Energy Technology Data Exchange (ETDEWEB)
Li, Peipei [Key Laboratory of Ministry of Education for Special Functional Materials, Henan University, Kaifeng 475004 (China); Chen, Xinhua, E-mail: xuc0374@hotmail.com [College of Chemistry and Chemical Engineering, Xuchang University, Xuchang 461000 (China); Yang, Guangbin; Yu, Laigui [Key Laboratory of Ministry of Education for Special Functional Materials, Henan University, Kaifeng 475004 (China); Zhang, Pingyu, E-mail: pingyu@henu.edu.cn [Key Laboratory of Ministry of Education for Special Functional Materials, Henan University, Kaifeng 475004 (China)
2014-05-01
Graphical abstract: A lotus-leaf-like hierarchical structure was successfully created on Al foil by a facile three-step solution–immersion method. As-obtained etched-immersed Al/STA rough surface contains interconnected convex–concave micro-structure and uniformly distributed nano-sheets that endow the surface with excellent superhydrophobicity (WCA: 164.2°; WSA: below 5°). Besides, the as-prepared etched-immersed Al/STA superhydrophobic surface on Al foil exhibits good friction-reducing ability and stable superhydrophobicity. - Highlights: • A stable superhydrophobic surface was created on aluminum foil by a facile three-step solution–immersion method. • A lotus-leaf-like hierarchical structure consists of interconnected convex–concave micro-structure and uniformly distributed nano-sheets has been constructed on the aluminum surface. • The superhydrophobic surfaces on aluminum substrate showing effective friction-reducing performance and self-cleaning ability. - Abstract: A lotus-leaf-like hierarchical structure with superhydrophobicity was created on Al foil by a facile three-step solution–immersion method involving etching in hydrochloric acid solution and immersing in hot water as well as surface-modification by stearic acid (denoted as STA). As-prepared etched-immersed Al/STA rough surface was characterized by means of scanning electron microscopy and X-ray photoelectron spectroscopy. Moreover, the water contact angles and water sliding angles of as-prepared etched-immersed Al/STA rough surface were measured, and the friction-reducing performance and self-cleaning ability of the as-prepared surface were also evaluated. Results indicate that the etched-immersed Al/STA rough surface consists of interconnected convex–concave micro-structure and uniformly distributed nano-sheets. Besides, it exhibits stable superhydrophobicity and good friction-reducing ability. Namely, it has a contact angle of water as high as 164.2° and a water sliding
International Nuclear Information System (INIS)
Li, Peipei; Chen, Xinhua; Yang, Guangbin; Yu, Laigui; Zhang, Pingyu
2014-01-01
Graphical abstract: A lotus-leaf-like hierarchical structure was successfully created on Al foil by a facile three-step solution–immersion method. As-obtained etched-immersed Al/STA rough surface contains interconnected convex–concave micro-structure and uniformly distributed nano-sheets that endow the surface with excellent superhydrophobicity (WCA: 164.2°; WSA: below 5°). Besides, the as-prepared etched-immersed Al/STA superhydrophobic surface on Al foil exhibits good friction-reducing ability and stable superhydrophobicity. - Highlights: • A stable superhydrophobic surface was created on aluminum foil by a facile three-step solution–immersion method. • A lotus-leaf-like hierarchical structure consists of interconnected convex–concave micro-structure and uniformly distributed nano-sheets has been constructed on the aluminum surface. • The superhydrophobic surfaces on aluminum substrate showing effective friction-reducing performance and self-cleaning ability. - Abstract: A lotus-leaf-like hierarchical structure with superhydrophobicity was created on Al foil by a facile three-step solution–immersion method involving etching in hydrochloric acid solution and immersing in hot water as well as surface-modification by stearic acid (denoted as STA). As-prepared etched-immersed Al/STA rough surface was characterized by means of scanning electron microscopy and X-ray photoelectron spectroscopy. Moreover, the water contact angles and water sliding angles of as-prepared etched-immersed Al/STA rough surface were measured, and the friction-reducing performance and self-cleaning ability of the as-prepared surface were also evaluated. Results indicate that the etched-immersed Al/STA rough surface consists of interconnected convex–concave micro-structure and uniformly distributed nano-sheets. Besides, it exhibits stable superhydrophobicity and good friction-reducing ability. Namely, it has a contact angle of water as high as 164.2° and a water sliding
Li, Xin; Han, Jing; Zhang, Sheng; Zhai, Lianjie; Wang, Bozhou; Yang, Qi; Wei, Qing; Xie, Gang; Chen, Sanping; Gao, Shengli
2017-09-01
High-energy coordination polymers (CPs) not only exhibit good energetic performances but also have a good catalytic effect on the thermal decomposition of energetic materials. In this contribution, two high-energy CPs Cu2(DNBT)2(CH3OH)(H2O)3·3H2O (1) and [Cu3(DDT)2(H2O)2]n (2) (H2DNBT = 3,3‧-dinitro-5,5‧-bis(1H-1,2,4-triazole and H3DDT = 4,5-bis(1H-tetrazol-5-yl)-2H-1,2,3-triazole) were synthesized and structurally characterized. Furthermore, 1 was thermos-dehydrated to produce Cu2(DNBT)2(CH3OH)(H2O)3 (1a). The thermal decomposition kinetics of 1, 1a and 2 were studied by Kissinger's method and Ozawa's method. Thermal analyses and sensitivity tests show that all compounds exhibit high thermal stability and low sensitivity for external stimuli. Meanwhile, all compounds have large positive enthalpy of formation, which are calculated as being (1067.67 ± 2.62) kJ mol-1 (1), (1464.12 ± 3.12) kJ mol-1 (1a) and (3877.82 ± 2.75) kJ mol-1 (2), respectively. The catalytic effects of 1a and 2 on the thermal decomposition of ammonium dinitramide (ADN) were also investigated.
Mondal, Bikash; Mac Giolla Eain, Marc; Xu, QianFeng; Egan, Vanessa M; Punch, Jeff; Lyons, Alan M
2015-10-28
Condensation of water vapor is an essential process in power generation, water collection, and thermal management. Dropwise condensation, where condensed droplets are removed from the surface before coalescing into a film, has been shown to increase the heat transfer efficiency and water collection ability of many surfaces. Numerous efforts have been made to create surfaces which can promote dropwise condensation, including superhydrophobic surfaces on which water droplets are highly mobile. However, the challenge with using such surfaces in condensing environments is that hydrophobic coatings can degrade and/or water droplets on superhydrophobic surfaces transition from the mobile Cassie to the wetted Wenzel state over time and condensation shifts to a less-effective filmwise mechanism. To meet the need for a heat-transfer surface that can maintain stable dropwise condensation, we designed and fabricated a hybrid superhydrophobic-hydrophilic surface. An array of hydrophilic needles, thermally connected to a heat sink, was forced through a robust superhydrophobic polymer film. Condensation occurs preferentially on the needle surface due to differences in wettability and temperature. As the droplet grows, the liquid drop on the needle remains in the Cassie state and does not wet the underlying superhydrophobic surface. The water collection rate on this surface was studied using different surface tilt angles, needle array pitch values, and needle heights. Water condensation rates on the hybrid surface were shown to be 4 times greater than for a planar copper surface and twice as large for silanized silicon or superhydrophobic surfaces without hydrophilic features. A convection-conduction heat transfer model was developed; predicted water condensation rates were in good agreement with experimental observations. This type of hybrid superhydrophobic-hydrophilic surface with a larger array of needles is low-cost, robust, and scalable and so could be used for heat
Li, Cheng; Lin, Ying; Huang, Yuanyuan; Liu, Xiaoxiao; Liang, Shuli
2014-01-01
Phytase expressed and anchored on the cell surface of Pichia pastoris avoids the expensive and time-consuming steps of protein purification and separation. Furthermore, yeast cells with anchored phytase can be used as a whole-cell biocatalyst. In this study, the phytase gene of Citrobacter amalonaticus was fused with the Pichia pastoris glycosylphosphatidylinositol (GPI)-anchored glycoprotein homologue GCW61. Phytase exposed on the cell surface exhibits a high activity of 6413.5 U/g, with an optimal temperature of 60°C. In contrast to secreted phytase, which has an optimal pH of 5.0, phytase presented on the cell surface is characterized by an optimal pH of 3.0. Moreover, our data demonstrate that phytase anchored on the cell surface exhibits higher pH stability than its secreted counterpart. Interestingly, our in vitro digestion experiments demonstrate that phytase attached to the cell surface is a more efficient enzyme than secreted phytase.
International Nuclear Information System (INIS)
Vashista, M.; Paul, S.
2011-01-01
The Barkhausen Noise Analysis (BNA) technique has been utilised to assess surface integrity of steels. But the BNA technique is not very successful in evaluating surface integrity of ground steels that exhibit poor micro-magnetic response. A new approach has been proposed for the processing of BN signal and two newly proposed parameters, namely 'count' and 'event', have been shown to correlate linearly with the residual stress upon grinding, with judicious choice of user defined 'threshold', even when the micro-magnetic response of the work material is poor. In the present study, residual stress induced upon conventional plunge surface grinding of hardened bearing steel has been investigated along with unhardened bearing steel for benchmarking. Moreover, similar correlation has been established, when primarily compressive stress is induced upon high speed grinding using cBN wheel with moderately deep cut suppressing the micro-magnetic response from the ground medium carbon steel as the work material. - Highlights: → The problem of work materials exhibiting poor BN response and poor Barkhausen Noise response is identified. → A novel signal processing strategy is introduced to address the issue of poor micro-magnetic response of some ferromagnetic material. → Potential of newly introduced BN parameters has been studied. → These two BN parameters exhibited linear correlation with residual stress for work material with poor micro-magnetic response.
Removal of arsenate by ferrihydrite via surface complexation and surface precipitation
Energy Technology Data Exchange (ETDEWEB)
Jiang, Xiuli [Department of Environment Engineering, College of the Environment and Ecology, and The Key Laboratory of the Ministry of Education for Coastal and Wetland Ecosystem, Xiamen University, Xiamen (China); Department of Chemical and Biochemical Engineering, College of Chemistry and Chemical Engineering, and The Key Laboratory for Synthetic Biotechnology of Xiamen City, Xiamen University, Xiamen (China); Peng, Changjun; Fu, Dun; Chen, Zheng [Department of Environment Engineering, College of the Environment and Ecology, and The Key Laboratory of the Ministry of Education for Coastal and Wetland Ecosystem, Xiamen University, Xiamen (China); Shen, Liang [Department of Chemical and Biochemical Engineering, College of Chemistry and Chemical Engineering, and The Key Laboratory for Synthetic Biotechnology of Xiamen City, Xiamen University, Xiamen (China); Li, Qingbiao [Department of Environment Engineering, College of the Environment and Ecology, and The Key Laboratory of the Ministry of Education for Coastal and Wetland Ecosystem, Xiamen University, Xiamen (China); Department of Chemical and Biochemical Engineering, College of Chemistry and Chemical Engineering, and The Key Laboratory for Synthetic Biotechnology of Xiamen City, Xiamen University, Xiamen (China); Ouyang, Tong, E-mail: yz3t@xmu.edu.cn [Department of Environment Engineering, College of the Environment and Ecology, and The Key Laboratory of the Ministry of Education for Coastal and Wetland Ecosystem, Xiamen University, Xiamen (China); Wang, Yuanpeng, E-mail: wypp@xmu.edu.cn [Department of Chemical and Biochemical Engineering, College of Chemistry and Chemical Engineering, and The Key Laboratory for Synthetic Biotechnology of Xiamen City, Xiamen University, Xiamen (China)
2015-10-30
Graphical abstract: - Highlights: • Surface complexation and surface precipitation of As on ferrihydrite happen at pH 3–6. • The formation of surface precipitation enhanced As(V) adsorption. • The dissolved Fe{sup 3+} had a good linear relationship with the amount of arsenate re-adsorption. - Abstract: In this study, macroscopic and spectroscopic experimental methods accurately modeled the sorption process of arsenate on ferrihydrite. EXAFS, X-ray diffraction and infrared (IR) spectroscopy indicated that the behavior of As(V) adsorption onto ferrihydrite took place mainly via surface complexation and surface precipitation at acidic pH (3.0–6.0), while the surface precipitation was dominated at longer time intervals and higher Fe{sup 3+} concentration. The macroscopic competitive adsorption experiment between arsenate with phosphate indicated two types of adsorption sites existing on the surface of ferrihydrite, i.e., non-exchangeable sites, which are responsible for a rapid surface complex formation; and exchangeable sites for a slow build-up of surface precipitates. In the slow build-up precipitates, the As(V) surface coverage (mmol/g) exhibited a good linear relationship (R{sup 2} = 0.952) with the amount of dissolved Fe{sup 3+}. Three steps are involved during the process of surface precipitation, i.e., (1) an initial uptake of As(V) via surface complexation; (2) re-adsorption of Fe{sup 3+} leaching from ferrihydrite on the surface complex; and (3) As(V) adsorption via surface complexation again and finally forming the surface precipitate.
Energy Technology Data Exchange (ETDEWEB)
Niu, Zhijun; Zhao, Yang; Sun, Wei; Shi, Suqing, E-mail: shisq@nwu.edu.cn; Gong, Yongkuan
2016-11-15
Highlights: • Biomimetic surface modification of PP was successfully conducted by integrating mussel-inspired technology, thiol chemistry and cell outer membranes-like structures. • The resultant biomimetic surface exhibits good interface and surface stability. • The obvious suppression of protein adsorption and platelet adhesion is also achieved. • The residue thoil groups on the surface could be further functionalized. - Abstract: Biomimetic surface modification of polypropylene (PP) is conducted by surface chain transfer reaction based on the mussel-inspired versatile adhesion technology and thiol chemistry, using 2-methacryloyloxyethylphosphorylcholine (MPC) as a hydrophilic monomer mimicking the cell outer membrane structure and 2,2-azobisisobutyronitrile (AIBN) as initiator in ethanol. A layer of polydopamine (PDA) is firstly deposited onto PP surface, which not only offers good interfacial adhesion with PP, but also supplies secondary reaction sites (-NH{sub 2}) to covalently anchor thiol groups onto PP surface. Then the radical chain transfer to surface-bonded thiol groups and surface re-initiated polymerization of MPC lead to the formation of a thin layer of polymer brush (PMPC) with cell outer membrane mimetic structure on PP surface. X-ray photoelectron spectrophotometer (XPS), atomic force microscopy (AFM) and water contact angle measurements are used to characterize the PP surfaces before and after modification. The protein adsorption and platelet adhesion experiments are also employed to evaluate the interactions of PP surface with biomolecules. The results show that PMPC is successfully grafted onto PP surface. In comparison with bare PP, the resultant PP-PMPC surface exhibits greatly improved protein and platelet resistance performance, which is the contribution of both increased surface hydrophilicity and zwitterionic structure. More importantly, the residue thiol groups on PP-PMPC surface create a new pathway to further functionalize such
International Nuclear Information System (INIS)
Niu, Zhijun; Zhao, Yang; Sun, Wei; Shi, Suqing; Gong, Yongkuan
2016-01-01
Highlights: • Biomimetic surface modification of PP was successfully conducted by integrating mussel-inspired technology, thiol chemistry and cell outer membranes-like structures. • The resultant biomimetic surface exhibits good interface and surface stability. • The obvious suppression of protein adsorption and platelet adhesion is also achieved. • The residue thoil groups on the surface could be further functionalized. - Abstract: Biomimetic surface modification of polypropylene (PP) is conducted by surface chain transfer reaction based on the mussel-inspired versatile adhesion technology and thiol chemistry, using 2-methacryloyloxyethylphosphorylcholine (MPC) as a hydrophilic monomer mimicking the cell outer membrane structure and 2,2-azobisisobutyronitrile (AIBN) as initiator in ethanol. A layer of polydopamine (PDA) is firstly deposited onto PP surface, which not only offers good interfacial adhesion with PP, but also supplies secondary reaction sites (-NH 2 ) to covalently anchor thiol groups onto PP surface. Then the radical chain transfer to surface-bonded thiol groups and surface re-initiated polymerization of MPC lead to the formation of a thin layer of polymer brush (PMPC) with cell outer membrane mimetic structure on PP surface. X-ray photoelectron spectrophotometer (XPS), atomic force microscopy (AFM) and water contact angle measurements are used to characterize the PP surfaces before and after modification. The protein adsorption and platelet adhesion experiments are also employed to evaluate the interactions of PP surface with biomolecules. The results show that PMPC is successfully grafted onto PP surface. In comparison with bare PP, the resultant PP-PMPC surface exhibits greatly improved protein and platelet resistance performance, which is the contribution of both increased surface hydrophilicity and zwitterionic structure. More importantly, the residue thiol groups on PP-PMPC surface create a new pathway to further functionalize such
CCPIT Machinery Exhibition Succeeded in Kuala Lumpur
Institute of Scientific and Technical Information of China (English)
无
2005-01-01
@@ From August 18 to 20, 2005, China Council for the Promotion of International Trade(CCPIT) held China Machinery and Electronics Trade Exhibition, CME 2005 in Kuala Lumpur, the capital of Malaysia on behalf of China, a good job has been done.
CERN’s travelling exhibition goes to Austria
Mélissa Lanaro
2011-01-01
Since April 2009 CERN’s travelling exhibition has been touring through some of the Organization's Member States. After Italy and Denmark it has been on show since February at Austria’s Hartberg Ökopark, a very popular science museum situated some one hundred kilometres from Vienna. To coincide with the CERN exhibition, Austria’s scientific community has organised a series of events for the general public which have had marked success. The exhibition's next destination will be Portugal and preparations are already underway to ensure that it is another resounding success The travelling exhibition was designed in collaboration with the University of Geneva, as part of the celebrations for its 450th anniversary, and has already notched up a good number of kilometres as it travels from country to country. “In 2010 the exhibition already had around 55,000 visitors,” explains Rolf Landua, who heads the Education Group. Since its inauguration ...
CCPIT Machinery Exhibition Succeeded in Kuala Lumpur
Institute of Scientific and Technical Information of China (English)
无
2005-01-01
From August 18 to 20, 2005, China Council for the Promotion of International Trade(CCPIT) held China Machinery and Electronics Trade Exhibition, CME 2005 in Kuala Lumpur, the capital of Malaysia on behalf of China, a good job has been done.……
Toommee, S.; Pratumpong, P.
2018-06-01
Zeolite was successfully modified by conventional synthetic route. Polyethylene glycol was employed for surface modification of zeolite. The surface of zeolite exhibited therefore hydrophobic properties. Less than 5 wt% of modified zeolites with uniform size and shape were integrated into polypropylene matrix. Mechanical properties of composite exhibited the similar trend compare to neat polypropylene. Oxygen transmission rate and water vapor transmission rate were evaluated and it exhibited the strong potential to be a good candidate material in active packaging.
Dawlee, S; Jayabalan, Muthu
2011-10-01
Biofunctionally active and inherently radiopaque polymers are the emerging need for biomedical applications. Novel segmented polyurethane elastomer with inherent radiopacity was prepared using aliphatic chain extender 2,3-diiodo-2-butene-1,4-diol, polyol polytetramethylene glycol and 4,4'-methylenebis(phenyl isocyanate) (MDI) for blood compatible applications. Aliphatic polyurethane was also prepared using hexamethylene diisocyanate for comparison. X-ray analysis of the polyurethanes revealed good radiopacity even at a relatively low concentration of 3% iodine in aromatic polyurethane and 10% in aliphatic polyurethane. The polyurethanes also possessed excellent thermal stability. MDI-based polyurethane showed considerably higher tensile strength than the analogous HDI-based polyurethane. MDI-based aromatic polyurethane exhibited a dynamic surface morphology in aqueous medium, resulting in the segregation of hydrophilic domains which was more conducive to anti-thrombogenic properties. The polyurethane was cytocompatible with L929 fibroblast cells, non-hemolytic, and possessed good blood compatibility.
International Nuclear Information System (INIS)
Dawlee, S; Jayabalan, Muthu
2011-01-01
Biofunctionally active and inherently radiopaque polymers are the emerging need for biomedical applications. Novel segmented polyurethane elastomer with inherent radiopacity was prepared using aliphatic chain extender 2,3-diiodo-2-butene-1,4-diol, polyol polytetramethylene glycol and 4,4'-methylenebis(phenyl isocyanate) (MDI) for blood compatible applications. Aliphatic polyurethane was also prepared using hexamethylene diisocyanate for comparison. X-ray analysis of the polyurethanes revealed good radiopacity even at a relatively low concentration of 3% iodine in aromatic polyurethane and 10% in aliphatic polyurethane. The polyurethanes also possessed excellent thermal stability. MDI-based polyurethane showed considerably higher tensile strength than the analogous HDI-based polyurethane. MDI-based aromatic polyurethane exhibited a dynamic surface morphology in aqueous medium, resulting in the segregation of hydrophilic domains which was more conducive to anti-thrombogenic properties. The polyurethane was cytocompatible with L929 fibroblast cells, non-hemolytic, and possessed good blood compatibility.
Energy Technology Data Exchange (ETDEWEB)
Dawlee, S; Jayabalan, Muthu, E-mail: muthujayabalan@rediffmail.com [Polymer Science Division, Biomedical Technology Wing, Sree Chitra Tirunal Institute for Medical Sciences and Technology, Thiruvananthapuram, Kerala 695 012 (India)
2011-10-15
Biofunctionally active and inherently radiopaque polymers are the emerging need for biomedical applications. Novel segmented polyurethane elastomer with inherent radiopacity was prepared using aliphatic chain extender 2,3-diiodo-2-butene-1,4-diol, polyol polytetramethylene glycol and 4,4'-methylenebis(phenyl isocyanate) (MDI) for blood compatible applications. Aliphatic polyurethane was also prepared using hexamethylene diisocyanate for comparison. X-ray analysis of the polyurethanes revealed good radiopacity even at a relatively low concentration of 3% iodine in aromatic polyurethane and 10% in aliphatic polyurethane. The polyurethanes also possessed excellent thermal stability. MDI-based polyurethane showed considerably higher tensile strength than the analogous HDI-based polyurethane. MDI-based aromatic polyurethane exhibited a dynamic surface morphology in aqueous medium, resulting in the segregation of hydrophilic domains which was more conducive to anti-thrombogenic properties. The polyurethane was cytocompatible with L929 fibroblast cells, non-hemolytic, and possessed good blood compatibility.
Jakob, Andreas; Crawford, Elizabeth A; Gross, Jürgen H
2016-04-01
The non-stick properties of parchment papers are achieved by polydimethylsiloxane (PDMS) coatings. During baking, PDMS can thus be extracted from the silicone-coated parchment into the baked goods. Positive-ion direct analysis in real time (DART) mass spectrometry (MS) is highly efficient for the analysis of PDMS. A DART-SVP source was coupled to a quadrupole-time-of-flight mass spectrometer to detect PDMS on the contact surface of baked goods after use of silicone-coated parchment papers. DART spectra from the bottom surface of baked cookies and pizzas exhibited signals because of PDMS ions of the general formula [(C2H6SiO)n + NH4 ](+) in the m/z 800-1900 range. Copyright © 2016 John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
Yang Meng
2017-11-01
Full Text Available In this study, a novel and convenient bio-inspired modification strategy was used to create stable superhydrophobic structures on halloysite clay nanotubes (HNTs surfaces. The polydopamine (PDA nanoparticles can firmly adhere on HNTs surfaces in a mail environment of pH 8.5 via the oxidative self-polymerization of dopamine and synthesize a rough nano-layer assisted with vitamin M, which provides a catechol functional platform for the secondary reaction to graft hydrophobic long-chain alkylamine for preparation of hierarchical micro/nano structures with superhydrophobic properties. The micromorphology, crystal structure, and surface chemical composition of the resultant superhydrophobic HNTs were characterized by field emission scanning electron (FE-SEM, transmission electron microscopy (TEM, X-ray diffraction (XRD, Fourier transform infrared spectroscopy (FTIR, and X-ray photoelectron spectroscopy (XPS. The as-formed surfaces exhibited outstanding superhydrophobicity with a water contact angle (CA of 156.3 ± 2.3°, while having little effect on the crystal structures of HNTs. Meanwhile, the resultant HNTs also showed robust stability that can conquer various harsh conditions including strong acidic/alkaline solutions, organic solvents, water boiling, ultrasonic cleaning, and outdoor solar radiation. In addition, the novel HNTs exhibited excellent packaged capabilities of phase change materials (PCMs for practical application in thermal energy storage, which improved the mass fractions by 22.94% for stearic acid and showed good recyclability. These HNTs also exhibited good oil/water separation ability. Consequently, due to the superior merits of high efficiency, easy operation, and non-toxicity, this bionic surface modification approach may make HNTs have great potentials for extensive applications.
Directory of Open Access Journals (Sweden)
S. Toommee
2018-06-01
Full Text Available Zeolite was successfully modified by conventional synthetic route. Polyethylene glycol was employed for surface modification of zeolite. The surface of zeolite exhibited therefore hydrophobic properties. Less than 5 wt% of modified zeolites with uniform size and shape were integrated into polypropylene matrix. Mechanical properties of composite exhibited the similar trend compare to neat polypropylene. Oxygen transmission rate and water vapor transmission rate were evaluated and it exhibited the strong potential to be a good candidate material in active packaging. Keywords: Zeolite, Composite, Polypropylene, Packaging, PEG-template
Electromagnetic excitation of phonons at C(001) surfaces
International Nuclear Information System (INIS)
Perez-Sanchez, F L; Perez-Rodriguez, F
2009-01-01
The photon-phonon coupling at C(001)-(2 x 1) surfaces and its manifestation in far-infrared reflectance anisotropy spectra (FIR-RAS) are theoretically investigated. We solve the coupled system of equations for the electromagnetic field and lattice vibrations, described within the adiabatic bond charge model (ABCM), with the method of expansion into bulk phonon and photon modes. The calculated FIR-RAS exhibit resonances associated with zone-center surface phonons in good agreement with available HREELS experiments and predictions of vibrational modes for diamond (001)-(2 x 1) surfaces from ABCM and ab initio calculations. Interestingly, the reflectance anisotropy spectra for a C(001)-(2 x 1) surface turn out to be qualitatively different from the spectra for a Si(001)-(2 x 1) surface, reported previously.
Electromagnetic excitation of phonons at C(001) surfaces
Energy Technology Data Exchange (ETDEWEB)
Perez-Sanchez, F L [Escuela de Ciencias, Universidad Autonoma ' Benito Juarez' de Oaxaca, Avenida Universidad S/N, Ex-Hacienda de Cinco Senores, Ciudad Universitaria, Oaxaca de Juarez, Oaxaca, 68120 (Mexico); Perez-Rodriguez, F, E-mail: fperez@sirio.ifuap.buap.m [Instituto de Fisica, Benemerita Universidad Autonoma de Puebla, Apartado Post. J-48, Puebla 72570 (Mexico)
2009-09-02
The photon-phonon coupling at C(001)-(2 x 1) surfaces and its manifestation in far-infrared reflectance anisotropy spectra (FIR-RAS) are theoretically investigated. We solve the coupled system of equations for the electromagnetic field and lattice vibrations, described within the adiabatic bond charge model (ABCM), with the method of expansion into bulk phonon and photon modes. The calculated FIR-RAS exhibit resonances associated with zone-center surface phonons in good agreement with available HREELS experiments and predictions of vibrational modes for diamond (001)-(2 x 1) surfaces from ABCM and ab initio calculations. Interestingly, the reflectance anisotropy spectra for a C(001)-(2 x 1) surface turn out to be qualitatively different from the spectra for a Si(001)-(2 x 1) surface, reported previously.
The exploration of the exhibition informatization
Zhang, Jiankang
2017-06-01
The construction and management of exhibition informatization is the main task and choke point during the process of Chinese exhibition industry’s transformation and promotion. There are three key points expected to realize a breakthrough during the construction of Chinese exhibition informatization, and the three aspects respectively are adopting service outsourcing to construct and maintain the database, adopting advanced chest card technology to collect various kinds of information, developing statistics analysis to maintain good cutomer relations. The success of Chinese exhibition informatization mainly calls for mature suppliers who can provide construction and maintenance of database, the proven technology, a sense of data security, advanced chest card technology, the ability of data mining and analysis and the ability to improve the exhibition service basing on the commercial information got from the data analysis. Several data security measures are expected to apply during the process of system developing, including the measures of the terminal data security, the internet data security, the media data security, the storage data security and the application data security. The informatization of this process is based on the chest card designing. At present, there are several types of chest card technology: bar code chest card; two-dimension code card; magnetic stripe chest card; smart-chip chest card. The information got from the exhibition data will help the organizers to make relevant service strategies, quantify the accumulated indexes of the customers, and improve the level of the customer’s satisfaction and loyalty, what’s more, the information can also provide more additional services like the commercial trips, VIP ceremonial reception.
Selenium plating of aluminium and nickel surfaces
International Nuclear Information System (INIS)
Qureshi, N.; Shams, N.; Kamal, A.; Ashraf, A.
1993-01-01
Selenium exhibits photovoltaic and photoconductive properties. This makes selenium useful in the production of photocells, exposure meters for photographic use, in solar cells, etc. In commerce, selenium coated surfaces are extensively used as photo receptive drums in the xerography machines for reproducing documents. Laboratory experiments were designed to obtain selenium plating on different materials. Of the various electrodes tested for cathodic deposition, anodized aluminum and nickel plated copper were found to give good results. (author)
International Nuclear Information System (INIS)
Van Dillen, Teun
2015-01-01
The Fukushima nuclear accident (Japan, 11 March 2011) revealed the need for well-founded criteria for surface contamination and associated screening levels related to the import of non-food (consumer) goods, containers and conveyances. The only available European-harmonised criteria are those laid down in the IAEA transport regulations, but these criteria date back from the early 1960's and only apply to the safe transport of radioactive materials. The main problem is that a generic dose-assessment model for consumer products is missing. Therefore, RIVM (National Institute for Public Health and the Environment) developed a new methodology entitled SUDOQU (Surface Dose Quantification) to calculate the annual effective dose for both consumers and non-radiological workers, addressing issues of removability of surface contamination. The methodology can be used to derive criteria and screening levels for surface contamination and could serve as a useful tool for policy-makers and radiation-protection specialists. (authors)
2016-12-01
hydrodynamic skin friction is greatly reduced and the water is said to slip over the air layer [12]. A number of direct numerical simulations ( DNS ) [13...practical means of reducing drag. It is therefore important to investigate materials where in the passive state exhibit the desired qualities of
A Nanotube Surface Reinforced Graphite Fiber Exhibiting Significantly Enhanced Properties, Phase I
National Aeronautics and Space Administration — Nanotechnology which includes carbon nanotubes has the potential to produce materials that exhibit properties beyond those expected from conventional materials which...
Fabrication of multi-functional silicon surface by direct laser writing
Verma, Ashwani Kumar; Soni, R. K.
2018-05-01
We present a simple, quick and one-step methodology based on nano-second laser direct writing for the fabrication of micro-nanostructures on silicon surface. The fabricated surfaces suppress the optical reflection by multiple reflection due to light trapping effect to a much lower value than polished silicon surface. These textured surfaces offer high enhancement ability after gold nanoparticle deposition and then explored for Surface Enhanced Raman Scattering (SERS) for specific molecular detection. The effect of laser scanning line interval on optical reflection and SERS signal enhancement ability was also investigated. Our results indicate that low optical reflection substrates exhibit uniform SERS enhancement with enhancement factor of the order of 106. Furthermore, this methodology provide an alternative approach for cost-effective large area fabrication with good control over feature size.
DEFF Research Database (Denmark)
Achiam, Marianne
2015-01-01
The immersive exhibition is a specialized exhibition genre in museums, which creates the illusion of time and place by representing key characteristics of a reference world and by integrating the visitor in this three-dimensionally reconstructed world (Mortensen 2010). A successful representation...... of the reference world depends on three criteria: whether the exhibition is staged as a coherent whole with all the displayed objects supporting the representation, whether the visitor is integrated as a component of the exhibition, and whether the content and message of the exhibition become dramatized...
