Skin hydration, microrelief and greasiness of normal skin in Antarctica.

Science.gov (United States)

Tsankov, N; Mateev, D; Darlenski, R

2018-03-01

The skin is the primary defence of the human body against external factors from physical, chemical, mechanical and biologic origin. Climatic factors together with low temperature and sun radiation affect the skin. The effect of climatic conditions in Antarctica on healthy skin has not been previously addressed. The aim of this study was to evaluate the changes in the skin hydration, greasiness and microrelief due to the extreme climatic environmental factors during the stay of the members of the Bulgarian Antarctic expedition. Fifty-nine Caucasian healthy subjects, 42 men and 17 women with mean age 50.9 years (27-68), were enrolled. The study was performed in five consecutive years from 2011 to 2016 at the Bulgarian Antarctic base camp at Livingston Island. The study protocol consisted of two parts: study A: duration of 15 days with measurement of skin physiology parameters on a daily basis, and study B: five measurements at baseline and at days 14, 30, 45 and 50 upon arrival in Antarctica. We measured three biophysical parameters related to skin physiology at cheek skin by an impedance measuring device. No statistically significant difference between parameters at the different measurement points. There is a variation in skin hydration reaching its lower point at day 11 and then returning to values similar to baseline. Initially, an increase in skin greasiness was witnessed with a sharp depression at day 11 and final values at day 15 resembling the ones at baseline. An increase, although not statistically significant, in skin roughness was observed in the first 15 days of the study. Study B showed no statistically significant variances between values of the three parameters. Our studies show the pioneer results of the effect of Antarctic climate on human skin physiology. © 2017 European Academy of Dermatology and Venereology.

High load of Merkel cell polyomavirus DNA detected in the normal skin of Japanese patients with Merkel cell carcinoma.

Science.gov (United States)

Hashida, Yumiko; Nakajima, Kimiko; Nakajima, Hideki; Shiga, Takeo; Tanaka, Moe; Murakami, Masanao; Matsuzaki, Shigenobu; Naganuma, Seiji; Kuroda, Naoki; Seki, Yasutaka; Katano, Harutaka; Sano, Shigetoshi; Daibata, Masanori

2016-09-01

Although Merkel cell polyomavirus (MCPyV) has the potential to cause Merkel cell carcinoma (MCC), it is also found in the normal skin of healthy individuals. However, the mechanism for transformation of MCPyV to an oncogenic form is unknown. To investigate the levels of MCPyV infection in the normal skin patients with MCC compared with those in a control cohort. We studied a total of six Japanese patients with cutaneous MCC. Sun-exposed and sun-unexposed skin swabs were obtained and analyzed for MCPyV loads using quantitative real-time polymerase chain reaction. At first, we found a patient with MCC carrying an extremely high load of MCPyV DNA in normal skin. This unique case prompted us to further explore the levels of MCPyV as skin microbiota in patients with MCC. We showed that MCPyV DNA levels were significantly higher in swabs obtained from normal skin samples of six patients with MCC compared with those from 30 age-matched healthy individuals and 19 patients with other cutaneous cancers. Whereas MCPyV strains obtained from the normal skin of patients with MCC had gene sequences without structural alterations, sequences of the tumor-derived strains showed truncating mutations or deletions. Although the number of patients with MCC studied was small, our findings suggest that MCC may occur with a background of high MCPyV load in the skin, and are expected to stimulate further studies on whether such skin virome levels could be one of predictive markers for the development of MCC. Copyright © 2016 Elsevier B.V. All rights reserved.

Confocal laser-scanning microscopy of capillaries in normal and psoriatic skin

Science.gov (United States)

Archid, Rami; Patzelt, Alexa; Lange-Asschenfeldt, Bernhard; Ahmad, Sufian S.; Ulrich, Martina; Stockfleth, Eggert; Philipp, Sandra; Sterry, Wolfram; Lademann, Juergen

2012-10-01

An important and most likely active role in the pathogenesis of psoriasis has been attributed to changes in cutaneous blood vessels. The purpose of this study was to use confocal laser-scanning microscopy (CLSM) to investigate dermal capillaries in psoriatic and normal skin. The structures of the capillary loops in 5 healthy participants were compared with those in affected skin of 13 psoriasis patients. The diameters of the capillaries and papillae were measured for each group with CLSM. All investigated psoriasis patients showed elongated, widened, and tortuous microvessels in the papillary dermis, whereas all healthy controls showed a single capillary loop in each dermal papilla. The capillaries of the papillary loop and the dermal papilla were significantly enlarged in the psoriatic skin lesions (diameters 24.39±2.34 and 146.46±28.52 μm, respectively) in comparison to healthy skin (diameters 9.53±1.8 and 69.48±17.16 μm, respectively) (P<0.001). CLSM appears to represent a promising noninvasive technique for evaluating dermal capillaries in patients with psoriasis. The diameter of the vessels could be seen as a well-quantifiable indicator for the state of psoriatic skin. CLSM could be useful for therapeutic monitoring to delay possible recurrences.

Distribution of erlotinib in rash and normal skin in cancer patients receiving erlotinib visualized by matrix assisted laser desorption/ionization mass spectrometry imaging.

Science.gov (United States)

Nishimura, Meiko; Hayashi, Mitsuhiro; Mizutani, Yu; Takenaka, Kei; Imamura, Yoshinori; Chayahara, Naoko; Toyoda, Masanori; Kiyota, Naomi; Mukohara, Toru; Aikawa, Hiroaki; Fujiwara, Yasuhiro; Hamada, Akinobu; Minami, Hironobu

2018-04-06

The development of skin rashes is the most common adverse event observed in cancer patients treated with epidermal growth factor receptor-tyrosine kinase inhibitors such as erlotinib. However, the pharmacological evidence has not been fully revealed. Erlotinib distribution in the rashes was more heterogeneous than that in the normal skin, and the rashes contained statistically higher concentrations of erlotinib than adjacent normal skin in the superficial skin layer (229 ± 192 vs. 120 ± 103 ions/mm 2 ; P = 0.009 in paired t -test). LC-MS/MS confirmed that the concentration of erlotinib in the skin rashes was higher than that in normal skin in the superficial skin layer (1946 ± 1258 vs. 1174 ± 662 ng/cm 3 ; P = 0.028 in paired t -test). The results of MALDI-MSI and LC-MS/MS were well correlated (coefficient of correlation 0.879, P distribution of erlotinib in the skin tissue was visualized using non-labeled MALDI-MSI. Erlotinib concentration in the superficial layer of the skin rashes was higher than that in the adjacent normal skin. We examined patients with advanced pancreatic cancer who developed skin rashes after treatment with erlotinib and gemcitabine. We biopsied both the rash and adjacent normal skin tissues, and visualized and compared the distribution of erlotinib within the skin using matrix-assisted laser desorption/ionization mass spectrometry imaging (MALDI-MSI). The tissue concentration of erlotinib was also measured by liquid chromatography-tandem mass spectrometry (LC-MS/MS) with laser microdissection.

Diffuse Reflectance Spectroscopy of Human Skin Using a Commercial Fiber Optic Spectrometer

International Nuclear Information System (INIS)

Atencio, J. A. Delgado; Rodriguez, M. Cunill; Montiel, S. Vazquez y; Castro, Jorge; Rodriguez, A. Cornejo; Gutierrez, J. L.; Martinez, F.; Gutierrez, B.; Orozco, E.

2008-01-01

Diffuse reflectance spectroscopy is a reliable and easy to implement technique in human tissue characterization. In this work we evaluate the performance of the commercial USB4000 miniature fiber optic spectrometer in the in-vivo measurement of the diffuse reflectance spectra of different healthy skin sites and lesions in a population of 54 volunteers. Results show, that this spectrometer reproduces well the typical signatures of skin spectra over the 400-1000 nm region. Remarkable spectral differences exist between lesions and normal surrounding skin. A diffusion-based model was used to simulate reflectance spectra collected by the optical probe of the system

Skin perfusion measurement: the normal range, the effects of ambient temperature and its clinical application

International Nuclear Information System (INIS)

Henry, R.E.; Malone, J.M.; Daly, M.J.; Hughes, J.H.; Moore, W.S.

1982-01-01

Quantitation of skin perfusion provides objective criteria to determine the optimal amputation level in ischemic limb disease, to assess the maturation of pedicle flaps in reconstructive surgery, and to select appropriate treatment for chronic skin ulcers. A technique for measurement of skin perfusion using intradermal (ID) Xe-133 and a gamma camera/minicomputer system was previously reported. An update of this procedure is now reported, the normal range for the lower extremity in men, observations on the effects of ambient temperature, and an experience using the procedure to determine amputation level

Influence of water and salt solutions on UVB irradiation of normal skin and psoriasis

International Nuclear Information System (INIS)

Boer, J.; Schothorst, A.A.; Boom, B.; Suurmond, D.; Hermans, J.

1982-01-01

The influence of tap-water (TW) and salt solutions on the minimal erythema dose (MED) was investigated for normal human skin and uninvolved skin of psoriasis patients. MED (UVB) determinations on the forearm revealed that: (1) the MED definitely decreases whenever the arm is immersed in TW or NaCl solutions with a low concentration (4%) prior to UVB exposure, whereas almost saturated NaCl solution (26%), as well as locum Dead Sea water (LDSW), do not produce a change in the MED, and (2) the decrease in MED obtained by wetting the skin with TW was no longer present when the skin was allowed to dry for 20 min. A decrease in water uptake by skin (in vivo) and by callus (in vitro) was found as the salt concentration of the external solution increased. It is proposed that water taken up by the skin plays an important role in the sensitivity of the skin to UVB exposure. Bathing in TW or 4% NaCl prior to UVB exposure offered a slight to moderate improvement in psoriasis over UVB irradiation alone. Finally, it was shown that there is no obvious difference in clearance of the psoriatic skin between a bath in TW, 4% NaCl, or LDSW prior to UVB exposure. (orig.)

Mast cells are dispensable for normal and activin-promoted wound healing and skin carcinogenesis.

Science.gov (United States)

Antsiferova, Maria; Martin, Caroline; Huber, Marcel; Feyerabend, Thorsten B; Förster, Anja; Hartmann, Karin; Rodewald, Hans-Reimer; Hohl, Daniel; Werner, Sabine

2013-12-15

The growth and differentiation factor activin A is a key regulator of tissue repair, inflammation, fibrosis, and tumorigenesis. However, the cellular targets, which mediate the different activin functions, are still largely unknown. In this study, we show that activin increases the number of mature mast cells in mouse skin in vivo. To determine the relevance of this finding for wound healing and skin carcinogenesis, we mated activin transgenic mice with CreMaster mice, which are characterized by Cre recombinase-mediated mast cell eradication. Using single- and double-mutant mice, we show that loss of mast cells neither affected the stimulatory effect of overexpressed activin on granulation tissue formation and reepithelialization of skin wounds nor its protumorigenic activity in a model of chemically induced skin carcinogenesis. Furthermore, mast cell deficiency did not alter wounding-induced inflammation and new tissue formation or chemically induced angiogenesis and tumorigenesis in mice with normal activin levels. These findings reveal that mast cells are not major targets of activin during wound healing and skin cancer development and also argue against nonredundant functions of mast cells in wound healing and skin carcinogenesis in general.

Characterization of oily mature skin by biophysical and skin imaging techniques.

Science.gov (United States)

de Melo, M O; Maia Campos, P M B G

2018-02-13

The skin is a complex biological system and may suffer change according to the environmental factors, as higher temperatures can increase sebum excretion, presenting oiliness and acne. These alterations can persist during the aging and provoke more changes in aged skin. In this study we evaluated the mature oily skin characteristics using biophysical and skin imaging techniques. Sixty healthy female subjects, aged between 39 and 55 years old were recruited and separated into 2 groups according to their skin type: normal/dry and oily skin. The skin was evaluated in terms of stratum corneum water content, transepidermal water loss (TEWL) sebum content, dermis thickness and echogenicity, skin microrelief, and pores content. The mature oily skin presented no significant differences when compared to the normal/dry skin on the stratum corneum water content and TEWL parameters. The sebum content was significantly higher on the oily skin group. The microrelief analysis showed an increase of skin roughness values in the oily skin and increase of scaliness in the normal/dry skin. The oily skin showed lower dermis echogenicity mainly in the frontal region and higher dermis thickness when compared to normal/dry skin. The mature oily skin showed different characteristics from normal/dry skin in terms of sebum content, microrelief parameters, and dermis thickness. This way, the characterization of mature oily skin in an objective way is very important to development of dermocosmetic products for more effective treatments focused specially on this type of skin. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Nonablative fractional laser resurfacing in Asian skin--a review.

Science.gov (United States)

Sachdeva, Silonie

2010-12-01

Skin resurfacing has been a part of cosmetic dermatology for more than two decades now, and most of it has been ablative with traditional aggressive lasers including the CO(2) and erbium. The last few years have seen a revolutionary change with the invention of nonablative lasers for skin tightening. Fractional resurfacing is a new concept of cutaneous remodeling whereby laser-induced zones of microthermal injury are surrounded by normal untreated tissue that helps in quicker healing. The various wavelengths used are 1320, 1440, and 2940 nm with depth of penetration ranging from 25 μ to 1.2 mm. This article reviews the history of nonablative fractional laser resurfacing, its indications, contraindications, and a review of use in Asian skin with Fitzpatrick type III-VI. © 2010 Wiley Periodicals, Inc.

Ultrasonography of Skin Changes in Legs with Chronic Venous Disease.

Science.gov (United States)

Caggiati, A

2016-10-01

In daily practice, ultrasonography (US) is used only to designate the location and pattern of venous lesions. Skin US is not performed between routine venous investigations. Skin morphology is evaluated by the same probes used for routine Duplex evaluation of superficial veins. US findings from evident skin lesions are comparatively evaluated with those from the surrounding apparently normal skin and from the contralateral leg. Inflammation and dermal edema can be found in the apparently normal skin of C2 legs. Swollen legs show thickening of the subcutaneous layer as a result of diffuse soaking or anechoic cavities, with or without dermal edema. Chronic hypodermitis is characterized by inflammatory edema in initial phases, and by liposclerosis in advanced cases. Recrudescence of inflammation provokes focal rarefactions of the subcutaneous layer, possibly related to ulcer opening. In legs with venous disorders, sonography refines clinical evaluation of the skin and may reveal changes not highlighted by inspection. Some of these changes could require further investigation because they have not yet been explained or described. Skin sonography should improve knowledge of the natural history of skin changes, as well as contribute to a better grading of venous diseases severity In particular, US evidence of cutaneous and subcutaneous changes in C2 legs should be considered to stratify the treatment in C2 legs, by identifying those in which varicose veins are not simply a cosmetic problem. Copyright © 2016 European Society for Vascular Surgery. Published by Elsevier Ltd. All rights reserved.

Reconstructing in-vivo reflectance spectrum of pigmented skin lesion by Monte Carlo simulation

Science.gov (United States)

Wang, Shuang; He, Qingli; Zhao, Jianhua; Lui, Harvey; Zeng, Haishan

2012-03-01

In dermatology applications, diffuse reflectance spectroscopy has been extensively investigated as a promising tool for the noninvasive method to distinguish melanoma from benign pigmented skin lesion (nevus), which is concentrated with the skin chromophores like melanin and hemoglobin. We carried out a theoretical study to examine melanin distribution in human skin tissue and establish a practical optical model for further pigmented skin investigation. The theoretical simulation was using junctional nevus as an example. A multiple layer skin optical model was developed on established anatomy structures of skin, the published optical parameters of different skin layers, blood and melanin. Monte Carlo simulation was used to model the interaction between excitation light and skin tissue and rebuild the diffuse reflectance process from skin tissue. A testified methodology was adopted to determine melanin contents in human skin based on in vivo diffuse reflectance spectra. The rebuild diffuse reflectance spectra were investigated by adding melanin into different layers of the theoretical model. One of in vivo reflectance spectra from Junctional nevi and their surrounding normal skin was studied by compare the ratio between nevus and normal skin tissue in both the experimental and simulated diffuse reflectance spectra. The simulation result showed a good agreement with our clinical measurements, which indicated that our research method, including the spectral ratio method, skin optical model and modifying the melanin content in the model, could be applied in further theoretical simulation of pigmented skin lesions.

The effect of a daily facial cleanser for normal to oily skin on the skin barrier of subjects with acne.

Science.gov (United States)

Draelos, Zoe D

2006-07-01

Acne vulgaris is a common skin disorder that affects many people every year, especially the teenaged population. People with acne find the condition especially difficult to manage because of the disease's chronicity and variability in response to treatment. Acne is the result of pores clogged with shed skin cells combined with sebum in the hair follicle. Successful treatment of acne is important because acne has the potential to result in lasting physical and emotional scarring. For many years, physicians have agreed that although cleansing is not effective on its own, effective cleansing is an important part of any acne treatment regimen. However, patients have not been satisfied with the types of cleansers available. In addition to containing dyes and perfumes that can irritate and exacerbate acne, these cleansers often are too harsh and can result in excessive drying of the skin, which leads to overcompensation by the oil glands and ultimately to more oil on the surface of the skin. This study examined the use of a daily facial cleanser formulated for normal to oily skin in subjects with mild facial acne. The cleanser was studied for 2 weeks in the absence of additional treatments to eliminate the confounding effects of various treatments. Subjects were monitored for skin barrier function through transepidermal water loss (TEWL) and corneometry, sebum level, and lesion counts. The results of the study indicate that the facial cleanser is gentle and does not damage the skin barrier or result in sebum overcompensation; additionally, the cleanser is effective at deep-pore cleansing, which may help to manage some acne-associated symptoms.

Ultrastructural changes in human skin after exposure to a pulsed laser

Energy Technology Data Exchange (ETDEWEB)

Nakagawa, H.; Tan, O.T.; Parrish, J.A.

1985-05-01

Selective vascular injury following irradiation using a pulsed laser source at 577 nm was examined using ultrastructural methods in the skin of 3 fair-skinned healthy human volunteers. This vascular-specific damage was confined to the papillary dermis. Red blood cells were altered in several ways. As well as an increase in the electron density, configurational distortion modified the normal biconcave forms to ameboid structures. The most interesting finding was the appearance within these altered cells of well-defined circular/oval electron-lucent areas of 800 A diameter, possibly representing a heat-fixed record of steam formation within the red blood cell. In addition, considerable degenerative changes were evident in endothelial cells and pericytes, while mast cells, neutrophils, histiocytes, and fibroblasts as well as collagen bundles immediately surrounding most laser-damaged blood vessels appeared normal.

A comparison study of lipid profile levels between skin tags affected people and normal population in Tehran, Iran

Directory of Open Access Journals (Sweden)

Abbas Rasi

2014-01-01

Full Text Available Background: For many years the association of skin tags and endocrynopathies has been postulated, although many reports are available but it has never been evaluated to mean normal population. Dyslipidemia is a frequent disorder among people and seemed to be necessary for screening within skin tag condition. This study is designed to find any possible association between skin tags and dyslipidemia. Materials and Methods: From April 2009 to June 2011, 168 patients enrolled the study. Among the remaining 152 patients, there were 89 females (58.5% and 63 males (%41.5. Based on the TLGS study 136 men and 220 women enrolled the control group of study. The mean age was 28.4 years. Patients trained to have normal free diet for at least 1 month then referred to the laboratory. Blood samples were taken over 12 hours fasting with 2 hours intervals. Hypertriglyceridemia was defined as plasma level ≥160 mg/dl for men and ≥130 mg/dl for women. Hypercholesterolemia pointed at its value >200 mg/dl. Normal HDL levels was defined as >39 mg/dl for men and >35 mg/dl to women. Results: Mean skin tag number was 12.6 per subject. The most frequent localizations of skin tags were neck and upper chest (mean number: 13.4, 48.9% followed by axilla (mean number: 11.6, 33% and breast (10.2, 10.1% in the patient group. The mean cholesterol level of case group was 192.2 ± 33.1 mg/dl, while it was 187.0 ± 42 mg/dl in the control group. The mean ± SD for triglyceride was 132.1 ± 69 mg/dl in comparison to 129 ± 74 in the control group. Conclusion: The study showed no significant differences between normal population and patients′ lipid profile.

Q-switched ruby laser irradiation of normal human skin. Histologic and ultrastructural findings.

Science.gov (United States)

Hruza, G J; Dover, J S; Flotte, T J; Goetschkes, M; Watanabe, S; Anderson, R R

1991-12-01

The Q-switched ruby laser is used for treatment of tatoos. The effects of Q-switched ruby laser pulses on sun-exposed and sun-protected human skin, as well as senile lentigines, were investigated with clinical observation, light microscopy, and transmission electron microscopy. A pinpricklike sensation occurred at radiant exposures as low as 0.2 J/cm2. Immediate erythema, delayed edema, and immediate whitening occurred with increasing radiant exposure. The threshold for immediate whitening varied inversely with skin pigmentation, ranging from a mean of 1.4 J/cm2 in lentigines to 3.1 J/cm2 in sun-protected skin. Transmission electron microscopy showed immediate alteration of mature melanosomes and nuclei within keratinocytes and melanocytes, but stage I and II melanosomes were unaffected. Histologically, immediate injury was confined to the epidermis. There was minimal inflammatory response 1 day after exposure. After 1 week, subthreshold exposures induced hyperpigmentation, with epidermal hyperplasia and increased melanin staining noted histologically. At higher radiant exposures, hypopigmentation occurred with desquamation of a pigmented scale/crust. All sites returned to normal skin color and texture without scarring within 3 to 6 months. These observations suggest that the human skin response to selective photothermolysis of pigmented cells is similar to that reported in animal models, including low radiant exposure stimulation of melanogenesis and high radiant exposure lethal injury to pigmented epidermal cells.

Radiosensitivity of fibroblasts obtained from a cafe-au-lait spot and normal-appearing skin of a patient with neurofibromatosis (NF-6)

International Nuclear Information System (INIS)

Hannan, M.A.; Smith, B.P.; Sigut, D.; Sackey, K.

1990-01-01

Fibroblast cells derived from a cafe-au-lait spot and normal-appearing skin of a neurofibromatosis (NF-6) patient were studied for radiosensitivity in comparison with two normal cell lines used as controls. No difference in radiosensitivity was observed between the patient's cell lines and the controls using acute gamma-irradiation. However, a markedly increased radiosensitivity of the fibroblasts obtained from the patient's skin of normal appearance was demonstrated after chronic gamma-irradiation. The cells from the cafe-au-lait spot showed intermediate sensitivity to chronic irradiation as compared with the control cell lines and the fibroblasts derived from the normal skin of the patient. These results showed the usefulness of chronic irradiation in detecting increased cellular radiosensitivity which may result from a unique DNA repair defect in an NF patient. We suggest that enhanced genetic changes in radiosensitive NF patients may lead to formation of cafe-au-lait lesions and certain tumors. Such a transformation may be associated with production of radiotolerant cells

Diffuse reflectance imaging for non-melanoma skin cancer detection using laser feedback interferometry

Science.gov (United States)

Mowla, Alireza; Taimre, Thomas; Lim, Yah L.; Bertling, Karl; Wilson, Stephen J.; Prow, Tarl W.; Soyer, H. P.; Rakić, Aleksandar D.

2016-04-01

We propose a compact, self-aligned, low-cost, and versatile infrared diffuse-reflectance laser imaging system using a laser feedback interferometry technique with possible applications in in vivo biological tissue imaging and skin cancer detection. We examine the proposed technique experimentally using a three-layer agar skin phantom. A cylindrical region with a scattering rate lower than that of the surrounding normal tissue was used as a model for a non-melanoma skin tumour. The same structure was implemented in a Monte Carlo computational model. The experimental results agree well with the Monte Carlo simulations validating the theoretical basis of the technique. Results prove the applicability of the proposed technique for biological tissue imaging, with the capability of depth sectioning and a penetration depth of well over 1.2 mm into the skin phantom.

Characterization of Ninjurin and TSC22 induction after X-irradiation of normal human skin cells

International Nuclear Information System (INIS)

Koike, Manabu; Ninomiya, Yasuharu; Koike, Aki

2008-01-01

The skin is an external organ that is most frequently exposed to radiation. It is important to elucidate the influence of radiation exposure on the skin at the molecular level. To identify radiation-responsive genes in human skin cells, we used microarray technology to examine the effects of irradiation on 641 genes in normal human epidermal keratinocytes at 4 h and 8 h postirradiation with a cytotoxic dose of X-ray (10 Gy). We found that 18 genes were upregulated and 35 genes were downregulated in keratinocytes at 4 h and/or 8 h postirradiation. Ninjurin, whose function remains unknown in keratinocytes, was induced most strongly by X-irradiation. Several known apoptosis-related genes, such as TSC22, were also upregulated. We characterized Ninjurin and TSC22 induction after X-irradiation of normal human skin cells. The induction of the expression of Ninjurin and TSC22 mRNA in keratinocytes following high-dose X-irradiation was confirmed by northern blot analysis. In dermal fibroblasts, Ninjurin, but not TSC22, was induced after X-ray irradiation. The dependence of both gene expression on the status of an apoptosis regulator, p53, was found. In addition, the expression of both mRNA was induced upon treatment with an apoptosis inducer, etoposide. On the other hand, TSC22, but not Ninjurin, was induced and accumulated in keratinocytes upon treatment with an apoptosis inducer, anisomycin. However, in transient expression assay, EYFP-TSC22, as well as EYFP-Ninjurin or EYFP alone, did not induce apoptosis in keratinocytes in contrast to EYFP-GADD45. Taken together, these findings have important implications on the understanding of the mechanism underlying the complex response of skin cells following X-irradiation. (author)

Elemental concentration in normal skin and fibroepithelial polip lesions by synchrotron radiation total reflection X-ray fluorescence technique

International Nuclear Information System (INIS)

Soares, Julio C.A.C.R.; Canellas, Catarine G.L.; Lopes, Ricardo T.; Anjos, Marcelino J.

2011-01-01

In this work, the concentrations of trace elements were measured in acrochordon, a skin lesion also known as skin tag or fibroepithelial polyp, as well as in normal skin from the same patient. The samples were analysed by Synchrotron Radiation Total Reflection X- ray Fluorescence (SRTXRF) in the Synchrotron Light National Laboratory (LNLS) in Campinas/Sao Paulo-Brazil. The collection of lesion and healthy skin samples, including papillary dermis and epidermis, has involved 17 patients. It was evaluated the presence of P, S, Cl, K, Ca, Cr, Mn, Fe, Cu, Zn, Br and Rb in the paired samples, which were compared, and significant differences were found in some of them. (author)

Distribution and ultrastructure of pigment cells in the skins of normal and albino adult turbot, Scophthalmus Maximus

Institute of Scientific and Technical Information of China (English)

GUO Huarong; HUANG Bing; QI Fei; ZHANG Shicui

2007-01-01

The distribution and ultrastructure of pigment cells in skins of normal and albino adult turbots were examined with transmission electron microscopy (TEM). Three types of pigment cells of melanophore, iridophore and xanthophore have been recognized in adult turbot skins. The skin color depends mainly on the amount and distribution of melanophore and iridophore, as xanthophore is quite rare. No pigment cells can be found in the epidermis of the skins. In the pigmented ocular skin of the turbot, melanophore and iridophore are usually co-localized in the dermis. This is quite different from the distribution in larvae skin. In albino and white blind skins of adult turbots, however, only iridophore monolayer still exists, while the melanophore monolayer disappears. This cytological evidence explains why the albino adult turbot, unlike its larvae, could never resume its body color no matter what environmental and nutritional conditions were provided. Endocytosis is quite active in the cellular membrane of the iridophore. This might be related to the formation of reflective platelet and stability of the iridophore.

Targeted Therapy in Nonmelanoma Skin Cancers

International Nuclear Information System (INIS)

Spallone, Giulia; Botti, Elisabetta; Costanzo, Antonio

2011-01-01

Nonmelanoma skin cancer (NMSC) is the most prevalent cancer in light-skinned populations, and includes mainly Basal Cell Carcinomas (BCC), representing around 75% of NMSC and Squamous Cell Carcinomas (SCC). The incidence of these tumors is continuously growing. It was found that the overall number of procedures for NMSC in US rose by 76%, from 1,158,298 in 1992 to 2,048,517 in 2006. Although mortality from NMSC tends to be very low, clearly the morbidity related to these skin cancers is very high. Treatment options for NMSC include both surgical and nonsurgical interventions. Surgery was considered the gold standard therapy, however, advancements in the knowledge of pathogenic mechanisms of NMSCs led to the identification of key targets for drug intervention and to the consequent development of several targeted therapies. These represent the future in treatment of these common forms of cancer ensuring a high cure rate, preservation of the maximal amount of normal surrounding tissue and optimal cosmetic outcome. Here, we will review recent advancements in NMSC targeted therapies focusing on BCC and SCC

Targeted Therapy in Nonmelanoma Skin Cancers

Directory of Open Access Journals (Sweden)

Giulia Spallone

2011-05-01

Full Text Available Nonmelanoma skin cancer (NMSC is the most prevalent cancer in light-skinned populations, and includes mainly Basal Cell Carcinomas (BCC, representing around 75% of NMSC and Squamous Cell Carcinomas (SCC. The incidence of these tumors is continuously growing. It was found that the overall number of procedures for NMSC in US rose by 76%, from 1,158,298 in 1992 to 2,048,517 in 2006. Although mortality from NMSC tends to be very low, clearly the morbidity related to these skin cancers is very high. Treatment options for NMSC include both surgical and nonsurgical interventions. Surgery was considered the gold standard therapy, however, advancements in the knowledge of pathogenic mechanisms of NMSCs led to the identification of key targets for drug intervention and to the consequent development of several targeted therapies. These represent the future in treatment of these common forms of cancer ensuring a high cure rate, preservation of the maximal amount of normal surrounding tissue and optimal cosmetic outcome. Here, we will review recent advancements in NMSC targeted therapies focusing on BCC and SCC.

The measurement of skin impedance for the diagnosis of skin cancer

International Nuclear Information System (INIS)

Menzies, S.; Crook, B.; McCarthy, W.

1996-01-01

Full text: In vivo skin impedance measurements have been reported to be diagnostic in differentiating benign from malignant skin tumours (Kiss G et al. Borgyogy Vener Szle 45: 164,1969; Melczer N. In: Cancer of the Skin. Saunders Co. Philadelphia, 1976, pp293-313). However, in contrast to non-melanoma skin cancer, only, a small sample of malignant melanomas were reported in these previous studies. We performed skin impedance measurements on a larger sample of melanomas in order to assess the potential use of such instrumentation for clinical diagnosis. The diagnostic method described by Kiss and Horvath was reproduced with only minor modifications. Low voltage impedance measurements at 1600 Hz were taken over each lesion and on nearby surrounding normal skin. Filter paper (4mm diameter) soaked in 0.1 M KCl was used at the skin-probe interface. A minimum of 2 skin and 1 lesion measurements were taken. All lesions were taken from relatively hairless sites and were non abraded or ulcerated. With the exception of 6 seborrhoeic keratoses all lesions were excised for histological diagnosis. The lesions tested were 27 invasive melanomas, 3 in situ melanomas, 27 basal cell carcinomas (BCC), 70 benign melanocytic lesions, 19 seborrhoeic keratoses, 5 Bowens disease (in situ SCC), 1 squamous cell carcinoma (SCC) and 25 other benign lesions. Results were interpreted as previously (Melczer) by the quotient of skin impedance / lesion impedance > 1.5 indicating malignancy. Analysis of total melanocytic lesions gave a sensitivity of 44% and specificity of 83% for the diagnosis of invasive melanoma (p < 0.05). Fifty two percent of BCCs were positively diagnosed. Analysis of all benign versus all invasive malignancy gave a sensitivity of 47% and specificity of 77% for the diagnosis of invasive malignancy (p < 0.01). While impedance measurements at 1600 Hz provide a statistically significant differentiation of melanoma versus non-melanoma and invasive malignancy versus benign lesions

The Use of Matriderm and Autologous Skin Graft in the Treatment of Full Thickness Skin Defects

Directory of Open Access Journals (Sweden)

Jang Hwan Min

2014-07-01

Full Text Available Background For patients with full thickness skin defects, autologous Split-thickness skin grafts (STSG are generally regarded as the mainstay of treatment. However, skin grafts have some limitations, including undesirable outcomes resulting from scars, poor elasticity, and limitations in joint movement due to contractures. In this study, we present outcomes of Matriderm grafts used for various skin tissue defects whether it improves on these drawbacks. Methods From January 2010 to March 2012, a retrospective review of patients who had undergone autologous STSG with Matriderm was performed. We assessed graft survival to evaluate the effectiveness of Matriderm. We also evaluated skin quality using a Cutometer, Corneometer, Tewameter, or Mexameter, approximately 12 months after surgery. Results A total of 31 patients underwent STSG with Matriderm during the study period. The success rate of skin grafting was 96.7%. The elasticity value of the portion on which Matriderm was applied was 0.765 (range, 0.635-0.800, the value of the trans-epidermal water loss (TEWL was 10.0 (range, 8.15-11.00 g/hr/m2, and the humidification value was 24.0 (range, 15.5-30.0. The levels of erythema and melanin were 352.0 arbitrary unit (AU (range, 299.25-402.75 AU and 211.0 AU (range, 158.25-297.00 AU, respectively. When comparing the values of elasticity and TEWL of the skin treated with Matriderm to the values of the surrounding skin, there was no statistically significant difference between the groups. Conclusions The results of this study demonstrate that a dermal substitute (Matriderm with STSG was adopted stably and with minimal complications. Furthermore, comparing Matriderm grafted skin to normal skin using Cutometer, Matriderm proved valuable in restoring skin elasticity and the skin barrier.

Expression and Localization of Peroxisome Proliferator-Activated Receptors and Nuclear Factor κB in Normal and Lesional Psoriatic Skin

DEFF Research Database (Denmark)

Westergaard, Majken; Henningsen, Jeanette; Johansen, Claus

2003-01-01

Abnormal epidermal proliferation and differentiation characterize the inflammatory skin disease psoriasis. Here we demonstrate that expression of PPARdelta mRNA and protein is markedly upregulated in psoriatic lesions and that lipoxygenase products accumulating in psoriatic lesions are potent...... activators of PPARdelta. The expression levels of NF-kappaB p50 and p65 were not significantly altered in lesional compared with nonlesional psoriatic skin. In the basal layer of normal epidermis both p50 and p65 were sequestered in the cytoplasm, whereas p50, but not p65, localized to nuclei...... in the suprabasal layers, and this distribution was maintained in lesional psoriatic skin. In normal human keratinocytes PPAR agonists neither impaired IL-1beta-induced translocation of p65 nor IL-1beta-induced NF-kappaB DNA binding. We show that PPARdelta physically interacts with the N-terminal Rel homology...

Normal tissue tolerance to external beam radiation therapy: Skin

International Nuclear Information System (INIS)

Ginot, A.; Doyen, J.; Hannoun-Levi, J.M.; Courdi, A.

2010-01-01

Acute skin toxicity is frequent during radiation therapy and can lead to temporary arrest of the treatment. Chronic toxicity can occur and conduct to cosmetic problems. Alopecia is the most frequent toxicity concerning hair and is most of the time reversible. Several factors linked to patients influence skin toxicity, such as under-nutrition, old age, obesity, smoking, skin diseases, autoimmune diseases, failure of DNA reparation. Skin, hair and nail toxicities depend also on radiation schedule. Acute toxicity is greater when dose per fraction increases. Chronic and acute toxicities are more often when total dose increases. Under 45 Gy, the risk of severe skin toxicity is low, and begins above 50 Gy. Skin toxicity depends also on the duration of radiotherapy and split course schedules are associated with less toxicities. Irradiation surface seems to influence skin toxicity but interaction is more complex. Reirradiation is often feasible in case of cancer recurrence but with a risk of grade 3-4 toxicity above all in head and neck cancer. The benefit/risk ratio has to be always precisely evaluated. Permanent alopecia is correlated with the follicle dose. Modern techniques of radiation therapy allow to spare skin. (authors)

Macro-environment of breast carcinoma: frequent genetic alterations in the normal appearing skins of patients with breast cancer.

Science.gov (United States)

Moinfar, Farid; Beham, Alfred; Friedrich, Gerhard; Deutsch, Alexander; Hrzenjak, Andelko; Luschin, Gero; Tavassoli, Fattaneh A

2008-05-01

Genetic abnormalities in microenvironmental tissues with subsequent alterations of reciprocal interactions between epithelial and mesenchymal cells play a key role in the breast carcinogenesis. Although a few reports have demonstrated abnormal fibroblastic functions in normal-appearing fibroblasts taken from the skins of breast cancer patients, the genetic basis of this phenomenon and its implication for carcinogenesis are unexplored. We analyzed 12 mastectomy specimens showing invasive ductal carcinomas. In each case, morphologically normal epidermis and dermis, carcinoma, normal stroma close to carcinoma, and stroma at a distant from carcinoma were microdissected. Metastatic-free lymphatic tissues from lymph nodes served as a control. Using PCR, DNA extracts were examined with 11 microsatellite markers known for a high frequency of allelic imbalances in breast cancer. Losses of heterozygosity and/or microsatellite instability were detected in 83% of the skin samples occurring either concurrently with or independently from the cancerous tissues. In 80% of these cases at least one microsatellite marker displayed loss of heterozygosity or microsatellite instability in the skin, which was absent in carcinoma. A total of 41% of samples showed alterations of certain loci observed exclusively in the carcinoma but not in the skin compartments. Our study suggests that breast cancer is not just a localized genetic disorder, but rather part of a larger field of genetic alterations/instabilities affecting multiple cell populations in the organ with various cellular elements, ultimately contributing to the manifestation of the more 'localized' carcinoma. These data indicate that more global assessment of tumor micro- and macro-environment is crucial for our understanding of breast carcinogenesis.

Mast cells and atopic dermatitis. Stereological quantification of mast cells in atopic dermatitis and normal human skin

DEFF Research Database (Denmark)

Damsgaard, T E; Olesen, A B; Sørensen, Flemming Brandt

1997-01-01

Stereological quantification of mast cell numbers was applied to sections of punch biopsies from lesional and nonlesional skin of atopic dermatitis patients and skin of healthy volunteers. We also investigated whether the method of staining and/or the fixative influenced the results...... of the determination of the mast cell profile numbers. The punch biopsies were taken from the same four locations in both atopic dermatitis patients and normal individuals. The locations were the scalp, neck and flexure of the elbow (lesional skin), and nates (nonlesional skin). Clinical scoring was carried out...... at the site of each biopsy. After fixation and plastic embedding, the biopsies were cut into 2 microns serial sections. Ten sections, 30 microns apart, from each biopsy were examined and stained alternately with either toluidine blue or Giemsa stain and mast cell profile numbers were determined. The study...

In vivo study of the human skin by the method of laser-induced fluorescence spectroscopy

International Nuclear Information System (INIS)

Borisova, E.; Avramov, L.

2000-01-01

The goals of this study are to perform a preliminary evaluation of the diagnostic potential of noninvasive laser-induced auto-fluorescence spectroscopy (LIAFS) for human skin and optimize of detection and diagnosis of hollow organs and skin. In recent years, there has been growing interest in the use of laser-induced fluorescence to discriminate disease from normal surrounding tissue. The most fluorescence studies have used exogenous fluorophores of this discrimination. The laser-induced auto-fluorescence which is used for diagnosis of tissues in the human body avoids administration of any drugs. In this study a technique for optical biopsy of in vivo human skin is presented. The auto-fluorescence characterization of tissue relies on different spectral properties of tissues. It was demonstrated a differentiation between normal skin and skin with vitiligo. Two main endogenous fluorophores in the human skin account for most of the cellular auto-fluorescence for excitation wavelength 337 nm reduced from of nicotinamide adenine dinucleotide and collagen. The auto-fluorescence spectrum of human skin depend on main internal absorbers which are blood and melanin. In this study was described the effect caused by blood and melanin content on the shape of the auto-fluorescence spectrum of human skin. Human skin fluorescence spectrum might provide dermatologists with important information and such investigations are successfully used now in skin disease diagnostics, in investigation of the environmental factor impact or for evaluation of treatment efficiency. (authors)

Nonlinear spectral imaging of human normal skin, basal cell carcinoma and squamous cell carcinoma based on two-photon excited fluorescence and second-harmonic generation

Science.gov (United States)

Xiong, S. Y.; Yang, J. G.; Zhuang, J.

2011-10-01

In this work, we use nonlinear spectral imaging based on two-photon excited fluorescence (TPEF) and second harmonic generation (SHG) for analyzing the morphology of collagen and elastin and their biochemical variations in basal cell carcinoma (BCC), squamous cell carcinoma (SCC) and normal skin tissue. It was found in this work that there existed apparent differences among BCC, SCC and normal skin in terms of their thickness of the keratin and epithelial layers, their size of elastic fibers, as well as their distribution and spectral characteristics of collagen. These differences can potentially be used to distinguish BCC and SCC from normal skin, and to discriminate between BCC and SCC, as well as to evaluate treatment responses.

Merkel cells are long-lived cells whose production is stimulated by skin injury✰

Science.gov (United States)

Wright, Margaret C.; Logan, Gregory J.; Bolock, Alexa M.; Kubicki, Adam C.; Hemphill, Julie A.; Sanders, Timothy A.; Maricich, Stephen M.

2017-01-01

Mechanosensitive Merkel cells are thought to have finite lifespans, but controversy surrounds the frequency of their replacement and which precursor cells maintain the population. We found by embryonic EdU administration that Merkel cells undergo terminal cell division in late embryogenesis and survive long into adulthood. We also found that new Merkel cells are produced infrequently during normal skin homeostasis and that their numbers do not change during natural or induced hair cycles. In contrast, live imaging and EdU experiments showed that mild mechanical injury produced by skin shaving dramatically increases Merkel cell production. We confirmed with genetic cell ablation and fate-mapping experiments that new touch dome Merkel cells in adult mice arise from touch dome keratinocytes. Together, these independent lines of evidence show that Merkel cells in adult mice are long-lived, are replaced rarely during normal adult skin homeostasis, and that their production can be induced by repeated shaving. These results have profound implications for understanding sensory neurobiology and human diseases such as Merkel cell carcinoma. PMID:27998808

Merkel cells are long-lived cells whose production is stimulated by skin injury.

Science.gov (United States)

Wright, Margaret C; Logan, Gregory J; Bolock, Alexa M; Kubicki, Adam C; Hemphill, Julie A; Sanders, Timothy A; Maricich, Stephen M

2017-02-01

Mechanosensitive Merkel cells are thought to have finite lifespans, but controversy surrounds the frequency of their replacement and which precursor cells maintain the population. We found by embryonic EdU administration that Merkel cells undergo terminal cell division in late embryogenesis and survive long into adulthood. We also found that new Merkel cells are produced infrequently during normal skin homeostasis and that their numbers do not change during natural or induced hair cycles. In contrast, live imaging and EdU experiments showed that mild mechanical injury produced by skin shaving dramatically increases Merkel cell production. We confirmed with genetic cell ablation and fate-mapping experiments that new touch dome Merkel cells in adult mice arise from touch dome keratinocytes. Together, these independent lines of evidence show that Merkel cells in adult mice are long-lived, are replaced rarely during normal adult skin homeostasis, and that their production can be induced by repeated shaving. These results have profound implications for understanding sensory neurobiology and human diseases such as Merkel cell carcinoma. Copyright © 2016 Elsevier Inc. All rights reserved.

Incorporation of 14C-linoleic acid in lipids of normal and psoriatic human skin

International Nuclear Information System (INIS)

Ruestow, B.; Metz, D.; Kunze, D.; Meffert, H.

1980-01-01

The 14 C-linoleic acid incorporation in lipids of surviving epidermis and corium of normal and psoriatic human skin was investigated. Changes of lipid metabolism were found in both epidermis and corium. Particularly the turnover of phospholipids was increased in the uninvolved psoriatic epidermis in relation to the involved psoriatic epidermis or to healthy controls. Possible reasons of these phenomena and the significance of structural lipids in psoriasis are discussed. (author)

Experiment K-7-29: Connective Tissue Studies. Part 1; Rat Skin, Normal and Repair

Science.gov (United States)

Vailas, A. C.; Grindeland, R.; Ashman, R.; Choy, V.; Durnova, G.; Graf, B.; Griffith, P.; Kaplansky, A. S.; Kolis, S.; Martinez, D.;

A Comparison of the Local Flap and Skin Graft by Location of Face in Reconstruction after Resection of Facial Skin Cancer.

Science.gov (United States)

Lee, Kyung Suk; Kim, Jun Oh; Kim, Nam Gyun; Lee, Yoon Jung; Park, Young Ji; Kim, Jun Sik

2017-12-01

Surgery for reconstruction of defects after surgery should be performed selectively and the many points must be considered. The authors conducted this study to compare the local flap and skin graft by facial location in the reconstruction after resection of facial skin cancer. The authors performed the study in patients that had received treatment in Department of Plastic Surgery, Gyeongsang National University. The cases were analyzed according to the reconstruction methods for the defects after surgery, sex, age, tumor site, and tumor size. Additionally, the authors compared differences of aesthetic satisfaction (out of 5 points) of patients in the local flap and skin graft by facial location after resection of facial skin cancer by dividing the face into eight areas. A total of 153 cases were confirmed. The most common facial skin cancer was basal cell carcinoma (56.8%, 87 cases), followed by squamous cell carcinoma (37.2%, 57 cases) and bowen's disease (5.8%, 9 cases). The most common reconstruction method was local flap 119 cases (77.7%), followed by skin graft 34 cases (22.3%). 86 patients answered the questionnaire and mean satisfaction of the local flap and skin graft were 4.3 and 3.5 ( p =0.04), respectively, indicating that satisfaction of local flap was significantly high. When comparing satisfaction of patients according to results, local flap shows excellent effects in functional and cosmetic aspects would be able to provide excellent results rather than using a skin graft with poor touch and tone compared to the surrounding normal skin.

Modifications of center-surround, spot detection and dot-pattern selective operators

NARCIS (Netherlands)

Petkov, Nicolai; Visser, Wicher T.

2005-01-01

This paper describes modifications of the models of center-surround and dot-pattern selective cells proposed previously. These modifications concern mainly the normalization of the difference of Gaussians (DoG) function used to model center-surround receptive fields, the normalization of

Anti-oxidant defence mechanism in vitiliginous skin increases with skin type

NARCIS (Netherlands)

Briganti, S.; Caron-Schreinemachers, A.-L. D. B.; Picardo, M.; Westerhof, W.

2012-01-01

Background Vitiligo skin shows different burning capacity in people with different phototype. In normal skin antioxidant status is correlated to skin phototype, but unexpectedly it appears that there is a gradual decrease in burning susceptibility of depigmented skin of individuals with increasing

Comparison of skin barrier function and sensory nerve electric current perception threshold between IgE-high extrinsic and IgE-normal intrinsic types of atopic dermatitis.

Science.gov (United States)

Mori, T; Ishida, K; Mukumoto, S; Yamada, Y; Imokawa, G; Kabashima, K; Kobayashi, M; Bito, T; Nakamura, M; Ogasawara, K; Tokura, Y

2010-01-01

Background Two types of atopic dermatitis (AD) have been proposed, with different pathophysiological mechanisms underlying this seemingly heterogeneous disorder. The extrinsic type shows high IgE levels presumably as a consequence of skin barrier damage and feasible allergen permeation, whereas the intrinsic type exhibits normal IgE levels and is not mediated by allergen-specific IgE. Objectives To investigate the relationship between pruritus perception threshold and skin barrier function of patients with AD in a comparison between the extrinsic and intrinsic types. Methods Enrolled in this study were 32 patients with extrinsic AD, 17 with intrinsic AD and 24 healthy individuals. The barrier function of the stratum corneum was assessed by skin surface hydration and transepidermal water loss (TEWL), and pruritus perception was evaluated by the electric current perception threshold (CPT) of sensory nerves upon neuroselective transcutaneous electric stimulation. Results Skin surface hydration was significantly lower and TEWL was significantly higher in extrinsic AD than intrinsic AD or normal controls. Although there was no statistically significant difference in CPT among extrinsic AD, intrinsic AD and normal controls, CPT was significantly correlated with skin surface hydration and inversely with TEWL in intrinsic AD and normal controls, but not extrinsic AD. Finally, CPT was correlated with the visual analogue scale of itch in the nonlesional skin of patients with extrinsic but not intrinsic AD. Conclusions Patients with extrinsic AD have an impaired barrier, which increases the pre-existing pruritus but rather decreases sensitivity to external stimuli. In contrast, patients with intrinsic AD retain a normal barrier function and sensory reactivity to external pruritic stimuli.

Action spectra for inactivation of normal and xeroderma pigmentosum human skin fibroblasts by ultraviolet radiations

International Nuclear Information System (INIS)

Keyse, S.M.; Moss, S.H.; Davies, D.J.G.

1983-01-01

Action spectra for UV-induced lethality as measured by colony forming ability were determined both for a normal human skin fibroblast strain (1BR) and for an excision deficient xeroderma pigmentosum strain (XP4LO) assigned to complementation group A using 7 monochromatic wavelengths in the range 254-365 nm. The relative sensitivity of the XP strain compared to the normal skin fibroblasts shows a marked decrease at wavelengths longer than 313 nm, changing from a ratio of about 20 at the shorter wavelengths to just greater than 1.0 at the longer wavelengths. The action spectra thus indicate that the influence on cell inactivation of the DNA repair defect associated with XP cells is decreased and almost reaches zero at longer UV wavelengths. This would occur, for example, if the importance of pyrimidine dimers as the lethal lesion decreased with increasing wavelength. These results are consistent with pyrimidine dimers induced in DNA being the major lethal lesion in both cell strains over the wavelength range 254-313 nm. However, it is indicated that different mechanisms of inactivation operate at wavelengths longer than 313 nm. (author)

Survival of human diploid skin fibroblasts from normal individuals after X-irradiation

International Nuclear Information System (INIS)

Little, J.B.; Nove, J.; Strong, L.C.; Nichols, W.W.

1988-01-01

The cytotoxic effect of X-rays was measured by a colony formation assay in multiple experiments with fibroblast cell strains derived from 24 presumably normal individuals, received as 65 different coded and blinded samples. Each strain was received on two or more occasions at different times and bearing different codes. The means and standard deviations of the survival curve parameters for the 24 strains were: D 0 = 123 +- 23; D 10 = 273 +- 42 cGy. The D 0 ranged from 89 to 175 and the D 10 from 196 to 372 cGy. The degree of interexperimental variation, though generally minimal, differed considerably among cell strains. There was no systematic effect of passage level, cloning efficiency, serum lot, age or sex of the donor on X-ray survival. These results confirm that the intrinsic radiosensitivity varies significantly among skin fibroblasts isolated from clinically normal individuals, apparently owing to as yet unidentified genetic factors. (Author)

Fibroblast radiosensitivity versus acute and late normal skin responses in patients treated for breast cancer

International Nuclear Information System (INIS)

Brock, William A.; Tucker, Susan L.; Geara, Fady B.; Wike, Jennifer; Peters, Lester J.; Turesson, Ingela; Nyman, Jan

1995-01-01

Purpose/Objective: To determine if the radiosensitivity of normal human skin fibroblasts, measured in early passage cultures, is significantly correlated with the degree of acute or late normal skin damage in patients treated for breast cancer with radiotherapy. Methods and Materials: In the 1970s, a series of breast cancer patients was treated at the Department of Oncology in Gothenburg, Sweden with postoperative irradiation to the parasternal region. Patients were treated bilaterally using different fractionation schedules and doses to the right and left fields. Peak acute reactions were scored on a six-point scale, and skin erythema was measured by reflectance spectrophotometry. Telangiectasia was graded over time on a six-point scale. In April 1992, two small skin biopsies were obtained from 22 patients in two treatment groups (i.e., four dose-fractionation schedules) and, using either delayed or immediate plating, fibroblast radiosensitivity was measured in early passage cultures by clonogenic survival, after high and low dose-rate irradiations. Survival at 2.0 Gy (SF2) was calculated from complete survival curves. Results: To test assay reproducibility, SF2 values derived from paired biopsies of the same patient (12 cases) were compared. A reasonably good correlation (p = 0.075) was obtained for SF2s determined by high dose-rate irradiations with immediate plating, but not for delayed plating or low dose-rate treatments. The median coefficient of variation in the replicate SF2s after high dose-rate treatment and immediate plating was 13%, suggesting that the poor correlation in paired SF2 values is due to the magnitude of the uncertainty in SF2 relative to the overall spread in SF2 values between patients (CV = 28%). Individual SF2 values and averaged values from patients with data from two biopsies were compared with the acute and late clinical reactions. A significant negative correlation was found between SF2 and relative clinical response, but only when

Direct immunofluorescence of normal skin in rheumatoid arthritis.

Science.gov (United States)

Fitzgerald, O M; Barnes, L; Woods, R; McHugh, L; Barry, C; O'Loughlin, S

1985-11-01

The clinical significance of previously described immunoglobulin and complement deposition in the superficial dermal vessel walls of patients with rheumatoid arthritis is unknown. In the present study, skin biopsies were obtained from the normal forearm and buttock of 48 unselected patients with rheumatoid arthritis and were examined by direct immunofluorescence (IF) for the presence of immunoglobulin (IgG,A,M) and complement (C3) in the vessel walls. Deposits of C3, IgM or IgG were detected in 10 patients. Five patients had deposits at the forearm sample alone, four patients had deposits at both biopsy sites, while one patient was positive at the buttock alone. Clinical features were similar in patients with and without vessel IF. However, patients with IF were significantly more seropositive with lower levels of complement and raised levels of serum IgA and IgM. There was also an increased level of circulating IgG immune complexes in these patients. Further analysis following exclusion of seronegative patients revealed similar results. This study suggests that the presence of vessel IF identifies a subgroup of patients who have evidence of more severe immunological disturbance.

Skin Graft

OpenAIRE

Shimizu, Ruka; Kishi, Kazuo

2012-01-01

Skin graft is one of the most indispensable techniques in plastic surgery and dermatology. Skin grafts are used in a variety of clinical situations, such as traumatic wounds, defects after oncologic resection, burn reconstruction, scar contracture release, congenital skin deficiencies, hair restoration, vitiligo, and nipple-areola reconstruction. Skin grafts are generally avoided in the management of more complex wounds. Conditions with deep spaces and exposed bones normally require the use o...

Abnormally dark or light skin

Science.gov (United States)

Hyperpigmentation; Hypopigmentation; Skin - abnormally light or dark ... Normal skin contains cells called melanocytes. These cells produce melanin , the substance that gives skin its color. Skin with ...

Chemical peeling by SA-PEG remodels photo-damaged skin: suppressing p53 expression and normalizing keratinocyte differentiation.

Science.gov (United States)

Dainichi, Teruki; Amano, Satoshi; Matsunaga, Yukiko; Iriyama, Shunsuke; Hirao, Tetsuji; Hariya, Takeshi; Hibino, Toshihiko; Katagiri, Chika; Takahashi, Motoji; Ueda, Setsuko; Furue, Masutaka

2006-02-01

Chemical peeling with salicylic acid in polyethylene glycol vehicle (SA-PEG), which specifically acts on the stratum corneum, suppresses the development of skin tumors in UVB-irradiated hairless mice. To elucidate the mechanism through which chemical peeling with SA-PEG suppresses skin tumor development, the effects of chemical peeling on photodamaged keratinocytes and cornified envelopes (CEs) were evaluated in vivo. Among UVB-irradiated hairless mice, the structural atypia and expression of p53 protein in keratinocytes induced by UVB irradiation were intensely suppressed in the SA-PEG-treated mice 28 days after the start of weekly SA-PEG treatments when compared to that in the control UVB-irradiated mice. Incomplete expression of filaggrin and loricrin in keratinocytes from the control mice was also improved in keratinocytes from the SA-PEG-treated mice. In photo-exposed human facial skin, immature CEs were replaced with mature CEs 4 weeks after treatment with SA-PEG. Restoration of photodamaged stratum corneum by treatment with SA-PEG, which may affect remodeling of the structural environment of the keratinocytes, involved the normalization of keratinocyte differentiation and suppression of skin tumor development. These results suggest that the stratum corneum plays a protective role against carcinogenesis, and provide a novel strategy for the prevention of photo-induced skin tumors.

The examination of biophysical parameters of skin (transepidermal water loss, skin hydration and pH value) in different body regions of normal cats of both sexes.

