechanism of acupuncture. One of these theories proposes that acupuncture points and meridians have unique electrical properties and their electrical skin impedance is lower than surrounding areas. The aim of this study was to evaluate the differences in electrical skin impedance between PC4 and the pericardium meridian compared with the surrounding areas. Eighteen healthy subjects (10 women) were recruited to participate in the study. An impedance meter based on the four-electrode technique was designed specifically for the study. Twenty-five points were marked on the skin: one on the point PC4, four others on the pericardium meridian and 20 points around it. The electrical impedance of each point was measured with the four-electrode device. The mean electrical skin impedance at PC4 was significantly different from the 20 of the surrounding points but not significantly different from the four adjacent points. The mean skin impedance of the five points over the pericardium meridian was significantly different from that of parallel rows of points using repeated measures analysis of variance (ppericardium meridian is lower than surrounding areas, supporting the idea of different properties of the pericardium meridian compared with the control areas. Evidence on skin impedance at PC4 is inconclusive and further studies are needed.

  20. Ultraviolet radiation and skin cancer.

    Science.gov (United States)

    Narayanan, Deevya L; Saladi, Rao N; Fox, Joshua L

    2010-09-01

    Skin cancer is the most common type of cancer in fair-skinned populations in many parts of the world. The incidence, morbidity and mortality rates of skin cancers are increasing and, therefore, pose a significant public health concern. Ultraviolet radiation (UVR) is the major etiologic agent in the development of skin cancers. UVR causes DNA damage and genetic mutations, which subsequently lead to skin cancer. A clearer understanding of UVR is crucial in the prevention of skin cancer. This article reviews UVR, its damaging effects on the skin and its relationship to UV immunosuppression and skin cancer. Several factors influence the amount of UVR reaching the earth's surface, including ozone depletion, UV light elevation, latitude, altitude, and weather conditions. The current treatment modalities utilizing UVR (i.e. phototherapy) can also predispose to skin cancers. Unnecessary exposure to the sun and artificial UVR (tanning lamps) are important personal attributable risks. This article aims to provide a comprehensive overview of skin cancer with an emphasis on carefully evaluated statistics, the epidemiology of UVR-induced skin cancers, incidence rates, risk factors, and preventative behaviors & strategies, including personal behavioral modifications and public educational initiatives. © 2010 The International Society of Dermatology.