Energy Technology Data Exchange (ETDEWEB)
Lee, Hae Ri [Center for Energy Convergence Research, Korea Institute of Science Technology, Hwarang-ro 14-gil 5, Seongbuk-gu, Seoul 136-791 (Korea, Republic of); Department of Chemical and Biological Engineering, Korea University, 145, Anam-ro, Seongbuk-gu, Seoul 136-701 (Korea, Republic of); Seo, Hyo Ree; Lee, Boeun; Cho, Byung Won [Center for Energy Convergence Research, Korea Institute of Science Technology, Hwarang-ro 14-gil 5, Seongbuk-gu, Seoul 136-791 (Korea, Republic of); Lee, Kwan-Young [Department of Chemical and Biological Engineering, Korea University, 145, Anam-ro, Seongbuk-gu, Seoul 136-701 (Korea, Republic of); Oh, Si Hyoung, E-mail: sho74@kist.re.kr [Center for Energy Convergence Research, Korea Institute of Science Technology, Hwarang-ro 14-gil 5, Seongbuk-gu, Seoul 136-791 (Korea, Republic of)
2017-01-15
Graphical abstract: Strategically-designed spinel-structured nano-scale surface layer, LiM{sub x}Mn{sup IV}{sub 1−x}O{sub 4}, featuring a high Li{sup +} ion conductivity and a good chemical stability was applied on Al-doped LiMn{sub 2}O{sub 4} spinel for the drastic improvement of the electrochemical performance at the elevated temperature as a promising cathode material for lithium rechargeable batteries. - Highlights: • Spinel-structured surface layer with a high Li-ion conductivity and a good chemical stability was prepared. • Simple wet process was developed to apply nano-scale surface layer on aluminum doped lithium manganese oxide spinel. • The properties of nano-scale surface layer were characterized by analytical tools including GITT, HR-TEM and XAS. • Materials with surface coating layer exhibit an excellent electrochemical performance at the elevated temperature. - Abstract: Li-ion conducting spinel-structured oxide layer with a manganese oxidation state close to being tetravalent was prepared on aluminum-doped lithium manganese oxide spinel for improving the electrochemical performances at the elevated temperatures. This nanoscale surface layer provides a good ionic conduction path for lithium ion transport to the core and also serves as an excellent chemical barrier for protecting the high-capacity core material from manganese dissolution into the electrolyte. In this work, a simple wet process was employed to prepare thin LiAlMnO{sub 4} and LiMg{sub 0.5}Mn{sub 1.5}O{sub 4} layers on the surface of LiAl{sub 0.1}Mn{sub 1.9}O{sub 4}. X-ray absorption studies revealed an oxidation state close to tetravalent manganese on the surface layer of coated materials. Materials with these surface coating layers exhibited excellent capacity retentions superior to the bare material, without undermining the lithium ion transport characteristics and the high rate performances.
Directory of Open Access Journals (Sweden)
Pergal Marija V.
2014-01-01
Full Text Available Segmented polyurethanes based on poly(dimethylsiloxane, currently used for biomedical applications, have sub-optimal biocompatibility which reduces their efficacy. Improving the endothelial cell attachment and blood-contacting properties of PDMS-based copolymers would substantially improve their clinical applications. We have studied the surface properties and in vitro biocompatibility of two series of segmented poly(urethane-dimethylsiloxanes (SPU-PDMS based on hydroxypropyl- and hydroxyethoxypropyl- terminated PDMS with potential applications in blood-contacting medical devices. SPU-PDMS copolymers were characterized by contact angle measurements, surface free energy determination (calculated using the van Oss-Chaudhury-Good and Owens-Wendt methods, and atomic force microscopy. The biocompatibility of copolymers was evaluated using an endothelial EA.hy926 cell line by direct contact assay, before and after pre-treatment of copolymers with multicomponent protein mixture, as well as by a competitive blood-protein adsorption assay. The obtained results suggested good blood compatibility of synthesized copolymers. All copolymers exhibited good resistance to fibrinogen adsorption and all favored albumin adsorption. Copolymers based on hydroxyethoxypropyl-PDMS had lower hydrophobicity, higher surface free energy, and better microphase separation in comparison with hydroxypropyl-PDMS-based copolymers, which promoted better endothelial cell attachment and growth on the surface of these polymers as compared to hydroxypropyl-PDMS-based copolymers. The results showed that SPU-PDMS copolymers display good surface properties, depending on the type of soft PDMS segments, which can be tailored for biomedical application requirements such as biomedical devices for short- and long-term uses. [Projekat Ministarstva nauke Republike Srbije, br. 172062
Preparation and Evaluation of Some Surface Active Sequestering Agents for Some Heavy Metals
International Nuclear Information System (INIS)
Badawi, A.M.; Mohamed, M.Z.; Mohamed, A.S.; Khowdry, M.M.; Bastway, A.F.
2004-01-01
A novel series of chelating agents has been synthesized by the reaction of ethylenediaminetetraacetic acid, citric acid and polyethylene glycol with different molecular weights and different number of moles. The unique structural features of these surfactants have been confirmed by FTIR spectra, elemental analysis and H 1 NMR spectrum. These surfactants exhibit excellent properties in sequestering heavy metal such as copper, lead and mercury. They show good surfactant properties, including surface tension, effectiveness, efficiency and emulsifying power. Critical micelle concentration, maximum surface excess and minimum surface area have been studied. Free energy of micellization and adsorption have been calculated
Shaping surface of palladium nanospheres through the control of reaction parameters
International Nuclear Information System (INIS)
Wang Lianmeng; Tan Enzhong; Guo Lin; Wang Lihua; Han Xiaodong
2011-01-01
Solid, cracked, and flower-shaped surfaces of palladium nanospheres with high yields and good uniformity were successfully prepared by a wet chemical method. On the basis of the experimental data, the same size of palladium nanosphere with different surface morphologies can be regulated only by changing the amount of ammonium hydroxide and reductant in one experimental system. The as-prepared products were studied by transmission electron microscopy (TEM), scanning electron microscopy (SEM) and x-ray diffraction (XRD). In addition, surface-enhanced Raman scattering (SERS) spectra on the as-prepared different surface of palladium nanospheres exhibit high activity towards p-aminothiophenol (PATP) detection, and the result further reveals that the predominance of the a1 vibration mode in the SERS spectra via an electromagnetic (EM) mechanism is significant.
DEFF Research Database (Denmark)
Mortensen, Marianne Foss
Science museums define the objectives of their exhibitions in terms of visitor learning outcomes. Yet, exhibit designers lack theoretical and empirical research findings on which to base the creation of such educational environments. Here, this shortcoming is addressed through the development...... of tools and processes to guide the design of educational science exhibits. The guiding paradigm for this development is design-based research, which is characterised by an iterative cycle of design, enactment, and analysis. In the design phase, an educational intervention is planned and carried out based...... on the generation of theoretical ideas for exhibit design is offered in a fourth and parallel research undertaking, namely the application of the notion of cultural border-crossing to a hypothetical case of exhibit design....
LHC INAUGURATION, LHC Fest highlights: exhibition time!
2008-01-01
David Gross, one of the twenty-one Nobel Laureates who have participated in the project.Tuesday 21 October 2008 Accelerating Nobels Colliding Charm, Atomic Cuisine, The Good Anomaly, A Quark Somewhere on the White Paper, Wire Proliferation, A Tale of Two Liquids … these are just some of the titles given to artworks by Physics Nobel Laureates who agreed to make drawings of their prize-winning discoveries (more or less reluctantly) during a special photo session. Science photographer Volker Steger made portraits of Physics Nobel Laureates and before the photo sessions he asked them to make a drawing of their most important discovery. The result is "Accelerating Nobels", an exhibition that combines unusual portraits of and original drawings by twenty-one Nobel laureates in physics whose work is closely related to CERN and the LHC. This exhibition will be one of the highlights of the LHC celebrations on 21 October in the SM18 hall b...
Potential Biosignificant Interest and Surface Activity of Efficient Heterocyclic Derivatives.
El-Sayed, Refat; Althagafi, Ismail
2016-01-01
Some functionalized pyridine and fused system derivatives were synthesized using enaminonitrile derivative 5 as a starting material for the reaction, with various reagents under different conditions. Propoxylation of these compounds using different moles of propylene oxide (3, 5 and 7 moles) leads to a novel group of surface active agents. The antimicrobial and surface activities of the synthesized compounds were investigated. Most of the evaluated compounds proved to be active as antibacterial and antifungal agents and showed good surface activity, which makes them suitable for diverse applications such as the manufacturing of emulsifiers, cosmetics, drugs, pesticides, etc. Additionally, biodegradation testing exhibits significant breakdown within six to seven days, and hence, lowers the toxicity to human beings and becomes environmentally friendly.
Energy Technology Data Exchange (ETDEWEB)
Anon.
1979-09-15
Linked to the 25th Anniversary celebrations, an exhibition of some of CERN's technological achievements was opened on 22 June. Set up in a new 600 m{sup 2} Exhibition Hall on the CERN site, the exhibition is divided into eight technology areas — magnets, vacuum, computers and data handling, survey and alignment, radiation protection, beam monitoring and handling, detectors, and workshop techniques.
International Nuclear Information System (INIS)
Cheng, Yongpan; Xu, Jinliang; Sui, Yi
2015-01-01
Microchannels with superhydrophobic surfaces are a promising candidate for electric cooling with mild frictional penalty. Frictional and thermal performance of laminar liquid-water flow in such microchannels is numerically investigated for various shear-free fractions and Reynolds numbers. The structures on superhydrophobic surfaces include square posts and holes, transverse and longitudinal grooves. Combined frictional and thermal performance of microchannels is evaluated by a goodness factor, and is compared with that of smooth plain channels. It is found that with increasing shear-free fractions, both friction factor and average Nusselt number deteriorate for four surface patterns; however, goodness factor is improved significantly over smooth plain channels. In general, superhydrophobic surfaces containing longitudinal and transverse grooves exhibit the lowest and highest frictional and thermal performance, respectively; however, combined performance of these two are on opposite. Among four surface patterns, longitudinal grooves have the highest goodness factors, except at high shear-free fractions or high Reynolds numbers where overall performance is surpassed by square posts. At very low or high shear-free fractions, frictional and thermal performance of two-dimensional square posts and holes approaches that of one-dimensional longitudinal or transverse grooves. Our study suggests microchannels with superhydrophobic surfaces as promising candidates for efficient cooling devices.
Molecules at an exhibition: portraits of intriguing materials in everyday life
National Research Council Canada - National Science Library
Emsley, John
1998-01-01
... Good Chemical Guide won the Rhone-Poulenc Science Book Price in 1995.This page intentionally left blankMOLECULESAT AN EXHIBITION Portraits of intriguing materials in everyday life JOHN EMSLEY OXFORD UNIVERSITY PRESSOXFORD UNIVERSITY PRESS Great Clarendon Street, Oxford 0x2 6op Oxford University Press is a department of the University of O...
22nd Annual Logistics Conference and Exhibition
2006-04-20
Bill” Kenwell, Vice President, Sales and Marketing, Maersk 5:30pm-7:30pm Reception in Exhibit Hall Wednesday, April 19, 2006 7:00am-5:30pm...some commercial sales of our products, services and platforms. We provide surface, air, and undersea applications on more than 460 programs for US...diagnostic system & process • Seamless B2B integration with maintenance systems Enabled By… EOATM Overview Sensor Data Maintenance Logs Repair Data Expert
Exhibition | CERN Micro Club | 1-30 September
2014-01-01
The CERN Micro Club (CMC) is organising an exhibition looking back on the origins of the personal computer, also known as the micro-computer, to mark the 60th anniversary of CERN and the club’s own 30th anniversary. CERN, Building 567, R-021 and R-029 01.09.2014 - 30.09.2014 from 4.00 to 6.00 p.m. The exhibition will be held in the club’s premises (Building 567, rooms R-0121 and R-029) and will be open Mondays to Thursdays from 1 to 30 September 2014. Come and admire, touch and use makes and models that disappeared from the market many years ago, such as Atari, Commodore, Olivetti, DEC, IBM and Apple II and III, all in good working order and installed with applications and games from the period. Club members will be on hand to tell you about these early computers, which had memories of just of a few kilobytes, whereas those of modern computers can reach several gigabytes or even terabytes.
Organic composite-mediated surface coating of human acellular bone matrix with strontium.
Huang, Yi-Zhou; Wang, Jing-Jing; Huang, Yong-Can; Wu, Cheng-Guang; Zhang, Yi; Zhang, Chao-Liang; Bai, Lin; Xie, Hui-Qi; Li, Zhao-Yang; Deng, Li
2018-03-01
Acellular bone matrix (ACBM) provides an osteoconductive scaffold for bone repair, but its osteoinductivity is poor. Strontium (Sr) improves the osteoinductivity of bone implants. In this study, we developed an organic composite-mediated strontium coating strategy for ACBM scaffolds by using the ion chelating ability of carboxymethyl cellulose (CMC) and the surface adhesion ability of dopamine (DOPA). The organic coating composite, termed the CMC-DOPA-Sr composite, was synthesized under a mild condition, and its chemical structure and strontium ion chelating ability were then determined. After surface decoration, the physicochemical properties of the strontium-coated ACBM (ACBM-Sr) scaffolds were characterized, and their biocompatibility and osteoinductivity were determined in vitro and in vivo. The results showed that the CMC-DOPA-Sr composite facilitated strontium coating on the surface of ACBM scaffolds. The ACBM-Sr scaffolds possessed a sustained strontium ion release profile, exhibited good cytocompatibility, and enhanced the osteogenic differentiation of mesenchymal stem cells in vitro. Furthermore, the ACBM-Sr scaffolds showed good histocompatibility after subcutaneous implantation in nude mice. Taken together, this study provided a simple and mild strategy to realize strontium coating for ACBM scaffolds, which resulted in good biocompatibility and improved osteoinductivity. Copyright © 2017 Elsevier B.V. All rights reserved.
Preparation and Wetting Behavior of Lyophobic Surface on Zinc Substrate
Directory of Open Access Journals (Sweden)
HAN Xiang-xiang
2018-03-01
Full Text Available Micro-nano structure on zinc substrate was fabricated through the combination of chemical etching with hydrochloric acid aqueous solution and hydrothermal reaction. After modification with perfluorooctanoic solution, the lyophobic surface was prepared. The phase composition, microstructure, chemical composition, and wettability of the as-obtained surface were investigated by X-ray diffractometer, scanning electron microscope, Fourier transform infrared spectrometer, and contact angle tester. The results show that a layer of ZnO nano-rods grows on the surface of the submicrometer structure, and exhibits good resistance to water impact and stability under the combined action of low surface energy material. When hydrochloric acid concentration is 1.0mol/L and hydrothermal reaction temperature is 95℃, the lyophobic surface possesses the best morphology of ZnO nano-rods. The maximum contact angles of distilled water and peanut oil are 154.65° and 144.65°, respectively, and the sliding angle is less than 10°.
Yu, Haiyuan; Bi, Xiaofang
2018-04-01
Realization of the effective Si penetration at a lower processing temperature is a challenge, but of significance in reducing the strict requirements for the equipment and realizing cost-cutting in production. In this work, we have modified the surface microstructure of Fe-3 wt%Si alloy by using surface mechanical attrition treatment. The modified surface microstructure is characteristic of nanocrystalline, which is found to significantly enhance the efficiency of subsequent Si penetration into the alloy, and successively leading to the decrease of penetration temperature up to 200 °C. As a consequence, the Si gradient distribution across thickness can be readily controlled by changing penetration time, and FeSi alloys with various gradients are prepared by chemical vapor deposition along with subsequent annealing process. The dependence of magnetic and mechanical properties on Si gradient for demonstrates that the increase of Si gradient reduces core losses, especially at higher frequencies, and meanwhile improves ductility of FeSi alloys as well. The mechanism underlying the effect of Si gradient is clarified by combining magnetostriction measurement and domain structure observations. This work provides a facile and effective way for achieving gradient FeSi alloys with good magnetic property and ductility.
Staff Association
2017-01-01
A Look of Hope Islam Mahmoud Sweity From 19 to 30 June 2017 CERN Meyrin, Main Building Islam Mahmoud Sweity Islam Mahmoud Sweity was born in 1997 at Beit Awwa, Palestine. She is currently following a course to get an Art diploma of Painting at the college of Fine Arts at An-Najah National University under the supervision of Esmat Al As'aad. Her portraits, landscapes and still life paintings are full of life and shining colours. Charged of emotional empathy they catch the attention of the viewer and are reminding us that life is beautiful and worth living in spite of all difficulties we have to go through. She participated in many exhibitions and has exposed her drawings in 2015 at CERN and in France in the framework of the exhibition "The Origin“, and in 2017 in the Former Yugoslav Republic of Macedonia, Palestina and Jordan. In this exhibition the oil paintings made in the past year will be presented. For more information : staff.association@cern.ch | T&eacu...
Green Approach to the Fabrication of Superhydrophobic Mesh Surface for Oil/Water Separation.
Wang, Fajun; Lei, Sheng; Xu, Yao; Ou, Junfei
2015-07-20
We report a simple and environment friendly method to fabricate superhydrophobic metallic mesh surfaces for oil/water separation. The obtained mesh surface exhibits superhydrophobicity and superoleophilicity after it was dried in an oven at 200 °C for 10 min. A rough silver layer is formed on the mesh surface after immersion, and the spontaneous adsorption of airborne carbon contaminants on the silver surface lower the surface free energy of the mesh. No low-surface-energy reagents and/or volatile organic solvents are used. In addition, we demonstrate that by using the mesh box, oils can be separated and collected from the surface of water repeatedly, and that high separation efficiencies of larger than 92 % are retained for various oils. Moreover, the superhydrophobic mesh also possesses excellent corrosion resistance and thermal stability. Hence, these superhydrophobic meshes might be good candidates for the practical separation of oil from the surface of water. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DEFF Research Database (Denmark)
Tybjerg, Karin
2017-01-01
of exhibiting epistemic objects that utilize their knowledge-generating potential and allow them to continue to stimulate curiosity and generate knowledge in the exhibition. The epistemic potential of the objects can then be made to work together with the function of the exhibition as a knowledge-generating set...
Solution-Processed Organic and Halide Perovskite Transistors on Hydrophobic Surfaces.
Ward, Jeremy W; Smith, Hannah L; Zeidell, Andrew; Diemer, Peter J; Baker, Stephen R; Lee, Hyunsu; Payne, Marcia M; Anthony, John E; Guthold, Martin; Jurchescu, Oana D
2017-05-31
Solution-processable electronic devices are highly desirable due to their low cost and compatibility with flexible substrates. However, they are often challenging to fabricate due to the hydrophobic nature of the surfaces of the constituent layers. Here, we use a protein solution to modify the surface properties and to improve the wettability of the fluoropolymer dielectric Cytop. The engineered hydrophilic surface is successfully incorporated in bottom-gate solution-deposited organic field-effect transistors (OFETs) and hybrid organic-inorganic trihalide perovskite field-effect transistors (HTP-FETs) fabricated on flexible substrates. Our analysis of the density of trapping states at the semiconductor-dielectric interface suggests that the increase in the trap density as a result of the chemical treatment is minimal. As a result, the devices exhibit good charge carrier mobilities, near-zero threshold voltages, and low electrical hysteresis.
Shape-Memory PVDF Exhibiting Switchable Piezoelectricity.
Hoeher, Robin; Raidt, Thomas; Novak, Nikola; Katzenberg, Frank; Tiller, Joerg C
2015-12-01
In this study, a material is designed which combines the properties of shape-memory and electroactive polymers. This is achieved by covalent cross-linking of polyvinylidene fluoride. The resulting polymer network exhibits excellent shape-memory properties with a storable strain of 200%, and fixity as well as recovery values of 100%. Programming upon rolling induces the transformation from the nonelectroactive α-phase to the piezoelectric β-phase. The highest β-phase content is found to be 83% for a programming strain of 200% affording a d33 value of -30 pm V(-1). This is in good accordance with literature known values for piezoelectric properties. Thermal triggering this material does not only result in a shape change but also renders the material nonelectroactive. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Enhanced Bioactivity and Bacteriostasis of Surface Fluorinated Polyetheretherketone.
Chen, Meiling; Ouyang, Liping; Lu, Tao; Wang, Heying; Meng, Fanhao; Yang, Yan; Ning, Congqin; Ma, Jingzhi; Liu, Xuanyong
2017-05-24
Although polyetheretherketone (PEEK) has been considered as a potential orthopedic and dental application material due to its similar elastic modulus as bones, inferior osseointegration and bacteriostasis of PEEK hampers its clinical application. In this work, fluorinated PEEK was constructed via plasma immersion ion implantation (PIII) followed by hydrofluoric acid treatment to ameliorate the osseointegration and antibacterial properties of PEEK. The surface microstructure, composition, and hydrophilicity of all samples were investigated. Rat bone mesenchymal stem cells (rBMSCs) were cultured on their surfaces to estimate bioactivity. The fluorinated PEEK can enhance the cell adhesion, cell spreading, proliferation, and alkaline phosphatase (ALP) activity compared to pristine PEEK. Furthermore, the fluorinated PEEK surface exhibits good bacteriostatic effect against Porphyromonas gingivalis, which is one of the major periodontal pathogens. In summary, we provide an effective route to introduce fluorine and the results reveal that the fluorinated PEEK can enhance the osseointegration and bacteriostasis, which provides a potential candidate for dental implants.
Good leadership for good quality
Franzon, Vilma Maria
2016-01-01
Good leadership is important if you like to have high quality in the results. My experience in the production of the television industry is that conditions for good leadership is insufficient. Therefore, I have tried to get answers for those two questions in my exam report: What are the characteristics of good leadership? What are the prerequisites for good leadership out of production? The method I used is a literature study and observation. I have read a number of books and research studies...
International Nuclear Information System (INIS)
Wang, Fei; Chen, Xin-liang; Geng, Xin-hua; Zhang, De-kun; Wei, Chang-chun; Huang, Qian; Zhang, Xiao-dan; Zhao, Ying
2012-01-01
Highlights: ► Natively textured surface hydrogenated gallium-doped zinc oxide (HGZO) thin films have been deposited via magnetron sputtering on glass substrates. ► The directly deposited HGZO thin films present rough crater-type surface morphology. ► Typical HGZO thin film exhibits a high electron mobility of 41.3 cm 2 /V s and a relative low sheet resistance of ∼7.0 Ω. ► These HGZO thin films have high optical transmittances in the visible and near infrared region (∼380–1100 nm). ► A gradient H 2 growth method for fabricating HGZO thin films has been proposed in magnetron sputtering process. - Abstract: The main purposes are to obtain high quality transparent conductive oxide (TCO) based on zinc oxide (ZnO) thin films with high optical transparency in the visible and near infrared spectral range, high electrical conductivity and good light-scattering capability to enhance the path of the light inside the Si-based thin film solar cells. Natively textured surface hydrogenated gallium-doped ZnO (HGZO) thin films have been deposited via pulsed direct current (DC) magnetron sputtering on glass substrates at a substrate temperature of 553 K. These natively textured HGZO thin films exhibit high optical transmittance (over 80%) in the visible and near infrared region (λ = 380–1100 nm) and excellent electrical properties. The optimized HGZO thin film with crater-type textured surface obtained at the hydrogen flow rate of ∼2.0 sccm exhibits a high electron mobility of 41.3 cm 2 /V s and a relatively low sheet resistance of ∼7.0 Ω. The influences of hydrogen flow rates on the surface morphology, electrical and optical properties of HGZO thin films were investigated in detail. In addition, we put forward a method of gradient H 2 growth technique for fabricating HGZO thin films so as to obtain rough surface structure with good light-scattering capability and high electrical conductivity. “Crater-like” surface feature size and optical transmittance
Near-field Spectroscopy of Surface Plasmons in Flat Gold Nanoparticles
International Nuclear Information System (INIS)
Achermann, Marc; Shuford, Kevin L.; Schatz, George C.; Dahanayaka, D.H.; Bumm, Lloyd A; Klimov, Victor I.
2007-01-01
We use near-field interference spectroscopy with a broadband femtosecond, white-light probe to study local surface plasmon resonances in flat gold nanoparticles (FGNPs). Depending on nanoparticle dimensions, local near-field extinction spectra exhibit none, one, or two resonances in the range of visible wavelengths (1.6-2.6 eV). The measured spectra can be accurately described in terms of interference between the field emitted by the probe aperture and the field reradiated by driven FGNP surface plasmon oscillations. The measured resonances are in good agreement with those predicted by calculations using discrete dipole approximation. We observe that the amplitudes of these resonances are dependent upon the spatial position of the near-field probe, which indicates the possibility of spatially selective excitation of specific plasmon modes
Numerical analysis of high-speed liquid lithium free-surface flow
International Nuclear Information System (INIS)
Gordeev, Sergej; Heinzel, Volker; Stieglitz, Robert
2012-01-01
Highlights: ► The free surface behavior of a high speed lithium jet is investigated by means of a CFD LES analysis. ► The study is aiming to validate adequate LES technique. ► The Osaka University experiments with liquid lithium jet have been simulated. ► Four cases with jet flow velocities of 4, 9, 13 and 15 m/s are analyzed. ► Calculation results show a good qualitative and a quantitative agreement with the experimental data. - Abstract: The free-surface stability of the target of the International Fusion Material Irradiation Facility (IFMIF) is one of the crucial issues, since the spatio-temporal behavior of the free-surface determines the neutron flux to be generated. This article investigates the relation between the evolution of a wall boundary layer in a convergent nozzle and the free surface shape of a high speed lithium jet by means of a CFD LES analysis using the Osaka University experiments. The study is aiming to validate adequate LES technique to analyze the individual flow phenomena observed. Four cases with jet flow velocities of 4, 9, 13 and 15 m/s are analyzed. First analyses of calculation results show that the simulation exhibits a good qualitative and a quantitative agreement with the experimental data, which allows in the future a more realistic prediction of the IFMIF target behavior.
Xu, Kaiqi; Zhang, Zhizhen; Su, Wei; Huang, Xuejie
Core-shell Si/Cu nanocomposites were synthesized via a flexible self-limiting surface reaction without extra reductant for the first time. The nano Si was uniformly coated with Cu nanoparticles with a diameter of 5-10nm, which can enhance the electronic conductivity of the nanocomposites and buffer the huge volume change during charge/discharge owing to its high ductility. Benefited from the unique structure, the Si/Cu nanocomposites exhibited a good electrochemical performance as anodes for lithium ion batteries, which exhibited a capacity retention of 656mAh/g after 50 cycles and a coulombic efficiency of more than 99%.
DPPC Monolayers Exhibit an Additional Phase Transition at High Surface Pressure
DEFF Research Database (Denmark)
Shen, Chen; de la Serna, Jorge B.; Struth, Bernd
2015-01-01
Pulmonary surfactant forms a monolayer at the air/aqueous interface within the lung. During the breath process, the surface pressure (Π) periodically varies from ~40mN/m up to ~70mN/m. The film is mechanically stable during this rapid and reversible expansion. Pulmonary surfactant consists of ~90......% of lipid with 10% integrated proteins. Among its lipid compounds, di-palmitoyl-phosphatidylcholine (DPPC) dominates (~45wt%). DPPC is the only known lipid that can be compressed to very high surface pressure (~70mN/m) before its monolayer collapses. Most probably, this feature contributes to the mechanical...... stability of the alveoli monolayer. Still, to the best of our knowledge, some details of the compression isotherm presented here and the related structures of the DPPC monolayer were not studied so far. The liquid-expanded/liquid-condensed phase transition of the DPPC monolayer at ~10mN/m is well known...
Radi, Smaail; Attayibat, Ahmed; El-Massaoudi, Mohamed; Bacquet, Maryse; Jodeh, Shehdeh; Warad, Ismail; Al-Showiman, Salim S; Mabkhot, Yahia N
2015-10-01
A simple heterogeneous synthesis of pure adsorbent based polymer hybrid made by condensing a functionalized C,N-bipyrazole with a 3-glycidoxypropyl-trimethoxysilane silylant agent, previously anchored on a silica surface was developed. The formed material (SG2P) was characterized through elemental analysis, FT-IR spectroscopy, (13)C NMR of solid state, scanning electron microscope (SEM), and was studied and evaluated by determination of the surface area using the BET equation, the adsorption and desorption capability using the isotherm of nitrogen and B.J.H. pore sizes. The new material exhibits good thermal stability determined by thermogravimetry curves and good chemical stability was examined in various acidic and buffer solutions (pH 1-7). The binding and adsorption abilities of SG2P were investigated for Hg(2+), Cd(2+), Pb(2+), Zn(2+), K(+), Na(+) and Li(+) cations and compared to the results of classical liquid-liquid extraction with the unbound C,N-bipyrazole compound. The grafting at the surface of silica does not affect complexing properties of the ligand and the SG2P exhibits a high selectivity toward Hg(2+) ion with no complexation being observed towards zinc and alkali metals. The extracted and the complexing cation percentages were determined by atomic absorption measurements. Copyright © 2015 Elsevier B.V. All rights reserved.
Mitja Janža; Dejan Šram; Kim Mezga; Mišo Andjelov; Jože Uhan
2016-01-01
Assessment of the available quantity of groundwater is of essential importance for its sustainable use. Modern approaches for estimation of groundwater availability take into account all potential impacts of abstractions, including impacts on groundwater dependent ecosystems and impacts on surface waters ecological status. Groundwater body is in good quantitative status if groundwater abstractions do not cause signifiant damages to groundwater dependent ecosystems and signifiant d...
CERN Bulletin
2010-01-01
To complete the revamp of CERN’s Council Chamber, a new exhibition is being installed just in time for the June Council meetings. Panels will showcase highlights of CERN’s history, using some of the content prepared for the exhibitions marking 50 years of the PS, which were displayed in the main building last November. The previous photo exhibition in the Council Chamber stopped at the 1970s. To avoid the new panels becoming quickly out of date, photos are grouped together around specific infrastructures, rather than following a classic time-line. “We have put the focus on the accelerators – the world-class facilities that CERN has been offering researchers over the years, from the well-known large colliders to the lesser-known smaller facilities,” says Emma Sanders, who worked on the content. The new exhibition will be featured in a future issue of the Bulletin with photos and an interview with Fabienne Marcastel, designer of the exhibit...
Conciliating surface superhydrophobicities and mechanical strength of porous silicon films
Wang, Fuguo; Zhao, Kun; Cheng, Jinchun; Zhang, Junyan
2011-01-01
Hydrophobic surfaces on Mechanical stable macroporous silicon films were prepared by electrochemical etching with subsequent octadecyltrichlorosilane (OTS) modification. The surface morphologies were controlled by current densities and the mechanical properties were adjusted by their corresponding porosities. Contrast with the smooth macroporous silicon films with lower porosities (34.1%) and microporous silicon with higher porosities (97%), the macroporous film with a rough three-dimension (3D) surface and a moderate pore to cross-section area ratio (37.8%, PSi2‧) exhibited both good mechanical strength (Yong' modulus, shear modulus and collapse strength are 64.2, 24.1 and 0.32 GPa, respectively) and surface superhydrophobicity (water contact angle is 158.4 ± 2° and sliding angle is 2.7 ± 1°). This result revealed that the surface hydrophobicities (or the surface roughness) and mechanical strength of porous films could be conciliated by pore to cross-section area ratios control and 3D structures construction. Thus, the superhydrophobic surfaces on mechanical stable porous films could be obtained by 3D structures fabrication on porous film with proper pore to cross-section area ratios.
Wettability and Contact Time on a Biomimetic Superhydrophobic Surface
Liang, Yunhong; Peng, Jian; Li, Xiujuan; Huang, Jubin; Qiu, Rongxian; Zhang, Zhihui; Ren, Luquan
2017-01-01
Inspired by the array microstructure of natural superhydrophobic surfaces (lotus leaf and cicada wing), an array microstructure was successfully constructed by high speed wire electrical discharge machining (HS-WEDM) on the surfaces of a 7075 aluminum alloy without any chemical treatment. The artificial surfaces had a high apparent contact angle of 153° ± 1° with a contact angle hysteresis less than 5° and showed a good superhydrophobic property. Wettability, contact time, and the corresponding superhydrophobic mechanism of artificial superhydrophobic surface were investigated. The results indicated that the micro-scale array microstructure was an important factor for the superhydrophobic surface, while different array microstructures exhibited different effects on the wettability and contact time of the artificial superhydrophobic surface. The length (L), interval (S), and height (H) of the array microstructure are the main influential factors on the wettability and contact time. The order of importance of these factors is H > S > L for increasing the apparent contact angle and reducing the contact time. The method, using HS-WEDM to fabricate superhydrophobic surface, is simple, low-cost, and environmentally friendly and can easily control the wettability and contact time on the artificial surfaces by changing the array microstructure. PMID:28772613
EXHIBITION: Accelerated Particles
2004-01-01
An exhibition of plastic arts and two evenings of performances by sound and visual artists as part of CERN's 50th anniversary celebrations. Fifty candles for CERN, an international laboratory renowned for fundamental research, is a cause for celebration. Since March this year, Geneva and neighbouring parts of France have been the venues for a wealth of small and large-scale events, which will continue until November. Given CERN's location in the commune of Meyrin, the ForuMeyrin is hosting exhibitions of plastic arts and performances entitled: Accelerated Particles. Several works will be exhibited and performed in two 'salons'. Salon des matières: An exhibition of plastic arts From Tues 12 October to Wed 3 November 2004 Tuesdays to Fridays: 16:00 to 19:00 Saturdays: 14:00 to 18:00 Exhibition open late on performance nights, entrance free Salon des particules: Musical and visual performances Tues 12 and Mon 25 October from 20:00 to 23:00 Preview evening for both events: Tues 12 October from 18:...