Science.gov (United States)

Szczepanik, Marcin P; Wilkołek, Piotr M; Adamek, Lukasz R; Pomorski, Zbigniew J H

2011-04-01

The purpose of this study was to evaluate transepidermal water loss (TEWL), skin hydration and skin pH in normal cats. Twenty shorthaired European cats of both sexes were examined in the study. Measurements were taken from five different sites: the lumbar region, the axillary fossa, the inguinal region, the ventral abdominal region and the left thoracic region. In each of the regions, TEWL, skin hydration and skin pH were measured. The highest TEWL value was observed in the axillary fossa (18.22g/h/m(2)) and the lowest in the lumbar region (10.53g/h/m(2)). The highest skin hydration was found in the inguinal region (18.29CU) and the lowest in the lumbar region (4.62CU). The highest skin pH was observed in the inguinal region (6.64) and the lowest in the lumbar region (6.39). Statistically significant differences in TEWL were observed between the lumbar region and the left side of the thorax region (P=0.016), the axillary fossa (P=0.0004), the ventral region (P=0.005), and the inguinal region (P=0.009). There were significant differences in skin hydration between the lumbar region and the left thorax (P=0.000003), the axillary fossa (P=0.002), the ventral abdomen (P=0.03), and the inguinal region (P=0.0003) as well as between the thorax and the ventral abdomen (P=0.005). TEWL was higher in females (15g/h/m(2)) than in males (4.57g/h/m(2)). Skin hydration was higher in females (13.89CU) than in males (12.28CU). Significant differences were not found between males and females for TEWL and skin hydration. Skin pH was higher in males (6.94) than in females (6.54), which was significant (P=0.004). Crown Copyright © 2010. Published by Elsevier Ltd. All rights reserved.

Site, gender and age variation in normal skin colour on the back and the forearm: tristimulus colorimeter measurements.

Science.gov (United States)

Fullerton, A; Serup, J

1997-02-01

To study whether anatomical location and age and gender of subjects had any influence on the objective skin colour measurements. Baseline colour in prone position was measured with the Minolta ChromaMeter® in the upper, middle and lower level of the upper back and on the forearm of 168 volunteers. These two sites are commonly used in skin testing. Higher basal a* and lower basal L* levels were found on the upper scapular region compared to the lower scapular region and the subscapular region. The basal b* level showed no variation relative to site. The basal a* and the basal b* levels were lower on the forearm compared to the upper back while the basal L* level was higher. Females above 65 years showed a less coloured skin with lower values as compared to those of younger age. Females were found to have a generally lower basal a* level than males both on the upper back and forearm skin. These relatively major differences and sources of variation have to be considered when planning irritancy studies where colour differences between erythema and normal skin is used.

Expression and activity of arginase isoenzymes during normal and diabetes-impaired skin repair.

Science.gov (United States)

Kämpfer, Heiko; Pfeilschifter, Josef; Frank, Stefan

2003-12-01

Within the past years, an important role for nitric oxide (NO) in skin repair has been well defined. As NO is synthesized from L-arginine by NO synthases (NOS), the availability of L-arginine might be one rate-limiting factor of NO production at the wound site. Upon injury, arginase-1 and -2 mRNA, protein, and activity were strongly induced reaching a maximum between day 3 and day 7 postwounding. Immunohistochemistry colocalized both arginases and the inducible NOS (iNOS) at epithelial sites at the margins of the wound. Notably, diabetes-impaired skin repair in leptin-deficient mice (diabetes/diabetes, db/db; and obese/obese, ob/ob) was characterized by an abnormally elevated arginase activity in wound tissue in the absence of an expression of iNOS. Expression analyses demonstrated that arginase-1 contributed to increased arginase activities in impaired repair. Interestingly, an improved healing of chronic wound situations in leptin-supplemented ob/ob mice was strongly associated with an adjustment of the dysregulated expression of L-arginine-converting enzymes: an attenuated iNOS expression was upregulated early in repair and an augmented arginase-1 expression and activity was downregulated in the presence of markedly elevated numbers of macrophages during late repair. These data suggest a coordinated consumption of L-arginine by the NOS and arginase enzymatic pathways at the wound site as a prerequisite for a balanced NO (via iNOS) and polyamine (via arginases) synthesis that drives a normal skin repair.

Gene expression analysis of skin grafts and cultured keratinocytes using synthetic RNA normalization reveals insights into differentiation and growth control.

Science.gov (United States)

Katayama, Shintaro; Skoog, Tiina; Jouhilahti, Eeva-Mari; Siitonen, H Annika; Nuutila, Kristo; Tervaniemi, Mari H; Vuola, Jyrki; Johnsson, Anna; Lönnerberg, Peter; Linnarsson, Sten; Elomaa, Outi; Kankuri, Esko; Kere, Juha

2015-06-25

Keratinocytes (KCs) are the most frequent cells in the epidermis, and they are often isolated and cultured in vitro to study the molecular biology of the skin. Cultured primary cells and various immortalized cells have been frequently used as skin models but their comparability to intact skin has been questioned. Moreover, when analyzing KC transcriptomes, fluctuation of polyA+ RNA content during the KCs' lifecycle has been omitted. We performed STRT RNA sequencing on 10 ng samples of total RNA from three different sample types: i) epidermal tissue (split-thickness skin grafts), ii) cultured primary KCs, and iii) HaCaT cell line. We observed significant variation in cellular polyA+ RNA content between tissue and cell culture samples of KCs. The use of synthetic RNAs and SAMstrt in normalization enabled comparison of gene expression levels in the highly heterogenous samples and facilitated discovery of differences between the tissue samples and cultured cells. The transcriptome analysis sensitively revealed genes involved in KC differentiation in skin grafts and cell cycle regulation related genes in cultured KCs and emphasized the fluctuation of transcription factors and non-coding RNAs associated to sample types. The epidermal keratinocytes derived from tissue and cell culture samples showed highly different polyA+ RNA contents. The use of SAMstrt and synthetic RNA based normalization allowed the comparison between tissue and cell culture samples and thus proved to be valuable tools for RNA-seq analysis with translational approach. Transciptomics revealed clear difference both between tissue and cell culture samples and between primary KCs and immortalized HaCaT cells.

Real-time visualization of melanin granules in normal human skin using combined multiphoton and reflectance confocal microscopy.

Science.gov (United States)

Majdzadeh, Ali; Lee, Anthony M D; Wang, Hequn; Lui, Harvey; McLean, David I; Crawford, Richard I; Zloty, David; Zeng, Haishan

2015-05-01

Recent advances in biomedical optics have enabled dermal and epidermal components to be visualized at subcellular resolution and assessed noninvasively. Multiphoton microscopy (MPM) and reflectance confocal microscopy (RCM) are noninvasive imaging modalities that have demonstrated promising results in imaging skin micromorphology, and which provide complementary information regarding skin components. This study assesses whether combined MPM/RCM can visualize intracellular and extracellular melanin granules in the epidermis and dermis of normal human skin. We perform MPM and RCM imaging of in vivo and ex vivo skin in the infrared domain. The inherent three-dimensional optical sectioning capability of MPM/RCM is used to image high-contrast granular features across skin depths ranging from 50 to 90 μm. The optical images thus obtained were correlated with conventional histologic examination including melanin-specific staining of ex vivo specimens. MPM revealed highly fluorescent granular structures below the dermal-epidermal junction (DEJ) region. Histochemical staining also demonstrated melanin-containing granules that correlate well in size and location with the granular fluorescent structures observed in MPM. Furthermore, the MPM fluorescence excitation wavelength and RCM reflectance of cell culture-derived melanin were equivalent to those of the granules. This study suggests that MPM can noninvasively visualize and quantify subepidermal melanin in situ. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Fibroblast radiosensitivity versus acute and late normal skin responses in patients treated for breast cancer

International Nuclear Information System (INIS)

Brock, W.A.; Wike, J.; Tucker, S.L.

1995-01-01

To determine if the radiosensitivity of normal human skin fibroblasts, measured in early passage cultures, is significantly correlated with the degree of acute or late normal skin damage in patients treated for breast cancer with radiotherapy. To test assay reproducibility, SF2 values derived from paired biopsies of the same patient (12 cases) were compared. A reasonably good correlation (p = 0.075) was obtained for SF2s determined by high dose-rate irradiations with immediated plating, but not for delayed plating or low dose-rate treatments. The median coefficient of variation in the replicate SF2s after high dose-rate treatment and immediate plating was 13%, suggesting that the poor correlation in paired SF2 values is due to the magnitude of the uncertainty in SF2 relative to the overall spread in SF2 values between patients (CV = 28%). Individual SF2 values and averaged values from patients with data from two biopsies were compared with the acute and late clinical reactions. A significant negative correlation was found between SF2 and relative clinical response, but only when averaged high dose-rate SF2 values and telangiectasia scores were compared. There was no significant correlation between average SF2 values and acute responses or between individual SF2 measurements and either the acute or late clinical response. The results of this study suggest that the degree of late telangiectasia is at least partially dependent upon the intrinsic cellular radiosensitivity of normal fibroblasts, but the relationship is not clear cut. Multiple replicate assays are necessary to obtain reliable estimates of fibroblast SF2 values using current techniques. 20 refs., 3 figs., 3 tabs

Host-cell reactivation of UV-irradiated and chemically-treated herpes simplex virus-1 by xeroderma pigmentosum, xp heterozygotes and normal skin fibroblasts

International Nuclear Information System (INIS)

Selsky, C.A.

1978-01-01

The host-cell reactivation of UV-irradiated and N-acetoxy-2-acetylamino-fluorene-treated herpes simplex virus type 1 strain MP was studied in normal and xeroderma pigmentosum human skin fibroblasts. Virus treated with either agent demonstrated lower survival in XP cells from complementation groups A, B, C and D than in normal fibroblasts. The relative reactivation ability of XP cells from the different genetic complementation groups was found to be the same for both irradiated and chemically treated virus. In addition, the inactivation kinetics for virus treated with either agent in the XP variant were comparable to that seen in normal skin fibroblasts. The addition of 2 or 4 mmoles caffeine to the post-infection assay medium had no effect on the inactivation kinetics of virus treated by either agent in the XP variant or in XP cells from the different genetic complementation groups. Treatment of the virus with nitrogen mustard resulted in equivalent survival in normal and XP genetic complementation group D cells. No apparent defect was observed in the ability of XP heterozygous skin fibroblasts to repair virus damaged with up to 100 μg N-acetoxy-2-acetylaminofluorene per ml. These findings indicate that the repair of UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated virus is accomplished by the same pathway or different pathways sharing a common intermediate step and that the excision defect of XP cells plays little if any role in the reactivation of nitrogen mustard treated virus. (Auth.)

Neuromodulators for Aging Skin

Science.gov (United States)

... Light treatment to the skin and Restylane to tear troughs and outer eyebrow. Photo courtesy of Rebecca Fitzagerald, MD - Los Angeles, California Possible risks Soreness Mild bruising Temporary weakness of surrounding muscles Headache Drooping eyelid Why choose neuromodulators for aging ...

Skin graft - slideshow

Science.gov (United States)

... this page: //medlineplus.gov/ency/presentations/100100.htm Skin graft - series—Normal anatomy To use the sharing features ... entire body, and acts as a protective barrier. Skin grafts may be recommended for: Extensive wounds Burns Specific ...

Quantification of thermal damage in skin tissue

Institute of Scientific and Technical Information of China (English)

徐峰; 文婷; 卢天健; Seffen; Keith

2008-01-01

Skin thermal damage or skin burns are the most commonly encountered type of trauma in civilian and military communities. Besides, advances in laser, microwave and similar technologies have led to recent developments of thermal treatments for disease and damage involving skin tissue, where the objective is to induce thermal damage precisely within targeted tissue structures but without affecting the surrounding, healthy tissue. Further, extended pain sensation induced by thermal damage has also brought great...

UVB 311 nm tolerance of vitiligo skin increases with skin photo type

NARCIS (Netherlands)

Caron-Schreinemachers, Anne-Lou D. B.; Kingswijk, Melanie M.; Bos, Jan D.; Westerhof, Wiete

2005-01-01

It is assumed that skin is protected against sunburn by melanin. In patients with vitiligo, there are white patches in the normal pigmented skin. We noticed that there is a difference in burning capacity of these white patches between people with different skin types. With UVB 311 nm lamps, we

Host-cell reactivation of uv-irradiated and chemically treated Herpes simplex virus type 1 strain MP in normal and xeroderma pigmentosum skin fibroblasts

International Nuclear Information System (INIS)

Selsky, C.A.

1976-01-01

The host-cell reactivation of UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated herpes simplex virus type 1 strain mp was studied in normal human skin fibroblasts and xeroderma pigmentosum skin fibroblasts from XP genetic complementation groups A-D and in an XP variant. The increasing relative order for the host-cell reactivation of both types of damaged virus in the different complementation groups is A = D < B < C; XP variant = normal controls. XP complementation group D cells, which manifest the most severe inhibition of her ability for both UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated virus, can reactivate nitrogen mustard treated HSV-1 mp to the same extent as normal cells. Together, these results indicate that (1) Excision repair of UV and N-acetoxy-2-acetylaminofluorene DNA damaged viruses share a common rate limiting enzymatic step and (2) The repair defect in xeroderma pigmentosum cells plays little or no role in the recovery of nitrogen mustard treated virus. The results of studies on the effect of caffeine on the survival of both UV- and N-acetoxy-2-acetylaminofluorene-treated virus in normal and XP cells imply that the reactivation of HSV-1 mp is mediated by an excision repair process with little if any recovery contributed by post-replication repair mechanisms. The host-cell reactivation of N-acetoxy-2-acetylaminofluorene-treated HSV-1 mp was also correlated with the defective UV-induced unscheduled DNA synthesis in two skin fibroblast strains established from a skin biopsy obtained from each of two juvenile females who had been clinically diagnosed as xeroderma pigmentosum. These findings are discussed in relation to the further characterization of the xeroderma pigmentosum phenotype and their possible utilization for the selection and isolation of new mammalian cell DNA repair mutants

Influence of low-energy laser radiation on normal skin and certain tumor tissues

Energy Technology Data Exchange (ETDEWEB)

Pletnev, S.D.; Karpenko, O.M.

For some years, the authors' Institute has studied the influence of various types of low-energy laser radiation on normal tissue and the growth of tumors. Radiation at 3 and 30 J/cm/sup 2/ causes an increase in biological activity of various cell elements, manifested as an increase in mitotic activity of the cells in the basal layer of the epidermis, conglomeration of chromatin in the cell nuclei and an increase in degranulation of fat cells in the process of their migration to the reticular layer. Also noted was an increase in content of fibroblastic and lymphohistocytic elements in the dermis, as well as an increase in collagenization of connective tissue. It was found that irradiation of the skin by helium-neon, cadmium-helium and nitrogen lasers before and after grafting of the cells of various tumors modifies the course of the tumor process. This effect is apparently related to the fact that systematic irradiation results in changes creating a favorable background for survival and proliferation of tumor cells in the skin tissue medium. The changes facilitate an increase in survival and growth of both pigmented and nonpigmented tumors. Low power radiation stimulates the activity of the cells or cell structures; medium power stimulates their activity; high power suppresses activity.

Quantification of thermal damage in skin tissue

Institute of Scientific and Technical Information of China (English)

Xu Feng; Wen Ting; Lu Tianjian; Seffen Keith

2008-01-01

Skin thermal damage or skin burns are the most commonly encountered type of trauma in civilian and military communities. Besides, advances in laser, microwave and similar technologies have led to recent developments of thermal treatments for disease and damage involving skin tissue, where the objective is to induce thermal damage precisely within targeted tissue structures but without affecting the surrounding, healthy tissue. Further, extended pain sensation induced by thermal damage has also brought great problem for burn patients. Thus, it is of great importance to quantify the thermal damage in skin tissue. In this paper, the available models and experimental methods for quantification of thermal damage in skin tissue are discussed.

Three-Dimensional In Vitro Skin and Skin Cancer Models Based on Human Fibroblast-Derived Matrix.

Science.gov (United States)

Berning, Manuel; Prätzel-Wunder, Silke; Bickenbach, Jackie R; Boukamp, Petra

2015-09-01

Three-dimensional in vitro skin and skin cancer models help to dissect epidermal-dermal and tumor-stroma interactions. In the model presented here, normal human dermal fibroblasts isolated from adult skin self-assembled into dermal equivalents with their specific fibroblast-derived matrix (fdmDE) over 4 weeks. The fdmDE represented a complex human extracellular matrix that was stabilized by its own heterogeneous collagen fiber meshwork, largely resembling a human dermal in vivo architecture. Complemented with normal human epidermal keratinocytes, the skin equivalent (fdmSE) thereof favored the establishment of a well-stratified and differentiated epidermis and importantly allowed epidermal regeneration in vitro for at least 24 weeks. Moreover, the fdmDE could be used to study the features of cutaneous skin cancer. Complementing fdmDE with HaCaT cells in different stages of malignancy or tumor-derived cutaneous squamous cell carcinoma cell lines, the resulting skin cancer equivalents (fdmSCEs) recapitulated the respective degree of tumorigenicity. In addition, the fdmSCE invasion phenotypes correlated with their individual degree of tissue organization, disturbance in basement membrane organization, and presence of matrix metalloproteinases. Together, fdmDE-based models are well suited for long-term regeneration of normal human epidermis and, as they recapitulate tumor-specific growth, differentiation, and invasion profiles of cutaneous skin cancer cells, also provide an excellent human in vitro skin cancer model.

A Simple Device For Measuring Skin Friction

Directory of Open Access Journals (Sweden)

Gupta A.B

1995-01-01

Full Text Available A simple device for measuring skin friction in vivo is described. The frictional coefficient of normal Indian skin and the effect of hydration and application of talc and glycerol on the frictional coefficient and also the friction of ichthyotic skin have been determined with its help. The average value of friction of friction of normal India skin at forearm is found to be 0.41 +- 0.08, the hydration raises the value to 0.71 +- 0.11 and the effect of glycerol is also to school it up to 0.70+- 0.05, almost equal to that of water. The effect of talc however is opposite and its application lowers the friction to 0.21+-0.07. The mean coeff of friction for ichthyotic skin is found to be 0.21+- 0.0.5, which closely agrees with talc-treated normal skin. A good positive correlation (p<0.01 between friction and sebum level at skin site, with r = 0.64, has been observed.

Alp Rose stem cells, olive oil squalene and a natural alkyl polyglucoside emulsifier: Are they appropriate ingredients of skin moisturizers - in vivo efficacy on normal and sodium lauryl sulfate - irritated skin?.

Science.gov (United States)

Filipović, Mila; Gledović, Ana; Lukić, Milica; Tasić-Kostov, Marija; Isailović, Tanja; Pantelić, Ivana; Vuleta, Gordana; Savić, Snežana

2016-11-01

Since skin moisturization may be achieved by both actives and chosen carrier, plant stem cells, squalene and natural alkyl polyglucoside emulsifier may be potential components of contemporary cosmetic products. The aim of the study was in vivo evaluation of the skin irritation potential and the efficacy of Alpine Rose stem cells incorporated into li-posomes and olive oil squalene as ingredients of moisturizing creams, with respect to the novel emulsifier used for creams’ stabilization. With the employment of noninvasive skin biophysical measurements, skin hydration (EC), transepi-dermal water loss (TEWL), erythema index (EI) and viscoelas-ticity were measured on 76 healthy volunteers. In the first phase, skin irritation after a 24-hour occlusion and the long-term efficacy of creams (a 21-day study) on healthy skin were evaluated. Phase II of the study focused on the cream efficacy assessment after a 6-day treatment of sodium lauryl sulfate-irritated skin. After a 24-hour occlusion, there were no significant changes in the EI for any tested sample. In the second phase of the study, the EI was not significantly altered for the cream containing squalene, while the application of all active samples resulted in a significant reduction of TEWL. In both phases of the study an EC increase was recorded, espe-cially for the squalene-containing cream. Due to the lack of skin irritation and skin barrier impairment along with the marked hydration effect, it could be said that the in-vestigated actives incorporated into alkyl polyglucoside emulsi-fier-stabilized creams may be safely applied as ingredients for "tailor-made" cosmetic moisturizers intended for normal and dry skin care, whereas olive oil squalene could be used for the treatment of irritated or sensitive skin as well. [Projekat Ministarstva nauke Republike Srbije, br. TR34031

Alp Rose stem cells, olive oil squalene and a natural alkyl polyglucoside emulsifier: Are they appropriate ingredients of skin moisturizers - in vivo efficacy on normal and sodium lauryl sulfate - irritated skin?

Directory of Open Access Journals (Sweden)

Filipović Mila

2016-01-01

Full Text Available Background/Aim. Since skin moisturization may be achieved by both actives and chosen carrier, plant stem cells, squalene and natural alkyl polyglucoside emulsifier may be potential components of contemporary cosmetic products. The aim of the study was in vivo evaluation of the skin irritation potential and the efficacy of Alpine Rose stem cells incorporated into li-posomes and olive oil squalene as ingredients of moisturizing creams, with respect to the novel emulsifier used for creams’ stabilization. Methods. With the employment of noninvasive skin biophysical measurements, skin hydration (EC, transepi-dermal water loss (TEWL, erythema index (EI and viscoelas-ticity were measured on 76 healthy volunteers. In the first phase, skin irritation after a 24-hour occlusion and the long-term efficacy of creams (a 21-day study on healthy skin were evaluated. Phase II of the study focused on the cream efficacy assessment after a 6-day treatment of sodium lauryl sulfate-irritated skin. Results. After a 24-hour occlusion, there were no significant changes in the EI for any tested sample. In the second phase of the study, the EI was not significantly altered for the cream containing squalene, while the application of all active samples resulted in a significant reduction of TEWL. In both phases of the study an EC increase was recorded, espe-cially for the squalene-containing cream. Conclusion. Due to the lack of skin irritation and skin barrier impairment along with the marked hydration effect, it could be said that the in-vestigated actives incorporated into alkyl polyglucoside emulsi-fier-stabilized creams may be safely applied as ingredients for "tailor-made" cosmetic moisturizers intended for normal and dry skin care, whereas olive oil squalene could be used for the treatment of irritated or sensitive skin as well. [Projekat Ministarstva nauke Republike Srbije, br. TR34031

Sun’s effect on skin

Science.gov (United States)

The skin uses sunlight to help manufacture vitamin D, which is important for normal bone formation. But sometimes its ultraviolet light can be ... the pigment melanin. Melanin protects skin from the sun's ultraviolet rays, which can burn the skin, and ...

Normal Skin Microbiota is Altered in Pre-clinical Hidradenitis Suppurativa

DEFF Research Database (Denmark)

Ring, Hans Christian; Bay, Lene; Kallenbach, Klaus

2017-01-01

therefore hypothesized that clinically unaffected HS skin would also have an increased presence of biofilm compared with that of healthy controls. We conducted a case-control study, investigating the morphology of the axillary skin microbiota. Peptide nucleic acid – fluorescence in situ hybridization probes...... were used in combination with confocal laser scanning microscopy. Significant differences were found in both distribution and quantity of the cutaneous microbiota in clinically non-affected axillary skin of patients with HS compared with healthy controls. Surprisingly, we detected fewer bacteria...... and less biofilm in patients with HS. The reduced microbiota in patients with HS may play an important role in the early course of the disease....

Analysis of vegetation recovery surrounding a restored wetland using the normalized difference infrared index (NDII) and normalized difference vegetation index (NDVI)

Science.gov (United States)

Wilson, Natalie R.; Norman, Laura

2018-01-01

Watershed restoration efforts seek to rejuvenate vegetation, biological diversity, and land productivity at Cienega San Bernardino, an important wetland in southeastern Arizona and northern Sonora, Mexico. Rock detention and earthen berm structures were built on the Cienega San Bernardino over the course of four decades, beginning in 1984 and continuing to the present. Previous research findings show that restoration supports and even increases vegetation health despite ongoing drought conditions in this arid watershed. However, the extent of restoration impacts is still unknown despite qualitative observations of improvement in surrounding vegetation amount and vigor. We analyzed spatial and temporal trends in vegetation greenness and soil moisture by applying the normalized difference vegetation index (NDVI) and normalized difference infrared index (NDII) to one dry summer season Landsat path/row from 1984 to 2016. The study area was divided into zones and spectral data for each zone was analyzed and compared with precipitation record using statistical measures including linear regression, Mann– Kendall test, and linear correlation. NDVI and NDII performed differently due to the presence of continued grazing and the effects of grazing on canopy cover; NDVI was better able to track changes in vegetation in areas without grazing while NDII was better at tracking changes in areas with continued grazing. Restoration impacts display higher greenness and vegetation water content levels, greater increases in greenness and water content through time, and a decoupling of vegetation greenness and water content from spring precipitation when compared to control sites in nearby tributary and upland areas. Our results confirm the potential of erosion control structures to affect areas up to 5 km downstream of restoration sites over time and to affect 1 km upstream of the sites.

Plasma IGF-I, INSL3, testosterone, inhibin concentrations and scrotal circumferences surrounding puberty in Japanese Black beef bulls with normal and abnormal semen.

Science.gov (United States)

Weerakoon, W W P N; Sakase, M; Kawate, N; Hannan, M A; Kohama, N; Tamada, H

2018-07-01

The relationships between semen abnormalities and peripheral concentrations of testicular and metabolic hormones in beef bulls are unclear. Here we compared plasma insulin-like growth factor I (IGF-I), insulin-like peptide 3 (INSL3), testosterone, inhibin concentrations, and scrotal circumferences surrounding puberty in Japanese Black beef bulls (n = 66) with normal or abnormal semen. We collected blood samples and measured scrotal circumferences monthly from 4 to 24 months of age. Semen was collected weekly from 12 months until at least 18 months of age. Fresh semen was evaluated for semen volume, sperm motility, concentrations, and morphological defects. The normal fresh semen was frozen by a standard method and examined for post-thaw sperm motility and fertility. Bulls were classified as having either normal post-thaw semen (n = 45) or abnormal semen (n = 21, when at least one of the above test items was abnormal for 6 months). Abnormal semen was classified into abnormal fresh or low-fertility post-thaw which evaluated for rates of transferable embryos. The abnormal fresh was categorized as having sperm morphological defects, low motility, and morphological defects plus low motility. Scrotal circumferences were smaller for the abnormal-semen group vs. the normal-semen group at 20 and 24 months (p IGF-I, INSL3, and inhibin concentrations in the abnormal-semen group were lower than those of the normal-semen group (p IGF-I; 6, 9, 11-14, 17, and 20-21 months for INSL3; 5, 8-13, 16, 17, 19, and 20 months for inhibin). The plasma testosterone concentrations were lower in the abnormal-semen bulls vs. normal-semen bulls only at 22 months (p IGF-I and inhibin concentrations for low-fertility post-thaw semen (p IGF-I, INSL3, and inhibin surrounding puberty may be associated with semen aberration in beef bulls. Notably, the combined sperm abnormality of morphological defects and low motility in fresh semen could involve lowered INSL3, whereas the low

Effect of capping agents on the cytotoxicity of silver nanoparticles in human normal and cancer skin cell lines

Energy Technology Data Exchange (ETDEWEB)

Netchareonsirisuk, Ponsawan [Chulalongkorn University, Program in Biotechnology, Faculty of Science (Thailand); Puthong, Songchan [Chulalongkorn University, Antibody Production Research Unit, Institute of Biotechnology and Genetic Engineering (Thailand); Dubas, Stephan [Chulalongkorn University, Petroleum and Petrochemical College (Thailand); Palaga, Tanapat [Chulalongkorn University, Department of Microbiology, Faculty of Science (Thailand); Komolpis, Kittinan, E-mail: kittinan.k@chula.ac.th [Chulalongkorn University, Antibody Production Research Unit, Institute of Biotechnology and Genetic Engineering (Thailand)

2016-11-15

Silver nanoparticles (AgNPs) are among the most widely used nanomaterials in medical and consumer products. However, safety in the uses of AgNPs is still controversial. The toxicity of AgNPs toward various cell types has been reported to depend on the surface properties of the nanoparticles. In this study, the effect of AgNPs with the average size of 5–15 nm on the viability of the CCD-986SK human normal skin fibroblast cell line and A375 human malignant melanoma cell line was evaluated. Comparative toxicity studies, based on MTT assay, were performed by using either sodium alginate or poly (4-styrenesulfonic acid-co-maleic acid) sodium salt (PSSMA) as capping agent in the nanoparticle preparation. The cytotoxicity tests revealed that AgNO{sub 3} alone was highly toxic to both cell types while both alginate and PSSMA alone were not toxic. AgNPs capped with alginate were selectively toxic to the cancer cell line but not to the normal cell line while AgNPs capped with PSSMA were toxic to both cancer and normal cell lines. Judging from the 50 % inhibition concentration (IC{sub 50}), it was found that the cancer cell line was more sensitive to AgNPs than the normal cell line. Study on the mode of cell death by annexin V and propidium iodide staining revealed that AgNPs induced more apoptotic cell death (84–90 %) than necrosis (8–12 %) in the skin cancer cell line. These results suggest that the toxicity of AgNPs depended on the type of capping agent and the type of cell line.

Visual attention and flexible normalization pools

Science.gov (United States)

Schwartz, Odelia; Coen-Cagli, Ruben

2013-01-01

Attention to a spatial location or feature in a visual scene can modulate the responses of cortical neurons and affect perceptual biases in illusions. We add attention to a cortical model of spatial context based on a well-founded account of natural scene statistics. The cortical model amounts to a generalized form of divisive normalization, in which the surround is in the normalization pool of the center target only if they are considered statistically dependent. Here we propose that attention influences this computation by accentuating the neural unit activations at the attended location, and that the amount of attentional influence of the surround on the center thus depends on whether center and surround are deemed in the same normalization pool. The resulting form of model extends a recent divisive normalization model of attention (Reynolds & Heeger, 2009). We simulate cortical surround orientation experiments with attention and show that the flexible model is suitable for capturing additional data and makes nontrivial testable predictions. PMID:23345413

Attention and normalization circuits in macaque V1

Science.gov (United States)

Sanayei, M; Herrero, J L; Distler, C; Thiele, A

2015-01-01

Attention affects neuronal processing and improves behavioural performance. In extrastriate visual cortex these effects have been explained by normalization models, which assume that attention influences the circuit that mediates surround suppression. While normalization models have been able to explain attentional effects, their validity has rarely been tested against alternative models. Here we investigate how attention and surround/mask stimuli affect neuronal firing rates and orientation tuning in macaque V1. Surround/mask stimuli provide an estimate to what extent V1 neurons are affected by normalization, which was compared against effects of spatial top down attention. For some attention/surround effect comparisons, the strength of attentional modulation was correlated with the strength of surround modulation, suggesting that attention and surround/mask stimulation (i.e. normalization) might use a common mechanism. To explore this in detail, we fitted multiplicative and additive models of attention to our data. In one class of models, attention contributed to normalization mechanisms, whereas in a different class of models it did not. Model selection based on Akaike's and on Bayesian information criteria demonstrated that in most cells the effects of attention were best described by models where attention did not contribute to normalization mechanisms. This demonstrates that attentional influences on neuronal responses in primary visual cortex often bypass normalization mechanisms. PMID:25757941

Dietary ascorbic acid normalizes ribosomal efficiency for collagen production in skin of streptozotocin-induced diabetic rats

International Nuclear Information System (INIS)

Schneir, M.; Imberman, M.; Ramamurthy, N.; Golub, L.

1987-01-01

The objective of this study was to quantify the contribution of both ribosome amount and ribosomal efficiency to decreased collagen production in skin of diabetic rats and diabetic rats treated with dietary ascorbic acid. Male Sprague-Dawley rats were distributed equally into the following categories: non-diabetic controls; diabetics; ascorbic acid-treated diabetics. On day-20, all rats were injected with ( 3 H)proline and killed after 2 h. Absolute rate of collagen production, ribosome content, and ribosomal efficiency of collagen production were quantified. Also ribosomal efficiency was quantified for ribosomes in sucrose-gradient fractionated post-mitochondrial supernatants. The results indicate that decreased ribosomal efficiency was responsible for 70% of the decreased collagen production with 30% caused by decreased ribosome content, when measured for total skin or sucrose gradient-isolated ribosomes. At both levels of analysis, ascorbic acid treatment normalized ribosomal efficiency, indicating diabetes-mediated decreased ribosomal efficiency for collagen production is related to a co-translational event, such as procollagen underhydroxylation

Stimulus size dependence of hue changes induced by chromatic surrounds.

Science.gov (United States)

Kellner, Christian Johannes; Wachtler, Thomas

2016-03-01

A chromatic surround induces a change in the perceived hue of a stimulus. This shift in hue depends on the chromatic difference between the stimulus and the surround. We investigated how chromatic induction varies with stimulus size and whether the size dependence depends on the surround hue. Subjects performed asymmetric matching of color stimuli with different sizes in surrounds of different chromaticities. Generally, induced hue shifts decreased with increasing stimulus size. This decrease was quantitatively different for different surround hues. However, when size effects were normalized to an overall induction strength, the chromatic specificity was largely reduced. The separability of inducer chromaticity and stimulus size suggests that these effects are mediated by different neural mechanisms.

Terahertz pulse imaging in reflection geometry of human skin cancer and skin tissue

International Nuclear Information System (INIS)

Woodward, Ruth M; Cole, Bryan E; Wallace, Vincent P; Pye, Richard J; Arnone, Donald D; Linfield, Edmund H; Pepper, Michael

2002-01-01

We demonstrate the application of terahertz pulse imaging (TPI) in reflection geometry for the study of skin tissue and related cancers both in vitro and in vivo. The sensitivity of terahertz radiation to polar molecules, such as water, makes TPI suitable for studying the hydration levels in the skin and the determination of the lateral spread of skin cancer pre-operatively. By studying the terahertz pulse shape in the time domain we have been able to differentiate between diseased and normal tissue for the study of basal cell carcinoma (BCC). Basal cell carcinoma has shown a positive terahertz contrast, and inflammation and scar tissue a negative terahertz contrast compared to normal tissue. In vivo measurements on the stratum corneum have enabled visualization of the stratum corneum-epidermis interface and the study of skin hydration levels. These results demonstrate the potential of terahertz pulse imaging for the study of skin tissue and its related disorders, both in vitro and in vivo

Human Epidermal Langerhans Cells Maintain Immune Homeostasis in Skin by Activating Skin Resident Regulatory T Cells

Science.gov (United States)

Seneschal, Julien; Clark, Rachael A.; Gehad, Ahmed; Baecher-Allan, Clare M.; Kupper, Thomas S.

2013-01-01

Recent discoveries indicate that the skin of a normal individual contains 10-20 billion resident memory T cells ( which include various T helper, T cytotoxic, and T regulatory subsets, that are poised to respond to environmental antigens. Using only autologous human tissues, we report that both in vitro and in vivo, resting epidermal Langerhan cells (LC) selectively and specifically induced the activation and proliferation of skin resident regulatory T cells (Treg), a minor subset of skin resident memory T cells. In the presence of foreign pathogen, however, the same LC activated and induced proliferation of effector memory T (Tem) cells and limited Treg cells activation. These underappreciated properties of LC: namely maintenance of tolerance in normal skin, and activation of protective skin resident memory T cells upon infectious challenge, help clarify the role of LC in skin. PMID:22560445

In vivo assessment of the structure of skin microcirculation by reflectance confocal-laser-scanning microscopy

Science.gov (United States)

Sugata, Keiichi; Osanai, Osamu; Kawada, Hiromitsu

2012-02-01

One of the major roles of the skin microcirculation is to supply oxygen and nutrition to the surrounding tissue. Regardless of the close relationship between the microcirculation and the surrounding tissue, there are few non-invasive methods that can evaluate both the microcirculation and its surrounding tissue at the same site. We visualized microcapillary plexus structures in human skin using in vivo reflectance confocal-laser-scanning microscopy (CLSM), Vivascope 3000® (Lucid Inc., USA) and Image J software (National Institutes of Health, USA) for video image processing. CLSM is a non-invasive technique that can visualize the internal structure of the skin at the cellular level. In addition to internal morphological information such as the extracellular matrix, our method reveals capillary structures up to the depth of the subpapillary plexus at the same site without the need for additional optical systems. Video images at specific depths of the inner forearm skin were recorded. By creating frame-to-frame difference images from the video images using off-line video image processing, we obtained images that emphasize the brightness depending on changes of intensity coming from the movement of blood cells. Merging images from different depths of the skin elucidates the 3-dimensional fine line-structure of the microcirculation. Overall our results show the feasibility of a non-invasive, high-resolution imaging technique to characterize the skin microcirculation and the surrounding tissue.

Matching the skin barrier to the skin type.

Science.gov (United States)

Thompson, Hyacinth; North, Jacqui; Davenport, Rebecca; Williams, Julia

Peristomal skin problems are thought to be common (Herlufsson et al, 2006; Williams et al, 2010), and can interfere with the security of stoma products. Stoma patients are reliant on the integrity of their peristomal skin to maintain a normal lifestyle. Bekkers et al (1996) highlighted that, if the peristomal skin becomes damaged, it not only affects the person physically, but also psychologically, ultimately prolonging rehabilitation and adaptation to the stoma. Therefore, it can be concluded that maintaining skin integrity is a basic and essential skill in ensuring good stoma management. This article explores the assessment of four stoma patients, highlighting the importance of matching their skin type with their skin barrier for optimum skin protection. The patients have kindly agreed for their case studies to be published as a means of informing others. All names have been changed in line with Nursing and Midwifery Council (2010) guidelines to maintain patient confidentiality. This article was originally presented at the World Council of Enterostomal Therapists' (WCET) annual conference in 2010, receiving first prize at poster presentations.

Psychoneuroimmunology and the Skin.

Science.gov (United States)

Honeyman, Juan F

2016-08-23

The nervous, immune, endocrine and integumentary systems are closely related and interact in a number of normal and pathological conditions. Nervous system mediators may bring about direct changes to the skin or may induce the release of immunological or hormonal mediators that cause pathological changes to the skin. This article reviews the psychological mechanisms involved in the development of skin diseases.

Attention and normalization circuits in macaque V1.

Science.gov (United States)

Sanayei, M; Herrero, J L; Distler, C; Thiele, A

2015-04-01

Attention affects neuronal processing and improves behavioural performance. In extrastriate visual cortex these effects have been explained by normalization models, which assume that attention influences the circuit that mediates surround suppression. While normalization models have been able to explain attentional effects, their validity has rarely been tested against alternative models. Here we investigate how attention and surround/mask stimuli affect neuronal firing rates and orientation tuning in macaque V1. Surround/mask stimuli provide an estimate to what extent V1 neurons are affected by normalization, which was compared against effects of spatial top down attention. For some attention/surround effect comparisons, the strength of attentional modulation was correlated with the strength of surround modulation, suggesting that attention and surround/mask stimulation (i.e. normalization) might use a common mechanism. To explore this in detail, we fitted multiplicative and additive models of attention to our data. In one class of models, attention contributed to normalization mechanisms, whereas in a different class of models it did not. Model selection based on Akaike's and on Bayesian information criteria demonstrated that in most cells the effects of attention were best described by models where attention did not contribute to normalization mechanisms. This demonstrates that attentional influences on neuronal responses in primary visual cortex often bypass normalization mechanisms. © 2015 The Authors. European Journal of Neuroscience published by Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

A case of radiation-induced skin cancer of the neck

International Nuclear Information System (INIS)

Matsushita, Tetsuya; Susuki, Takeo; Kikui, Tomoko; Masada, Yoshiko; Tahara, Shinya.

1994-01-01

The authors discuss the case of radiation-induced skin cancer of the neck in a 76-year-old woman who had undergone irradiation of tubercular lymphadenitis of the cervix while in her low teens. Some fifty years later, a squamous cell carcinoma developed in the irradiated region and in due course deeply invaded the sternocleidomastoidous muscle. Thus, a radical neck dissection was performed and the tumor and the lymph tissue removed en bloc, after which reconstruction was accomplished by using a latissimus dorsi musculocutaneous flap. With regard to the lessons learned from treating this case, three points are considered important and are listed below. When treating radiation-induced skin cancer patients, the head and neck regions should be examined in detail for the presence of other tumors. The excision of the skin surrounding the tumor should be as wide as possible, so as to remove skin that may have been also over-subjected to irradiation. The remaining skin surrounding the defect left by the excision is atrophic and thin. (author)

Histological Study on the Skin of Japanese Flounder Paralichthys olivaceus

Institute of Scientific and Technical Information of China (English)

ZHU Jie; ZHANG Xiumei; GAO Tianxiang

2005-01-01

Histological development of Japanese flounder Paralichthys olivaceus larval skin and ultrastructural difference of skin between reared normal and malpigmented Japanese flounder were studied with light microscopy (LM) and transmission electron microscopy (TEM). The results show that the skin develops slowly before the metamorphosis, while at the onset of metamorphosis, the skin develops quickly and becomes complete in structure till about 50 d after being hatched. Ultrastructural observation on the normal and malpigmented skins shows that the iridophore and melanophore are adjacent to each other. Profile and structure of the two kinds of pigment cells are more complete in the skin of normal ocular side than in the skin of pigmented blind side. The ultrastructure of typical chloride cell was observed in the skin of Japanese flounder larvae for the first time.

Prefabricated neck expanded skin flap with the superficial temporal vessels for facial resurfacing.

Science.gov (United States)

Lazzeri, Davide; Su, Weijie; Qian, Yunliang; Messmer, Caroline; Agostini, Tommaso; Spinelli, Giuseppe; Marcus, Jeffrey R; Levin, L Scott; Zenn, Micheal R; Zhang, Yi Xin

2013-05-01

The achievement of a normal-appearing face after surgical resurfacing remains an elusive goal. This is due in part to insufficient color matching, restoration of contours, and the persistence of visible scars. Flap prefabrication is a staged procedure that provides an independent axial blood supply to local expanded tissues. We describe a new reconstructive alternative with superior reconstructive surgical options for facial resurfacing that better matches damaged or discarded facial tissues. A superficial temporal fascial flap was harvested as the vascular supply of the prefabricated neck flap and located in a subcutaneous neck pocket over a tissue expander. After a 5-month period for expansion and maturation, the prefabricated skin flap was raised, islanded, and rotated to resurface the facial defect. Four patients with hemifacial postburn contracture and two patients affected by hemifacial vascular malformations aged 17 to 42 years (mean 29 years) were successfully treated with no major complication after a mean period of 15 months. Prefabricated neck-expanded skin flap demonstrated an excellent color and texture match with facial skin that surrounded the repair sites, and optimal aesthetic results were obtained. Importantly, facial expression was completely maintained due to thinness and pliability of the rotated skin. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

A Meta-ethnography: Skin-to-Skin Holding From the Caregiver's Perspective.

Science.gov (United States)

Vittner, Dorothy; Casavant, Sharon; McGrath, Jacqueline M

2015-06-01

Although the benefits of skin-to-skin care (SSC) are well documented in the literature, practices in the clinical setting remain inconsistent. Although nurses' reported knowledge about SSC has improved, confusion still exists regarding safety and appropriateness. Existing qualitative literature primarily focuses on parents' experiences; yet it is crucial to describe the essence of professional caregivers' experiences to enhance facilitation and implementation of SSC. Most studies surrounding the caregiver's perspective and SSC have focused on barriers that impede implementation or examined the experience from the organizational perspective and general group experiences rather than individual personal experiences with SSC. This meta-ethnography integrated the findings from several discrete studies into a salient interpretative perspective, creating a relevant understanding of the process of SSC as a means of enhancing facilitation and implementation of SSC with hospitalized infants. An ethnographic meta-synthesis of qualitative literature was completed. As a result of this synthesis, the caregivers' experiences were separated into themes to articulate the phenomena juxtaposed from the 8 original studies that influence facilitation of SSC for the parent-infant dyad. Qualitative data analysis uncovered 4 overarching themes: (1) varying thresholds of getting started; (2) defining adequate resources; (3) navigating the demands and complexity of the infant; and (4) balancing parental readiness with infant needs. This ethnographic meta-synthesis confirms nurses have good intentions in supporting SSC practices, yet struggle to meet competing demands in their daily practice. Innovative and practical translations of SSC are needed to normalize SSC as the daily standard for premature infants.

Laser-induced thermal coagulation enhances skin uptake of topically applied compounds.

Science.gov (United States)

Haak, C S; Hannibal, J; Paasch, U; Anderson, R R; Haedersdal, M

2017-08-01

Ablative fractional laser (AFL) generates microchannels in skin surrounded by a zone of thermally altered tissue, termed the coagulation zone (CZ). The thickness of CZ varies according to applied wavelength and laser settings. It is well-known that AFL channels facilitate uptake of topically applied compounds, but the importance of CZ is unknown. Franz Cells were used to investigate skin uptake and permeation of fluorescent labeled polyethylene glycols (PEGs) with mean molecular weights (MW) of 350, 1,000, and 5,000 Da. Microchannels with CZ thicknesses ranging from 0 to 80 μm were generated from micro-needles (0 μm, CZ-0), and AFL (10,600 nm) applied to -80°C deep frozen skin (20 μm, CZ-20) and skin equilibrated to room temperature (80 μm, CZ-80). Channels penetrated into similar mid-dermal skin depths of 600-700 μm, and number of channels per skin area was similar. At 4 hours incubation, skin uptake of PEGs into CZ and dermis was evaluated by fluorescence microscopy at specific skin depths of 150, 400, and 1,000 μm and the transcutaneous permeation was quantified by fluorescence of receptor fluids. Overall, the highest uptake of PEGs was reached through microchannels surrounded by CZ compared to channels with no CZ (CZ-20 and CZ-80>CZ-0).The thickness of CZ affected PEG distribution in skin. A thin CZ-20 favored significantly higher mean fluorescence intensities inside CZ areas compared to CZ-80 (PEG 350, 1,000, and 5,000; P channels was significantly higher than through CZ-80 and CZ-0 at all skin depths (PEG 350, 1,000 and 5,000, 150-1,000 μm; P distribution, with highest PEG uptake achieved from microchannels surrounded by a thin CZ. Lasers Surg. Med. 49:582-591, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Is the Fractional Laser Still Effective in Assisting Cutaneous Macromolecule Delivery in Barrier-Deficient Skin? Psoriasis and Atopic Dermatitis as the Disease Models.

Science.gov (United States)

Lee, Woan-Ruoh; Shen, Shing-Chuan; Sung, Calvin T; Liu, Pei-Ying; Fang, Jia-You

2018-04-26

Most of the investigations into laser-assisted skin permeation have used the intact skin as the permeation barrier. Whether the laser is effective in improving cutaneous delivery via barrier-defective skin is still unclear. In this study, ablative (Er:YAG) and non-ablative (Er:glass) lasers were examined for the penetration of peptide and siRNA upon topical application on in vitro skin with a healthy or disrupted barrier. An enhanced peptide flux (6.9 fold) was detected after tape stripping of the pig stratum corneum (SC). A further increase of flux to 11.7 fold was obtained after Er:YAG laser irradiation of the SC-stripped skin. However, the application of Er:glass modality did not further raise the flux via the SC-stripped skin. A similar trend was observed in the case of psoriasiform skin. Conversely, the flux was enhanced 3.7 and 2.6 fold after treatment with the Er:YAG and the Er:glass laser on the atopic dermatitis (AD)-like skin. The 3-D skin structure captured by confocal microscopy proved the distribution of peptide and siRNA through the microchannels and into the surrounding tissue. The fractional laser was valid for ameliorating macromolecule permeation into barrier-disrupted skin although the enhancement level was lower than that of normal skin.

Optical coherence tomography for imaging of skin and skin diseases

DEFF Research Database (Denmark)

Mogensen, Mette; Thrane, Lars; Jørgensen, Thomas Martini

2009-01-01

Optical coherence tomography (OCT) is an emerging imaging technology based on light reflection. It provides real-time images with up to 2-mm penetration into the skin and a resolution of approximately 10 μm. It is routinely used in ophthalmology. The normal skin and its appendages have been studi...... technical solutions are being pursued to further improve the quality of the images and the data provided, and OCT is being integrated in multimodal imaging devices that would potentially be able to provide a quantum leap to the imaging of skin in vivo....

High resolution skin colorimetry, strain mapping and mechanobiology.

Science.gov (United States)

Devillers, C; Piérard-Franchimont, C; Schreder, A; Docquier, V; Piérard, G E

2010-08-01

Skin colours are notoriously different between individuals. They are governed by ethnicities and phototypes, and further influenced by a variety of factors including photoexposures and sustained mechanical stress. Indeed, mechanobiology is a feature affecting the epidermal melanization. High-resolution epiluminescence colorimetry helps in deciphering the effects of forces generated by Langer's lines or relaxed skin tension lines on the melanocyte activity. The same procedure shows a prominent laddering pattern of melanization in striae distensae contrasting with the regular honeycomb pattern in the surrounding skin.

Avoiding obstacles by using a proximity infrared sensor skin

Institute of Scientific and Technical Information of China (English)

Cao Zhengcai; Fu Yili; Wu Qidi; Wang Shuguo; Wang Guangguo

2007-01-01

Placement and wiring of vast amount of sensor elements on the 3-dimensionally configured robot surface to form soft sensor skin is very difficult with the traditional technology, hi this paper we propose a new method to realize such a skin. By implanting infrared sensors array in an elastic body, we obtain an elastic and tough sensor skin that can be shaped freely. The developed sensor skin is a large-area, flexible array of infrared sensors with data processing capabilities. Depending on the skin electronics, it endows its carrier with an ability to sense its surroundings. The structure, the method of infrared sensor signal processing, and basic experiments of sensor skin are presented. The validity of the infrared sensor skin is investigated by preliminary obstacle avoidance trial.

Hyperpigmentation

Science.gov (United States)

... Archive JAOCD Information for Authors Information for Reviewers Human & Animal ... of skin become darker in color than the normal surrounding skin. This darkening occurs when an excess of melanin, the brown pigment that produces normal skin color, ...

Dose conversion factors of radiation doses at normal operation discharges. E. Description of geographical surroundings and critical group; Dosomraekningsfaktorer foer normaldriftutslaepp. E. Omraadesbeskrivningar och kritisk grupp

Energy Technology Data Exchange (ETDEWEB)

Hallberg, Bengt

2001-10-01

A study was performed in order to develop and supplement existing models for calculating radiation doses from discharges of radionuclides under normal operating conditions at the Swedish NPPs at Barsebaeck, Forsmark, Oskarshamn and Ringhals, and at the nuclear plants at Studsvik and the Westinghouse Atom fuel plant. A general description of the surroundings of each plant is given in this report, together with an inventory of agricultural activities, forestry, areas for leisure activities etc. The conditions of the critical group has been selected based on the description of the surroundings and the modeling of dispersion in the atmosphere and fallout on the ground. In contrast to earlier models where fictive critical groups were used, the present model is based on factual circumstances.

Study of mast cell count in skin tags

Directory of Open Access Journals (Sweden)

Zaher Hesham

2007-01-01

Full Text Available Background: Skin tags or acrochordons are common tumors of middle-aged and elderly subjects. They consist of loose fibrous tissue and occur mainly on the neck and major flexures as small, soft, pedunculated protrusions. Objectives: The aim was to compare the mast cells count in skin tags to adjacent normal skin in diabetic and nondiabetic participants in an attempt to elucidate the possible role of mast cells in the pathogenesis of skin tags. Participants and Methods: Thirty participants with skin tags were divided into group I (15 nondiabetic participants and group II (15 diabetic participants. Three biopsies were obtained from each participant: a large skin tag, a small skin tag and adjacent normal skin. Mast cell count from all the obtained sections was carried out, and the mast cell density was expressed as the average mast cell count/high power field (HPF. Results: A statistically significant increase in mast cells count in skin tags in comparison to normal skin was detected in group I and group II. There was no statistically significant difference between mast cell counts in skin tags of both the groups. Conclusion: Both the mast cell mediators and hyperinsulinemia are capable of inducing fibroblast proliferation and epidermal hyperplasia that are the main pathologic abnormalities seen in all types of skin tags. However, the presence of mast cells in all examined skin tags regardless of diabetes and obesity may point to the possible crucial role of mast cells in the etiogenesis of skin tags through its interaction with fibroblasts and keratinocytes.

Differential susceptibility of primary cultured human skin cells to hypericin PDT in an in vitro model.

Science.gov (United States)

Popovic, A; Wiggins, T; Davids, L M

2015-08-01

Skin cancer is the most common cancer worldwide, and its incidence rate in South Africa is increasing. Photodynamic therapy (PDT) has been shown to be an effective treatment modality, through topical administration, for treatment of non-melanoma skin cancers. Our group investigates hypericin-induced PDT (HYP-PDT) for the treatment of both non-melanoma and melanoma skin cancers. However, a prerequisite for effective cancer treatments is efficient and selective targeting of the tumoral cells with minimal collateral damage to the surrounding normal cells, as it is well established that cancer therapies have bystander effects on normal cells in the body, often causing undesirable side effects. The aim of this study was to investigate the cellular and molecular effects of HYP-PDT on normal primary human keratinocytes (Kc), melanocytes (Mc) and fibroblasts (Fb) in an in vitro tissue culture model which represented both the epidermal and dermal cellular compartments of human skin. Cell viability analysis revealed a differential cytotoxic response to a range of HYP-PDT doses in all the human skin cell types, showing that Fb (LD50=1.75μM) were the most susceptible to HYP-PDT, followed by Mc (LD50=3.5μM) and Kc (LD50>4μM HYP-PDT) These results correlated with the morphological analysis which displayed distinct morphological changes in Fb and Mc, 24h post treatment with non-lethal (1μM) and lethal (3μM) doses of HYP-PDT, but the highest HYP-PDT doses had no effect on Kc morphology. Fluorescent microscopy displayed cytoplasmic localization of HYP in all the 3 skin cell types and additionally, HYP was excluded from the nuclei in all the cell types. Intracellular ROS levels measured in Fb at 3μM HYP-PDT, displayed a significant 3.8 fold (phuman skin cells thus highlighting the efficacy and indeed, the potential bystander effect of if administered in vivo. This study contributes toward our knowledge of the cellular response of the epidermis to photodynamic therapies and

Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

Energy Technology Data Exchange (ETDEWEB)

Yamakoshi, Takako [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Makino, Teruhiko, E-mail: tmakino@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Ur Rehman, Mati; Yoshihisa, Yoko [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Sugimori, Michiya [Department of Integrative Neuroscience, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Shimizu, Tadamichi, E-mail: shimizut@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan)

2013-03-01

Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes.

Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

International Nuclear Information System (INIS)

Yamakoshi, Takako; Makino, Teruhiko; Ur Rehman, Mati; Yoshihisa, Yoko; Sugimori, Michiya; Shimizu, Tadamichi

2013-01-01

Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes

CT after gastrectomy for gastric carcinoma : significance of soft tissue surrounding the celiac axis

International Nuclear Information System (INIS)

Baek, Seung Yon; Kim, Hae Young; Choi, Hye Young; Lee, Sun Wha; Ko, Eun Joo; Lee, Myung Sook

1997-01-01

To evaluate whether soft tissue surrounding the celiac axis, as seen on abdominal CT imaging after gastrectomy for gastric carcinoma, should be considered as the recurrence of carcinoma or postoperative change. One hundred and forty-one abdominal CT examinations of 71 patients who had undergone subtotal or total gastrectomy for gastric carcinoma were included in our study. Conventional CT scans were obtained with 1cm thickness and interval from the diaphragm to the kidneys after contrast enhancement. It was considered that carcinoma had not recurred if findings were negative on UGI series, endoscopy with biopsy and a normal level of carcinoembryonic antigen except for soft tissue surrounding the celiac axis on abdominal CT. We then divided subjects into a recurrence group(N=20) and normal group(N=51) and on initial follow-up CT(FU-CT), analyzed the incidence, margin, shape, extent, degree and pattern of attenuation of the soft tissue surrounding the celiac axis in both groups. Since the second FU-CT examination, we observed changes in the soft tissue surrounding the celiac axis. On initial follow-up CT, at mean 308 days after surgery, fifty-five percent(39/71) of total patients (70%(14/20) of the recurrence group and 49%(25/51) of the normal group) showed soft tissue surrounding the celiac axis. The margin was distinct in 12(86%) of the recurrence group and indistinct in 21(84%) of the normal group(p<0.001). Twelve (86%) of the recurrence group showed a nodular or confluent nodular shape and 21(84%) of the normal group showed a permeative shape (p<0.001). Extent was unilateral in eight (57%) of the recurrence group and bilateral in 16(64%) of the normal group. Attenuation was similar to that of the spleen and muscle in seven(50%) of the recurrence group and was similar to that of muscle in 18(72%) of the normal group. The pattern of attenuation was homogeneous in 13(93%) of the recurrence group and 21(84%) of the normal group. There was no significant difference in

In vivo study of human skin using pulsed terahertz radiation

Energy Technology Data Exchange (ETDEWEB)

Pickwell, E [Semiconductor Physics Group, Cavendish Laboratory, Cambridge University, Madingley Road, Cambridge CB3 0HE (United Kingdom); Cole, B E [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom); Fitzgerald, A J [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom); Pepper, M [Semiconductor Physics Group, Cavendish Laboratory, Cambridge University, Madingley Road, Cambridge CB3 0HE (United Kingdom); Wallace, V P [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom)

2004-05-07

Studies in terahertz (THz) imaging have revealed a significant difference between skin cancer (basal cell carcinoma) and healthy tissue. Since water has strong absorptions at THz frequencies and tumours tend to have different water content from normal tissue, a likely contrast mechanism is variation in water content. Thus, we have previously devised a finite difference time-domain (FDTD) model which is able to closely simulate the interaction of THz radiation with water. In this work we investigate the interaction of THz radiation with normal human skin on the forearm and palm of the hand in vivo. We conduct the first ever systematic in vivo study of the response of THz radiation to normal skin. We take in vivo reflection measurements of normal skin on the forearm and palm of the hand of 20 volunteers. We compare individual examples of THz responses with the mean response for the areas of skin under investigation. Using the in vivo data, we demonstrate that the FDTD model can be applied to biological tissue. In particular, we successfully simulate the interaction of THz radiation with the volar forearm. Understanding the interaction of THz radiation with normal skin will form a step towards developing improved imaging algorithms for diagnostic detection of skin cancer and other tissue disorders using THz radiation.