Hands-On Math and Art Exhibition Promoting Science Attitudes and Educational Plans
Directory of Open Access Journals (Sweden)
Helena Thuneberg
2017-01-01
Full Text Available The current science, technology, engineering, art, math education (STEAM approach emphasizes integration of abstract science and mathematical ideas for concrete solutions by art. The main aim was to find out how experience of learning mathematics differed between the contexts of school and an informal Math and Art Exhibition. The study participants (N=256 were 12-13 years old from Finland. Several valid questionnaires and tests were applied (e.g., SRQ-A, RAVEN in pre- and postdesign showing a good reliability. The results based on General Linear Modeling and Structural Equation Path Modeling underline the motivational effects. The experience of the effectiveness of hands-on learning at school and at the exhibition was not consistent across the subgroups. The lowest achieving group appreciated the exhibition alternative for math learning compared to learning math at school. The boys considered the exhibition to be more useful than the girls as it fostered their science and technology attitudes. However, for the girls, the attractiveness of the exhibition, the experienced situation motivation, was much more strongly connected to the attitudes on science and technology and the worthiness of mathematics. Interestingly, the pupils experienced that even this short informal learning intervention affected their science and technology attitudes and educational plans.
Bertin; CERN PhotoLab
1969-01-01
The United Kingdom inaugurated the Industrial Exhibitions in 1968, and it wasn't till 1971 that other countries staged exhibitions at CERN. This photo was taken in 1969, at the second British exhibition, where 16 companies were present.
Xiong, Li; Kendrick, Laken L; Heusser, Hannele; Webb, Jamie C; Sparks, Bradley J; Goetz, James T; Guo, Wei; Stafford, Christopher M; Blanton, Michael D; Nazarenko, Sergei; Patton, Derek L
2014-07-09
Superamphiphobic surfaces, exhibiting high contact angles and low contact angle hysteresis to both water and low surface tension liquids, have attracted a great deal attention in recent years because of the potential of these materials in practical applications such as liquid-resistant textiles, self-cleaning surfaces, and antifouling/anticorrosion coatings. In this work, we present a simple strategy for fabricating of superamphiphobic coatings based on photopolymerization of hybrid thiol-ene resins. Spray-deposition and UV photopolymerization of thiol-ene resins containing hydrophobic silica nanoparticles and perfluorinated thiols provide a multiscale topography and low-energy surface that endows the surface with superamphiphobicity. The wettability and chemical composition of the surfaces were characterized by contact-angle goniometry and X-ray photoelectron spectroscopy, respectively. The hierarchical roughness features of the thiol-ene surfaces were investigated with field-emission scanning electron microscopy. Droplet impact and sandpaper abrasion tests indicate the coatings respectively possess a robust antiwetting behavior and good mechanical durability.
Wang, Evelyn N; McCarthy, Matthew; Enright, Ryan; Culver, James N; Gerasopoulos, Konstantinos; Ghodssi, Reza
2015-03-24
Surfaces having a hierarchical structure--having features of both microscale and nanoscale dimensions--can exhibit superhydrophobic properties and advantageous condensation and heat transfer properties. The hierarchical surfaces can be fabricated using biological nanostructures, such as viruses as a self-assembled nanoscale template.
Digital collections and exhibits
Denzer, Juan
2015-01-01
Today's libraries are taking advantage of cutting-edge technologies such as flat panel displays using touch, sound, and hands-free motions to design amazing exhibits using everything from simple computer hardware to advanced technologies such as the Microsoft Kinect. Libraries of all types are striving to add new interactive experiences for their patrons through exciting digital exhibits, both online and off. Digital Collections and Exhibits takes away the mystery of designing stunning digital exhibits to spotlight library trea
Song, Lei; Sjollema, Jelmer; Norde, Willem; Busscher, Henk J.; van der Mei, Henny C.
2015-01-01
Bacteria adhering to surfaces exhibit nanoscopic vibrations that depend on the viscoelasticity of the bond. The quantification of the nanoscopic vibrations of bacteria adhering to surfaces provides new opportunities to better understand the properties of the bond through which bacteria adhere and
Discrimination? - Exhibition of posters
Jakimovska, Jana
2017-01-01
Participation in the exhibition with the students form the Art Academy. The exhibition consisted of 15 posters tackling the subjects of hate speech and discrimination. The exhibition happened thanks to the invitation of the Faculty of Law at UGD, and it was a part of a larger event of launching books on the aforementioned subjects.
Jeschke, Alexander A.; Vosbeck, Katrin; Dreybrodt, Wolfgang
2001-01-01
The effective dissolution rates of gypsum are determined by mixed kinetics, where the rate constants of dissolution at the surface and the transport constant of molecular diffusion of dissolved material are similar. To obtain the surface reaction rate law it is necessary to know the transport constant. We have determined the surface rate law for monocrystalline selenite by using a rotating disc set-up, where the transport coefficients are well known. As a result, up to a calcium concentration of 0.6 · ceq, we find a nearly linear rate law Rs = ksl (1- cs/ ceq) n1, where cs is the total calcium concentration at the surface and ceq the equilibrium concentration with respect to gypsum, n1 = 1.2 ± 0.2, and ksl = 1.1 · 10 -4 mmol cm -2 s -1 ± 15%. We also employed batch-experiments for selenite, alabaster and gypsum rock samples. The result of these experiments were interpreted by using a transport constant determined by NaCl dissolution experiments under similar physical conditions. The batch experiments reveal a dissolution rate law Rs = ksl (1- cs/ ceq) n1, ksl = 1.3 · 10 -4 mmol · cm -2 s -1, n1 = 1.2 ± 0.2 for c ≤ 0.94 · ceq. Close to equilibrium a nonlinear rate law, Rs = ks2 (1- cs/ ceq) n2, is observed, where ks2 is in the order of 10 mmol · cm -2 s -1 and n2 ≈ 4.5. The experimentally observed gypsum dissolution rates from the batch experiments could be accurately fitted, with only minor variations of the surface reaction constant obtained from the rotating disk experiment and the transport coefficient from the NaCl dissolution batch experiment. Batch experiments on pure synthetic gypsum, reveal a linear rate law up to equilibrium. This indicates inhibition of dissolution in natural samples close to equilibrium, as is known also for calcite minerals.
Reed, S. E.; Kreylos, O.; Hsi, S.; Kellogg, L. H.; Schladow, G.; Yikilmaz, M. B.; Segale, H.; Silverman, J.; Yalowitz, S.; Sato, E.
2014-12-01
One of the challenges involved in learning earth science is the visualization of processes which occur over large spatial and temporal scales. Shaping Watersheds is an interactive 3D exhibit developed with support from the National Science Foundation by a team of scientists, science educators, exhibit designers, and evaluation professionals, in an effort to improve public understanding and stewardship of freshwater ecosystems. The hands-on augmented reality sandbox allows users to create topographic models by shaping real "kinetic" sand. The exhibit is augmented in real time by the projection of a color elevation map and contour lines which exactly match the sand topography, using a closed loop of a Microsoft Kinect 3D camera, simulation and visualization software, and a data projector. When an object (such as a hand) is sensed at a particular height above the sand surface, virtual rain appears as a blue visualization on the surface and a flow simulation (based on a depth-integrated version of the Navier-Stokes equations) moves the water across the landscape. The blueprints and software to build the sandbox are freely available online (http://3dh2o.org/71/) under the GNU General Public License, together with a facilitator's guide and a public forum (with how-to documents and FAQs). Using these resources, many institutions (20 and counting) have built their own exhibits to teach a wide variety of topics (ranging from watershed stewardship, hydrology, geology, topographic map reading, and planetary science) in a variety of venues (such as traveling science exhibits, K-12 schools, university earth science departments, and museums). Additional exhibit extensions and learning modules are planned such as tsunami modeling and prediction. Moreover, a study is underway at the Lawrence Hall of Science to assess how various aspects of the sandbox (such as visualization color scheme and level of interactivity) affect understanding of earth science concepts.
EXHIBITION: Accelerated Particles
2004-01-01
http://www.cern.ch/cern50/ An exhibition of plastic arts and two evenings of performances by sound and visual artists as part of CERN's fiftieth anniversary celebrations. The fiftieth anniversary of a world famous organization like CERN, an international laboratory specializing in fundamental research, is a cause for celebration. Since March this year, Geneva and neighbouring parts of France have been the venues for a wealth of small and large-scale events, which will continue until November. Given CERN's location in the commune of Meyrin, the ForuMeyrin is hosting two "salons" consisting of an exhibition of plastic arts and evenings of music and visual arts performances with the collective title of "Accelerated Particles". Several works will be exhibited and performed. Salon des matières: An exhibition of plastic arts Until Wednesday 3 November 2004. Tuesdays to Fridays: 4.00 p.m. to 7.00 p.m. Saturdays: 2.00 p.m. to 6.00 p.m. Doors open late on the evening of the performances. Salon des ...
Exhibiting the Human/Exhibiting the Cyborg: “Who Am I?”
Directory of Open Access Journals (Sweden)
Sophia C. Vackimes
2013-08-01
Full Text Available The role of the museum in shaping our relationship to science and technology, particularly cyborgization, is illuminated by a close examination of the Who Am I permanent exhibition in the Wellcome Wing of the Science Museum of London. This innovative exhibition raises real questions both about the human-technology-science relationship but also about museography. In the context of the history and current practices of museums engaging contemporary technological developments the evidence suggest that even as the Who am I? exhibit did break somewhat from previous approaches, especially the didactic presentation of the socially useful, it has not changed the feld as a whole.
International Nuclear Information System (INIS)
Chang, Y C; Mei, G H; Chang, T W; Wang, T J; Lin, D Z; Lee, C K
2007-01-01
Herein, we propose a special type of periodic subwavelength structure, which is optically an effective gradient-index (GRIN) antireflective surface that also exhibits enhanced-hydrophobic behaviour. Our new concept was developed adopting both the effective medium theory (EMT) and Wenzel's wettability model. To demonstrate the concept, an inverted pyramid structure was fabricated by electron beam (EB) lithography and anisotropic etching. The experimental data was found to be in good agreement with the theoretical prediction. Some potential applications that can benefit from this combination of antireflection and enhanced-hydrophobicity features are discussed
Directory of Open Access Journals (Sweden)
D.S. Blaise Williams, III
2016-03-01
Conclusion: USA exhibit unique postural strategies compared to SSA. These unique strategies seemingly exhibit a direction-specific attribute and may be associated with divergent motor control strategies.
Application of an imaging system to a museum exhibition for developing interactive exhibitions
Miyata, Kimiyoshi; Inoue, Yuka; Takiguchi, Takahiro; Tsumura, Norimichi; Nakaguchi, Toshiya; Miyake, Yoichi
2009-10-01
In the National Museum of Japanese History, 215,759 artifacts are stored and used for research and exhibitions. In museums, due to the limitation of space in the galleries, a guidance system is required to satisfy visitors' needs and to enhance their understanding of the artifacts. We introduce one exhibition using imaging technology to improve visitors' understanding of a kimono (traditional Japanese clothing) exhibition. In the imaging technology introduced, one data projector, one display with touch panel interface, and magnifiers were used as exhibition tools together with a real kimono. The validity of this exhibition method was confirmed by results from a visitors' interview survey. Second, to further develop the interactive guidance system, an augmented reality system that consisted of cooperation between the projector and a digital video camera was also examined. A white paper board in the observer's hand was used as a projection screen and also as an interface to control the images projected on the board. The basic performance of the proposed system was confirmed; however continuous development was necessary for applying the system to actual exhibitions.
Exhibition; Image display agency
International Nuclear Information System (INIS)
Normazlin Ismail
2008-01-01
This article touches on the role of Malaysian Nuclear Agency as nuclear research institutions to promote, develop and encourage the peaceful uses of nuclear technology in its agricultural, medical, manufacturing, industrial, health and environment for the development of the country running successfully. Maturity of Malaysian Nuclear Agency in dealing with nuclear technology that are very competitive and globalization cannot be denied. On this basis Malaysian Nuclear Agency was given the responsibility to strengthen the nuclear technology in Malaysia. One way is through an exhibition featuring the research, discoveries and new technology products of the nuclear technology. Through this exhibition is to promote the nuclear technology and introduce the image of the agency in the public eye. This article also states a number of exhibits entered by the Malaysian Nuclear Agency and achievements during the last exhibition. Authors hope that the exhibition can be intensified further in the future.
Influence of surface defects in ZnO thin films on its biosensing response characteristic
Energy Technology Data Exchange (ETDEWEB)
Saha, Shibu; Gupta, Vinay [Department of Physics and Astrophysics, University of Delhi, Delhi-110007 (India)
2011-09-15
Highly c-axis oriented zinc oxide (ZnO) thin films deposited by rf magnetron sputtering under varying processing pressure (20-50 mT) in a reactive gas mixture of argon and oxygen were studied for biosensing application. The as-deposited ZnO thin films were in a state of compressive stress having defects related to interstitial Zn and antisite oxygen. Glucose oxidase has been chosen as the model enzyme in the present study and was immobilized on the surface of ZnO thin films deposited on indium tin oxide coated Corning Glass substrate. The studies reveal a correlation between the biosensing characteristic and the presence of defects in the ZnO films. The ZnO films deposited under high pressure (50 mT) are found to be more sensitive for biosensing application due to availability of more surface area for effective immobilization of biomolecules and exhibits a suitable microenvironment with good electron transfer characteristic. The obtained results highlight the importance of desired microstate besides availability of suitable native defects in the ZnO thin film for exhibiting enhanced biosensing response.
Influence of surface defects in ZnO thin films on its biosensing response characteristic
International Nuclear Information System (INIS)
Saha, Shibu; Gupta, Vinay
2011-01-01
Highly c-axis oriented zinc oxide (ZnO) thin films deposited by rf magnetron sputtering under varying processing pressure (20-50 mT) in a reactive gas mixture of argon and oxygen were studied for biosensing application. The as-deposited ZnO thin films were in a state of compressive stress having defects related to interstitial Zn and antisite oxygen. Glucose oxidase has been chosen as the model enzyme in the present study and was immobilized on the surface of ZnO thin films deposited on indium tin oxide coated Corning Glass substrate. The studies reveal a correlation between the biosensing characteristic and the presence of defects in the ZnO films. The ZnO films deposited under high pressure (50 mT) are found to be more sensitive for biosensing application due to availability of more surface area for effective immobilization of biomolecules and exhibits a suitable microenvironment with good electron transfer characteristic. The obtained results highlight the importance of desired microstate besides availability of suitable native defects in the ZnO thin film for exhibiting enhanced biosensing response.
Li, Chun-Yi; Liao, Ying-Chih
2016-05-11
In this study, a plasma surface modification with printing process was developed to fabricate printed flexible conductor patterns or devices directly on polydimethylsiloxane (PDMS) surface. An atmospheric plasma treatment was first used to oxidize the PDMS surface and create a hydrophilic silica surface layer, which was confirmed with photoelectron spectra. The plasma operating parameters, such as gas types and plasma powers, were optimized to obtain surface silica layers with the longest lifetime. Conductive paste with epoxy resin was screen-printed on the plasma-treated PDMS surface to fabricate flexible conductive tracks. As a result of the strong binding forces between epoxy resin and the silica surface layer, the printed patterns showed great adhesion on PDMS and were undamaged after several stringent adhesion tests. The printed conductive tracks showed strong mechanical stability and exhibited great electric conductivity under bending, twisting, and stretching conditions. Finally, a printed pressure sensor with good sensitivity and a fast response time was fabricated to demonstrate the capability of this method for the realization of printed electronic devices.
Miyamoto, Yumi; Kuroda, Yoshiyuki; Uematsu, Tsubasa; Oshikawa, Hiroyuki; Shibata, Naoya; Ikuhara, Yuichi; Suzuki, Kosuke; Hibino, Mitsuhiro; Yamaguchi, Kazuya; Mizuno, Noritaka
2015-10-01
The efficient surface reaction and rapid ion diffusion of nanocrystalline metal oxides have prompted considerable research interest for the development of high functional materials. Herein, we present a novel low-temperature method to synthesize ultrasmall nanocrystalline spinel oxides by controlling the hydration of coexisting metal cations in an organic solvent. This method selectively led to Li-Mn spinel oxides by tuning the hydration of Li+ ions under mild reaction conditions (i.e., low temperature and short reaction time). These particles exhibited an ultrasmall crystallite size of 2.3 nm and a large specific surface area of 371 ± 15 m2 g-1. They exhibited unique properties such as unusual topotactic Li+/H+ ion exchange, high-rate discharge ability, and high catalytic performance for several aerobic oxidation reactions, by creating surface phenomena throughout the particles. These properties differed significantly from those of Li-Mn spinel oxides obtained by conventional solid-state methods.
Miyamoto, Yumi; Kuroda, Yoshiyuki; Uematsu, Tsubasa; Oshikawa, Hiroyuki; Shibata, Naoya; Ikuhara, Yuichi; Suzuki, Kosuke; Hibino, Mitsuhiro; Yamaguchi, Kazuya; Mizuno, Noritaka
2015-01-01
The efficient surface reaction and rapid ion diffusion of nanocrystalline metal oxides have prompted considerable research interest for the development of high functional materials. Herein, we present a novel low-temperature method to synthesize ultrasmall nanocrystalline spinel oxides by controlling the hydration of coexisting metal cations in an organic solvent. This method selectively led to Li–Mn spinel oxides by tuning the hydration of Li+ ions under mild reaction conditions (i.e., low temperature and short reaction time). These particles exhibited an ultrasmall crystallite size of 2.3 nm and a large specific surface area of 371 ± 15 m2 g−1. They exhibited unique properties such as unusual topotactic Li+/H+ ion exchange, high-rate discharge ability, and high catalytic performance for several aerobic oxidation reactions, by creating surface phenomena throughout the particles. These properties differed significantly from those of Li–Mn spinel oxides obtained by conventional solid-state methods. PMID:26456216
Expoziţia „Anunţul publicitar în Basarabia" / The exhibition "Advertisements in Bessarabia"
Directory of Open Access Journals (Sweden)
Vera Serjant
2016-10-01
Full Text Available The National Museum of History of Moldova for the first time held a temporary exhibition dedicated to the history of advertising in Bessarabia (19th century 1930s. It was presented to the public in the hall upstairs from 24 December 2015 to 15 February 2016. The exhibition "Advertisements in Bessarabia" was aimed at promoting the museum collections, especially periodical press fund. It included about 106 exhibits. Newspapers were the most important means of advertising before the advent of radio and television. Selected advertisements contain information about the trading houses, factories, hotels, shops, bank offices, bars, theater and circus in Bessarabia, mainly in Chisinau. Images of Chisinau streets and buildings of previous years introduced the visitors to the atmosphere of bygone days. In the showcases promotional items were exhibited. As carriers of advertising information there were represented packages of goods. The exhibition was supplemented by the reconstruction of a kiosk of the late 19th century. The creators of the exhibition sought to immerse its visitors into the world of desires, expectations and values of the society in a certain historical period.
Tritiated water vapor in the surface air at Tokyo
International Nuclear Information System (INIS)
Inoue, Hisayuki; Katsuragi, Yukio; Shigehara, Koji
1984-01-01
Tritium concentration in water vapor in the air near the surface and in the precipitation at Tokyo was measured during the period from 9 August to 20 November in 1974. From August to the middle of October, tritium mixing ratios in the surface air had relatively higher values except those in air masses which were associated with a typhoon. The mixing ratios of tritium in the air decreased abruptly at the middle of October, which indicates the decrease of tritium influx from aloft. These data exhibit the salient feature that variations in tritium concentration in TR are linear to the reciprocal of the content of water vapor during each period. Tritium concentrations in vapor and rain water collected simultaneously show nearly equal values. One of the reasons for the good correlation of tritium concentration between falling drops and ambient air is considered to be the result of the rapid isotopic exchange. (author)
The World of Virtual Exhibitions
Directory of Open Access Journals (Sweden)
Irena Eiselt
2013-09-01
Full Text Available EXTENDED ABSTRACTSpecial collections of the National and University Library (NUK hide a lot of items of precious value. The Slovenian cultural heritage is stored on paper or on other media as a part of the library’s Manuscripts, Incunabula and Rare Books Collection, Old Prints Collection, Maps and Pictorial Collection, Music Collection, Ephemera Collection, Serials Collection, and Slovenian Diaspora Publications Collection. Only a small part of the treasures is temporary revealed to the public on special exhibitions. The idea of virtual exhibitions of library treasures was born in 2005. The library aimed to exhibit precious items of special collections of high historical or artistic value. In 2008 the first two virtual exhibitions were created in-house offering access to the rich collections of old postcards of Ljubljana at the beginning of 20th century kept in the Maps and Pictorial Collection of NUK. They were soon followed by other virtual exhibitions. At the beginning they were organised in the same way as physical exhibitions, afterwards different programs were used for creation of special effects (for ex. 3D wall. About two years ago it was decided that the creation of virtual exhibitions will be simplified. Files of digitised and borndigital library materials in jpg format are imported to MS PowerPoint 2010. Each jpg file is now formatted by adding a frame, a description … to the slides which are saved as jpg files. The last step is the import of jpg files into Cooliris application used for NUK web exhibitions. In the paper the virtual exhibition design and creation, the technical point of view and criteria for the selection of exhibition content are explained following the example of the virtual exhibitions the Old Postcards of Ljubljana, Photo Ateliers in Slovenia, a collection of photographs Four Seasons by Fran Krašovec and photos of Post-Earthquake Ljubljana in 1895.
Xin, Xian-zhen; Chen, Jie; Xiang, Nan; Wei, Bin
2013-01-01
We sought to study the corrosion behavior and surface properties of a commercial cobalt-chromium (Co-Cr) alloy which was fabricated with selective laser melting (SLM) technique. For this purpose, specimens were fabricated using different techniques, such as SLM system and casting methods. Surface hardness testing, microstructure observation, surface analysis using X-ray photoelectron spectroscopy (XPS) and electrochemical corrosion test were carried out to evaluate the corrosion properties and surface properties of the specimens. We found that microstructure of SLM specimens was more homogeneous than that of cast specimens. The mean surface hardness values of SLM and cast specimens were 458.3 and 384.8, respectively; SLM specimens showed higher values than cast ones in hardness. Both specimens exhibited no differences in their electrochemical corrosion properties in the artificial saliva through potentiodynamic curves and EIS, and no significant difference via XPS. Therefore, we concluded that within the scope of this study, SLM-fabricated restorations revealed good surface properties, such as proper hardness, homogeneous microstructure, and also showed sufficient corrosion resistance which could meet the needs of dental clinics.
Raising the shields: PCR in the presence of metallic surfaces protected by tailor-made coatings.
Scherag, Frank D; Brandstetter, Thomas; Rühe, Jürgen
2014-10-01
The implementation of PCR reactions in the presence of metallic surfaces is interesting for the generation of novel bioanalytical devices, because metals exhibit high mechanical stability, good thermal conductivity, and flexibility during deformation. However, metallic substrates are usually non-compatible with enzymatic reactions such as PCR due to poisoning of the active center of the enzyme or nonspecific adsorption of the enzymeto the metal surface, which could result in protein denaturation. We present a method for the generation of polymer coatings on metallic surfaces which are designed to minimize protein adsorption and also prevent the release of metal ions. These coatings consist of three layers covalently linked to each other; a self-assembled monolayer to promote adhesion, a photochemically generated barrier layer and a photochemically generated hydrogel. The coatings can be deposited onto aluminum, stainless steel, gold and copper surfaces. We compare PCR efficiencies in the presence of bare metallic surfaces with those of surfaces treated with the novel coating system. Copyright © 2014 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Kumpf, C.; Müller, A.; Weigand, W.
2003-01-01
The atomic structure and lattice dynamics of epitaxial BeTe(001) thin films are derived from surface x-ray diffraction and Raman spectroscopy. On the Te-rich BeTe(001) surface [1 (1) over bar0]-oriented Te dimers are identified. They cause a (2 X 1) superstructure and induce a pronounced buckling...... in the underlying Te layer. The Be-rich surface exhibits a (4 X 1) periodicity with alternating Te dimers and Te-Be-Te trimers. A vibration eigenfrequency of 165 cm(-1) is observed for the Te-rich surface, while eigenmodes at 157 and 188 cm(-1) are found for the Be-rich surface. The experimentally derived atomic...... geometry and the vibration modes are in very good agreement with the results of density functional theory calculations....
DEFF Research Database (Denmark)
2013-01-01
Sonnesgade 11 The exhibition at the AAA library presents selected work produced by students prior to the exhibition of installations in project and praxis constructing an archive at Sonnesgade 11. The exhibition at Sonnesgade 11 was the culmination of collaboration with SLETH architects and studio...
Two-dimensional colloidal fluids exhibiting pattern formation.
Chacko, Blesson; Chalmers, Christopher; Archer, Andrew J
2015-12-28
Fluids with competing short range attraction and long range repulsive interactions between the particles can exhibit a variety of microphase separated structures. We develop a lattice-gas (generalised Ising) model and analyse the phase diagram using Monte Carlo computer simulations and also with density functional theory (DFT). The DFT predictions for the structures formed are in good agreement with the results from the simulations, which occur in the portion of the phase diagram where the theory predicts the uniform fluid to be linearly unstable. However, the mean-field DFT does not correctly describe the transitions between the different morphologies, which the simulations show to be analogous to micelle formation. We determine how the heat capacity varies as the model parameters are changed. There are peaks in the heat capacity at state points where the morphology changes occur. We also map the lattice model onto a continuum DFT that facilitates a simplification of the stability analysis of the uniform fluid.
The Road Transport world exhibition in Paris
International Nuclear Information System (INIS)
Anon.
1995-01-01
Following the agreement between French and German professionals of automobile and industrial vehicle, the Road Transport world exhibition will take place alternatively in Paris and Hanover. The 1995 meeting has taken place in Paris (September 15-21) and about 20 countries were represented. Road transport is the principal way of goods transportation in France and represent 88% of the traffic explained in tons gross and 70% in tons km. The petroleum dependence of the transportation sector is becoming a worrying problem as the gasoline and diesel fuels taxes will be discussed in the 1996 financial laws project. According to the last ''Worldwide energetic perspectives'' report published by the IEA, in 2010 the transportation sector could absorb more than 60% of the worldwide petroleum consumption. This increase represents a challenge to the petroleum industry to increase the energetic efficiency of the vehicle fuels and the production of diesel fuels, and conversely to reduce the pollution effluents. (J.S.). 4 tabs
Katarina Anthony
2015-01-01
Summer is coming - and with it, a new Microcosm exhibition showcasing CERN (see here). But while the new exhibit is preparing to enchant visitors, many have been asking about the site's former content. Will it simply be out with the old and in with the new? Not as such! The plasma ball from Microcosm is now on display at the LHCb site. As Microcosm's new content is moving in, its old content is moving up. From LHCb to IdeaSquare, former Microcosm displays and objects are being installed across the CERN site. "Microcosm featured many elements that were well suited to life outside of the exhibition," says Emma Sanders, Microcosm project leader in the EDU group. "We didn't want this popular content to go to waste, and so set out to find them new homes across CERN." The LHCb experiment has received a number of Microcosm favourites, including the Rutherford experiment, the cosmic ray display and the Thomson experiment. "We&...
Globe exhibit wins international acclaim
Katarina Anthony
2011-01-01
The Globe’s “Universe of Particles” exhibition has recently received four prestigious awards for its avant-garde design. This external praise is great encouragement for the CERN exhibitions currently on the drawing board. The Universe of Particles exhibition has won 4 awards for its avant-garde design. Back in 2008, the design company Atelier Brückner was presented with a challenge: to design the layout of a new permanent exhibition for CERN, one that would epitomize both the Organization and its research. The brief was concise but complex: the exhibit had to be symbolic of the Organization, use modern technology, engage and immerse visitors, and, preferably, use touch-screen technology. With the help of IArt, an interactive technology firm, and based on the content provided by CERN’s Education Group, Atelier Brückner developed the “Universe of Particles” exhibit as it is today. Its principal concept centred on the s...
Zhang, Xiang; Shi, Chunsheng; Liu, Enzuo; Li, Jiajun; Zhao, Naiqin; He, Chunnian
2015-10-01
In this study, we demonstrated nitrogen-doped graphene network supported few-layered graphene shell encapsulated Cu nanoparticles (NPs) (Cu@G-NGNs) as a sensing platform, which were constructed by a simple and scalable in situ chemical vapor deposition (CVD) technique with the assistance of a self-assembled three-dimensional (3D) NaCl template. Compared with pure Cu NPs and graphene decorated Cu NPs, the graphene shells can strengthen the plasmonic coupling between graphene and Cu, thereby contributing to an obvious improvement in the local electromagnetic field that was validated by finite element numerical simulations, while the 3D nitrogen-doped graphene walls with a large surface area facilitated molecule adsorption and the doped nitrogen atoms embedded in the graphene lattice can reduce the surface energy of the system. With these merits, a good surface enhanced Raman spectroscopy (SERS) activity of the 3D Cu@G-NGN painting film on glass was demonstrated using rhodamine 6G and crystal violet as model analytes, exhibiting a satisfactory sensitivity, reproducibility and stability. As far as we know, this is the first report on the in situ synthesis of nitrogen-doped graphene/copper nanocomposites and this facile and low-cost Cu-based strategy tends to be a good supplement to Ag and Au based substrates for SERS applications.In this study, we demonstrated nitrogen-doped graphene network supported few-layered graphene shell encapsulated Cu nanoparticles (NPs) (Cu@G-NGNs) as a sensing platform, which were constructed by a simple and scalable in situ chemical vapor deposition (CVD) technique with the assistance of a self-assembled three-dimensional (3D) NaCl template. Compared with pure Cu NPs and graphene decorated Cu NPs, the graphene shells can strengthen the plasmonic coupling between graphene and Cu, thereby contributing to an obvious improvement in the local electromagnetic field that was validated by finite element numerical simulations, while the 3D nitrogen
Huo, Fangjun; Guo, Weihua; Wu, Hao; Wang, Yueting; He, Gang; Xie, Li; Tian, Weidong
2018-04-01
Biomimetic specific surface structure could improve biological behaviors of specific cells and eventual tissue integration. Featuring titanium surface with structures resembling bone resorption lacunae (RL) can be a promising approach to improve the osteoblast responses and osseointegration of implants. As a most common used dental implant surface, sandblasting and acid etching (SLA) surface has micro-sized structures with dimensions similar to RL, but great differences exist when it comes to shape and contour. In this work, by anodizing titanium substrate in a novel HCOONa/CH3COONa electrolyte, RL-like crater structures were fabricated with highly similar size, shape and contour. Compared with SLA, it was much more similar to RL structure in shape and contour. Furthermore, through subsequent alkali-heat treatment, nano-sized structures that overlaid the whole surface were obtained, which further mimic undercuts features inside the RL. The as-prepared surface was consisted of crystalline titania and exhibited super-hydrophilicity with good stability. In vitro evaluation results showed that the surface could significantly improve adhesion, proliferation and differentiation of MG63 cells in comparison with SLA. This new method may be a promising candidate for biomimetic modification of titanium implant to promote osseointegration.
Gain-Enhanced On-Chip Antenna Utilizing Artificial Magnetic Conductor Reflecting Surface at 94 GHz
Nafe, Mahmoud
2015-01-01
In this work, the use of specially patterned reflecting surfaces for improving on- chip antenna performance is investigated. By using a periodic metallic surface on top of a grounded substrate, the structure can mimic the behavior of a perfect mag- netic conductor, hence called Artificial Magnetic Conductor (AMC) surface. Unlike conventional ground plane reflecting surfaces, AMC surfaces generally enhance the radiation and impedance characteristics of close-by antennas. Based on this property, a ring-based AMC reflecting surface has been designed in the oxide layer for on-chip antennas operating at 94 GHz. Furthermore, a folded dipole antenna with its associ- ated planar feeding structures has been optimized and integrated with the developed ring-based AMC surface. The proposed design is then fabricated at KAUST clean- room facilities. Prototype characterization showed very promising results with good correlation to simulations, with the antenna exhibiting an impedance bandwidth of 10% (90-100 GHz) and peak gain of -1.4 dBi, which is the highest gain reported for on-chip antennas at this frequency band without the use of any external o↵-chip components or post-fabrication steps.