In vivo study of human skin using pulsed terahertz radiation

International Nuclear Information System (INIS)

Pickwell, E; Cole, B E; Fitzgerald, A J; Pepper, M; Wallace, V P

2004-01-01

Studies in terahertz (THz) imaging have revealed a significant difference between skin cancer (basal cell carcinoma) and healthy tissue. Since water has strong absorptions at THz frequencies and tumours tend to have different water content from normal tissue, a likely contrast mechanism is variation in water content. Thus, we have previously devised a finite difference time-domain (FDTD) model which is able to closely simulate the interaction of THz radiation with water. In this work we investigate the interaction of THz radiation with normal human skin on the forearm and palm of the hand in vivo. We conduct the first ever systematic in vivo study of the response of THz radiation to normal skin. We take in vivo reflection measurements of normal skin on the forearm and palm of the hand of 20 volunteers. We compare individual examples of THz responses with the mean response for the areas of skin under investigation. Using the in vivo data, we demonstrate that the FDTD model can be applied to biological tissue. In particular, we successfully simulate the interaction of THz radiation with the volar forearm. Understanding the interaction of THz radiation with normal skin will form a step towards developing improved imaging algorithms for diagnostic detection of skin cancer and other tissue disorders using THz radiation

Stereological quantification of lymphocytes in skin biopsies from atopic dermatitis patients

DEFF Research Database (Denmark)

Ellingsen, A R; Sørensen, F B; Larsen, Jytte Overgaard

2001-01-01

with active eczema in 8 adults with AD and from clinically normal skin from 4 of the patients. Five persons without allergy or skin disease served as controls. The mean number of lymphocytes in 4-mm skin biopsies was 469,000 and 124,000 in active eczema and in clinically normal skin, respectively. Compared......Atopic dermatitis (AD) is histologically characterized by lymphocytic infiltration of the skin and quantitative assessment is required. This study introduces stereological techniques to quantify the number of lymphocytes in skin biopsies. Four-millimetre punch biopsies were taken from skin...... with controls, the number of lymphocytes in biopsies increased by a factor of 6.8 in active eczema and a factor of 1.8 in clinically normal skin. If 20% of skin is affected by eczema the total number of lymphocytes located in the affected skin can be estimated to 1.27 x 10(10). A patient with clinically...

An oral TRPV1 antagonist attenuates laser radiant-heat-evoked potentials and pain ratings from UV(B)-inflamed and normal skin.

Science.gov (United States)

Schaffler, Klaus; Reeh, Peter; Duan, W Rachel; Best, Andrea E; Othman, Ahmed A; Faltynek, Connie R; Locke, Charles; Nothaft, Wolfram

2013-02-01

Laser (radiant-heat) evoked potentials (LEPs) from vertex-EEG peak-to-peak (PtP) amplitude were used to determine acute antinociceptive/antihyperalgesic efficacy of ABT-102, a novel TRPV1 antagonist efficacious in preclinical pain models, compared with active controls and placebo in normal and UV(B)-inflamed skin. This was a randomized, placebo- and active-controlled, double-blind, intra-individual, crossover trial. Twenty-four healthy subjects received six sequences of single doses of ABT-102 (0.5, 2, 6 mg), etoricoxib 90 mg, tramadol 100 mg and placebo. Painful stimuli were induced by CO(2) -laser on normal and UV(B) -inflamed skin. LEPs and visual analogue scale (VAS-pain) ratings were taken at baseline and hourly up to 8 h post-dose from both skin types. Compared with placebo, significant mean decreases in the primary variable of LEP PtP-amplitude from UV(B)-inflamed skin were observed with ABT-102 6 mg (P < 0.001), ABT-102 2 mg (P = 0.002), tramadol 100 mg (P < 0.001), and etoricoxib 90 mg (P = 0.001) over the 8 h period; ABT-102 0.5 mg was similar to placebo. ABT-102 6 mg was superior to active controls over the 8 h period (P < 0.05) whereas ABT-102 2 mg was comparable. Improvements in VAS scores compared with placebo were observed with ABT-102 6 mg (P < 0.001) and ABT-102 2 mg (P = 0.002). ABT-102 average plasma concentrations were 1.3, 4.4 and 9.4 ng ml(-1) for the 0.5, 2 and 6 mg doses, respectively. There were no clinically significant safety findings. TRPV-1 antagonism appears promising in the management of clinical pain, but requires further investigation. © 2012 Abbott. British Journal of Clinical Pharmacology © 2012 The British Pharmacological Society.

Cutaneous Leishmaniasis Induces a Transmissible Dysbiotic Skin Microbiota that Promotes Skin Inflammation.

Science.gov (United States)

Gimblet, Ciara; Meisel, Jacquelyn S; Loesche, Michael A; Cole, Stephen D; Horwinski, Joseph; Novais, Fernanda O; Misic, Ana M; Bradley, Charles W; Beiting, Daniel P; Rankin, Shelley C; Carvalho, Lucas P; Carvalho, Edgar M; Scott, Phillip; Grice, Elizabeth A

2017-07-12

Skin microbiota can impact allergic and autoimmune responses, wound healing, and anti-microbial defense. We investigated the role of skin microbiota in cutaneous leishmaniasis and found that human patients infected with Leishmania braziliensis develop dysbiotic skin microbiota, characterized by increases in the abundance of Staphylococcus and/or Streptococcus. Mice infected with L. major exhibit similar changes depending upon disease severity. Importantly, this dysbiosis is not limited to the lesion site, but is transmissible to normal skin distant from the infection site and to skin from co-housed naive mice. This observation allowed us to test whether a pre-existing dysbiotic skin microbiota influences disease, and we found that challenging dysbiotic naive mice with L. major or testing for contact hypersensitivity results in exacerbated skin inflammatory responses. These findings demonstrate that a dysbiotic skin microbiota is not only a consequence of tissue stress, but also enhances inflammation, which has implications for many inflammatory cutaneous diseases. Copyright © 2017 Elsevier Inc. All rights reserved.

Muscle biopsies off-set normal cellular signaling in surrounding musculature

DEFF Research Database (Denmark)

Krag, Thomas O; Hauerslev, Simon; Dahlqvist, Julia R

2013-01-01

muscle tissue for at least 3 weeks after the biopsy was performed and magnetic resonance imaging suggests that an effect of a biopsy may persist for at least 5 months. Cellular signaling after a biopsy resembles what is seen in severe limb-girdle muscular dystrophy type 2I with respect to protein......Studies of muscle physiology and muscular disorders often require muscle biopsies to answer questions about muscle biology. In this context, we have often wondered if muscle biopsies, especially if performed repeatedly, would affect interpretation of muscle morphology and cellular signaling. We...... hypothesized that muscle morphology and cellular signaling involved in myogenesis/regeneration and protein turnover can be changed by a previous muscle biopsy in close proximity to the area under investigation. Here we report a case where a past biopsy or biopsies affect cellular signaling of the surrounding...

Skin perfusion pressure measured with a photo sensor in an air-filled plastic balloon: validity and reproducibility on the lower leg in normal subjects and patients suspected of obliterative arterial disease

DEFF Research Database (Denmark)

Nielsen, Steen Levin; Nielsen, Anne Lerberg; Vind, Susanne Haase

2011-01-01

An inflatable small plastic bag including a photo sensor was constructed for measurement of skin perfusion pressure avoiding the rim of the photo sensor over bony and tendineous surfaces of the tibia below the knee, at the ankle, and on the dorsal forefoot. Compression was obtained using a conical...... blood pressure cuff with continuous decrease from suprasystolic arm pressure. The validity of skin perfusion pressure with the new device was compared to that of isotope washout below the knee in normal subjects and in patients with an ischemic forefoot with acceptable agreement. The method had a high...... reproducibility within and between days in normal subjects. Compared to systolic arterial pressure measured using a strain gauge with a cuff on the ankle in normal subjects and patients with intermittent claudication the new device showed blood pressure in the skin closer to the diastolic pressure. The new...

Bacterial skin flora of diabetic patients in the Jos University Teaching ...

African Journals Online (AJOL)

Diabetics frequently are afflicted with bacterial skin infections because of the high circulating blood sugar. The frequent skin infections in these patients may be a result of change in normal skin flora. This study was carried out to find out the normal skin flora of these patients. Ninety four (50 study and 44 control) consecutive ...

Skin care products can aggravate epidermal function: studies in a murine model suggest a pathogenic role in sensitive skin

OpenAIRE

Li, Z; Hu, L; Elias, PM; Man, M-Q

2018-01-01

Sensitive skin is defined as a spectrum of unpleasant sensations in response to a variety of stimuli. However, only some skin care products provoke cutaneous symptoms in individuals with sensitive skin. Hence, it would be useful to identify products that could provoke cutaneous symptoms in individuals with sensitive skin.To assess whether vehicles, as well as certain branded skin care products, can alter epidermal function following topical applications to normal mouse skin.Following topical ...

Skin perfusion pressure measured with a photo sensor in an air-filled plastic balloon: validity and reproducibility on the lower leg in normal subjects and patients suspected of obliterative arterial disease

International Nuclear Information System (INIS)

Nielsen, Steen Levin; Nielsen, Anne Lerberg; Vind, Susanne Haase; Thomassen, Anders

2011-01-01

An inflatable small plastic bag including a photo sensor was constructed for measurement of skin perfusion pressure avoiding the rim of the photo sensor over bony and tendineous surfaces of the tibia below the knee, at the ankle, and on the dorsal forefoot. Compression was obtained using a conical blood pressure cuff with continuous decrease from suprasystolic arm pressure. The validity of skin perfusion pressure with the new device was compared to that of isotope washout below the knee in normal subjects and in patients with an ischemic forefoot with acceptable agreement. The method had a high reproducibility within and between days in normal subjects. Compared to systolic arterial pressure measured using a strain gauge with a cuff on the ankle in normal subjects and patients with intermittent claudication the new device showed blood pressure in the skin closer to the diastolic pressure. The new pressure device thus had acceptable validity and reproducibility for estimation of the skin perfusion pressure and can be used on bony and tendineous sites on the lower limb in regions where critical wound healing is frequent, e.g. ankle and forefoot

Hyperpigmentation of the skin associated with minocycline therapy

International Nuclear Information System (INIS)

Gordon, G.; Sparano, B.M.; Iatropoulos, M.J.

1985-01-01

Skin biopsy specimens and discolored fingernails from minocycline-treated patients were examined by light and electron microscopy, histochemistry, and energy-dispersive x-ray analysis. Both hyperpigmented and adjacent normally pigmented skin samples contained pigment-laden macrophages in the dermis, although these cells were more numerous in the hyperpigmented skin samples. Elemental analysis showed that both pigment deposits and stratum corneum of hyperpigmented skin samples contained iron and calcium. Discolored areas of fingernails from a minocycline-treated patient also contained iron and calcium. Both skin and nail discoloration were possibly due to the presence of an iron chelate of minocycline and/or quinoid derivatives of minocycline. The presence of iron-containing pigment in normal as well as hyperpigmented skin may have predisposed to formation of minocycline-associated pigment in these patients

Lymphatic albumin clearance from psoriatic skin

International Nuclear Information System (INIS)

Staberg, B.; Klemp, P.; Aasted, M.; Worm, A.M.; Lund, P.

1983-01-01

In nine patients with untreated psoriasis vulgaris, human serum albumin labelled with 125 I or 131 I was injected intradermally in symmetrically located involved and uninvolved skin. The activity of the depots was followed by external detection, and the arrival of labelled albumin in plasma was monitored. In involved psoriatic skin the local mean half-time (T1/2) for tracer disappearance was 20.8 +/- 8.2 (S.D.) hr and in clinically normal skin, 29.1 +/- 9.6 (S.D.) hr. The difference was significant (p less than 0.002). Accordingly, the tracer from involved skin reached higher plasma levels than the tracer from uninvolved skin. However, under slight lymphatic stasis the appearance rate of radiolabelled albumin in plasma from both tissues was minimal during 1 to 2 hours after the injection, indicating that a local direct transvascular drainage of plasma albumin from the interstitium of diseased and normal skin was negligible. We conclude that the previously demonstrated increased extravasation of plasma proteins in involved psoriatic skin is compensated by an increased lymphatic drainage of plasma proteins, and not by an increased local transvascular return

p63 in skin development and ectodermal dysplasias

Science.gov (United States)

Koster, Maranke I.

2010-01-01

The transcription factor p63 is critically important for skin development and maintenance. Processes that require p63 include epidermal lineage commitment, epidermal differentiation, cell adhesion, and basement membrane formation. Not surprisingly, alterations in the p63 pathway underlie a subset of ectodermal dysplasias, developmental syndromes in which the skin and skin appendages do not develop normally. This review summarizes the current understanding of the role of p63 in normal development and ectodermal dysplasias. PMID:20445549

Ectodermal dysplasia-skin fragility syndrome

Directory of Open Access Journals (Sweden)

Vijay S Adhe

2011-01-01

Full Text Available Ectodermal dysplasia-skin fragility (EDSF syndrome is a rare and first described inherited disorder of desmosomes. It occurs due to loss-of-function mutations in PKP1 gene resulting in poorly formed desmosomes and loss of desmosomal and epidermal integrity. We report a case of a 2-year-old Indian male child who presented with palmoplantar hyperkeratosis with fissuring, short, sparse, and easily pluckable scalp hair, nail dystrophy, and multiple erosions over the skin. Skin biopsy showed epidermal hyperplasia with widening of intercellular spaces. His developmental milestones were delayed but intelligence was normal. Echocardiography, X-ray chest, and electrocardiogram were normal. Very few cases of this syndrome have been reported in the literature. We consider this as the first case report from India.

Research surface resistance of copper normal and abnormal skin-effects depending on the frequency of electromagnetic field

International Nuclear Information System (INIS)

Kutovyi, V.A.; Komir, A.I.

2013-01-01

The results of the frequency dependence of surface resistance of copper in diffuse and specular reflection of electrons from the conductive surface of the high-frequency resonance of the system depending on the frequency of the electromagnetic field in the normal and anomalous skin effect. Found, the surface resistance of copper is reduced by more than 10 times at the temperature of liquid helium, as compared with a surface resistivity at room temperature, at frequencies f ≤ 173 MHz, for diffuse reflection of conduction electrons from the surface of the conductive layer, and the specular reflection - at frequencies f ≤ 346 MHz

OCT imaging of skin cancer and other dermatological diseases

DEFF Research Database (Denmark)

Mogensen, Mette; Thrane, Lars; Jørgensen, Thomas Martini

2009-01-01

Optical coherence tomography (OCT) provides clinicians and researchers with micrometer-resolution, in vivo, cross-sectional images of human skin up to several millimeter depth. This review of OCT imaging applied within dermatology covers the application of OCT to normal skin, and reports on a lar...... number of applications in the fields of non-melanoma skin cancer, malignant melanomas, psoriasis and dermatitis, infestations, bullous skin diseases, tattoos, nails, haemangiomas, and other skin diseases. (© 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim)......Optical coherence tomography (OCT) provides clinicians and researchers with micrometer-resolution, in vivo, cross-sectional images of human skin up to several millimeter depth. This review of OCT imaging applied within dermatology covers the application of OCT to normal skin, and reports on a large...

Corticocortical feedback increases the spatial extent of normalization.

Science.gov (United States)

Nassi, Jonathan J; Gómez-Laberge, Camille; Kreiman, Gabriel; Born, Richard T

2014-01-01

Normalization has been proposed as a canonical computation operating across different brain regions, sensory modalities, and species. It provides a good phenomenological description of non-linear response properties in primary visual cortex (V1), including the contrast response function and surround suppression. Despite its widespread application throughout the visual system, the underlying neural mechanisms remain largely unknown. We recently observed that corticocortical feedback contributes to surround suppression in V1, raising the possibility that feedback acts through normalization. To test this idea, we characterized area summation and contrast response properties in V1 with and without feedback from V2 and V3 in alert macaques and applied a standard normalization model to the data. Area summation properties were well explained by a form of divisive normalization, which computes the ratio between a neuron's driving input and the spatially integrated activity of a "normalization pool." Feedback inactivation reduced surround suppression by shrinking the spatial extent of the normalization pool. This effect was independent of the gain modulation thought to mediate the influence of contrast on area summation, which remained intact during feedback inactivation. Contrast sensitivity within the receptive field center was also unaffected by feedback inactivation, providing further evidence that feedback participates in normalization independent of the circuit mechanisms involved in modulating contrast gain and saturation. These results suggest that corticocortical feedback contributes to surround suppression by increasing the visuotopic extent of normalization and, via this mechanism, feedback can play a critical role in contextual information processing.

Laser-induced thermal coagulation enhances skin uptake of topically applied compounds

DEFF Research Database (Denmark)

Haak, C S; Hannibal, J; Paasch, U

2017-01-01

microchannels surrounded by CZ compared to channels with no CZ (CZ-20 and CZ-80>CZ-0).The thickness of CZ affected PEG distribution in skin. A thin CZ-20 favored significantly higher mean fluorescence intensities inside CZ areas compared to CZ-80 (PEG 350, 1,000, and 5,000; P ...BACKGROUND: Ablative fractional laser (AFL) generates microchannels in skin surrounded by a zone of thermally altered tissue, termed the coagulation zone (CZ). The thickness of CZ varies according to applied wavelength and laser settings. It is well-known that AFL channels facilitate uptake...... of topically applied compounds, but the importance of CZ is unknown. METHODS: Franz Cells were used to investigate skin uptake and permeation of fluorescent labeled polyethylene glycols (PEGs) with mean molecular weights (MW) of 350, 1,000, and 5,000 Da. Microchannels with CZ thicknesses ranging from 0 to 80...

Investigation of the predictive validity of laser-EPs in normal, UVB-inflamed and capsaicin-irritated skin with four analgesic compounds in healthy volunteers.

Science.gov (United States)

Schaffler, Klaus; Nicolas, Laurent B; Borta, Andreas; Brand, Tobias; Reitmeir, Peter; Roebling, Robert; Scholpp, Joachim

2017-07-01

The aim of the present study was to assess the predictivity of laser-(radiant-heat)-evoked potentials (LEPs) from the vertex electroencephalogram, using an algesimetric procedure, testing the anti-nociceptive/anti-hyperalgesic effects of single oral doses of four marketed analgesics (of different compound classes) vs. placebo, in healthy volunteers with three skin types. This was a randomized, placebo-controlled, single-blind, five-way-crossover trial. Twenty-five healthy male/female Caucasians were included (receiving celecoxib 200 mg, pregabalin 150 mg, duloxetine 60 mg, lacosamide 100 mg or placebo) in a Williams design, with CO 2 laser-induced painful stimuli to normal, ultraviolet (UV) B-inflamed and capsaicin-irritated skin. LEPs and visual analogue scale ratings were taken at baseline and hourly for 6 h postdose from all three skin types. In normal skin, the averaged postdose LEP peak-to-peak-(PtP)-amplitudes were reduced by pregabalin (-2.68 μV; 95% confidence interval (CI) -4.16, 1.19) and duloxetine (-1.73 μV; 95% CI -3.21, -0.26) but not by lacosamide and celecoxib vs. placebo. On UVB-irradiated skin, reflecting inflammatory pain, celecoxib induced a pronounced reduction in LEP PtP amplitudes vs. placebo (-6.2 μV; 95% CI -7.88, -4.51), with a smaller reduction by duloxetine (-4.54 μV; 95% CI -6.21, -2.87) and pregabalin (-3.72 μV; 95% CI -5.40, -2.04), whereas lacosamide was inactive. LEP PtP amplitudes on capsaicin-irritated skin, reflecting peripheral/spinal sensitization, as in neuropathic pain, were reduced by pregabalin (-3.78 μV; 95% CI -5.31, -2.25) and duloxetine (-2.32 μV; 95% CI -3.82, -0.82) but not by celecoxib or lacosamide vs. placebo, which was in agreement with known clinical profiles. Overall, PtP amplitude reductions were in agreement with subjective ratings. LEP algesimetry is sensitive to analgesics with different modes of action and may enable the effects of novel analgesics to be assessed during early clinical

A new algorithm for the discrimination of actinic keratosis from normal skin and squamous cell carcinoma based on in vivo analysis of optical properties by high-definition optical coherence tomography

DEFF Research Database (Denmark)

Boone, M A L M; Suppa, M; Marneffe, A

2016-01-01

properties for discrimination of AK from SCC and from normal sun exposed skin and to subdifferentiate AKs. METHODS: The technique of semi-log plot has been implemented on HD-OCT signals. This permitted the in vivo measurement of OCT signals coming from the skin entrance up to the superficial reticular dermis...... involvement, non-Bowenoid AK with follicular involvement, Bowenoid AK, hypertrophic and lichenoid form of AK and squamous cell carcinoma. CONCLUSION: HD-OCT seems to enable the combination of in vivo morphological analysis of cellular and 3D microarchitectural structures with in vivo analysis of optical...... properties of tissue scatterers in AK/SCC lesions and normal sun-exposed skin. In vivoHD-OCT analysis of optical properties permits AK discrimination from SCC and AK subdifferentiation with higher accuracy than in vivoHD-OCT analysis of morphology alone....

Skin Picking Disorder

Directory of Open Access Journals (Sweden)

Pinar Cetinay Aydin

2014-08-01

Full Text Available Skin picking disorder is not a dermatological disorder and it is a table characterized with picking skin excessively and repetitively, leading to damage in skin tissue. Unlike normal picking behaviour, psychogenic skin picking is repetitive and it can lead to severe damage in the skin and even complications which constitute vital danger. While some patients define frequent but short lasting picking attacks, others define rarer attacks which last a few hours. Skin picking disorder, which is not included in the classification systems up to DSM-5 as a separate diagnosis category, is included as an independent diagnosis in Obsessive Compulsive Disorder and Associated Disorders category in DSM-5. In case reports, open label studies and double blind studies selective serotonin reuptake inhibitors are shown to be effective in the treatment of skin picking disorder. Mostly, cognitive-behaviourial techniques are used and have been proven to be useful in psychotherapy. Habit reversal is one of the behaviourial techniques which are frequently applied, give positive results in which well-being state can be maintained. [Psikiyatride Guncel Yaklasimlar - Current Approaches in Psychiatry 2014; 6(4.000: 401-428

Corticocortical feedback increases the spatial extent of normalization

Science.gov (United States)

Nassi, Jonathan J.; Gómez-Laberge, Camille; Kreiman, Gabriel; Born, Richard T.

2014-01-01

Normalization has been proposed as a canonical computation operating across different brain regions, sensory modalities, and species. It provides a good phenomenological description of non-linear response properties in primary visual cortex (V1), including the contrast response function and surround suppression. Despite its widespread application throughout the visual system, the underlying neural mechanisms remain largely unknown. We recently observed that corticocortical feedback contributes to surround suppression in V1, raising the possibility that feedback acts through normalization. To test this idea, we characterized area summation and contrast response properties in V1 with and without feedback from V2 and V3 in alert macaques and applied a standard normalization model to the data. Area summation properties were well explained by a form of divisive normalization, which computes the ratio between a neuron's driving input and the spatially integrated activity of a “normalization pool.” Feedback inactivation reduced surround suppression by shrinking the spatial extent of the normalization pool. This effect was independent of the gain modulation thought to mediate the influence of contrast on area summation, which remained intact during feedback inactivation. Contrast sensitivity within the receptive field center was also unaffected by feedback inactivation, providing further evidence that feedback participates in normalization independent of the circuit mechanisms involved in modulating contrast gain and saturation. These results suggest that corticocortical feedback contributes to surround suppression by increasing the visuotopic extent of normalization and, via this mechanism, feedback can play a critical role in contextual information processing. PMID:24910596

Skin Fungi from Colonization to Infection.

Science.gov (United States)

de Hoog, Sybren; Monod, Michel; Dawson, Tom; Boekhout, Teun; Mayser, Peter; Gräser, Yvonne

2017-07-01

Humans are exceptional among vertebrates in that their living tissue is directly exposed to the outside world. In the absence of protective scales, feathers, or fur, the skin has to be highly effective in defending the organism against the gamut of opportunistic fungi surrounding us. Most (sub)cutaneous infections enter the body by implantation through the skin barrier. On intact skin, two types of fungal expansion are noted: (A) colonization by commensals, i.e., growth enabled by conditions prevailing on the skin surface without degradation of tissue, and (B) infection by superficial pathogens that assimilate epidermal keratin and interact with the cellular immune system. In a response-damage framework, all fungi are potentially able to cause disease, as a balance between their natural predilection and the immune status of the host. For this reason, we will not attribute a fixed ecological term to each species, but rather describe them as growing in a commensal state (A) or in a pathogenic state (B).

SU-E-J-273: Skin Temperature Recovery Rate as a Potential Predictor for Radiation-Induced Skin Reactions

Energy Technology Data Exchange (ETDEWEB)

Biswal, N C; Wu, Z; Chu, J [Rush University Medical Center, Chicago, IL (United States); Sun, J [Argonne National Laboratory, Lemont, IL (United States)

2015-06-15

Purpose: To assess the potential of dynamic infrared imaging to evaluate early skin reactions during radiation therapy in cancer patients. Methods: Thermal images were captured by our home-built system consisting of two flash lamps and an infrared (IR) camera. The surface temperature of the skin was first raised by ∼ 6 °C from ∼1 ms short flashes; the camera then captured a series of IR images for 10 seconds. For each image series, a basal temperature was recorded for 0.5 seconds before flash was triggered. The temperature gradients (ε) were calculated between a reference point (immediately after the flash) and at a time point of 2sec, 4sec and 9sec after that. A 1.0 cm region of interest (ROI) on the skin was drawn; the mean and standard deviations of the ROIs were calculated. The standard ε values for normal human skins were evaluated by imaging 3 healthy subjects with different skin colors. All of them were imaged on 3 separate days for consistency checks. Results: The temperature gradient, which is the temperature recovery rate, depends on the thermal properties of underlying tissue, i.e. thermal conductivity. The average ε for three volunteers averaged over 3 measurements were 0.64±0.1, 0.72±0.2 and 0.80±0.3 at 2sec, 4sec and 9sec respectively. The standard deviations were within 1.5%–3.2%. One of the volunteers had a prior small skin burn on the left wrist and the ε values for the burned site were around 9% (at 4sec) and 13% (at 9sec) lower than that from the nearby normal skin. Conclusion: The temperature gradients from the healthy subjects were reproducible within 1.5%–3.2 % and that from a burned skin showed a significant difference (9%–13%) from the normal skin. We have an IRB approved protocol to image head and neck patients scheduled for radiation therapy.

SU-E-J-273: Skin Temperature Recovery Rate as a Potential Predictor for Radiation-Induced Skin Reactions

International Nuclear Information System (INIS)

Biswal, N C; Wu, Z; Chu, J; Sun, J

2015-01-01

Purpose: To assess the potential of dynamic infrared imaging to evaluate early skin reactions during radiation therapy in cancer patients. Methods: Thermal images were captured by our home-built system consisting of two flash lamps and an infrared (IR) camera. The surface temperature of the skin was first raised by ∼ 6 °C from ∼1 ms short flashes; the camera then captured a series of IR images for 10 seconds. For each image series, a basal temperature was recorded for 0.5 seconds before flash was triggered. The temperature gradients (ε) were calculated between a reference point (immediately after the flash) and at a time point of 2sec, 4sec and 9sec after that. A 1.0 cm region of interest (ROI) on the skin was drawn; the mean and standard deviations of the ROIs were calculated. The standard ε values for normal human skins were evaluated by imaging 3 healthy subjects with different skin colors. All of them were imaged on 3 separate days for consistency checks. Results: The temperature gradient, which is the temperature recovery rate, depends on the thermal properties of underlying tissue, i.e. thermal conductivity. The average ε for three volunteers averaged over 3 measurements were 0.64±0.1, 0.72±0.2 and 0.80±0.3 at 2sec, 4sec and 9sec respectively. The standard deviations were within 1.5%–3.2%. One of the volunteers had a prior small skin burn on the left wrist and the ε values for the burned site were around 9% (at 4sec) and 13% (at 9sec) lower than that from the nearby normal skin. Conclusion: The temperature gradients from the healthy subjects were reproducible within 1.5%–3.2 % and that from a burned skin showed a significant difference (9%–13%) from the normal skin. We have an IRB approved protocol to image head and neck patients scheduled for radiation therapy

Differentiation of involved and uninvolved psoriatic skin from healthy skin using noninvasive visual, colorimeter and evaporimeter methods.

Science.gov (United States)

Pershing, L K; Bakhtian, S; Wright, E D; Rallis, T M

1995-08-01

Uninvolved skin of psoriasis may not be entirely normal. The object was to characterize healthy, uninvolved psoriatic skin and lesional skin by biophysical methods. Involved and uninvolved psoriatic and age-gender matched healthy skin was measured objectively with a colorimeter and evaporimeter and subjectively with visual assessment in 14 subjects. Visual assessment of erythema (E), scaling (S) and induration (I) as well as the target lesion score at the involved psoriatic skin sites were significantly elevated (puninvolved psoriatic skin >healthy skin (pcolorimeter L* and a* scale values at uninvolved psoriatic skin sites were lower and higher (pcolorimeter description (L*× b*)/a* significantly differentiated healthy skin from both involved and uninvolved psoriatic skin. These collective data highlight that even visually appearing uninvolved psoriatic skin is compromised compared with healthy skin. These objective, noninvasive but differential capabilities of the colorimeter and evaporimeter will aid in the mechanistic quantification of new psoriatic drug therapies and in conjuction with biochemical studies, add to understanding of the multifactorial pathogenesis of psoriasis.

Semi-conservative deoxyribonucleic acid synthesis in unirradiated and ultraviolet-irradiated xeroderma pigmentosum and normal human skin fibroblasts

International Nuclear Information System (INIS)

Rude, J.M.; Friedberg, E.C.

1977-01-01

Rates of semiconservative DNA synthesis have been investigated in asynchronous xeroderma pigmentosum (XP), XP variant, and normal human skin fibroblasts using the technique of cellular autoradiography. In unirradiated cells, no differences in DNA synthesis rates were detected among the three cell strains. Exposure to UV radiation caused the rate of DNA synthesis to decrease for at least three hours in all three cell strains. In the normal cell strain, recovery of the DNA synthetic rate occurred at later times following a UV fluence of 5 J/m 2 . At this same UV fluence, recovery was absent in classical XP cells during a 24 h post-irradiation period while it was slower than normal in XP variant cells. When the UV fluence to classical XP and XP variant cells was reduced so that survival in all three cell strains was approximately the same (25%), recovery of the DNA synthetic rate was similar in all three cell strains. These results are discussed in terms of current models of DNA replication in UV-irradiated cells and indicate: (1) that pyrimidine dimers are very effective blocks to DNA synthesis and (2) that there is no inherent defect in semiconservative DNA synthesis in either classical XP or XP variant cells which is independent of a defect in DNA repair capacity

Main approaches for delivering antioxidant vitamins through the skin to prevent skin ageing.

Science.gov (United States)

Gašperlin, Mirjana; Gosenca, Mirjam

2011-07-01

One of the major contributions to skin photoageing and diseases is oxidative stress, caused by UV radiation inducing reactive oxygen and nitrogen species. Successful prophylaxis and therapy would necessitate control of the oxidant/antioxidant balance at the affected site, which can be achieved through the external supply of endogenous antioxidants. This review discusses possible strategies for dermal delivery of the antioxidant vitamins E and C, as oral supplementation has proved insufficient. These antioxidants have low skin bioavailability, owing to their poor solubility, inefficient skin permeability, or instability during storage. These drawbacks can be overcome by various approaches, such as chemical modification of the vitamins and the use of new colloidal drug delivery systems. New knowledge is included about the importance of: enhancing the endogenous skin antioxidant defense through external supply; the balance between various skin antioxidants; factors that can improve the skin bioavailability of antioxidants; and new delivery systems, such as microemulsions, used to deliver vitamins C and E into the skin simultaneously. A promising strategy for enhancing skin protection from oxidative stress is to support the endogenous antioxidant system, with antioxidants containing products that are normally present in the skin.

Photoactivation of corticosteroids in UVB-exposed skin.

Science.gov (United States)

Miolo, G; Caffieri, S; Dalzoppo, D; Gallocchio, F; Fasani, E; Beyersbergen van Henegouwen, G M J

2011-04-04

The photodegradation of flumethasone (FM) and fluocinolone acetonide (FC) was studied in solution and in the pig skin. Both glucocorticosteroids applied to the pig skin were unstable under UVB light. The photoproducts formed in the skin were the lumi-, photolumi- and andro-derivatives for FM, the same found in vitro. Instead, FC hydroperoxide formed in solution was not found in the skin: the reactivity and oxidative ability of this photoproduct towards biological substrates (lipids, proteins) seems the reason of the lack of its detection in the ex vivo model. In fact, it demonstrated to quickly oxidize amino acids and peptides, and to react with BSA both in the dark and under irradiation. Moreover, the presence in the irradiated pig skin of the FC andro-derivative, which usually forms in H-donating environment, seems consistent with the mechanism of Norrish I fragmentation followed by H-abstraction, likely from the surrounding biological substrates. These findings indicate that photoreactivity of these compounds may take place in the skin of patients exposing themselves to sunlight and is a warning about possible skin damage as a result of that. Furthermore, photolability of these drugs in the skin might cause loss of their therapeutic activity. Copyright © 2011 Elsevier B.V. All rights reserved.

Topical PDT in the Treatment of Benign Skin Diseases: Principles and New Applications

Directory of Open Access Journals (Sweden)

Miri Kim

2015-09-01

Full Text Available Photodynamic therapy (PDT uses a photosensitizer, light energy, and molecular oxygen to cause cell damage. Cells exposed to the photosensitizer are susceptible to destruction upon light absorption because excitation of the photosensitizing agents leads to the production of reactive oxygen species and, subsequently, direct cytotoxicity. Using the intrinsic cellular heme biosynthetic pathway, topical PDT selectively targets abnormal cells, while preserving normal surrounding tissues. This selective cytotoxic effect is the basis for the use of PDT in antitumor treatment. Clinically, PDT is a widely used therapeutic regimen for oncologic skin conditions such as actinic keratosis, squamous cell carcinoma in situ, and basal cell carcinoma. PDT has been shown, under certain circumstances, to stimulate the immune system and produce antibacterial, and/or regenerative effects while protecting cell viability. Thus, it may be useful for treating benign skin conditions. An increasing number of studies support the idea that PDT may be effective for treating acne vulgaris and several other inflammatory/infective skin diseases, including psoriasis, rosacea, viral warts, and aging-related changes. This review provides an overview of the clinical investigations of PDT and discusses each of the essential aspects of the sequence: its mechanism of action, common photosensitizers, light sources, and clinical applications in dermatology. Of the numerous clinical trials of PDT in dermatology, this review focuses on those studies that have reported remarkable therapeutic benefits following topical PDT for benign skin conditions such as acne vulgaris, viral warts, and photorejuvenation without causing severe side effects.

ICRP-26 and skin contamination

International Nuclear Information System (INIS)

Finnigan, T.; Huda, W.; Newbery, G.R.

1979-01-01

The experience of dealing with skin contamination incidents at The Radiochemical Centre over a 3-year period is presented. Data are given for the primary isotopes involved, the duration of skin contamination, and the skin doses that arise from these incidents. The methods employed in performing dosimetry for skin contamination are discussed and examples involving the isotopes carbon-14 and indium-111 are described. For skin contamination incidents, the mode of penetration of the activity into skin is normally not known and this can be of major significance for the final skin dose estimate. The operational health physics difficulties encountered in complying with both ICRP-26 and UK legislation for skin contamination are considered. In the event of multiple exposure (i.e. skin doses calculated from whole body film badges, extremity TLD dose meters and skin contamination) there is ambiguity in the precise meaning of the skin dose. The usefulness of Derived Working Levels is also discussed. Experience at The Radiochemical Centre has shown that good plant design, proper training and prompt action in dealing with contamination incidents ensures that overexposures to skin from accidental contamination are rare occurrences. (author)

An Assessment of Normalized Difference Skin Index Robustness in Aquatic Environments

Science.gov (United States)

2014-03-27

20 11 40 0. 56 0. 57 0. 58 0. 590 . 6 0. 61 0. 62 0. 63 W av el en gt h (n m ) Reflectance 0 m L 1. 07 m L 2. 14 m L 3. 21 m L 4. 28 m L 35 .7 1...thickness from water concentration profiles obtained with Raman spectroscopy”. Acta Dermato-Venereologica, 87(1):4–8, 2007. [10] Eismann, Michael T...confocal Raman spectroscopy”. Skin Research and Technology, 16(2):137–141, 2009. [35] Nunez, Abel S. “A physical model of human skin and its application

Number of Langerhans cells is decreased in premalignant keratosis and skin cancers.

Science.gov (United States)

Shevchuk, Z; Filip, A; Shevchuk, V; Kashuba, E

2014-03-01

It was shown earlier that a number of CD207 positive Langerhans cells was lower in basal cell carcinomas than in the normal epidermis. Moreover, benign skin lesions presented a higher number of Langerhans cells when they were compared to malignant tumors. To count Langerhans cells, assessing expression levels of CD1A and CD207 markers in actinic keratosis, basal and squamous cell carcinomas, compared with the normal skin. Comparison of Langerhans cells might give a valuable prognostic marker for skin cancer. Immunohistochemistry and methods of statistics were used. Expression of CD1A and CD207 markers was assessed in tumor samples of actinic keratosis, cutaneous basal and squamous cell carcinomas, in comparison with the normal skin. In each cohort there were 40 patients (and 11 healthy individuals). We have shown that the number of Langerhans cells is considerably lower in cutaneous basal and squamous cell carcinomas, compared with their number in the normal skin (p keratosis, basal and squamous cell carcinoma. This may suggest an alteration of Langerhans cells phenotype in skin neoplastic diseases, making the number of Langerhans cells a valuable prognostic factor for skin tumors.

Characterization of skin friction coefficient, and relationship to stratum corneum hydration in a normal Chinese population.

Science.gov (United States)

Zhu, Y H; Song, S P; Luo, W; Elias, P M; Man, M Q

2011-01-01

Studies have demonstrated that some cutaneous biophysical properties vary with age, gender and body sites. However, the characteristics of the skin friction coefficient in different genders and age groups have not yet been well established. In the present study, we assess the skin friction coefficient in a larger Chinese population. A total of 633 subjects (300 males and 333 females) aged 0.15-79 years were enrolled. A Frictiometer FR 770 and Corneometer CM 825 (C&K MPA 5) were used to measure the skin friction coefficient and stratum corneum hydration, respectively, on the dorsal surface of the hand, the forehead and the canthus. In the females, the maximum skin friction coefficients on both the canthus and the dorsal hand skin were observed around the age of 40 years. In the males, the skin friction coefficient on the dorsal hand skin gradually increased from 0 to 40 years of age, and changed little afterward. Skin friction coefficients on some body sites were higher in females than in age-matched males in some age groups. On the canthus and the dorsal hand skin of females, a positive correlation was found between skin friction coefficient and stratum corneum hydration (p skin friction coefficient was positively correlated with stratum corneum hydration on the forehead and the dorsal hand skin (p skin friction coefficient varies with age, gender and body site, and positively correlates with stratum corneum hydration on some body sites. Copyright © 2010 S. Karger AG, Basel.

Artificial skin in perspective: concepts and applications.

Science.gov (United States)

Brohem, Carla A; Cardeal, Laura B da Silva; Tiago, Manoela; Soengas, María S; Barros, Silvia B de Moraes; Maria-Engler, Silvya S

2011-02-01

Skin, the largest organ of the human body, is organized into an elaborate layered structure consisting mainly of the outermost epidermis and the underlying dermis. A subcutaneous adipose-storing hypodermis layer and various appendages such as hair follicles, sweat glands, sebaceous glands, nerves, lymphatics, and blood vessels are also present in the skin. These multiple components of the skin ensure survival by carrying out critical functions such as protection, thermoregulation, excretion, absorption, metabolic functions, sensation, evaporation management, and aesthetics. The study of how these biological functions are performed is critical to our understanding of basic skin biology such as regulation of pigmentation and wound repair. Impairment of any of these functions may lead to pathogenic alterations, including skin cancers. Therefore, the development of genetically controlled and well characterized skin models can have important implications, not only for scientists and physicians, but also for manufacturers, consumers, governing regulatory boards and animal welfare organizations. As cells making up human skin tissue grow within an organized three-dimensional (3D) matrix surrounded by neighboring cells, standard monolayer (2D) cell cultures do not recapitulate the physiological architecture of the skin. Several types of human skin recombinants, also called artificial skin, that provide this critical 3D structure have now been reconstructed in vitro. This review contemplates the use of these organotypic skin models in different applications, including substitutes to animal testing. © 2010 John Wiley & Sons A/S.

Human Wharton's jelly mesenchymal stem cells promote skin wound healing through paracrine signaling.

Science.gov (United States)

Arno, Anna I; Amini-Nik, Saeid; Blit, Patrick H; Al-Shehab, Mohammed; Belo, Cassandra; Herer, Elaine; Tien, Col Homer; Jeschke, Marc G

2014-02-24

The prevalence of nonhealing wounds is predicted to increase due to the growing aging population. Despite the use of novel skin substitutes and wound dressings, poorly vascularized wound niches impair wound repair. Mesenchymal stem cells (MSCs) have been reported to provide paracrine signals to promote wound healing, but the effect of human Wharton's jelly-derived MSCs (WJ-MSCs) has not yet been described in human normal skin. Human WJ-MSCs and normal skin fibroblasts were isolated from donated umbilical cords and normal adult human skin. Fibroblasts were treated with WJ-MSC-conditioned medium (WJ-MSC-CM) or nonconditioned medium. Expression of genes involved in re-epithelialization (transforming growth factor-β2), neovascularization (hypoxia-inducible factor-1α) and fibroproliferation (plasminogen activator inhibitor-1) was upregulated in WJ-MSC-CM-treated fibroblasts (P≤0.05). WJ-MSC-CM enhanced normal skin fibroblast proliferation (P≤0.001) and migration (P≤0.05), and promoted wound healing in an excisional full-thickness skin murine model. Under our experimental conditions, WJ-MSCs enhanced skin wound healing in an in vivo mouse model.

Monitoring program of surrounding of the NPP SE-EBO

International Nuclear Information System (INIS)

Dobis, L.; Kostial, J.

1997-01-01

The paper dealt with monitoring program of radiation control of surrounding of the NPP Bohunice, which has the aim: (1) to ensure the control of influence of work of the NPP Bohunice on the environment in their surrounding; (2) to ensure the back-ground for regular brief of control and supervisory organs about condition of the environment in surrounding of the NPP Bohunice; (3) to maintain the expected technical level of control of the NPP Bohunice and to exploit optimally the technical means; (4) to solicit permanently the data about the radioactivity of environment in surrounding of the NPP Bohunice for forming of files of the data; (5) to exploit purposefully the technical equipment, technical workers and to maintain their in permanent emergency and technical eligibility for the case of the breakdown; (6) to obtain permanently the files of the values for qualification of the reference levels. This program of monitoring includes the radiation control of surrounding of the NPP Bohunice, in the time of normal work of power-station's blocks, inclusively of all types of trouble-shooting and repairer works in surrounding of the NPP Bohunice, up to distance 20 km from power-station. The monitoring includes: outlets from the NPP Bohunice, monitoring of radiation characteristics in surrounding of the NPP Bohunice, (aerosols, fall-outs, soil), the links of food chains: (grass and fodder, milk, agriculture products), hydrosphere in surrounding (surface waters, drink water, bores of radiation control in complex of the NPP Bohunice, components of the hydrosphere), measurement of radiation from external sources (measurement of the dose rates, measurement of the doses [sk

Methylmalonic and propionic acidemias: lipid profiles of normal and affected human skin fibroblasts incubated with [1-14C]propionate

International Nuclear Information System (INIS)

Giudici, T.A.; Chen, R.G.; Oizumi, J.; Shaw, K.N.; Ng, W.G.; Donnell, G.N.

1986-01-01

Normal human skin fibroblasts and those from methylmalonic acidemia and propionic acidemia patients were grown in culture. Following incubation with [1- 14 C]propionate, the major lipid classes in the cells were separated by thin layer chromatography and isolated fractions analyzed by radio gas chromatography for the presence of odd-numbered long-chain fatty acids; the pattern of even-numbered long-chain fatty acids was obtained also. Normal fibroblasts incorporated a small percentage of propionate into odd-numbered fatty acids which were present in all lipids studied. The abnormal cells incorporated a larger amount while maintaining the characteristic ratios of odd-numbered fatty acids found in the normal line. Most of the radioactivity was associated with phospholipids which are the predominant constituents of cell membranes. A characteristic C15/C17 ratio was found for different phospholipids and the triglyceride fraction; pentadecanoic acid was the principal odd-numbered fatty acid utilized in the assembly of complex lipids. Compared to even-numbered long-chain fatty acids the absolute amount of odd-numbered fatty acids was low (1-2%), even in affected cells. An unusual polar lipid fraction was isolated in the course of the study. In the normal cell it contained several unlabeled eicosanoids which were missing from the same fraction of both affected cell lines

Cosmeceuticals: efficacy and influence on skin tone.

Science.gov (United States)

Draelos, Zoe Diana

2014-04-01

Cosmeceuticals are understood to be active cosmetics that are sold over-the-counter, but have profound effects on skin appearance and functioning. This term has no legal meaning in the United States, because only cosmetics and pharmaceuticals are recognized by regulatory bodies. Cosmeceuticals are carefully developed and tested by the cosmetics industry to deliver consumer-recognizable benefits, with an excellent safety profile. Persons use these products worldwide, including those of African descent, for improvement of skin tone. This article discusses the issues surrounding cosmeceutical use by persons of African descent. Copyright © 2014 Elsevier Inc. All rights reserved.

Friction and durability of virgin and damaged skin with and without skin cream treatment using atomic force microscopy

Directory of Open Access Journals (Sweden)

Bharat Bhushan

2012-11-01

Full Text Available Skin can be damaged by the environment easily. Skin cream is an effective and rapid way to moisten the skin by changing the skin surface properties. Rat skin and pig skin are common animal models for studies and were used as skin samples in this study. The nano- and macroscale friction and durability of damaged skin were measured and compared with those of virgin (intact/undamaged skin. The effect of skin cream on friction and durability of damaged and virgin skin samples is discussed. The effects of velocity, normal load, relative humidity and number of cycles were studied. The nanoscale studies were performed by using atomic force microscope (AFM, and macroscale studies were performed by using a pin-on-disk (POD reciprocating tribometer. It was found that damaged skin has different mechanical properties, surface roughness, contact angle, friction and durability compared to that of virgin skin. But similar changes occur after skin cream treatment. Rat and pig skin show similar trends in friction and durability.

Polarization singularities of the object field of skin surface

International Nuclear Information System (INIS)

Angelsky, O V; Ushenko, A G; Ushenko, Yu A; Ushenko, Ye G

2006-01-01

The paper deals with the investigation of formation mechanisms of laser radiation polarization structure scattered by an optically thin surface layer of human skin in two registration zones: a boundary field and a far zone of Fraunhofer diffraction. The conditions of forming polarization singularities by such an object in the scattered radiation field have been defined. Statistical and fractal polarization structure of object fields of physiologically normal and pathologically changed skin has been studied. It has been shown that polarization singularities of radiation scattered by physiologically normal skin samples have a fractal coordinate structure. It is characteristic for fields of pathologically changed skin to have a statistical coordinate structure of polarization singularities in all diffraction zones

Tissue engineered skin substitutes created by laser-assisted bioprinting form skin-like structures in the dorsal skin fold chamber in mice.

Directory of Open Access Journals (Sweden)

Stefanie Michael

Full Text Available Tissue engineering plays an important role in the production of skin equivalents for the therapy of chronic and especially burn wounds. Actually, there exists no (cellularized skin equivalent which might be able to satisfactorily mimic native skin. Here, we utilized a laser-assisted bioprinting (LaBP technique to create a fully cellularized skin substitute. The unique feature of LaBP is the possibility to position different cell types in an exact three-dimensional (3D spatial pattern. For the creation of the skin substitutes, we positioned fibroblasts and keratinocytes on top of a stabilizing matrix (Matriderm®. These skin constructs were subsequently tested in vivo, employing the dorsal skin fold chamber in nude mice. The transplants were placed into full-thickness skin wounds and were fully connected to the surrounding tissue when explanted after 11 days. The printed keratinocytes formed a multi-layered epidermis with beginning differentiation and stratum corneum. Proliferation of the keratinocytes was mainly detected in the suprabasal layers. In vitro controls, which were cultivated at the air-liquid-interface, also exhibited proliferative cells, but they were rather located in the whole epidermis. E-cadherin as a hint for adherens junctions and therefore tissue formation could be found in the epidermis in vivo as well as in vitro. In both conditions, the printed fibroblasts partly stayed on top of the underlying Matriderm® where they produced collagen, while part of them migrated into the Matriderm®. In the mice, some blood vessels could be found to grow from the wound bed and the wound edges in direction of the printed cells. In conclusion, we could show the successful 3D printing of a cell construct via LaBP and the subsequent tissue formation in vivo. These findings represent the prerequisite for the creation of a complex tissue like skin, consisting of different cell types in an intricate 3D pattern.

Study on the Environmental Tritium in Surrounding of Bantar Gebang - Bekasi and Leuwigajah - Bandung Landfill Areas

International Nuclear Information System (INIS)

Satrio; Syafalni; Evarista Ristin

2004-01-01

The investigation of environmental tritium distribution in surrounding of Bantar Gebang - Bekasi and Leuwigajah landfill areas has been carried out. The aim of this investigation was to know tritium concentration in surrounding of both landfill areas. Normally, tritium concentration in the nature is around 0-5 TU. The results of this investigation showed that the tritium concentration in both shallow groundwater of both landfill areas were still in the range of its normal limit, whereas tritium concentration in stream along both landfill areas and leached water showed higher value. Tritium concentration in deep groundwater of Bantar Gebang landfill showed about the zero value, it means is the normal condition. (author)

Friction coefficient of skin in real-time.

Science.gov (United States)

Sivamani, Raja K; Goodman, Jack; Gitis, Norm V; Maibach, Howard I

2003-08-01

Friction studies are useful in quantitatively investigating the skin surface. Previous studies utilized different apparatuses and materials for these investigations but there was no real-time test parameter control or monitoring. Our studies incorporated the commercially available UMT Series Micro-Tribometer, a tribology instrument that permits real-time monitoring and calculation of the important parameters in friction studies, increasing the accuracy over previous tribology and friction measurement devices used on skin. Our friction tests were performed on four healthy volunteers and on abdominal skin samples. A stainless steel ball was pressed on to the skin with at a pre-set load and then moved across the skin at a constant velocity of 5 mm/min. The UMT continuously monitored the friction force of the skin and the normal force of the ball to calculate the friction coefficient in real-time. Tests investigated the applicability of Amonton's law, the impact of increased and decreased hydration, and the effect of the application of moisturizers. The friction coefficient depends on the normal load applied, and Amonton's law does not provide an accurate description for the skin surface. Application of water to the skin increased the friction coefficient and application of isopropyl alcohol decreased it. Fast acting moisturizers immediately increased the friction coefficient, but did not have the prolonged effect of the slow, long lasting moisturizers. The UMT is capable of making real-time measurements on the skin and can be used as an effective tool to study friction properties. Results from the UMT measurements agree closely with theory regarding the skin surface.

Clinical efficacy of artificial skin combined with vacuum sealing drainage in treating large-area skin defects

Institute of Scientific and Technical Information of China (English)

TANG Jin; GUO Wei-chun; YU Ling; ZHAO Sheng-hao

2010-01-01

Objective: To observe the clinical efficacy of artificial skin combined with vacuum sealing drainage (VSD) in treating large-area skin defects.Methods: Totally 18 patients with skin defects, treated with artificial skin combined with VSD from September 2008to May 2009 in our hospital, were retrospectively analyzed in this study. There were 15 males and 3 females, aged 7-66years, 34.3 years on average. Among them, 10 cases had skin laceration caused by traffic accidents (7 with open fractures), 1 mangled injury, 1 blast injury, 1 stump infection combined with skin defects after amputation and 5 heel ulcers.Results: All skin grafts in 16 cases survived after being controlled by VSD for one time. For the rest 2 patients,one with skin avulsion on the left foot was given median thickness skin grafts after three times of VSD, the other with open fractures in the left tibia and fibula caused by a traffic accident was given free flap transplantation. Skin grafts of both patients survived, with normal color and rich blood supply.Conclusion: Skin grafting in conjunction with artificial skin and VSD is much more effective than traditional dressing treatment and worth wide application in clinic.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

Energy Technology Data Exchange (ETDEWEB)

Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

2014-11-14

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Elevation of telomerase activity in chronic radiation ulcer of human skin

International Nuclear Information System (INIS)

Li Xiaoying; Zhao Po; Wang Dewen; Yang Zhixiang

1997-01-01

Objective: To investigate the levels of telomerase activity in chronic radiation ulcers of human skin and the possible relationship between the enzyme and cancer transformation. Method: Using nonisotopic telomere repeat amplification protocol (TRAP), detections were performed in 20 cases of chronic radiation ulcers of human skin, 5 cases of normal skin tissues and 5 cases of carcinoma. Results: The positive rates for telomerase activity were 30.0%(6/20), 0(0/5) and 100%(5/5) in chronic radiation ulcers of human skin, normal skin and carcinoma, respectively. The telomerase activity in radiation ulcer was weaker than in carcinoma. Conclusion: The telomerase activity assay might be used as a marker for predicting the prognosis and the effect of treatment in chronic radiation ulcer of human skin

The Pinking Shears: A Novel Tool for Improving Skin Graft Cosmesis

Directory of Open Access Journals (Sweden)

Cormac W. Joyce, MB BCh

2014-12-01

Full Text Available Summary: A significant aesthetic disadvantage to split skin grafts is the obvious transition between the graft and the normal skin. We report on a novel method to interrupt this transition point by using pinking shears, which are dressmaking scissors with saw-toothed blades that create a chevron pattern instead of a straight edge. We describe a case where the pinking shears were utilized on a split skin graft and Integra for reconstruction of the skin on a volar forearm. This technique allows for breaking-up of the transition point between the skin graft and normal skin and gives rise to an improved aesthetic outcome as the boundary is significantly less well-defined. This novel method shows promise and further study is certainly warranted.

Semi-conservative deoxyribonucleic acid synthesis in unirradiated and ultraviolet-irradiated xeroderma pigmentosum and normal human skin fibroblasts

Energy Technology Data Exchange (ETDEWEB)

Rude' e, J.M.; Friedberg, E.C.

1977-03-01

Rates of semiconservative DNA synthesis have been investigated in asynchronous xeroderma pigmentosum (XP), XP variant, and normal human skin fibroblasts using the technique of cellular autoradiography. In unirradiated cells, no differences in DNA synthesis rates were detected among the three cell strains. Exposure to uv radiation caused the rate of DNA synthesis to decrease for at least three hours in all three cell strains. In the normal cell strain, recovery of the DNA synthetic rate occurred at later times following a uv fluence of 5 J/m2. At this same uv fluence, recovery was absent in classical XP cells during a 24 h post-irradiation period while it was slower than normal in XP variant cells. When the uv fluence to classical XP and XP variant cells was reduced so that survival in all three cell strains was approximately the same (25%), recovery of the DNA synthetic rate was similar in all three cell strains. These results are discussed in terms of current models of DNA replication in uv-irradiated cells and indicate: (1) that pyrimidine dimers are very effective blocks to DNA synthesis and (2) that there is no inherent defect in semi-conservative DNA synthesis in either classical XP or XP variant cells which is independent of a defect in DNA repair capacity.

Negative pressure wound therapy using polyvinyl alcohol foam to bolster full-thickness mesh skin grafts in dogs.

Science.gov (United States)

Or, Matan; Van Goethem, Bart; Kitshoff, Adriaan; Koenraadt, Annika; Schwarzkopf, Ilona; Bosmans, Tim; de Rooster, Hilde

2017-04-01

To report the use of negative pressure wound therapy (NPWT) with polyvinyl alcohol (PVA) foam to bolster full-thickness mesh skin grafts in dogs. Retrospective case series. Client-owned dogs (n = 8). Full-thickness mesh skin graft was directly covered with PVA foam. NPWT was maintained for 5 days (in 1 or 2 cycles). Grafts were evaluated on days 2, 5, 10, 15, and 30 for graft appearance and graft take, granulation tissue formation, and complications. Firm attachment of the graft to the recipient bed was accomplished in 7 dogs with granulation tissue quickly filling the mesh holes, and graft take considered excellent. One dog had bandage complications after cessation of the NPWT, causing partial graft loss. The PVA foam did not adhere to the graft or damage the surrounding skin. The application of NPWT with a PVA foam after full-thickness mesh skin grafting in dogs provides an effective method for securing skin grafts, with good graft acceptance. PVA foam can be used as a primary dressing for skin grafts, obviating the need for other interposing materials to protect the graft and the surrounding skin. © 2017 The American College of Veterinary Surgeons.

Pros and cons of fish skin cells in culture: long-term full skin and short-term scale cell culture from rainbow trout, Oncorhynchus mykiss.

Science.gov (United States)

Rakers, Sebastian; Klinger, Matthias; Kruse, Charli; Gebert, Marina

2011-12-01

Here, we report the establishment of a permanent skin cell culture from rainbow trout (Oncorhynchus mykiss). The cells of the fish skin cell culture could be propagated over 60 passages so far. Furthermore, we show for the first time that it is possible to integrate freshly harvested rainbow trout scales into this new fish skin cell culture. We further demonstrated that epithelial cells derived from the scales survived in the artificial micro-environment of surrounding fibroblast-like cells. Also, antibody staining indicated that both cell types proliferated and started to build connections with the other cell type. It seems that it is possible to generate an 'artificial skin' with two different cell types. This could lead to the development of a three-dimensional test system, which might be a better in vitro representative of fish skin in vivo than individual skin cell lines. Copyright © 2011 Elsevier GmbH. All rights reserved.

New analysis methods for skin fine-structure via optical image and development of 3D skin Cycloscan(™).

Science.gov (United States)

Han, J Y; Nam, G W; Lee, H K; Kim, M J; Kim, E J

2015-11-01

This study was conducted to develop methods for measuring skin fine-structure via optical image and apparatus for photographing to analyze efficacy of anti-aging. We developed an apparatus named 3D Skin CycloScan(™) to evaluate the efficacy of cosmetics by imagification of skin fine-structure such as wrinkles, pores, and skin texture. The semi-sphere shaped device has 12 different sequential flashing light sources captures optical image simultaneously in one second to exclude the influence of the subject's movement. The normal map that is extracted through shape from shading method is composed of face contour and skin fine-structure parts. When the low-frequency component which is the result of the Gaussian Filter application is eliminated, we can get only skin fine-structure. In this normal map, it is possible to extract two-dimensional vector map called direction map and we can regulate the intensity of the image of wrinkles, pores, and skin texture after filtering the direction map. We performed a clinical study to apply this new apparatus and methods to evaluate an anti-aging efficacy of cosmetics visually and validate with other conventional methods. After using anti-aging cream including 2% adenosine for 8 weeks, the total amount of fine wrinkle around eye area detected via 3D Skin CycloScan(™) was reduced by 12.1%. Also, wrinkles on crow's feet measured by PRIMOS COMPACT(®) (GFMesstechnik GmbH, Germany) reduced 11.7%. According to an aspect of the present study, by changing the direction of the lights toward to subject's skin, we can obtain the information about the fine structures present on the skin such as wrinkles, pores, or skin texture and represent it as an image. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Esterification of all-trans-retinol in normal human epithelial cell strains and carcinoma lines from oral cavity, skin and breast: reduced expression of lecithin:retinol acyltransferase in carcinoma lines.

Science.gov (United States)

Guo, X; Ruiz, A; Rando, R R; Bok, D; Gudas, L J

2000-11-01

When exogenous [(3)H]retinol (vitamin A) was added to culture medium, normal human epithelial cells from the oral cavity, skin, lung and breast took up and esterified essentially all of the [(3)H]retinol within a few hours. As shown by [(3)H]retinol pulse-chase experiments, normal epithelial cells then slowly hydrolyzed the [(3)H]retinyl esters to [(3)H]retinol, some of which was then oxidized to [(3)H]retinoic acid (RA) over a period of several days. In contrast, cultured normal human fibroblasts and human umbilical vein endothelial cells (HUVEC) did not esterify significant amounts of [(3)H]retinol; this lack of [(3)H]retinol esterification was correlated with a lack of expression of lecithin:retinol acyltransferase (LRAT) transcripts in normal fibroblast and HUVEC strains. These results indicate that normal, differentiated cell types differ in their ability to esterify retinol. Human carcinoma cells (neoplastically transformed epithelial cells) of the oral cavity, skin and breast did not esterify much [(3)H]retinol and showed greatly reduced LRAT expression. Transcripts of the neutral, bile salt-independent retinyl ester hydrolase and the bile salt-dependent retinyl ester hydrolase were undetectable in all of the normal cell types, including the epithelial cells. These experiments suggest that retinoid-deficiency in the tumor cells could develop because of the lack of retinyl esters, a storage form of retinol.

Hydrocortisone Diffusion Through Synthetic Membrane, Mouse Skin, and Epiderm™ Cultured Skin.

Science.gov (United States)

Christensen, John Mark; Chuong, Monica Chang; Le, Hang; Pham, Loan; Bendas, Ehab

2011-03-01

OBJECTIVES: The penetration of hydrocortisone (HC) from six topical over-the-counter products along with one prescription cream through cultured normal human-derived epidermal keratinocytes (Epiderm™), mouse skin and synthetic nylon membrane was performed as well as the effect hydrating the skin by pre-washing was explored using the Upright Franz Cell. METHOD AND RESULTS: Permeation of HC through EpiDerm™, mouse skin and synthetic membrane was highest with the topical HC gel formulation with prewash treatment of the membranes among seven products evaluated, 198 ± 32 µg/cm(2), 746.32 ± 12.43 µg/cm(2), and 1882 ± 395.18 µg/cm(2), respectively. Pre-washing to hydrate the skin enhanced HC penetration through EpiDerm™ and mouse skin. The 24-hour HC released from topical gel with prewash treatment was 198.495 ± 32 µg/cm(2) and 746.32 ± 12.43 µg/cm(2) while without prewash, the 24-h HC released from topical gel was 67.2 ± 7.41 µg/cm(2) and 653.43 ± 85.62 µg/cm(2) though EpiDerm™ and mouse skin, respectively. HC penetration through synthetic membrane was ten times greater than through mouse skin and EpiDerm™. Generally, the shape, pattern, and rank order of HC diffusion from each commercial product was similar through each membrane.

Hyperelastic Material Properties of Mouse Skin under Compression.

Directory of Open Access Journals (Sweden)

Yuxiang Wang

Full Text Available The skin is a dynamic organ whose complex material properties are capable of withstanding continuous mechanical stress while accommodating insults and organism growth. Moreover, synchronized hair cycles, comprising waves of hair growth, regression and rest, are accompanied by dramatic fluctuations in skin thickness in mice. Whether such structural changes alter skin mechanics is unknown. Mouse models are extensively used to study skin biology and pathophysiology, including aging, UV-induced skin damage and somatosensory signaling. As the skin serves a pivotal role in the transfer function from sensory stimuli to neuronal signaling, we sought to define the mechanical properties of mouse skin over a range of normal physiological states. Skin thickness, stiffness and modulus were quantitatively surveyed in adult, female mice (Mus musculus. These measures were analyzed under uniaxial compression, which is relevant for touch reception and compression injuries, rather than tension, which is typically used to analyze skin mechanics. Compression tests were performed with 105 full-thickness, freshly isolated specimens from the hairy skin of the hind limb. Physiological variables included body weight, hair-cycle stage, maturity level, skin site and individual animal differences. Skin thickness and stiffness were dominated by hair-cycle stage at young (6-10 weeks and intermediate (13-19 weeks adult ages but by body weight in mature mice (26-34 weeks. Interestingly, stiffness varied inversely with thickness so that hyperelastic modulus was consistent across hair-cycle stages and body weights. By contrast, the mechanics of hairy skin differs markedly with anatomical location. In particular, skin containing fascial structures such as nerves and blood vessels showed significantly greater modulus than adjacent sites. Collectively, this systematic survey indicates that, although its structure changes dramatically throughout adult life, mouse skin at a given

The skin microbiome: Associations between altered microbial communities and disease.

Science.gov (United States)

Weyrich, Laura S; Dixit, Shreya; Farrer, Andrew G; Cooper, Alan J; Cooper, Alan J

2015-11-01

A single square centimetre of the human skin can contain up to one billion microorganisms. These diverse communities of bacteria, fungi, mites and viruses can provide protection against disease, but can also exacerbate skin lesions, promote disease and delay wound healing. This review addresses the current knowledge surrounding the healthy skin microbiome and examines how different alterations to the skin microbial communities can contribute to disease. Current methodologies are considered, changes in microbial diversity and colonisation by specific microorganisms are discussed in the context of atopic dermatitis, psoriasis, acne vulgaris and chronic wounds. The recent impact of modern Westernised lifestyles on the human skin microbiome is also examined, as well as the potential benefits and pitfalls of novel therapeutic strategies. Further analysis of the human skin microbiome, and its interactions with the host immune system and other commensal microorganisms, will undoubtedly elucidate molecular mechanisms for disease and reveal gateways for novel therapeutic treatment strategies. © 2015 The Australasian College of Dermatologists.

Laser-induced fluorescence for the detection of esophageal and skin cancer

Science.gov (United States)

Vo-Dinh, Tuan; Panjehpour, Masoud; Overholt, Bergein F.; Julius, Clark E.; Overholt, Suzanne; Phan, Mary N.

2003-07-01

Laser-induced fluorescence (LIF) is used for in-vivo cancer diagnosis of the esophagus and skin cancer. For esophageal measurements a fiberoptic probe inserted through an endoscope was used. Autofluorescence of normal and malignant tissues were measured directly on patient skin without requiring an endoscope. Measurement of the fluorescence signal from the tissue was performed using laser excitation at 410 nm. The methodology was applied to differentiate normal and malignant tumors of the esophagus and malignant skin lesions. The results of this LIF approach were compared with histopathology results of the biopsy samples and indicated excellent agreement in the classification of normal and malignant tumors for the samples investigated.

[Skin hydration and hydrating products].

Science.gov (United States)

Duplan, H; Nocera, T

2018-05-01

One of the skin's principal functions is to protect the body against its environment by maintaining an effective epidermal barrier, not only against external factors, but also to prevent water loss from the body. Indeed, water homeostasis is vital for the normal physiological functioning of skin. Hydration levels affect not only visible microscopic parameters such as the suppleness and softness of skin, but also molecular parameters, enzyme activities and cellular signalling within the epidermis. The body is continually losing some of its water, but this phenomenon is limited and the optimal hydration gradient in skin is ensured via a set of sophisticated regulatory processes that rely on the functional and dynamic properties of the uppermost level of the skin consisting of the stratum corneum. The present article brings together data recently acquired in the fields of skin hydration and the characterisation of dehydrated or dry skin, whether through study of the regulatory processes involved or as a result of changes in the techniques used for in situ measurement, and thus in optimisation of management. Copyright © 2018. Published by Elsevier Masson SAS.

Potentially lethal damage repair in cell lines of radioresistant human tumours and normal skin fibroblasts

International Nuclear Information System (INIS)

Marchese, M.J.; Minarik, L.; Hall, E.J.; Zaider, M.

1985-01-01

Radiation cell survival data were obtained in vitro for three cell lines isolated from human tumours traditionally considered to be radioresistant-two melanomas and one osteosarcoma-as well as from a diploid skin fibroblast cell line. One melanoma cell line was much more radioresistant than the other, while the osteosarcoma and fibroblast cell lines were more radiosensitive than either. For cells growing exponentially, little potentially lethal damage repair (PLDR) could be demonstrated by comparing survival data for cells in which subculture was delayed by 6 h with those sub-cultured immediately after treatment. For the malignant cells in plateau phase, which in these cells might be better termed 'slowed growth phase', since an appreciable fraction of the cells are still cycling, a small amount of PLDR was observed, but not as much as reported by other investigators in the literature. The normal fibroblasts, which achieved a truer plateau phase in terms of noncycling cells, showed a significantly larger amount of PLDR than the tumour cells. (author)

Expression of p63 and Cyclooxygenase-2 and Their Correlation in Skin Tumors

Institute of Scientific and Technical Information of China (English)

WU Yan; LIU Houjun; LI Jiawen

2007-01-01

To study the expression of p63 and cyclooxygenase-2 (cox-2) in skin tumors and evaluate the correlation between p63 and cox-2, the expressions of cox-2 and p63 were measured by streptavidin-peroxidase complex immunohistochemical technique in 17 cases of skin squamous cell carcinoma (SCC), 19 cases of Bowen's disease(Bowen), 11 cases of actinic keratosis(AK), 12 cases of seborreic keratosis(SK) and 13 specimens of normal skin. Our results showed that the expression of p63 in skin squamous cell carcinoma, Bowen's disease and actinic keratosis were significantly higher than that in seborreic keratosis, while the expression of p63 in seborreic keratosis was significantly higher than that in normal skin. The expression of cox-2 in skin squamous cell carcinoma,Bowen's disease and actinic keratosis were significantly higher than that in seborreic keratosis, while no statistical difference was noted in the expression of cox-2 between seborreic keratosis and normal skin. Cox-2 expression was positively correlated with the high p63 expression in malignant skin tumors. The increased expression of cox-2 and p63 may play an important role in the development of skin tumors and work synergetically in malignant skin tumors.

Magnetosensitive e-skins with directional perception for augmented reality

Science.gov (United States)

Cañón Bermúdez, Gilbert Santiago; Karnaushenko, Dmitriy D.; Karnaushenko, Daniil; Lebanov, Ana; Bischoff, Lothar; Kaltenbrunner, Martin; Fassbender, Jürgen; Schmidt, Oliver G.; Makarov, Denys

2018-01-01

Electronic skins equipped with artificial receptors are able to extend our perception beyond the modalities that have naturally evolved. These synthetic receptors offer complimentary information on our surroundings and endow us with novel means of manipulating physical or even virtual objects. We realize highly compliant magnetosensitive skins with directional perception that enable magnetic cognition, body position tracking, and touchless object manipulation. Transfer printing of eight high-performance spin valve sensors arranged into two Wheatstone bridges onto 1.7-μm-thick polyimide foils ensures mechanical imperceptibility. This resembles a new class of interactive devices extracting information from the surroundings through magnetic tags. We demonstrate this concept in augmented reality systems with virtual knob-turning functions and the operation of virtual dialing pads, based on the interaction with magnetic fields. This technology will enable a cornucopia of applications from navigation, motion tracking in robotics, regenerative medicine, and sports and gaming to interaction in supplemented reality. PMID:29376121

Detection of human papillomavirus in nonmelanoma skin cancer lesions and healthy perilesional skin in kidney transplant recipients and immunocompetent patients.

Science.gov (United States)

Bernat-García, J; Morales Suárez-Varela, M; Vilata-Corell, J J; Marquina-Vila, A

2014-04-01

The influence of human papillomavirus (HPV) on the development of nonmelanoma skin cancer (NMSC) is a topic of debate. HPV types from the beta genus (HPV-β) have been most frequently associated with the development of skin cancer. To analyze the prevalence and range of HPV types in NMSC lesions and healthy perilesional skin in immunodepressed and immunocompetent patients and to evaluate the influence of various clinical factors on the prevalence of HPV in skin cancer. Nested polymerase chain reaction and sequencing were used to detect HPV in 120 NMSC samples obtained by biopsy from 30 kidney transplant recipients and 30 immunocompetent patients. In all cases, a sample was taken from the tumor site and the surrounding healthy skin. Potential confounders were assessed and the data analyzed by multivariate logistic regression. HPV DNA was detected in 44 (73.3%) of the 60 samples from immunodepressed patients and in 32 (53.3%) of the 60 samples from immunocompetent patients (adjusted odds ratio, 3.4; 95% CI, 1.2-9.6). In both groups of patients, HPV was more common in healthy perilesional skin than in lesional skin. HPV-β was the most common type isolated. We found a wide range of HPV types (mostly HPV-β) in the skin of kidney transplant recipients and immunocompetent patients with skin cancer. Copyright © 2013 Elsevier España, S.L. and AEDV. All rights reserved.

Imaging-guided two-photon excitation-emission-matrix measurements of human skin tissues

Science.gov (United States)

Yu, Yingqiu; Lee, Anthony M. D.; Wang, Hequn; Tang, Shuo; Zhao, Jianhua; Lui, Harvey; Zeng, Haishan

2012-07-01

There are increased interests on using multiphoton imaging and spectroscopy for skin tissue characterization and diagnosis. However, most studies have been done with just a few excitation wavelengths. Our objective is to perform a systematic study of the two-photon fluorescence (TPF) properties of skin fluorophores, normal skin, and diseased skin tissues. A nonlinear excitation-emission-matrix (EEM) spectroscopy system with multiphoton imaging guidance was constructed. A tunable femtosecond laser was used to vary excitation wavelengths from 730 to 920 nm for EEM data acquisition. EEM measurements were performed on excised fresh normal skin tissues, seborrheic keratosis tissue samples, and skin fluorophores including: NADH, FAD, keratin, melanin, collagen, and elastin. We found that in the stratum corneum and upper epidermis of normal skin, the cells have large sizes and the TPF originates from keratin. In the lower epidermis, cells are smaller and TPF is dominated by NADH contributions. In the dermis, TPF is dominated by elastin components. The depth resolved EEM measurements also demonstrated that keratin structure has intruded into the middle sublayers of the epidermal part of the seborrheic keratosis lesion. These results suggest that the imaging guided TPF EEM spectroscopy provides useful information for the development of multiphoton clinical devices for skin disease diagnosis.

[Reconstruction of combined skin and bilateral artey defects at palmar side of fingers by free posterior interrosseous artery flap in a bridge fashion].

Science.gov (United States)

Xu, Bao-cheng; Liang, Gang; Chen, Fu-sheng

2012-05-01

To investigate the feasibility and therapeutic effect of free posterior interrosseous artery flap in a bridge fashion for combined skin and bilateral artery defects at palmar side of fingers. 6 cases with combined skin and bilateral artery defects at palmar side of fingers were treated with long-pedicled free posterior interrosseous artery flap in a bridge fashion. The flap size ranged from 3.5 cm x 2.0 cm to 6.5 em x 3.0 cm. The wounds at donor sites were closed directly. All the 6 flaps survived completely without any complication, and the wounds healed primarily. The blood supply and vein drainage in all the 6 fingers were normal. 4 cases were followed up for 1-12 months (average, 7 months). Satisfactory cosmetic and functional results were achieved. The flaps looked a little bit thicker than the surrounding tissue. The long-pedicled free posterior interrosseous artery flap in a bridge fashion is a good option for reconstruction of the combined skin and bilateral artery defects at palmar side of fingers in one stage.

Use of autologous tissue engineered skin to treat porcine full-thickness skin defects

Institute of Scientific and Technical Information of China (English)

CAI Xia; CAO Yi-lin; CUI Lei; LIU Wei; GUAN Wen-xiang

2005-01-01

Objective: To explore a feasible method to repair full-thickness skin defects utilizing tissue engineered techniques. Methods: The Changfeng hybrid swines were used and the skin specimens were cut from the posterior limb girdle region, from which the keratinocytes and fibroblasts were isolated and harvested by trypsin, EDTA, and type II collagenase. The cells were seeded in Petri dishes for primary culture. When the cells were in logarithmic growth phase, they were treated with trypsin to separate them from the floor of the tissue culture dishes. A biodegradable material, Pluronic F-127, was prefabricated and mixed with these cells, and then the cell-Pluronic compounds were seeded evenly into a polyglycolic acid (PGA). Then the constructs were replanted to the autologous animals to repair the full-thickness skin defects. Histology and immunohistochemistry of the neotissue were observed in 1, 2, 4, and 8 postoperative weeks. Results: The cell-Pluronic F-127-PGA compounds repaired autologous full-thickness skin defects 1 week after implantation. Histologically, the tissue engineered skin was similar to the normal skin with stratified epidermis overlying a moderately thick collageneous dermis. Three of the structural proteins in the epidermal basement membrane zone, type IV collagen, laminin, and type VII collagen were detected using immunohistochemical methods. Conclusions: By studying the histology and immunohistochemistry of the neotissue, the bioengineered skin graft holds great promise for improving healing of the skin defects.

Skin deposits in hereditary cystatin C amyloidosis

DEFF Research Database (Denmark)

Benedikz, Eirikur; Blöndal, H; Gudmundsson, G

1990-01-01

Clinically normal skin from 47 individuals aged 9-70 years was investigated. Cystatin C amyloid deposits were found in various locations of the skin by light and/or electron microscopy, in all 12 patients with a clinical history of hereditary cystatin C amyloidosis (HCCA). Six asymptomatic...... individuals, who had the Alu 1 restriction fragment length polymorphism (RFLP) marker reported to cosegregate with the disease, also had cystatin C amyloid deposits in the skin. Three asymptomatic individuals (age 17-46) belonging to the HCCA families were without amyloid in the skin but had Alu 1 RFLP marker...

Modeling of skin cancer dermatoscopy images

Science.gov (United States)

Iralieva, Malica B.; Myakinin, Oleg O.; Bratchenko, Ivan A.; Zakharov, Valery P.

2018-04-01

An early identified cancer is more likely to effective respond to treatment and has a less expensive treatment as well. Dermatoscopy is one of general diagnostic techniques for skin cancer early detection that allows us in vivo evaluation of colors and microstructures on skin lesions. Digital phantoms with known properties are required during new instrument developing to compare sample's features with data from the instrument. An algorithm for image modeling of skin cancer is proposed in the paper. Steps of the algorithm include setting shape, texture generation, adding texture and normal skin background setting. The Gaussian represents the shape, and then the texture generation based on a fractal noise algorithm is responsible for spatial chromophores distributions, while the colormap applied to the values corresponds to spectral properties. Finally, a normal skin image simulated by mixed Monte Carlo method using a special online tool is added as a background. Varying of Asymmetry, Borders, Colors and Diameter settings is shown to be fully matched to the ABCD clinical recognition algorithm. The asymmetry is specified by setting different standard deviation values of Gaussian in different parts of image. The noise amplitude is increased to set the irregular borders score. Standard deviation is changed to determine size of the lesion. Colors are set by colormap changing. The algorithm for simulating different structural elements is required to match with others recognition algorithms.

Formation of DNA single-strand breaks by near-ultraviolet and gamma-rays in normal and Bloom's syndrome skin fibroblasts

International Nuclear Information System (INIS)

Hirschi, M.; Netrawali, M.S.; Remsen, J.F.; Cerutti, P.A.

1981-01-01

The formation of single-strand breaks by near-ultraviolet light at 313 nm and by aerobic gamma-rays was compared for skin fibroblast monolayer cultures from 4 normal donors (NF) and 8 patients with Bloom's syndrome (BS) by the alkaline elution method. In 6 of 8 BS strains, the number of breaks induced by near-ultraviolet light, 2.25 kJ/sq m, at 0 degrees was comparable to NF, while elevated breakage was observed in BS strains HG 369 and HG 916. Breakage frequencies were increased substantially in 6 of 8 BS strains relative to NF when the near-ultraviolet light exposure was at 37 degrees. BS strain GM 2520 represents an exception since normal breakage frequencies were induced both at 0 degrees and 37 degrees. Aerobic gamma-rays (75 R) induced comparable numbers of single-strand breaks in BS and NF strains at 0 degrees. The breakage frequencies were reduced an average of 17% in NF when the same dose was given at 30 degrees followed by 6 min incubation. Under the same conditions, the breakage frequencies were on the average reduced by 42% relative to 0 degrees in the BS strains, indicating that they possess normal or possibly slightly increased capacities for the rejoining of gamma-ray-induced breaks

Genetic deletion of amphiregulin restores the normal skin phenotype in a mouse model of the human skin disease tylosis

Directory of Open Access Journals (Sweden)

Vishnu Hosur

2017-08-01

Full Text Available In humans, gain-of-function (GOF mutations in RHBDF2 cause the skin disease tylosis. We generated a mouse model of human tylosis and show that GOF mutations in RHBDF2 cause tylosis by enhancing the amount of amphiregulin (AREG secretion. Furthermore, we show that genetic disruption of AREG ameliorates skin pathology in mice carrying the human tylosis disease mutation. Collectively, our data suggest that RHBDF2 plays a critical role in regulating EGFR signaling and its downstream events, including development of tylosis, by facilitating enhanced secretion of AREG. Thus, targeting AREG could have therapeutic benefit in the treatment of tylosis.

Identification of β-SiC surrounded by relatable surrounding diamond ...

Indian Academy of Sciences (India)

β-SiC is identified in the presence of a relatable surrounding diamond medium using subtle, but discernible Raman ... Change in the nature of the surrounding material structure and its .... intensity implies very low graphite content in thin film. In.

Permeability of commercial solvents through living human skin

DEFF Research Database (Denmark)

Ursin, C; Hansen, C M; Van Dyk, J W

1995-01-01

A procedure has been developed for measuring the steady state rate of permeation of commercial solvents through living human skin. To get the most consistent results, it was necessary with some solvents to normalize the solvent permeation rate of a given skin sample with its [3H]water permeation...... rate. For other solvents this was not necessary, so the un-normalized data were used. High [3H]water permeation rate also was used as a criterion for "defective" skin samples that gave erroneous permeability rates, especially for solvents having slow permeability. The linearity of the steady state data...... of DMSO and octyl acetate were measured. No octyl acetate was detected and the permeability of DMSO was proportional to its mole fraction in the mixture. The effect of two hours of solvent exposure on the viability of skin (based on DNA synthesis) was measured and found to be very dependent on the solvent....

Assessment of Optical Coherence Tomography Imaging in the Diagnosis of Non-Melanoma Skin Cancer and Benign Lesions Versus Normal Skin:

DEFF Research Database (Denmark)

Mogensen, Mette; Jørgensen, Thomas Martini; Nürnberg, Birgit Meincke

2009-01-01

BACKGROUND Optical coherence tomography (OCT) is an optical imaging technique that may be useful in diagnosis of non-melanoma skin cancer (NMSC). OBJECTIVES To describe OCT features in NMSC such as actinic keratosis (AK) and basal cell carcinoma (BCC) and in benign lesions and to assess the diagn......BACKGROUND Optical coherence tomography (OCT) is an optical imaging technique that may be useful in diagnosis of non-melanoma skin cancer (NMSC). OBJECTIVES To describe OCT features in NMSC such as actinic keratosis (AK) and basal cell carcinoma (BCC) and in benign lesions and to assess...

Four Cases of Atopic Dermatitis Complicated by Sjogren's Syndrome: Link between Dry Skin and Autoimmune Anhidrosis

Directory of Open Access Journals (Sweden)

Shun Kitaba

2011-01-01

Full Text Available We report four adult cases of atopic dermatitis (AD complicated by Sjogren's syndrome (SS. The patients fulfilled diagnostic criteria for AD and SS. All cases showed persistent itchy dry skin and eczematous lesions complicated by sicca symptoms including dry eyes and dry mouth with moderate joint pain. One case manifested annular erythema and another manifested widespread discoid erythema. To investigate the underlying cause of dry skin in these cases, sweating function was evaluated using a quantitative sudomotor axon reflex test (QSART in which the axon reflex is stimulated by acetylcholine iontophoresis. The sweating latency time was significantly prolonged in eczematous skin of AD and AD/SS compared to normal controls. Axon reflex (AXR sweat volume was also significantly reduced in AD (normal and eczematous skin and AD/SS (normal and eczema compared to normal control. In contrast, the direct sweat volume of lesional or non-lesional AD skin induced by direct stimulation with acetylcholine was only slightly reduced compared to that in normal controls, but not in SS and lesional skin of AD/SS patients. These results suggest that the impaired sweat response in AD is attributable to an abnormal sudomotor axon reflex, which is accelerated and modulated when complicated by SS resulting in dry skin in the present cases.

Skin care products can aggravate epidermal function: studies in a murine model suggest a pathogenic role in sensitive skin.

Science.gov (United States)

Li, Zhengxiao; Hu, Lizhi; Elias, Peter M; Man, Mao-Qiang

2018-02-01

Sensitive skin is defined as a spectrum of unpleasant sensations in response to a variety of stimuli. However, only some skin care products provoke cutaneous symptoms in individuals with sensitive skin. Hence, it would be useful to identify products that could provoke cutaneous symptoms in individuals with sensitive skin. To assess whether vehicles, as well as certain branded skin care products, can alter epidermal function following topical applications to normal mouse skin. Following topical applications of individual vehicle or skin care product to C57BL/6J mice twice daily for 4 days, transepidermal water loss (TEWL) rates, stratum corneum (SC) hydration and skin surface pH were measured on treated versus untreated mouse skin with an MPA5 device and pH 900 pH meter. Our results show that all tested products induced abnormalities in epidermal functions of varying severity, including elevations in TEWL and skin surface pH, and reduced SC hydration. Our results suggest that mice can serve as a predictive model that could be used to evaluate the potential safety of skin care products in humans with sensitive skin. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Discovery of skin lymphocytes was a game changer in experimental dermatology

NARCIS (Netherlands)

Matos, Tiago R.; de Rie, Menno A.

2017-01-01

A substantial part of ongoing research in experimental dermatology focuses on skin T cellsfor that reason, we find important to highlight the pioneering work of Jan D. Bos et al. from 1987 (The skin immune system (SIS): Distribution and immunophenotype of lymphocyte subpopulations in normal skin)

Effects of irradiation of skin flaps

International Nuclear Information System (INIS)

Sumi, Y.; Ueda, M.; Oka, T.; Torii, S.

1984-01-01

The reaction of skin flaps to irradiation and the optimum postoperative time for irradiation was studied in the rat. Flaps showed different reactions depending on the time of irradiation. There was a correlation between the radiosensitivity and the vascularity of the flap. Those flaps in the marginal hypovascular stage of revascularization showed reactions similar to normal skin. However, severe adverse reactions were observed in the marginal hypervascular stage

Systemic sclerosis with normal or nonspecific nailfold capillaroscopy.

Science.gov (United States)

Fichel, Fanny; Baudot, Nathalie; Gaitz, Jean-Pierre; Trad, Salim; Barbe, Coralie; Francès, Camille; Senet, Patricia

2014-01-01

In systemic sclerosis (SSc), a specific nailfold videocapillaroscopy (NVC) pattern is observed in 90% of cases and seems to be associated with severity and progression of the disease. To describe the characteristics of SSc patients with normal or nonspecific (normal/nonspecific) NVC. In a retrospective cohort study, clinical features and visceral involvements of 25 SSc cases with normal/nonspecific NVC were compared to 63 SSc controls with the SSc-specific NVC pattern. Normal/nonspecific NVC versus SSc-specific NVC pattern was significantly associated with absence of skin sclerosis (32 vs. 6.3%, p = 0.004), absence of telangiectasia (47.8 vs. 17.3%, p = 0.006) and absence of sclerodactyly (60 vs. 25.4%, p = 0.002), and less frequent severe pulmonary involvement (26.3 vs. 58.2%, p = 0.017). Normal/nonspecific NVC in SSc patients appears to be associated with less severe skin involvement and less frequent severe pulmonary involvement. © 2014 S. Karger AG, Basel.

Study of skin markers for magnetic resonance imaging examinations

International Nuclear Information System (INIS)

Takatsu, Yasuo; Umezaki, Yoshie; Miyati, Tosiaki; Yamamura, Kenichirou

2013-01-01

In magnetic resonance imaging (MRI), skin markers are used as a landmark in order to make plans for examinations. However, there isn't a lot of research about the material and shape of skin markers. The skin marker's essential elements are safety, good cost performance, high signal intensity for T 1 weighted image (T 1 WI) and T 2 weighted image (T 2 WI), and durable. In order to get a high signal-to-noise ratio (SNR) of T 1 WI and T 2 WI, baby oil, salad oil and olive oil were chosen, because these materials were easy to obtain and safe for the skin. The SNR of baby oil was the best. Baby oil was injected into the infusion tube, and the tube was solvent welded and cut by a heat sealer. In order to make ring shaped skin markers, both ends of the tube were stuck with adhesive tape. Three different diameters of markers were made (3, 5, 10 cmφ). Ring shaped skin markers were put on to surround the examination area, therefore, the edge of the examination area could be seen at every cross section. Using baby oil in the ring shaped infusion tube is simple, easy, and a highly useful skin marker. (author)

Temperament affects sympathetic nervous function in a normal population.

Science.gov (United States)

Kim, Bora; Lee, Jae-Hon; Kang, Eun-Ho; Yu, Bum-Hee

2012-09-01

Although specific temperaments have been known to be related to autonomic nervous function in some psychiatric disorders, there are few studies that have examined the relationship between temperaments and autonomic nervous function in a normal population. In this study, we examined the effect of temperament on the sympathetic nervous function in a normal population. Sixty eight healthy subjects participated in the present study. Temperament was assessed using the Korean version of the Cloninger Temperament and Character Inventory (TCI). Autonomic nervous function was determined by measuring skin temperature in a resting state, which was recorded for 5 minutes from the palmar surface of the left 5th digit using a thermistor secured with a Velcro® band. Pearson's correlation analysis and multiple linear regression were used to examine the relationship between temperament and skin temperature. A higher harm avoidance score was correlated with a lower skin temperature (i.e. an increased sympathetic tone; r=-0.343, p=0.004) whereas a higher persistence score was correlated with a higher skin temperature (r=0.433, p=0.001). Hierarchical linear regression analysis revealed that harm avoidance was able to predict the variance of skin temperature independently, with a variance of 7.1% after controlling for sex, blood pressure and state anxiety and persistence was the factor predicting the variance of skin temperature with a variance of 5.0%. These results suggest that high harm avoidance is related to an increased sympathetic nervous function whereas high persistence is related to decreased sympathetic nervous function in a normal population.

Age influences the skin reaction pattern to mechanical stress and its repair level through skin care products.

Science.gov (United States)

Zouboulis, Christos C; Elewa, Rana; Ottaviani, Monica; Fluhr, Joachim; Picardo, Mauro; Bernois, Armand; Heusèle, Catherine; Camera, Emanuela

2018-03-01

Skin aging is associated with alterations of surface texture, sebum composition and immune response. Mechanical stress induces repair mechanisms, which may be dependent on the age and quality of the skin. The response to mechanical stress in young and aged individuals, their subjective opinion and the objective effectiveness of skin care products were evaluated by biophysical skin quality parameters (stratum corneum hydration, transepidermal water loss, skin pH, pigmentation and erythema) at baseline, 1, 6, 24h and 7days at the forearms of 2 groups of healthy volunteers, younger than 35 years (n=11) and older than 60 years (n=13). In addition, casual surface lipid composition was studied under the same conditions at the baseline and day 7 after mechanical stress induction. Evaluations were also performed in stressed skin areas treated daily with skin care products and the subjective opinion of the volunteers was additionally documented. The tested groups exhibited age-associated baseline skin functions as well as casual surface lipid composition and different reaction patterns to mechanical stress. Skin care was more effective in normalizing skin reaction to stress in the young than in the aged group. The subjective volunteer opinion correlated with the objective measurements. Copyright © 2017 Elsevier B.V. All rights reserved.

Raman spectroscopy reveals biophysical markers in skin cancer surgical margins

Science.gov (United States)

Feng, Xu; Moy, Austin J.; Nguyen, Hieu T. M.; Zhang, Yao; Fox, Matthew C.; Sebastian, Katherine R.; Reichenberg, Jason S.; Markey, Mia K.; Tunnell, James W.

2018-02-01

The recurrence rate of nonmelanoma skin cancer is highly related to the residual tumor after surgery. Although tissueconserving surgery, such as Mohs surgery, is a standard method for the treatment of nonmelanoma skin cancer, they are limited by lengthy and costly frozen-section histopathology. Raman spectroscopy (RS) is proving to be an objective, sensitive, and non-destructive tool for detecting skin cancer. Previous studies demonstrated the high sensitivity of RS in detecting tumor margins of basal cell carcinoma (BCC). However, those studies rely on statistical classification models and do not elucidate the skin biophysical composition. As a result, we aim to discover the biophysical differences between BCC and primary normal skin structures (including epidermis, dermis, hair follicle, sebaceous gland and fat). We obtained freshly resected ex vivo skin samples from fresh resection specimens from 14 patients undergoing Mohs surgery. Raman images were acquired from regions containing one or more structures using a custom built 830nm confocal Raman microscope. The spectra were grouped using K-means clustering analysis and annotated as either BCC or each of the five normal structures by comparing with the histopathology image of the serial section. The spectral data were then fit by a previously established biophysical model with eight primary skin constituents. Our results show that BCC has significant differences in the fit coefficients of nucleus, collagen, triolein, keratin and elastin compared with normal structures. Our study reveals RS has the potential to detect biophysical changes in resection margins, and supports the development of diagnostic algorithms for future intraoperative implementation of RS during Mohs surgery.

Skin and gonadal dose reduction during hip radiography of the bull

International Nuclear Information System (INIS)

Wood, A.K.W.; Blockey, deB.; Reynolds, K.M.; Leith, I.S.; Burns, P.A.

1979-01-01

Radiology is being used to an increasing extent in the clinical diagnosis of hip lameness in bulls. Consequent gonadal doses may have important implications in later breeding programmes. Skin and gonadal doses were recorded during hip radiography of 18 bulls. An additional 0.13 mm copper filtration reduced skin dose by more than one third, but had no effect on gonadal dose. The average radiation dose to the gonads was approximately halved by completely surrounding the scrotum with lead sheeting 0.95 mm in thickness. (author)

Analysis of the skin surface and inner structure around pores on the face.

Science.gov (United States)

Mizukoshi, Koji; Takahashi, Kazuhiro

2014-02-01

Facial pores do not appear to close again in old skin. Therefore, the tissue structure around the pore has been speculated to keep the pore open. To elucidate the reason for pore enlargement, we examined the relationship between the skin surface and inner skin structural characteristics in the same regions especially around the pore. Samples of the skin surface were obtained from the cheek and examined using a laser image processor to obtain three-dimensional (3D) data. The inner structure of the skin was analyzed using in vivo confocal laser scanning microscopy (CLSM). The conspicuous pore not only had a concave structure but also a discontinuous convex structure on the skin surface surrounding the pore. Furthermore, CLSM image indicated that the skin inner structure developed a discontinuous dermal papilla structure and isotropic dermal fiber structure. There were structural changes in the skin surface around conspicuous pores, including not only a concave structure but also a convex structure with skin inner structure changing. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Skin graft viability test

International Nuclear Information System (INIS)

Wahner, H.W.; Robertson, J.S.

1983-01-01

With respect to skin pedicles (tubular pedicle or direct flap), an estimation of the blood supply is of great importance in making a decision as to when to perform the separation from the original blood supply. This decision is based on empiric observation of the normal time of healing and varies greatly with the site and the concepts of the individual surgery. A number of methods have been proposed for testing the circulation of pedicle skin flaps or tubes, and these methods all seem more complicated and less accurate than the isotope method that is described in this chapter

Tribology of human skin and mechanical skin equivalents in contact with textiles

NARCIS (Netherlands)

Derler, S.; Schrade, G.U.; Gerhardt, L.C.

2007-01-01

The friction of untreated human skin (finger) against a reference textile was investigated with 12 subjects using a force plate. In touch experiments, in which the subjects assessed the surface roughness of the textile at normal loads of 1.5 ± 0.7 N, the average friction coefficients ranged from

T-cell receptor gamma delta bearing cells in normal human skin

NARCIS (Netherlands)

Bos, J. D.; Teunissen, M. B.; Cairo, I.; Krieg, S. R.; Kapsenberg, M. L.; Das, P. K.; Borst, J.

1990-01-01

T-cell antigen receptors (TCR) are divided into common alpha beta and less common gamma delta types. In the murine skin, TCR gamma delta+ cells have been reported to form the great majority of epidermal T lymphocytes. We have examined the relative contribution of TCR alpha beta+ and TCR gamma delta+

Skin acceptability of a cosmetic moisturizer formulation in female subjects with sensitive skin

Directory of Open Access Journals (Sweden)

Nisbet SJ

2018-04-01

Full Text Available Stephanie J Nisbet Skin Health Medical Affairs, GSK Consumer Healthcare, Weybridge, Surrey, UK Purpose: This 3-week, open-label, noncomparative clinical study evaluated the skin acceptability of a cosmetic moisturizer in subjects with sensitive skin, by monitoring adverse events (AEs and cutaneous discomfort related to normal usage.Materials and methods: Female subjects aged between 18–60 years, with Fitzpatrick phototype classification I–IV and sensitive skin, verified by a positive reaction on the stinging test at screening, were included. Subjects applied the moisturizer to their face and body twice daily for 21±2 days at home and recorded study product usage and feelings of cutaneous discomfort (eg, dryness, prickling, stinging, and itching in a diary; any AEs were reported to the clinic. At study end, skin acceptability of the moisturizer was investigator-assessed based on the nature of AEs and subjects’ self-reported feelings of discomfort, and by clinical evaluation of skin reactions in the area of moisturizer application (appearance of erythema, formation of edema, and skin desquamation; scored according to an adapted Draize and Kligman scale. Only subjects with a treatment compliance of ≥80% were included in the final analysis.Results: In total, 35 subjects initiated and completed the study; all were compliant to the minimum study product usage. Per investigator clinical dermatological assessment at study end, none of the 35 subjects had skin reactions in the area of moisturizer application and there were no reported AEs. One subject reported sensations of mild prickling and itching immediately after applying the moisturizer (not classified as AEs, which spontaneously remitted after complete absorption of the product and were noted only in exposed areas. These events were considered by the investigator as being possibly/probably related to the use of study product; however, no clinical signs of skin reaction were observed in

Resveratrol anti-ultraviolet-induced guinea pig skin injury

International Nuclear Information System (INIS)

Li Wenxing; Zhao Ying

2014-01-01

Objective: To Estimate on the protection effect of Stilbene on skin damage induced by ultraviolet radiation. Methods: After the normal skin in guinea pig under the intervene of Resveratrol was irradiated with over- dose of ultraviolet rays (UVB and UVA), the samples in every group were matched and compared. Results: The skin tissue in the Resveratrol intervene group irradiated by ultraviolet rays didn't change obviously as compared with that in the self-control group. But, the damage skin tissue in the control group irradiated by ultraviolet did change significantly as compared with that in the Stilbene intervene group. Conclusion: Resveratrol is a good material to protect the skin from damage effect by ultraviolet radiation. (authors)

Efficient in vivo gene transfer to xenotransplanted human skin by lentivirus-mediated, but not by AAV-directed, gene delivery

DEFF Research Database (Denmark)

Jakobsen, Maria Vad; Askou, Anne Louise; Dokkedahl, Karin Stenderup

skin graft, and firefly luciferase expression was observed primarily in neighboring tissue beneath or surrounding the graft. In contrast, gene delivery by intradermally injected lentiviral vectors was efficient and led to extensive and persistent firefly luciferase expression within the human skin...... graft only. The study demonstrates limited capacity of single-stranded AAV vectors of six commonly used serotypes for gene delivery to human skin in vivo....

Personnel decontamination and preventive skin care

International Nuclear Information System (INIS)

Henning, Klaus; Gojowczyk, Peter

2010-01-01

Skin contamination arises from contact with contaminated aqueous solutions and from transmission of radioactively contaminated dirt particles. As long as the surface of the skin is neither inflamed nor showing any lesions, normally only a limited part of the top layer (epidermis), i.e. the upper layers of the stratum corneum, is contaminated. The intact horny layer has a barrier function protecting against the penetration of chemicals and dirt particles. The horny layer can be damaged by water, solvents, alkaline substances, and acids. In general, it is safe to say that the horny layer acts as a natural barrier to the penetration of liquid and particulate impurities into lower layers of the skin. As long as the horny layer is intact and free from lesions, the risk of incorporation can be considered low. When decontaminating and cleansing the skin, also in daily skin cleansing, care must be taken to prevent the acid protective layer and the horny layer from being compromised. Daily cleansing and cleansing for decontamination must be carried out with a mild, weakly acidic detergent. In addition, prevention should be achieved daily by applying a non-greasy skin lotion to protect the skin. Following a systematic regular regimen in skin cleansing and preventive skin care as well as a specific approach in skin decontamination and cleansing will avoid damage to the skin and remove any contamination incurred. This approach comprises a three-pronged concept, namely skin protection, cleansing and care. (orig.)

Effects of tretinoin on wound healing in aged skin.

Science.gov (United States)

de Campos Peseto, Danielle; Carmona, Erica Vilaça; Silva, Kellyn Cristina da; Guedes, Flavia Roberta Valente; Hummel Filho, Fernando; Martinez, Natalia Peres; Pereira, José Aires; Rocha, Thalita; Priolli, Denise Gonçalves

2016-03-01

Aged and adult populations have differences in the structural, biological, and healing properties of skin. Comparative studies of healing under the influence of retinoids in both these populations are very important and, to the best of our knowledge, have not been performed to date. The purpose of this study was to compare the activities of topical tretinoin in aged and adult animal models of wound healing by secondary intention. Male aged rats (24 months old, n = 7) and adult rats (6 months old, n = 8) were used. The rats were assigned to the following groups according to the dates on which wound samples were excised (day 14 or 21 after model creation): treated group, control group, and naive group. Topical application of tretinoin cream was used only on the proximal wound and was applied daily for 7 days. Wound healing areas were measured using metal calipers, and morphological analysis was performed. Slides were stained with Hematoxylin and Eosin, Masson's trichrome, and periodic acid-Schiff stains. Statistical analysis adopted a 5% coefficient for rejection of the null hypothesis. Although aged animals showed skin repair, complete reepithelialization was found on day 21 in some animals of both groups (treated and control). In aged rats, the wound area was significantly smaller in treated wounds than in untreated wounds, resulting in a larger scar area compared with the adult group. When treated wounds were compared, no differences were found between the wound areas in adult and aged rats. As expected, the collagen concentration was higher in normal skin from adult rats than in normal skin from aged animals, but there was no difference when aged skin was treated with tretinoin. These results indicate that tretinoin increases collagen synthesis in aged skin and returns the healing process to a normal state of skin healing. © 2016 by the Wound Healing Society.

Resistance of germfree athymic nude mice to two-stage skin carcinogenesis

Energy Technology Data Exchange (ETDEWEB)

Holland, J.M.; Perkins, E.H.

1979-01-01

Germfree athymic and normal littermate mice were compared with respect to their relative sensitivity to single skin application of dimethylbenzanthacine followed either by croton oil or TPA applied as a co-carcinogen. In separate experiments the acute response of both phenotypes to TPA was assessed by histologic examination of skin as well as the incorporttion of tritiated thymidine into acid insoluble material obtained from the isolated epidermis. Nude mice were observed to be less, equal, or more sensitive than normal littermate to topical skin carcinogenesis depending upon experimental variables. The tendency of solvent to spread rapidly on the skin of nude mice appeared to have the greatest influence on susceptibility to papilloma induction. Other factors of potential, although unproven importance, include differences in skin structure, possibly associated with accelerated activity of hair follicles as well as resistance to both the inflammatory and hyperplasiogenic effects of TPA.

THERAPEUTIC OF SKIN AGING WITH CARBON DIOXIDE LASER SKIN RESURFACING AND COMBINATION WITH AIR COOLING

Directory of Open Access Journals (Sweden)

NKA Maya Damayanti

2013-12-01

Full Text Available Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 So far, a lot of people who want their face skin always looks young though age continued to grow. It cannot be denied that aging will occur in everyone although some faster or later occur. Various ways were developed by scientists to fix this issue. Laser Skin Resurfacing (LSR technique to tighten facial skin is a procedure that is popular among the public and the practice of medicine. CO2 LSR technique is still a gold standard was used. Pain during surgery can be reduced when this technique was combined with air cooling. In addition, the adverse effects of post-operative might be tolerated.   /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;}

Elevated c-Src and c-Yes expression in malignant skin cancers

Directory of Open Access Journals (Sweden)

Lee Jang

2010-08-01

Full Text Available Abstracts Background Src family kinases (SFKs play an important role in cancer proliferation, survival, motility, invasiveness, metastasis, and angiogenesis. Among the SFKs, c-Src and c-Yes are particularly over-expressed or hyper-activated in many human epithelial cancers. However, only a few studies have attempted to define the expression and role of c-Src and c-Yes in cutaneous carcinomas. Objectives To investigate the expression of c-Src and c-Yes in cutaneous carcinomas to include malignant melanoma (MM, squamous cell carcinoma (SCC and basal cell carcinoma (BCC. Methods We examined 6 normal skin tissues and 18 malignant skin tumor tissues using western blotting for the expression of c-Src and c-Yes. In another set, 16 specimens of MM, 16 SCCs and 16 BCCs were analyzed for the expression of c-Src and c-Yes using immunohistochemical staining. Results Western blotting showed that c-Src was expressed in all malignant skin tumors, but not in normal skin, while c-Yes was expressed in MM and SCC, but not in BCC and normal skin. Immunohistochemical staining results of c-Src and c-Yes in MM, SCC, and BCC mirrored those of the western blot analysis. Conclusions c-Src, rather than c-Yes, plays a key role in the proliferation and progression of malignant skin cancers.

Volumetric Visualization of Human Skin

Science.gov (United States)

Kawai, Toshiyuki; Kurioka, Yoshihiro

We propose a modeling and rendering technique of human skin, which can provide realistic color, gloss and translucency for various applications in computer graphics. Our method is based on volumetric representation of the structure inside of the skin. Our model consists of the stratum corneum and three layers of pigments. The stratum corneum has also layered structure in which the incident light is reflected, refracted and diffused. Each layer of pigment has carotene, melanin or hemoglobin. The density distributions of pigments which define the color of each layer can be supplied as one of the voxel values. Surface normals of upper-side voxels are fluctuated to produce bumps and lines on the skin. We apply ray tracing approach to this model to obtain the rendered image. Multiple scattering in the stratum corneum, reflective and absorptive spectrum of pigments are considered. We also consider Fresnel term to calculate the specular component for glossy surface of skin. Some examples of rendered images are shown, which can successfully visualize a human skin.

Human normal tissue reactions in radiotherapy

International Nuclear Information System (INIS)

Taniike, Keiko

1990-01-01

Acute and late normal tissue reactions in radiotherapy have not been considered to be major problems with conventional fractionation. But they may cause certain problems when newer schedules such as hyperfractionation or accelerated fractionation are used. In opposing parallel radiotherapy, the dose fractionation of skin or subcutaneous connective tissue are different between in one portal and two portals daily. So we examined acute skin erythema and late connective tissue fibrosis in the two groups (one and two portals) of the patients with uterus cancer. Acute skin erythema and late connective tissue fibrosis were slightly stronger in case of one portal daily. In relation to the anatomical site of skin, acute skin erythema was stronger at the buttocks than the lower abdomen, but late fibrosis was reverse to that. So the degree of acute skin erythema did not predict the degree of late connective tissue fibrosis. The number of Time Dose Fractionation Factor could roughly estimate the degree of erythema and fibrosis. Late fibrosis in 36 fractions increased with an increase of abdominal thickness, but acute erythema did not. (author)

Spectral Detection of Human Skin in VIS-SWIR Hyperspectral Imagery without Radiometric Calibration

Science.gov (United States)

2012-03-01

6 Spectral reflectance of human skin at VIS-SWIR wavelengths. Skin with less melanin appears brighter because it has higher reflectance...6 illustrates the spectral reflectance of human skin with different melanin levels. One paper proposes a Normalized Difference Skin Index (NDSI), a...1.4% Melanin 12.6% Melanin 23.2% Melanin 34.3% Melanin 45% Melanin Figure 6. Spectral reflectance of human skin at VIS-SWIR wavelengths. Skin with less

Mouse Genetic Models Reveal Surprising Functions of IκB Kinase Alpha in Skin Development and Skin Carcinogenesis

Energy Technology Data Exchange (ETDEWEB)

Xia, Xiaojun [The Methodist Hospital Research Institute, Houston, TX 77030 (United States); Park, Eunmi [Department of Radiation Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA 02115 (United States); Fischer, Susan M. [Department of Molecular Carcinogenesis, The University of Texas MD Anderson Cancer Center, Smithville, TX 78967 (United States); Hu, Yinling, E-mail: huy2@mail.nih.gov [Cancer and Inflammation Program, Center for Cancer Research, Frederick National Laboratory for Cancer Research, Frederick, MD 21701 (United States)

2013-02-15

Gene knockout studies unexpectedly reveal a pivotal role for IκB kinase alpha (IKKα) in mouse embryonic skin development. Skin carcinogenesis experiments show that Ikkα heterozygous mice are highly susceptible to chemical carcinogen or ultraviolet B light (UVB) induced benign and malignant skin tumors in comparison to wild-type mice. IKKα deletion mediated by keratin 5 (K5).Cre or K15.Cre in keratinocytes induces epidermal hyperplasia and spontaneous skin squamous cell carcinomas (SCCs) in Ikkα floxed mice. On the other hand, transgenic mice overexpressing IKKα in the epidermis, under the control of a truncated loricrin promoter or K5 promoter, develop normal skin and show no defects in the formation of the epidermis and other epithelial organs, and the transgenic IKKα represses chemical carcinogen or UVB induced skin carcinogenesis. Moreover, IKKα deletion mediated by a mutation, which generates a stop codon in the Ikkα gene, has been reported in a human autosomal recessive lethal syndrome. Downregulated IKKα and Ikkα mutations and deletions are found in human skin SCCs. The collective evidence not only highlights the importance of IKKα in skin development, maintaining skin homeostasis, and preventing skin carcinogenesis, but also demonstrates that mouse models are extremely valuable tools for revealing the mechanisms underlying these biological events, leading our studies from bench side to bedside.

Mouse Genetic Models Reveal Surprising Functions of IκB Kinase Alpha in Skin Development and Skin Carcinogenesis

International Nuclear Information System (INIS)

Xia, Xiaojun; Park, Eunmi; Fischer, Susan M.; Hu, Yinling

2013-01-01

Gene knockout studies unexpectedly reveal a pivotal role for IκB kinase alpha (IKKα) in mouse embryonic skin development. Skin carcinogenesis experiments show that Ikkα heterozygous mice are highly susceptible to chemical carcinogen or ultraviolet B light (UVB) induced benign and malignant skin tumors in comparison to wild-type mice. IKKα deletion mediated by keratin 5 (K5).Cre or K15.Cre in keratinocytes induces epidermal hyperplasia and spontaneous skin squamous cell carcinomas (SCCs) in Ikkα floxed mice. On the other hand, transgenic mice overexpressing IKKα in the epidermis, under the control of a truncated loricrin promoter or K5 promoter, develop normal skin and show no defects in the formation of the epidermis and other epithelial organs, and the transgenic IKKα represses chemical carcinogen or UVB induced skin carcinogenesis. Moreover, IKKα deletion mediated by a mutation, which generates a stop codon in the Ikkα gene, has been reported in a human autosomal recessive lethal syndrome. Downregulated IKKα and Ikkα mutations and deletions are found in human skin SCCs. The collective evidence not only highlights the importance of IKKα in skin development, maintaining skin homeostasis, and preventing skin carcinogenesis, but also demonstrates that mouse models are extremely valuable tools for revealing the mechanisms underlying these biological events, leading our studies from bench side to bedside

Comparison of native porcine skin and a dermal substitute using tensiometry and digital image speckle correlation.