Liu, Feng; Wang, Shuliang; Zhang, Ming; Ma, Miaolian; Wang, Chengyu; Li, Jian
2013-09-01
Improvement of the robustness of superhydrophobic surfaces is crucial for the purpose of achieving commercial applications of these surfaces in such various areas as self-cleaning, water repellency and corrosion resistance. We have investigated a fabrication of polyvinyl alcohol (PVA)/silica (SiO2) composite polymer coating on wooden substrates with super repellency toward water, low sliding angles, low contact angle hysteresis, and relatively better mechanical robustness. The composite polymer slurry, consisting of well-mixing SiO2 particles and PVA, is prepared simply and subsequently coated over wooden substrates with good adhesion. In this study, the mechanical robustness of superhydrophobic wood surfaces was evaluated. The effect of petaloid structures of the composite polymer on robustness was investigated using an abrasion test and the results were compared with those of superhydrophobic wood surfaces fabricated by other processes. The produced wood surfaces exhibited promising superhydrophobic properties with a contact angle of 159̊ and a sliding angle of 4̊, and the relatively better mechanical robustness.
Choi, Suhee; Ahn, Miri; Kim, Jongwon
2013-05-24
The fabrication of effective surface-enhanced Raman scattering (SERS) substrates has been the subject of intensive research because of their useful applications. In this paper, dendritic gold (Au) rod (DAR) structures prepared by simple one-step electrodeposition in a short time were examined as an effective SERS-active substrate. The SERS activity of the DAR surfaces was compared to that of other nanostructured Au surfaces with different morphologies, and its dependence on the structural variation of DAR structures was examined. These comparisonal investigations revealed that highly faceted sharp edge sites present on the DAR surfaces play a critical role in inducing a high SERS activity. The SERS enhancement factor was estimated to be greater than 10(5), and the detection limit of rhodamine 6G at DAR surfaces was 10(-8)M. The DAR surfaces exhibit excellent spot-to-spot and substrate-to-substrate SERS enhancement reproducibility, and their long-term stability is very good. It was also demonstrated that the DAR surfaces can be effectively utilized in electrochemical SERS systems, wherein a reversible SERS behavior was obtained during the cycling to cathodic potential regions. Considering the straightforward preparation of DAR substrates and the clean nature of SERS-active Au surfaces prepared in the absence of additives, we expect that DAR surfaces can be used as cost-effective SERS substrates in analytical and electrochemical applications. Copyright © 2013 Elsevier B.V. All rights reserved.
Optimization of biosurfactant production by Bacillus brevis using response surface methodology
Directory of Open Access Journals (Sweden)
Foukia E. Mouafi
2016-03-01
Full Text Available The present study aims to evaluate and validate a statistical model for maximizing biosurfactant productivity by Bacillus brevis using response surface methodology. In this respect, twenty bacterial isolates were screened for biosurfactant production using hemolytic activity, oil spreading technique, and emulsification index (E24. The most potent biosurfactant-producing bacterium (B. brevis was used for construction of the statistical response surface model. The optimum conditions for biosurfactant production by B. brevis were: 33 °C incubation temperature at pH 8 for 10 days incubation period and 8.5 g/L glucose concentration as a sole carbon source. The produced biosurfactant (BS (73% exhibited foaming activity, thermal stability in the range 30–80 °C for 30 min., pH stability, from 4 to 9 and antimicrobial activity against (Escherichia coli. The BS gave a good potential application as an emulsifier.
HOW GOOD IS GOODS AND SERVICES TAX
Dr. Sreemoyee Guha Roy
2016-01-01
Goods and Services Tax is a broad based and a single comprehensive tax levied on goods and services consumed in an economy. GST is levied at every stage of the production-distribution chain with applicable set offs in respect of the tax remitted at previous stages. It is basically a tax on final consumption. The Goods and Services Tax (GST) is a value added tax to be implemented in India, the decision on which is pending. GST is the only indirect tax that directly affects all sectors and sect...
Thermodynamic investigation of surface of minerals
Energy Technology Data Exchange (ETDEWEB)
Medout-Marere, V.; Zoungrana, T.; Douillard, J.M.; Partyka, S. [U.P.R.E.S.A., 5072 CNRS, University of Montpellier II, place Eugene Bataillon, Case 015, 34095 Montpellier Cedex (France); Malandrini, H. [Sanofi Recherche-Centre de Recherches, 371 rue du Professeur Blayac, 34000 Montpellier (France)
1998-06-06
In this paper values of surface enthalpies and surface Gibbs free energies are given in order to characterize subsurface minerals. These values are obtained by combining standard measurements of adsorption and the Van Oss-Chaudhury-Good model [Van Oss, C.J., Chaudhury, M.K., Good, R.J., 1987. Monopolar surfaces. Adv. Coll. Interface Sci. 28, 35; Van Oss, C.J., Good, R.J., Chaudhury, M.K., 1988. Additive and nonadditive surface tension components and the interpretation of contact angles. Langmuir 4, 884; Van Oss, C.J., Giese, R.F., Costanzo, P.M., 1990. DLVO and non-DLVO interactions in hectorite. Clays Clay Min. 38, 151; Van Oss, C.J., Giese, R.F., Li, Z., Murphy, K., Norris, J., Chaudhury, M.K., Good, R.J., 1992. Determination of contact angles and pore sizes of porous media by column and thin layer wicking. J. Adhesion Sci. Technol. 6, 413.]. This model is reviewed and modified with a view to identify the types of interactions at solid-fluid interfaces and interpreting experimental results
A novel aluminum based nanocomposite with high strength and good ductility
Energy Technology Data Exchange (ETDEWEB)
Ramezanalizadeh, Hossein, E-mail: hralizadeh@ut.ac.ir [School of Metallurgy and Materials Engineering, College of Engineering, University of Tehran, Tehran (Iran, Islamic Republic of); Emamy, Masoud [School of Metallurgy and Materials Engineering, College of Engineering, University of Tehran, Tehran (Iran, Islamic Republic of); Shokouhimehr, Mohammadreza [School of Chemical and Biological Engineering, College of Engineering, Seoul National University, Seoul (Korea, Republic of)
2015-11-15
Aluminum based nanocomposite containing nano-sized Al{sub 3}Mg{sub 2} reinforcing was fabricated via mechanical milling followed by hot extrusion techniques. For this, Al and Al{sub 3}Mg{sub 2} powders were mixed mechanically and milled at different times (0, 2, 5, 7, 10, 15 and 20 h) to achieve Al–10 wt.% Al{sub 3}Mg{sub 2} composite powders. Hot extrusion of cold pressed powders was done at 400 °C with extrusion ratio of 6:1. Microstructures of the powders and consolidated materials were studied using transmission electron microscopy, scanning electron microscope and X-ray diffraction. Fracture surfaces were also investigated by scanning electron microscopy equipped with EDS analyzer. The results showed that an increase in milling time caused to reduce the grain size unlike the lattice strain of Al matrix. In addition, the fabricated composites exhibited homogeneous distribution and less agglomerations of the n-Al{sub 3}Mg{sub 2} with increasing milling time. The mechanical behavior of these nanocomposites was investigated by hardness and tensile tests, which revealed it has four times the strength of a conventional Al along with good ductility. It was found that the ultimate tensile strength (UTS) and elongation of the nanocomposites were significantly improved with increases in milling time up to 15 h. This improvement was attributed to the grain refinement strengthening and homogeneous distribution of the n-Al{sub 3}Mg{sub 2}. Fracture surfaces showed that the interfacial bonding between Al and Al{sub 3}Mg{sub 2} could be improved with increasing in milling time. Also HRTEM results from interface showed that a metallurgical clean interface and intimate contact between matrix and second phase. By extending the milling process up to 20 h, there was no significant improvement in mechanical behavior of materials, due to the completion of milling process and dynamic and static recovery of composite at higher milling times. - Highlights: • A novel aluminum
Directory of Open Access Journals (Sweden)
Weikang Zhang
2017-03-01
Full Text Available Leaf surface is a multifunctional interface between a plant and its environment, which affects both ecological and biological processes. Leaf surface topography directly affects microhabitat availability and ability for deposition. In this study, atomic force microscopy (AFM and the resuspended particulate matter method were applied to evaluate the adsorptive capacity of the leaf surface. Patterns of particulate‐capturing capacities in different tree species and the effect of leaf surface features on these capacities were explored. Results indicated the following: (1 more total suspended particles (TSP per unit leaf area were captured by coniferous tree species than by broad‐leaved tree species in a particular order—i.e., Pinus tabuliformis > Pinus bungeana > Salix matsudana > Acer truncatum > Ginkgo biloba > Populus tomentosa; (2 Significant seasonal variation in particulate‐capturing capacities were determined. During the observation period, the broad‐leaved tree species capturing TSP and coarse particulate matter (PM10 clearly exhibited a ∩‐shape pattern— that is, increasing initially and later on decreasing; meanwhile, the ∩‐shape pattern was not clearly shown in P. tabuliformis and P. bungeana. However, no obvious patterns in the absorption of fine particulate matter (PM2.5 were found in the tested tree species; (3 The leaf surface topography, as observed by AFM and scanning electron microscopy, revealed that the broad‐leaved tree exhibits a good correlation between micro‐roughness of leaf surfaces and density of particles settling on leaf surfaces over time. However, the main factors affecting the adsorptive capacities of the leaves in coniferous trees are the number of stomata as well as the amount of epicuticular wax and the properties of the cuticle in different seasons.
Howe, Daniel K; Gaji, Rajshekhar Y; Marsh, Antoinette E; Patil, Bhagyashree A; Saville, William J; Lindsay, David S; Dubey, J P; Granstrom, David E
2008-05-01
A gene family of surface antigens is expressed by merozoites of Sarcocystis neurona, the primary cause of equine protozoal myeloencephalitis (EPM). These surface proteins, designated SnSAGs, are immunodominant and therefore excellent candidates for development of EPM diagnostics or vaccines. Prior work had identified an EPM isolate lacking the major surface antigen SnSAG1, thus suggesting there may be some diversity in the SnSAGs expressed by different S. neurona isolates. Therefore, a bioinformatic, molecular and immunological study was conducted to assess conservation of the SnSAGs. Examination of an expressed sequence tag (EST) database revealed several notable SnSAG polymorphisms. In particular, the EST information implied that the EPM strain SN4 lacked the major surface antigen SnSAG1. The absence of this surface antigen from the SN4 strain was confirmed by both Western blot and Southern blot. To evaluate SnSAG polymorphisms in the S. neurona population, 14 strains were examined by Western blots using monospecific polyclonal antibodies against the four described SnSAGs. The results of these analyses demonstrated that SnSAG2, SnSAG3, and SnSAG4 are present in all 14 S. neurona strains tested, although some variance in SnSAG4 was observed. Importantly, SnSAG1 was not detected in seven of the strains, which included isolates from four cases of EPM and a case of fatal meningoencephalitis in a sea otter. Genetic analyses by PCR using gene-specific primers confirmed the absence of the SnSAG1 locus in six of these seven strains. Collectively, the data indicated that there is heterogeneity in the surface antigen composition of different S. neurona isolates, which is an important consideration for development of serological tests and prospective vaccines for EPM. Furthermore, the diversity reported herein likely extends to other phenotypes, such as strain virulence, and may have implications for the phylogeny of the various Sarcocystis spp. that undergo sexual stages
Chen, Yin
2015-06-12
A stable noble-metal-free hydrogen evolution photocatalyst based on graphite carbon nitride (g-C3N4) was developed by a molecular-level design strategy. Surface functionalization was successfully conducted to introduce a single nickel active site onto the surface of the semiconducting g-C3N4. This catalyst family (with less than 0.1 wt% of Ni) has been found to produce hydrogen with a rate near to the value obtained by using 3 wt% platinum as co-catalyst. This new catalyst also exhibits very good stability under hydrogen evolution conditions, without any evidence of deactivation after 24h. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Hong, Xiaoting; Hui, K.S.; Zeng, Zhi; Hui, K.N.; Zhang, Luojiang; Mo, Mingyue; Li, Min
2014-01-01
Highlights: • Porous carbons were prepared using endothelium corneum gigeriae galli as precursor. • Surface and structural properties strongly depend on carbonization temperatures. • Resultant carbons possess nitrogen heteroatom and high surface areas. • ECGG-900 sample exhibits excellent electrochemical capacitive performances. - Abstract: Endothelium corneum gigeriae galli derived 3D hierarchical nitrogen-doped porous carbon was for the first time prepared by preliminary carbonization at 450 °C and final KOH activation at high temperatures. The surface and structural properties of the as-synthesized samples are analyzed with Brunauer–Emmett–Teller surface analyzer apparatus, X-Ray Diffractometer, scanning electron microscopy, transmission electron microscopy, X-ray photoelectron spectrometer. The electrochemical performances are analyzed by cyclic voltammetry, galvanostatic charge/discharge cycling and electrochemical impedance spectroscopy. The obtained results show that the sample carbonized at 900 °C possesses the SSA of 2149.9 m 2 g −1 , average micropore diameter of 1.78 nm, and exhibits the highest initial specific capacitance of 198.0 F g −1 at current density of 1 A g −1 in 6 M KOH solution. It retains good specific capacitance retention of 91.6% after 3000 charge/discharge cycles at current density of 2 A g −1
Greenhouse Earth: A Traveling Exhibition
International Nuclear Information System (INIS)
Booth, W.H.; Caesar, S.
1992-09-01
The Franklin Institute Science Museum provided an exhibit entitled the Greenhouse Earth: A Traveling Exhibition. This 3500 square-foot exhibit on global climate change was developed in collaboration with the Association of Science-Technology Centers. The exhibit opened at The Franklin Institute on February 14, 1992, welcoming 291,000 visitors over its three-month stay. During its three-year tour, Greenhouse Earth will travel to ten US cities, reaching two million visitors. Greenhouse Earth aims to deepen public understanding of the scientific issues of global warming and the conservation measures that can be taken to slow its effects. The exhibit features hands-on exhibitry, interactive computer programs and videos, a theater production, a ''demonstration cart,'' guided tours, and lectures. supplemental educational programs at the Institute included a teachers preview, a symposium on climate change, and a ''satellite field trip.'' The development of Greenhouse Earth included front-end and formative evaluation procedures. Evaluation includes interviews with visitors, prototypes, and summative surveys for participating museums. During its stay in Philadelphia, Greenhouse Earth was covered by the local and national press, with reviews in print and broadcast media. Greenhouse Earth is the first large-scale museum exhibit to address global climate change
Drivers of Finished-Goods Inventory in the U.S. Automobile Industry
Gérard P. Cachon; Marcelo Olivares
2010-01-01
Automobile manufacturers in the U.S. supply chain exhibit significant differences in their days of supply of finished vehicles (average inventory divided by average daily sales rate). For example, from 1995 to 2004, Toyota consistently carried approximately 30 fewer days of supply than General Motors. This suggests that Toyota's well-documented advantage in manufacturing efficiency, product design, and upstream supply chain management extends to their finished-goods inventory in their downstr...
Chen, Weixiang
The effects of the surface treatment of the hydrogen storage alloy on the activation property and cycle life of nickel/metal-hydride (Ni/MH) batteries were investigated by means of the electrochemical impedance spectra. It was found that the oxide layer on the alloy surface affected its electrochemical properties and catalysis for the oxygen combination. Therefore, Ni/MH battery employed the untreated alloy as negative electrode material exhibited bad activation property, short cycle life and high internal pressure. Because of the improvement in the metal hydride electrode electrochemical characteristics and catalysis for oxygen recombination by the surface treatment of the alloy in 0.02 M KBH 4+6 M KOH or 6 M KOH solution, the battery used the treated alloy as negative exhibited good activation, long cycle life and low internal pressure. The composition and dissolution of the alloy surface were analyzed by an electron probe microanalysis (EPMA) and induced coupled plasma spectroscopy (ICP). It was found that the Ni-rich surface layer was an important factor to improve the activation and cycle life of battery.
Staff Association
2016-01-01
Encounters Hanne Blitz From February 1st to 12th 2016 CERN Meyrin, Main Building What is our reaction to a first encounter with a tourist attraction? Contemporary Dutch painter Hanne Blitz captures visitors' responses to art and architecture, sweeping vistas and symbolic memorials. Encounters, a series of oil paintings curated specially for this CERN exhibition, depicts tourists visiting cultural highlights around the world. A thought-provoking journey not to be missed, and a tip of the hat to CERN's large Hadron Collider.
Investigation of back surface fields effect on bifacial solar cells
Sepeai, Suhaila; Sulaiman, M. Y.; Sopian, Kamaruzzaman; Zaidi, Saleem H.
2012-11-01
A bifacial solar cell, in contrast with a conventional monofacial solar cell, produces photo-generated current from both front and back sides. Bifacial solar cell is an attractive candidate for enhancing photovoltaic (PV) market competitiveness as well as supporting the current efforts to increase efficiency and lower material costs. This paper reports on the fabrication of bifacial solar cells using phosphorus-oxytrichloride (POCl3) emitter formation on p-type, nanotextured silicon (Si) wafer. Backside surface field was formed through Al-diffusion using conventional screen-printing process. Bifacial solar cells with a structure of n+pp+ with and without back surface field (BSF) were fabricated in which silicon nitride (SiN) anti reflection and passivation films were coated on both sides, followed by screen printing of Argentum (Ag) and Argentum/Aluminum (Ag/Al) on front and back contacts, respectively. Bifacial solar cells without BSF exhibited open circuit voltage (VOC) of 535 mV for front and 480 mV for back surface. With Al-alloyed BSF bifacial solar cells, the VOC improved to 580 mV for the front surface and 560 mV for the back surface. Simulation of bifacial solar cells using PC1D and AFORS software demonstrated good agreement with experimental results. Simulations showed that best bifacial solar cells are achieved through a combination of high lifetime wafer, low recombination back surface field, reduced contact resistance, and superior surface passivation.
Ductile Bulk Aluminum-Based Alloy with Good Glass-Forming Ability and High Strength
International Nuclear Information System (INIS)
Long-Chao, Zhuo; Shu-Jie, Pang; Hui, Wang; Tao, Zhang
2009-01-01
Based on a new approach for designing glassy alloy compositions, bulk Al-based alloys with good glass-forming ability (GFA) are synthesized. The cast Al 86 Si 0.5 Ni 4.06 Co 2.94 Y 6 Sc 0.5 rod with a diameter of 1 mm shows almost fully amorphous structure besides about 5% fcc-Al nucleated in the center of the rod. The bulk alloy with high Al concentration exhibits an ultrahigh yield strength of 1.18 GPa and maximum strength of 1.27 GPa as well as an obvious plastic strain of about 2.4% during compressive deformation. This light Al-based alloy with good GFA and mechanical properties is promising as a new high specific strength material with good deformability. (condensed matter: structure, mechanical and thermal properties)
Exhibition of electric and magnetic fields of extra-low frequency
International Nuclear Information System (INIS)
Rincon, Leonardo; Socadagui, Jorge; Roman, Francisco
2001-01-01
The existent norms were studied in the international environment regarding human beings' exhibition to electro-magnetic fields, under the points of view of the industrial frequency (60 Hz) and the time of exhibition. The norm CENELEC was selected (Committee Europeen of Normalisation Electro technique) ENV 50166-1. The electro-magnetic fields existent were measured in four substations of the Colombian interconnected system, locating the critical fields and relation them with the work places from the personnel exposed to this fields. In different areas of the substations studied they were values of electric field that violate the norm CENELEC, being the most critical case the areas of the module of line and of the patios of transformation. In magnetic field not it founded any violation of the mentioned norm. A serious case of exposed population was identified that corresponds to the gang in charge of carrying out the basic maintenance. This gang carries out its maintenance works in areas with critical electric fields and during superior times of exhibition to those permitted for the norm. The fields electrician and magnetic too were measured under the vain of transmission line of 115 kw and double vertical circuit. The measured values were compared with the values theoretical ob had by means of programs of calculation of fields electric and magnetic developed in the national university of Colombia, being obtained a very good approach for the case of the magnetic field. Using electro-magnetic field well known and trusts procedures, the measure probes were gauged in the laboratory of high voltage of the national university of Colombia
Surface treatment of non-ferrous metals for the purpose of gas analysis
International Nuclear Information System (INIS)
Quaglia, L.; Weber, G.; Triffaux, J.; Geerts, J.; Audenhove, J. van; Pauwels, J.
1979-01-01
The present report is an updating of earlier reports published in 1972 and 1976. Its major improvement compared to the earlier reports is that greater importance has been devoted to quantify the parameters of mechanical shaping techniques to be used with or without subsequent chemical etching. Surface treatments have been studied and standardized for a number of non-ferrous metals. Recommendations were generally made on the basis of the following: the proposed treatment must give a minimum surface content; it must exhibit good reproducibility; it must be easy to perform with equipment normally available in analytical laboratories. The recommended treatments are presented in the form of sheets. They give full information on mechanica shaping parameters if these are important, and -if needed- the subsequent chemical etching conditions. Typical residual surface contents are given for oxygen carbon and nitrogen. They refer to samples freshly prepared. The metals or alloys concerned are: aluminium, aluminium alloyed with 3%, 7% and 13% silicon, copper, lead, nickel, titanium, TiAl 6 V 4 zirconium, tungsten and molybdenum
Polysiloxane surface modified with bipyrazolic tripodal receptor for quantitative lead adsorption
Energy Technology Data Exchange (ETDEWEB)
Radi, Smaail, E-mail: radi_smaail@yahoo.fr [Laboratoire de Chimie Organique, Macromoleculaire et Produits Naturels, Equipe de Chimie Bio-organique et Macromoleculaire, Unite Associee au CNRST URAC 25, Departement de Chimie, Faculte des Sciences, Universite Med I, BP 524, 60 000 Oujda (Morocco); Tighadouini, Said; Toubi, Yahya [Laboratoire de Chimie Organique, Macromoleculaire et Produits Naturels, Equipe de Chimie Bio-organique et Macromoleculaire, Unite Associee au CNRST URAC 25, Departement de Chimie, Faculte des Sciences, Universite Med I, BP 524, 60 000 Oujda (Morocco); Bacquet, Maryse [Universite des Sciences et Technologies de Lille, UMET: Unite Materiaux et Transformations UMR8207, Equipe Ingenierie des Systemes Polymeres, Batiment C6 salle 119-59655 Villeneuve d' Ascq (France)
2011-01-15
A new silica gel compound modified N,N-bis(3,5-dimethylpyrazol-1-ylmethyl) amine (SiN{sub 2}Pz) was synthesized and characterized by elemental analysis, FT-IR, {sup 13}C NMR of the solid state, nitrogen adsorption-desorption isotherm, BET surface area and BJH pore sizes. The new surface exhibits good chemical and thermal stability determined by thermogravimetry curves (TGA). The effect of pH and stirring time on the adsorption of Pb(II) were studied. The process of metal retention was followed by batch method and the optimum pH value for the quantitative adsorption of this toxic metal ion was 7. At this pH value, the new functionalized polysiloxane presents further improvements and shows higher affinity (123 mg of Pb{sup 2+}/g of silica) for the effective adsorption of Pb(II) compared to others described sorbents. The extracted amounts of Pb(II) were determined by atomic absorption measurements.
Wang, Guixia; Babaahmadi, Vahid; He, Nanfei; Liu, Yixin; Pan, Qin; Montazer, Majid; Gao, Wei
2017-11-01
All solid-state micro-supercapacitors (MSC) have emerged as attractive energy-storage units for portable and wearable electronics. Here, we describe a textile-based solid-state MSC via laser scribing of graphene oxide (GO) coatings on a flexible polyethylene terephthalate (PET) fabric. The laser-scribed graphene oxide layers (LGO) possess three-dimensionally porous structure suitable for electrochemical-double-layer formation. To improve the wash fastness and the flexibility of the as-prepared MSCs, glutaraldehyde (GA) was employed to crosslink the GO layers and PVA-gel electrolyte onto the PET fabric. The resultant all solid-state MSCs exhibited excellent flexibility, high areal specific capacitance (756 μF·cm-2 at 20 mV·s-1), and good rate capability when subject to bending and laundering. Furthermore, the MSC device showed a high power density of about 1.4 W·cm-3 and an energy density of 5.3 × 10-5 Wh·cm-3, and retained 98.3% of its initial capacitance after 1000 cycles at a current density of 0.5 mA·cm-2. This work is the first demonstration of in-plane MSCs on PET fabric surfaces with enhanced durability and flexibility.
Investigating Design Research Landscapes through Exhibition
DEFF Research Database (Denmark)
Jönsson, Li; Hansen, Flemming Tvede; Mäkelä, Maarit
2013-01-01
What characterizes a design research exhibition compared to a traditional design and art exhibition? How do you show the very materialities of the design experiments as a means for communicating knowledge of research and of practice? How do you present, review and utilize such an exhibition......? With those questions in mind, the intention and challenge for the Nordes 2013 Design Research Exhibition was to expand on current notions of staging research enquires in design research conference contexts. Artefacts, installations, performances, and other materialities that relate to the theme...... of the conference - Experiments in Design Research – were displayed as tools to express and communicate different design research enquires. Through this paper we will describe the Nordes exhibition as a specific case that renders questions visible in relation to how to utilize a design research exhibition...
Good Looking Is Looking Good / Märt Milter
Milter, Märt
1998-01-01
Meloodilist drum ǹ̀bassi viljelevatest välismaa plaadifirmadest Good Looking Recordsist ja Looking Good Recordsist, mida juhib LTJ Bukem ja temaga koostööd tegevatest muusikutest Blame, Seba, Tayla, MC Conrad, Artemis
Surface tension and density of liquid In-Sn-Zn alloys
Pstruś, Janusz
2013-01-01
Using the dilatometric method, measurements of the density of liquid alloys of the ternary system In-Sn-Zn in four sections with a constant ratio Sn:In = 24:1, 3:1, 1:1, 1:3, for various Zn additions (5, 10, 14, 20, 3 5, 50 and 75 at.% Zn) were performed at the temperature ranges of 500-1150 K. Density decreases linearly for all compositions. The molar volume calculated from density data exhibits close to ideal dependence on composition. Measurements of the surface tension of liquid alloys have been conducted using the method of maximum pressure in the gas bubbles. There were observed linear dependences on temperature with a negative gradients dσ/dT. Generally, with two exceptions, there was observed the increase of surface tension with increasing content of zinc. Using the Butler's model, the surface tension isotherms were calculated for temperatures T = 673 and 1073 K. Calculations show that only for high temperatures and for low content of zinc (up to about 35 at.%), the modeling is in very good agreement with experiment. Using the mentioned model, the composition of the surface phase was defined at two temperatures T = 673 and 973 K. Regardless of the temperature and of the defined section, the composition of the bulk is very different in comparison with the composition of the surface.
Time, Interaction, and Design in Support of a Good Life
DEFF Research Database (Denmark)
Froes, Isabel Cristina G.; Laaksolahti, Jarmo Matti; Witzner Hansen, Dan
development. Our ongoing investigation of Interaction Design for a Good Life (http://itu.dk/IxDLab/) has uncovered a broad diversity of perspectives on how to unpack ‘a good life’ through research and design, and indeed what constitutes a good life to begin with. Through our investigations, time has surfaced...... as pivotal to our budding understanding of elements of a good life and a useful framing for future investigations. Time is also an important topic for interaction design, because it is at the core of interaction, the practice of design, and, in many ways, our use and relationships with technological......This position paper outlines a research program for the IxD Research Group at the IT University of Copenhagen. As such, it presents a range of questions addressing different corners of the question of time in IxD from the point of view of HCI, social interaction, material expressions, and software...
A mini-exhibition with maximum content
Laëtitia Pedroso
2011-01-01
The University of Budapest has been hosting a CERN mini-exhibition since 8 May. While smaller than the main travelling exhibition it has a number of major advantages: its compact design alleviates transport difficulties and makes it easier to find suitable venues in the Member States. Its content can be updated almost instantaneously and it will become even more interactive and high-tech as time goes by. The exhibition on display in Budapest. The purpose of CERN's new mini-exhibition is to be more interactive and easier to install. Due to its size, the main travelling exhibition cannot be moved around quickly, which is why it stays in the same country for 4 to 6 months. But this means a long waiting list for the other Member States. To solve this problem, the Education Group has designed a new exhibition, which is smaller and thus easier to install. Smaller maybe, but no less rich in content, as the new exhibition conveys exactly the same messages as its larger counterpart. However, in the slimm...
Nanowire surface fastener fabrication on flexible substrate
Toku, Yuhki; Uchida, Keita; Morita, Yasuyuki; Ju, Yang
2018-07-01
The market for wearable devices has increased considerably in recent years. In response to this demand, flexible electronic circuit technology has become more important. The conventional bonding technology in electronic assembly depends on high-temperature processes such as reflow soldering, which result in undesired thermal damages and residual stress at a bonding interface. In addition, it exhibits poor compatibility with bendable or stretchable device applications. Therefore, there is an urgent requirement to attach electronic parts on printed circuit boards with good mechanical and electrical properties at room temperature. Nanowire surface fasteners (NSFs) are candidates for resolving these problems. This paper describes the fabrication of an NSF on a flexible substrate, which can be used for room temperature conductive bonding. The template method is used for preparing high-density nanowire arrays. A Cu thin film is layered on the template as the flexible substrate. After etching the template, a Cu NSF is obtained on the Cu film substrate. In addition, the electrical and mechanical properties of the Cu NSF are studied under various fabrication conditions. The Cu NSF exhibits high shear adhesion strength (∼234 N cm‑2) and low contact resistivity (2.2 × 10‑4 Ω cm2).
DLC nano-dot surfaces for tribological applications in MEMS devices
Energy Technology Data Exchange (ETDEWEB)
Singh, R. Arvind; Na, Kyounghwan [Nano-Bio Research Center, Korea Institute of Science and Technology, 39-1, Hawolgok-dong, Seongbuk-gu, Seoul 136-791 (Korea, Republic of); Yi, Jin Woo; Lee, Kwang-Ryeol [Computational Science Center, Korea Institute of Science and Technology, 39-1, Hawolgok-dong, Seongbuk-gu, Seoul 136-791 (Korea, Republic of); Yoon, Eui-Sung, E-mail: esyoon@kist.re.kr [Nano-Bio Research Center, Korea Institute of Science and Technology, 39-1, Hawolgok-dong, Seongbuk-gu, Seoul 136-791 (Korea, Republic of)
2011-02-01
With the invention of miniaturized devices like micro-electro-mechanical systems (MEMS), tribological studies at micro/nano-scale have gained importance. These studies are directed towards understanding the interactions between surfaces at micro/nano-scales, under relative motion. In MEMS devices, the critical forces, namely adhesion and friction restrict the smooth operation of the elements that are in relative motion. These miniaturized devices are traditionally made from silicon (Si), whose tribological properties are not good. In this paper, we present a short investigation of nano- and micro-tribological properties of diamond-like carbon (DLC) nano-dot surfaces. The investigation was undertaken to evaluate the potential of these surfaces for their possible application to the miniaturized devices. The tribological evaluation of the DLC nano-dot surfaces was done in comparison with bare Si (1 0 0) surfaces and DLC coated silicon surfaces. A commercial atomic force microscope (AFM) was used to measure adhesion and friction properties of the test materials at the nano-scale, whereas a custom-built micro-tribotester was used to measure their micro-friction property. Results showed that the DLC nano-dot surfaces exhibited superior tribological properties with the lowest values of adhesion force, and friction force both at the nano- and micro-scales, when compared to the bare Si (1 0 0) surfaces and DLC coated silicon surfaces. In addition, the DLC nano-dot surfaces showed no observable wear at the micro-scale, unlike the other two test materials. The superior tribological performance of the DLC nano-dot surfaces is attributed to their hydrophobic nature and the reduced area of contact projected by them.
DLC nano-dot surfaces for tribological applications in MEMS devices
International Nuclear Information System (INIS)
Singh, R. Arvind; Na, Kyounghwan; Yi, Jin Woo; Lee, Kwang-Ryeol; Yoon, Eui-Sung
2011-01-01
With the invention of miniaturized devices like micro-electro-mechanical systems (MEMS), tribological studies at micro/nano-scale have gained importance. These studies are directed towards understanding the interactions between surfaces at micro/nano-scales, under relative motion. In MEMS devices, the critical forces, namely adhesion and friction restrict the smooth operation of the elements that are in relative motion. These miniaturized devices are traditionally made from silicon (Si), whose tribological properties are not good. In this paper, we present a short investigation of nano- and micro-tribological properties of diamond-like carbon (DLC) nano-dot surfaces. The investigation was undertaken to evaluate the potential of these surfaces for their possible application to the miniaturized devices. The tribological evaluation of the DLC nano-dot surfaces was done in comparison with bare Si (1 0 0) surfaces and DLC coated silicon surfaces. A commercial atomic force microscope (AFM) was used to measure adhesion and friction properties of the test materials at the nano-scale, whereas a custom-built micro-tribotester was used to measure their micro-friction property. Results showed that the DLC nano-dot surfaces exhibited superior tribological properties with the lowest values of adhesion force, and friction force both at the nano- and micro-scales, when compared to the bare Si (1 0 0) surfaces and DLC coated silicon surfaces. In addition, the DLC nano-dot surfaces showed no observable wear at the micro-scale, unlike the other two test materials. The superior tribological performance of the DLC nano-dot surfaces is attributed to their hydrophobic nature and the reduced area of contact projected by them.
The macroeconomic analysis of public goods and their influence in the region of Czech Republic
Directory of Open Access Journals (Sweden)
Richard POSPÍŠIL
2016-04-01
Full Text Available In the region of Czech Republic, the provision of public goods is one of the State’s most important activities with society-wide impacts. Therefore, the debate on the structure and scope of public budgets is legitimate and ongoing on a society-wide scale. Mainstream fiscal theory considers public goods to be one of the failures of market equilibrium, classifying them as being close to positive externalities. In this case, the activity of the State brings benefits to other entities that are not involved in this activity and do not even directly pay for it. The main characteristics of these goods include irreducibility of their amount in society, non-excludability and non-rivalry. There are a number of goods between purely private and purely public goods which, to varying extents, exhibit both elements. Today, the majority of goods provided by the public sector are of such a nature; as a result, the form of allocation and the subsequent redistribution of resources are crucial when analysing public goods. The present paper analyses public goods in the Czech Republic from an economic and legal perspective using Cost-Benefit Analysis, including their efficiency and society-wide benefits.
Cui, Zhe; Yin, Long; Wang, Qingjun; Ding, Jianfu; Chen, Qingmin
2009-09-15
Superhydrophobic surfaces with multi-scale nano/microstructures have been prepared on epoxy paint surfaces using a feasible dip-coating process. The microstructures with 5-10 microm protuberances were first prepared on epoxy paint surface by sandblast. Then the nanostructures were introduced on the microstructure surface by anchoring 50-100 nm SiO(2) particles (nano-SiO(2)) onto the sandblasted paint surface, which was completed by dip-coating with a nano-SiO(2)/epoxy adhesive solution (M1). At last the surface was further modified for enhancing hydrophobicity by another dip-coating with a solution of a low surface energy polymer, aminopropyl terminated polydimethylsiloxane (ATPS) modified epoxy adhesive (M2). The water contact angle of the as-prepared samples reached as high as 167.8 degrees and the sliding angle was 7 degrees. The prepared superhydrophobic surface exhibited excellent durability to the high speed scouring test and high stability in neutral and basic aqueous solutions and some common organic solvents. In addition, this method can be adopted to fabricate large scale samples with a good homogeneity of the whole surface at very low cost.
An, Geon-Hyoung; Ahn, Hyo-Jin; Hong, Woong-Ki
2015-01-01
Four different types of carbon nanofibers (CNFs) for electrical double-layer capacitors (EDLCs), porous and non-porous CNFs with and without Pt metal nanoparticles, are synthesized by an electrospinning method and their performance in electrical double-layer capacitors (EDLCs) is characterized. In particular, the Pt-embedded porous CNFs (PCNFs) exhibit a high specific surface area of 670 m2 g-1, a large mesopore volume of 55.7%, and a low electrical resistance of 1.7 × 103. The synergistic effects of the high specific surface area with a large mesopore volume, and superior electrical conductivity result in an excellent specific capacitance of 130.2 F g-1, a good high-rate performance, superior cycling durability, and high energy density of 16.9-15.4 W h kg-1 for the performance of EDLCs.
Switchable directional excitation surface plasmon polaritons with dielectric nanoantennas
DEFF Research Database (Denmark)
Sinev, I.; Komissarenko, F.; Bogdanov, A.
We demonstrate directional launching of surface plasmon polaritons on thin goldfilm with a single silicon nanosphere. The directivity pattern of the excited surface waves exhibits rapid switching from forward to backward excitation, which is driven by the mutual interference of magnetic and elect......We demonstrate directional launching of surface plasmon polaritons on thin goldfilm with a single silicon nanosphere. The directivity pattern of the excited surface waves exhibits rapid switching from forward to backward excitation, which is driven by the mutual interference of magnetic...
International Nuclear Information System (INIS)
Wang, Haibin; Chen, Eryu; Jia, Xianbu; Liang, Lijun; Wang, Qi
2015-01-01
Graphical abstract: - Highlights: • The SiO 2 and PTFE NP-filled coatings exhibit excellent superhydrophobicity. • PTFE-filled coatings show denser structures and better liquid resistance than SiO 2 . • Air pocket of Wentzel model explains the difference in the superhydrophobicity. - Abstract: Superhydrophobicity is extensively investigated because of the numerous methods developed for water-repellant interface fabrication. Many suitable functional materials for the production of superhydrophobic surfaces on various substrates are still being explored. In this study, inorganic SiO 2 and organic polytetrafluoroethylene (PTFE) nanoparticles (NPs) are used for a comparative study on the performance of superhydrophobic coating on carbon steel surfaces. The NPs are added to PTFE coating emulsions by physical blending to form coating mixtures. Raw SiO 2 NPs are then hydrophobized using KH-570 and validated by Fourier transform-infrared spectroscopy (FT-IR) and Dynamic Laser Scattering (DLS) grain size analyses. The microstructures of the surfaces are characterized by contact angle (CA) measurements and field emission-scanning electron microscope (FE-SEM) images. The prepared surfaces are subjected to adhesion, hardness, water resistance, and acid/alkali erosion tests. Hydrophobized SiO 2 -filled coating surfaces are found to have better uniformity than raw SiO 2 regardless of their similar maximum static contact angles (SCAs) about 150°. A SCA of 163.1° is obtained on the PTFE NP-filled coating surfaces that have a considerably denser structure than SiO 2 . Thermogravimetric (TG) and differential scanning calorimetry (DSC) analyses reveal that all fabricated surfaces have good thermal stability and tolerate temperatures up to 550 °C. The PTFE NP-filled coating surfaces also exhibit excellent water and acid resistance. A possible mechanism concerning the amount of trapped air is proposed in relation to practical superhydrophobic surface fabrication
Solar absorption surface panel
Santala, Teuvo J.
1978-01-01
A composite metal of aluminum and nickel is used to form an economical solar absorption surface for a collector plate wherein an intermetallic compound of the aluminum and nickel provides a surface morphology with high absorptance and relatively low infrared emittance along with good durability.
Energy Technology Data Exchange (ETDEWEB)
Birse, J.; Chambers, K.
2000-07-01
This report gives details of a project to make the Good Practice Guidelines, which were developed to help the UK Bioenergy industry, the national and local governments, and the public, more widely available. Details concerning the designing of a Good Practice Programme, and the proposed codes of Good Practice programme are given, and general relevant good practice guidance documents are discussed. The stakeholder survey and workshop, and the proposed codes of a Good Practice Programme are presented in Annexes. (UK)
Protein imprinting and recognition via forming nanofilms on microbeads surfaces in aqueous media
International Nuclear Information System (INIS)
Lu Yan; Yan Changling; Wang Xuejing; Wang Gongke
2009-01-01
In this paler, we present a technique of forming nanofilms of poly-3-aminophenylboronic acid (pAPBA) on the surfaces of polystyrene (PS) microbeads for proteins (papain and trypsin) in aqueous. Papain was chosen as a model to study the feasibility of the technique and trypsin as an extension. Obtained core-shell microbeads were characterized using scanning electron microscopy (SEM), Raman spectroscopy, X-ray photoelectron spectroscopy (XPS) and BET methods. The results show that pAPBA formed nanofilms (60-100 nm in thickness) on the surfaces of PS microbeads. The specific surface area of the papain-imprinted beads was about 180 m 2 g -1 and its pore size was 31 nm. These imprinted microbeads exhibit high recognition specificity and fast mass transfer kinetics. The specificity of these imprinted beads mainly originates from the spatial effect of imprinted sites. Because the protein-imprinted sites were located at, or close to, the surface, the imprinted beads have good site accessibility toward the template molecules. The facility of the imprinting protocol and the high recognition properties of imprinted microbeads make the approach an attractive solution to problems in the field of biotechnology.
Science Fiction Exhibits as STEM Gateways
Robie, Samantha
Women continue to hold less than a quarter of all STEM jobs in the United States, prompting many museums to develop programs and exhibits with the express goal of interesting young girls in scientific fields. At the same time, a number of recent museum exhibits have harnessed the popularity of pop culture and science fiction in order to interest general audiences in STEM subject matter, as well as using the exhibits as springboards to expand or shift mission goals and focus. Because science fiction appears to be successful at raising interest in STEM fields, it may be an effective way to garner the interest of young girls in STEM in particular. This research seeks to describe the ways in which museums are currently using science fiction exhibits to interest young girls in STEM fields and careers. Research focused on four institutions across the country hosting three separate exhibits, and included staff interviews and content analysis of exhibit descriptions, promotional materials, a summative evaluation and supplementary exhibit productions. In some ways, science fiction exhibits do serve young girls, primarily through the inclusion of female role models, staff awareness, and prototype testing to ensure interactives are attractive to girls as well as to boys. However, STEM appears to be underutilized, which may be partly due to a concern within the field that the outcome of targeting a specific gender could be construed as "stereotyping".
Tuning Surface Chemistry of Polyetheretherketone by Gold Coating and Plasma Treatment
Novotná, Zdeňka; Rimpelová, Silvie; Juřík, Petr; Veselý, Martin; Kolská, Zdeňka; Hubáček, Tomáš; Borovec, Jakub; Švorčík, Václav
2017-06-01
Polyetheretherketone (PEEK) has good chemical and biomechanical properties that are excellent for biomedical applications. However, PEEK exhibits hydrophobic and other surface characteristics which cause limited cell adhesion. We have investigated the potential of Ar plasma treatment for the formation of a nanostructured PEEK surface in order to enhance cell adhesion. The specific aim of this study was to reveal the effect of the interface of plasma-treated and gold-coated PEEK matrices on adhesion and spreading of mouse embryonic fibroblasts. The surface characteristics (polarity, surface chemistry, and structure) before and after treatment were evaluated by various experimental techniques (gravimetry, goniometry, X-ray photoelectron spectroscopy (XPS), and electrokinetic analysis). Further, atomic force microscopy (AFM) was employed to examine PEEK surface morphology and roughness. The biological response of cells towards nanostructured PEEK was evaluated in terms of cell adhesion, spreading, and proliferation. Detailed cell morphology was evaluated by scanning electron microscopy (SEM). Compared to plasma treatment, gold coating improved PEEK wettability. The XPS method showed a decrease in the carbon concentration with increasing time of plasma treatment. Cell adhesion determined on the interface between plasma-treated and gold-coated PEEK matrices was directly proportional to the thickness of a gold layer on a sample. Our results suggest that plasma treatment in a combination with gold coating could be used in biomedical applications requiring enhanced cell adhesion.
Directory of Open Access Journals (Sweden)
Peng Zhao
2018-01-01
Full Text Available A compact frequency selective surface (FSS for 5G applications has been designed based on 2.5-dimensional Jerusalem cross. The proposed element consists of two main parts: the successive segments of the metal traces placed alternately on the two surfaces of the substrate and the vertical vias connecting traces. Compared with previous published two-dimensional miniaturized elements, the transmission curves indicate a significant size reduction (1/26 wavelengths at the resonant frequency and exhibit good angular and polarization stabilities. Furthermore, a general equivalent circuit model is established to provide direct physical insight into the operating principle of this FSS. A prototype of the proposed FSS has been fabricated and measured, and the results validate this design.
Photowalk Exhibition opens at Microcosm
Katarina Anthony
2011-01-01
The winning photographs from the 2010 Global Particle Physics Photowalk competition will go on display at Microcosm from 11 February to 2 April. The exhibition is part of a global photography event taking place over three continents, with Photowalk exhibitions opening simultaneously at Fermilab in the US, KEK in Japan and here at CERN. DESY wire chamber - First place people's choice; second place global jury competition. Photographer: Hans-Peter Hildebrandt If you were one of the 1,300 photography lovers who voted in last year’s Photowalk competition, this exhibition is your chance to see the winning entries in print. The exhibition will take place in the downstairs gallery of Microcosm, overlooking the garden. 15 photographs will be on display, with each of the laboratories that participated in Photowalk represented by their 3 winning entries. Among them will be the “people’s choice” sunburst photo of a particle detector at DESY (Photo 1), and...
Directory of Open Access Journals (Sweden)
Winnie Tsang
2014-06-01
Full Text Available The artistic development in China experienced drastic changes during the Cultural Revolution from 1966 to 1976. Traditional Chinese art was denounced, whereas propaganda art became predominant in shaping the public’s loyalty towards the Communist Party and the country. Two major groups of art exhibitions emerged during the Revolution—the unofficial Red Guard art exhibitions organized by student activists in collaboration with local communes and art schools between 1966 and 1968, and the state-run national exhibitions from 1972 to 1975. These exhibitions were significant to this period because they were held frequently in the capital city Beijing and occasionally elsewhere, and through art they presented unique revolutionary beliefs to the Chinese people in a public setting. While the Red Guard art exhibitions and the national exhibitions certainly created different national narratives, I argue that the national exhibitions were in fact an attempt to revise the national narrative created by the Red Guard art exhibitions in order to re-establish a more utopian, consistent, and official national narrative. This paper unravels the intricate relationship between the two groups of exhibitions by comparing their exhibition venues, ideological focuses, work selection and quality editing.
Luminescent Surface Quaternized Carbon Dots
Bourlinos, Athanasios B.
2012-01-10
Thermal oxidation of a salt precursor made from the acid base combination of tris(hydroxymethyl)aminomethane and betaine hydrochloride results in light-emitting surface quaternized carbon dots that are water-dispersible, display anion exchange properties, and exhibit uniform size/surface charge. © 2011 American Chemical Society.
Luminescent Surface Quaternized Carbon Dots
Bourlinos, Athanasios B.; Zbořil, Radek; Petr, Jan; Bakandritsos, Aristides; Krysmann, Marta; Giannelis, Emmanuel P.
2012-01-01
Thermal oxidation of a salt precursor made from the acid base combination of tris(hydroxymethyl)aminomethane and betaine hydrochloride results in light-emitting surface quaternized carbon dots that are water-dispersible, display anion exchange properties, and exhibit uniform size/surface charge. © 2011 American Chemical Society.
Energy Technology Data Exchange (ETDEWEB)
N, Karunagaran [S.K.P Engineering College, Tiruvannamalai (India); A, Rajadurai [Anna University, Chennai (India)
2016-06-15
This paper investigates the effect of surface treatment for glass fiber, stainless steel wire mesh on tensile, flexural, inter-laminar shear and impact properties of glass fiber/stainless steel wire mesh reinforced epoxy hybrid composites. The glass fiber fabric is surface treated either by 1 N solution of sulfuric acid or 1 N solution of sodium hydroxide. The stainless steel wire mesh is also surface treated by either electro dissolution or sand blasting. The hybrid composites are fabricated using epoxy resin reinforced with glass fiber and fine stainless steel wire mesh by hand lay-up technique at room temperature. The hybrid composite consisting of acid treated glass fiber and sand blasted stainless steel wire mesh exhibits a good combination of tensile, flexural, inter-laminar shear and impact behavior in comparison with the composites made without any surface treatment. The fine morphological modifications made on the surface of the glass fiber and stainless steel wire mesh enhances the bonding between the resin and reinforcement which inturn improved the tensile, flexural, inter-laminar shear and impact properties.
Designing immersion exhibits as border-crossing environments
DEFF Research Database (Denmark)
Mortensen, Marianne Foss
2010-01-01
be applied to achieve an understanding of the immersion exhibit form. The argument proceeds by demonstrating how the characteristics of immersion exhibits, and visitors to them, classify them as microcultures, and examining the implications of this for exhibit design using a hypothetical immersion exhibit...
Software licenses: Good fences make good neighbors
International Nuclear Information System (INIS)
McCreary, J.G.; Woodyard, A.
1995-01-01
The basis for a good contract is that it is beneficial to both parties. A good foundation will cement the responsibilities and obligations of the parties after areas of agreement have been negotiated. Unfortunately, software licenses do not always reflect what is best for all. Some clauses are definitely for the benefit of the vendor, while others are required by a prudent client. The resulting contract is then a matter of reasonable compromise to achieve a good business relationship. Major issues of warranty, liability, training, support, and payment may be in conflict. Such topics as maintenance, testing, patents, extent of use, and return of software are often overlooked or addressed unevenly. This paper addresses these subjects and provides guidelines for software licenses. An understanding of legal phrases is of value. A better understanding of the viewpoints of both the vendor and the client results in a better working relationship
Energy Technology Data Exchange (ETDEWEB)
Guo, Lili; Qin, Lin, E-mail: qinlin@tyut.edu.cn; Kong, Fanyou; Yi, Hong; Tang, Bin
2016-12-01
Highlights: • The Mo alloyed layers were successfully prepared on TLM surface by DG-PSA. • The surface microhardness of TLM is remarkably enhanced by Mo alloying. • The TLM samples after Mo alloying exhibit good wettability. • The Mo alloyed TLM samples show excellent tribological properties. - Abstract: Molybdenum, an alloying element, was deposited and diffused on Ti-5Zr-3Sn-5Mo-15Nb (TLM) substrate by double glow plasma surface alloying technology at 900, 950 and 1000 °C. The microstructure, composition distribution and micro-hardness of the Mo modified layers were analyzed. Contact angles on deionized water and wear behaviors of the samples against corundum balls in simulated human body fluids were investigated. Results show that the surface microhardness is significantly enhanced after alloying and increases with treated temperature rising, and the contact angles are lowered to some extent. More importantly, compared to as-received TLM alloy, the Mo modified samples, especially the one treated at 1000 °C, exhibit the significant improvement of tribological properties in reciprocating wear tests, with lower specific wear rate and friction coefficient. To conclude, Mo alloying treatment is an effective approach to obtain excellent comprehensive properties including optimal wear resistance and improved wettability, which ensure the lasting and safety application for titanium alloys as the biomedical implants.
It's About Making Surfaces Invisible
Indian Academy of Sciences (India)
It's About Making Surfaces Invisible ... light is reflected from the surface between two media. The in- tensity of ... The reflection from each new interface and the combined reflec- .... Let us see the requirements of a material for a good stamp. The.
Staff Association
2017-01-01
Sintropie Flavio Pellegrini From 13 to 24 March 2017 CERN Meyrin, Main Building Energia imprigionata - Flavio Pellegrini. The exhibition is composed by eleven wood artworks with the expression of movement as theme. The artworks are the result of harmonics math applied to sculpture. The powerful black colour is dominated by the light source, generating reflexes and modulations. The result is a continuous variation of perspective visions. The works generate, at a first approach, an emotion of mystery and incomprehension, only a deeper contemplation lets one discover entangling and mutative details, evidencing the elegance of the lines and letting the meaning emerge. For more information : staff.association@cern.ch | Tél: 022 766 37 38
The Culture of Exhibitions and Conservation
Directory of Open Access Journals (Sweden)
Dimitrios Doumas
2013-11-01
Full Text Available The article reflects on temporary exhibitions from a theoretical as well as practical perspective. Regarded as a particularly effective mass-communication medium, exhibitions have a dual nature: they are scholarly undertakings, bringing off a curator’s vision and, simultaneously, they are projects with economic implications that need to be well managed and administered. The role of conservation in the making of temporary exhibitions, either in-house or touring, is here discussed in relation to how work is planned and prioritized as well as how time is managed and staff is allocated. Reference to weaknesses that lessen the crucial input of conservation in the decision-making process is also made. Much of the debate, which focuses on art exhibitions, concerns practicalities encountered in a private museum that extend from the very early stages of selecting objects for display to the mounting of an exhibition.
Depreciation of public goods in spatial public goods games
Shi, Dong-Mei; Zhuang, Yong; Li, Yu-Jian; Wang, Bing-Hong
2011-10-01
In real situations, the value of public goods will be reduced or even lost because of external factors or for intrinsic reasons. In this work, we investigate the evolution of cooperation by considering the effect of depreciation of public goods in spatial public goods games on a square lattice. It is assumed that each individual gains full advantage if the number of the cooperators nc within a group centered on that individual equals or exceeds the critical mass (CM). Otherwise, there is depreciation of the public goods, which is realized by rescaling the multiplication factor r to (nc/CM)r. It is shown that the emergence of cooperation is remarkably promoted for CM > 1 even at small values of r, and a global cooperative level is achieved at an intermediate value of CM = 4 at a small r. We further study the effect of depreciation of public goods on different topologies of a regular lattice, and find that the system always reaches global cooperation at a moderate value of CM = G - 1 regardless of whether or not there exist overlapping triangle structures on the regular lattice, where G is the group size of the associated regular lattice.
Online Exhibits & Concept Maps
Douma, M.
2009-12-01
Presenting the complexity of geosciences to the public via the Internet poses a number of challenges. For example, utilizing various - and sometimes redundant - Web 2.0 tools can quickly devour limited time. Do you tweet? Do you write press releases? Do you create an exhibit or concept map? The presentation will provide participants with a context for utilizing Web 2.0 tools by briefly highlighting methods of online scientific communication across several dimensions. It will address issues of: * breadth and depth (e.g. from narrow topics to well-rounded views), * presentation methods (e.g. from text to multimedia, from momentary to enduring), * sources and audiences (e.g. for experts or for the public, content developed by producers to that developed by users), * content display (e.g. from linear to non-linear, from instructive to entertaining), * barriers to entry (e.g. from an incumbent advantage to neophyte accessible, from amateur to professional), * cost and reach (e.g. from cheap to expensive), and * impact (e.g. the amount learned, from anonymity to brand awareness). Against this backdrop, the presentation will provide an overview of two methods of online information dissemination, exhibits and concept maps, using the WebExhibits online museum (www.webexhibits.org) and SpicyNodes information visualization tool (www.spicynodes.org) as examples, with tips on how geoscientists can use either to communicate their science. Richly interactive online exhibits can serve to engage a large audience, appeal to visitors with multiple learning styles, prompt exploration and discovery, and present a topic’s breadth and depth. WebExhibits, which was among the first online museums, delivers interactive information, virtual experiments, and hands-on activities to the public. While large, multidisciplinary exhibits on topics like “Color Vision and Art” or “Calendars Through the Ages” require teams of scholars, user interface experts, professional writers and editors
Superhydrophobic surfaces of electrospun block copolymer fibers with low content of fluorosilicones
International Nuclear Information System (INIS)
Tian, Xiaoping; Yi, Lingmin; Meng, Xiaomei; Xu, Kai; Jiang, Tengteng; Lai, Dongzhi
2014-01-01
A series of well-defined poly[methyl(3,3,3-trifluoropropyl)siloxane]-b-poly(methyl methacrylate) (PMTFPS-b-PMMA) diblock copolymers with low content of PMTFPS were synthesized by atom transfer radical polymerization (ATRP) of MMA from PMTFPS macroinitiators (PMTFPS-Br). The polymerization result reveals that the ATRP of MMA from PMTFPS-Br is fist-order with respect to MMA under different polymerization conditions, demonstrating a typical characteristic of living polymerization. The results also show that PMTFPS-b-PMMA diblock copolymers can exhibit a total surface tension (γ S ) varying from 25.28 mN/m to 21.87 mN/m with the change of PMTFPS contents from 2.6 wt% to 22.2 wt%. Moreover, the water contact angles of electrospun PMTFPS-b-PMMA surfaces could be higher than 150° with water roll-off angles less than 10°, which denotes a superhydrophobic property. However, the electronspinning conditions, especially the concentration of spinning solution, would have important effect on the surface morphology, surface composition and wetting behavior of electrospun films. It was found that bead-free fibers with uniform diameter as well as good superhydrophobic property could be prepared on condition that the polymer concentration of spinning solution was as high as 32 wt% in the mixed solvent of DMF and THF.
International Nuclear Information System (INIS)
Chernov, Sergii
2016-01-01
Recent experiments discovered a new class of materials called topological insulators and started an extensive investigation in order to find more materials of such type and to understand and explore the opening perspectives in fundamental science and application. These materials exhibit a Dirac-type (massless) electronic state, bridging the fundamental band gap. Surprisingly, a strongly spin-polarized surface state with linear dispersion resembling that of Dirac type was found on the already well-investigated W(110) surface. This rose the question of the existence of the same non-trivial electron state on other metal surfaces. The present work describes the investigation of surface electronic states on the Mo(110) surface, their dispersion and transformation upon surface oxidation. This system is isoelectronic to the case of W(110) but due to the lower atomic number the spin-orbit interaction responsible for local band gap formation is substantially decreased by a factor of 5. The Mo(110) surface was shown to exhibit a linearly dispersing state quite similar to the one on W(110), but within a smaller energy range of 120 meV, with the Dirac point lying in the center of a local band gap in k-space. The experimental investigations were performed with the help of momentum microscopy, using a Ti:sapphire laser in the lab and synchrotron radiation at BESSY II, Berlin. The results show good agreement with theoretical calculations of the band structure and photoemission patterns for clean Mo(110). The fully parallel 3D acquisition scheme allowed to visualize the full surface Brillouin zone of the sample up to few eV binding energy within a single exposure of typically less than 30 min. This opens the door to future time-resolved experiments with maximum detection efficiency.
Energy Technology Data Exchange (ETDEWEB)
Chernov, Sergii
2016-04-20
Recent experiments discovered a new class of materials called topological insulators and started an extensive investigation in order to find more materials of such type and to understand and explore the opening perspectives in fundamental science and application. These materials exhibit a Dirac-type (massless) electronic state, bridging the fundamental band gap. Surprisingly, a strongly spin-polarized surface state with linear dispersion resembling that of Dirac type was found on the already well-investigated W(110) surface. This rose the question of the existence of the same non-trivial electron state on other metal surfaces. The present work describes the investigation of surface electronic states on the Mo(110) surface, their dispersion and transformation upon surface oxidation. This system is isoelectronic to the case of W(110) but due to the lower atomic number the spin-orbit interaction responsible for local band gap formation is substantially decreased by a factor of 5. The Mo(110) surface was shown to exhibit a linearly dispersing state quite similar to the one on W(110), but within a smaller energy range of 120 meV, with the Dirac point lying in the center of a local band gap in k-space. The experimental investigations were performed with the help of momentum microscopy, using a Ti:sapphire laser in the lab and synchrotron radiation at BESSY II, Berlin. The results show good agreement with theoretical calculations of the band structure and photoemission patterns for clean Mo(110). The fully parallel 3D acquisition scheme allowed to visualize the full surface Brillouin zone of the sample up to few eV binding energy within a single exposure of typically less than 30 min. This opens the door to future time-resolved experiments with maximum detection efficiency.
Affordances and distributed cognition in museum exhibitions
DEFF Research Database (Denmark)
Achiam, Marianne; May, Michael; Marandino, Martha
2014-01-01
consistent framework. Here, we invoke the notions of affordance and distributed cognition to explain in a coherent way how visitors interact with exhibits and exhibit spaces and make meaning from those interactions, and we exemplify our points using observations of twelve visitors to exhibits at a natural...... history museum. We show how differences in exhibit characteristics give rise to differences in the interpretive strategies used by visitors in their meaning-making process, and conclude by discussing how the notions of affordance and distributed cognition can be used in an exhibit design perspective....
Directory of Open Access Journals (Sweden)
Yonghua Zhan
2017-12-01
Full Text Available Multifunctional manganese oxide nanoparticles (NPs with impressive enhanced T1 contrast ability show great promise in biomedical diagnosis. Herein, we developed a dual-modality imaging agent system based on polyethylene glycol (PEG-coated manganese oxide NPs conjugated with organic dye (Cy7.5, which functions as a fluorescence imaging (FI agent as well as a magnetic resonance imaging (MRI imaging agent. The formed Mn3O4@PEG-Cy7.5 NPs with the size of ~10 nm exhibit good colloidal stability in different physiological media. Serial FI and MRI studies that non-invasively assessed the bio-distribution pattern and the feasibility for in vivo dual-modality imaging-guided lymph node mapping have been investigated. In addition, histological and biochemical analyses exhibited low toxicity even at a dose of 20 mg/kg in vivo. Since Mn3O4@PEG-Cy7.5 NPs exhibited desirable properties as imaging agents and good biocompatibility, this work offers a robust, safe, and accurate diagnostic platform based on manganese oxide NPs for tumor metastasis diagnosis.
Holland at CERN – Industrial exhibition
GS Department
2010-01-01
Sponsored by EVD, an agency of the Dutch Ministry of the Economy From 8 to 11 November 2010 Industrial Exhibition Administration Building Bldg. 61 9-00 - 17-30 Twenty seven companies will present their latest technology at the industrial exhibition "Holland at CERN". Dutch industry will exhibit products and technologies which are related to the field of particle physics. Individual interviews will take place directly at the stands in the Main Building. The firms will contact relevant users/technicians but any user wishing to make contact with a particular firm is welcome to use the contact details which are available from each departmental secretariat or at the following URL: http://gs-dep.web.cern.ch/gs-dep/groups/sem/ls/Industrial_Exhibitions.htm#Industrial_exhibitions You will find the list of exhibitors below. LIST OF EXHIBITORS: Schelde Exotech Vernooy BV Triumph Group INCAA Computers DeMaCo Holland bv TNO Science & Industry Janssen Precision Engi...
Peer assessment of aviation performance: inconsistent for good reasons.
Roth, Wolff-Michael; Mavin, Timothy J
2015-03-01
Research into expertise is relatively common in cognitive science concerning expertise existing across many domains. However, much less research has examined how experts within the same domain assess the performance of their peer experts. We report the results of a modified think-aloud study conducted with 18 pilots (6 first officers, 6 captains, and 6 flight examiners). Pairs of same-ranked pilots were asked to rate the performance of a captain flying in a critical pre-recorded simulator scenario. Findings reveal (a) considerable variance within performance categories, (b) differences in the process used as evidence in support of a performance rating, (c) different numbers and types of facts (cues) identified, and (d) differences in how specific performance events affect choice of performance category and gravity of performance assessment. Such variance is consistent with low inter-rater reliability. Because raters exhibited good, albeit imprecise, reasons and facts, a fuzzy mathematical model of performance rating was developed. The model provides good agreement with observed variations. Copyright © 2014 Cognitive Science Society, Inc.
Superconductive microstrip exhibiting negative differential resistivity
International Nuclear Information System (INIS)
Huebener, R.P.; Gallus, D.E.
1975-01-01
A device capable of exhibiting negative differential electrical resistivity over a range of values of current and voltage is formed by vapor-depositing a thin layer of a material capable of exhibiting superconductivity on an insulating substrate, establishing electrical connections at opposite ends of the deposited strip, and cooling the alloy into its superconducting range. The device will exhibit negative differential resistivity when biased in the current-induced resistive state
International Nuclear Information System (INIS)
Sizmann, R.; Varelas, C.
1976-01-01
There is experimental evidence that swift light ions incident at small angles towards single crystalline surfaces can lose an appreciable fraction of their kinetic energy during reflection. It is shown that these projectiles penetrate into the bulk surface region of the crystal. They can travel as channeled particles along long paths through the solid (surface channeling). The angular distribution and the depth history of the re-emerged projectiles are investigated by computer simulations. A considerable fraction of the penetrating projectiles re-emerges from the crystal with constant transverse energy if the angle of incidence is smaller than the critical angle for axial channeling. Analytical formulae are derived based on a diffusion model for surface channeling. A comparison with experimental data exhibits the relevance of the analytical solutions. (Auth.)
Huang, J.; Kang, Q.; Yang, J. X.; Jin, P. W.