Science.gov (United States)

Fritz, Jason R; Phillips, Brett T; Conkling, Nicole; Fourman, Mitchell; Melendez, Mark M; Bhatnagar, Divya; Simon, Marcia; Rafailovich, Miriam; Dagum, Alexander B

2012-10-01

Dermal substitutes are currently used in plastic surgery to cover various soft tissue defects caused by trauma, burns, or ablative cancer surgery. Little information is available on the biomechanical properties of these dermal substitutes after adequate incorporation as compared to normal skin. Determining parameters such as tensile strength in these skin substitutes will help us further understand their wound healing properties and potential in developing artificial tissue constructs. We hypothesize that a dermal substitute has a lower stress-strain curve and altered stress-induced deformation quantified with tensiometry and digital image speckle correlation (DISC) analysis. Two separate 5×10-cm full-thickness wounds were created on the dorsum of 3 female swine. Fibrin glue was applied before either a full-thickness skin graft (FTSG) or application of artificial dermal matrix. On day 42, cultured autologous keratinocytes were applied as a cell sheet to the wound covered with Integra. On day 56, the wounds were fully excised and fresh tissue specimens, including normal skin, were stored in a physiological solution and prepared for analysis. Rectangular samples were excised from the center of each specimen measuring 4×4×30 mm. Using a tensiometer and DISC analysis, we evaluated the tensile strength of 3 different groups of skin, namely, normal, FTSG, and Integra. There is a significant difference between the Integra specimen when compared to normal skin and FTSG. We found a minimal difference in the stress-strain curves of the latter two. Integra alone shows plastic deformation with continued stretching before ultimate midline fracture. There is significant change between the Young's moduli of the normal skin and the Integra, whereas there is little difference between the FTSG and the normal skin; DISC confirms this analysis. The normal skin and FTSG show a convergence of vectors to a linear plane, whereas Integra shows very little organization. Using 2 different

Evaluation of dermal-epidermal skin equivalents ('composite-skin') of human keratinocytes in a collagen-glycosaminoglycan matrix(Integra artificial skin).

Science.gov (United States)

Kremer, M; Lang, E; Berger, A C

2000-09-01

origin. These experimental results demonstrate the establishment of an effective cell cultivation process which may be suitable for scale-up production of the epidermal component as large-scale composite-skin grafts. When seeded into Integratrade mark and grafted onto the nude mouse a replacement skin with normal functioning dermal-epidermal components was developed. These results encourage the design of a clinical trial to assess the function of this composite graft in man.

Quantitative Assessment of Skin Stiffness in Localized Scleroderma Using Ultrasound Shear-Wave Elastography.

Science.gov (United States)

Wang, Liyun; Yan, Feng; Yang, Yujia; Xiang, Xi; Qiu, Li

2017-07-01

The purpose of this study was to evaluate the usefulness of ultrasound shear-wave elastography (US-SWE) in characterization of localized scleroderma (LS), as well as in the disease staging. A total of 21 patients with 37 LS lesions were enrolled in this study. The pathologic stage (edema, sclerosis or atrophy) of the lesions was characterized by pathologic examination. The skin elastic modulus (E-values including E mean , E min , E max and E sd ) and thickness (h) was evaluated both in LS lesions and site-matched unaffected skin (normal controls) using US-SWE. The relative difference of E-values (E RD ) was calculated between each pair of lesions and its normal control for comparison among different pathologic stages. Of the 37 LS lesions, 2 were in edema, 22 were in sclerosis and 13 were in atrophy. US-SWE results showed a significant increase of skin elastic modulus and thickness in all lesions (p < 0.001 in sclerosis and p < 0.05 in atrophy) compared with the normal controls. The measured skin elastic modulus and thickness were greater in sclerosis than in atrophy. However, once normalized by skin thickness, the atrophic lesions, which were on average thinner, appeared significantly stiffer than those of the sclerosis (normalized E RD : an increase of 316.3% in atrophy vs. 50.6% in sclerosis compared with the controls, p = 0.007). These findings suggest that US-SWE allows for quantitative evaluation of the skin stiffness of LS lesions in different stages; however, the E-values directly provided by the US-SWE system alone do not distinguish between the stages, and the normalization by skin thickness is necessary. This non-invasive, real-time imaging technique is an ideal tool for assessing and monitoring LS disease severity and progression. Copyright © 2017 World Federation for Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.

An objective long-term evaluation of Integra (a dermal skin substitute) and split thickness skin grafts, in acute burns and reconstructive surgery.

Science.gov (United States)

Nguyen, Dai Q A; Potokar, Tom S; Price, Patricia

2010-02-01

The field of wound healing and tissue repair has advanced rapidly in the last decade, with this there is an increasing emphasis on the importance of the functional and cosmetic outcomes following injury. Integra artificial skin is the most widely used synthetic skin substitute and is reported to have better outcomes in relation to the appearance and elasticity when compared to split thickness skin grafting (SSG). A review of the literature reveals very few trials that are based on an objective evaluation of Integra treated scars as compared to SSGs. This research aimed to provide objective data on the long-term outcome of Integra. All adult patients from the Welsh Burns Centre who had been successfully treated with Integra+/-SSG were invited to attend a clinic for a follow up provided they had been healed for greater than one year. The hypothesis that Integra scars are more pliable than skin grafts was tested objectively using the Cutometer, a suction device which measures skin elasticity. Of the 13 patients eligible, six were available for assessment. The results of this study suggest that Integra treated sites correlate well with normal skin as measured by the Cutometer. This was statistically significant for the parameters Ur/Ue (elastic function) and Ur/Uf (gross elasticity). On the other hand there was no correlation seen between the patients SSG sites and the patient's normal skin. With advances in medicine we are increasingly able to modulate wound healing and the resultant scars. In order to assess new and often costly treatments the need for objective scar measurement tools have become apparent. Integra has been advocated to improve scarring from injury. However, there have been few studies to evaluate the long-term outcome of Integra as compared to traditional methods such as SSG. In the past scar evaluation has been based on subjective scores by patients and clinicians. Now the mechanical properties of the skin can be evaluated using simple

Elemental composition of skin tissue by PIXE and INAA analyses

International Nuclear Information System (INIS)

Hollands, R.; Spyrou, N.M.

1997-01-01

Hypertrophic scars are a particular type of scar that can form after any type of dermal injury. They are unsightly, red, elevated above normal skin level, itchy and painful. At present no-one knows why these scars form. Due to the differences between scar tissue and normal skin it was decided to analyse skin tissue which at a later date would be compared to scar tissue. Spit skin graft (epidermis) samples as well as full thickness skin (epidermis to dermis) tissue were analysed using PIXE and RBS with a 2 MeV proton beam. The epidermis was compared to the dermis to see if there were any variations between the two. In all the samples P, S, Cl, K, Ca, Fe, and Cd were detected and in a majority of the samples Zn and Ba were found, using PIXE. It was found that, between the epidermis and dermis, there was an significant increase in P in the epidermis in both full thickness and split skin graft samples. Complementary elemental analysis was also performed using neutron activation, and Br, Na and Zn were detected. (author)

Effects of radiation on the skin blood volume pulse in humans

Energy Technology Data Exchange (ETDEWEB)

Zanelli, G D [Mount Vernon Hospital, Northwood (UK)

1977-01-01

Measurements have been made of the changes in skin blood volume pulse (BVP) in the irradiated skin of three patients (two female, one male) during and up to 250 days after radiotherapy for malignant disease. The instrumentation comprised a modified commercial finger photo-plethysmograph probe with associated electronics, and a survey of the literature revealed that the consensus of opinion seems to be that the recorded pulsations arise from small 'muscular' arteries and arterioles in the 40 to 300 ..mu..m size range. The results show that, as expected, normal, untreated skin shows sizeable variations in BVP. The BVP of irradiated skin became significantly greater than that of normal skin when a dose of 1000 to 1500 rad has been accumulated. The maximum amplitude of the BVP of the irradiated skin seemed to correlate well with the overall severity of the erythema, but increases in BVP preceded erythema flare-ups. In two patients, elevated BVP were recorded for irradiated areas even when most visual signs of erythema had disappeared. Mild cooling of irradiated and non-irradiated skin had differing effects in the BVP. The measurement of the BVP of irradiated skin is a simple, reliable and completely atraumatic method for investigating vascular damage to superficial tissues in humans.

Permeability of commercial solvents through living human skin

DEFF Research Database (Denmark)

Ursin, C; Hansen, C M; Van Dyk, J W

1995-01-01

A procedure has been developed for measuring the steady state rate of permeation of commercial solvents through living human skin. To get the most consistent results, it was necessary with some solvents to normalize the solvent permeation rate of a given skin sample with its [3H]water permeation...... rate. For other solvents this was not necessary, so the un-normalized data were used. High [3H]water permeation rate also was used as a criterion for "defective" skin samples that gave erroneous permeability rates, especially for solvents having slow permeability. The linearity of the steady state data...... was characterized by calculation of the "percent error of the slope." The following permeability rates (g/m2h) of single solvents were measured: dimethyl sulfoxide (DMSO), 176; N-methyl-2-pyrrolidone, 171; dimethyl acetamide, 107; methyl ethyl ketone, 53; methylene chloride, 24; [3H]water, 14.8; ethanol, 11...

Transcriptome Analysis Reveals Markers of Aberrantly Activated Innate Immunity in Vitiligo Lesional and Non-Lesional Skin

Science.gov (United States)

Huang, Yuanshen; Wang, Yang; Yu, Jie; Gao, Min; Levings, Megan; Wei, Shencai; Zhang, Shengquan; Xu, Aie; Su, Mingwan; Dutz, Jan; Zhang, Xuejun; Zhou, Youwen

2012-01-01

Background Vitiligo is characterized by the death of melanocytes in the skin. This is associated with the presence of T cell infiltrates in the lesional borders. However, at present, there is no detailed and systematic characterization on whether additional cellular or molecular changes are present inside vitiligo lesions. Further, it is unknown if the normal appearing non-lesional skin of vitiligo patients is in fact normal. The purpose of this study is to systematically characterize the molecular and cellular characteristics of the lesional and non-lesional skin of vitiligo patients. Methods and Materials Paired lesional and non-lesional skin biopsies from twenty-three vitiligo patients and normal skin biopsies from sixteen healthy volunteers were obtained with informed consent. The following aspects were analyzed: (1) transcriptome changes present in vitiligo skin using DNA microarrays and qRT-PCR; (2) abnormal cellular infiltrates in vitiligo skin explant cultures using flow cytometry; and (3) distribution of the abnormal cellular infiltrates in vitiligo skin using immunofluorescence microscopy. Results Compared with normal skin, vitiligo lesional skin contained 17 genes (mostly melanocyte-specific genes) whose expression was decreased or absent. In contrast, the relative expression of 13 genes was up-regulated. The up-regulated genes point to aberrant activity of the innate immune system, especially natural killer cells in vitiligo. Strikingly, the markers of heightened innate immune responses were also found to be up-regulated in the non-lesional skin of vitiligo patients. Conclusions and Clinical Implications As the first systematic transcriptome characterization of the skin in vitiligo patients, this study revealed previously unknown molecular markers that strongly suggest aberrant innate immune activation in the microenvironment of vitiligo skin. Since these changes involve both lesional and non-lesional skin, our results suggest that therapies targeting

Paper Skin Multisensory Platform for Simultaneous Environmental Monitoring

KAUST Repository

Nassar, Joanna M.

2016-02-19

Human skin and hair can simultaneously feel pressure, temperature, humidity, strain, and flow—great inspirations for applications such as artificial skins for burn and acid victims, robotics, and vehicular technology. Previous efforts in this direction use sophisticated materials or processes. Chemically functionalized, inkjet printed or vacuum-technology-processed papers albeit cheap have shown limited functionalities. Thus, performance and/or functionalities per cost have been limited. Here, a scalable “garage” fabrication approach is shown using off-the-shelf inexpensive household elements such as aluminum foil, scotch tapes, sticky-notes, napkins, and sponges to build “paper skin” with simultaneous real-time sensing capability of pressure, temperature, humidity, proximity, pH, and flow. Enabling the basic principles of porosity, adsorption, and dimensions of these materials, a fully functioning distributed sensor network platform is reported, which, for the first time, can sense the vitals of its carrier (body temperature, blood pressure, heart rate, and skin hydration) and the surrounding environment.

Skin Diseases: Skin Health and Skin Diseases

Science.gov (United States)

Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Skin Health and Skin Diseases Past Issues / Fall 2008 Table of Contents ... acne to wrinkles Did you know that your skin is the largest organ of your body? It ...

Claudins 1, 2, 3, 4, 5 and 7 in solar keratosis and squamocellular carcinoma of the skin

Science.gov (United States)

Hintsala, Hanna-Riikka; Siponen, Maria; Haapasaari, Kirsi-Maria; Karihtala, Peeter; Soini, Ylermi

2013-01-01

Claudins are tight junction proteins regulating the paracellular permeability of cell layers. We investigated the expression of claudins 1, 2, 3, 4, 5 and 7 in a sample set consisting of a total of 93 cases representing normal skin, actinic keratoses and squamous cell carcinomas of the skin. There were several changes found in claudin expression. Claudin 1 appeared to be progressively decreased in solar keratosis and skin squamous cell carcinomas compared to normal skin while expression of claudin 2 was increased. With claudins 3 and 5 occasional immunoreactivity was found in squamous cell carcinomas. Claudins 4 and 7 were variably expressed in skin neoplasia compared to normal skin. According to the results expression of claudins 1 and 2 change in parallel with the severity of the epidermal preneoplastic and neoplastic lesions thus probably influencing the disturbed epithelial polarity characteristic of these lesions. Claudin 1 under- and claudin 2 overexpression also lead to a leakier epithelial barrier function of the skin with a resulting damage to skin epithelial resistance. Other claudins investigated in this study did not show progressive changes even though occasional overexpression of them was found in skin squamous cell carcinoma. PMID:24294371

Applications of positron annihilation to dermatology and skin cancer

International Nuclear Information System (INIS)

Liu, Guang; Chen, Hongmin; Chakka, Lakshmi; Gadzia, Joseph E.; Jean, Y.C.

2007-01-01

Positronium annihilation lifetime experiments have been performed to investigate the interaction between skin cancer and positronium for human skin samples. Positronium annihilation lifetime is found to be shorter and intensity is found to be less for the samples with basal cell carcinoma and squamous cell carcinoma than the normal skin samples. These results indicate a reduction of free volume in the molecular level for the skin with cancer with respect to the skin without cancer. Positron annihilation spectroscopy may be potentially developed as a new noninvasive and external method for dermatology clinics, early detection of cancer, and nano-PET technology in the future. (copyright 2007 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

Applications of positron annihilation to dermatology and skin cancer

Energy Technology Data Exchange (ETDEWEB)

Liu, Guang; Chen, Hongmin; Chakka, Lakshmi [Department of Chemistry, University of Missouri-Kansas City, Kansas City, MO 64110 (United States); Gadzia, Joseph E. [Dermatology, Department of Internal Medicine, University of Kansas Medical Center, Kansas City, KS 66103 and Kansas Medical Clinic, Topeka, KS 66614 (United States); Jean, Y.C. [Department of Chemistry, University of Missouri-Kansas City, Kansas City, MO 64110 (United States); R and D Center for Membrane Technology, Chung Yuan Christian University, Chung-Li (China)

2007-07-01

Positronium annihilation lifetime experiments have been performed to investigate the interaction between skin cancer and positronium for human skin samples. Positronium annihilation lifetime is found to be shorter and intensity is found to be less for the samples with basal cell carcinoma and squamous cell carcinoma than the normal skin samples. These results indicate a reduction of free volume in the molecular level for the skin with cancer with respect to the skin without cancer. Positron annihilation spectroscopy may be potentially developed as a new noninvasive and external method for dermatology clinics, early detection of cancer, and nano-PET technology in the future. (copyright 2007 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

Stratum corneum integrity as a predictor for peristomal skin problems in ostomates

DEFF Research Database (Denmark)

Nybaek, H; Lophaven, Søren Nymand; Karlsmark, T

2010-01-01

BACKGROUND: Peristomal skin problems are common, most often the result is disruption of the skin barrier and this may account for more than one in three visits to ostomy nurses. Therefore a specific assessment of individual risk factors relating to the skin barrier function would be of great...... interest. METHODS: Skin barrier integrity in ostomy patients with peristomal skin problems (PSP) was compared with that of ostomy patients with normal skin (controls) using transepidermal water loss (TEWL). Mechanical barrier disruption was determined by a tape stripping test and chemical barrier...

Biocompounds from rapeseed oil industry co-stream as active ingredients for skin care applications

OpenAIRE

Rivera Rodríguez, Diana Marcela; Rommi, Katariina; Macedo Fernandes, Margarida Maria; Lantto, Raija; Tzanov, Tzanko

2015-01-01

OBJECTIVE: Despite the great number of substances produced by the skincare industry, very few of them seem to truly have an effect on the skin. Therefore, given the social implications surrounding physical appearance, the search for new bioactive compounds to prevent or attenuate skin ageing and enhance self-image is a priority of current research. In this context, being rich in valuable compounds, such as proteins, phenolics, lipids and vitamins, this study is focused on the potential activi...

Study of the skin effect in superconducting materials

Energy Technology Data Exchange (ETDEWEB)

Szeftel, Jacob, E-mail: jszeftel@lpqm.ens-cachan.fr [ENS Cachan, LPQM, 61 avenue du Président Wilson, 94230 Cachan (France); Sandeau, Nicolas [Aix Marseille Univ, CNRS, Centrale Marseille, Institut Fresnel, F-13013 Marseille (France); Khater, Antoine [Université du Maine, UMR 6087 Laboratoire PEC, F-72000 Le Mans (France)

2017-05-03

Highlights: • Comprehensive theoretical study of the skin effect in superconductors. • Based on Newton and Maxwell's equations. • Usual and anomalous skin effects dealt with in the same framework. - Abstract: The skin effect is analyzed to provide the numerous measurements of the penetration depth of the electromagnetic field in superconducting materials with a theoretical basis. Both the normal and anomalous skin effects are accounted for within a single framework, focusing on frequencies less than the superconducting gap. The emphasis is laid on the conditions required for the penetration depth to be equal to London's length, which enables us to validate an assumption widely used in the interpretation of all current experimental results.

Tenskinmetric Evaluation of Surface Energy Changes in Adult Skin: Evidence from 834 Normal Subjects Monitored in Controlled Conditions

Directory of Open Access Journals (Sweden)

Camilla Dal Bosco

2014-03-01

Full Text Available To evaluate the influence of the skin aging critical level on the adult skin epidermal functional state, an improved analytical method based on the skin surface energetic measurement (TVS modeling was developed. Tenskinmetric measurements were carried out non-invasively in controlled conditions by contact angle method using only a water-drop as reference standard liquid. Adult skin was monitored by TVS Observatory according to a specific and controlled thermal protocol (Camianta protocol in use at the interconnected “Mamma Margherita Terme spa” of Terme Euganee. From June to November 2013, the surface free energy and the epidermal hydration level of adult skin were evaluated on arrival of 265 male and 569 female adult volunteers (51–90 years of age and when they departed 2 weeks later. Sensitive measurements were carried out at 0.1 mN/m. High test compliance was obtained (93.2% of all guests. Very interesting results are obtained. The high sensitivity and discrimination power of tenskinmetry combined with a thermal Camianta protocol demonstrate the possibility to evaluate at baseline level the surface energetic changes and the skin reactivity which occurs on adult skin.

Synthesis and kinetics of [18F]4'-fluoroantipyrine in normal mice

International Nuclear Information System (INIS)

Robbins, P.J.; Fortman, D.L.; Scholz, K.L.; Fusaro, G.A.; Sodd, V.J.

1978-01-01

Antipyrine labeled with radioiodine has proven useful for studying the symmetry of human brain perfusion by gamma-camera techniques. The feasibility of preparing F-18-labeled antipyrine for eventual use with a positron camera was investigated. The preparation of [ 18 F] 4'-fluoroantipyrine and its distribution in normal mice were used to evaluate this potential. 4'-Fluoroantipyrine was prepared in 7 to 20% chemical yield by the pyrolysis of the 4'-diazonium fluoroborate salt of antipyrine. This Schiemann salt was prepared by a five-step synthesis from 1-(4'-nitrophenyl)-3-methyl-5-chloro-pyrazole. Fluorine-18 labeling of the diazonium fluoroborate salt by exchange with aqueous F-18 and pyrolysis of the dried labeled salt produced [ 18 F] 4'-fluoroantipyrine with specific activities of 0.83 to 2.7 μCi/mg. The incorporated F-18 activity ranged from 0.53 to 1.9%. The labeling procedure took about 3 hr. The labeled antipyrine was administered by tail vein to fasting female Swiss-Cox mice. Distribution of F-18 at 12, 30, 60, and 120 sec, and 10 min, after injection showed that radioactivity persisted in the brain up to 120 sec at a level greater than that of the skin and the bone. (Skin and bone samples were chosen as representative of activities in the scalp and skull surrounding the brain.) Thus, perfusion imaging of the CNS should be possible when greater quantities of high-specific-activity F-18-labeled antipyrine becomes available

Oxidative Stress and Ageing: The Influence of Environmental Pollution, Sunlight and Diet on Skin

Directory of Open Access Journals (Sweden)

Khimara Naidoo

2017-01-01

Full Text Available Skin ageing is a complex process that is determined by both intrinsic and extrinsic factors, which leads to a progressive loss of structure and function. There is extensive evidence indicating that oxidative stress induced by reactive oxygen species plays an important role in the process of human skin ageing. Mitochondria are the major source of cellular oxidative stress and are widely implicated in cutaneous ageing. Extrinsic skin ageing is driven to a large extent by environmental factors and external stressors such as ultraviolet radiation (UVR, pollution and lifestyle factors which have been shown to stimulate the production of reactive oxygen species and generate oxidative stress. The oxidative damage from these exogenous sources can impair skin structure and function, leading to the phenotypic features of extrinsic skin ageing. The following review highlights the current evidence surrounding the role of mitochondria and oxidative stress in the ageing process and the influence of environmental factors such as ultraviolet radiation, pollution and diet on skin ageing.

Comparison of differences in knowledge about skin care bettwen young women and man

Directory of Open Access Journals (Sweden)

Katarzyna Bojarczuk

2017-08-01

Full Text Available Introduction: The skin of modern people is exposed daily to a number of irritants like stress, consequences of inadequate diet, exposure to chemicals and plastics. Those factors can pose a challenge not only for delicate skin of a child, or a woman, but also for more resistant skin of men. Every type of complexion requires individual care, adjusted to different conditions and life circumstances. The choice of proper skin care products should be based on basic skin type and also one's gender. Objectives: Evaluation of differences in students' knowledge about skin care in relation to their gender. Material and methods: Evaluation of students' knowledge concerning proper skin care guidelines was conducted among 210 students (150 women and 60 men using anonymous survey. Results: Majority of male respondents determined their skin type as a normal one (56.6%, majority of female respondents as a combination type (51.3%. Men in contrast to women are more often unable to evaluate the type of their own skin (16.7% vs 4.0%.  Acne was the most common skin condition students of both sexes complained about. Daily skin care activities are performed by 96.6% interviewed women and 63.3% men. The regular use of face skin care products was reported by 87.3% of women and 31.6% of men. Conclusions: 1. Majority of women evaluate their basic skin type as combination one, most men regarded their skin type as normal . 2. Women more often than men take care of their skin and use adequate skin care products. 3. Facial moisturizing lotion is the most frequently chosen skin care product by both women and men.

Micro-fractional ablative skin resurfacing with two novel erbium laser systems.

Science.gov (United States)

Dierickx, Christine C; Khatri, Khalil A; Tannous, Zeina S; Childs, James J; Cohen, Richard H; Erofeev, Andrei; Tabatadze, David; Yaroslavsky, Ilya V; Altshuler, Gregory B

2008-02-01

Fractional ablation offers the potential benefits of full-surface ablative skin resurfacing while minimizing adverse effects. The purpose of this study was to evaluate the safety, damage profile, and efficacy of erbium fractional lasers. Histology from animal and human skin as well as clinical evaluations were conducted with erbium YAG (2,940 nm) and erbium YSGG (2,790 nm) fractional lasers varying pulse width, microbeam (microb) energy, number of passes, and stacking of pulses. Single-pulse treatment parameters from 1 to 12 mJ per 50-70 microm diameter microbeam and 0.25-5 milliseconds pulse widths produced microcolumns of ablation with border coagulation of up to 100 microm width and 450 microm depth. Stacking of pulses generated deeper microcolumns. Clinical observations and in vivo histology demonstrate rapid re-epithelization and limited adverse side effects. Facial treatments were performed in the periorbital and perioral areas using 1-8 passes of single and stacked pulses. Treatments were well-tolerated and subjects could resume their normal routine in 4 days. A statistically significant reduction in wrinkle scores at 3 months was observed for both periorbital and perioral wrinkles using blinded grading. For periorbital treatments of four passes or more, over 90% had > or =1 score wrinkle reduction (0-9 scale) and 42% had > or =2. For perioral wrinkles, over 50% had substantial improvements (> or =2). The clinical observations and histology findings demonstrate that micro-fractional ablative treatment with 2,790 and 2,940 nm erbium lasers resulted in safe and effective wrinkle reduction with minimal patient downtime. The depth and width of the ablated microcolumns and varying extent of surrounding coagulation can be controlled and used to design new treatment procedures targeted for specific indications and areas such as moderate to severe rhytides and photodamaged skin.

Assessment of extent of skin involvement in scleroderma using shear wave elastography

Directory of Open Access Journals (Sweden)

Anupam Wakhlu

2017-01-01

Full Text Available Introduction: Scleroderma (systemic sclerosis [SSc] is a rare autoimmune disease which manifests as fibrosis in the skin and other internal organs. Conventionally, the modified Rodnan skin score (MRSS has been used to quantify the extent of skin fibrosis (resulting in skin tightness in SSc. This technique, although widely validated, is limited by the requirement of a trained, experienced assessor. Recent literature suggests that utilization of the objective ultrasound-based assessment of skin fibrosis utilizing shear wave elastography (SWE may be a more robust technique to detect early skin tightness in SSc. Methods: We evaluated the use of SWE (assessed by an experienced radiologist in 24 patients with SSc compared with 16 healthy controls. Results: Our patients were predominantly females, with median disease duration of 1.5 years and median MRSS of 17. There was minimal intraobserver variation in the assessment of SWE. Patients with SSc had higher SWE values (mean elasticity [Emean] compared to healthy controls at most assessed sites for the MRSS. The Emeancorrelated significantly at all sites with the MRSS scores. At the sites where MRSS was scored as 0 (normal, the Emeanin patients with SSc was higher when compared with similarly clinical normal skin in patients with SSc, suggesting potential early involvement of these areas of the skin with fibrosis. Conclusion: SWE is a promising tool to objectively assess skin fibrosis in SSc and may be useful in detecting early, subclinical skin involvement in this disease.

Infrared imaging of skin lesions

Science.gov (United States)

McIntosh, Laura M.; Mansfield, James R.; Jackson, Michael; Crowson, A. Neil; Mantsch, Henry H.

2002-02-01

IR spectroscopy produces spectra in which detailed information concerning chemical structure is inherent. Numerous studies have demonstrated that the most useful IR methods for analysis of biological tissues are microscopic image-based techniques in which fine-scaled spatial and high-quality spectral information is integrated. Unlike traditional visible microscopic methods, the contrast in IR imaging is gained by differences in spectra and the spatial heterogeneity of biochemical components, not by the addition of stains. In order for IR imaging to be more broadly accepted, non-subjective data processing methods are being developed to extract the most out of the large spectral images that are acquired. This paper demonstrates data processing techniques that have been extremely useful in the analysis of normal and abnormal skin. Analysis of skin specimens is of particular clinical importance due to the difficulty in rendering a differential diagnosis. Unstained frozen skin sections were mapped using an IR microscope. Functional group mapping, clustering routines and linear discriminant analysis were used to process the data. Functional group mapping and clustering routines were useful in the initial interpretation of images and to research for trends in uncharacterized spectral images. LDA was useful for differentiating normal from abnormal tissue once a well- defined training spectral set was established. Representative spectroscopic images are shown that demonstrate the power of IR imaging.

Skin manifestations of growth hormone-induced diseases.

Science.gov (United States)

Kanaka-Gantenbein, Christina; Kogia, Christina; Abdel-Naser, Mohamed Badawy; Chrousos, George P

2016-09-01

The human skin is a well-organized organ bearing different types of cells in a well-structured interference to each other including epidermal and follicular keratinocytes, sebocytes, melanocytes, dermal papilla cells and fibroblasts, endothelial cells, sweat gland cells as well as nerves. Several hormones act on different cell types of the skin, while it is also considered an endocrine organ secreting hormones that act at several sites of the organism. GH receptors are found in almost all cell types forming the skin, while IGF-1 receptors' expression is restricted to the epidermal keratinocytes. Both Growth Hormone (GH) excess, as in the case of Acromegaly in adults, or Gigantism in growing children, and GH deficiency states lead to skin manifestations. In case of GH excess the main dermatological findings are skin thickening, coarsening of facial features, acrochordons, puffy hands and feet, oily skin and hyperhidrosis, while GH deficiency, on the contrary, is characterized by thin, dry skin and disorder of normal sweating. Moreover, special disorders associated with GH excess may have specific characteristics, as is the case of café-au-lait spots in Neurofibromatosis, or big café-au-lait skin hyperpigmented regions with irregular margins, as is the case in McCune-Albright syndrome. Meticulous examination of the skin may therefore contribute to the final diagnosis in cases of GH-induced disorders.

[ROLE OF microRNA IN SKIN DEVELOPMENT AND WOUND HEALING].

Science.gov (United States)

Song, Zhifang; Liu, Dewu

2014-07-01

To review the role of microRNA (miRNA) in skin development and wound healing. The recent literature about miRNA in skin development and wound healing was reviewed and analyzed. miRNA extensively involved in the development of the skin, including epidermal cell proliferation, differentiation, aging and hair follicle development; miR-203 known as the "skin-specific miRNA" can directly inhibit the expression of p63 and promote the differentiation of the epidermis. Meanwhile, miRNA also involved in various stages of skin regeneration and wound healing. Abnormal expression of miRNA is closely related with abnormal wound healing. miRNA play an important role in maintaining normal skin physiology and skin regeneration. To explore their roles in the healing of skin wounds and their regulatory mechanism can provide a new target for the treatment, which has a potential value and broad prospects.

Radiation therapy in cancer patients with psoriasis. The fractionated daily dose and the Koebner phenomenon

International Nuclear Information System (INIS)

Ben-Yosef, Rami; Soyfer, Vyacheslav; Vexler, Akiva

2005-01-01

Skin side effects following XRT take place more often in patients with skin disorders. In this study six patients with psoriatic lesions were evaluated. The total/daily XRT dose to the tumor site was 50-70/1.8-2.0 Gy. No debilitating effect of XRT was observed in both the psoriatic lesions and in the surrounding normal skin

Clinical scoring and instrumental analysis to evaluate skin types.

Science.gov (United States)

Mercurio, D G; Segura, J H; Demets, M B A; Maia Campos, P M B G

2013-04-01

The biology of the skin is very complex, and there are a number of methods used to classify the different skin types. It is possible to measure or quantify the characteristics of the specific skin types, using a variety of techniques that can objectively evaluate the properties of the skin in a noninvasive manner. To clinically characterize different skin types by dermatological evaluation and biophysical and skin imaging techniques, and to evaluate the relationship between the different characteristics. The study recruited 26 volunteers. Clinical scoring was performed by a dermatologist who classified the volunteers' skin as normal or dry (group 1) and combination or oily (group 2). Objective measurements included skin microrelief, pH, oiliness, water content of the stratum corneum and transepidermal water loss (TEWL). Positive correlations were found between the level of skin oiliness and skin texture obtained from both instrumental analysis and clinical scoring. The combination and oily skin types had higher clinical scores for shine intensity, oiliness and tendency to pigmentation, and also had higher objective scores for sebum secretion, TEWL and roughness. Biophysical and skin imaging techniques are effective tools to help characterize skin type and assist in clinical dermatology. We found that different skin types had different characteristics related to skin microrelief, oiliness and TEWL, and therefore require specific dermatological treatments. © The Author(s) CED © 2013 British Association of Dermatologists.

Shining Light on Skin Pigmentation: The Darker and the Brighter Side of Effects of UV Radiation†

Science.gov (United States)

Maddodi, Nityanand; Jayanthy, Ashika; Setaluri, Vijayasaradhi

2012-01-01

The term barrier function as applied to human skin often connotes the physical properties of this organ that provide protection from its surrounding environment. This term does not generally include skin pigmentation. However, skin pigmentation, which is the result of melanin produced in melanocytes residing the basal layer of the skin and exported to the keratinocytes in the upper layers, serves equally important protective function. Indeed, changes in skin pigmentation are often the most readily recognized indicators of exposure of skin to damaging agents, especially to natural and artificial radiation in the environment. Several recent studies have shed new light on a) the mechanisms of involved in selective effects of subcomponents of UV radiation on human skin pigmentation and b) the interactive influences between keratinocytes and melanocytes, acting as ‘epidermal melanin unit’, that manifest as changes in skin pigmentation in response to exposure to various forms of radiation. This article provides a concise review of our current understanding of the effects of the non-ionizing solar radiation, at cellular and molecular levels, on human skin pigmentation. PMID:22404235

Effect of skin hydration on the dynamics of fingertip gripping contact.

Science.gov (United States)

André, T; Lévesque, V; Hayward, V; Lefèvre, P; Thonnard, J-L

2011-11-07

The dynamics of fingertip contact manifest themselves in the complex skin movements observed during the transition from a stuck state to a fully developed slip. While investigating this transition, we found that it depended on skin hydration. To quantify this dependency, we asked subjects to slide their index fingertip on a glass surface while keeping the normal component of the interaction force constant with the help of visual feedback. Skin deformation inside the contact region was imaged with an optical apparatus that allowed us to quantify the relative sizes of the slipping and sticking regions. The ratio of the stuck skin area to the total contact area decreased linearly from 1 to 0 when the tangential force component increased from 0 to a maximum. The slope of this relationship was inversely correlated to the normal force component. The skin hydration level dramatically affected the dynamics of the contact encapsulated in the course of evolution from sticking to slipping. The specific effect was to reduce the tendency of a contact to slip, regardless of the variations of the coefficient of friction. Since grips were more unstable under dry skin conditions, our results suggest that the nervous system responds to dry skin by exaggerated grip forces that cannot be simply explained by a change in the coefficient of friction.

Ultrastructure of elastosis in facial rhytidectomy skin

International Nuclear Information System (INIS)

Rudolph, R.; Woodward, M.

1981-01-01

Skin from 19 facial rhytidectomies performed in patients with chronic solar damage was compared with postauricular skin from patients of similar age. Light microscopy demonstrated large areas of amorphous material that stained PAS positive in all 19 face-lift specimens, while none of the controls had such material. Electron microscopy of the ''elastotic'' material revealed large amorphous masses of granular material, with loss of the microfilament component of normal elastin. Current theories suggest that the elastotic material in solar-damaged skin is a product of radiation-damaged fibroblasts, rather than being either collagen or degenerated elastin. Such knowledge may help the plastic surgeons encourage rhytidectomy patients to protect themselves from solar radiation

Reliability of skin testing as a measure of nutritional state

International Nuclear Information System (INIS)

Forse, R.A.; Christou, N.; Meakins, J.L.; MacLean, L.D.; Shizgal, H.M.

1981-01-01

The reliability of skin testing to assess the nutritional state was evaluated in 257 patients who received total parenteral nutrition (TPN). The nutritional state was assessed by determining body composition, by multiple-isotope dilution. Immunocompetence was simultaneously evaluated by skin testing with five recall antigens. These measurements were carried out before and at two-week intervals during TPN. A statistically significant relationship existed between the response to skin testing and the nutritional state. A body composition consistent with malnutrition was present in the anergic patients, while body composition was normal in the patients who reacted normally to skin testing. However, a considerable overlap existed as 43% of the reactive patients were malnourished, and 21% of the anergic patients were normally nourished. Thirty-seven (43%) of the 86 anergic patients converted and became reactive during TPN, and their body composition improved significantly. The remaining 49 anergic patients (57%) did not convert, and their body composition did not change despite similar nutritional support. The principal difference between the two groups of anergic patients was the nature of the therapy administered. In the anergic patients who converted, therapy was aggressive and appropriate, and clinical improvement occurred in 23 (62.2%) of the patients, with a mortality of 5.4%. In the 49 patients who remained anergic, therapy was often inappropriate or unsuccessful, with clinical improvement in only three (6.1%) of the patients and a mortality of 42.8%. The data demonstrated a significant relationship between the response to skin testing and the nutritional state. However, because of the wide overlap, skin testing does not accurately assess a person's nutritional state. The persistence of the anergic state is indicative of a lack of response to therapy

Ability of PABA to protect mammalian skin from ultraviolet light-induced skin tumors and actinic damage

International Nuclear Information System (INIS)

Snyder, D.S.; May, M.

1975-01-01

Application of 5% para-aminobenzoic acid (PABA) to hairless mice one hour prior to ultraviolet light (UVL) irradiation will almost totally protect these animals from developing tumors induced by chronic exposure to UVL in the 290 to 320 nm range in conjunction with a chemical carcinogen. Mice exposed to UVL and not protected by PABA developed primarily squamous cell carcinomas. Two months after cessation of chronic UVL exposure, the non-PABA-treated irradiated mouse skin appeared thickened, yellow, and wrinkled while showing elevated DNA synthesis, hyperplasia, hypergranulosis, and increased amounts of elastotic material. The PABA-treated skin was grossly normal

Pathological skin picking: case presentation and review of the literature

Directory of Open Access Journals (Sweden)

Maria Isabela Sarbu

2015-04-01

Full Text Available Pathological skin picking is a condition in which patients induce skin lesions through repetitive, compulsive excoriations of normal skin or skin with minor surface irregularities and they admit their role in the production of the lesions, but are unable to stop their behavior. Psychiatric comorbidities most often associated with skin picking include obsessive-compulsive disorder (OCD, anxiety disorders, mood disorders, body dysmorphic disorders, trichotillomania and compulsive-buying disorder. We report the case of a 17 year old female patient who addressed the dermatology department of our hospital with an eruption consisting of erythematous papules and plaques. The local examination revealed several clues of paramount importance in drawing the final conclusion and the psychiatric examination helped establish the diagnosis of pathological skin picking in a patient with obsessive-compulsive disorder.

Diversity of bacterial communities on the facial skin of different age-group Thai males

Directory of Open Access Journals (Sweden)

Alisa Wilantho

2017-11-01

Full Text Available Background Skin microbiome varies from person to person due to a combination of various factors, including age, biogeography, sex, cosmetics and genetics. Many skin disorders appear to be related to the resident microflora, yet databases of facial skin microbiome of many biogeographies, including Thai, are limited. Methods Metagenomics derived B-RISA and 16S rRNA gene sequencing was utilized to identify the culture-independent bacterial diversity on Thai male faces (cheek and forehead areas. Skin samples were categorized (grouped into (i normal (teenage.hea and (ii acne-prone (teenage.acn young adults, and normal (iii middle-aged (middle.hea and (iv elderly (elderly.hea adults. Results The 16S rRNA gene sequencing was successful as the sequencing depth had an estimated >98% genus coverage of the true community. The major diversity was found between the young and elderly adults in both cheek and forehead areas, followed by that between normal and acne young adults. Detection of representative characteristics indicated that bacteria from the order Rhizobiales, genera Sphingomonas and Pseudoalteromonas, distinguished the elderly.hea microbiota, along the clinical features of wrinkles and pores. Prediction of the metabolic potential revealed reduced metabolic pathways involved in replication and repair, nucleotide metabolism and genetic translation in the elderly.hea compared with that in the teenage.hea. For young adults, some unique compositions such as abundance of Propionibacterium acnes and Staphylococcus epidermidis, with a minor diversity between normal and acne skins, were detected. The metabolic potentials of the acne vs. normal young adults showed that teenage.acn was low in many cellular processes (e.g., cell motility and environmental adaptation, but high in carbohydrate metabolism, which could support acne growth. Moreover, comparison with the age-matched males from the US (Boulder, Colorado to gain insight into the diversity across

Diversity of bacterial communities on the facial skin of different age-group Thai males.

Science.gov (United States)

Wilantho, Alisa; Deekaew, Pamornya; Srisuttiyakorn, Chutika; Tongsima, Sissades; Somboonna, Naraporn

2017-01-01

Skin microbiome varies from person to person due to a combination of various factors, including age, biogeography, sex, cosmetics and genetics. Many skin disorders appear to be related to the resident microflora, yet databases of facial skin microbiome of many biogeographies, including Thai, are limited. Metagenomics derived B-RISA and 16S rRNA gene sequencing was utilized to identify the culture-independent bacterial diversity on Thai male faces (cheek and forehead areas). Skin samples were categorized (grouped) into (i) normal ( teenage.hea ) and (ii) acne-prone ( teenage.acn ) young adults, and normal (iii) middle-aged ( middle.hea ) and (iv) elderly ( elderly.hea ) adults. The 16S rRNA gene sequencing was successful as the sequencing depth had an estimated >98% genus coverage of the true community. The major diversity was found between the young and elderly adults in both cheek and forehead areas, followed by that between normal and acne young adults. Detection of representative characteristics indicated that bacteria from the order Rhizobiales, genera Sphingomonas and Pseudoalteromonas , distinguished the elderly.hea microbiota, along the clinical features of wrinkles and pores. Prediction of the metabolic potential revealed reduced metabolic pathways involved in replication and repair, nucleotide metabolism and genetic translation in the elderly.hea compared with that in the teenage.hea . For young adults, some unique compositions such as abundance of Propionibacterium acnes and Staphylococcus epidermidis , with a minor diversity between normal and acne skins, were detected. The metabolic potentials of the acne vs. normal young adults showed that teenage.acn was low in many cellular processes (e.g., cell motility and environmental adaptation), but high in carbohydrate metabolism, which could support acne growth. Moreover, comparison with the age-matched males from the US (Boulder, Colorado) to gain insight into the diversity across national biogeography

Cyclic peptides as potential therapeutic agents for skin disorders.

Science.gov (United States)

Namjoshi, Sarika; Benson, Heather A E

2010-01-01

There is an increasing understanding of the role of peptides in normal skin function and skin disease. With this knowledge, there is significant interest in the application of peptides as therapeutics in skin disease or as cosmeceuticals to enhance skin appearance. In particular, antimicrobial peptides and those involved in inflammatory processes provide options for the development of new therapeutic directions in chronic skin conditions such as psoriasis and dermatitis. To exploit their potential, it is essential that these peptides are delivered to their site of action in active form and in sufficient quantity to provide the desired effect. Many polymers permeate the skin poorly and are vulnerable to enzymatic degradation. Synthesis of cyclic peptide derivatives can substantially alter the physicochemical characteristics of the peptide with the potential to improve its skin permeation. In addition, cyclization can stabilize the peptide structure and thereby increase its stability. This review describes the role of cyclic peptides in the skin, examples of current cyclic peptide therapeutic products, and the potential for cyclic peptides as dermatological therapeutics and cosmeceuticals.

Human skin wetness perception: psychophysical and neurophysiological bases

Science.gov (United States)

Filingeri, Davide; Havenith, George

2015-01-01

The ability to perceive thermal changes in the surrounding environment is critical for survival. However, sensing temperature is not the only factor among the cutaneous sensations to contribute to thermoregulatory responses in humans. Sensing skin wetness (i.e. hygrosensation) is also critical both for behavioral and autonomic adaptations. Although much has been done to define the biophysical role of skin wetness in contributing to thermal homeostasis, little is known on the neurophysiological mechanisms underpinning the ability to sense skin wetness. Humans are not provided with skin humidity receptors (i.e., hygroreceptors) and psychophysical studies have identified potential sensory cues (i.e. thermal and mechanosensory) which could contribute to sensing wetness. Recently, a neurophysiological model of human wetness sensitivity has been developed. In helping clarifying the peripheral and central neural mechanisms involved in sensing skin wetness, this model has provided evidence for the existence of a specific human hygrosensation strategy, which is underpinned by perceptual learning via sensory experience. Remarkably, this strategy seems to be shared by other hygroreceptor-lacking animals. However, questions remain on whether these sensory mechanisms are underpinned by specific neuromolecular pathways in humans. Although the first study on human wetness perception dates back to more than 100 years, it is surprising that the neurophysiological bases of such an important sensory feature have only recently started to be unveiled. Hence, to provide an overview of the current knowledge on human hygrosensation, along with potential directions for future research, this review will examine the psychophysical and neurophysiological bases of human skin wetness perception. PMID:27227008

Vitamin E-deficiency did not exacerbate partial skin reactions in mice locally irradiated with X-rays

International Nuclear Information System (INIS)

Chi, C.; Hayashi, Daisuke; Nemoto, Masato; Nyui, Minako; Anzai, Kazunori; Urano, Shiro

2011-01-01

We previously showed that free radicals and oxidative stress are involved in radiation-induced skin reactions. Since vitamin E (VE) is a particularly important lipophilic antioxidant, VE-deficient mice were used to examine its effects on radiation-induced skin damage. The VE content of the skin was reduced to one fourth of levels of normal mice. Neither the time of onset nor the extent of the reactions quantified with a scoring system differed between normal and VE-deficient mice after local X-irradiation (50 Gy). Similarly, there was no difference in the levels of the ascorbyl radical between the groups, although they were higher in irradiated skin than non-irradiated skin. X-irradiation increased the amount of Bax protein in the skin of normal mice both in the latent and acute inflammatory stages, time- and dose-dependently. The increase was associated with an increase in cytochrome c in the cytosolic fraction, indicating that apoptosis was also promoted by the irradiation. The increase in Bax protein correlated well with the thickness of the skin. Although a deficiency in VE should lower resistance to free radicals in the mitochondrial membrane and thus enhance radiation-induced Bax expression and apoptosis, it actually attenuated the increase in Bax protein caused by irradiation. (author)

Can thermal lasers promote skin wound healing?

Science.gov (United States)

Capon, Alexandre; Mordon, Serge

2003-01-01

Lasers are now widely used for treating numerous cutaneous lesions, for scar revision (hypertrophic and keloid scars), for tissue welding, and for skin resurfacing and remodeling (wrinkle removal). In these procedures lasers are used to generate heat. The modulation of the effect (volatilization, coagulation, hyperthermia) of the laser is obtained by using different wavelengths and laser parameters. The heat source obtained by conversion of light into heat can be very superficial, yet intense, if the laser light is well absorbed (far-infrared:CO(2) or Erbium:Yttrium Aluminum Garnet [Er:YAG] lasers), or it can be much deeper and less intense if the laser light is less absorbed by the skin (visible or near-infrared). Lasers transfer energy, in the form of heat, to surrounding tissues and, regardless of the laser used, a 45-50 degrees C temperature gradient will be obtained in the surrounding skin. If a wound healing process exists, it is a result of live cells reacting to this low temperature increase. The generated supraphysiologic level of heat is able to induce a heat shock response (HSR), which can be defined as the temporary changes in cellular metabolism. These changes are rapid and transient, and are characterized by the production of a small family of proteins termed the heat shock proteins (HSP). Recent experimental studies have clearly demonstrated that HSP 70, which is over-expressed following laser irradiation, could play a role with a coordinated expression of other growth factors such as transforming growth factor (TGF)-beta. TGF-beta is known to be a key element in the inflammatory response and the fibrogenic process. In this process, the fibroblasts are the key cells since they produce collagen and extracellular matrix. In conclusion, the analysis of the literature, and the fundamental considerations concerning the healing process when using thermal lasers, are in favor of a modification of the growth factors synthesis after laser irradiation, induced

In vivo determination of optical properties and fluorophore characteristics of non-melanoma skin cancer

Science.gov (United States)

Rajaram, Narasimhan; Kovacic, Dianne; Migden, Michael F.; Reichenberg, Jason S.; Nguyen, Tri H.; Tunnell, James W.

2009-02-01

Diffuse optical spectroscopy (DOS) and laser-induced fluorescence (LIF) techniques have widely been used as noninvasive tools for early cancer detection in several organs including the cervix, oral cavity and gastrointestinal tract. Using a combined DOS/LIF approach, one can simultaneously measure the morphology and biochemical composition of tissue and use these features to diagnose malignancy. We report for the first time to our knowledge both the optical properties and native fluorophore characteristics of non-melanoma skin cancer in the UV-visible range. We collected in vivo diffuse reflectance and intrinsic fluorescence measurements from 44 skin lesions on 37 patients. The skin sites were further categorized into three groups of non-melanoma skin cancer according to histopathology: 1) pre-cancerous actinic keratosis 2) malignant squamous cell carcinoma (SCC) and 3) basal cell carcinoma (BCC). We used a custom-built probe-based clinical system that collects both white light reflectance and laser-induced fluorescence in the wavelength range of 350-700 nm. We extracted the blood volume fraction, oxygen saturation, blood vessel size, tissue microarchitecture and melanin content from diffuse reflectance measurements. In addition, we determined the native fluorophore contributions of NADH, collagen and FAD from laser-induced fluorescence for all groups. The scattering from tissue decreased with progression from clinically normal to precancerous actinic keratosis to malignant SCC. A similar trend was observed for clinically normal skin and malignant BCC. Statistically significant differences were observed in the collagen contributions, which were lower in malignant SCC and BCC as compared to normal skin. Our data demonstrates that the mean optical properties and fluorophore contributions of normal, benign and malignant nonmelanoma cancers are significantly different from each other and can potentially be used as biomarkers for the early detection of skin cancer.

Hydroquinone neuropathy following use of skin bleaching creams: case report.

Science.gov (United States)

Karamagi, C; Owino, E; Katabira, E T

2001-04-01

A 30-year old black woman presented with gradual onset of weakness of the legs associated with burning sensation in the feet for two months. She had been using two hydroquinone based skin bleaching creams (MGC by M. G. C. International, MEKAKO by Anglo Fabrics BOLTON Ltd) for about four years. Her BP was 80/40 mm Hg supine with un-recordable diastolic pressure on standing. She had decreased power (Grade 3/5), loss of deep tendon reflexes and impairment of deep sensation in the lower limbs. A complete blood count, urinalysis, serum electrolytes, serum creatinine and uric acid were all normal. Oral GTT, VDRL and brucella tests were negative. Chest and abdominal radiographs did not show any abnormalities. A diagnosis of peripheral neuropathy with autonomic neuropathy possibly due to hydroquinone toxicity was made and she was advised to stop using hydroquinone based skin bleaching creams. Four months later she was asymptomatic, her BP was 120/80 mmHg supine and standing, and neurological examination was normal. The case raises the question of whether hydroquinone based skin bleaching creams could be a cause of peripheral neuropathy and underscores the need for research on hydroquinone based skin bleaching creams and neuropathy particularly in black women involved in the sale and/or use of skin bleaching creams.

Ultraviolet-laser ablation of skin

Energy Technology Data Exchange (ETDEWEB)

Lane, R.J.; Linsker, R.; Wynne, J.J.; Torres, A.; Geronemus, R.G.

1985-05-01

The authors report on the use of pulsed ultraviolet-laser irradiation at 193 nm from an argon-fluoride laser and at 248 nm from a krypton-fluoride laser to ablate skin. In vitro, both wavelengths performed comparably, removing tissue precisely and cleanly, and leaving minimal thermal damage to the surrounding tissue. In vivo, the 193-nm laser radiation failed to remove tissue after bleeding began. The 248-nm radiation, however, continued to remove tissue despite bleeding and left a clean incision with only minimal thermal damage. The krypton-fluoride excimer laser beam at 248 nm, which should be deliverable through a quartz optical fiber, has great potential as a surgical instrument.

Piezoresistive pressure sensor array for robotic skin

Science.gov (United States)

Mirza, Fahad; Sahasrabuddhe, Ritvij R.; Baptist, Joshua R.; Wijesundara, Muthu B. J.; Lee, Woo H.; Popa, Dan O.

2016-05-01

Robots are starting to transition from the confines of the manufacturing floor to homes, schools, hospitals, and highly dynamic environments. As, a result, it is impossible to foresee all the probable operational situations of robots, and preprogram the robot behavior in those situations. Among human-robot interaction technologies, haptic communication is an intuitive physical interaction method that can help define operational behaviors for robots cooperating with humans. Multimodal robotic skin with distributed sensors can help robots increase perception capabilities of their surrounding environments. Electro-Hydro-Dynamic (EHD) printing is a flexible multi-modal sensor fabrication method because of its direct printing capability of a wide range of materials onto substrates with non-uniform topographies. In past work we designed interdigitated comb electrodes as a sensing element and printed piezoresistive strain sensors using customized EHD printable PEDOT:PSS based inks. We formulated a PEDOT:PSS derivative ink, by mixing PEDOT:PSS and DMSO. Bending induced characterization tests of prototyped sensors showed high sensitivity and sufficient stability. In this paper, we describe SkinCells, robot skin sensor arrays integrated with electronic modules. 4x4 EHD-printed arrays of strain sensors was packaged onto Kapton sheets and silicone encapsulant and interconnected to a custom electronic module that consists of a microcontroller, Wheatstone bridge with adjustable digital potentiometer, multiplexer, and serial communication unit. Thus, SkinCell's electronics can be used for signal acquisition, conditioning, and networking between sensor modules. Several SkinCells were loaded with controlled pressure, temperature and humidity testing apparatuses, and testing results are reported in this paper.

Eyelid skin as a potential site for drug delivery to conjunctiva and ocular tissues.

Science.gov (United States)

See, Gerard Lee; Sagesaka, Ayano; Sugasawa, Satoko; Todo, Hiroaki; Sugibayashi, Kenji

2017-11-25

The feasibility of topical application onto the (lower) eyelid skin to deliver hydrophilic and lipophilic compounds into the conjunctiva and ocular tissues was evaluated by comparing with conventional eye drop application. Skin permeation and the concentration of several model compounds, and skin impedance were determined utilizing eyelid skin from hairless rats, as well as abdominal skin in the same animals for comparison. In vitro static diffusion cells were used to assess the skin permeation in order to provide key insights into the relationship between the skin sites and drugs. The obtained results revealed that drug permeation through the eyelid skin was much higher than that through abdominal skin regardless of the drug lipophilicity. Specifically, diclofenac sodium salt and tranilast exhibited approximately 6-fold and 11-fold higher permeability coefficients, respectively, through eyelid skin compared with abdominal skin. Histomorphological evaluation and in vivo distribution of model fluorescent dyes were also examined in the conjunctiva and skin after eyelid administration by conventional microscope and confocal laser scanning microscope analyses. The result revealed that eyelid skin has a thinner stratum corneum, thereby showing lower impedance, which could be the reason for the higher drug permeation through eyelid skin. Comparative evaluation of lipophilic and hydrophilic model compounds administered via the eyelid skin over 8h revealed stronger fluorescence intensity in the skin and surrounding tissues compared with eye drop administration. These results suggested that the (lower) eyelid skin is valuable as a prospective site for ophthalmic medicines. Copyright © 2017 Elsevier B.V. All rights reserved.

Aging and senescence of skin cells in culture

DEFF Research Database (Denmark)

Rattan, Suresh

2015-01-01

Studying age-related changes in the physiology, biochemistry, and molecular biology of isolated skin cell populations in culture has greatly expanded the understanding of the fundamental aspects of skin aging. The three main cell types that have been studied extensively with respect to cellular...... aging in vitro are dermal fibroblasts, epidermal keratinocytes, and melanocytes. Serial subcultivation of normal diploid skin cells can be performed only a limited number of times, and the emerging senescent phenotype can be categorized into structural, physiological, biochemical, and molecular...... phenotypes, which can be used as biomarkers of cellular aging in vitro. The rate and phenotype of aging are different in different cell types. There are both common features and specific features of aging of skin fibroblasts, keratinocytes, melanocytes, and other cell types. A progressive accumulation...

One-sheet spiraling full thickness skin graft for penile resurfacing after paraffinoma excision

Directory of Open Access Journals (Sweden)

Theddeus O.H. Prasetyono

2011-08-01

Full Text Available In the midst of on-going non-illicit practice of silicone or paraffin injection to enlarge penis, the author reported 3 cases of surgical treatment to resurface the body of the penis after excision of the destructed penile skin using full thickness skin graft. The skin excision was performed technically through penile body degloving procedure. Full thickness skin graft was then applied as a single sheet donor tissue to cover the denuded penile body spirally. The full thickness graft, which is relatively easy to be performed, is no doubt much thinner than a skin flap, while it also bears a smaller degree of secondary contraction than split skin graft. The color of the skin is considerably matched as it comes from the groin, which is a nearby area of penis. The size and skin sensitization of the penis looks to be natural. The only disadvantage is the common possibility of either spiral or circular junctional scar in between graft edges and between the graft and the penile mucosa and skin to develop hypertrophic scar. However, this possible scar problem applies also to any other surgical scar with any donor tissue. Fortunately, the 3 cases posed no scar problem and normal appearance. All the patients have also regained their normal sexual function. (Med J Indones 2011; 20:222-5Keywords: full thickness skin graft, paraffinoma, siliconoma, sexual function

Transport Pathways and Enhancement Mechanisms within Localized and Non-Localized Transport Regions in Skin Treated with Low-Frequency Sonophoresis and Sodium Lauryl Sulfate

OpenAIRE

Polat, Baris E.; Figueroa, Pedro L.; Blankschtein, Daniel; Langer, Robert

2010-01-01

Recent advances in transdermal drug delivery utilizing low-frequency sonophoresis (LFS) and sodium lauryl sulfate (SLS) have revealed that skin permeability enhancement is not homogenous across the skin surface. Instead, highly perturbed skin regions, known as localized transport regions (LTRs), exist. Despite these findings, little research has been conducted to identify intrinsic properties and formation mechanisms of LTRs and the surrounding less-perturbed non-LTRs. By independently analyz...