2017-08-01
The surface runoff and soil infiltration exert significant influence on soil erosion. The effects of slope gradient/length (SG/SL), individual rainfall amount/intensity (IRA/IRI), vegetation cover (VC) and antecedent soil moisture (ASM) on the runoff depth (RD) and soil infiltration (INF) were evaluated in a series of natural rainfall experiments in the South of China. RD is found to correlate positively with IRA, IRI, and ASM factors and negatively with SG and VC. RD decreased followed by its increase with SG and ASM, it increased with a further decrease with SL, exhibited a linear growth with IRA and IRI, and exponential drop with VC. Meanwhile, INF exhibits a positive correlation with SL, IRA and IRI and VC, and a negative one with SG and ASM. INF was going up and then down with SG, linearly rising with SL, IRA and IRI, increasing by a logit function with VC, and linearly falling with ASM. The VC level above 60% can effectively lower the surface runoff and significantly enhance soil infiltration. Two RD and INF prediction models, accounting for the above six factors, were constructed using the multiple nonlinear regression method. The verification of those models disclosed a high Nash-Sutcliffe coefficient and low root-mean-square error, demonstrating good predictability of both models.
Zhou, Zhuang; Rajabzadeh, Saeid; Fang, Lifeng; Miyoshi, Taro; Kakihana, Yuriko; Matsuyama, Hideto
2017-08-01
Braid-reinforced hollow fiber membranes with high mechanical properties and considerable antifouling surface were prepared by blending poly(vinyl chloride) (PVC) with poly(vinyl chloride-co-poly(ethylene glycol) methyl ether methacrylate) (poly(VC-co-PEGMA)) copolymer via non-solvent induced phase separation (NIPS). The tensile strength of the braid-reinforced PVC hollow fiber membranes were significantly larger than those of previously reported various types of PVC hollow fiber membranes. The high interfacial bonding strength indicated the good compatibility between the coating materials and the surface of polyethylene terephthalate (PET)-braid. Owing to the surface segregation phenomena, the membrane surface PEGMA coverage increased upon increasing the poly(VC-co-PEGMA)/PVC blending ratio, resulting in higher hydrophilicities and bovine serum albumin (BSA) repulsion. To compare the fouling properties, membranes with similar PWPs were prepared by adjusting the dope solution composition to eliminate the effect of hydrodynamic conditions on the membrane fouling performance. The blend membranes surface exhibited considerable fouling resistance to the molecular adsorption from both BSA solution and activated sludge solution. In both cases, the flux recovered to almost 80% of the initial flux using only water backflush. Considering their great mechanical properties and antifouling resistance to activated sludge solution, these novel membranes show good potential for application in wastewater treatment. Copyright © 2017 Elsevier B.V. All rights reserved.
Elite suppressor-derived HIV-1 envelope glycoproteins exhibit reduced entry efficiency and kinetics.
Directory of Open Access Journals (Sweden)
Kara G Lassen
2009-04-01
Full Text Available Elite suppressors (ES are a rare subset of HIV-1-infected individuals who are able to maintain HIV-1 viral loads below the limit of detection by ultra-sensitive clinical assays in the absence of antiretroviral therapy. Mechanism(s responsible for this elite control are poorly understood but likely involve both host and viral factors. This study assesses ES plasma-derived envelope glycoprotein (env fitness as a function of entry efficiency as a possible contributor to viral suppression. Fitness of virus entry was first evaluated using a novel inducible cell line with controlled surface expression levels of CD4 (receptor and CCR5 (co-receptor. In the context of physiologic CCR5 and CD4 surface densities, ES envs exhibited significantly decreased entry efficiency relative to chronically infected viremic progressors. ES envs also demonstrated slow entry kinetics indicating the presence of virus with reduced entry fitness. Overall, ES env clones were less efficient at mediating entry than chronic progressor envs. Interestingly, acute infection envs exhibited an intermediate phenotypic pattern not distinctly different from ES or chronic progressor envs. These results imply that lower env fitness may be established early and may directly contribute to viral suppression in ES individuals.
Surface properties, solubility and dissolution kinetics of bamboo phytoliths
Fraysse, Fabrice; Pokrovsky, Oleg S.; Schott, Jacques; Meunier, Jean-Dominique
2006-04-01
Although phytoliths, constituted mainly by micrometric opal, exhibit an important control on silicon cycle in superficial continental environments, their thermodynamic properties and reactivity in aqueous solution are still poorly known. In this work, we determined the solubility and dissolution rates of bamboo phytoliths collected in the Réunion Island and characterized their surface properties via electrophoretic measurements and potentiometric titrations in a wide range of pH. The solubility product of "soil" phytoliths ( pKsp0=2.74 at 25 °C) is equal to that of vitreous silica and is 17 times higher than that of quartz. Similarly, the enthalpy of phytoliths dissolution reaction (ΔHr25-80°C=10.85kJ/mol) is close to that of amorphous silica but is significantly lower than the enthalpy of quartz dissolution. Electrophoretic measurements yield isoelectric point pH IEP = 1.2 ± 0.1 and 2.5 ± 0.2 for "soil" (native) and "heated" (450 °C heating to remove organic matter) phytoliths, respectively. Surface acid-base titrations allowed generation of a 2-p K surface complexation model. Phytoliths dissolution rates, measured in mixed-flow reactors at far from equilibrium conditions at 2 ⩽ pH ⩽ 12, were found to be intermediate between those of quartz and vitreous silica. The dissolution rate dependence on pH was modeled within the concept of surface coordination theory using the equation: R=k1·{>SiOH2+}n+k2·{>SiOH0}+k3·{>SiO-}m, where {> i} stands for the concentration of the surface species present at the SiO 2-H 2O interface, ki are the rate constants of the three parallel reactions and n and m represent the order of the proton- and hydroxy-promoted reactions, respectively. It follows from the results of this study that phytoliths dissolution rates exhibit a minimum at pH ˜ 3. This can explain their good preservation in the acidic soil horizons of Réunion Island. In terms of silicon biogeochemical cycle, phytoliths represent a large buffering reservoir
SFG and SPR Study of Sodium Dodecyl Sulfate Film Assembly on Positively Charged Surfaces
Song, Sanghun; Weidner, Tobias; Wagner, Matthew; Castner, David
2012-02-01
This study uses sum frequency generation (SFG) vibrational spectroscopy and surface plasmon resonance (SPR) sensing to investigate the structure of sodium dodecyl sulfate (SDS) films formed on positively charged and hydrophilic surfaces. The SPR signals show a good surface coverage suggesting that full monolayer coverage is reached at 1 mM. SFG spectra of SDS adsorbed exhibits well resolved CH3 peaks and OH peaks. At both 0.2 mM and 1 mM SDS concentration the intensity of both the CH3 and OH peaks decreased close to background levels. We found that the loss of SFG signal at 0.2 mM occurs at this concentration independent of surface charge density. It is more likely that the loss of signal is related to structural inhomogeneity induced by a striped phase - stand-up phase transition. This is supported by a distinct change of the relative SFG phase between CH3/OH near 0.2 mM. The second intensity minimum might be related to charge compensation effects. We observed a substrate dependence for the high concentration transition. We also observed distinct SFG signal phase changes for water molecules associated with SDS layers at different SDS solution concentrations indicating that the orientation of bound water changed with SDS surface structure.
Good government and good governance: record keeping in a ...
African Journals Online (AJOL)
This article addresses the challenges that arise when record keeping systems are advocated as a necessary under-pinning for good government and good governance. The relationship between record keeping and accountability is analysed and contextualised in relation to transparency and Freedom of Information ...
Depreciation of public goods in spatial public goods games
International Nuclear Information System (INIS)
Shi, Dong-Mei; Zhuang, Yong; Li, Yu-Jian; Wang, Bing-Hong
2011-01-01
In real situations, the value of public goods will be reduced or even lost because of external factors or for intrinsic reasons. In this work, we investigate the evolution of cooperation by considering the effect of depreciation of public goods in spatial public goods games on a square lattice. It is assumed that each individual gains full advantage if the number of the cooperators n c within a group centered on that individual equals or exceeds the critical mass (CM). Otherwise, there is depreciation of the public goods, which is realized by rescaling the multiplication factor r to (n c /CM)r. It is shown that the emergence of cooperation is remarkably promoted for CM > 1 even at small values of r, and a global cooperative level is achieved at an intermediate value of CM = 4 at a small r. We further study the effect of depreciation of public goods on different topologies of a regular lattice, and find that the system always reaches global cooperation at a moderate value of CM = G − 1 regardless of whether or not there exist overlapping triangle structures on the regular lattice, where G is the group size of the associated regular lattice
Deng, Shaoying; Wang, Daoying; Zhang, Muhan; Geng, Zhiming; Sun, Chong; Bian, Huan; Xu, Weimin; Zhu, Yongzhi; Liu, Fang; Wu, Haihong
2016-03-01
Based on single factor experiments, NaCl concentration, adenosine 5'-monophosphate (AMP) concentration and temperature were selected as independent variables for a three-level Box-Behnken experimental design, and the shear force and cooking loss were response values for regression analysis. According to the statistical models, it showed that all independent variables had significant effects on shear force and cooking loss, and optimal values were at the NaCl concentration of 4.15%, AMP concentration of 22.27 mmol/L and temperature of 16.70°C, which was determined with three-dimensional response surface diagrams and contour plots. Under this condition, the observed shear force and cooking loss were 0.625 kg and 8.07%, respectively, exhibiting a good agreement with their predicted values, showing the good applicability and feasibility of response surface methodology (RSM) for improving pork tenderness. Compared with control pig muscles, AMP combined with NaCl treatment demonstrated significant effects on improvement of meat tenderness and reduction of cooking loss. Therefore, AMP could be regarded as an effective tenderization agent for pork. © 2015 Japanese Society of Animal Science.
Evaluation of surface-wave waveform modeling for lithosphere velocity structure
Chang, Tao-Ming
Surface-waveform modeling methods will become standard tools for studying the lithosphere structures because they can place greater constraints on earth structure and because of interest in the three-dimensional earth. The purpose of this study is to begin to learn the applicabilities and limitations of these methods. A surface-waveform inversion method is implemented using generalized seismological data functional theory. The method has been tested using synthetic and real seismic data and show that this method is well suited for teleseismic and regional seismograms. Like other linear inversion problems, this method also requires a good starting model. To ease reliance on good starting models, a global search technique, the genetic algorithm, has been applied to surface waveform modeling. This method can rapidly find good models for explaining surface-wave waveform at regional distance. However, this implementation also reveals that criteria which are widely used in seismological studies are not good enough to indicate the goodness of waveform fit. These two methods with the linear waveform inversion method, and traditional surface wave dispersion inversion method have been applied to a western Texas earthquake to test their abilities. The focal mechanism of the Texas event has been reestimated using a grid search for surface wave spectral amplitudes. A comparison of these four algorithms shows some interesting seismic evidences for lithosphere structure.
Metal-free, single-polymer device exhibits resistive memory effect
Bhansali, Unnat Sampatraj; Khan, Yasser; Cha, Dong Kyu; Almadhoun, Mahmoud N.; Li, Ruipeng; Chen, Long; Amassian, Aram; Odeh, Ihab N.; Alshareef, Husam N.
2013-01-01
All-polymer, write-once-read-many times resistive memory devices have been fabricated on flexible substrates using a single polymer, poly(3,4- ethylenedioxythiophene):polystyrene sulfonate (PEDOT:PSS). Spin-cast or inkjet-printed films of solvent-modified PEDOT:PSS are used as electrodes, while the unmodified or as-is PEDOT:PSS is used as the semiconducting active layer. The all-polymer devices exhibit an irreversible but stable transition from a low resistance state (ON) to a high resistance state (OFF) at low voltages caused by an electric-field-induced morphological rearrangement of PEDOT and PSS at the electrode interface. However, in the metal-PEDOT:PSS-metal devices, we have shown a metal filament formation switching the device from an initial high resistance state (OFF) to the low resistance state (ON). The all-PEDOT:PSS memory device has low write voltages (<3 V), high ON/OFF ratio (>10 3), good retention characteristics (>10 000 s), and stability in ambient storage (>3 months). © 2013 American Chemical Society.
Metal-free, single-polymer device exhibits resistive memory effect
Bhansali, Unnat Sampatraj
2013-12-23
All-polymer, write-once-read-many times resistive memory devices have been fabricated on flexible substrates using a single polymer, poly(3,4- ethylenedioxythiophene):polystyrene sulfonate (PEDOT:PSS). Spin-cast or inkjet-printed films of solvent-modified PEDOT:PSS are used as electrodes, while the unmodified or as-is PEDOT:PSS is used as the semiconducting active layer. The all-polymer devices exhibit an irreversible but stable transition from a low resistance state (ON) to a high resistance state (OFF) at low voltages caused by an electric-field-induced morphological rearrangement of PEDOT and PSS at the electrode interface. However, in the metal-PEDOT:PSS-metal devices, we have shown a metal filament formation switching the device from an initial high resistance state (OFF) to the low resistance state (ON). The all-PEDOT:PSS memory device has low write voltages (<3 V), high ON/OFF ratio (>10 3), good retention characteristics (>10 000 s), and stability in ambient storage (>3 months). © 2013 American Chemical Society.
International Nuclear Information System (INIS)
Clarkson, R.B.; Odintsov, B.M.; Ceroke, P.J.; Ardenkjaer-Larsen, J.H.; Fruianu, M.; Belford, R.L.
1998-01-01
Carbon chars have been synthesized in our laboratory from a variety of starting materials, by means of a highly controlled pyrolysis technique. These chars exhibit electron paramagnetic resonance (EPR) line shapes which change with the local oxygen concentration in a reproducible and stable fashion; they can be calibrated and used for oximetry. Biological stability and low toxicity make chars good sensors for in vivo measurements. Scalar and dipolar interactions of water protons at the surfaces of chars may be utilized to produce dynamic nuclear polarization (DNP) of the 1 H nuclear spin population in conjunction with electron Zeeman pumping. Low-frequency EPR, DNP and DNP-enhanced MRI all show promise as oximetry methods when used with carbon chars. (author)
Ko, Na Re; Sabbatier, Gad; Cunningham, Alexander; Laroche, Gaétan; Oh, Jung Kwon
2014-02-01
Polylactide (PLA) is a class of promising biomaterials that hold great promise for various biological and biomedical applications, particularly in the field of vascular tissue engineering where it can be used as a fibrous mesh to coat the inside of vascular prostheses. However, its hydrophobic surface providing nonspecific interactions and its limited ability to further modifications are challenges that need to be overcome. Here, the development of new air-spun PLA nanofibers modified with hydrophilic surfaces exhibiting reduction response is reported. Surface-initiated atom transfer radical polymerization allows for grafting pendant oligo(ethylene oxide)-containing polymethacrylate (POEOMA) from PLA air-spun fibers labeled with disulfide linkages. The resulting PLA-ss-POEOMA fibers exhibit enhanced thermal stability and improved surface properties, as well as thiol-responsive shedding of hydrophilic POEOMA by the cleavage of its disulfide linkages in response to reductive reactions, thus tuning the surface properties. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Dang, Xueping; Wang, Yingkai; Hu, Chengguo; Huang, Jianlin; Chen, Huaixia; Wang, Shengfu; Hu, Shengshui
2014-01-01
A new analogue of polydopamine (PDA), i.e., polyhydroquinone (PH 2 Q), was polymerized and its surface chemistry was studied by different ways of characterization. PH 2 Q was produced by the self-polymerization of H 2 Q mediated by dissolved oxygen, and the self-polymerization process was strongly dependent on the type and the pH value of the buffer solutions. PH 2 Q can not only achieve surface hydrophilization of different substrates like polyethylene terephthalate (PET) film, graphite strip, C 12 SH/Au and wax slice, but also possess several unique properties like reversible adsorption, good solubility and low cost. These properties made PH 2 Q an ideal polymeric modifier for the noncovalent functionalization of some nanomaterials. By simply grinding with PH 2 Q, pristine multi-walled carbon nanotubes (MWNTs) can be readily dispersed in water with high solubility and good stability. The resulting MWNT–PH 2 Q composite exhibited excellent electrochemical performance, which was employed for the simultaneous determination of dopamine (DA) and uric acid (UA). - Highlights: • Polyhydroquinone (PH 2 Q) was produced by the self-polymerization of hydroquinone (H 2 Q) mediated by dissolved oxygen. • PH 2 Q can achieve surface hydrophilization of a variety of substrates. • PH 2 Q is an ideal polymeric modifier for the functionalization of multi-walled carbon nanotubes (MWNTs). • The MWNT–PH 2 Q composite can be employed for the simultaneous determination of dopamine (DA) and uric acid (UA)
"Good mothering" or "good citizenship"?
Porter, Maree; Kerridge, Ian H; Jordens, Christopher F C
2012-03-01
Umbilical cord blood banking is one of many biomedical innovations that confront pregnant women with new choices about what they should do to secure their own and their child's best interests. Many mothers can now choose to donate their baby's umbilical cord blood (UCB) to a public cord blood bank or pay to store it in a private cord blood bank. Donation to a public bank is widely regarded as an altruistic act of civic responsibility. Paying to store UCB may be regarded as a "unique opportunity" to provide "insurance" for the child's future. This paper reports findings from a survey of Australian women that investigated the decision to either donate or store UCB. We conclude that mothers are faced with competing discourses that force them to choose between being a "good mother" and fulfilling their role as a "good citizen." We discuss this finding with reference to the concept of value pluralism.
Modification of Ti6Al4V surface by diazonium compounds
Sandomierski, Mariusz; Buchwald, Tomasz; Strzemiecka, Beata; Voelkel, Adam
2018-02-01
Ti6Al4V alloy is the most commonly used in orthopedic industry as an endoprosthesis. Ti6Al4V exhibits good mechanical properties, except the abrasion resistance. Surface modification of Ti6Al4V in order to obtain organic layer, and then the attachment of the polymer, can allow for overcoming this problem. The aim of the work was the modification of Ti6Al4V surface by diazonium compounds: salt or cation generated in situ and examine the influence of the reducing agent - ascorbic acid, and the temperature of reaction on modification process. Moreover, the simulated body fluid was used for the assessment of the organic layer stability on Ti6Al4V surface. The evaluation of the modification was carried out using the following methods: Raman microspectroscopy, scanning electron microscopy and energy-dispersive X-ray spectroscopy. Higher temperature of modification by 4-hydroxymethylbenzenediazonium cation, provides the largest amount of organic layer on the Ti6Al4V alloy. In the case of the Ti6Al4V modified by Variamine Blue B salt, the amount of organic layer is not dependent on the reaction condition. Moreover, the ascorbic acid and the presence of TiO2 does not effect on the modification. The modified surface is completely coated with the organic layer which is stable in simulated body fluid.
Students-exhibits interaction at a science center
Botelho, Agostinho; Morais, Ana M.
2006-12-01
In this study we investigate students' learning during their interaction with two exhibits at a science center. Specifically, we analyze both students' procedures when interacting with exhibits and their understanding of the scientific concepts presented therein. Bernstein's theory of pedagogic discourse (1990, 2000) provided the sociological foundation to assess the exhibit-student interaction and allowed analysis of the influence of the characteristics of students, exhibits, and interactions on students' learning. Eight students (ages 12ndash;13 years of age) with distinct sociological characteristics participated in the study. Several findings emerged from the results. First, the characteristics of the students, exhibits, and interactions appeared to influence student learning. Second, to most students, what they did interactively (procedures) seems not to have had any direct consequence on what they learned (concept understanding). Third, the data analysis suggest an important role for designers and teachers in overcoming the limitations of exhibit-student interaction.
Cadmium in goods - contribution to environmental exposure
Energy Technology Data Exchange (ETDEWEB)
Bergbaeck, B; Jonsson, Arne [Kalmar Univ. (Sweden). Dept. of Natural Science
1998-03-01
The total amount of Cd used in Sweden since 1940 is approximately 5000 tonnes, including alloys, fertilizers and impurities in zinc. The stock of Cd in goods in the Swedish anthroposphere is dominated by NiCd-batteries. However, when one considers the degree of exposure to corrosion, Cd stabilizers are dominant. Emissions of Cd from industrial plants and other point sources have been historically important. However, these point source emissions must be seen in relation to the increasingly significant fugitive `consumption emissions`, from the use and/or end-use of various goods. In this study, methods of reconstructing the flows of cadmium (Cd) and estimating the emissions over time are discussed. This is done through studies of the development of production, technology, trade and the longevity of metals in Swedish society. This last part in the chain will form the `consumption emissions` calculated from emission factors giving the proportion of the cadmium content in goods that eventually will reach the environment. The main accumulation of metals in the anthroposphere occurs in urban areas where the influx of metals is greatest. Urban areas probably represent `hot spots` as far as this type of environmental impact is concerned. Extreme Cd concentrations in surface sediments in central Stockholm indicate an ongoing release of Cd from the anthroposphere. The sources are so far unknown, i.e. this Cd flow to the biosphere cannot be explained in terms of deposition or emissions from point sources. Approximately 40 tonnes of Cd in goods are exposed to corrosion in varying degrees. This stock is dominated by Cd in stabilizers and pigments, and as impurities in Zn 15 refs, 2 figs, 8 tabs
Directory of Open Access Journals (Sweden)
Mitja Janža
2016-12-01
Full Text Available Assessment of the available quantity of groundwater is of essential importance for its sustainable use. Modern approaches for estimation of groundwater availability take into account all potential impacts of abstractions, including impacts on groundwater dependent ecosystems and impacts on surface waters ecological status. Groundwater body is in good quantitative status if groundwater abstractions do not cause signifiant damages to groundwater dependent ecosystems and signifiant diminution in the ecological status of surface water bodies. The methodology presented in this paper was developed as an integral part of the assessment of the quantitative status of groundwater bodies in Slovenia and is tailored to the characteristics of the groundwater dependent ecosystems as well as hydrological and hydrogeological conditions in the Slovenian territory. Two different approaches were implemented; for forest habitats on alluvial aquifers, and habitats of amphibians and molluscs in karst areas. Estimates of the required quantity of groundwater for groundwater dependent ecosystems conservation were performed at the level of groundwater bodies and annual averages of temporal variables of the water balance, calculated with the regional water balance model GROWA-SI. In the areas of groundwater bodies with groundwater dependent ecosystems estimated quantity present 0.1 % - 12.4 % of the groundwater recharge. The estimated share of annual renewable quantity of groundwater to maintain the ecological status of surface waters for the entire territory of Slovenia is 23.2 %. The largest share, 30 % is in north-eastern Slovenia and the lowest in the north-west part of Slovenia with a 16.6 % average annual renewable quantity.
International Nuclear Information System (INIS)
Lunt, R.E.
1987-01-01
Mechanical handling apparatus is adapted to handle goods, such as boxed fruit, during a process of irradiation, in palletized form. Palletized goods are loaded onto wheeled vehicles in a loading zone. Four vehicles are wheeled on a track into an irradiation zone via a door in a concrete shield. The vehicles are arranged in orthogonal relationship around a source of square section. Turntables are positioned at corners of the square shaped rail truck around the source selectively to turn the vehicles to align then with track sections. Mechanical manipulating devices are positioned in the track sections opposed to sides of the source. During irradiation, the vehicles and their palletized goods are cylically moved toward the source to offer first sides of the goods for irradiation and are retraced from the source and are pivoted through 90 0 to persent succeeding sides of the goods for irradiation
Tian, Rui; Yan, Dongpeng; Li, Chunyang; Xu, Simin; Liang, Ruizheng; Guo, Lingyan; Wei, Min; Evans, David G.; Duan, Xue
2016-05-01
Gold nanoclusters (Au NCs) as ultrasmall fluorescent nanomaterials possess discrete electronic energy and unique physicochemical properties, but suffer from relatively low quantum yield (QY) which severely affects their application in displays and imaging. To solve this conundrum and obtain highly-efficient fluorescent emission, 2D exfoliated layered double hydroxide (ELDH) nanosheets were employed to localize Au NCs with a density as high as 5.44 × 1013 cm-2, by virtue of the surface confinement effect of ELDH. Both experimental studies and computational simulations testify that the excited electrons of Au NCs are strongly confined by MgAl-ELDH nanosheets, which results in a largely promoted QY as well as prolonged fluorescence lifetime (both ~7 times enhancement). In addition, the as-fabricated Au NC/ELDH hybrid material exhibits excellent imaging properties with good stability and biocompatibility in the intracellular environment. Therefore, this work provides a facile strategy to achieve highly luminescent Au NCs via surface-confined emission enhancement imposed by ultrathin inorganic nanosheets, which can be potentially used in bio-imaging and cell labelling.Gold nanoclusters (Au NCs) as ultrasmall fluorescent nanomaterials possess discrete electronic energy and unique physicochemical properties, but suffer from relatively low quantum yield (QY) which severely affects their application in displays and imaging. To solve this conundrum and obtain highly-efficient fluorescent emission, 2D exfoliated layered double hydroxide (ELDH) nanosheets were employed to localize Au NCs with a density as high as 5.44 × 1013 cm-2, by virtue of the surface confinement effect of ELDH. Both experimental studies and computational simulations testify that the excited electrons of Au NCs are strongly confined by MgAl-ELDH nanosheets, which results in a largely promoted QY as well as prolonged fluorescence lifetime (both ~7 times enhancement). In addition, the as-fabricated Au NC
Directory of Open Access Journals (Sweden)
Kaili Wang
2017-06-01
Full Text Available Mussel-inspired polydopamine (PDA chemistry and electroless deposition approaches were used to prepare stable superhydrophobic coatings on wood surfaces. The as-formed PDA coating on a wood surface exhibited a hierarchical micro/nano roughness structure, and functioned as an “adhesive layer” between the substrate and a metallic film by the metal chelating ability of the catechol moieties on PDA, allowing for the formation of a well-developed micro/nanostructure hierarchical roughness. Additionally, the coating acted as a stable bridge between the substrate and hydrophobic groups. The morphology and chemical components of the prepared superhydrophobic wood surfaces were characterized by scanning electron microscopy (SEM, Fourier transform infrared (FT-IR spectroscopy, and X-ray photoelectron spectroscopy (XPS. The PDA and octadecylamine (OA modified surface showed excellent superhydrophobicity with a water contact angle (CA of about 153° and a rolling angle (RA of about 9°. The CA further increased to about 157° and RA reduced to about 5° with the Cu metallization. The superhydrophobic material exhibited outstanding stability in harsh conditions including ultraviolet aging, ultrasonic washing, strong acid-base and organic solvent immersion, and high-temperature water boiling. The results suggested that the PDA/OA layers were good enough to confer robust, degradation-resistant superhydrophobicity on wood substrates. The Cu metallization was likely unnecessary to provide significant improvements in superhydrophobic property. However, due to the amazing adhesive capacity of PDA, the electroless deposition technique may allow for a wide range of potential applications in biomimetic materials.
Ozone-surface reactions in five homes: surface reaction probabilities, aldehyde yields, and trends.
Wang, H; Morrison, G
2010-06-01
Field experiments were conducted in five homes during three seasons (summer 2005, summer 2006 and winter 2007) to quantify ozone-initiated secondary aldehyde yields, surface reaction probabilities, and trends any temporal over a 1.5-year interval. Surfaces examined include living room carpets, bedroom carpets, kitchen floors, kitchen counters, and living room walls. Reaction probabilities for all surfaces for all seasons ranged from 9.4 x 10(-8) to 1.0 x 10(-4). There were no significant temporal trends in reaction probabilities for any surfaces from summer 2005 to summer 2006, nor over the entire 1.5-year period, indicating that it may take significantly longer than this period for surfaces to exhibit any 'ozone aging' or lowering of ozone-surface reactivity. However, all surfaces in three houses exhibited a significant decrease in reaction probabilities from summer 2006 to winter 2007. The total yield of aldehydes for the summer of 2005 were nearly identical to that for summer of 2006, but were significantly higher than for winter 2007. We also observed that older carpets were consistently less reactive than in newer carpets, but that countertops remained consistently reactive, probably because of occupant activities such as cooking and cleaning. Ozone reactions taking place at indoor surfaces significantly influence personal exposure to ozone and volatile reaction products. These field studies show that indoor surfaces only slowly lose their ability to react with ozone over several year time frames, and that this is probably because of a combination of large reservoirs of reactive coatings and periodic additions of reactive coatings in the form of cooking, cleaning, and skin-oil residues. When considering exposure to ozone and its reaction products and in the absence of dramatic changes in occupancy, activities or furnishings, indoor surface reactivity is expected to change very slowly.
Directory of Open Access Journals (Sweden)
Hery Harjono Muljo
2014-05-01
Full Text Available This study wants to know and understand whether good governance principles have been well applied as well as the factors influencing optimization of the implementation of good governance principles on the academic field in an effort to realize good university governance in Bina Nusantara University. The study aims to evaluate the implementation of good governance principles on the academic field, know the factors that affect the implementation of good governance principles on the academic field, and improve and develop the academic areas in accordance with good governance principles in order to maximize the role of Bina Nusantara University as Good University Governance. The approach model used to understand the implementation of good governance principles was a model to educational institution using the 8 principles, namely academic freedom, shared governance, clear rights and responsibilities, selection at merit, financial stability, accountability, regular testing of standards, and the importance of close cooperation. Research used qualitative method with descriptive analysis, by analyzing the factors influencing optimization of the implementation of good governance principles, particularly on academic areas. The results achieved there were 18 factors that affect the optimization of the implementation of good governance principles. Then the factors affected the optimization ofthe implementation of good governance principles the most are operational centralization and academic decentralization which were the novelty of this study.
International Nuclear Information System (INIS)
Tan, Yuan; Jing, Lijing; Ding, Yonghong; Wei, Tianxin
2015-01-01
Highlights: • The in-situ photo-grafting polymerization method was used to prepare the polymer film. • The synthesized MIF was layer stucture film. • The MIF exhibited good imprinting effect and highly selectivity. - Abstract: This work aimed to prepare a novel double-layer structure molecularly imprinted polymer film (MIF) on the surface plasmon resonance (SPR) sensor chips for detection of testosterone in aqueous media. The film was synthesized by in-situ UV photo polymerization. Firstly, the modification of gold surface of SPR chip was performed by 1-dodecanethiol. Then double-layer MIF was generated on the 1-dodecanethiol modified gold surface. The non-modified and imprinted surfaces were characterized by atomic force microscopy (AFM), fourier transform infrared (FTIR) spectroscopy and contact angle measurements. Analysis of SPR spectroscopy showed that the imprinted sensing film displayed good selectivity for testosterone compared to other analogues and the non-imprinted polymer film (NIF). Within the concentrations range of 1 × 10 −12 –1 × 10 −8 mol/L, the coupling angle changes of SPR were linear with the negative logarithm of testosterone concentrations (R 2 = 0.993). Based on a signal/noise ratio of three, the detection limit was estimated to be 10 −12 mol/L. Finally, the developed MIF was successfully applied to the seawater detection of testosterone. The results in the experiments suggested that a combination of SPR sensing with MIF was a promising alternative method for detection of testosterone in aqueous media
Galician mining and metallurgy in the light of the General Regional Exhibition of Lviv in 1894
Directory of Open Access Journals (Sweden)
Wojciech Paduchowski
2014-12-01
Full Text Available The General Regional Exhibition of Lviv was organized in 1894, on the 100 year anniversary of the Kosciuszko Uprising of 1794. The Exhibition was meant to demonstrate Galicia’s economical and cultural progress since its gaining political autonomy and to become an opportunity for the national integration of Poles. The Exhibition displays included various thematic groups which were devoted to both spiritual and material aspects of life in Galicia and were meant to show the abundance of its crops and produce, mining and metallurgy, agriculture, forestry and hunting. The shows pictured everyday life of the inhabitants of Galicia, its folk art, so-called domestic industry and craftwork. Other sections of the Exhibition demonstrated the development of the Galician financial institutions, public administration, healthcare, communication, engineering, construction, literature, general and vocational education and the bloom of the fine arts and architecture. The article analyzes only some parts of the great legacy of the Exhibition, its scope focuses on mining and metallurgy. The text points out the dynamic development of the oil industry and the increase in the branches such as: salt production, iron smelting, and brown and hard coal extraction. The only branch of the Galicia’s economy which had not offered good perspectives and was thus soon discontinued had been the production of earthwax (ozocerite. The organization of the exhibitions of such sort was regarded at that time as one of the best ways to stimulate economy and benefit the regions. The actual development itself, especially of the oil mining, aided many positive social and cultural changes and undoubtedly increased the societal potential and might have resulted in further initiatives.
Synthesis of laser beam rapidly solidified novel surfaces on D2 tool steel
International Nuclear Information System (INIS)
Ahmed, B.A.; Rizwan, K.F.; Minhas, J.A.; Waheed-ul-Haq, S.; Shahid, M.