Preliminary experiments on quantification of skin condition

Science.gov (United States)

Kitajima, Kenzo; Iyatomi, Hitoshi

2014-03-01

In this study, we investigated a preliminary assessment method for skin conditions such as a moisturizing property and its fineness of the skin with an image analysis only. We captured a facial images from volunteer subjects aged between 30s and 60s by Pocket Micro (R) device (Scalar Co., Japan). This device has two image capturing modes; the normal mode and the non-reflection mode with the aid of the equipped polarization filter. We captured skin images from a total of 68 spots from subjects' face using both modes (i.e. total of 136 skin images). The moisture-retaining property of the skin and subjective evaluation score of the skin fineness in 5-point scale for each case were also obtained in advance as a gold standard (their mean and SD were 35.15 +/- 3.22 (μS) and 3.45 +/- 1.17, respectively). We extracted a total of 107 image features from each image and built linear regression models for estimating abovementioned criteria with a stepwise feature selection. The developed model for estimating the skin moisture achieved the MSE of 1.92 (μS) with 6 selected parameters, while the model for skin fineness achieved that of 0.51 scales with 7 parameters under the leave-one-out cross validation. We confirmed the developed models predicted the moisture-retaining property and fineness of the skin appropriately with only captured image.

Skin signs in Ehlers-Danlos syndrome: clinical tests and para-clinical methods

DEFF Research Database (Denmark)

Remvig, Lars; Duhn, Ph; Ullman, S

2010-01-01

Objective: The criteria for Ehlers-Danlos syndrome (EDS) and the hypermobility syndrome (HMS) should be reliable. Examination for general joint hypermobility has high reliability but there is only sparse information on the reliability of skin tests, and no information on the level of normal skin...

Skin signs in Ehlers-Danlos syndrome: clinical tests and para-clinical methods

DEFF Research Database (Denmark)

Remvig, L; Duhn, Ph; Ullman, S

2010-01-01

The criteria for Ehlers-Danlos syndrome (EDS) and the hypermobility syndrome (HMS) should be reliable. Examination for general joint hypermobility has high reliability but there is only sparse information on the reliability of skin tests, and no information on the level of normal skin extensibility...

Protection against UVB-induced oxidative stress in human skin cells and skin models by methionine sulfoxide reductase A.

Science.gov (United States)

Pelle, Edward; Maes, Daniel; Huang, Xi; Frenkel, Krystyna; Pernodet, Nadine; Yarosh, Daniel B; Zhang, Qi

2012-01-01

Environmental trauma to human skin can lead to oxidative damage of proteins and affect their activity and structure. When methionine becomes oxidized to its sulfoxide form, methionine sulfoxide reductase A (MSRA) reduces it back to methionine. We report here the increase in MSRA in normal human epidermal keratinocytes (NHEK) after ultraviolet B (UVB) radiation, as well as the reduction in hydrogen peroxide levels in NHEK pre-treated with MSRA after exposure. Further, when NHEK were pre-treated with a non-cytotoxic pentapeptide containing methionine sulfoxide (metSO), MSRA expression increased by 18.2%. Additionally, when the media of skin models were supplemented with the metSO pentapeptide and then exposed to UVB, a 31.1% reduction in sunburn cells was evident. We conclude that the presence of MSRA or an externally applied peptide reduces oxidative damage in NHEK and skin models and that MSRA contributes to the protection of proteins against UVB-induced damage in skin.

Experimental studies on the radiation-modifying effect of bleomycin in malignant and normal mouse tissue in vivo

International Nuclear Information System (INIS)

Molin, J.; Sogaard, P.E.; Overgaard, J.

1981-01-01

The interaction between bleomycin (BLM) and radiation was studied in a C3H mammary carcinoma and its surrounding normal skin. In the skin, single and fractionated doses of sequential treatment with BLM (25 mg/kg) 24 hours prior to radiation therapy did not influence the response to irradiation, whereas simultaneous treatment with BLM given 15 minutes before radiation therapy enhanced the reaction to irradiation by a factor of 1.2 or 1.4 following treatment with one fraction or five fractions, respectively. The tumor response to irradiation was not influenced by a single sequential treatment, but five daily fractions of radiation therapy following five daily dose fractions of BLM increased the radiation dose needed to control 50% of the tumors, probably because the tumors continued to grow during the BLM treatment. Simultaneous treatment enhanced the response to irradiation by a factor of 1.2 after both single-dose and fractionated therapy. Based on these data it was concluded that none of the combined treatment schedules were able to produce a better therapeutic effect than radiation therapy alone. Furthermore, mortality due to lung fibrosis in mice treated with BLM indicated the marked toxicity of the drug. This toxicity was most pronounced after fractionated treatment and when radiation therapy and BLM were given simultaneously

Analysis of assistance procedures to normal birth in primiparous

Directory of Open Access Journals (Sweden)

Joe Luiz Vieira Garcia Novo

2016-04-01

Full Text Available Introduction: Current medical technologies in care in birth increased maternal and fetal benefits persist, despite numerous unnecessary procedures. The purpose of the normal childbirth care is to have healthy women and newborns, using a minimum of safe interventions. Objective: To analyze the assistance to normal delivery in secondary care maternity. Methodology: A total of 100 primiparous mothers who had vaginal delivery were included, in which care practices used were categorized: 1 according to the WHO classification for assistance to normal childbirth: effective, harmful, used with caution and used inappropriately; 2 associating calculations with the Bologna Index parameters: presence of a birth partner, partograph, no stimulation of labor, delivery in non-supine position, and mother-newborn skin-to-skin contact. Results: Birth partners (85%, correctly filled partographs (62%, mother-newborn skin-to-skin contact (36%, use of oxytocin (87%, use of parenteral nutrition during labor (86% and at delivery (74%, episiotomy (94% and uterine fundal pressure in the expulsion stage (58%. The overall average value of the Bologna Index of the mothers analyzed was 1.95. Conclusions: Some effective procedures recommended by WHO (presence of a birth partner, some effective and mandatory practices were not complied with (partograph completely filled, potentially harmful or ineffective procedures were used (oxytocin in labor/post-partum, as well as inadequate procedures (uterine fundal pressure during the expulsion stage, use of forceps and episiotomy. The maternity’s care model did not offer excellence procedures in natural birth to their mothers in primiparity, (BI=1.95.

Novel biodegradable porous scaffold applied to skin regeneration.

Science.gov (United States)

Wang, Hui-Min; Chou, Yi-Ting; Wen, Zhi-Hong; Wang, Chau-Zen; Wang, Zhao-Ren; Chen, Chun-Hong; Ho, Mei-Ling

2013-01-01

Skin wound healing is an important lifesaving issue for massive lesions. A novel porous scaffold with collagen, hyaluronic acid and gelatin was developed for skin wound repair. The swelling ratio of this developed scaffold was assayed by water absorption capacity and showed a value of over 20 g water/g dried scaffold. The scaffold was then degraded in time- and dose-dependent manners by three enzymes: lysozyme, hyaluronidase and collagenase I. The average pore diameter of the scaffold was 132.5±8.4 µm measured from SEM images. With human skin cells growing for 7 days, the SEM images showed surface fractures on the scaffold due to enzymatic digestion, indicating the biodegradable properties of this scaffold. To simulate skin distribution, the human epidermal keratinocytes, melanocytes and dermal fibroblasts were seeded on the porous scaffold and the cross-section immunofluorescent staining demonstrated normal human skin layer distributions. The collagen amount was also quantified after skin cells seeding and presented an amount 50% higher than those seeded on culture wells. The in vivo histological results showed that the scaffold ameliorated wound healing, including decreasing neutrophil infiltrates and thickening newly generated skin compared to the group without treatments.

Novel biodegradable porous scaffold applied to skin regeneration.

Directory of Open Access Journals (Sweden)

Hui-Min Wang

Full Text Available Skin wound healing is an important lifesaving issue for massive lesions. A novel porous scaffold with collagen, hyaluronic acid and gelatin was developed for skin wound repair. The swelling ratio of this developed scaffold was assayed by water absorption capacity and showed a value of over 20 g water/g dried scaffold. The scaffold was then degraded in time- and dose-dependent manners by three enzymes: lysozyme, hyaluronidase and collagenase I. The average pore diameter of the scaffold was 132.5±8.4 µm measured from SEM images. With human skin cells growing for 7 days, the SEM images showed surface fractures on the scaffold due to enzymatic digestion, indicating the biodegradable properties of this scaffold. To simulate skin distribution, the human epidermal keratinocytes, melanocytes and dermal fibroblasts were seeded on the porous scaffold and the cross-section immunofluorescent staining demonstrated normal human skin layer distributions. The collagen amount was also quantified after skin cells seeding and presented an amount 50% higher than those seeded on culture wells. The in vivo histological results showed that the scaffold ameliorated wound healing, including decreasing neutrophil infiltrates and thickening newly generated skin compared to the group without treatments.

EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA); Scientific Opinion on the substantiation of health claims related to astaxanthin and protection of the skin from UV-induced damage (ID 1687, 1979), defence against Helicobacter pylori (ID 1686), contribution to normal spermatogenesis

DEFF Research Database (Denmark)

Tetens, Inge

claims in relation to astaxanthin and protection of the skin from UV-induced damage, defence against Helicobacter pylori, contribution to normal spermatogenesis, contribution to normal muscle function, and “immune system”. The scientific substantiation is based on the information provided by the Member...

Traumatic degloving lesion of penile and scrotal skin

Directory of Open Access Journals (Sweden)

Luiz A. Zanettini

2005-06-01

Full Text Available Avulsions of penile and scrotal skin are uncommon events and are caused mainly by accidents with industrial machines and agricultural machine belts. We report the case of a 30-year old patient with avulsion and traumatic degloving of the penile and scrotal skin, with exposure of the cavernous bodies, spongy body, and testes due to an industrial machine accident. Reconstruction was performed in steps, achieving a satisfactory esthetic result, normal voiding and reestablished sexual function.

Impact of overweight on the normal physiology of human in vivo skin

Directory of Open Access Journals (Sweden)

Liliana Tavares

2013-06-01

Full Text Available Obesity is an increasing public health issue, particularly in Portugal, where more than 50% of the population is obese. The pathophysiological consequences of being overweight have a severe cutaneous impact. However, there is still a lack of studies to link these alterations to BMI categories. This present work intends to identify the hydration and biomechanical behaviour changes related to weight augmentation. This transversal study was performed on a convenience sample of 57 volunteers, all females, aged between 20 and 46 (30±8 years old. Volunteers were divided in two groups – group I, with a BMI between 19,9 and 24,9 Kg/m2 and group II, between 25 and 29,9 Kg/m2. One single determination of the superficial hydration, transepidermal water loss and biomechanical behaviour of the skin, was obtained with non-invasive methods. The data showed that weight increase positively influences hydration levels and transepidermal water loss, and negatively influences the skin's biomechanical behaviour. Despite the relevance of these results, there is still a need for complementary studies, with a wider number of individuals, in order to better understand its nature and meaning.

PREPARATIVE SKIN PREPARATION AND SURGICAL WOUND INFECTION

Directory of Open Access Journals (Sweden)

Anjanappa

2015-01-01

Full Text Available BACKGROUND AND OBJECTIVE: It is an established fact now that the normal skin of healthy human beings harbours a rich bacterial fl ora. Normally considered non - pathogenic , these organisms way be a potential source of infection of the surgical wound. Approximately 20% of the resident flora is beyond the reach of surgical scrubs and antiseptics. The goal of surgical preparation of the skin with antiseptics is to remove transient and pathogenic microorganisms on the skin surface and to reduce the resident flora to a low level. Povidone iodine (I odophors and chlorhexidine are most often used antiseptics for pre - operative skin preparation. OBJECTIVES : To evaluate the efficacy of povidone iodine alone and in combination with antiseptic agent containing alcoholic chlorhexidine in preoperative skin p reparation by taking swab culture. (2 To compare the rate of postoperative wound infection in both the groups. METHODS: One hundred patients (fifty in each group undergoing clean elective surgery with no focus of infection on the body were included in th e study. The pre - operative skin preparation in each group is done with the respective antiseptic regimen. In both the groups after application of antiseptics , sterile saline swab culture was taken immediately from site of incision. In cases which showed gr owth of organisms , the bacteria isolated were identified by their morphological and cultural characteristics. Grams staining , coagulase test and antibiotic sensitivity test were done wherever necessary and difference in colonization rates was determined as a measure of efficacy of antiseptic regimen. RESULTS: The results of the study showed that when compared to povidone iodine alone , using a combination of povidone iodine and alcoholic solution of chlorhexidine , the colonization rates of the site of incisi on were reduced significantly. As for the rate of post - operative wound infection , it is also proven that wound infections are also

Focal skin defect, limb anomalies and microphthalmia.

NARCIS (Netherlands)

Jackson, K.E.; Andersson, H.C.

2004-01-01

We describe two unrelated female patients with congenital single focal skin defects, unilateral microphthalmia and limb anomalies. Growth and psychomotor development were normal and no brain malformation was detected. Although eye and limb anomalies are commonly associated, clinical anophthalmia and

Visualization of dermal alteration in skin lesions with discoid lupus erythematosus by multiphoton microscopy

International Nuclear Information System (INIS)

Lin, L H; Yu, H B; Zhu, X Q; Zhuo, S M; Chen, J X; Wang, Y Y; Yang, Y H

2013-01-01

Discoid lupus erythematosus (DLE) is a chronic dermatological disease which lacks valid methods for early diagnosis and therapeutic monitoring. Considering the collagen and elastin disorder due to mucin deposition of DLE, multiphoton microscopy (MPM) imaging techniques were employed to obtain high-resolution collagen and elastin images from the dermis. The content and distribution of collagen and elastin were quantified to characterize the dermal pathological status of skin lesions with DLE in comparison with normal skin. Our results showed a significant difference between skin lesions with DLE and normal skin in terms of the morphological structure of collagen and elastin in the dermis, demonstrating the possibility of MPM for noninvasively tracking the pathological process of DLE even in its early stages and evaluating the therapeutic efficacy at the molecular level. (paper)

Calibration of thermoluminescence skin dosemeter response to beta emitters found in Ontario Hydro nuclear power stations

International Nuclear Information System (INIS)

Walsh, M.L.; Agnew, D.A.; Donnelly, K.E.

1984-01-01

The response of the Ontario Hydro Thermoluminescence Dosimetry System to beta radiation in nuclear power station environments was evaluated. Synthetic beta spectra were constructed, based on activity samples from heat transport systems and fuelling machine contamination smears at nuclear power stations. Using these spectra and dosemeter energy response functions, an overall response factor for the skin dosemeter relative to skin dose at 7 mg.cm -2 was calculated. This calculation was done assuming three specific geometries: (1) an infinite uniformly contaminated plane source at a distance of 33 cm (50 mg.cm -2 total shielding) from the receptor; (2) an infinite cloud surrounding the receptor; (3) a point source at 33 cm. Based on these calculations, a conservative response factor of 0.7 has been chosen. This provides an equation for skin dose assignment, i.e. Skin Dose = 1.4 x Skin Dosemeter Reading when the skin dosemeter is directly calibrated in mGy(gamma). (author)

Reduced lymphoid response to skin allotransplants in cows with hepatic lipidosis.

Science.gov (United States)

Wentink, G H; van den Ingh, T S; Rutten, V P; Müller, K E; Wensing, T

1999-04-01

The immune responsiveness of cows with hepatic lipidosis (fatty liver) in comparison to control cows with a normal liver fat content was tested by applying skin allotransplants to the skin of the back of cows on day 3 after parturition. Immunoreactivity was determined by semiquantitative counting of the number of infiltrating lymphocytes in the recipient skin adjacent to the allotransplants during a period of 21 days. There were more invading lymphocytes in samples from control cows than there were in samples from cows with hepatic lipidosis. It was concluded that cows with hepatic lipidosis have a reduced lymphoid response to skin allotransplants.

Steroid synthesis by primary human keratinocytes; implications for skin disease

Energy Technology Data Exchange (ETDEWEB)

Hannen, Rosalind F., E-mail: r.f.hannen@qmul.ac.uk [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Michael, Anthony E. [Centre for Developmental and Endocrine Signalling, Academic Section of Obstetrics and Gynaecology, Division of Clinical Developmental Sciences, 3rd Floor, Lanesborough Wing, St. George' s, University of London, Cranmer Terrace, Tooting, London SW17 0RE (United Kingdom); Jaulim, Adil [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Bhogal, Ranjit [Life Science, Unilever R and D Colworth House, Sharnbrook, Bedfordshire MK44 1LQ (United Kingdom); Burrin, Jacky M. [Centre for Endocrinology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London EC1M 6BQ (United Kingdom); Philpott, Michael P. [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom)

2011-01-07

Research highlights: {yields} Primary keratinocytes express the steroid enzymes required for cortisol synthesis. {yields} Normal primary human keratinocytes can synthesise cortisol. {yields} Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. {yields} StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3{beta}HSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7-{sup 3}H]-pregnenolone through each steroid intermediate to [7-{sup 3}H]-cortisol in cultured PHK. Trilostane (a 3{beta}HSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data

Steroid synthesis by primary human keratinocytes; implications for skin disease

International Nuclear Information System (INIS)

Hannen, Rosalind F.; Michael, Anthony E.; Jaulim, Adil; Bhogal, Ranjit; Burrin, Jacky M.; Philpott, Michael P.

2011-01-01

Research highlights: → Primary keratinocytes express the steroid enzymes required for cortisol synthesis. → Normal primary human keratinocytes can synthesise cortisol. → Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. → StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3βHSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7- 3 H]-pregnenolone through each steroid intermediate to [7- 3 H]-cortisol in cultured PHK. Trilostane (a 3βHSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data show that PHK are capable of extra

"Ser diferente é normal?"/"Being different: is it normal?"

Directory of Open Access Journals (Sweden)

Viviane Veras

2007-01-01

Full Text Available A pergunta título deste trabalho retoma o slogan “Ser diferente é normal”, que é parte da campanha criada para uma organização não-governamental que atende portadores de Síndrome de Down. O objetivo é a inclusão social da pessoa com deficiência e o primeiro passo foi propor a inclusão de um grupo de diferentes no grupo dito normal. No vídeo de lançamento da campanha, o diferente, identificado como normal, é mostrado por meio de exemplos – um negro com cabelo black-power, um skin-head, um corpo tatuado, um corpo feminino halterofílico, uma família hippie, uma garota com síndrome de Down. A visão da adolescente dançando reduz, de certo modo, o efeito imaginário que vai além da síndrome, uma vez que apenas o corpo com seus olhinhos puxados se destacam, e não se interrogam questões cognitivas. Minha proposta é refletir sobre o estatuto paradoxal do exemplo, tal como é trabalhado nesse vídeo: se, por definição, um exemplo mostra de fato seu pertencimento a uma classe, pode-se concluir que é exatamente por ser exemplar que ele se encontra fora dela, no exato momento em que a exibe e define. The question in the title of this paper refers to the slogan "ser diferente é normal" ("It´s normal to be different", which is part of a campaign created for a NGO that supports people with Down syndrome. The objective of the campaign is to promote the social inclusion of individuals with Down syndrome, and the first step was to propose the inclusion of a group of "differents" in the so-called normal group. The film launching the campaign shows the different identified as normal by means of examples: a black man exhibiting blackpower haircut, a skin-head, a tattooed body, an over-athletic female body, a hippie family and a girl with Down syndrome. The vision of the dancing teenager lessens the imaginary effect that surpasses the syndrome, since only her body and her little oriental eyes stand out and no cognitive issues are

Tailoring force sensitivity and selectivity by microstructure engineering of multidirectional electronic skins

Science.gov (United States)

Park, Jonghwa; Kim, Jinyoung; Hong, Jaehyung; Lee, Hochan; Lee, Youngoh; Cho, Seungse; Kim, Sung-Woo; Kim, Jae Joon; Kim, Sung Youb; Ko, Hyunhyub

2018-04-01

Electronic skins (e-skins) with high sensitivity to multidirectional mechanical stimuli are crucial for healthcare monitoring devices, robotics, and wearable sensors. In this study, we present piezoresistive e-skins with tunable force sensitivity and selectivity to multidirectional forces through the engineered microstructure geometries (i.e., dome, pyramid, and pillar). Depending on the microstructure geometry, distinct variations in contact area and localized stress distribution are observed under different mechanical forces (i.e., normal, shear, stretching, and bending), which critically affect the force sensitivity, selectivity, response/relaxation time, and mechanical stability of e-skins. Microdome structures present the best force sensitivities for normal, tensile, and bending stresses. In particular, microdome structures exhibit extremely high pressure sensitivities over broad pressure ranges (47,062 kPa-1 in the range of <1 kPa, 90,657 kPa-1 in the range of 1-10 kPa, and 30,214 kPa-1 in the range of 10-26 kPa). On the other hand, for shear stress, micropillar structures exhibit the highest sensitivity. As proof-of-concept applications in healthcare monitoring devices, we show that our e-skins can precisely monitor acoustic waves, breathing, and human artery/carotid pulse pressures. Unveiling the relationship between the microstructure geometry of e-skins and their sensing capability would provide a platform for future development of high-performance microstructured e-skins.

Evaluation of dose to skin surface contamination in the factory Juzbado of fuel elements

International Nuclear Information System (INIS)

Ortiz Trujillo, D.; Agustin Perez Fonseca, A.; Alejandro Fuentes, A.

2013-01-01

The aim of this work is previously set a simple calculation methodology applicable to the boundary conditions surrounding the environment where skin contamination may have occurred so that you can evaluate in a simple and fast way the dose that the worker is receiving while enduring such pollution. (Author)

Normal tissue tolerance to external beam radiation therapy: Skin; Dose de tolerance des tissus sains: la peau et les phaneres

Energy Technology Data Exchange (ETDEWEB)

Ginot, A.; Doyen, J.; Hannoun-Levi, J.M.; Courdi, A. [Service d' oncologie-radiotherapie, centre Antoine-Lacassagne, 06 - Nice (France)

2010-07-15

Acute skin toxicity is frequent during radiation therapy and can lead to temporary arrest of the treatment. Chronic toxicity can occur and conduct to cosmetic problems. Alopecia is the most frequent toxicity concerning hair and is most of the time reversible. Several factors linked to patients influence skin toxicity, such as under-nutrition, old age, obesity, smoking, skin diseases, autoimmune diseases, failure of DNA reparation. Skin, hair and nail toxicities depend also on radiation schedule. Acute toxicity is greater when dose per fraction increases. Chronic and acute toxicities are more often when total dose increases. Under 45 Gy, the risk of severe skin toxicity is low, and begins above 50 Gy. Skin toxicity depends also on the duration of radiotherapy and split course schedules are associated with less toxicities. Irradiation surface seems to influence skin toxicity but interaction is more complex. Reirradiation is often feasible in case of cancer recurrence but with a risk of grade 3-4 toxicity above all in head and neck cancer. The benefit/risk ratio has to be always precisely evaluated. Permanent alopecia is correlated with the follicle dose. Modern techniques of radiation therapy allow to spare skin. (authors)

miRNAs in inflammatory skin diseases and their clinical implications

DEFF Research Database (Denmark)

Løvendorf, Marianne B; Skov, Lone

2015-01-01

biological processes. The clinical implications of miRNAs are intriguing, both from a diagnostic and a therapeutic perspective. Accordingly, there is emerging evidence for the clinical potential of miRNAs as both biomarkers and possible therapeutic targets in skin diseases. Future studies will hopefully...... incomplete; however, it is known that miRNAs are implicated in various cellular processes of both normal and diseased skin. Some miRNAs appear to be consistently deregulated in several different inflammatory skin diseases, including psoriasis and atopic dermatitis, indicating a common role in fundamental...

Shining light on skin pigmentation: the darker and the brighter side of effects of UV radiation.

Science.gov (United States)

Maddodi, Nityanand; Jayanthy, Ashika; Setaluri, Vijayasaradhi

2012-01-01

The term barrier function as applied to human skin often connotes the physical properties of this organ that provides protection from its surrounding environment. This term does not generally include skin pigmentation. However, skin pigmentation, which is the result of melanin produced in melanocytes residing in the basal layer of the skin and exported to the keratinocytes in the upper layers, serves equally important protective function. Indeed, changes in skin pigmentation are often the most readily recognized indicators of exposure of skin to damaging agents, especially to natural and artificial radiation in the environment. Several recent studies have shed new light on (1) the mechanisms involved in selective effects of subcomponents of UV radiation on human skin pigmentation and (2) the interactive influences between keratinocytes and melanocytes, acting as "epidermal melanin unit," that manifest as changes in skin pigmentation in response to exposure to various forms of radiation. This article provides a concise review of our current understanding of the effects of the nonionizing solar radiation, at cellular and molecular levels, on human skin pigmentation. © 2012 Wiley Periodicals, Inc. Photochemistry and Photobiology © 2012 The American Society of Photobiology.

Estrogen Receptor and Progesterone Receptor Expression in Normal Terminal Duct Lobular Units Surrounding Invasive Breast Cancer

Science.gov (United States)

Yang, Xiaohong R.; Figueroa, Jonine D.; Hewitt, Stephen M.; Falk, Roni T.; Pfeiffer, Ruth M.; Lissowska, Jolanta; Peplonska, Beata; Brinton, Louise A.; Garcia-Closas, Montserrat; Sherman, Mark E.

2014-01-01

Introduction Molecular and morphological alterations related to carcinogenesis have been found in terminal duct lobular units (TDLUs), the microscopic structures from which most breast cancer precursors and cancers develop, and therefore, analysis of these structures may reveal early changes in breast carcinogenesis and etiologic heterogeneity. Accordingly, we evaluated relationships of breast cancer risk factors and tumor pathology to estrogen receptor (ER) and progesterone receptor (PR) expression in TDLUs surrounding breast cancers. Methods We analyzed 270 breast cancer cases included in a population-based breast cancer case-control study conducted in Poland. TDLUs were mapped in relation to breast cancer: within the same block as the tumor (TDLU-T), proximal to tumor (TDLU-PT), or distant from (TDLU-DT). ER/PR was quantitated using image analysis of immunohistochemically stained TDLUs prepared as tissue microarrays. Results In surgical specimens containing ER-positive breast cancers, ER and PR levels were significantly higher in breast cancer cells than in normal TDLUs, and higher in TDLU-T than in TDLU-DT or TDLU-PT, which showed similar results. Analyses combining DT-/PT TDLUs within subjects demonstrated that ER levels were significantly lower in premenopausal women vs. postmenopausal women (odds ratio [OR]=0.38, 95% confidence interval [CI]=0.19, 0.76, P=0.0064) and among recent or current menopausal hormone therapy users compared with never users (OR=0.14, 95% CI=0.046–0.43, Ptrend=0.0006). Compared with premenopausal women, TDLUs of postmenopausal women showed lower levels of PR (OR=0.90, 95% CI=0.83–0.97, Ptrend=0.007). ER and PR expression in TDLUs was associated with epidermal growth factor receptor (EGFR) expression in invasive tumors (P=0.019 for ER and P=0.03 for PR), but not with other tumor features. Conclusions Our data suggest that TDLUs near breast cancers reflect field effects, whereas those at a distance demonstrate influences of breast

The influence of the preparations with the glucocorticosteroids and ceramides on the morphological state of the rats’ skin with the nonspecific dermatitis

Directory of Open Access Journals (Sweden)

Ya. O. Butko

2013-04-01

Full Text Available Introduction. Local therapy is an important method for treatment of dermatitis used to suppress the skin inflammation and the main related symptoms: hyperemia, edema, pruritus, lichenification etc. However today it is important to pay more attention to elimination of the skin dryness, restoration of the damaged epithelium and improvement of the skin barrier functions in dermatitis therapy. Considering all the requirements mentioned above, cream and ointment that correspond to the modern requirements of the local therapy were developed. They promote the decrease of inflammatory processes in skin (Mometasone furoate and Methylprednisolone atseponat are strong GCS with antipruritic, anti-inflammatory, vasoconstrictive, antiproliferative action and with minimum side effects, eliminate excessive skin dryness, restore the damaged epithelium, improve the skin condition and normalize the barrier functions of the skin (ceramides are the natural ceramides of the human’s skin. The purpose of this work was morphological study of the rats’ skin during treatment with cream “Mometasone with ceramides” and ointment “Methyl­prednisolone with ceramides” in the conditions of contact dermatitis inducted by turpentine. Materials and methods. Skin of animals was an object of the research after its treatment with cream “Mometasone with ceramides” and ointment “Methylprednisolone with ceramides”. The comparator preparations were cream “Elocom” and ointment “Advantan”. In the experiment 36 rats divided into groups were used. All the preparations were applied on the skin in a thin layer once a day. After the 5th day of the treatment animals were taken out of the experiment and all the tissue materials were fixed in 10% solution of formalin for morphological studies carrying out. Sections were stained with hematoxylin and eosine. An examination was carried out under the microscope Micros 400. Results of the research. The results showed that

Field enhancement due to anomalous skin effect inside a target

International Nuclear Information System (INIS)

Ma, G.; Tan, W.

1996-01-01

A new method based on Fourier transformation to study the skin effects is presented. Using this method, the field amplitude in plasma is represented in terms of electric conductivity, and the normal and anomalous skin effects are described through one formula by omitting the plasma dispersion or not. The results are in agreement with other publications [e.g., J. P. Matte and K. Aguenaou, Phys. Rev. A 45, 2558 (1992)] for equivalent parameters. But for deeper positions inside a target, which have not been studied by others, it is found that the field amplitude is considerably enhanced due to an anomalous skin effect, even for constant collision frequency. In addition, the skin absorptions and some calculations on an anomalous skin effect for different collision frequencies are also presented. copyright 1996 American Institute of Physics

Protective molecular mechanisms of resveratrol in UVR-induced Skin carcinogenesis.

Science.gov (United States)

Aziz, Saba W; Aziz, Moammir H

2018-01-01

Skin cancer is a major health problem worldwide. It is the most common cancer in the United States and poses a significant healthcare burden. Excessive UVR exposure is the most common cause of skin cancer. Despite various precautionary measures to avoid direct UVR exposure, the incidence of skin cancer and mortality related to it remains high. Furthermore, the current treatment options are expensive and have side effects including toxicity to normal cells. Thus, a safe and effective approach is needed to prevent and treat skin cancer. Chemopreventive strategy using naturally occurring compounds, such as resveratrol, is a promising approach to reduce the incidence of UVR-induced skin cancer and delay its progression. This review highlights the current body of evidence related to chemopreventive role of resveratrol and its molecular mechanisms in UVR-induced skin carcinogenesis. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Changes in Transepidermal Water Loss and Skin Hydration according to Expression of Aquaporin-3 in Psoriasis

Science.gov (United States)

Lee, Young; Je, Young-Jin; Lee, Sang-Sin; Li, Zheng Jun; Choi, Dae-Kyoung; Kwon, Yoo-Bin; Sohn, Kyung-Cheol; Im, Myung; Seo, Young Joon

2012-01-01

Background Aquaporins (AQPs) are a family of water transporting proteins present in many mammalian epithelial and endothelial cell types. Among the AQPs, AQP3 is known to be a water/glycerol transporter expressed in human skin. Objective The relationship between the expression level of AQP3 and transpidermal water loss (TEWL) in the lesional and peri-lesional skin of psoriasis-affected patients, and skin hydration in the lesional and peri-lesional skin of psoriasis patients, was investigated. Methods The expression of AQP3 in psoriasis-affected and healthy control skin was determined using immunohistochemical and immunofluroscence staining. TEWL and skin hydration were measured using a Tewameter® TM210 (Courage & Khazaka, Cologne, Germany) and a Corneometer® CM 820 (Courage & Khazaka), respectively. Results AQP3 was mainly expressed in the plasma membrane of stratum corneum and the stratum spinosum in normal epidermis. Unlike the normal epidermis, AQP3 showed decreased expression in the lesional and peri-lesional epidermis of psoriasis. TEWL was increased, and skin hydration was decreased, in the lesional and peri-lesional skin of psoriasis patients, compared with the healthy control sample. Conclusion Although various factors contribute to reduced skin hydration in the lesional and peri-lesional skin of psoriasis, AQP3 appears to be a key factor in the skin dehydration of psoriasis-affected skin. PMID:22577267

Real significance of skin contamination is

International Nuclear Information System (INIS)

Sudmann, R.H.

1983-01-01

For five decades, health physicists have discussed the thickness, area, significance of radioactive contamination and the exposures to various portions of the skin. Concern about instances of skin contamination extend beyond the resultant organ dose simply because it is a recognizable and quantifiable event. As such, there is a tendency for management and regulatory agencies to use it as a trend indicator. The final result is a score card similar to the list of OSHA reportable accidents. In fact, the skin contamination incidence rate has a somewhat different meaning to the health physicist, to the manager, and to the regulator. The question must then be asked, What is the true significance of skin contamination, Is it the resultant skin dose, Is it an indicator of loss of control, Is it both or neither. In order to answer these questions, Rockwell Hanford Operations began analysis of the previous five years records of skin contamination cases. Since by policy each incidence of skin contamination is documented, a large percentage of the 425 records analyzed were of low level activity (less than 100 dpm/cm 2 ) on the extremeties, primarily hands and fingers. Most of these cases were readily decontaminated with soap and water. Individual elements studied included: detection/monitoring methods and limits; impact of type of operation on the incidence rate; causes of and methods for reduction of the incidence rate; reporting and documentation; and dose assessment. Results of the study indicate that skin contamination rarely presents a beta dose problem because it is normally highly localized on the extremeties. Only in unusual cases does it represent a potential for internal deposition. Thus, the real importance of skin contamination incidence is as an indicator of deteriorating conditions and should be reviewed by health physicists, managers and regulators as such

Smart Surroundings

NARCIS (Netherlands)

Havinga, Paul J.M.; Jansen, P.G.; Lijding, M.E.M.; Scholten, Johan

2004-01-01

Ambient systems are networked embedded systems integrated with everyday environments and supporting people in their activities. These systems will create a Smart Surrounding for people to facilitate and enrich daily life and increase productivity at work. Such systems will be quite different from

Full-Thickness Skin Grafting with De-Epithelization of the Wound Margin for Finger Defects with Bone or Tendon Exposure

Directory of Open Access Journals (Sweden)

Jun Hee Lee

2015-05-01

Full Text Available BackgroundFull-thickness skin grafts (FTSGs are generally considered unreliable for coverage of full-thickness finger defects with bone or tendon exposure, and there are few clinical reports of its use in this context. However, animal studies have shown that an FTSG can survive over an avascular area ranging up to 12 mm in diameter. In our experience, the width of the exposed bones or tendons in full-thickness finger defects is <7 mm. Therefore, we covered the bone- or tendon-exposed defects of 16 fingers of 10 patients with FTSGs.MethodsThe surgical objectives were healthy granulation tissue formation in the wound bed, marginal de-epithelization of the normal skin surrounding the defect, preservation of the subdermal plexus of the central graft, and partial excision of the dermis along the graft margin. The donor site was the mastoid for small defects and the groin for large defects.ResultsMost of the grafts (15 of 16 fingers survived without significant surgical complications and achieved satisfactory functional and aesthetic results. Minor complications included partial graft loss in one patient, a minimal extension deformity in two patients, a depression deformity in one patient, and mild hyperpigmentation in four patients.ConclusionsWe observed excellent graft survival with this method with no additional surgical injury of the normal finger, satisfactory functional and aesthetic outcomes, and no need for secondary debulking procedures. Potential disadvantages include an insufficient volume of soft tissue and graft hyperpigmentation. Therefore, FTSGs may be an option for treatment of full-thickness finger defects with bone or tendon exposure.

Diagnosis of malignant melanoma and basal cell carcinoma by in vivo NIR-FT Raman spectroscopy is independent of skin pigmentation

DEFF Research Database (Denmark)

Philipsen, P A; Knudsen, L; Gniadecka, M

2013-01-01

and skin tumour diagnostics in vivo. We obtained Raman spectra in vivo from the normal skin of 55 healthy persons with different skin pigmentation (Fitzpatrick skin type I-VI) and in vivo from 25 basal cell carcinomas, 41 pigmented nevi and 15 malignant melanomas. Increased skin pigmentation resulted...

Effects of external pressure loading on human skin blood flow measured by 133Xe clearance

International Nuclear Information System (INIS)

Holloway, G.A. Jr.; Daly, C.H.; Kennedy, D.; Chimoskey, J.

1976-01-01

Forearm skin blood flow was measured during external pressure loading in normal human subjects using 133 Xe washout from intracutaneous injection sites. Pressures ranging between 5 and 150 mmHg were applied through a 3-cm-diameter disc placed over the site of flow determination. The pressure was maintained constant by a servo-controlled loading mechanism. Flow decreased with pressures from 5 to 10 and 30 to 150 mmHg, but remained constant with pressures from 10 to 30 mmHg. Reactive hyperemia occurred following removal of pressures of 90 mmHg or greater, but did not occur following removal of lower pressures. The pressure-flow curve for parasacral skin of paraplegic subjects closely paralleled the pressure-flow curve of normal skin at pressures tested: 5 to 15 mmHg. These data are interpreted to demonstrate autoregulation of skin blood flow. Autoregulation in parasacral skin of paraplegic subjects suggests a peripheral mechanism. The occurrence of hyperemia at pressures which exceed the ability of skin to autoregulate suggests that both autoregulation and post occlusion hyperemia may have the same mechanism

The Roles of Vitamin C in Skin Health.

Science.gov (United States)

Pullar, Juliet M; Carr, Anitra C; Vissers, Margreet C M

2017-08-12

The primary function of the skin is to act as a barrier against insults from the environment, and its unique structure reflects this. The skin is composed of two layers: the epidermal outer layer is highly cellular and provides the barrier function, and the inner dermal layer ensures strength and elasticity and gives nutritional support to the epidermis. Normal skin contains high concentrations of vitamin C, which supports important and well-known functions, stimulating collagen synthesis and assisting in antioxidant protection against UV-induced photodamage. This knowledge is often used as a rationale for the addition of vitamin C to topical applications, but the efficacy of such treatment, as opposed to optimising dietary vitamin C intake, is poorly understood. This review discusses the potential roles for vitamin C in skin health and summarises the in vitro and in vivo research to date. We compare the efficacy of nutritional intake of vitamin C versus topical application, identify the areas where lack of evidence limits our understanding of the potential benefits of vitamin C on skin health, and suggest which skin properties are most likely to benefit from improved nutritional vitamin C intake.

Removal of heavy metal contamination from peanut skin extracts by waste biomass adsorption

Science.gov (United States)

Polyphenols are a rapidly increasing portion of the nutraceutical and functional food marketplace. Peanut skins are a waste product which have potential as a low-cost source of polyphenols. Extraction and concentration of peanut skin extracts can cause normally innocuous levels of the heavy metal co...

A novel approach to measuring the frictional behaviour of human skin in vivo

NARCIS (Netherlands)

Veijgen, N.K.; Masen, Marc Arthur; van der Heide, Emile

2012-01-01

Friction involving human skin plays a key role in human life. The availability of a portable tribometer improves the accessibility to large number of both subjects and anatomical sites. This is the first mobile device suitable to measure skin friction with a controlled and variable normal load

In Situ complement activation and T-cell immunity in leprosy spectrum: An immunohistological study on leprosy lesional skin.

Directory of Open Access Journals (Sweden)

Nawal Bahia El Idrissi

Full Text Available Mycobacterium leprae (M. leprae infection causes nerve damage and the condition worsens often during and long after treatment. Clearance of bacterial antigens including lipoarabinomannan (LAM during and after treatment in leprosy patients is slow. We previously demonstrated that M. leprae LAM damages peripheral nerves by in situ generation of the membrane attack complex (MAC. Investigating the role of complement activation in skin lesions of leprosy patients might provide insight into the dynamics of in situ immune reactivity and the destructive pathology of M. leprae. In this study, we analyzed in skin lesions of leprosy patients, whether M. leprae antigen LAM deposition correlates with the deposition of complement activation products MAC and C3d on nerves and cells in the surrounding tissue. Skin biopsies of paucibacillary (n = 7, multibacillary leprosy patients (n = 7, and patients with erythema nodosum leprosum (ENL (n = 6 or reversal reaction (RR (n = 4 and controls (n = 5 were analyzed. The percentage of C3d, MAC and LAM deposition was significantly higher in the skin biopsies of multibacillary compared to paucibacillary patients (p = <0.05, p = <0.001 and p = <0.001 respectively, with a significant association between LAM and C3d or MAC in the skin biopsies of leprosy patients (r = 0.9578, p< 0.0001 and r = 0.8585, p<0.0001 respectively. In skin lesions of multibacillary patients, MAC deposition was found on axons and co-localizing with LAM. In skin lesions of paucibacillary patients, we found C3d positive T-cells in and surrounding granulomas, but hardly any MAC deposition. In addition, MAC immunoreactivity was increased in both ENL and RR skin lesions compared to non-reactional leprosy patients (p = <0.01 and p = <0.01 respectively. The present findings demonstrate that complement is deposited in skin lesions of leprosy patients, suggesting that inflammation driven by complement activation might contribute to nerve damage in the lesions

Care and management of a stoma: maintaining peristomal skin health.

Science.gov (United States)

Boyles, Anna; Hunt, Sharon

2016-09-22

It is estimated that around one in 500 people in the UK are living with a stoma, with approximately 21 000 operations that result in stoma formation being performed each year ( Colostomy Association, 2016 ). These people face a unique set of challenges in maintaining the integrity of their peristomal skin. This article explores the normal structure and function of skin and how the care and management of a stoma presents challenges for maintaining peristomal skin health. Particular focus is paid to the incidence of skin problems for those living with a stoma, whether it is temporary or permanent, and the factors that contribute to skin breakdown in this population. Wider factors such as the central role of the clinical nurse specialist and the impact of product usage on positive outcomes and health economics are also considered.

Biological Rhythms in the Skin

Directory of Open Access Journals (Sweden)

Mary S. Matsui

2016-05-01

Full Text Available Circadian rhythms, ≈24 h oscillations in behavior and physiology, are reflected in all cells of the body and function to optimize cellular functions and meet environmental challenges associated with the solar day. This multi-oscillatory network is entrained by the master pacemaker located in the suprachiasmatic nucleus (SCN of the hypothalamus, which directs an organism’s rhythmic expression of physiological functions and behavior via a hierarchical system. This system has been highly conserved throughout evolution and uses transcriptional–translational autoregulatory loops. This master clock, following environmental cues, regulates an organism’s sleep pattern, body temperature, cardiac activity and blood pressure, hormone secretion, oxygen consumption and metabolic rate. Mammalian peripheral clocks and clock gene expression have recently been discovered and are present in all nucleated cells in our body. Like other essential organ of the body, the skin also has cycles that are informed by this master regulator. In addition, skin cells have peripheral clocks that can function autonomously. First described in 2000 for skin, this review summarizes some important aspects of a rapidly growing body of research in circadian and ultradian (an oscillation that repeats multiple times during a 24 h period cutaneous rhythms, including clock mechanisms, functional manifestations, and stimuli that entrain or disrupt normal cycling. Some specific relationships between disrupted clock signaling and consequences to skin health are discussed in more depth in the other invited articles in this IJMS issue on Sleep, Circadian Rhythm and Skin.

Analytical Solution of Tunnel Surrounding Rock for Stress and Displacement Based on Lade–Duncan Criterion

Directory of Open Access Journals (Sweden)

MingZheng Zhu

2018-01-01

Full Text Available The deformation and failure of tunnel surrounding rock is the result of tunnel excavation disturbance and rock stress release. When the local stress of surrounding rock exceeds the elastic limit of rock mass, the plastic analysis of surrounding rock must be carried out to judge the stability of tunnel. In this study, the Lade–Duncan yield criterion is used to calculate the analytic solutions for the surrounding rock in a tunnel, and the radius and displacement of the plastic zone are deduced using an equilibrium equation. The plastic zone radius and displacement based on Lade–Duncan criterion and Mohr–Coulomb criterion were compared by using single-factor analysis method under the different internal friction angles, in situ stresses, and support resistances. The results show that the solutions of the radius and displacement of plastic zone calculated by the Lade–Duncan criterion are close to those of Mohr–Coulomb criterion under the high internal friction angle and support resistance or low in situ rock stress; however, the radius and displacement of the plastic zone calculated by the Lade–Duncan criterion are larger under normal circumstances, and the Lade–Duncan criterion is more applicable to the stability analysis of the surrounding rock in a tunnel.

Investigation of pion-treated human skin nodules for therapeutic gain

International Nuclear Information System (INIS)

Kligerman, M.M.; Sala, J.M.; Wilson, S.; Yuhas, J.M.

1978-01-01

A patient with multiple metastatic tumor nodules in the skin, from a primary breast carcinoma, was treated with graded doses of pions and x rays to establish skin tolerance. She was followed up for 346 days, permitting observation of time to regrowth of the tumor nodules. All 16 of these had disappeared after treatment, without significant correlation with type of radiation or dose, or with nodule size. However, time to regrowth depended both on the type and the dose of radiation. Earlier, relative biological effectiveness (RBE), was established at 1.42 for acute skin injury. Using this RBE to normalize doses of pions and x rays causing equivalent acute skin injury, and plotting those doses vs time to regrowth of tumor nodules, yielded a therapeutic gain (37.5%) in favor of pions. No late skin or subcutaneous tissue changes were seen, and no qualitative difference between pions and x rays in late skin effects was observed

Tubuloreticular inclusions in skin biopsies from patients with HIV infection

DEFF Research Database (Denmark)

Pedersen, C; Horn, T; Junge, Jette

1989-01-01

Skin biopsies obtained from apparently normal skin from 15 HIV infected patients and 6 anti-HIV negative patients were examined by electron microscopy. Tubuloreticular inclusions (TRI) were detected within the cytoplasm of capillary endothelial cells in 5/5 AIDS patients and in 2/5 patients...... of the patients without TRI, interferon activity was below detection level. The occurrence of TRI was not dependent on the presence of free p24 antigen in serum. It is concluded that the occurrence of TRI in entothelial cells of skin capillaries is associated with late stages of HIV infection and this may...

Safety of radiofrequency treatment over human skin previously injected with medium-term injectable soft-tissue augmentation materials: a controlled pilot trial.

Science.gov (United States)

Alam, Murad; Levy, Ross; Pajvani, Urvi; Pavjani, Urvi; Ramierez, James A; Guitart, Joan; Veen, Heather; Gladstone, Hayes B

2006-03-01

Several soft-tissue augmentation materials are now available for reduction of nasolabial fold creases and perioral rhytides. Nasolabial folds and perioral rhytides can also be improved by skin tightening delivered by non-ablative radiofrequency (RF) treatment. The purpose of this study was to assess the safety of RF treatment over skin areas recently injected with medium-term injectable soft-tissue augmentation materials. Five subjects were assigned to the experimental arm (augmentation materials plus RF) and one to the control arm (augmentation materials alone). Each subject received injections of 0.3 mL of hyaluronic acid derivative (Restylane) and calcium hydroxylapatite (Radiesse) 3 cm apart on the upper inner arm. Two weeks later, two non-overlapping passes of RF (Thermage ThermaCool TC) were delivered at 63.5 setting with medium-fast 1.5 cm2 tip over injected sites in all of the experimental subjects. Punch skin biopsies were obtained 3 days later from each of the two injection sites on each subject. Light microscopy and digital photomicrographs obtained at low, medium, and high power showed no difference between filler materials in experimental and control subjects. In both cases filler was evident at the deep dermal-subcutaneous junction. Nodule formation, foreign body extravasation, or hemorrhage/clot was not observed grossly or histologically. Subjects and physicians did not report any difference in signs and symptoms between the experimental and control arms. Slightly increased transitory pain was noted when RF was delivered over filler versus over normal skin. Applying RF treatment over the same area 2 weeks after deep dermal injection with hyaluronic acid derivatives or calcium hydroxylapatite does not appear to cause gross morphological changes in the filler material or surrounding skin. Further studies with different parameters are necessary to confirm these findings. 2006 Wiley-Liss, Inc.

Variation of Biophysical Parameters of the Skin with Age, Gender, and Body Region

Science.gov (United States)

Firooz, Alireza; Sadr, Bardia; Babakoohi, Shahab; Sarraf-Yazdy, Maryam; Fanian, Ferial; Kazerouni-Timsar, Ali; Nassiri-Kashani, Mansour; Naghizadeh, Mohammad Mehdi; Dowlati, Yahya

2012-01-01

Background. Understanding the physiological, chemical, and biophysical characteristics of the skin helps us to arrange a proper approach to the management of skin diseases. Objective. The aim of this study was to measure 6 biophysical characteristics of normal skin (sebum content, hydration, transepidermal water loss (TEWL), erythema index, melanin index, and elasticity) in a normal population and assess the effect of sex, age, and body location on them. Methods. Fifty healthy volunteers in 5 age groups (5 males and females in each) were enrolled in this study. A multifunctional skin physiology monitor (Courage & Khazaka electronic GmbH, Germany) was used to measure skin sebum content, hydration, TEWL, erythema index, melanin index, and elasticity in 8 different locations of the body. Results. There were significant differences between the hydration, melanin index, and elasticity of different age groups. Regarding the locations, forehead had the highest melanin index, where as palm had the lowest value. The mean values of erythema index and melanin index and TEWL were significantly higher in males and anatomic location was a significant independent factor for all of 6 measured parameters. Conclusion. Several biophysical properties of the skin vary among different gender, age groups, and body locations. PMID:22536139

Bioactive reagents used in mesotherapy for skin rejuvenation in vivo induce diverse physiological processes in human skin fibroblasts in vitro- a pilot study.

Science.gov (United States)

Jäger, Claudia; Brenner, Christiane; Habicht, Jüri; Wallich, Reinhard

2012-01-01

The promise of mesotherapy is maintenance and/or recovery of a youthful skin with a firm, bright and moisturized texture. Currently applied medications employ microinjections of hyaluronic acid, vitamins, minerals and amino acids into the superficial layer of the skin. However, the molecular and cellular processes underlying mesotherapy are still elusive. Here we analysed the effect of five distinct medication formulas on pivotal parameters involved in skin ageing, that is collagen expression, cell proliferation and morphological changes using normal human skin fibroblast cultures in vitro. Whereas in the presence of hyaluronic acid, NCTF135(®) and NCTF135HA(®) , cell proliferation was comparable to control cultures; however, with higher expression of collagen type-1, matrix metalloproteinase-1 and tissue inhibitor of matrix metalloproteinase-1, addition of Soluvit(®) N and Meso-BK led to apoptosis and/or necrosis of human fibroblasts. The data indicate that bioactive reagents currently applied for skin rejuvenation elicit strikingly divergent physiological processes in human skin fibroblast in vitro. © 2011 John Wiley & Sons A/S.

The contribution of skin blood flow in warming the skin after the application of local heat; the duality of the Pennes heat equation.

Science.gov (United States)

Petrofsky, Jerrold; Paluso, Dominic; Anderson, Devyn; Swan, Kristin; Yim, Jong Eun; Murugesan, Vengatesh; Chindam, Tirupathi; Goraksh, Neha; Alshammari, Faris; Lee, Haneul; Trivedi, Moxi; Hudlikar, Akshay N; Katrak, Vahishta

2011-04-01

As predicted by the Pennes equation, skin blood flow is a major contributor to the removal of heat from an external heat source. This protects the skin from erythema and burns. But, for a person in a thermally neutral room, the skin is normally much cooler than arterial blood. Therefore, if skin blood flow (BF) increases, it should initially warm the skin paradoxically. To examine this phenomenon, 10 young male and female subjects participated in a series of experiments to examine the contribution of skin blood flow in the initial warming the skin after the application of local heat. Heat flow was measured by the use of a thermode above the brachioradialis muscle. The thermode was warmed by constant temperature water at 44°C entering the thermode at a water flow rate of 100 cm(3)/min. Skin temperature was measured by a thermistor and blood flow in the underlying skin was measured by a laser Doppler imager in single point mode. The results of the experiments showed that, when skin temperature is cool (31-32°C), the number of calories being transferred to the skin from the thermode cannot account for the rise in skin temperature alone. A significant portion of the rise in skin temperature is due to the warm arterialized blood traversing the skin from the core areas of the body. However, as skin temperature approaches central core temperature, it becomes less of a heat source and more of a heat sync such that when skin temperature is at or above core temperature, the blood flow to the skin, as predicted by Pennes, becomes a heat sync pulling heat from the thermode. Copyright © 2010 IPEM. Published by Elsevier Ltd. All rights reserved.

Epidermal hydrogen peroxide is not increased in lesional and non-lesional skin of vitiligo.

Science.gov (United States)

Zailaie, Mohammad Z

2017-01-01

It is widely believed that the loss of the epidermal melanocytes in vitiligo is basically due to excessive oxidative stress. Previous research work described abnormal elevation of the absolute concentration of the epidermal hydrogen peroxide (H 2 O 2 ) in lesional and non-lesional skin of vitiligo. Based on this finding, our primary research objective was to use this feature as a screening marker in individuals at a great risk of developing vitiligo. Ninety-six patients of non-segmental vitiligo (NSV) of varying durations, skin phototypes, and treatment modalities (psoralen UVA-, narrow band UVB-treated) were recruited for this study. Raman spectroscopic measurements, using an external probehead, of the lesional and non-lesional skin were obtained, and the resulting spectra were analyzed using the Opus software package of the MultiRam spectrometer and the intensity of the peak at 875 cm -1 that represents the absolute concentration of H 2 O 2 was calculated. Contrary to previous reports, in patients of skin phototype IV, the absolute concentrations of H 2 O 2 in non-lesional and lesional NSV of all groups were non-significantly decreased compared to normal control. In patients of NSV of skin phototype V, the decrease in the absolute concentrations of H 2 O 2 was not significant in the untreated group, and a slight non-significant increase in the NBUVB-treated group was noted. However, in the PUVA-treated group, the non-lesional skin demonstrated significant increase in the absolute concentration of H 2 O 2 , whereas the lesional skin showed only a slight non-significant increase compared to normal control. In NSV patients of skin phototype VI who were previously treated with PUVA, the non-lesional skin showed a slight non-significant increase in the absolute concentration of H 2 O 2 ; however, the lesional skin showed a marked significant decrease compared to normal control and the non-lesional skin. Thereof, one can conclude that the epidermal H 2 O 2 is not

Migration of metallic ions from screwposts into dentin and surrounding tissues

International Nuclear Information System (INIS)

Arvidson, K.; Wroblewski, R.

1978-01-01

Previous investigations have shown that corrosion and other electrochemical processes occur when different alloys or metals are found together in the same mouth. In the present report, when teeth were restored using non-noble metallic posts, the metals diffused out to surrounding hard and soft connective tissues. The material consisted of extracted teeth with screwposts and surrounding discolored connective tissues. The screwposts had been cemented to the teeth 3-10 years earlier. The distribution of metal ion was determined by means of energy-dispersive X-ray microanalysis. Copper and zinc were found in both hard and soft tissues. Relatively high concentrations of copper ions were identified in areas of the teeth with blue-green discolorations. Zinc ions were detected in the dentin; they most probably originated from the screwposts and the cement, but zinc is also found in normal human dentin. Copper, zinc, silver and iron were found in the dark discolorations of the gingiva adjacent to the extracted teeth. (author)

Monte Carlo simulation of light reflection from cosmetic powders on the skin

Science.gov (United States)

Okamoto, Takashi; Motoda, Masafumi; Igarashi, Takanori; Nakao, Keisuke

2011-07-01

The reflection and scattering properties of light incident on skin covered with powder particles have been investigated. A three-layer skin structure with a spot is modeled, and the propagation of light in the skin and the scattering of light by particles on the skin surface are simulated by means of a Monte Carlo method. Under the condition in which only single scattering of light occurs in the powder layer, the reflection spectra of light from the skin change dramatically with the size of powder particles. The color difference between normal skin and spots is found to diminish more when powder particles smaller than the wavelength of light are used. It is shown that particle polydispersity suppresses substantially the extreme spectral change caused by monodisperse particles with a size comparable to the light wavelength.

Constituents from the roots of Taraxacum platycarpum and their effect on proliferation of human skin fibroblasts.

Science.gov (United States)

Warashina, Tsutomu; Umehara, Kaoru; Miyase, Toshio

2012-01-01

A MeOH extract from the roots of Taraxacum platycarpum has shown significant effects on the proliferation of normal human skin fibroblasts. Chemical analysis of the extract resulted in the isolation of 26 compounds, including eight new triterpenes, one new sesquiterpene glycoside, and seventeen known compounds. The structure of each new compound was established using NMR spectroscopy. Some triterpenes had a significant effect on the proliferation of normal human skin fibroblasts.

An investigation into the management of acute skin reactions from tangential breast irradiation

International Nuclear Information System (INIS)

Meegan, M.A.; Haycocks, T.R.

1997-01-01

This research examined the acute skin reaction of two consecutive groups receiving tangetial breast irradiation for carcinoma of the breast. The first group used the traditional skin care advice of using warm water only within the treatment area, while the second group continued with their normal skin care regime. Data was collected on the physical manifestations of the acute reaction, medical history, the use of concurrent cytotoxic agents, treatment parameters and skin care products used. Statistical analysis using the T-test method showed no difference in the skin reaction between the two groups. The investigation has lead to a change of policy in the management of acute breast reactions. Patients receiving radiation therapy to the breast or chest wall can now use their routine skin care products with no adverse effect on skin reactions. (author)

[Nursing Experience With a Patient With Gastrostomy Leakage Resulting in Moisture-Associated Skin Damage].

Science.gov (United States)

Hsu, Mei-Yu; Hsu, Hsiao-Hui; Lyu, Ji-Yan

2016-10-01

Leakage is a common complication of gastrostomy. Exposure of the skin surrounding the gastrostomy tube to moisture or chemical irritants may cause moisture-associated skin damage (MASD) and seriously affect the patient's quality of life. This case study describes a nursing experience with gastrostomy leakage that resulted in MASD. An assessment conducted from July 29, 2015 to August 20, 2015 revealed that heavy gastronomy leakage had caused extensive skin erosion, ulceration, hyperplasia, and superficial infection. Simultaneously, the patient was required to conduct complex stoma care, which resulted in physical and psychological exhaustion. Changes in traditional tube and wound care were discussed on multiple occasions with an interdisciplinary healthcare team. Based on the evidence-based literature, we provide gastrostomy and MASD management strategies. Through team collaboration, we prevented gastric contents from contacting the patient's skin directly, improved patient comfort, controlled effluent and skin infections, maintained fluid and electrolyte balances, and acce-lerated the healing of the damaged skin. We recommend that healthcare professionals caring for patients with gastrostomy leakage be provided with early skin protection programs to learn the standard methods for identifying and correcting leakage factors, containing effluent, and adequately stabilizing the gastrostomy tube in order to reduce the impact on the patient's quality of life. In addition, patient education on tube and skin care should be provided to prevent the reoccurrence of complications.

Blood-group-related carbohydrates are expressed in organotypic cultures of human skin and oral mucosa

DEFF Research Database (Denmark)

Grøn, B; Andersson, A; Dabelsteen, Erik

1999-01-01

cultures. The organotypic skin and oral mucosa cultures showed a histological differentiation pattern analogous to that of normal skin and buccal mucosa, and a tissue-specific expression of carbohydrate structures and cytokeratins. However, both types of organotypic cultures also expressed markers which...... are normally seen during wound healing, including Lewis y, cytokeratin 16, and cytokeratin 19. We conclude that the organotypic cultures of oral mucosa and skin are suitable models for future studies of the function of cell-surface carbohydrates, although the expression of wound healing markers has to be taken...... the function of cell-surface carbohydrates, we established organotypic cultures of skin and buccal mucosa. In these cultures, keratinocytes are grown at the air-liquid interface on a supporting matrix consisting of homologous fibroblasts embedded in a collagen type I gel. We examined the expression of blood...

Morphological and clinical characteristics of the head epidermal skin carcinomas

Directory of Open Access Journals (Sweden)

Mijović M.

2015-01-01

Full Text Available The most common skin malignant tumor of the epidermoid origin are basal cell (BCC and squamous cell (SCC carcinoma. They occur at the photoexposed parts of the body in 90% of cases and are directly associated with skin damage caused by long term exposure to UV rays, usually in older persons and light skin. Almost 65,000 people die annually in the world from their consequences. The most important link in preventing the occurrence of these tumors is prevention, but their early identification allows adequate surgical treatment with sparing surrounding tissue. The main objective of this paper is to examine the histopathological and clinical-morphological characteristics of BCC and SCC of the skin of the head. The analysis included 439 cancer (297 (67.7% BCC, 126 (28.7% SCK and 16 (3.6% BCK + SCK, among which over 60% were diagnosed in men, usually in the seventh and eighth decade of life, with the highest incidence of BCC on the nose or on the skin of the upper half of the face and SCK on the lips or the skin of the lower half of face. All skin cancers of the head were more common on the right side. Clinical and morphological, most of the BCC were manifested by ulcerative form of average size 1.2cm and mixed histological type, and SCK by vegetative form of average size 1.55cm and histological grade I. The highest number of BCC and SCC was completly removed, in contrast to the combination of these two tumors among them in most cases the subsequent surgical intervention was necessary.

The human POLH gene is not mutated, and is expressed in a cohort of patients with basal or squamous cell carcinoma of the skin.

LENUS (Irish Health Repository)

Flanagan, Annabelle M

2007-04-01

Skin cancer, the most common cancer in the general population, is strongly associated with exposure to the ultraviolet component of sunlight. To investigate the relationship between DNA damage processing and skin tumour development, we determined the POLH status of a cohort of skin cancer patients. The human POLH gene encodes DNA polymerase eta (poleta), which normally carries out accurate translesion synthesis past the major UV-induced photoproduct, the dithymine cyclobutane dimer. In the absence of active poleta in xeroderma pigmentosum variant (XPV) patients, mutations accumulate at sites of UV-induced DNA damage, providing the initiating step in skin carcinogenesis. Forty patients diagnosed with skin cancer were genotyped for polymorphisms in the POLH protein-coding sequence, using glycosylase-mediated polymorphism detection (GMPD) and direct DNA sequencing of POLH PCR products derived from white blood cell genomic DNA. All individuals carried the wild-type POLH sequence. No POLH mutations were identified in genomic DNA from skin tumours derived from 15 of these patients. As determined by RT-PCR, POLH mRNA was expressed in all normal and skin tumour tissue examined. Poleta protein was also detectable by Western blotting, in two matched normal and skin tumour extracts. An alternatively spliced form of POLH mRNA, lacking exon 2, was more readily detected in skin tissue than in white blood cells from the same patient. Real-time PCR was used to quantify POLH expression in matched normal and skin tumour-derived mRNA from a series of patients diagnosed with either basal or squamous cell carcinoma. Compared to matched normal skin tissue from the same patient, 1 of 7 SCC, and 4 of 10 BCC tumours examined showed at least a 2-fold reduction in POLH expression, while 1 of 7 SCC, and 3 of 10 BCC tumours showed at least a 2-fold increase in POLH expression. Differences in gene expression, rather than sequence changes may be the main mechanism by which POLH status varies

UV-radiation and skin cancer dose effect curves

International Nuclear Information System (INIS)

Henriksen, T.; Dahlback, A.; Larsen, S.H.

1988-08-01

Norwegian skin cancer data were used in an attempt to arrive at the dose effect relationship for UV-carcinogenesis. The Norwegian population is relatively homogenous with regard to skin type and live in a country where the annual effective UV-dose varies by approximately 40 percent. Four different regions of the country, each with a broadness of 1 o in latitude (approximately 111 km), were selected . The annual effective UV-doses for these regions were calculated assuming normal ozone conditions throughout the year. The incidence of malignant melanoma and non-melanoma skin cancer (mainly basal cell carcinoma) in these regions were considered and compared to the annual UV-doses. For both these types of cancer a quadratic dose effect curve seems to be valid. Depletions of the ozone layer results in larger UV-doses which in turn may yield more skin cancer. The dose effect curves suggest that the incidence rate will increase by an ''amplification factor'' of approximately 2

Touch Receptors Undergo Rapid Remodeling in Healthy Skin

Directory of Open Access Journals (Sweden)

Kara L. Marshall

2016-11-01

Full Text Available Sensory tissues exposed to the environment, such as skin, olfactory epithelia, and taste buds, continuously renew; therefore, peripheral neurons must have mechanisms to maintain appropriate innervation patterns. Although somatosensory neurons regenerate after injury, little is known about how these neurons cope with normal target organ changes. To elucidate neuronal plasticity in healthy skin, we analyzed the structure of Merkel-cell afferents, which are gentle touch receptors, during skin remodeling that accompanies mouse hair-follicle regeneration. The number of Merkel cells is reduced by 90% and axonal arbors are simplified during active hair growth. These structures rebound within just days. Computational modeling predicts that Merkel-cell changes are probabilistic, but myelinated branch stability depends on Merkel-cell inputs. Electrophysiology and behavior demonstrate that tactile responsiveness is less reliable during active growth than in resting skin. These results reveal that somatosensory neurons display structural plasticity at the cost of impairment in the reliability of encoding gentle touch.

Ectodermal dysplasia-skin fragility syndrome: A rare case report

Directory of Open Access Journals (Sweden)

Subhash Kashyap

2015-01-01

Full Text Available Ectodermal dysplasia/skin fragility syndrome (ED-SFS is a newly described autosomal recessive disorder characterized by skin fragility and blistering, palmoplantar keratoderma, abnormal hair growth, nail dystrophy, and occasionally defective sweating. It results from mutations in the PKP1 gene encoding plakophilin 1 (PKP1, which is an important component of stratifying epithelial desmosomes and a nuclear component of many cell types. Only 12 cases of this rare genodermatosis have been reported so far. We present an unusual case of ED-SFS in a 12-year boy who was normal at birth but subsequently developed skin fragility, hair and nail deformities, abnormal dentition, palmoplantar keratoderma, and abnormal sweating but no systemic abnormality.

Provocation of skin graft rejection across murine class II differences by non--bone-marrow-derived cells

International Nuclear Information System (INIS)

Stuart, P.M.; Beck-Maier, B.; Melvold, R.W.

1984-01-01

We have evaluated the relative contribution of bone-marrow-derived cells to skin allograft immunogenicity in mice differing only at class II major histocompatibility genes by using bone marrow radiation chimeras as donors. The mouse strains used were C57BL/6Kh (B6) and B6.C-H-2bm12 (bm12), which differ only at at A beta gene of the I region of the mouse H-2 complex. Our results demonstrated that skin from (B6----bm12) chimeras was accepted by bm12 recipients and rejected by B6 mice in a manner indistinguishable from that of normal bm12 skin. Likewise, naive bm12 mice rejected (bm12----B6) chimeric skin and normal B6 skin equally well, and B6 animals accepted both types of skin grafts. Our data argues that the donor cell-type leading to graft rejection across limited I region differences is not of bone marrow origin, and that these cells must--at least under certain circumstances--express class II antigens

In vivo effect of carbon dioxide laser-skin resurfacing and mechanical abrasion on the skin's microbial flora in an animal model.

Science.gov (United States)

Manolis, Evangelos N; Tsakris, Athanassios; Kaklamanos, Ioannis; Markogiannakis, Antonios; Siomos, Konstadinos

2006-03-01

Although beam-scanning carbon dioxide (CO2) lasers have provided a highly efficient tool for esthetic skin rejuvenation there has been no comprehensive animal studies looking into microbial skin changes following CO2 laser skin resurfacing. To evaluate the in vivo effects of CO2 laser skin resurfacing in an experimental rat model in comparison with mechanical abrasion on the skin microbial flora. Four separate cutaneous sections of the right dorsal surface of 10 Wistar rats were treated with a CO2 laser, operating at 18 W and delivering a radiant energy of 5.76 J/cm2, while mechanical abrasions of the skin were created on four sections of the left dorsal surface using a scalpel. Samples for culture and biopsies were obtained from the skin surfaces of the rats on day 1 of application of the CO2 laser or mechanical abrasion, as well as 10, 30, and 90 days after the procedure. The presence of four microorganisms (staphylococci, streptococci, diphtheroids, and yeasts) was evaluated as a microbe index for the skin flora, and colony counts were obtained using standard microbiological methods. Skin biopsy specimens, following CO2 laser treatment, initially showed epidermal and papillary dermal necrosis and later a re-epithelization of the epidermis as well as the generation of new collagen on the upper papillary dermis. The reduction in microbial counts on day 1 of the CO2 laser-inflicted wound was statistically significant for staphylococci and diphtheroids compared with the baseline counts (p=.004 and pSkin resurfacing using CO2 lasers considerably reduces microbial counts of most microorganisms in comparison with either normal skin flora or a scalpel-inflicted wound. This might contribute to the positive clinical outcome of laser skin resurfacing.

In-vitro Investigations of Skin Closure using Diode Laser and Protein Solder Containing Gold Nanoshells

Directory of Open Access Journals (Sweden)

Mohammad Sadegh Nourbakhsh

2010-12-01

Full Text Available Introduction: Laser tissue soldering is a new technique for repair of various tissues including the skin, liver, articular cartilage and nerves and is a promising alternative to suture. To overcome the problems of thermal damage to surrounding tissues and low laser penetration depth, some exogenous chromophores such as gold nanoshells, a new class of nanoparticles consisting of a dielectric core surrounded by a thin metal shell, are used. The aims of this study were to use two different concentrations of gold nanoshells as the exogenous material for skin tissue soldering and also to examine the effects of laser soldering parameters on the properties of the repaired skin. Material and Methods: Two mixtures of albumin solder and different concentrations of gold nanoshells were prepared. A full thickness incision of 2×20 mm2 was made on the surface and after placing 50 μl of the solder mixture on the incision, an 810 nm diode laser was used to irradiate it at different power densities. The changes of tensile strength, σt, due to temperature rise, number of scan (Ns, and scan velocity (Vs were investigated. Results: The results showed that the tensile strength of the repaired skin increased with increasing irradiance for both gold nanoshell concentrations. In addition, at constant laser irradiance (I, the tensile strength of the repaired incision increased with increasing Ns and decreasing Vs. In our case, this corresponded to st = 1610 g/cm2 at I ~ 60 Wcm-2, T ~ 65ºC, Ns = 10 and Vs = 0.2 mms-1. Discussion and Conclusion: Gold nanoshells can be used as an indocyanine green dye (ICG alterative for laser tissue soldering.  Although by increasing the laser power density, the tensile strength of the repaired skin increases, an optimum power density must be considered due to the resulting increase in tissue temperature.

A seminar on gardens for the health of the skin.

Science.gov (United States)

Ryan, Terence J; Matts, Paul J; Snyder, Brad; Orr, Vanya

2014-05-01

This is a report on a seminar held on January 12, 2013, at the Regional Dermatology Training Centre in Tanzania, sponsored by the International Society of Dermatology as part of its Taskforce Program for Skin Care for All: Community Dermatology. There were four themes: (i) Gardens attached to health centers increase their attractiveness and result in increased attendance and, thus, increase the utilization of effective skin care interventions. Literature on the positive effect of greenery surrounding health centers on health and the environment is reviewed. (ii) Adding an expert on agriculture to the staff of health centers in Rwanda has provided nutrition and safe medicines. (iii) In southern India, these interventions are channeled through the empowerment of tribal women in an area noted for anxiety due to unemployment in the tea and forestry industry. The gardens are used for teaching about nutrition and herbal medicines, and the women are further attracted by childcare facilities. (iv) Measuring barrier function defects gives early warning of malnutrition of the skin after damage by trauma or by ultraviolet radiation. Higher cost research techniques may help to provide the science required to produce its evidence base. In conclusion, Gardens for health should be adopted as policy by skin care providers. © 2014 The International Society of Dermatology.

Site-Specific Differentiation of Fibroblasts in Normal and Scleroderma Skin

National Research Council Canada - National Science Library

Chang, Howard Y

2008-01-01

The results from year I of funding suggest that appropriate markers and technologies are in place for systematic investigation of the positional identity of fibroblasts both in normal and diseased tissues...

A study on the quantitative evaluation of skin barrier function

Science.gov (United States)

Maruyama, Tomomi; Kabetani, Yasuhiro; Kido, Michiko; Yamada, Kenji; Oikaze, Hirotoshi; Takechi, Yohei; Furuta, Tomotaka; Ishii, Shoichi; Katayama, Haruna; Jeong, Hieyong; Ohno, Yuko

2015-03-01

We propose a quantitative evaluation method of skin barrier function using Optical Coherence Microscopy system (OCM system) with coherency of near-infrared light. There are a lot of skin problems such as itching, irritation and so on. It has been recognized skin problems are caused by impairment of skin barrier function, which prevents damage from various external stimuli and loss of water. To evaluate skin barrier function, it is a common strategy that they observe skin surface and ask patients about their skin condition. The methods are subjective judgements and they are influenced by difference of experience of persons. Furthermore, microscopy has been used to observe inner structure of the skin in detail, and in vitro measurements like microscopy requires tissue sampling. On the other hand, it is necessary to assess objectively skin barrier function by quantitative evaluation method. In addition, non-invasive and nondestructive measuring method and examination changes over time are needed. Therefore, in vivo measurements are crucial for evaluating skin barrier function. In this study, we evaluate changes of stratum corneum structure which is important for evaluating skin barrier function by comparing water-penetrated skin with normal skin using a system with coherency of near-infrared light. Proposed method can obtain in vivo 3D images of inner structure of body tissue, which is non-invasive and non-destructive measuring method. We formulate changes of skin ultrastructure after water penetration. Finally, we evaluate the limit of performance of the OCM system in this work in order to discuss how to improve the OCM system.

Determination of the pollution with lead in the batteries factory in Al-Saffera (Aleppo) and surrounding area

International Nuclear Information System (INIS)

Al-Oudat, M.; Al-Kharfan, K.; Al-Shamali, K.

2007-10-01

The study aimed to determine the lead concentrations in the ecosystem surrounding the batteries factory in Al-Saffera. The results showed that the lead levels were very high in both factory area and the surrounding agricultural area. Lead levels in air varied between 12 and 34 μg/m3 in the area outside the factory. The same trends were in both soil and plant samples, and normal washing does not decrease the lead level in plant samples to acceptable levels. Mean lead levels in blood was also high and ranged between 55 and 28 μg /dl for factory workers and village inhabitants respectively. In conclusion the authorities administration must take all necessary procedures to reduce the lead levels in the factory area and in the surrounding area.(Author)

Determination of the pollution with lead in the batteries factory in Al-Saffera (Aleppo) and surrounding area

Energy Technology Data Exchange (ETDEWEB)

Al-Oudat, M; Al-Kharfan, K; Al-Shamali, K [Atomic Energy Commission, Damascus (Syrian Arab Republic), Dept. of Protection and Safety

2007-10-15

The study aimed to determine the lead concentrations in the ecosystem surrounding the batteries factory in Al-Saffera. The results showed that the lead levels were very high in both factory area and the surrounding agricultural area. Lead levels in air varied between 12 and 34 {mu}g/m3 in the area outside the factory. The same trends were in both soil and plant samples, and normal washing does not decrease the lead level in plant samples to acceptable levels. Mean lead levels in blood was also high and ranged between 55 and 28 {mu}g /dl for factory workers and village inhabitants respectively. In conclusion the authorities administration must take all necessary procedures to reduce the lead levels in the factory area and in the surrounding area.(Author)

Small Demodex populations colonize most parts of the skin of healthy dogs.

Science.gov (United States)

Ravera, Iván; Altet, Laura; Francino, Olga; Sánchez, Armand; Roldán, Wendy; Villanueva, Sergio; Bardagí, Mar; Ferrer, Lluís

2013-02-01

It is unproven that all dogs harbour Demodex mites in their skin. In fact, several microscopic studies have failed to demonstrate mites in healthy dogs. Demodex canis is a normal inhabitant of the skin of most, if not all, dogs. This hypothesis was tested using a sensitive real-time PCR to detect Demodex DNA in the skin of dogs. One hundred dogs living in a humane society shelter, 20 privately owned and healthy dogs and eight dogs receiving immunosuppressive or antineoplastic therapy. Hair samples (250-300 hairs with their hair bulbs) were taken from five or 20 skin locations. A real-time PCR that amplifies a 166 bp sequence of the D. canis chitin synthase gene was used. The percentage of positive dogs increased with the number of sampling points. When a large canine population was sampled at five cutaneous locations, 18% of dogs were positive for Demodex DNA. When 20 skin locations were sampled, all dogs tested positive for mite DNA. Our study indicates that Demodex colonization of the skin is present in all dogs, independent of age, sex, breed or coat. Nevertheless, the population of mites in a healthy dog appears to be small. Demodex DNA was amplified from all 20 cutaneous points investigated, without statistically significant differences. Using a real-time PCR technique, Demodex mites, albeit in very low numbers, were found to be normal inhabitants of haired areas of the skin of healthy dogs. © 2013 The Authors. Veterinary Dermatology © 2013 ESVD and ACVD.

Studies on the relationship between epidermal cell turnover kinetics and permeability of hairless mouse skin

International Nuclear Information System (INIS)

Han, S.R.

1988-01-01

The primary aim of this study was to develop non-invasive, physical means to quantitatively assess the epidermal turnover kinetics and barrier properties of the skin and relate these to the cutaneous irritation which results from ultraviolet light irradiation and mold thermal burns. After systematically injecting radiolabeled glycine, the appearance of radioactivity at the skin's surface indicated the transit time of radiolabeled cells through the skin. By plotting the data as the cumulative specific activity against time and then fitting them with a third order polynomial equation, it is possible to estimate the turnover time of the stratum corneum. The skin turnover was coordinated with non-invasive transepidermal water loss (TEWL) studies determined with an evaporimeter. In vitro diffusion studies of the permeability of hydrocortisone through UVB irradiated and thermally burned skin were also performed. The studies indicated that irritated skin offers a relatively low diffusional resistance to hydrocortisone. Depending on the severity of the trauma, the increases in hydrocortisone's permeability coefficient through irritated skin ranged from a low of about 2 times normal to a high of about 210 times normal. Trauma-induced changes in hydrocortisone permeability parallel changes in TEWL, proving that the barrier deficient state resulting from rapid epidermal turnover is a general phenomenon

Enhanced unscheduled DNA synthesis in UV-irradiated human skin explants treated with T4N5 liposomes

International Nuclear Information System (INIS)

Yarosh, D.B.; Kibitel, J.T.; Green, L.A.; Spinowitz, A.

1991-01-01

Epidermal keratinocytes cultured from explants of skin cancer patients, including biopsies from xeroderma pigmentosum patients, were ultraviolet light-irradiated and DNA repair synthesis was measured. Repair capacity was much lower in xeroderma pigmentosum patients than in normal patients. The extent of DNA repair replication did not decline with the age of the normal patient. Treatment with T4N5 liposomes containing a DNA repair enzyme enhanced repair synthesis in both normal and xeroderma pigmentosum keratinocytes in an irradiation- and liposome-dose dependent manner. These results provide no evidence that aging people or skin cancer patients are predisposed to cutaneous malignancy by a DNA repair deficiency, but do demonstrate that T4N5 liposomes enhance DNA repair in the keratinocytes of the susceptible xeroderma pigmentosum and skin cancer population

Optical spectroscopy of radiotherapy and photodynamic therapy responses in normal rat skin shows vascular breakdown products

Science.gov (United States)

Teles de Andrade, Cintia; Nogueira, Marcelo S.; Kanick, Stephen C.; Marra, Kayla; Gunn, Jason; Andreozzi, Jacqueline; Samkoe, Kimberley S.; Kurachi, Cristina; Pogue, Brian W.

2016-03-01

Photodynamic therapy (PDT) and radiotherapy are non-systemic cancer treatment options with different mechanisms of damage. So combining these techniques has been shown to have some synergy, and can mitigate their limitations such as low PDT light penetration or radiotherapy side effects. The present study monitored the induced tissue changes after PDT, radiotherapy, and a combination protocol in normal rat skin, using an optical spectroscopy system to track the observed biophysical changes. The Wistar rats were treated with one of the protocols: PDT followed by radiotherapy, PDT, radiotherapy and radiotherapy followed by PDT. Reflectance spectra were collected in order to observe the effects of these combined therapies, especially targeting vascular response. From the reflectance, information about oxygen saturation, met-hemoglobin and bilirubin concentration, blood volume fraction (BVF) and vessel radius were extracted from model fitting of the spectra. The rats were monitored for 24 hours after treatment. Results showed that there was no significant variation in the vessel size or BVF after the treatments. However, the PDT caused a significant increase in the met-hemoglobin and bilirubin concentrations, indicating an important blood breakdown. These results may provide an important clue on how the damage establishment takes place, helping to understand the effect of the combination of those techniques in order to verify the existence of a known synergistic effect.

DNA repair in Bloom's syndrome skin fibroblasts after ultraviolet light irradiation

International Nuclear Information System (INIS)

Kurihara, Takayuki; Inoue, Masao; Kawashima, Hiroko; Yagi, Takashi; Takebe, Hiraku.

1981-01-01

Skin fibroblasts from a patient with Bloom's syndrome (86NoKi) were assayed for various DNA repair activities after ultraviolet light (UV) irradiation. Cultured fibroblasts as well as lymphocytes obtained from this patient showed a high frequency of spontaneous sister chromatid exchanges (SCEs). There was no significant difference between 86NoKi fibroblasts and skin fibroblasts from normal donors in the sensitivity to UV as measured by inactivation of colony forming activity, the capacity of host-cell reactivation (HCR) of UV-irradiated virus, and the amount of unscheduled DNA synthesis (UDS) after UV irradiation. However, the yield of UV-induced SCEs in 86NoKi cells was significantly higher than that in normal cells. (author)

Cancer associated fibroblasts (CAFs) are activated in cutaneous basal cell carcinoma and in the peritumoural skin

DEFF Research Database (Denmark)

Omland, Silje Haukali; Wettergren, Erika Elgstrand; Mollerup, Sarah

2017-01-01

of chemokines involved in tumour progression and immunosuppression (CXCL12, CCL17). Fibroblasts from chronically sun-exposed skin near tumours show gene expression patterns resembling that of CAFs, indicating that stromal fibroblasts in cancer-free surgical BCC margins exhibit a tumour promoting phenotype.......BACKGROUND: Cutaneous basal cell carcinoma (BCC) is the commonest cancer worldwide. BCC is locally invasive and the surrounding stromal microenvironment is pivotal for tumourigenesis. Cancer associated fibroblasts (CAFs) in the microenvironment are essential for tumour growth in a variety...... of neoplasms but their role in BCC is poorly understood. METHODS: Material included facial BCC and control skin from the peritumoural area and from the buttocks. With next-generation sequencing (NGS) we compared mRNA expression between BCC and peritumoural skin. qRT-PCR, immunohistochemical...

Cancer associated fibroblasts (CAFs) are activated in cutaneous basal cell carcinoma and in the peritumoural skin

DEFF Research Database (Denmark)

Omland, Silje Haukali; Wettergren, Erika Elgstrand; Mourier, Tobias

2017-01-01

of chemokines involved in tumour progression and immunosuppression (CXCL12, CCL17). Fibroblasts from chronically sun-exposed skin near tumours show gene expression patterns resembling that of CAFs, indicating that stromal fibroblasts in cancer-free surgical BCC margins exhibit a tumour promoting phenotype.......Background: Cutaneous basal cell carcinoma (BCC) is the commonest cancer worldwide. BCC is locally invasive and the surrounding stromal microenvironment is pivotal for tumourigenesis. Cancer associated fibroblasts (CAFs) in the microenvironment are essential for tumour growth in a variety...... of neoplasms but their role in BCC is poorly understood. Methods: Material included facial BCC and control skin from the peritumoural area and from the buttocks. With next-generation sequencing (NGS) we compared mRNA expression between BCC and peritumoural skin. qRT-PCR, immunohistochemical...

Further search for selectivity of positron annihilation in the skin and cancerous systems

International Nuclear Information System (INIS)

Liu Guang; Chen Hongmin; Chakka, Lakshmi; Cheng Meiling; Gadzia, Joseph E.; Suzuki, R.; Ohdaira, T.; Oshima, N.; Jean, Y.C.

2008-01-01

Positronium annihilation lifetime (PAL) spectroscopy and Doppler broadening energy spectra (DBES) have been used to search for selectivity and sensitivity for cancerous skin samples with and without cancer. This study is to further explore the melanoma cancerous system and other different types of skin samples. We found that the S parameter in melanoma skin samples cut at 0.39 mm depth from the same patient's skin is smaller than near the skin surface. However in 10 melanoma samples from different patients, the S parameters vary significantly. Similarly, among 10 normal skin samples without cancer, the S parameters also vary largely among different patients. To understand the sensitivity of PAS as a tool to detect cancer formation at the early stage, we propose a controlled and systematic study of in vivo experiments using UV-induced cancer skin from living animals

Free water content and monitoring of healing processes of skin burns studied by microwave dielectric spectroscopy in vivo

International Nuclear Information System (INIS)

Hayashi, Yoshihito; Miura, Nobuhiro; Shinyashiki, Naoki; Yagihara, Shin

2005-01-01

We have investigated the dielectric properties of human skin in vivo at frequencies up to 10 GHz using a time-domain reflectometry method with open-ended coaxial probes. Since γ-dispersion results from the reorientation of free water molecules, the free water content of skin is quantitatively determined by dielectric measurements. The free water content of finger skin increased by about 10% after soaking in 37 0 C water for 30 min, and it systematically decreased again through the drying process, as expected. Thus this analytical method has been applied to the study of skin burns. The free water content of burned human cheek skin due to hydrofluoric acid was significantly lower than that of normal skin, and the burned skin recovered through the healing process. In the case of a human hand skin burn due to heat, although the free water content was almost the same as that of normal skin at the beginning, it decreased during the healing process for the first 10 days, then began to increase. Although the number of test subjects was one for each experiment, it was shown that free water content is a good indicator for evaluating skin health and can be well monitored by dielectric spectroscopy

Aerial radiological survey of the area surrounding the St. Lucie Power Plant, Fort Pierce, Florida

International Nuclear Information System (INIS)

Feimster, E.L.

1979-06-01

An airborne radiological survey of an 1100 km 2 area surrounding the St. Lucie Power Plant was conducted 1 to 8 March 1977. Detected radioisotopes and their associated gamma ray exposure rates were consistent with that expected from the normal background emitters. Count rates observed at 150 m altitude are converted to equivalent exposure rates at 1 m above the ground and are presented in the form of an isopleth map. Ground exposure rates measured with small portable instruments and soil sample analysis agreed with the airborne data. Geological data are presented in an isopleth map of rock and soil types. Also included is a brief description of the vegetation and terrain surrounding the site

Preliminary observations on differences in the Raman spectra of cancerous and noncancerous cells and connective tissue of human skin

Science.gov (United States)

Short, Michael A.; Lui, Harvey; McLean, David I.; Zeng, Haishan; Alajlan, Abdulmajeed; Chen, Michael X.

2005-04-01

A less invasive method of reliably detecting skin cancers is required. Raman spectroscopy is just one of several spectroscopic methods that look promising, but are not yet sufficiently reliable. More information is needed on how and why the Raman spectra of cancerous skin tissue is different from its normal counterpart. We have used confocal micro-Raman spectroscopy with a spatial resolution of about a micron to obtain spectra of unstained thin sections of human skin. We found that there were clear differences in the Raman spectra between cancerous and non-cancerous tissue both in cells and in the connective tissue. The DNA contribution to the spectra was generally stronger in malignant cells than normal ones. In regions of the dermis far away from the tumor one obtains the usual collagen spectra of normal skin, but adjacent to the tumor the spectra no longer appeared to be those of native collagen.

Chronic ultraviolet exposure-induced p53 gene alterations in sencar mouse skin carcinogenesis model

International Nuclear Information System (INIS)

Tong, Ying; Smith, M.A.; Tucker, S.B.

1997-01-01

Alterations of the tumor suppressor gene p53 have been found in ultraviolet radiation (UVR) related human skin cancers and in UVR-induced murine skin tumors. However, links between p53 gene alterations and the stages of carcinogenesis induced by UVR have not been clearly defined. We established a chronic UVR exposure-induced Sencar mouse skin carcinogenesis model to determine the frequency of p53 gene alterations in different stages of carcinogenesis, including UV-exposed skin, papillomas, squamous-cell carcinomas (SCCs), and malignant spindle-cell tumors (SCTs). A high incidence of SCCs and SCTs were found in this model. Positive p53 nuclear staining was found in 10137 (27%) of SCCs and 12124 (50%) of SCTs, but was not detected in normal skin or papillomas. DNA was isolated from 40 paraffin-embedded normal skin, UV-exposed skin, and tumor sections. The p53 gene (exons 5 and 6) was amplified from the sections by using nested polymerase chain reaction (PCR). Subsequent single-strand conformation polymorphism (SSCP) assay and sequencing analysis revealed one point mutation in exon 6 (coden 193, C → A transition) from a UV-exposed skin sample, and seven point mutations in exon 5 (codens 146, 158, 150, 165, and 161, three C → T, two C → A, one C → G, and one A → T transition, respectively) from four SCTs, two SCCs and one UV-exposed skin sample. These experimental results demonstrate that alterations in the p53 gene are frequent events in chronic UV exposure-induced SCCs and later stage SCTs in Sencar mouse skin. 40 refs., 5 figs., 1 tab

Predicting chemically-induced skin reactions. Part II: QSAR models of skin permeability and the relationships between skin permeability and skin sensitization

Energy Technology Data Exchange (ETDEWEB)

Alves, Vinicius M. [Laboratory of Molecular Modeling and Design, Faculty of Pharmacy, Federal University of Goiás, Goiânia, GO 74605-220 (Brazil); Laboratory for Molecular Modeling, Division of Chemical Biology and Medicinal Chemistry, Eshelman School of Pharmacy, University of North Carolina, Chapel Hill, NC 27599 (United States); Muratov, Eugene [Laboratory for Molecular Modeling, Division of Chemical Biology and Medicinal Chemistry, Eshelman School of Pharmacy, University of North Carolina, Chapel Hill, NC 27599 (United States); Laboratory of Theoretical Chemistry, A.V. Bogatsky Physical–Chemical Institute NAS of Ukraine, Odessa 65080 (Ukraine); Fourches, Denis [Laboratory for Molecular Modeling, Division of Chemical Biology and Medicinal Chemistry, Eshelman School of Pharmacy, University of North Carolina, Chapel Hill, NC 27599 (United States); Strickland, Judy; Kleinstreuer, Nicole [ILS/Contractor supporting the NTP Interagency Center for the Evaluation of Alternative Toxicological Methods (NICEATM), P.O. Box 13501, Research Triangle Park, NC 27709 (United States); Andrade, Carolina H. [Laboratory of Molecular Modeling and Design, Faculty of Pharmacy, Federal University of Goiás, Goiânia, GO 74605-220 (Brazil); Tropsha, Alexander, E-mail: alex_tropsha@unc.edu [Laboratory for Molecular Modeling, Division of Chemical Biology and Medicinal Chemistry, Eshelman School of Pharmacy, University of North Carolina, Chapel Hill, NC 27599 (United States)

2015-04-15

Skin permeability is widely considered to be mechanistically implicated in chemically-induced skin sensitization. Although many chemicals have been identified as skin sensitizers, there have been very few reports analyzing the relationships between molecular structure and skin permeability of sensitizers and non-sensitizers. The goals of this study were to: (i) compile, curate, and integrate the largest publicly available dataset of chemicals studied for their skin permeability; (ii) develop and rigorously validate QSAR models to predict skin permeability; and (iii) explore the complex relationships between skin sensitization and skin permeability. Based on the largest publicly available dataset compiled in this study, we found no overall correlation between skin permeability and skin sensitization. In addition, cross-species correlation coefficient between human and rodent permeability data was found to be as low as R{sup 2} = 0.44. Human skin permeability models based on the random forest method have been developed and validated using OECD-compliant QSAR modeling workflow. Their external accuracy was high (Q{sup 2}{sub ext} = 0.73 for 63% of external compounds inside the applicability domain). The extended analysis using both experimentally-measured and QSAR-imputed data still confirmed the absence of any overall concordance between skin permeability and skin sensitization. This observation suggests that chemical modifications that affect skin permeability should not be presumed a priori to modulate the sensitization potential of chemicals. The models reported herein as well as those developed in the companion paper on skin sensitization suggest that it may be possible to rationally design compounds with the desired high skin permeability but low sensitization potential. - Highlights: • It was compiled the largest publicly-available skin permeability dataset. • Predictive QSAR models were developed for skin permeability. • No concordance between skin

Predicting chemically-induced skin reactions. Part II: QSAR models of skin permeability and the relationships between skin permeability and skin sensitization

International Nuclear Information System (INIS)

Alves, Vinicius M.; Muratov, Eugene; Fourches, Denis; Strickland, Judy; Kleinstreuer, Nicole; Andrade, Carolina H.; Tropsha, Alexander

2015-01-01

Skin permeability is widely considered to be mechanistically implicated in chemically-induced skin sensitization. Although many chemicals have been identified as skin sensitizers, there have been very few reports analyzing the relationships between molecular structure and skin permeability of sensitizers and non-sensitizers. The goals of this study were to: (i) compile, curate, and integrate the largest publicly available dataset of chemicals studied for their skin permeability; (ii) develop and rigorously validate QSAR models to predict skin permeability; and (iii) explore the complex relationships between skin sensitization and skin permeability. Based on the largest publicly available dataset compiled in this study, we found no overall correlation between skin permeability and skin sensitization. In addition, cross-species correlation coefficient between human and rodent permeability data was found to be as low as R 2 = 0.44. Human skin permeability models based on the random forest method have been developed and validated using OECD-compliant QSAR modeling workflow. Their external accuracy was high (Q 2 ext = 0.73 for 63% of external compounds inside the applicability domain). The extended analysis using both experimentally-measured and QSAR-imputed data still confirmed the absence of any overall concordance between skin permeability and skin sensitization. This observation suggests that chemical modifications that affect skin permeability should not be presumed a priori to modulate the sensitization potential of chemicals. The models reported herein as well as those developed in the companion paper on skin sensitization suggest that it may be possible to rationally design compounds with the desired high skin permeability but low sensitization potential. - Highlights: • It was compiled the largest publicly-available skin permeability dataset. • Predictive QSAR models were developed for skin permeability. • No concordance between skin sensitization and

Effects of the association of chemotherapy and radiotherapy on normal mouse skin

International Nuclear Information System (INIS)

Guigon, M.; Frindel, E.; Tubiana, M.; Hewitt, J.

1978-01-01

The effects of an association of chemotherapy and radiotherapy on the skin of mice were studied. The following drugs were tested; hydroxyurea, Methotrexate, and Bleomycin; they were injected at various times before irradiation. When hydroxyurea was injected 15 min before irradiation, the early and late cutaneous reactions were significantly lower than with irradiation alone. This protective effect corresponds to about 500 rad for an irradiation dose of 2500 rad. In the other protocols, we observed either no increase of the effect as a result of adjuvant chemotherapy (Methotrexate) or slightly increased reactions

Gene Expression Architecture of Mouse Dorsal and Tail Skin Reveals Functional Differences in Inflammation and Cancer | Office of Cancer Genomics

Science.gov (United States)

Inherited germline polymorphisms can cause gene expression levels in normal tissues to differ substantially between individuals. We present an analysis of the genetic architecture of normal adult skin from 470 genetically unique mice, demonstrating the effect of germline variants, skin tissue location, and perturbation by exogenous inflammation or tumorigenesis on gene signaling pathways.

Increased tissue leptin hormone level and mast cell count in skin tags: A possible role of adipoimmune in the growth of benign skin growths

Directory of Open Access Journals (Sweden)

El Safoury Omar

2010-01-01

Full Text Available Background: Skin tags (ST are common tumors. They mainly consist of loose fibrous tissue and occur on the neck and major flexures as small, soft, pedunculated protrusions. Decrease in endocrine, hormone level and other factors are thought to play a role in the evolution of ST. Leptin is an adipocyte-derived hormone that acts as a major regulatory hormone for food intake and energy homeostasis. Leptin deficiency or resistance can result in profound obesity and diabetes in humans. A role of mast cell in the pathogenesis of ST is well recognized. Aims: To investigate the role of leptin in the pathogenesis of ST and to clarify whether there is a correlation between mast cell count and leptin level in ST. Methods: Forty-five skin biopsies were taken from 15 patients with ST. From each patient, a biopsy of a large ST (length >4 mm, a small ST (length <2 mm and a normal skin biopsy (as a control were taken. The samples were processed for leptin level. Skin biopsies were stained with hematoxylin and eosin and toluidine blue-uranyl nitrate metachromatic method for mast cell count was used. Results: There was a significant increased level of leptin in the ST compared to the normal skin. It was highly significant in small ST than in big ST (P = 0.0001 and it was highly significant in small and big ST compared to controls, P = 0.0001 and P = 0.001, respectively. There was a significant increase in mast cell count in the ST, which did not correlate with the increased levels of leptin. Conclusion: This is the first report to demonstrate that tissue leptin may play a role in the pathogenesis of ST. The significant increase in the levels of leptin and mast cell count in ST may indicate a possible role of adipoimmune in the benign skin growths.

El sol: ¿enemigo de nuestra piel? The sun: enemy of our skin?

Directory of Open Access Journals (Sweden)

Moraima Mora Ochoa

Full Text Available Actualmente existe una elevada mortalidad y morbilidad por cáncer de piel, lo cual representa un grave problema que va en aumento; por tal razón, en el presente estudio se revisó la bibliografía especializada sobre algunos aspectos de interés, tales como: interacción de las radiaciones solares sobre esta parte del organismo, efectos beneficiosos y perjudiciales, respuestas cutáneas normales y anormales, relación entre el cáncer de piel y las radiaciones ultravioletas, así como medidas de protección solar, las cuales permitirán mantener una piel sana y saludable.Currently, there is a high mortality and morbidity due to skin cancer, which represents an increasingly serious problem. Therefore, this study reviewed the specialized literature on some aspects of interest such as interaction of solar radiations on this part of the body, beneficial and harmful effects, normal and abnormal skin responses, relationship between skin cancer and ultraviolet radiations, as well as sun protection measures, which will allow us to maintain a healthy skin.

Progressive skin necrosis of a huge occipital encephalocele

Science.gov (United States)

Andarabi, Yasir; Nejat, Farideh; El-Khashab, Mostafa

2008-01-01

Objects: Progressive skin necrosis of giant occipital encephalocoele is an extremely rare complication found in neonates. Infection and ulceration of the necrosed skin may lead to meningitis or sepsis. We present here a neonate with giant occipital encephalocoele showing progressive necrosis during the first day of his life. Methods: A newborn baby was found to have a huge mass in the occipital region, which was covered by normal pink-purplish skin. During the last hours of the first day of his life, the sac started becoming ulcerated accompanied with a rapid color change in the skin, gradually turning darker and then black. The neonate was taken up for urgent excision and repair of the encephalocele. Two years after the operation, he appears to be well-developed without any neurological problems. Conclusion: Necrosis may have resulted from arterial or venous compromise caused by torsion of the pedicle during delivery or after birth. The high pressure inside the sac associated with the thin skin of the encephalocoele may be another predisposing factor. In view of the risk of ulceration and subsequent infection, urgent surgery of the necrotizing encephalocele is suggested. PMID:19753210

Progressive skin necrosis of a huge occipital encephalocele

Directory of Open Access Journals (Sweden)

Andarabi Yasir

2008-01-01

Full Text Available Objects: Progressive skin necrosis of giant occipital encephalocoele is an extremely rare complication found in neonates. Infection and ulceration of the necrosed skin may lead to meningitis or sepsis. We present here a neonate with giant occipital encephalocoele showing progressive necrosis during the first day of his life. Methods: A newborn baby was found to have a huge mass in the occipital region, which was covered by normal pink-purplish skin. During the last hours of the first day of his life, the sac started becoming ulcerated accompanied with a rapid color change in the skin, gradually turning darker and then black. The neonate was taken up for urgent excision and repair of the encephalocele. Two years after the operation, he appears to be well-developed without any neurological problems. Conclusion: Necrosis may have resulted from arterial or venous compromise caused by torsion of the pedicle during delivery or after birth. The high pressure inside the sac associated with the thin skin of the encephalocoele may be another predisposing factor. In view of the risk of ulceration and subsequent infection, urgent surgery of the necrotizing encephalocele is suggested.

Investigation of metalloproteins distributions in cytosol of hepatocellular carcinoma and its surrounding tissues by using synchrotron radiation X-ray fluorescence

International Nuclear Information System (INIS)

Gao Yuxi; Chen Chunying; Li Bai; Chai Zhifang; Huang Yuying; He Wei; Deng Guilong; Liu Yingbin

2004-01-01

Synchrotron radiation X-ray fluorescence (SRXRF) spectroscopy is an advanced quantitative multielemental analytical technique with space resolution of several μm and sensitivities in the μ g/g range. It can be used for keeping track of trace elements in biological samples after an electrophoretic separation. In this paper, proteins in cytosol of human hepatocellular carcinoma and the surrounding 'normal' tissue were separated with thin layer isoelectric focusing (IEF). The contents of metal ions in protein bands were determined by SRXRF. The results showed that the metal-containing proteins detected in the two samples were very much alike, but their distribution patterns were easily distinguishable. The contents of iron, zinc, and copper in bands from the surrounding 'normal' tissue were generally higher than that from hepatoma tissue, especially in Fe-containing proteins with pIs of 6.5, 7.7, 8.0 and less than 3.5, Cu-containing proteins with PIs of 3.2, 4.9, 5.5, 5.9 and 6.5, as well as Zn-containing proteins with pI of 5.5 and 6.5. However, Fe contents in Fe-containing proteins of 4.0, and 7.0 from the hepatoma tissue were slight higher than that from the surrounding 'normal' tissue. Further studies are necessary to validate the universality and the biological meaning of the pattern. (authors)

Fluorescence excitation-emission matrix spectroscopy of vitiligo skin in vivo (Conference Presentation)

Science.gov (United States)

Zhao, Jianhua; Richer, Vincent; Al Jasser, Mohammed; Zandi, Soodabeh; Kollias, Nikiforos; Kalia, Sunil; Zeng, Haishan; Lui, Harvey

2016-02-01

Fluorescence signals depend on the intensity of the exciting light, the absorption properties of the constituent molecules, and the efficiency with which the absorbed photons are converted to fluorescence emission. The optical features and appearance of vitiligo have been explained primarily on the basis of reduced epidermal pigmentation, which results in abnormal white patches on the skin. The objective of this study is to explore the fluorescence properties of vitiligo and its adjacent normal skin using fluorescence excitation-emission matrix (EEM) spectroscopy. Thirty five (35) volunteers with vitiligo were acquired using a double-grating spectrofluorometer with excitation and emission wavelengths of 260-450 nm and 300-700 nm respectively. As expected, the most pronounced difference between the spectra obtained from vitiligo lesions compared to normally pigmented skin was that the overall fluorescence was much higher in vitiligo; these differences increased at shorter wavelengths, thus matching the characteristic spectral absorption of epidermal melanin. When comparing the fluorescence spectra from vitiligo to normal skin we detected three distinct spectral bands centered at 280nm, 310nm, and 335nm. The 280nm band may possibly be related to inflammation, whereas the 335 nm band may arise from collagen or keratin cross links. The source of the 310 nm band is uncertain; it is interesting to note its proximity to the 311 nm UV lamps used for vitiligo phototherapy. These differences are accounted for not only by changes in epidermal pigment content, but also by other optically active cutaneous biomolecules.

Demonstration of tyrosinase in the vitiligo skin of human beings by a sensitive fluorometric method as well as by 14C(U)-L-tyrosine incorporation into melanin

International Nuclear Information System (INIS)

Husain, I.; Vijayan, E.; Ramaiah, A.; Pasricha, J.S.; Madan, N.C.

1982-01-01

Tyrosinase activity (Monophenol, dihydroxyphenylalanine: oxygen oxidoreductase EC 1.14.18.1) in vitiligo and normal epidermal homogenates of skin from human beings was measured by estimating beta 3,4-dihydroxyphenylalanine (dopa) by a highly sensitive fluorometric method described in this paper. The tyrosine activity in the vitiligo skin was about 4 to 37% of corresponding normal skin. The activity of tyrosinase in normal human skin from different individuals and from different regions of the body was in the range of 4 to 140 picomoles of beta 3,4-dihydroxyphenylalanine formed per min/mg protein of epidermal homogenate. The enzyme from vitiligo and normal skin was severely inhibited by substance(s) of low molecular weight. The enzyme exhibits a lag of about 4 hr in the absence of added beta 3,4-dihydroxyphenylalanine and 1 hr in presence of 5 microM dopa. Tyrosinase from the normal and vitiligo skin was inhibited by excess concentration of tyrosine. The homogenates from vitiligo skin could synthesize melanin from C14(U)-L-Tyrosine. The rate of tyrosine incorporation into melanin by the epidermal homogenates is increased by 3,4-dihydroxyphenylalanine (dopa) disproportionate to its effect on tyrosinase activity. Based on the data presented in this paper it is concluded that melanocytes are present in the vitiligo skin. A tentative hypothesis is put forward to explain the lack of melanin synthesis by the vitiligo skin under in vivo conditions, although melanocytes are present

Pathological changes after bone marrow and skin allograft transplantation in rats inflicted with severe combined radiation-burn injury

International Nuclear Information System (INIS)

Zheng Huaien; Cheng Tianmin; Yan Yongtang

1994-01-01

Bone marrow and skin allografts from the same donor were transplanted to rats inflicted with 8 Gy γ-radiation combined with third degree burns of 15% body surface area within 6 hr post injury. Pathological changes of hematopoietic tissues and skin allografts were studied. All injured controls died within 7 days post injury without bone marrow regeneration; 50% of treated rats survived with living skin allografts on 50th day post injury. On days 100 and 480 post operation, grafted skin still survived well on recipients with normal ultrastructure. Epidermic cells of skin allografts proliferated on day 5, developed and repaired on day 10. Histological structure of the skin returned to normal on day 30 post operation. The regeneration of bone marrow appeared on 5th day, increased markedly on day 10, and almost completed on day 15 after bone marrow transplantation. However, the regeneration of lymphocytes in cortex of spleen and lymph nodes did not appear until day 15 of BMT. The results show that bone marrow and skin allograft transplantation at early time post injury in most severe combined radiation-burn injury have tremendous beneficial effects, and the skin allograft can survive for a long time

Skin graft

Science.gov (United States)

Skin transplant; Skin autografting; FTSG; STSG; Split thickness skin graft; Full thickness skin graft ... donor site. Most people who are having a skin graft have a split-thickness skin graft. This takes ...

Defects of filaggrin-like proteins in both lesional and nonlesional atopic skin.

Science.gov (United States)

Pellerin, Laurence; Henry, Julie; Hsu, Chiung-Yueh; Balica, Stéfana; Jean-Decoster, Catherine; Méchin, Marie-Claire; Hansmann, Britta; Rodriguez, Elke; Weindinger, Stefan; Schmitt, Anne-Marie; Serre, Guy; Paul, Carle; Simon, Michel

2013-04-01

Atopic dermatitis (AD) is a chronic inflammatory skin disease characterized by a disturbed epidermal barrier. In a subset of patients, this is explained by nonsense mutations in the gene encoding filaggrin (FLG). We sought to evaluate the respective role of FLG mutations and proinflammatory cytokines and to assess the expression of FLG, hornerin (HRNR), and FLG2, 2 FLG-like proteins, which are involved in epidermal barrier functions, in normal skin and both lesional and nonlesional skin of patients with AD. An FLG-genotyped cohort of 73 adults with AD and 73 aged-matched control subjects was analyzed by using immunohistochemistry and immunoblotting. Normal primary human keratinocytes were differentiated in either the absence or presence of IL-4, IL-13, and IL-25. Compared with control subjects, FLG, HRNR, and FLG2 were detected at significantly lower levels in the skin of patients with AD, irrespective of their FLG genotype. The reduction was greater in lesional compared with nonlesional skin. In addition, the proFLG/FLG ratio was found to be higher in the skin of wild-type patients than in control subjects. Cytokine treatment of keratinocytes induced a dramatic reduction in FLG, FLG2, and HRNR expression both at the mRNA and protein levels. The stratum corneum of lesional but also clinically unaffected skin of adults with AD is abnormal, with reduced expression of FLG and FLG-like proteins. In addition to nonsense mutations, proinflammatory cytokines and some defects in the proFLG processing can contribute to the FLG downregulation. Our study suggests that skin inflammation reduces the expression of FLG-like proteins, contributing to the AD-related epidermal barrier dysfunction. Copyright © 2013 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

Effects of advanced glycation end-products (AGEs) on skin ...

African Journals Online (AJOL)

kappa B (NF-κB) localization and cell viability were measured in vivo. Keratinocytes from normal skin were cultured in AGE-enriched conditional media, and the cell viability, apoptosis, adhesion and migration were detected in order to find the ...

The use of allodermis prepared from Euro skin bank to prepare autologous tissue engineered skin for clinical use.

Science.gov (United States)

Deshpande, P; Ralston, D R; MacNeil, S

2013-09-01

Over the past two decades a range of 3D models for human skin have been described. Some include native collagen and intrinsic basement membrane proteins and fibroblasts, others are based on xenogeneic collagen or synthetic supports often without fibroblasts. The aim of this study was to look at the influence of media calcium, basement membrane and fibroblasts on the quality of 3D tissue engineered skin produced using human de-epidermized acellular dermis. In this study we deliberately used Euro skin as the source of the donor dermis to examine to what extent this could provide an effective dermal substrate for producing 3D skin for clinical use. Keratinocytes were cultured in the presence and absence of fibroblasts and both with and without basement membrane on decellularized dermis at calcium concentrations ranging from 250μM to 1.6mM over a period of 14 days. Results showed the formation of a well attached epithelium with many of the features of normal skin in the presence of a basement membrane. This was largely independent of the presence of fibroblasts and not greatly influenced by the concentration of calcium in the media. However there was a clear requirement for physiological levels of calcium in the formation of a stratified epithelium in the absence of a basement membrane. Copyright © 2013 Elsevier Ltd and ISBI. All rights reserved.

Skin Diseases: Cross-section of human skin

Science.gov (United States)

Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Cross-section of human skin Past Issues / Fall 2008 Table of Contents For ... Logical Images, Inc. I n the areas of skin health and skin diseases, the NIH's National Institute ...

Overexpression of Amyloid Precursor Protein Promotes the Onset of Seborrhoeic Keratosis and is Related to Skin Ageing.

Science.gov (United States)

Li, Yuanying; Wang, Yu; Zhang, Wei; Jiang, Leiwei; Zhou, Wenming; Liu, Zhi; Li, Shijun; Lu, Hongguang

2018-02-28

Seborrhoeic keratosis is an age-related skin disease. Amyloid precursor protein (APP) plays an important role in the pathogenesis of age-related Alzheimer's disease. The aim of this study was to elucidate the expression characteristics of APP in seborrhoeic keratosis tissues (n = 50), and explore whether the production of APP is related to the onset of seborrhoeic keratosis and skin ageing, including ultraviolet (UV)-induced ageing, as observed in normal skin (n = 79). The results of immunohistochemistry, Western blotting and quantitative real-time PCR showed that APP and its downstream products (i.e. amyloid-β42) were more highly expressed in seborrhoeic keratosis than in paired adjacent normal skin tissues. In contrast, the expression of its key secretase (i.e. β-secretase1) was generally low. Furthermore, APP expression was higher in UV-exposed than non-exposed skin sites, and expression in the older age group (61-85 years) was greater than that in the younger age group (41-60 years) in seborrhoeic keratosis tissues (pkeratosis and is a marker of skin ageing and UV damage. Further research will elucidate whether therapeutic mitigation of increased levels of APP in the skin might delay the onset of seborrhoeic keratosis and skin ageing.

Novel Approaches for Diagnosing Melanoma Skin Lesions Through Supervised and Deep Learning Algorithms.

Science.gov (United States)

Premaladha, J; Ravichandran, K S

2016-04-01

Dermoscopy is a technique used to capture the images of skin, and these images are useful to analyze the different types of skin diseases. Malignant melanoma is a kind of skin cancer whose severity even leads to death. Earlier detection of melanoma prevents death and the clinicians can treat the patients to increase the chances of survival. Only few machine learning algorithms are developed to detect the melanoma using its features. This paper proposes a Computer Aided Diagnosis (CAD) system which equips efficient algorithms to classify and predict the melanoma. Enhancement of the images are done using Contrast Limited Adaptive Histogram Equalization technique (CLAHE) and median filter. A new segmentation algorithm called Normalized Otsu's Segmentation (NOS) is implemented to segment the affected skin lesion from the normal skin, which overcomes the problem of variable illumination. Fifteen features are derived and extracted from the segmented images are fed into the proposed classification techniques like Deep Learning based Neural Networks and Hybrid Adaboost-Support Vector Machine (SVM) algorithms. The proposed system is tested and validated with nearly 992 images (malignant & benign lesions) and it provides a high classification accuracy of 93 %. The proposed CAD system can assist the dermatologists to confirm the decision of the diagnosis and to avoid excisional biopsies.