2011-01-01
Surface layer of D2 tool steel was subjected to laser surface melting using continuous wave 2.5 kW CO/sub 2/ laser in point source melting mode. The processing parameters were varied to achieve a uniform depth of around 2 mm. Microstructural study revealed epitaxial growth of fine dendritic structure with secondary dendrite arm spacing in the range of 20-25 mu m. The phases in the parent annealed sample were BCC ferrite and chromium rich M7C3 carbide. The major phase after laser treatment was austenite and M7C3. The average hardness of annealed sample was 195 HV which increased to 410 HV after laser melting. Corrosion studies in 2% HCl solution exhibited a drastic improvement in corrosion resistance in laser treated samples. Improvement in properties is attributed to the refinement and uniformity of microstructure in the rapidly solidified surface. The case of a moving heat source was subjected to computer aided simulation to predict the melt depth at different processing conditions in point source melting mode. The calculated depths using the model, in ABAQUS software was found in good agreement with the experimental data. (author)
Exhibition - Mathematics, A Beautiful Elsewhere
2011-01-01
From 21 October 2011 to 18 March 2012, the Fondation Cartier pour l’art contemporain will present the exhibition Mathematics: A Beautiful Elsewhere, an exhibition developed in association with the Institut des Hautes Études Scientifiques (IHÉS) and under the patronage of UNESCO. For this unprecedented event, the foundation invited mathematicians to work with artists with whom it has previously worked to create an exhibition that allows visitors to see, hear, do, interpret and think about mathematics. By bringing mathematics into its premises, the Fondation Cartier is itself undergoing the “sudden change of scenery” described by mathematician Alexandre Grothendieck. More information is available here. Fondation Cartier pour l’art contemporain 261, boulevard Raspail 75014 Paris http://fondation.cartier.com Private Visit For professors, researchers and all the staff of Mathematics departments...
Good practices in radiological protection at Narora Atomic Power Station
International Nuclear Information System (INIS)
Singh, V.P.; Kumar, Sanjeev; Agrawal, Mitesh; Tiwari, S.K.; Kulhari, Praveen; Gupta, Ashok
2016-01-01
Radiological protection performance of nuclear power plant is assessed by collective exposure, individual average exposure, external/external exposure, personnel/surface contamination and reduction of radioactive wastes. Collective exposure is reduced by integrated comprehensive ALARA program in all aspects of nuclear plant operation and maintenance has reduced collective dose many folds. In the present paper, implementation of new good practices in Radiological Protection is presented
International Nuclear Information System (INIS)
Zuo, Zewen; Zhu, Kai; Gu, Chuan; Wen, Yibing; Cui, Guanglei; Qu, Jun
2016-01-01
Highlights: • Transparent, flexible SERS substrates were prepared using techniques compatible with well-established silicon device technologies. • The SERS substrates exhibit high sensitivity and good reproducibility. • The high performance is related with the quasi-three-dimensional structure of the PET. • In-situ detection of analyte on irregular objects was achieved by this SERS substrate. - Abstract: Transparent, flexible surface-enhanced Raman scattering (SERS) substrates were fabricated by metalization of structured polyethylene terephthalate (PET) sheets. The resultant Ag-coated structured PET SERS substrates were revealed to be highly sensitive with good reproducibility and stability, an enhancement factor of 3 × 10 6 was acquired, which can be attributed mainly to the presence of plentiful multiple-type hot spots within the quasi-three-dimensional surface of the structured PET obtained by oxygen plasma etching. In addition, detections of model molecules on fruit skin were also carried out, demonstrating the great potential of the Ag-coated structured PET in in-situ detection of analyte on irregular objects. Importantly, the technique used for the preparation of such substrate is completely compatible with well-established silicon device technologies, and large-area fabrication with low cost can be readily realized.
Energy Technology Data Exchange (ETDEWEB)
Zuo, Zewen, E-mail: zuozewen@mail.ahnu.edu.cn; Zhu, Kai; Gu, Chuan; Wen, Yibing; Cui, Guanglei; Qu, Jun
2016-08-30
Highlights: • Transparent, flexible SERS substrates were prepared using techniques compatible with well-established silicon device technologies. • The SERS substrates exhibit high sensitivity and good reproducibility. • The high performance is related with the quasi-three-dimensional structure of the PET. • In-situ detection of analyte on irregular objects was achieved by this SERS substrate. - Abstract: Transparent, flexible surface-enhanced Raman scattering (SERS) substrates were fabricated by metalization of structured polyethylene terephthalate (PET) sheets. The resultant Ag-coated structured PET SERS substrates were revealed to be highly sensitive with good reproducibility and stability, an enhancement factor of 3 × 10{sup 6} was acquired, which can be attributed mainly to the presence of plentiful multiple-type hot spots within the quasi-three-dimensional surface of the structured PET obtained by oxygen plasma etching. In addition, detections of model molecules on fruit skin were also carried out, demonstrating the great potential of the Ag-coated structured PET in in-situ detection of analyte on irregular objects. Importantly, the technique used for the preparation of such substrate is completely compatible with well-established silicon device technologies, and large-area fabrication with low cost can be readily realized.
DEFF Research Database (Denmark)
Andreassen, Rikke
light on the staging of exhibitions, the daily life of the exhibitees, the wider connections between shows across Europe and the thinking of the time on matters of race, science, gender and sexuality. A window onto contemporary racial understandings, the book presents interviews with the descendants...... of displayed people, connecting the attitudes and science of the past with both our (continued) modern fascination with ‘the exotic’, and contemporary language and popular culture. As such, it will be of interest to scholars of sociology, anthropology and history working in the areas of gender and sexuality...
Anniversary Exhibition. Nechvolodov.
Directory of Open Access Journals (Sweden)
- -
2006-03-01
Full Text Available On the 10th of August, 2005 in Tartu (the second biggest educational and cultural city in Estonia Stanislav Nechvolodov's exhibition was opened to show the 5-year cycle of his work, traditional for the author and his admirers. At the opening ceremony Nechvolodov said that the exhibition was the last one and appointed on his 70th anniversary.The architectural and building society in Irkutsk remembers Stanislav Nechvolodov as an architect working on dwelling and civil buildings in 1960-70s. Below are some extracts from the Estonian press.«Postimees» newspaper, December 1993. The interview «Expressionistic naturalist, conservative Nechvolodov» by journalist Eric Linnumyagi. He asks about all the details and describes the troubles experienced by Nechvolodov during the perestroika period in Estonia, for example: the Tartu University refused to install the sculpture of Socrat, the art school refused to engage him as an instructor, the sculpture of Socrat moved to Vrotzlav, Poland, and Nechvolodov moved to Poland to read lectures there.«Tartu» newspaper, November 2000. Mats Oun, artist, says in the article «Nechvolodov: a man of Renaissance»: «Nechvolodov works in Estonia, his works are placed in many local and foreign museums. Regardless some insignificant faults, he deserves a high estimation, and his manysided open exhibition can be an example for other artists. He is a man of Renaissance».
Creating Virtual Exhibitions for Educational and Cultural Development
Directory of Open Access Journals (Sweden)
Gabriela DUMITRESCU
2014-01-01
Full Text Available The paper presents different tools and mechanisms to implement a virtual exhibition in different cultural areas, such as museums and libraries. Quality characteristics of virtual exhibitions are identified and described. The possibility to create native mobile applications for virtual exhibitions presentation is analyzed. The functional flow of creating a virtual exhibition is presented and discussed. The Seals - History Treasure exhibition is presented and significant historical documents are revealed.
Su, Fenghua; Yao, Kai
2014-06-11
A novel method for controllable fabrication of a superhydrophobic surface with a water contact angle of 162 ± 1° and a sliding angle of 3 ± 0.5° on copper substrate is reported in this Research Article. The facile and low-cost fabrication process is composed from the electrodeposition in traditional Watts bath and the heat-treatment in the presence of (heptadecafluoro-1,1,2,2-tetradecyl) triethoxysilane (AC-FAS). The superhydrophobicity of the fabricated surface results from its pine-cone-like hierarchical micro-nanostructure and the assembly of low-surface-energy fluorinated components on it. The superhydrophobic surface exhibits high microhardness and excellent mechanical abrasion resistance because it maintains superhydrophobicity after mechanical abrasion against 800 grit SiC sandpaper for 1.0 m at the applied pressure of 4.80 kPa. Moreover, the superhydrophobic surface has good chemical stability in both acidic and alkaline environments. The potentiodynamic polarization and electrochemical impedance spectroscopy test shows that the as-prepared superhydrophobic surface has excellent corrosion resistance that can provide effective protection for the bare Cu substrate. In addition, the as-prepared superhydrophobic surface has self-cleaning ability. It is believed that the facile and low-cost method offer an effective strategy and promising industrial applications for fabricating superhydrophobic surfaces on various metallic materials.
Wang, Hanwei; Yao, Qiufang; Wang, Chao; Ma, Zhongqing; Sun, Qingfeng; Fan, Bitao; Jin, Chunde; Chen, Yipeng
2017-05-23
In this study, nanooctahedra MnFe₂O₄ were successfully deposited on a wood surface via a low hydrothermal treatment by hydrogen bonding interactions. As-prepared MnFe₂O₄/wood composite (MW) had superior performance of soft magnetism, fire resistance and electromagnetic wave absorption. Among them, small hysteresis loops and low coercivity (magnetization-field curve of MW with saturation magnetization of 28.24 emu/g, indicating its excellent soft magnetism. The MW also exhibited a good fire-resistant property due to its initial burning time at 20 s; while only 6 s for the untreated wood (UW) in combustion experiments. Additionally, this composite revealed good electromagnetic wave absorption with a minimum reflection loss of -9.3 dB at 16.48 GHz. Therefore, the MW has great potential in the fields of special decoration and indoor electromagnetic wave absorbers.
International Nuclear Information System (INIS)
Katahira, Fujito; Hirano, Kenji; Tanaka, Yasuhiro; Yoshida, Kazuo; Kuribayashi, Munetaka; Umemoto, Tadahiro
1994-01-01
A new method of surface melting by using a high power yttrium aluminium garnet laser was developed. This method is applicable to a long distance and narrow space, because of the good accessibility of the laser beam through optical fibre.A desensitization of sensitized type 304 stainless steel pipe was demonstrated by using this technique. A melted layer of thickness approximately 200μm had a very finite solidification structure, which contained approximately 1.5% δ-ferrite. The average chemical composition of this layer was almost the same as that of type 304 stainless steel, and a band of 300μm thickness under the melted layer underwent solution heat treatment (SHT).As a result of such surface melting, the melted layer exhibited superior resistance to intergranular stress corrosion cracking (IGSCC). Since the SHT layer is highly resistant to IGSCC generally, it may be possible to improve the IGSCC resistance of base metal to a comparatively deep extent (500μm from the surface) by this technique. ((orig.))
Energy Technology Data Exchange (ETDEWEB)
Katahira, Fujito (Ishikawajima-Harima Heavy Industries Co. Ltd., 1 Shin-Nakahara-Cho, Isogo-Ku, Yokohama 235 (Japan)); Hirano, Kenji (Ishikawajima-Harima Heavy Industries Co. Ltd., 1 Shin-Nakahara-Cho, Isogo-Ku, Yokohama 235 (Japan)); Tanaka, Yasuhiro (Ishikawajima-Harima Heavy Industries Co. Ltd., 1 Shin-Nakahara-Cho, Isogo-Ku, Yokohama 235 (Japan)); Yoshida, Kazuo (Ishikawajima-Harima Heavy Industries Co. Ltd., 1 Shin-Nakahara-Cho, Isogo-Ku, Yokohama 235 (Japan)); Kuribayashi, Munetaka (Ishikawajima-Harima Heavy Industries Co. Ltd., 1 Shin-Nakahara-Cho, Isogo-Ku, Yokohama 235 (Japan)); Umemoto, Tadahiro (Ishikawajima-Harima Heavy Industries Co. Ltd., 1 Shin-Nakahara-Cho, Isogo-Ku, Yokohama 235 (Japan))
1994-12-01
A new method of surface melting by using a high power yttrium aluminium garnet laser was developed. This method is applicable to a long distance and narrow space, because of the good accessibility of the laser beam through optical fibre.A desensitization of sensitized type 304 stainless steel pipe was demonstrated by using this technique. A melted layer of thickness approximately 200[mu]m had a very finite solidification structure, which contained approximately 1.5% [delta]-ferrite. The average chemical composition of this layer was almost the same as that of type 304 stainless steel, and a band of 300[mu]m thickness under the melted layer underwent solution heat treatment (SHT).As a result of such surface melting, the melted layer exhibited superior resistance to intergranular stress corrosion cracking (IGSCC). Since the SHT layer is highly resistant to IGSCC generally, it may be possible to improve the IGSCC resistance of base metal to a comparatively deep extent (500[mu]m from the surface) by this technique. ((orig.))
Kenda, Balthasar; Lognonné, Philippe; Spiga, Aymeric; Kawamura, Taichi; Kedar, Sharon; Banerdt, William Bruce; Lorenz, Ralph; Banfield, Don; Golombek, Matthew
2017-10-01
We investigated the possible seismic signatures of dust devils on Mars, both at long and short period, based on the analysis of Earth data and on forward modeling for Mars. Seismic and meteorological data collected in the Mojave Desert, California, recorded the signals generated by dust devils. In the 10-100 s band, the quasi-static surface deformation triggered by pressure fluctuations resulted in detectable ground-tilt effects: these are in good agreement with our modeling based on Sorrells' theory. In addition, high-frequency records also exhibit a significant excitation in correspondence to dust devil episodes. Besides wind noise, this signal includes shallow surface waves due to the atmosphere-surface coupling and is used for a preliminary inversion of the near-surface S-wave profile down to 50 m depth. In the case of Mars, we modeled the long-period signals generated by the pressure field resulting from turbulence-resolving Large-Eddy Simulations. For typical dust-devil-like vortices with pressure drops of a couple Pascals, the corresponding horizontal acceleration is of a few nm/s2 for rocky subsurface models and reaches 10-20 nm/s2 for weak regolith models. In both cases, this signal can be detected by the Very-Broad Band seismometers of the InSight/SEIS experiment up to a distance of a few hundred meters from the vortex, the amplitude of the signal decreasing as the inverse of the distance. Atmospheric vortices are thus expected to be detected at the InSight landing site; the analysis of their seismic and atmospheric signals could lead to additional constraints on the near-surface structure, more precisely on the ground compliance and possibly on the seismic velocities.
Digital Natives: Creating Emergent Exhibitions through Digital Technologies
DEFF Research Database (Denmark)
Smith, Rachel Charlotte; Iversen, Ole Sejer; Dindler, Christian
2011-01-01
. In this way, digital technology can contribute to the creation of emergent exhibitions in which the exhibition is created in dialogue between audiences and the museum. We present experiences from a current research project, the Digital Natives exhibition, in which digital technology was designed......Digital Technology can support the creation of dialogical spaces in the museum, both playful and reflective, that allow audiences to engage in the ongoing construction and reproduction of cultural heritage creating novel connections between self and others and between past, present and future...... as an integral part of the exhibition to encourage dialogue between audiences and the exhibition materials and thereby investigate how the exhibition emerge as a result of this dialogic co-construction inside the exhibition space. In short, the opportunities offered by digital technologies prompts us to consider...
30 CFR 77.200 - Surface installations; general.
2010-07-01
... AND HEALTH MANDATORY SAFETY STANDARDS, SURFACE COAL MINES AND SURFACE WORK AREAS OF UNDERGROUND COAL... other facilities (including custom coal preparation) shall be maintained in good repair to prevent accidents and injuries to employees. ...
Artefacts and the performance of an exhibition
DEFF Research Database (Denmark)
Svabo, Connie
2008-01-01
The article explores the role of mediating artefacts in children's encounters with a museum of natural history. Using actor network theory it explores how a specific artefact shapes the way users relate to exhibited objects and how the artefact guides users' movements in the exhibition....... The mediated performance of an exhibition is explored through an empirical case....
A content-oriented model for science exhibit engineering
DEFF Research Database (Denmark)
Achiam, Marianne
2013-01-01
Recently, science museums have begun to review their educational purposes and redesign their pedagogies. At the most basic level, this entails accounting for the performance of individual exhibits, and indeed, in some cases, research indicates shortcomings in exhibit design: While often successful......: as a means to operationalize the link between exhibit features and visitor activities; and as a template to transform scientists’ practices in the research context into visitors’ activities in the exhibit context. The resulting model of science exhibit engineering is presented and exemplified, and its...... implications for science exhibit design are discussed at three levels: the design product, the design process, and the design methodology....
France at CERN – Industrial exhibition
FP Department
2012-01-01
Industrial Exhibition Administration Building Bldg 61 – 1st Floor Tuesday 27 March: 9 a.m. – 5.30 p.m. Wednesday 28 March: 9 a.m. – 2 p.m. About thirty French companies are presenting their latest technological advances during the industrial exhibition "France at CERN", featuring products and technologies specifically related to CERN activities. Individual B2B meetings can be organized with the sales and technical representatives of participating firms and will take place at either the companies’ exhibition stands or in conference rooms in the Main Building. Individuals wishing to make contact with one or more companies must use the contact details available from each secretariat of department or by using this link. B2B meetings will be coordinated by UBIFRANCE. You will also find the list of exhibiting and participating companies online here. This event is sponsored by the French subsidiary of RS Components, the most important distri...
Temporary and Travelling Exhibitions. Museums and Monuments, X.
Daifuku, Hiroshi; And Others
The permanent exhibition, the most typical form of museum exhibition, has failed to attract repeated visitation, since visitors quickly become familiar with the objects shown. The temporary exhibition evolved as a result for the need of repeated visitation. The temporary exhibition, set up for a period of one to six months, introduces fresh…
Superhydrophobic surfaces of electrospun block copolymer fibers with low content of fluorosilicones
Energy Technology Data Exchange (ETDEWEB)
Tian, Xiaoping [Key Laboratory of Advanced Textile Materials and Manufacturing Technology, Ministry of Education, Zhejiang Sci-Tech University, Hangzhou 310018 (China); Engineering Research Center for Eco-Dyeing and Finishing of Textiles, Ministry of Education, Zhejiang Sci-Tech University, Hangzhou 310018 (China); Yi, Lingmin, E-mail: lmyi@zstu.edu.cn [Key Laboratory of Advanced Textile Materials and Manufacturing Technology, Ministry of Education, Zhejiang Sci-Tech University, Hangzhou 310018 (China); Engineering Research Center for Eco-Dyeing and Finishing of Textiles, Ministry of Education, Zhejiang Sci-Tech University, Hangzhou 310018 (China); Department of Chemical Engineering and Materials Science, Stevens Institute of Technology, Hoboken, NJ 07030 (United States); Meng, Xiaomei; Xu, Kai [Key Laboratory of Advanced Textile Materials and Manufacturing Technology, Ministry of Education, Zhejiang Sci-Tech University, Hangzhou 310018 (China); Engineering Research Center for Eco-Dyeing and Finishing of Textiles, Ministry of Education, Zhejiang Sci-Tech University, Hangzhou 310018 (China); Jiang, Tengteng; Lai, Dongzhi [Key Laboratory of Advanced Textile Materials and Manufacturing Technology, Ministry of Education, Zhejiang Sci-Tech University, Hangzhou 310018 (China)
2014-07-01
A series of well-defined poly[methyl(3,3,3-trifluoropropyl)siloxane]-b-poly(methyl methacrylate) (PMTFPS-b-PMMA) diblock copolymers with low content of PMTFPS were synthesized by atom transfer radical polymerization (ATRP) of MMA from PMTFPS macroinitiators (PMTFPS-Br). The polymerization result reveals that the ATRP of MMA from PMTFPS-Br is fist-order with respect to MMA under different polymerization conditions, demonstrating a typical characteristic of living polymerization. The results also show that PMTFPS-b-PMMA diblock copolymers can exhibit a total surface tension (γ{sub S}) varying from 25.28 mN/m to 21.87 mN/m with the change of PMTFPS contents from 2.6 wt% to 22.2 wt%. Moreover, the water contact angles of electrospun PMTFPS-b-PMMA surfaces could be higher than 150° with water roll-off angles less than 10°, which denotes a superhydrophobic property. However, the electronspinning conditions, especially the concentration of spinning solution, would have important effect on the surface morphology, surface composition and wetting behavior of electrospun films. It was found that bead-free fibers with uniform diameter as well as good superhydrophobic property could be prepared on condition that the polymer concentration of spinning solution was as high as 32 wt% in the mixed solvent of DMF and THF.
Water on a Hydrophobic surface
Scruggs, Ryan; Zhu, Mengjue; Poynor, Adele
2012-02-01
Hydrophobicity, meaning literally fear of water, is exhibited on the surfaces of non-stick cooking pans and water resistant clothing, on the leaves of the lotus plan, or even during the protein folding process in our bodies. Hydrophobicity is directly measured by determining a contact angle between water and an objects surface. Associated with a hydrophobic surface is the depletion layer, a low density region approximately 0.2 nm thick. We study this region by comparing data found in lab using surface plasmon resonance techniques to theoretical calculations. Experiments use gold slides coated in ODT and Mercapto solutions to model both hydrophobic and hydrophilic surfaces respectively.
Modulation of cavity-polaritons by surface acoustic waves
DEFF Research Database (Denmark)
de Lima, M. M.; Poel, Mike van der; Hey, R.
2006-01-01
We modulate cavity-polaritons using surface acoustic waves. The corresponding formation of a mini-Brillouin zone and band folding of the polariton dispersion is demonstrated for the first time. Results are in good agreement with model calculations.......We modulate cavity-polaritons using surface acoustic waves. The corresponding formation of a mini-Brillouin zone and band folding of the polariton dispersion is demonstrated for the first time. Results are in good agreement with model calculations....
Argandoña, Antonio
2011-01-01
The concept of the common good occupied a relevant place in classical social, political and economic philosophy. After losing ground in the Modern age, it has recently reappeared, although with different and sometimes confusing meanings. This paper is the draft of a chapter of a Handbook; it explains the meaning of common good in the Aristotelian-Thomistic philosophy and in the Social Doctrine of the Catholic Church; why the common good is relevant; and how it is different from the other uses...
CERN Industrials Exhibitions - Over 30 Years of Tradition
2001-01-01
Industrial exhibitions have been part of the CERN landscape for 33 years. At least once each year several companies from the same country come to CERN to present their products and services. Now, a new scheme of one-day visits is giving potential exhibitors at CERN a lighter option. The United Kingdom inaugurated the Industrial Exhibitions in 1968, and it wasn't till 1971 that other countries staged exhibitions at CERN. This photo was taken in 1969, at the second British exhibition, where 16 companies were present. Four years after joining CERN, Poland inaugurated its first exhibition at CERN in 1995 in the presence of the former Director-General Chris Llewellyn-Smith. Almost all the Member States have held industrial exhibitions at the Organization. May '68 wasn't only revolutionary in Paris. For the very first time, an industrial exhibition took place at CERN. Great Britain was first to come with eight companies and remains until this day the most devoted country to the programme with 17 exhibitions and ...
Memory and Mourning: An Exhibit History
Eberle, Scott G.
2005-01-01
Mounted by the Strong Museum in Rochester, New York, in 1993, and traveling nationally thereafter, the exhibit Memory and Mourning provided historical and contemporary perspectives to help museum guests explore their own reactions to loss and grief. In the process the exhibit's development team encountered a range of philosophical, historical,…
Surface tension modelling of liquid Cd-Sn-Zn alloys
Fima, Przemyslaw; Novakovic, Rada
2018-06-01
The thermodynamic model in conjunction with Butler equation and the geometric models were used for the surface tension calculation of Cd-Sn-Zn liquid alloys. Good agreement was found between the experimental data for limiting binaries and model calculations performed with Butler model. In the case of ternary alloys, the surface tension variation with Cd content is better reproduced in the case of alloys lying on vertical sections defined by high Sn to Zn molar fraction ratio. The calculated surface tension is in relatively good agreement with the available experimental data. In addition, the surface segregation of liquid ternary Cd-Sn-Zn and constituent binaries has also been calculated.
DEFF Research Database (Denmark)
Sørensen, Karsten Engsig
2006-01-01
An analysis of the rules governing trade in goods under the GATT agreement and the Agreement on Safeguards......An analysis of the rules governing trade in goods under the GATT agreement and the Agreement on Safeguards...
Croteau, T; Bertram, A K; Patey, G N
2008-10-30
Grand canonical Monte Carlo calculations are used to determine water adsorption and structure on defect-free kaolinite surfaces as a function of relative humidity at 235 K. This information is then used to gain insight into ice nucleation on kaolinite surfaces. Results for both the SPC/E and TIP5P-E water models are compared and demonstrate that the Al-surface [(001) plane] and both protonated and unprotonated edges [(100) plane] strongly adsorb at atmospherically relevant relative humidities. Adsorption on the Al-surface exhibits properties of a first-order process with evidence of collective behavior, whereas adsorption on the edges is essentially continuous and appears dominated by strong water lattice interactions. For the protonated and unprotonated edges no structure that matches hexagonal ice is observed. For the Al-surface some of the water molecules formed hexagonal rings. However, the a o lattice parameter for these rings is significantly different from the corresponding constant for hexagonal ice ( Ih). A misfit strain of 14.0% is calculated between the hexagonal pattern of water adsorbed on the Al-surface and the basal plane of ice Ih. Hence, the ring structures that form on the Al-surface are not expected to be good building-blocks for ice nucleation due to the large misfit strain.
Development of strippable gel for surface decontamination applications
International Nuclear Information System (INIS)
Banerjee, D.; Sandhya, U.; Khot, S.A.; Srinivas, C.
2015-07-01
Strippable gels are an attractive option for decontamination of surfaces particularly when materials are to be reused after decontamination. The process in general results in good decontamination performance with minimal secondary waste generation. This paper reports on development of strippable gel formulation using polyvinyl alcohol as the gel former. Peeling behavior of the gel film improved when glycerol was used as plasticizer. Incorporation of decontaminating agents is essential for the gel to be effective, so a number of decontaminating agents were screened based on their miscibility with the gel, smooth peeling, and good decontamination performance. Based on this study, a strippable gel, ‘INDIGEL’ was formulated as a potential candidate for surface decontamination applications. Extensive trials on evaluation of decontamination performance of Indigel were done on simulated surfaces like stainless steel tray, stainless steel fume hood, PVC floor, granite and ceramic table tops. Results show that Indigel is highly effective for decontamination of surfaces contaminated with all types of radionuclides. Simplicity of its use coupled with good decontamination ability will find application in nuclear and other chemical industries. (author)
International Nuclear Information System (INIS)
Wang Chuangye; Morgner, Harald
2011-01-01
In the current work, we first reconstructed the molar fraction-depth profiles of cation and anion near the surface of tetrabutylammonium iodide dissolved in formamide by a refined calculation procedure, based on angle resolved X-ray photoelectron spectroscopy experiments. In this calculation procedure, both the transmission functions of the core levels and the inelastic mean free paths of the photoelectrons have been taken into account. We have evaluated the partial molar volumes of surfactant and solvent by the densities of such solutions with different bulk concentrations. With those partial molar volumes, the molar concentration-depth profiles of tetrabutylammonium ion and iodide ion were determined. The surface excesses of both surfactant ions were then achieved directly by integrating these depth profiles. The anionic molar concentration-depth profiles and surface excesses have been compared with their counterparts determined by neutral impact ion scattering spectroscopy. The comparisons exhibit good agreements. Being capable of determining molar concentration-depth profiles of surfactant ions by core levels with different kinetic energies may extend the applicable range of ARXPS in investigating solution surfaces.
Energy Technology Data Exchange (ETDEWEB)
Huang Xingyi; Xie Liyuan; Jiang Pingkai; Wang Genlin; Liu Fei, E-mail: xyhuang@sjtu.edu.c, E-mail: pkjiang@sjtu.edu.c [Shanghai Key Lab of Electrical Insulation and Thermal Aging, Department of Polymer Science and Engineering, Shanghai Jiao Tong University, Shanghai 200240 (China)
2009-12-21
In this study, we investigated the influence of the surface modified BaTiO{sub 3} nanoparticles on the electrical, thermophysical and micromechanical properties of ethylene-vinyl acetate (EVM) vulcanizates. Gamma-aminopropyl triethoxysilane was used as a silane coupling agent for the surface treatment of the BaTiO{sub 3} nanoparticles. It was found that the incorporation of surface modified BaTiO{sub 3} nanoparticles into the EVM matrix not only increased the permittivity, thermal conductivity and the mechanical strength but also showed a comparative dielectric loss tangent with pure EVM vulcanizates. In particular, the nanocomposites exhibit relatively high dielectric strength and good ductility even at the loading level of 50 vol%. The improved properties not only originate from the homogeneous dispersion of BaTiO{sub 3} nanoparticles but also should be ascribed to the strong interfacial interaction between the surface modified BaTiO{sub 3} nanoparticles and EVM matrix. We also investigated the dielectric relaxation behaviour of the BaTiO{sub 3} filled EVM nanocomposites by using Jonscher's theory of universal dielectric response.
Return on research investments: personal good versus public good
Fox, P. A.
2017-12-01
For some time the outputs, i.e. what's produced, of publicly and privately funded research while necessary, are far from sufficient, when considering an overall return on (research) investment. At the present time products such as peer-reviewed papers, websites, data, and software are recognized by funders on timescales related to research awards and reporting. However, from a consumer perspective impact and value are determined at the time a product is discovered, accessed, assessed and used. As is often the case, the perspectives of producer and consumer communities can be distinct and not intersect at all. We contrast personal good, i.e. credit, reputation, with that of public good, e.g. interest, leverage, exploitation, and more. This presentation will elaborate on both the metaphorical and idealogical aspects of applying a "return on investment" frame for the topic of assessing "good".
Antibacterial Au nanostructured surfaces
Wu, Songmei; Zuber, Flavia; Brugger, Juergen; Maniura-Weber, Katharina; Ren, Qun
2016-01-01
We present here a technological platform for engineering Au nanotopographies by templated electrodeposition on antibacterial surfaces. Three different types of nanostructures were fabricated: nanopillars, nanorings and nanonuggets. The nanopillars are the basic structures and are 50 nm in diameter and 100 nm in height. Particular arrangement of the nanopillars in various geometries formed nanorings and nanonuggets. Flat surfaces, rough substrate surfaces, and various nanostructured surfaces were compared for their abilities to attach and kill bacterial cells. Methicillin-resistant Staphylococcus aureus, a Gram-positive bacterial strain responsible for many infections in health care system, was used as the model bacterial strain. It was found that all the Au nanostructures, regardless their shapes, exhibited similar excellent antibacterial properties. A comparison of live cells attached to nanotopographic surfaces showed that the number of live S. aureus cells was flat and rough reference surfaces. Our micro/nanofabrication process is a scalable approach based on cost-efficient self-organization and provides potential for further developing functional surfaces to study the behavior of microbes on nanoscale topographies.We present here a technological platform for engineering Au nanotopographies by templated electrodeposition on antibacterial surfaces. Three different types of nanostructures were fabricated: nanopillars, nanorings and nanonuggets. The nanopillars are the basic structures and are 50 nm in diameter and 100 nm in height. Particular arrangement of the nanopillars in various geometries formed nanorings and nanonuggets. Flat surfaces, rough substrate surfaces, and various nanostructured surfaces were compared for their abilities to attach and kill bacterial cells. Methicillin-resistant Staphylococcus aureus, a Gram-positive bacterial strain responsible for many infections in health care system, was used as the model bacterial strain. It was found that all
Energy Technology Data Exchange (ETDEWEB)
Dang, Xueping [Key Laboratory of Analytical Chemistry for Biology and Medicine (Ministry of Education), College of Chemistry and Molecular Sciences, Wuhan University, Wuhan 430072 (China); Hubei Collaborative Innovation Center for Advanced Organic Chemical Materials, Ministry of Education Key Laboratory for the Synthesis and Application of Organic Functional Molecules and College of Chemistry and Chemical Engineering, Hubei University, Wuhan 430062 (China); State Key Laboratory of Transducer Technology, Chinese Academy of Sciences, Beijing 10080 (China); Wang, Yingkai [Key Laboratory of Analytical Chemistry for Biology and Medicine (Ministry of Education), College of Chemistry and Molecular Sciences, Wuhan University, Wuhan 430072 (China); Hu, Chengguo, E-mail: cghu@whu.edu.cn [Key Laboratory of Analytical Chemistry for Biology and Medicine (Ministry of Education), College of Chemistry and Molecular Sciences, Wuhan University, Wuhan 430072 (China); State Key Laboratory of Transducer Technology, Chinese Academy of Sciences, Beijing 10080 (China); Huang, Jianlin; Chen, Huaixia; Wang, Shengfu [Hubei Collaborative Innovation Center for Advanced Organic Chemical Materials, Ministry of Education Key Laboratory for the Synthesis and Application of Organic Functional Molecules and College of Chemistry and Chemical Engineering, Hubei University, Wuhan 430062 (China); Hu, Shengshui, E-mail: sshu@whu.edu.cn [Key Laboratory of Analytical Chemistry for Biology and Medicine (Ministry of Education), College of Chemistry and Molecular Sciences, Wuhan University, Wuhan 430072 (China); State Key Laboratory of Transducer Technology, Chinese Academy of Sciences, Beijing 10080 (China)
2014-07-01
A new analogue of polydopamine (PDA), i.e., polyhydroquinone (PH{sub 2}Q), was polymerized and its surface chemistry was studied by different ways of characterization. PH{sub 2}Q was produced by the self-polymerization of H{sub 2}Q mediated by dissolved oxygen, and the self-polymerization process was strongly dependent on the type and the pH value of the buffer solutions. PH{sub 2}Q can not only achieve surface hydrophilization of different substrates like polyethylene terephthalate (PET) film, graphite strip, C{sub 12}SH/Au and wax slice, but also possess several unique properties like reversible adsorption, good solubility and low cost. These properties made PH{sub 2}Q an ideal polymeric modifier for the noncovalent functionalization of some nanomaterials. By simply grinding with PH{sub 2}Q, pristine multi-walled carbon nanotubes (MWNTs) can be readily dispersed in water with high solubility and good stability. The resulting MWNT–PH{sub 2}Q composite exhibited excellent electrochemical performance, which was employed for the simultaneous determination of dopamine (DA) and uric acid (UA). - Highlights: • Polyhydroquinone (PH{sub 2}Q) was produced by the self-polymerization of hydroquinone (H{sub 2}Q) mediated by dissolved oxygen. • PH{sub 2}Q can achieve surface hydrophilization of a variety of substrates. • PH{sub 2}Q is an ideal polymeric modifier for the functionalization of multi-walled carbon nanotubes (MWNTs). • The MWNT–PH{sub 2}Q composite can be employed for the simultaneous determination of dopamine (DA) and uric acid (UA)
A GPU-based mipmapping method for water surface visualization
Li, Hua; Quan, Wei; Xu, Chao; Wu, Yan
2018-03-01
Visualization of water surface is a hot topic in computer graphics. In this paper, we presented a fast method to generate wide range of water surface with good image quality both near and far from the viewpoint. This method utilized uniform mesh and Fractal Perlin noise to model water surface. Mipmapping technology was enforced to the surface textures, which adjust the resolution with respect to the distance from the viewpoint and reduce the computing cost. Lighting effect was computed based on shadow mapping technology, Snell's law and Fresnel term. The render pipeline utilizes a CPU-GPU shared memory structure, which improves the rendering efficiency. Experiment results show that our approach visualizes water surface with good image quality at real-time frame rates performance.