Predicting chemically-induced skin reactions. Part II: QSAR models of skin permeability and the relationships between skin permeability and skin sensitization

Science.gov (United States)

Alves, Vinicius M.; Muratov, Eugene; Fourches, Denis; Strickland, Judy; Kleinstreuer, Nicole; Andrade, Carolina H.; Tropsha, Alexander

2015-01-01

Skin permeability is widely considered to be mechanistically implicated in chemically-induced skin sensitization. Although many chemicals have been identified as skin sensitizers, there have been very few reports analyzing the relationships between molecular structure and skin permeability of sensitizers and non-sensitizers. The goals of this study were to: (i) compile, curate, and integrate the largest publicly available dataset of chemicals studied for their skin permeability; (ii) develop and rigorously validate QSAR models to predict skin permeability; and (iii) explore the complex relationships between skin sensitization and skin permeability. Based on the largest publicly available dataset compiled in this study, we found no overall correlation between skin permeability and skin sensitization. In addition, cross-species correlation coefficient between human and rodent permeability data was found to be as low as R2=0.44. Human skin permeability models based on the random forest method have been developed and validated using OECD-compliant QSAR modeling workflow. Their external accuracy was high (Q2ext = 0.73 for 63% of external compounds inside the applicability domain). The extended analysis using both experimentally-measured and QSAR-imputed data still confirmed the absence of any overall concordance between skin permeability and skin sensitization. This observation suggests that chemical modifications that affect skin permeability should not be presumed a priori to modulate the sensitization potential of chemicals. The models reported herein as well as those developed in the companion paper on skin sensitization suggest that it may be possible to rationally design compounds with the desired high skin permeability but low sensitization potential. PMID:25560673

Expression of telomerase reverse transcriptase in radiation-induced chronic human skin ulcer

International Nuclear Information System (INIS)

Zhao Po; Li Zhijun; Lu Yali; Zhong Mei; Gu Qingyang; Wang Dewen

2001-01-01

Objective: To investigate the expression of the catalytic subunit of telomerase, telomerase reverse transcriptase (TRT) and the possible relationship between the TRT and cancer transformation or poor healing in radiation-induced chronic ulcer of human skin. Methods: Rabbit antibody against human TRT and SP immunohistochemical method were used to detect TRT expression in 24 cases of formalin-fixed, paraffin-embed human skin chronic ulcer tissues induced by radiation, 5 cases of normal skin, 2 of burned skin, and 8 of carcinoma. Results: The positive rate for TRT was 58.3%(14/24) in chronic radiation ulcers, of which the strongly positive rate was 41.7%(10/24) and the weakly positive 16.7%(4/24), 0% in normal (0/5) and burned skin (0/2), and 100% in carcinoma (8/8). The strongly positive expression of TRT was observed almost always in the cytoplasm and nucleus of squamous epithelial cells of proliferative epidermis but the negative and partly weakly positive expression in the smooth muscles, endothelia of small blood vessels and capillaries, and fibroblasts. Chronic inflammtory cells, plasmacytes and lymphocytes also showed weakly positive for TRT. Conclusion: TRT expression could be involved in the malignant transformation of chronic radiation ulcer into squamous carcinoma, and in the poor healing caused by sclerosis of small blood vessels and lack of granulation tissue consisting of capillaries and fibroblasts

WE-AB-303-04: A Tissue Model of Cherenkov Emission From the Skin Surface During Megavoltage X-Ray Radiotherapy

Energy Technology Data Exchange (ETDEWEB)

Wiles, A. N.; Loyalka, S. K. [University of Missouri, Columbia, MO (United States); Izaguirre, E. W. [University of Missouri, Columbia, MO (United States); Baylor Scott & White Health, Temple, TX (United States)

2015-06-15

Purpose: To develop a tissue model of Cherenkov radiation emitted from the skin surface during external beam radiotherapy. Imaging Cherenkov radiation emitted from human skin allows visualization of the beam position and potentially surface dose estimates, and our goal is to characterize the optical properties of these emissions. Methods: We developed a Monte Carlo model of Cherenkov radiation generated in a semi-infinite tissue slab by megavoltage x-ray beams with optical transmission properties determined by a two-layered skin model. We separate the skin into a dermal and an epidermal layer in our model, where distinct molecular absorbers modify the Cherenkov intensity spectrum in each layer while we approximate the scattering properties with Mie and Rayleigh scattering from the highly structured molecular organization found in human skin. Results: We report on the estimated distributions of the Cherenkov wavelength spectrum, emission angles, and surface distribution for the modeled irradiated skin surface. The expected intensity distribution of Cherenkov radiation emitted from skin shows a distinct intensity peak around 475 nm, the blue region of the visible spectrum, between a pair of optical absorption bands in hemoglobin and a broad plateau beginning near 600 nm and extending to at least 700 nm where melanin and hemoglobin absorption are both low. We also find that the Cherenkov intensity decreases with increasing angle from the surface normal, the majority being emitted within 20 degrees of the surface normal. Conclusion: Our estimate of the spectral distribution of Cherenkov radiation emitted from skin indicates an advantage to using imaging devices with long wavelength spectral responsivity. We also expect the most efficient imaging to be near the surface normal where the intensity is greatest; although for contoured surfaces, the relative intensity across the surface may appear to vary due to decreasing Cherenkov intensity with increased angle from the

Skin blood flow from gas transport: helium xenon and laser Doppler compared

Energy Technology Data Exchange (ETDEWEB)

Neufeld, G.R.; Galante, S.R.; Whang, J.M.; DeVries, D.; Baumgardner, J.E.; Graves, D.J.; Quinn, J.A.

1988-03-01

A study was designed to compare three independent measures of cutaneous blood flow in normal healthy volunteers: xenon-133 washout, helium flux, and laser velocimetry. All measurements were confined to the volar aspect of the forearm. In a large group of subjects we found that helium flux through intact skin changes nonlinearly with the controlled local skin temperature whereas helium flux through stripped skin, which is directly proportional to skin blood flow, changes linearly with cutaneous temperature over the range 33 degrees to 42 degrees. In a second group of six volunteers we compared helium flux through stripped skin to xenon-133 washout (intact skin) at a skin temperature of 33 degrees, and we found an essentially linear relationship between helium flux and xenon measured blood flow. In a third group of subjects we compared helium flux blood flow (stripped skin) to laser doppler velocimetric (LDV) measurements (intact skin) at adjacent skin sites and found a nonlinear increase in the LDV skin blood flow compared to that determined by helium over the same temperature range. A possible explanation for the nonlinear increases of helium flux through intact skin and of LDV output with increasing local skin temperature is that they reflect more than a change in blood flow. They may also reflect physical changes in the stratum corneum, which alters its diffusional resistance to gas flux and its optical characteristics.

Skin blood flow from gas transport: helium xenon and laser Doppler compared

International Nuclear Information System (INIS)

Neufeld, G.R.; Galante, S.R.; Whang, J.M.; DeVries, D.; Baumgardner, J.E.; Graves, D.J.; Quinn, J.A.

1988-01-01

A study was designed to compare three independent measures of cutaneous blood flow in normal healthy volunteers: xenon-133 washout, helium flux, and laser velocimetry. All measurements were confined to the volar aspect of the forearm. In a large group of subjects we found that helium flux through intact skin changes nonlinearly with the controlled local skin temperature whereas helium flux through stripped skin, which is directly proportional to skin blood flow, changes linearly with cutaneous temperature over the range 33 degrees to 42 degrees. In a second group of six volunteers we compared helium flux through stripped skin to xenon-133 washout (intact skin) at a skin temperature of 33 degrees, and we found an essentially linear relationship between helium flux and xenon measured blood flow. In a third group of subjects we compared helium flux blood flow (stripped skin) to laser doppler velocimetric (LDV) measurements (intact skin) at adjacent skin sites and found a nonlinear increase in the LDV skin blood flow compared to that determined by helium over the same temperature range. A possible explanation for the nonlinear increases of helium flux through intact skin and of LDV output with increasing local skin temperature is that they reflect more than a change in blood flow. They may also reflect physical changes in the stratum corneum, which alters its diffusional resistance to gas flux and its optical characteristics

Spiritual and religious aspects of skin and skin disorders

Directory of Open Access Journals (Sweden)

Shenefelt PD

2014-08-01

Full Text Available Philip D Shenefelt,1 Debrah A Shenefelt2 1Dermatology and Cutaneous Surgery, University of South Florida, Tampa, 2Congregation Or Ahavah, Lutz, FL, USA Abstract: Skin and skin disorders have had spiritual aspects since ancient times. Skin, hair, and nails are visible to self and others, and touchable by self and others. The skin is a major sensory organ. Skin also expresses emotions detectable by others through pallor, coldness, "goose bumps", redness, warmth, or sweating. Spiritual and religious significances of skin are revealed through how much of the skin has been and continues to be covered with what types of coverings, scalp and beard hair cutting, shaving and styling, skin, nail, and hair coloring and decorating, tattooing, and intentional scarring of skin. Persons with visible skin disorders have often been stigmatized or even treated as outcasts. Shamans and other spiritual and religious healers have brought about healing of skin disorders through spiritual means. Spiritual and religious interactions with various skin disorders such as psoriasis, leprosy, and vitiligo are discussed. Religious aspects of skin and skin diseases are evaluated for several major religions, with a special focus on Judaism, both conventional and kabbalistic. Keywords: skin, skin disorders, spiritual, religious

Discrimination of collagen in normal and pathological dermis through polarization second harmonic generation

Science.gov (United States)

Su, Ping-Jung; Chen, Wei-Liang; Hong, Jin-Bon; Li, Tsung-Hsien; Wu, Ruei-Jr; Chou, Chen-Kuan; Lin, Sung-Jan; Dong, Chen-Yuan

2010-02-01

We used polarization-resolved, second harmonic generation (P-SHG) microscopy at single pixel resolution for medical diagnosis of pathological skin dermis, and found that P-SHG can be used to distinguish normal and dermal pathological conditions of keloid, morphea, and dermal elastolysis. We find that the histograms of the d33/d31 ratio for the pathological skins to contain two peak values and to be wider than that of the normal case, suggesting that the pathological dermal collagen fibers tend to be more structurally heterogeneous. Our work demonstrates that pixel-resolved, second-order susceptibility microscopy is effective for detecting heterogeneity in spatial distribution of collagen fibers.

Significant skin burns may occur with the use of a water balloon in HIFU treatment

Science.gov (United States)

Ritchie, Robert; Collin, Jamie; Wu, Feng; Coussios, Constantin; Leslie, Tom; Cranston, David

2012-10-01

HIFU is a minimally-invasive therapy suitable for treating selected intra-abdominal tumors. Treatment is safe although skin burns may occur due to pre-focal heating. HIFU treatment of a renal transplant tumor located in the left lower abdomen was undertaken in our centre. Treatment was performed prone, requiring displacement of the abdominal wall away from the treatment field using a water balloon, constructed of natural rubber latex and filled with degassed water. Intra-operatively, ultrasound imaging and physical examination of the skin directly over the focal region was normal. Immediately post-operative, a full-thickness skin burn was evident at the periphery of the balloon location, outside the expected HIFU path. Three possibilities may account for this complication. Firstly, the water balloon may have acted as a lens, focusing the HIFU to a neo-focus off axis. Secondly, air bubbles may have been entrapped between the balloon and the skin, causing heating at the interface. Finally, heating of the isolated water within the balloon may have been sufficient to cause burning. In this case, the placement of a water balloon caused a significant skin burn. Care should be taken in their use as burns, situated off axis, may occur even if the overlying skin appears normal.

Radiosensitization of mouse skin by oxygen and depletion of glutathione

International Nuclear Information System (INIS)

Stevens, Graham; Joiner, Michael; Joiner, Barbara; Johns, Helen; Denekamp, Juliana

1995-01-01

Purpose: To determine the oxygen enhancement ratio (OER) and shape of the oxygen sensitization curve of mouse foot skin, the extent to which glutathione (GSH) depletion radiosensitized skin, and the dependence of such sensitization on the ambient oxygen tension. Methods and Materials: The feet of WHT mice were irradiated with single doses of 240 kVp x-rays while mice were exposed to carbogen or gases with oxygen/nitrogen mixtures containing 8-100% O 2 . The anoxic response was obtained by occluding the blood supply to the leg of anesthetized mice with a tourniquet, surrounding the foot with nitrogen, and allowing the mice to breathe 10% O 2 . Further experiments were performed to assess the efficacy of this method to obtain an anoxic response. Radiosensitivity of skin was assessed using the acute skin-reaction assay. Glutathione levels were modified using two schedules of dl-buthionine sulphoximine (BSO) and diethylmaleate (DEM), which were considered to produce extensive and intermediate levels of GSH depletion in the skin of the foot during irradiation. Results: Carbogen caused the greatest radiosensitization of skin, with a reproducible enhancement of 2.2 relative to the anoxic response. The OER of 2.2 is lower than other reports for mouse skin. This may indicate that the extremes of oxygenation were not produced, although there was no direct evidence for this. When skin radiosensitivity was plotted against the logarithm of the oxygen tension in the ambient gas, a sigmoid curve with a K value of 17-21% O 2 in the ambient gas was obtained. Depletion of GSH caused minimal radiosensitization when skin was irradiated under anoxic or well-oxygenated conditions. Radiosensitization by GSH depletion was maximal at intermediate oxygen tensions of 10-21% O 2 in the ambient gas. Increasing the extent of GSH depletion led to increasing radiosensitization, with sensitization enhancement ratios of 1.2 and 1.1, respectively, for extensive and intermediate levels of GSH

Utilizing nonlinear optical microscopy to investigate the development of early cancer in nude mice in vivo

Science.gov (United States)

Wang, Chun-Chin; Li, Feng-Chieh; Lin, Sung-Jan; Lo, Wen; Dong, Chen-Yuan

2007-07-01

In this investigation, we used in vivo nonlinear optical microscopy to image normal and carcinogen DMBA treated skin tissues of nude mice. We acquired two-photon autofluroescence and second harmonic generation (SHG) images of the skin tissue, and applied the ASI (Autofluorescence versus SHG Index) to the resulting image. This allows us to visualize and quantify the interaction between mouse skin cells and the surrounding connective tissue. We found that as the imaging depth increases, ASI has a different distribution in the normal and the treated skin tissues. Since the DMBA treated skin eventually became squamous cell carcinoma (SCC), our results show that the physiological changes to mouse skin en route to become cancer can be effectively tracked by multiphoton microscopy. We envision this approach to be effective in studying tumor biology and tumor treatment procedures.

Tight Skin 2 Mice Exhibit Delayed Wound Healing Caused by Increased Elastic Fibers in Fibrotic Skin.

Science.gov (United States)

Long, Kristen B; Burgwin, Chelsea M; Huneke, Richard; Artlett, Carol M; Blankenhorn, Elizabeth P

2014-09-01

Rationale: The Tight Skin 2 (Tsk2) mouse model of systemic sclerosis (SSc) has many features of human disease, including tight skin, excessive collagen deposition, alterations in the extracellular matrix (ECM), increased elastic fibers, and occurrence of antinuclear antibodies with age. A tight skin phenotype is observed by 2 weeks of age, but measurable skin fibrosis is only apparent at 10 weeks. We completed a series of wound healing experiments to determine how fibrosis affects wound healing in Tsk2/+ mice compared with their wild-type (WT) littermates. Method: We performed these experiments by introducing four 4 mm biopsy punched wounds on the back of each mouse, ventral of the midline, and observed wound healing over 10 days. Tsk2/+ mice showed significantly delayed wound healing and increased wound size compared with the WT littermates at both 5 and 10 weeks of age. We explored the potential sources of this response by wounding Tsk2/+ mice that were genetically deficient either for the NLRP3 inflammasome (a known fibrosis mediator), or for elastic fibers in the skin, using a fibulin-5 knockout. Conclusion: We found that the loss of elastic fibers restores normal wound healing in the Tsk2/+ mouse and that the loss of the NLRP3 inflammasome had no effect. We conclude that elastic fiber dysregulation is the primary cause of delayed wound healing in the Tsk2/+ mouse and therapies that promote collagen deposition in the tissue matrix in the absence of elastin deposition might be beneficial in promoting wound healing in SSc and other diseases.

Evaluation of pH of bathing soaps and shampoos for skin and hair care

Directory of Open Access Journals (Sweden)

Jose Tarun

2014-01-01

Full Text Available Background: Normal healthy skin has potential of hydrogen (pH range of 5.4-5.9 and a normal bacterial flora. Use of soap with high pH causes an increase in skin pH, which in turn causes an increase in dehydrative effect, irritability and alteration in bacterial flora. The majority of soaps and shampoos available in the market do not disclose their pH. Aims and Objectives: The aim of this study was to assess the pH of different brands of bathing soaps and shampoos available in the market. Materials and Methods: The samples of soaps and shampoos were collected from shops in the locality. The samples of different brands are coded before the analysis of the pH. Solution of each sample was made and pH was measured using pH meter. Results: Majority of the soaps have a pH within the range of 9-10. Majority of the shampoos have a pH within the range of 6-7. Conclusions: The soaps and shampoos commonly used by the population at large have a pH outside the range of normal skin and hair pH values. Therefore, it is hoped that before recommending soap to patient especially those who have sensitive and acne prone skin, due consideration is given to the pH factor and also that manufacturers will give a thought to pH of soaps and shampoos manufactured by them, so that their products will be more skin and hair friendly.

Dissipation of Impact Stress Waves within the Artificial Blasting Damage Zone in the Surrounding Rocks of Deep Roadway

Directory of Open Access Journals (Sweden)

Jianguo Ning

2016-01-01

Full Text Available Artificial explosions are commonly used to prevent rockburst in deep roadways. However, the dissipation of the impact stress wave within the artificial blasting damage zone (ABDZ of the rocks surrounding a deep roadway has not yet been clarified. The surrounding rocks were divided into the elastic zone, blasting damage zone, plastic zone, and anchorage zone in this research. Meanwhile, the ABDZ was divided into the pulverizing area, fractured area, and cracked area from the inside out. Besides, the model of the normal incidence of the impact stress waves in the ABDZ was established; the attenuation coefficient of the amplitude of the impact stress waves was obtained after it passed through the intact rock mass, and ABDZ, to the anchorage zone. In addition, a numerical simulation was used to study the dynamic response of the vertical stress and impact-induced vibration energy in the surrounding rocks. By doing so, the dissipation of the impact stress waves within the ABDZ of the surrounding rocks was revealed. As demonstrated in the field application, the establishment of the ABDZ in the surrounding rocks reduced the effect of the impact-induced vibration energy on the anchorage support system of the roadway.

Evaluation of entrance surface-skin doses in animals submitted on exams of abdomen in veterinary radiology using Tl dosimetry

International Nuclear Information System (INIS)

Veneziani, G. R.; Matsushima, L. C.; Campos, L. L.; Filho, A. M.

2014-08-01

The radiation protection has recently gained considerable attention in human medicine. In veterinary medicine has been some advances in radiodiagnostic and therapy for domestic animal like dogs and cats. It is notable the increase of the costs with domestic animals that are considered, by many people in the whole world, like members of family. However, an important parameter that must be taken into account is the increasing use of computed tomography and other equipment s that uses ionizing radiation, which may lead to comparatively high exposure of critical organs. The radiation dose is determined by the balance between therapeutic benefit and possible damage to surrounding normal tissues. This study aimed the evaluation of entrance surface-skin doses in dogs submitted to radiodiagnostic procedures of abdomen using the technique of thermoluminescent dosimetry (TLD). The radiation doses were measured using thermoluminescent dosimeters of LiF:Mg,Ti (TLD 100) and a dog phantom made with a plastic container, proportional to the dog size, fulfilled with water. (Author)

Evaluation of entrance surface-skin doses in animals submitted on exams of abdomen in veterinary radiology using Tl dosimetry

Energy Technology Data Exchange (ETDEWEB)

Veneziani, G. R.; Matsushima, L. C.; Campos, L. L. [Instituto de Pesquisas Energeticas e Nucleares, Gerencia de Metrologia das Radiacoes / CNEN, Av. Lineu Prestes 2242, Cidade Universitaria, 05508-000 Sao Paulo (Brazil); Filho, A. M., E-mail: venezianigr@gmail.com [Centro Universitario de Rio Petro - UNIRP, Rodovia Br 153 (Transbrasiliana), Km. 69 Sao Jose do Rio Preto, Sao Paulo (Brazil)

2014-08-15

The radiation protection has recently gained considerable attention in human medicine. In veterinary medicine has been some advances in radiodiagnostic and therapy for domestic animal like dogs and cats. It is notable the increase of the costs with domestic animals that are considered, by many people in the whole world, like members of family. However, an important parameter that must be taken into account is the increasing use of computed tomography and other equipment s that uses ionizing radiation, which may lead to comparatively high exposure of critical organs. The radiation dose is determined by the balance between therapeutic benefit and possible damage to surrounding normal tissues. This study aimed the evaluation of entrance surface-skin doses in dogs submitted to radiodiagnostic procedures of abdomen using the technique of thermoluminescent dosimetry (TLD). The radiation doses were measured using thermoluminescent dosimeters of LiF:Mg,Ti (TLD 100) and a dog phantom made with a plastic container, proportional to the dog size, fulfilled with water. (Author)

Biologic changes due to long-wave ultraviolet irradiation on human skin: ultrastructural study

International Nuclear Information System (INIS)

Kumakiri, M.; Hashimoto, K.; Willis, I.

1977-01-01

Alteration of the skin induced by single and repeated long-wave ultraviolet (UVA) exposures was studied. Following a single exposure to relatively large doses of UVA, pronounced dermal damage was observed. In the papillary dermis, superficial dermal vessels showed widely open endothelial gaps and extravasation of blood cells. Marked changes of fibroblasts were also seen in the superficial dermis. In the reticular dermis, extravascular fibrin deposition was seen. After repeated exposures to UVA the formation of cross-banded filamentous aggregations (''Zebra bodies'') was observed in the superficial and reticular dermis. These were often found in amorphous masses surrounding the blood vessels. These striking dermal alterations were absent in skin irradiated by solar stimulating radiation and in control skin. Dyskeratotic ''sunburn cells'' were occasionally seen in the epidermis after single as well as repeated exposures to UVA. The number of these cells was less than that seen after a single exposure to solar simulating radiation

Methylquercetins stimulate melanin biosynthesis in a three-dimensional skin model.

Science.gov (United States)

Yamauchi, Kosei; Mitsunaga, Tohru

2018-03-01

In a previous study, we found that both synthetic 3-O-methylquercetin (3MQ) and 3,4',7-O-trimethylquercetin (34'7TMQ) increased extracellular melanin content. 34'7TMQ increased the activity of melanogenic enzymes by stimulating the p38 pathway and the expression of microphthalmia-associated transcription factor (MITF). In contrast, 3MQ increased the activity of melanogenic enzymes without the involvement of MITF, which suggests that 3MQ inhibits the degradation of melanogenic enzymes. In the present study, we investigated the effects of 3MQ and 34'7TMQ on melanogenesis in normal human melanocytes and using a commercial three-dimensional (3D) skin model system. Both 3MQ and 34'7TMQ elongated the dendrites of normal human melanocytes from a Caucasian donor, but did not stimulate melanogenesis in the melanocytes. In the 3D skin model, which included melanocytes from an Asian donor, 3MQ and 34'7TMQ increased and elongated the melanocytes and showed a tendency to stimulate melanogenesis. These results suggest that 3MQ and 34'7TMQ could be put to practical use in skin care products and agents aimed at preventing hair graying.

Proteome Analysis of Human Sebaceous Follicle Infundibula Extracted from Healthy and Acne-Affected Skin

Science.gov (United States)

Bek-Thomsen, Malene; Lomholt, Hans B.; Scavenius, Carsten; Enghild, Jan J.; Brüggemann, Holger

2014-01-01

Acne vulgaris is a very common disease of the pilosebaceous unit of the human skin. The pathological processes of acne are not fully understood. To gain further insight sebaceous follicular casts were extracted from 18 healthy and 20 acne-affected individuals by cyanoacrylate-gel biopsies and further processed for mass spectrometry analysis, aiming at a proteomic analysis of the sebaceous follicular casts. Human as well as bacterial proteins were identified. Human proteins enriched in acne and normal samples were detected, respectively. Normal follicular casts are enriched in proteins such as prohibitins and peroxiredoxins which are involved in the protection from various stresses, including reactive oxygen species. By contrast, follicular casts extracted from acne-affected skin contained proteins involved in inflammation, wound healing and tissue remodeling. Among the most distinguishing proteins were myeloperoxidase, lactotransferrin, neutrophil elastase inhibitor and surprisingly, vimentin. The most significant biological process among all acne-enriched proteins was ‘response to a bacterium’. Identified bacterial proteins were exclusively from Propionibacterium acnes. The most abundant P. acnes proteins were surface-exposed dermatan sulphate adhesins, CAMP factors, and a so far uncharacterized lipase in follicular casts extracted from normal as well as acne-affected skin. This is a first proteomic study that identified human proteins together with proteins of the skin microbiota in sebaceous follicular casts. PMID:25238151

[The application of delayed skin grafting combined traction in severe joint cicatricial contracture].

Science.gov (United States)

Xu, Zihan; Zhang, Zhenxin; Wang, Benfeng; Sun, Yaowen; Guo, Yadong; Gao, Wenjie; Qin, Gaoping

2014-11-01

To investigate the effect of delayed skin grafting combined traction in severe joint cicatricial contracture. At the first stage, the joint cicatricial contracture was released completely with protection of vessels, nerves and tendons. The wound was covered with allogenetic skin or biomaterials. After skin traction for 7-14 days, the joint could reach the extension position. Then the skin graft was performed on the wound. 25 cases were treated from Mar. 2000 to May. 2013. Primary healing was achieved at the second stage in all the cases. The skin graft had a satisfactory color and elasticity. Joint function was normal. All the patients were followed up for 3 months to 11 years with no hypertrophic scar and contraction relapse, except for one case who didn' t have enough active exercise on shoulder joint. Delayed skin grafting combined traction can effectively increase the skin graft survival rate and improve the joint function recovery.

Simultaneous Occurrence of Periodontal and Skin Abscesses in a ...

African Journals Online (AJOL)

Pre-operative quantitative analysis of plasma CRP was 1500mg/l, moderate growth of Staphylococcus aureus and Porphyromonas gingivalis were isolated from the skin and periodontal pus respectively and basic heamatological values were within normal range. Intensive non-surgical periodontal therapy was done at ...

Radio-induced fibrosis of skin: contribution to its development and treatment

International Nuclear Information System (INIS)

Vozenin-Brotons, Marie-Catherine

1999-01-01

Fibrosis of skin is frequently observed after therapeutic and accidental irradiations, and is characterized by the appearance of activated fibroblasts called myo-fibroblasts and the accumulation of extracellular matrix compounds. We postulated that radiation fibrosis could be considered as a chronic scar, where constant production of activating signals are emitted, whereas no negative feed back regulation occur. However, recent studies demonstrated that radiation-induced fibrosis could be treated using therapeutic agents like the superoxide dismutase. In order to better understand the mechanisms leading to skin fibrosis, we studied both the early reactions and the late fibrotic tissue induced by high radiation doses in normal skin. In particular, we investigated in the role of growth factors in these reactions. The synthesis of TGF-β1 was found to be increased, both the epidermis and the dermis, immediately after irradiation. This overexpression sustained during the development and the persistence phases of fibrosis, suggesting that the immediate cellular response induce a cascade of activation for genes and proteins which will result in the late effect of radiation in skin. Furthermore, these observations showed that the TGF-β1 could be a target for anti-fibrotic treatment. In order to test this hypothesis and to investigate further in the mechanisms leading to fibrosis regression after SOD treatment, we develop normal and fibrosis-like reconstructed skin models. These reconstructed skins were treated with liposomal and carrier-free Cu/Zn SOD, and examined for their effects on cell number, apoptosis and phenotypic differentiation. The results showed that SOD did not induce myo-fibroblast cell death or apoptosis whereas it significantly reduced TGF-β1 expression, thus demonstrating that SOD might be considered as a potent antagonist of the major fibro-genic growth factor. We also found that SOD significantly lowered the levels of the myo-fibroblast marker �

Rational Design and Enhanced Biocompatibility of a Dry Adhesive Medical Skin Patch

KAUST Repository

Kwak, Moon Kyu

2011-07-28

A new type of medical skin patch is developed that contains high-density, mushroom-like micropillars. Such dry-adhesive micropillars are highly biocompatible, have minimized side effects, and provide reasonable normal adhesion strength. To arrive at optimal conditions for the dry adhesive skin patch, the proper design of various structural and material parameters of micropillars is investigated. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Lymphoscintigraphy for sentinel lymph node mapping in Japanese patients with malignant skin neoplasms of the lower extremities. Comparison with previously investigated Japanese lymphatic anatomy

International Nuclear Information System (INIS)

Miura, Hiroyuki; Ono, Shuichi; Nagahata, Morio

2010-01-01

Lymph nodes (LN) and lymphatic drainage were identified by lymphoscintigraphy using 99m Tc-phytate in order to map the sentinel lymph nodes (SLNs) in patients with malignant skin neoplasms of the lower extremities, and to compare the results with an atlas of Japanese lymphatic anatomy. Sentinel lymphoscintigraphs of 18 patients with malignant skin neoplasms of the lower extremities (9 men, 9 women; age range 45-84 years, mean age 66 years) were analyzed retrospectively, and the LNs detected were identified as SLNs or secondary nodes. The patterns of lymphatic drainage were divided into three different categories: initial drainage into inguinal LN without visualization of popliteal LNs (inguinal type), initial drainage into popliteal LNs and then into intrapelvic LNs (popliteal type), and initial drainage into both popliteal and inguinal LNs (inguinal and popliteal type). More than half of the cases were the inguinal and popliteal type, as both inguinal and popliteal LNs were identified as SLNs. In the cases in which the hallux and its surrounding area were injected, all were the inguinal type and popliteal LNs were not visualized. In one case, only dynamic images detected lymphatic drainage without visualization of popliteal LNs. In contrast to the previously published literature on Japanese lymphatic anatomy, SLN lymphatic drainage from the skin of the lower extremities was wide and overlapping in many areas. However, in agreement with currently accepted anatomy, only the great saphenous lymphatic vessel drained the skin of the hallux and its surrounding area. The present results suggest that it is important to confirm lymphatic drainage in order to identify SLNs in the lower extremities. The patterns of lymphatic drainage from the skin of the foot were divided into three different categories. In contrast to previously published Japanese lymphatic anatomy, lymphatic drainage from the skin of the lower extremities was wide and overlapping in many areas. However

Biomedical engineering meets acupuncture - development of a miniaturized 48-channel skin impedance measurement system for needle and laser acupuncture

Science.gov (United States)

2010-01-01

Background Due to controversially discussed results in scientific literature concerning changes of electrical skin impedance before and during acupuncture a new measurement system has been developed. Methods The prototype measures and analyzes the electrical skin impedance computer-based and simultaneously in 48 channels within a 2.5×3.5 cm matrix. Preliminary measurements in one person were performed using metal needle and violet laser (405 nm) acupuncture at the acupoint Kongzui (LU6). The new system is an improvement on devices previously developed by other researchers for this purpose. Results Skin impedance in the immediate surroundings of the acupoint was lowered reproducibly following needle stimulation and also violet laser stimulation. Conclusions A new instrumentation for skin impedance measurements is presented. The following hypotheses suggested by our results will have to be tested in further studies: Needle acupuncture causes significant, specific local changes of electrical skin impedance parameters. Optical stimulation (violet laser) at an acupoint causes direct electrical biosignal changes. PMID:21092296

Biomedical engineering meets acupuncture - development of a miniaturized 48-channel skin impedance measurement system for needle and laser acupuncture

Directory of Open Access Journals (Sweden)

Wang Lu

2010-11-01

Full Text Available Abstract Background Due to controversially discussed results in scientific literature concerning changes of electrical skin impedance before and during acupuncture a new measurement system has been developed. Methods The prototype measures and analyzes the electrical skin impedance computer-based and simultaneously in 48 channels within a 2.5×3.5 cm matrix. Preliminary measurements in one person were performed using metal needle and violet laser (405 nm acupuncture at the acupoint Kongzui (LU6. The new system is an improvement on devices previously developed by other researchers for this purpose. Results Skin impedance in the immediate surroundings of the acupoint was lowered reproducibly following needle stimulation and also violet laser stimulation. Conclusions A new instrumentation for skin impedance measurements is presented. The following hypotheses suggested by our results will have to be tested in further studies: Needle acupuncture causes significant, specific local changes of electrical skin impedance parameters. Optical stimulation (violet laser at an acupoint causes direct electrical biosignal changes.

Permanent make-up colorants may cause severe skin reactions.

Science.gov (United States)

Wenzel, Sabrina M; Welzel, Julia; Hafner, Christian; Landthaler, Michael; Bäumler, Wolfgang

2010-10-01

In recent years, cosmetic tattoos [permanent make-up (PMU)] on eyelids, eyebrows and lips have become increasingly popular. However, most colorants are manufactured for non-medical purposes, without any established history of safe use in humans. To investigate severe adverse reactions, such as swelling, burning, and the development of papules, of the lips and the surrounding area in 4 patients who had had at least two PMU procedures on their lips. Adverse skin reactions were examined with patch and prick testing of the colorants. In addition, skin biopsies were taken in the centre of the prick test for histology. One patient declined prick testing. Beauticians tended to use various PMU products, but all contained Pigment Red 181 (CI 73360). All patients tested showed a clear delayed reaction to Pigment Red 181 or the tattoo ink, or both, after prick testing. Histology indicated an allergic reaction. Each lip lesion slowly abated after several months of topical or systemic therapy with steroids in combination with tacrolimus, but none has yet completely resolved. In light of the severe and often therapy-resistant skin reactions, we strongly recommend the regulation and control of the substances used in PMU colorants. © 2010 John Wiley & Sons A/S.

Skin tightening.

Science.gov (United States)

Woolery-Lloyd, Heather; Kammer, Jenna N

2011-01-01

Skin tightening describes the treatment of skin laxity via radiofrequency (RF), ultrasound, or light-based devices. Skin laxity on the face is manifested by progressive loss of skin elasticity, loosening of the connective tissue framework, and deepening of skin folds. This results in prominence of submandibular and submental tissues. Genetic factors (chronological aging) and extrinsic factors (ultraviolet radiation) both contribute to skin laxity. There are many RF, ultrasound, and light-based devices directed at treating skin laxity. All of these devices target and heat the dermis to induce collagen contraction. Heating of the dermis causes collagen denaturation and immediate collagen contraction in addition to long-term collagen remodeling. Via RF, light, or ultrasound, these skin tightening devices deliver heat to the dermis to create new collagen and induce skin tightening. This chapter will provide an overview of the various skin tightening devices. Copyright © 2011 S. Karger AG, Basel.

Reversibility of Pt-Skin and Pt-Skeleton Nanostructures in Acidic Media.

Science.gov (United States)

Durst, Julien; Lopez-Haro, Miguel; Dubau, Laetitia; Chatenet, Marian; Soldo-Olivier, Yvonne; Guétaz, Laure; Bayle-Guillemaud, Pascale; Maillard, Frédéric

2014-02-06

Following a well-defined series of acid and heat treatments on a benchmark Pt3Co/C sample, three different nanostructures of interest for the electrocatalysis of the oxygen reduction reaction were tailored. These nanostructures could be sorted into the "Pt-skin" structure, made of one pure Pt overlayer, and the "Pt-skeleton" structure, made of 2-3 Pt overlayers surrounding the Pt-Co alloy core. Using a unique combination of high-resolution aberration-corrected STEM-EELS, XRD, EXAFS, and XANES measurements, we provide atomically resolved pictures of these different nanostructures, including measurement of the Pt-shell thickness forming in acidic media and the resulting changes of the bulk and core chemical composition. It is shown that the Pt-skin is reverted toward the Pt-skeleton upon contact with acid electrolyte. This change in structure causes strong variations of the chemical composition.

The effects of mucopolysaccharide polysulphate on hydration and elasticity of human skin.

Science.gov (United States)

Wanitphakdeedecha, Rungsima; Eimpunth, Sasima; Manuskiatti, Woraphong

2011-01-01

Background. Mucopolysaccharide polysulphate (MPS) has been used in medicine as an anti-inflammatory and antithrombotic agent for over 50 years. Its chemical structure permits considerable hydrogen bonding with adjacent water molecules, which effectively leads to hydration of the surrounding tissue. In addition, it stimulates endogenous hyaluronate synthesis, resulting in an increase in water-binding capacity and viscoelasticity of the skin. Objective. To study the efficacy of 0.1% MPS on hydration and elasticity of human skin. Methods. The first part of this study was a randomized double blind placebo-controlled study which included 60 female volunteers aged 30-45 years with dry skin, defined by Corneometer CM 825. The volunteers were treated with either 0.1% MPS or vehicle control. All subjects were asked to apply 1 g of cream to their face twice daily for a total period of 4 weeks. Skin hydration and elasticity were measured at baseline and week 4 with Corneometer CM 825 and cutometer MPA 580, respectively, at forehead and both cheeks. The second part of this study focused on the efficacy of 0.1% MPS on skin hydration after single application. 20 female volunteers aged 30-45 years with dry skin, defined by Corneometer CM 825, were recruited to the study. All subjects were asked to apply 2 g of 0.1% MPS cream on entirely randomly selected forearm. Skin hydration at the middle of both forearms was measured at baseline, immediately after application, and every 1 hour after application for a period of 10 hours. Results. 57 subjects (28 in vehicle control group, 29 in MPS) completed treatment protocol. The baseline skin hydration of both groups was not significantly different (P = 0.47). Hower, there was a statistically significant difference in skin hydration at 4 weeks between MPS and placebo group (P = 0.01). Skin elasticity was significantly improved at week 4 in both groups (vehicle-control, P skin elasticity between MPS and vehicle-control group

Proteome analysis identifies L1CAM/CD171 and DPP4/CD26 as novel markers of human skin mast cells.

Science.gov (United States)

Gschwandtner, M; Paulitschke, V; Mildner, M; Brunner, P M; Hacker, S; Eisenwort, G; Sperr, W R; Valent, P; Gerner, C; Tschachler, E

2017-01-01

The function of skin mast cells has been well documented in IgE-mediated allergic reactions, whereas other mast cell functions are poorly defined. This study aimed at identifying novel mast cell proteins by proteome analysis of primary human skin mast cells. The proteome of skin mast cells was compared to other cell types and analyzed using bioinformatics. The expression and function of two proteins hitherto not described in skin mast cells was investigated in isolated mast cells as well as in mast cells in situ. Within the mast cell proteome, we identified 49 highly expressed proteins previously not described in mast cells; 21 of these proteins were found to be selectively expressed in mast cells. Two proteins, the neural cell adhesion molecule L1 and dipeptidyl peptidase 4, were further studied. L1 was found to be highly expressed in mast cells in normal, psoriasis, and mastocytosis skin. Dipeptidyl peptidase 4 was found to be expressed in mast cells in normal, psoriasis, and mastocytosis skin as well as in bone marrow mast cells in patients with systemic mastocytosis. In normal skin, mast cells were identified as a major source of dipeptidyl peptidase 4 and we also found that skin mast cells and fibroblasts secrete an active form of this enzyme. In a systematic proteomics approach we identified two novel mast cell proteins potentially relevant to skin homeostasis: neural cell adhesion molecule L1 and dipeptidyl peptidase 4. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Reduced FOXO1 expression accelerates skin wound healing and attenuates scarring.

Science.gov (United States)

Mori, Ryoichi; Tanaka, Katsuya; de Kerckhove, Maiko; Okamoto, Momoko; Kashiyama, Kazuya; Tanaka, Katsumi; Kim, Sangeun; Kawata, Takuya; Komatsu, Toshimitsu; Park, Seongjoon; Ikematsu, Kazuya; Hirano, Akiyoshi; Martin, Paul; Shimokawa, Isao

2014-09-01

The forkhead box O (FOXO) family has been extensively investigated in aging and metabolism, but its role in tissue-repair processes remains largely unknown. Herein, we clarify the molecular aspect of the FOXO family in skin wound healing. We demonstrated that Foxo1 and Foxo3a were both up-regulated during murine skin wound healing. Partial knockout of Foxo1 in Foxo1(+/-) mice throughout the body led to accelerated skin wound healing with enhanced keratinocyte migration, reduced granulation tissue formation, and decreased collagen density, accompanied by an attenuated inflammatory response, but we observed no wound phenotype in Foxo3a(-/-) mice. Fibroblast growth factor 2, adiponectin, and notch1 genes were significantly increased at wound sites in Foxo1(+/-) mice, along with markedly altered extracellular signal-regulated kinase 1/2 and AKT phosphorylation. Similarly, transient knockdown of Foxo1 at the wound site by local delivery of antisense oligodeoxynucleotides enhanced skin wound healing. The link between FOXO1 and scarring extends to patients, in particular keloid scars, where we see FOXO1 expression markedly increased in fibroblasts and inflammatory cells within the otherwise normal dermis. This occurs in the immediate vicinity of the keloid by comparison to the center of the mature keloid, indicating that FOXO1 is associated with the overgrowth of this fibrotic response into adjacent normal skin. Overall, our data indicate that molecular targeting of FOXO1 may improve the quality of healing and reduce pathological scarring. Copyright © 2014 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

Low doses of nanodiamonds and silica nanoparticles have beneficial hormetic effects in normal human skin fibroblasts in culture.

Science.gov (United States)

Mytych, Jennifer; Wnuk, Maciej; Rattan, Suresh I S

2016-04-01

Nanodiamonds (ND) and silica nanoparticles (SiO2-NP) have been much investigated for their toxicity at high doses, little is known about their biological activity at low concentrations. Here we report the biphasic dose response of ND and SiO2-NP in modulating normal human facial skin fibroblasts (FSF1) in culture. ND and SiO2-NP at low concentration (up to 0.5 μg/ml) had beneficial effects on FSF1 in terms of increasing their proliferation and metabolic activity. Exposure of FSF1 cells to low levels of NP enhanced their wound healing ability in vitro and slowed down aging during serial passaging as measured by maintenance of youthful morphology, reduction in the rate of loss of telomeres, and the over all proliferative characteristics. Furthermore, NP treatment induced the activation of Nrf2- and FOXO3A-mediated cellular stress responses, including an increased expression of heme oxygenease (HO-1), sirtuin (SIRT1), and DNA methyltransferase II (DNMT2). These results imply that ND and SiO2-NP at low doses are potential hormetins, which exert mild stress-induced beneficial hormetic effects through improved survival, longevity, maintenance, repair and function of human cells. Copyright © 2016 Elsevier Ltd. All rights reserved.

In vivo diagnosis of skin cancer using polarized and multiple scattered light spectroscopy

Science.gov (United States)

Bartlett, Matthew Allen

This thesis research presents the development of a non-invasive diagnostic technique for distinguishing between skin cancer, moles, and normal skin using polarized and multiple scattered light spectroscopy. Polarized light incident on the skin is single scattered by the epidermal layer and multiple scattered by the dermal layer. The epidermal light maintains its initial polarization while the light from the dermal layer becomes randomized and multiple scattered. Mie theory was used to model the epidermal light as the scattering from the intercellular organelles. The dermal signal was modeled as the diffusion of light through a localized semi-homogeneous volume. These models were confirmed using skin phantom experiments, studied with in vitro cell cultures, and applied to human skin for in vivo testing. A CCD-based spectroscopy system was developed to perform all these experiments. The probe and the theory were tested on skin phantoms of latex spheres on top of a solid phantom. We next extended our phantom study to include in vitro cells on top of the solid phantom. Optical fluorescent microscope images revealed at least four distinct scatterers including mitochondria, nucleoli, nuclei, and cell membranes. Single scattering measurements on the mammalian cells consistently produced PSD's in the size range of the mitochondria. The clinical portion of the study consisted of in vivo measurements on cancer, mole, and normal skin spots. The clinical study combined the single scattering model from the phantom and in vitro cell studies with the diffusion model for multiple scattered light. When parameters from both layers were combined, we found that a sensitivity of 100% and 77% can be obtained for detecting cancers and moles, respectively, given the number of lesions examined.

Thread Embedding Acupuncture Inhibits Ultraviolet B Irradiation-Induced Skin Photoaging in Hairless Mice

Directory of Open Access Journals (Sweden)

Yoon-Jung Kim

2015-01-01

Full Text Available Thread embedding acupuncture (TEA is an acupuncture treatment applied to many diseases in Korean medical clinics because of its therapeutic effects by continuous stimulation to tissues. It has recently been used to enhance facial skin appearance and antiaging, but data from evidence-based medicine are limited. To investigate whether TEA therapy can inhibit skin photoaging by ultraviolet B (UVB irradiation, we performed analyses for histology, histopathology, in situ zymography and western blot analysis in HR-1 hairless mice. TEA treatment resulted in decreased wrinkle formation and skin thickness (Epidermis; P=0.001 versus UV in UVB irradiated mice and also inhibited degradation of collagen fibers (P=0.010 versus normal by inhibiting proteolytic activity of gelatinase matrix-metalloproteinase-9 (MMP-9. Western blot data showed that activation of c-Jun N-terminal kinase (JNK induced by UVB (P=0.002 versus normal group was significantly inhibited by TEA treatment (P=0.005 versus UV with subsequent alleviation of MMP-9 activation (P=0.048 versus UV. These results suggest that TEA treatment can have anti-photoaging effects on UVB-induced skin damage by maintenance of collagen density through regulation of expression of MMP-9 and related JNK signaling. Therefore, TEA therapy may have potential roles as an alternative treatment for protection against skin damage from aging.

Nicotinic acid receptor abnormalities in human skin cancer: implications for a role in epidermal differentiation.

Directory of Open Access Journals (Sweden)

Yira Bermudez

Full Text Available Chronic UV skin exposure leads to epidermal differentiation defects in humans that can be largely restored by pharmacological doses of nicotinic acid. Nicotinic acid has been identified as a ligand for the human G-protein-coupled receptors GPR109A and GPR109B that signal through G(i-mediated inhibition of adenylyl cyclase. We have examined the expression, cellular distribution, and functionality of GPR109A/B in human skin and skin derived epidermal cells.Nicotinic acid increases epidermal differentiation in photodamaged human skin as judged by the terminal differentiation markers caspase 14 and filaggrin. Both GPR109A and GPR109B genes are transcribed in human skin and in epidermal keratinocytes, but expression in dermal fibroblasts is below limits of detection. Receptor transcripts are greatly over-expressed in squamous cell cancers. Receptor protein in normal skin is prominent from the basal through granular layers of the epidermis, with cellular localization more dispersive in the basal layer but predominantly localized at the plasma membrane in more differentiated epidermal layers. In normal human primary and immortalized keratinocytes, nicotinic acid receptors show plasma membrane localization and functional G(i-mediated signaling. In contrast, in a squamous cell carcinoma derived cell line, receptor protein shows a more diffuse cellular localization and the receptors are nearly non-functional.The results of these studies justify future genetic and pharmacological intervention studies to define possible specific role(s of nicotinic acid receptors in human skin homeostasis.

MALDI imaging facilitates new topical drug development process by determining quantitative skin distribution profiles.

Science.gov (United States)

Bonnel, David; Legouffe, Raphaël; Eriksson, André H; Mortensen, Rasmus W; Pamelard, Fabien; Stauber, Jonathan; Nielsen, Kim T

2018-04-01

Generation of skin distribution profiles and reliable determination of drug molecule concentration in the target region are crucial during the development process of topical products for treatment of skin diseases like psoriasis and atopic dermatitis. Imaging techniques like mass spectrometric imaging (MSI) offer sufficient spatial resolution to generate meaningful distribution profiles of a drug molecule across a skin section. In this study, we use matrix-assisted laser desorption/ionization mass spectrometry imaging (MALDI-MSI) to generate quantitative skin distribution profiles based on tissue extinction coefficient (TEC) determinations of four different molecules in cross sections of human skin explants after topical administration. The four drug molecules: roflumilast, tofacitinib, ruxolitinib, and LEO 29102 have different physicochemical properties. In addition, tofacitinib was administrated in two different formulations. The study reveals that with MALDI-MSI, we were able to observe differences in penetration profiles for both the four drug molecules and the two formulations and thereby demonstrate its applicability as a screening tool when developing a topical drug product. Furthermore, the study reveals that the sensitivity of the MALDI-MSI techniques appears to be inversely correlated to the drug molecules' ability to bind to the surrounding tissues, which can be estimated by their Log D values. Graphical abstract.

Melatonin Role in Ameliorating Radiation-induced Skin Damage: From Theory to Practice (A Review of Literature

Directory of Open Access Journals (Sweden)

Abbaszadeh A.

2017-06-01

Full Text Available Normal skin is composed of epidermis and dermis. Skin is susceptible to radiation damage because it is a continuously renewing organ containing rapidly proliferating mature cells. Radiation burn is a damage to the skin or other biological tissues caused by exposure to radiofrequency energy or ionizing radiation. Acute skin reaction is the most frequently occurring side effect of radiation therapy. Generally, any chemical/ biological agent given before or at the time of irradiation to prevent or ameliorate damage to normal tissues is called a radioprotector. Melatonin is a highly lipophilic substance that easily penetrates organic membranes and therefore is able to protect important intracellular structures including mitochondria and DNA against oxidative damage directly at the sites where such a kind of damage would occur. Melatonin leads to an increase in the molecular level of some important antioxidative enzymes such as superoxide, dismotase and glutation-peroxidase, and also a reduction in synthetic activity of nitric oxide. There is a large body of evidence which proves the efficacy of Melatonin in ameliorating UV and X ray-induced skin damage. We propose that, in the future, Melatonin would improve the therapeutic ratio in radiation oncology and ameliorate skin damage more effectively when administered in optimal and non-toxic doses

[Objective non-contact method of study of the color of the human skin integument by use of a photoelectric colorimeter].

Science.gov (United States)

Gruzdeva, N I; Zherebtsov, L D; Vasilevskiĭ, V K; Vremzen, S A

1975-04-01

The authors describe a method of determination of the colour of the skin in man based on the use of contactless photoelectric colorimeter made especially for this purpose. The mean normal values of the indices of the skin colour of the anterior and the posterior surface of the arm in 45 men and 35 women of the Europeoid race under normal conditions are presented.

DA 5505: a novel topical formulation of terbinafine that enhances skin penetration and retention.

Science.gov (United States)

Thapa, Raj Kumar; Han, Sang-Duk; Park, Hyoung Geun; Son, Miwon; Jun, Joon Ho; Kim, Jong Oh

2015-01-01

Topical fungal infections can become severe if left untreated. Efficient treatment modalities for topical fungal infections aid the penetration of antifungal agents deep into viable skin layers. Terbinafine is a fungicidal agent that inhibits ergosterol, an essential fungal component. The main objective of this study was to evaluate skin permeation and retention of a terbinafine-loaded solution containing chitosan as a film former. Comparative assessment of skin permeation and retention was performed using a prepared formulation (DA 5505) and marketed formulations of terbinafine in murine and porcine skin. To mimic fungal infection of skin, keratinized skin was induced in NC/Nga mice. In comparison with the marketed formulations, DA 5505 exhibited significantly better skin permeation. The flux, permeation coefficient, and enhancement ratio of terbinafine were remarkably increased by DA 5505 in comparison with the marketed formulations, and lag time was dramatically reduced. DA 5505 significantly increased cumulative terbinafine retention in viable skin layers in comparison with the marketed solution, suggesting enhanced efficacy. Furthermore, DA 5505 exhibited superior skin permeation in normal skin and keratinized skin. Thus, the DA 5505 formulation has the potential to effectively deliver terbinafine to superficial and deep cutaneous fungal infections.

Changes in unique hues induced by chromatic surrounds.

Science.gov (United States)

Klauke, Susanne; Wachtler, Thomas

2016-03-01

A chromatic surround can have a strong influence on the perceived hue of a stimulus. We investigated whether chromatic induction has similar effects on the perception of colors that appear pure and unmixed (unique red, green, blue, and yellow) as on other colors. Subjects performed unique hue settings of stimuli in isoluminant surrounds of different chromaticities. Compared with the settings in a neutral gray surround, unique hue settings altered systematically with chromatic surrounds. The amount of induced hue shift depended on the difference between stimulus and surround hues, and was similar for unique hue settings as for settings of nonunique hues. Intraindividual variability in unique hue settings was roughly twice as high as for settings obtained in asymmetric matching experiments, which may reflect the presence of a reference stimulus in the matching task. Variabilities were also larger with chromatic surrounds than with neutral gray surrounds, for both unique hue settings and matching of nonunique hues. The results suggest that the neural representations underlying unique hue percepts are influenced by the same neural processing mechanisms as the percepts of other colors.

Skin barrier disruption by sodium lauryl sulfate-exposure alters the expressions of involucrin, transglutaminase 1, profilaggrin, and kallikreins during the repair phase in human skin in vivo.

Science.gov (United States)

Törmä, Hans; Lindberg, Magnus; Berne, Berit

2008-05-01

Detergents are skin irritants affecting keratinocytes. In this study, healthy volunteers were exposed to water (vehicle) and 1% sodium lauryl sulfate (SLS) under occlusive patch tests for 24 hours. The messenger RNA (mRNA) expression of keratinocyte differentiation markers and of enzymes involved in corneodesmosome degradation was examined in skin biopsies (n=8) during the repair phase (6 hours to 7 days postexposure) using real-time reverse-transcription PCR. It was found that the expression of involucrin was increased at 6 hours, but then rapidly normalized. The expression of transglutaminase 1 exhibited a twofold increase after 24 hours in the SLS-exposed skin. Profilaggrin was decreased after 6 hours. Later (4-7 days), the expression in SLS-exposed areas was >50% above than in control areas. An increased and altered immunofluorescence pattern of involucrin, transglutaminase 1, and filaggrin was also found (n=4). At 6 hours post-SLS exposure, the mRNA expression of kallikrein-7 (KLK-7) and kallikrein-5 (KLK-5) was decreased by 50 and 75%, respectively, as compared with control and water-exposed areas. Thereafter, the expression pattern of KLK-7 and KLK-5 was normalized. Changes in protein expression of KLK-5 were also found. In conclusion, SLS-induced skin barrier defects induce altered mRNA expression of keratinocyte differentiation markers and enzymes degrading corneodesmosomes.

Immunohistochemical expression of interleukin 8 in skin biopsies from patients with inflammatory acne vulgaris

Directory of Open Access Journals (Sweden)

El Maged Rabee A

2007-01-01

Full Text Available Abstract Background This study was conducted to evaluate the immunohistochemical (IHC expression of interleukin 8 (IL-8 in skin biopsies of inflammatory acne vulgaris (IAV in an attempt to understand the disease pathogenesis. Materials and methods A total of 58 biopsies, 29 from lesional IAV and 29 normal non lesional sites were immunostained for IL-8. The intensity of staining was evaluated in the epidermis and dermis and was scored as mild, moderate and severe. The expression was correlated with the clinical grade, disease course and histological changes. Results IL-8 immunoreactivity was expressed in lesional IAV compared to non lesional skin biopsies (p Conclusion We were able to demonstrate altered immunoreactivity of IL-8 in IAV compared to normal skin. Targeted therapy to block IL-8 production may hold promise in limiting the deleterious effects of IL-8-mediated inflammatory response and angiogenesis.

Individual signatures and environmental factors shape skin microbiota in healthy dogs.

Science.gov (United States)

Cuscó, Anna; Belanger, Janelle M; Gershony, Liza; Islas-Trejo, Alma; Levy, Kerinne; Medrano, Juan F; Sánchez, Armand; Oberbauer, Anita M; Francino, Olga

2017-10-13

The individual, together with its environment, has been reported as the main force driving composition and structure of skin microbiota in healthy dogs. Therefore, one of the major concerns when analyzing canine skin microbiota is the likely influence of the environment. Despite the dense fur covering, certain skin diseases exhibit differential prevalence among skin sites, dog breeds, and individuals. We have characterized the normal variability of dog skin microbiota in a well-controlled cohort of a large number of Golden-Labrador Retriever crossed dogs (N = 35) with similar ages, related genetic background, and a shared environment. We found that the individual drives the skin microbiota composition and structure followed by the skin site. The main bacterial classes inhabiting dog skin in this cohort are Gammaproteobacteria and Bacilli. We also detected bacteria associated to the environment on different dog skin sites that could be reflecting the different degrees of exposure of each skin site and each dog. Network analyses elucidated bacterial interactions within and between skin sites, especially in the chin, abdomen, axilla, and perianal region, with the highly shared interactions probably representing an anatomical, behavioral, or environmental component. When analyzing each skin site independently to assess host-specific factors, we found that temporality (season of birth and time spent in the kennel) affected all the skin sites and specially the inner pinna. The most abundant taxon driving this difference was Sphingomonas. We also found taxonomic differences among male and female dogs on the abdomen, axilla, and back. We observed a large inter-individual variability and differences among skin sites. Host-specific variables, such as temporality or sex, were also shaping skin microbiota of healthy dogs, even in an environmental homogenous cohort.