CERN exhibition a big hit in Bulgaria
2005-01-01
The first CERN exhibition in Bulgaria attracted many visitors. In the first ever CERN exhibition to be held in Bulgaria, over 1,400 visitors, many of them students and young physicists, visited the 10-day event in Sofia. The CERN mini-exhibition took place at the National Earth and Mankind Museum between 8 and 17 November. Permanently staffed by young physicists from Sofia University, there were exhibits on display about research activities at CERN, as well as four additional posters describing Bulgaria's participation. The inauguration took place on the morning of 8 November in the presence of the Vice-Minister for Science and Education, Mrs. Vanya Dobreva, and some 200 guests. A series of short speeches were followed by a visit to the exhibition. CERN's representative at the event, Ray Lewis, was then asked by Professor Matey Mateev, President of the Union of Physicists in Bulgaria, to say a few words on behalf of the Organization. Numerous journalists were also present at the inauguration. A painting enti...
“Accelerating Science” exhibition zooms to Turkey
Joannah Caborn Wengler
2012-01-01
'Accelerating Science', CERN’s travelling science outreach exhibition, has just arrived at the Middle East Technical University (METU) in Ankara, Turkey for a four-month stay there. This is the first time it has moved outside the circle of the Member States. The Turkish venue will inaugurate some new exhibits that have recently been developed by CERN’s software developers. “It’s been a very busy day,” says Bilge Demirkoz, an associate professor of physics at METU and a member of AMS-02, who had been overseeing the unloading of the lorries when we spoke to her. “As the University doesn’t have a specific exhibition space, the CERN exhibits are going to be housed in the covered tennis courts just behind the cultural and congress centre. It’s a beautiful venue, and there are plenty of parking spaces.” The University has sent invitations to the exhibition to high schools and to about 100 ...
Nieroda, Jolanta; Rybak, Andrzej; Kmita, Grzegorz; Sitarz, Maciej
2018-05-01
Metallic glasses are metallic materials, which exhibit an amorphous structure. These are mostly three or more component alloys, and some of them are magnetic metals. Materials of this kind are characterized by high electrical resistivity and at the same time exhibit very good magnetic properties (e.g. low-magnetization loss). The above mentioned properties are very useful in electrical engineering industry and this material is more and more popular as a substance for high-efficiency electrical devices production. This industry area is still evolving, and thus even higher efficiency of apparatus based on amorphous material is expected. A raw material must be carefully investigated and characterized before the main production process is started. Presented work contains results of complementary examination of amorphous metal Metglas 2605. Studies involve two ways to obtain clean and oxidized surface with high reactivity, namely degreasing followed by annealing process and plasma treatment. The amorphous metal parameters were examined by means of several techniques: surface free energy (SFE) measurements by sessile drop method, X-ray Photoelectron Spectroscopy (XPS), Scanning Electron Microscopy (SEM), X-ray Diffraction (XRD), and both ex situ and in situ Raman spectroscopy. Additionally, influence of plasma parameters on wetting properties were optimized in systematic way with Design of Experiments (DOE) method. A wide range of used methods allow to fully investigate the amorphous metal material during preliminary preparation of surface. Obtained results provide information about appropriate parameters that should be applied in order to obtain highly reactive surface with functional oxide layer on it.
Demultiplexing Surface Waves With Silicon Nanoantennas
DEFF Research Database (Denmark)
Sinev, I.; Bogdanov, A.; Komissarenko, F.
2017-01-01
We demonstrate directional launching of surface plasmon polaritons on thin gold film with a single silicon nanosphere. The directivity pattern of the excited surface waves exhibits rapid switching from forward to backward excitation within extremely narrow spectral hand (! 50 nm), which is driven...... by the mutual interference of magnetic and electric dipole moments supported by the dielectric nanoantenna....
Glass fibres reinforced polyester composites degradation monitoring by surface analysis
Energy Technology Data Exchange (ETDEWEB)
Croitoru, Catalin [“Transilvania” University of Brasov, Materials Engineering and Welding Department, Eroilor 29 Str., 500036 Brasov (Romania); Patachia, Silvia, E-mail: st.patachia@unitbv.ro [“Transilvania” University of Brasov, Product Design Environment and Mechatronics Department, Eroilor 29 Str., 500036 Brasov (Romania); Papancea, Adina [“Transilvania” University of Brasov, Product Design Environment and Mechatronics Department, Eroilor 29 Str., 500036 Brasov (Romania); Baltes, Liana; Tierean, Mircea [“Transilvania” University of Brasov, Materials Engineering and Welding Department, Eroilor 29 Str., 500036 Brasov (Romania)
2015-12-15
Highlights: • Glass fibre-reinforced polyester composites surface analysis by photographic method. • The composites are submitted to accelerated ageing by UV irradiation at 254 nm. • The UV irradiation promotes differences in the surface chemistry of the composites. • MB dye is differently adsorbed on surfaces with different degradation degrees. • Good correlation between the colouring degree and surface chemistry. - Abstract: The paper presents a novel method for quantification of the modifications that occur on the surface of different types of gel-coated glass fibre-reinforced polyester composites under artificial UV-ageing at 254 nm. The method implies the adsorption of an ionic dye, namely methylene blue, on the UV-aged composite, and computing the CIELab colour space parameters from the photographic image of the coloured composite's surface. The method significantly enhances the colour differences between the irradiated composites and the reference, in contrast with the non-coloured ones. The colour modifications that occur represent a good indicative of the surface degradation, alteration of surface hydrophily and roughness of the composite and are in good correlation with the ATR-FTIR spectroscopy and optical microscopy results. The proposed method is easier, faster and cheaper than the traditional ones.
"Big Science" exhibition at Balexert
2008-01-01
CERN is going out to meet those members of the general public who were unable to attend the recent Open Day. The Laboratory will be taking its "Big Science" exhibition from the Globe of Science and Innovation to the Balexert shopping centre from 19 to 31 May 2008. The exhibition, which shows the LHC and its experiments through the eyes of a photographer, features around thirty spectacular photographs measuring 4.5 metres high and 2.5 metres wide. Welcomed and guided around the exhibition by CERN volunteers, shoppers at Balexert will also have the opportunity to discover LHC components on display and watch films. "Fun with Physics" workshops will be held at certain times of the day. Main hall of the Balexert shopping centre, ground floor, from 9.00 a.m. to 7.00 p.m. Monday to Friday and from 10 a.m. to 6 p.m. on the two Saturdays. Call for volunteers All members of the CERN personnel are invited to enrol as volunteers to help welcom...
Liu, Yanyan; Fan, Liangdong; Cai, Yixiao; Zhang, Wei; Wang, Baoyuan; Zhu, Bin
2017-07-19
Sufficiently high oxygen ion conductivity of electrolyte is critical for good performance of low-temperature solid oxide fuel cells (LT-SOFCs). Notably, material conductivity, reliability, and manufacturing cost are the major barriers hindering LT-SOFC commercialization. Generally, surface properties control the physical and chemical functionalities of materials. Hereby, we report a Sm 3+ , Pr 3+ , and Nd 3+ triple-doped ceria, exhibiting the highest ionic conductivity among reported doped-ceria oxides, 0.125 S cm -1 at 600 °C. It was designed using a two-step wet-chemical coprecipitation method to realize a desired doping for Sm 3+ at the bulk and Pr 3+ /Nd 3+ at surface domains (abbreviated as PNSDC). The redox couple Pr 3+ /Pr 4+ contributes to the extraordinary ionic conductivity. Moreover, the mechanism for ionic conductivity enhancement is demonstrated. The above findings reveal that a joint bulk and surface doping methodology for ceria is a feasible approach to develop new oxide-ion conductors with high impacts on advanced LT-SOFCs.
"Everyone just ate good food": 'Good food' in Islamabad, Pakistan.
Hasnain, Saher
2018-08-01
In recent years, consumption of alternatively produced foods has increased in popularity in response to the deleterious effects of rapidly globalising and industrialised food systems. Concerns over food safety in relation to these changes may result from elevated levels of risk and changing perceptions associated with food production practices. This paper explores how the middle class residents of Islamabad, Pakistan, use the concept of 'good food' to reconnect themselves with nature, changing food systems, and traditional values. The paper also demonstrates how these ideas relate to those of organic, local, and traditional food consumption as currently used in more economically developed states in the Global North. Through research based on participant observation and semi-structured interviews, this paper illustrates that besides price and convenience, purity, freshness, association with specific places, and 'Pakistani-ness' were considered as the basis for making decisions about 'good food'. The results show that while individuals are aware of and have some access to imported organic and local food, they prefer using holistic and culturally informed concepts of 'good food' instead that reconnect them with food systems. I argue that through conceptualisations of 'good food', the urban middle class in Islamabad is reducing their disconnection and dis-embeddedness from nature, the food systems, and their social identities. The paper contributes to literature on food anxieties, reconnections in food geography, and 'good food' perceptions, with a focus on Pakistan. Copyright © 2018. Published by Elsevier Ltd.
Scale-adaptive surface modeling of vascular structures
Directory of Open Access Journals (Sweden)
Ma Xin
2010-11-01
Full Text Available Abstract Background The effective geometric modeling of vascular structures is crucial for diagnosis, therapy planning and medical education. These applications require good balance with respect to surface smoothness, surface accuracy, triangle quality and surface size. Methods Our method first extracts the vascular boundary voxels from the segmentation result, and utilizes these voxels to build a three-dimensional (3D point cloud whose normal vectors are estimated via covariance analysis. Then a 3D implicit indicator function is computed from the oriented 3D point cloud by solving a Poisson equation. Finally the vessel surface is generated by a proposed adaptive polygonization algorithm for explicit 3D visualization. Results Experiments carried out on several typical vascular structures demonstrate that the presented method yields both a smooth morphologically correct and a topologically preserved two-manifold surface, which is scale-adaptive to the local curvature of the surface. Furthermore, the presented method produces fewer and better-shaped triangles with satisfactory surface quality and accuracy. Conclusions Compared to other state-of-the-art approaches, our method reaches good balance in terms of smoothness, accuracy, triangle quality and surface size. The vessel surfaces produced by our method are suitable for applications such as computational fluid dynamics simulations and real-time virtual interventional surgery.
International Nuclear Information System (INIS)
1989-01-01
The course 'Transport of hazardous goods' was held in Berlin in November 1988 in cooperation with the Bundesanstalt fuer Materialforschung und -pruefung. From all lecturs, two are recorded separately: 'Safety of tank trucks - requirements on the tank, development possibiities of active and passive safety' and 'Requirements on the transport of radioactive materials - possible derivations for other hazardous goods'. The other lectures deal with hazardous goods law, requirements on packinging, risk assessment, railroad transport, hazardous goods road network, insurance matters, EC regulations, and waste tourism. (HSCH) [de
International Nuclear Information System (INIS)
Jeong, Hae-Chang; Park, Hong-Gyu; Lee, Ju Hwan; Jang, Sang Bok; Oh, Byeong-Yun; Seo, Dae-Shik
2016-01-01
We demonstrated uniform liquid crystal (LC) alignment on ion beam (IB)-irradiated poly(styrene-co-allyl alcohol) by modifying the chemical bonding on the surface. An IB-irradiated copolymer was used for the alignment layer. We used physico-chemical analysis to determine the IB-irradiated surface modification and LC alignment mechanism on the surface. During IB treatment on poly(styrene-co-allyl alcohol), IB irradiation induces breaking of chemical bonds on the surface to give rise to new bonds with oxygen atoms. This causes a strong Van der Waals interaction between LCs and the modified surface, thereby resulting in uniform LC alignment. The results of contact angle (CA) studies of the copolymer support the chemical bonding changes that were investigated by XPS. We achieved uniform homogeneous LC alignment and obtained stable electro-optical performance by controlling the IB energy. Therefore, the LC cells with IB-irradiated poly(styrene-co-allyl alcohol) exhibited a good potential for alternative alignment of layers in LC applications.
Energy Technology Data Exchange (ETDEWEB)
Jeong, Hae-Chang [Information Display Device Laboratory, Department of Electrical and Electronic Engineering, Yonsei University, 50 Yonsei-ro, Seodaemun-gu, Seoul, 120-749 (Korea, Republic of); Park, Hong-Gyu [School of Electrical, Electronic & Control Engineering, Changwon National University, 20 Changwondaehak-ro, Uichang-gu, Changwon-si, Gyeongsangnam-do, 51140 (Korea, Republic of); Lee, Ju Hwan; Jang, Sang Bok [Information Display Device Laboratory, Department of Electrical and Electronic Engineering, Yonsei University, 50 Yonsei-ro, Seodaemun-gu, Seoul, 120-749 (Korea, Republic of); Oh, Byeong-Yun [ZeSHTech Co., Ltd., Business Incubator, Gwangju Institute of Science and Technology, 123, Cheomdangwagi-ro, Buk-gu, Gwangju, 500-712 (Korea, Republic of); Seo, Dae-Shik, E-mail: dsseo@yonsei.ac.kr [Information Display Device Laboratory, Department of Electrical and Electronic Engineering, Yonsei University, 50 Yonsei-ro, Seodaemun-gu, Seoul, 120-749 (Korea, Republic of)
2016-10-01
We demonstrated uniform liquid crystal (LC) alignment on ion beam (IB)-irradiated poly(styrene-co-allyl alcohol) by modifying the chemical bonding on the surface. An IB-irradiated copolymer was used for the alignment layer. We used physico-chemical analysis to determine the IB-irradiated surface modification and LC alignment mechanism on the surface. During IB treatment on poly(styrene-co-allyl alcohol), IB irradiation induces breaking of chemical bonds on the surface to give rise to new bonds with oxygen atoms. This causes a strong Van der Waals interaction between LCs and the modified surface, thereby resulting in uniform LC alignment. The results of contact angle (CA) studies of the copolymer support the chemical bonding changes that were investigated by XPS. We achieved uniform homogeneous LC alignment and obtained stable electro-optical performance by controlling the IB energy. Therefore, the LC cells with IB-irradiated poly(styrene-co-allyl alcohol) exhibited a good potential for alternative alignment of layers in LC applications.
Characterization of D2 tool steel friction surfaced coatings over low carbon steel
International Nuclear Information System (INIS)
Sekharbabu, R.; Rafi, H. Khalid; Rao, K. Prasad
2013-01-01
Highlights: • Solid state coating by friction surfacing method. • D2 tool steel is coated over relatively softer low carbon steel. • Defect free interface between tool steel coating and low carbon steel substrate. • D2 coatings exhibited higher hardness and good wear resistance. • Highly refined martensitic microstructure in the coating. - Abstract: In this work D2 tool steel coating is produced over a low carbon steel substrate using friction surfacing process. The process parameters are optimized to get a defect free coating. Microstructural characterization is carried out using optical microscopy, scanning electron microscopy and X-ray diffraction. Infrared thermography is used to measure the thermal profile during friction surfacing of D2 steel. Wear performance of the coating is studied using Pin-on-Disk wear tests. A lower rotational speed of the consumable rod and higher translational speed of the substrate is found to result in thinner coatings. Friction surfaced D2 steel coating showed fine-grained martensitic microstructure compared to the as-received consumable rod which showed predominantly ferrite microstructure. Refinement of carbides in the coating is observed due to the stirring action of the process. The infrared thermography studies showed the peak temperature attained by the D2 coating to be about 1200 °C. The combined effect of martensitic microstructure and refined carbides resulted in higher hardness and wear resistance of the coating
Amrhein, Sven; Bauer, Katharina Christin; Galm, Lara; Hubbuch, Jürgen
2015-12-01
The surface hydrophobicity of a protein is an important factor for its interactions in solution and thus the outcome of its production process. Yet most of the methods are not able to evaluate the influence of these hydrophobic interactions under natural conditions. In the present work we have established a high resolution stalagmometric method for surface tension determination on a liquid handling station, which can cope with accuracy as well as high throughput requirements. Surface tensions could be derived with a low sample consumption (800 μL) and a high reproducibility (content. The protein influence on the solutions' surface tension was correlated to the hydrophobicity of lysozyme, human lysozyme, BSA, and α-lactalbumin. Differences in proteins' hydrophobic character depending on pH and species could be resolved. Within this work we have developed a pH dependent hydrophobicity ranking, which was found to be in good agreement with literature. For the studied pH range of 3-9 lysozyme from chicken egg white was identified to be the most hydrophilic. α-lactalbumin at pH 3 exhibited the most pronounced hydrophobic character. The stalagmometric method occurred to outclass the widely used spectrophotometric method with bromophenol blue sodium salt as it gave reasonable results without restrictions on pH and protein species. © 2015 Wiley Periodicals, Inc.
Energy Technology Data Exchange (ETDEWEB)
Tan, Yuan; Jing, Lijing; Ding, Yonghong; Wei, Tianxin, E-mail: txwei@bit.edu.cn
2015-07-01
Highlights: • The in-situ photo-grafting polymerization method was used to prepare the polymer film. • The synthesized MIF was layer stucture film. • The MIF exhibited good imprinting effect and highly selectivity. - Abstract: This work aimed to prepare a novel double-layer structure molecularly imprinted polymer film (MIF) on the surface plasmon resonance (SPR) sensor chips for detection of testosterone in aqueous media. The film was synthesized by in-situ UV photo polymerization. Firstly, the modification of gold surface of SPR chip was performed by 1-dodecanethiol. Then double-layer MIF was generated on the 1-dodecanethiol modified gold surface. The non-modified and imprinted surfaces were characterized by atomic force microscopy (AFM), fourier transform infrared (FTIR) spectroscopy and contact angle measurements. Analysis of SPR spectroscopy showed that the imprinted sensing film displayed good selectivity for testosterone compared to other analogues and the non-imprinted polymer film (NIF). Within the concentrations range of 1 × 10{sup −12}–1 × 10{sup −8} mol/L, the coupling angle changes of SPR were linear with the negative logarithm of testosterone concentrations (R{sup 2} = 0.993). Based on a signal/noise ratio of three, the detection limit was estimated to be 10{sup −12} mol/L. Finally, the developed MIF was successfully applied to the seawater detection of testosterone. The results in the experiments suggested that a combination of SPR sensing with MIF was a promising alternative method for detection of testosterone in aqueous media.
DEFF Research Database (Denmark)
Campbell, Catherine; Scott, Kerry; Skovdal, Morten
2015-01-01
, physical cleanliness, honesty, gratitude and lifestyle adaptations (taking pills correctly andcoming to the clinic when told). As healthcare workers may decide to punish patients who do not live up the‘good patient persona’, many patients seek to perform within the confines of the ‘good patient persona...
DEFF Research Database (Denmark)
Skyum, Sven
1978-01-01
This paper continues the study of ETOL forms and good EOL forms done by Maurer, Salomaa and Wood. It is proven that binary very complete ETOL forms exist, good synchronized ETOL forms exist and that no propagating or synchronized ETOL form can be very complete.......This paper continues the study of ETOL forms and good EOL forms done by Maurer, Salomaa and Wood. It is proven that binary very complete ETOL forms exist, good synchronized ETOL forms exist and that no propagating or synchronized ETOL form can be very complete....
Korsgaard, Christine M.
2014-01-01
In some recent papers I have been arguing that the concept ‘good-for’ is prior to the concept of ‘good’ (in the sense in which final ends are good), and exploring the implications of that claim. One of those implications is that everything that is good is good for someone. That implication seems to fall afoul of our intuitions about certain cases, such as the intuition that a world full of happy people and animals is better than a world full of miserable ones, even if the people and animals a...
DEFF Research Database (Denmark)
Richter, Anne
In postmodern capitalist market economies, management of the single organisation is bound to be guided by several rationales, which are in conflict with each other. For some writers this perception leads to the argument, that conceptions of management should strive towards goals beyond the present...... society. For others, the handling of plural perspectives is just a management discipline. However these positions seem to share a focus on organization as a the arena for the organization of the good. The contribution looks at the management of occupational accidents as an example of striving for good...
Private Financing of Public Goods by Means of 'Eco-Goods' Schemes
DEFF Research Database (Denmark)
Ueda, Yoshifumi; Wegener, Andreas; Svendsen, Gert Tinggaard
2010-01-01
With a view to applying to the problem of collective action for the global commons, we analyze a three-stage game model where public goods are provided by the costly leadership of a social entrepreneur for undertaking 'eco-goods' scheme. We derive (i) the conclusion that the social entrepreneur can...... finance more for the collective action under not-for-profit constraint than without the constraint, and (ii) the conditions under which he prefers the not-for-profit constraint on a rational basis. The main results are applied to some social experiments on the natural common-pools of a public-goods nature...
DEFF Research Database (Denmark)
Ylirisku, Salu; Arvola, Mattias
2018-01-01
This chapter explores the philosopher and logician Georg Henrik von Wright’s metaethical treatise of the varieties of goodness in the context of design. von Wright investigated the use of notion of ‘good’ in language, and he identified six kinds of goodness: namely utilitarian goodness, instrumen......This chapter explores the philosopher and logician Georg Henrik von Wright’s metaethical treatise of the varieties of goodness in the context of design. von Wright investigated the use of notion of ‘good’ in language, and he identified six kinds of goodness: namely utilitarian goodness...
International Nuclear Information System (INIS)
1981-01-01
This rule is established under the provisions of the regulation for the execution of the law on the prevention of radiation injuries by radioisotopes. Terms are used in this rule for the same meanings as in the regulation. The limit of the concentration of radioisotopes in the goods contaminated by these isotopes which are not required to be sealed in containers defined by the Director General of the Science and Technology Agency is 1/10,000 of the value A 2 under the notification determining the details of technical standards concerning the transport of radioisotopes or the goods contaminated by radioisotopes outside works or enterprises. The application for the permission of transporting the goods which are highly difficult to be sealed in containers shall list names and addresses, the kinds, quantities, shapes and properties of the transported goods contaminated by radioisotopes, etc. The radiation dose rate of transported goods and vehicles under the regulation is 200 milli-rem an hour on the surfaces of these goods, vehicles and containers, and 10 milli-rem an hour at the distance of 1 meter from their surfaces. The permissible exposure dose of the persons engaging in transport is 1.5 rem a year. Dangerous goods, signs, and the application for the approval of special measures are specified, respectively. (Okada, K.)
J.C.M. van den Ende (Jan); R.C. Kijkuit (Bob)
2009-01-01
textabstractManagers know that simply generating lots of ideas doesn’t necessarily produce good ones. What companies need are systems that nurture good ideas and cull bad ones—before they ever reach the decision maker’s desk. Our research shows that tapping the input of many people early in the
Effect of surfaces similarity on contact resistance of fractal rough surfaces under cyclic loading
Gao, Yuanwen; Liu, Limei; Ta, Wurui; Song, Jihua
2018-03-01
Although numerous studies have shown that contact resistance depends significantly on roughness and fractal dimension, it remains elusive how they affect contact resistance between rough surfaces. The interface similarity index is first proposed to describe the similarity of the contact surfaces, which gives a good indication of the actual contact area between surfaces. We reveal that the surfaces' similarity be an origin of contact resistance variation. The cyclic loading can increase the contact stiffness, and the contact stiffness increases with the increase of the interface similarity index. These findings explain the mechanism of surface roughness and fractal dimension on contact resistance, and also provide reference for the reliability design of the electrical connection.
Controllable wettability and morphology of electrodeposited surfaces on zinc substrates
Energy Technology Data Exchange (ETDEWEB)
Zhang, Binyan; Lu, Shixiang, E-mail: shixianglu@bit.edu.cn; Xu, Wenguo, E-mail: wenguoxu60@bit.edu.cn; Cheng, Yuanyuan
2016-01-01
Graphical abstract: Superhydrophobic surfaces combining hierarchical micro/nanostructures were fabricated on zinc substrates by etching, electrodeposition of ZnO coatings and annealing. Such superhydrophobic surfaces offer possibilities for chemical, biological, electronic and microfluidic applications. - Highlights: • Superhydrophobic surface was fabricated via electrodeposition of ZnO and annealing. • The ZnO hierarchical micro/nanostructures contribute to the surface superhydrophobicity. • Surface wettability and morphology can be controlled by varying process conditions. • The anti-icing properties and reversible wetting behaviors of the ZnO coatings were studied. - Abstract: Superhydrophobic surfaces combining hierarchical micro/nanostructures were fabricated on zinc substrates by etching in hydrochloric acid solution, electrodeposition of ZnO coatings and subsequent thermal annealing. The optimal coatings were electrodeposited at −1.25 V for 900 s on the etched zinc substrates and then annealed at 200 °C for 60 min, which could achieve a maximum water contact angle of 170 ± 2° and an ultra-low sliding angle of approximately 0°. By conducting SEM and water CA analysis, we found that the morphology and wettability of prepared samples were controllable by the fabrication process. Interestingly, even without any additional modification, the samples prepared under different electrodeposition conditions (including Zn(CH{sub 3}COO){sub 2} concentration from 5 mM to 40 mM and deposition time from 300 s to 1500 s) exhibited superhydrophobic character. The influences of the Zn(CH{sub 3}COO){sub 2} concentration, deposition time, annealing temperature and annealing time on the wetting behaviors were also discussed in detail. Such superhydrophobic surfaces possess long-term stability, and good corrosion resistance as well as self-cleaning ability. In addition, the anti-icing properties of the ZnO films were investigated. These surfaces could be rapidly and
Controllable wettability and morphology of electrodeposited surfaces on zinc substrates
International Nuclear Information System (INIS)
Zhang, Binyan; Lu, Shixiang; Xu, Wenguo; Cheng, Yuanyuan
2016-01-01
Graphical abstract: Superhydrophobic surfaces combining hierarchical micro/nanostructures were fabricated on zinc substrates by etching, electrodeposition of ZnO coatings and annealing. Such superhydrophobic surfaces offer possibilities for chemical, biological, electronic and microfluidic applications. - Highlights: • Superhydrophobic surface was fabricated via electrodeposition of ZnO and annealing. • The ZnO hierarchical micro/nanostructures contribute to the surface superhydrophobicity. • Surface wettability and morphology can be controlled by varying process conditions. • The anti-icing properties and reversible wetting behaviors of the ZnO coatings were studied. - Abstract: Superhydrophobic surfaces combining hierarchical micro/nanostructures were fabricated on zinc substrates by etching in hydrochloric acid solution, electrodeposition of ZnO coatings and subsequent thermal annealing. The optimal coatings were electrodeposited at −1.25 V for 900 s on the etched zinc substrates and then annealed at 200 °C for 60 min, which could achieve a maximum water contact angle of 170 ± 2° and an ultra-low sliding angle of approximately 0°. By conducting SEM and water CA analysis, we found that the morphology and wettability of prepared samples were controllable by the fabrication process. Interestingly, even without any additional modification, the samples prepared under different electrodeposition conditions (including Zn(CH_3COO)_2 concentration from 5 mM to 40 mM and deposition time from 300 s to 1500 s) exhibited superhydrophobic character. The influences of the Zn(CH_3COO)_2 concentration, deposition time, annealing temperature and annealing time on the wetting behaviors were also discussed in detail. Such superhydrophobic surfaces possess long-term stability, and good corrosion resistance as well as self-cleaning ability. In addition, the anti-icing properties of the ZnO films were investigated. These surfaces could be rapidly and reversibly switched
International Nuclear Information System (INIS)
Crumpton, M.J.; Marchalonis, J.J.; Haustein, D.; Atwell, J.L.; Harris, A.W.
1976-01-01
Two established techniques for analysis of plasma membranes, namely, lactoperoxidase catalyzed surface radioiodination of intact cells and bulk membrane isolation following disruption of cells by shear forces, were applied in studies of membrane proteins of continuously cultured cells of the monoclonal T lymphoma line WEHI-22. It was found that macromolecular 125 I-iodide incorporated into plasma membrane proteins of intact cells was at least as good a marker for the plasma as was the commonly used enzyme 5'-nucleotidase, T lymphoma plasma membrane proteins were complex when analysed by polyacrylamide gel electrophoresis in sodium dodecylsulphate-containing buffers and more than thirty distinct components were resolved. More than fifteen of the components observed on a mass basis were also labelled with 125 I-iodide. Certain bands, however, exhibited a degree of label disproportionate to their staining properties with Coomassie Blue. This was interpreted in terms of their accessibility to the solvent in the intact cells. (author)
Surface Adsorption in Nonpolarizable Atomic Models.
Whitmer, Jonathan K; Joshi, Abhijeet A; Carlton, Rebecca J; Abbott, Nicholas L; de Pablo, Juan J
2014-12-09
Many ionic solutions exhibit species-dependent properties, including surface tension and the salting-out of proteins. These effects may be loosely quantified in terms of the Hofmeister series, first identified in the context of protein solubility. Here, our interest is to develop atomistic models capable of capturing Hofmeister effects rigorously. Importantly, we aim to capture this dependence in computationally cheap "hard" ionic models, which do not exhibit dynamic polarization. To do this, we have performed an investigation detailing the effects of the water model on these properties. Though incredibly important, the role of water models in simulation of ionic solutions and biological systems is essentially unexplored. We quantify this via the ion-dependent surface attraction of the halide series (Cl, Br, I) and, in so doing, determine the relative importance of various hypothesized contributions to ionic surface free energies. Importantly, we demonstrate surface adsorption can result in hard ionic models combined with a thermodynamically accurate representation of the water molecule (TIP4Q). The effect observed in simulations of iodide is commensurate with previous calculations of the surface potential of mean force in rigid molecular dynamics and polarizable density-functional models. Our calculations are direct simulation evidence of the subtle but sensitive role of water thermodynamics in atomistic simulations.
Lee, Jung-Pil; Choi, Sinho; Park, Soojin
2011-01-18
We demonstrate a simple method for the fabrication of rough silicon surfaces with micro- and nanostructures, which exhibited superhydrophobic behaviors. Hierarchically rough silicon surfaces were prepared by copper (Cu)-assisted chemical etching process where Cu nanoparticles having particle size of 10-30 nm were deposited on silicon surface, depending on the period of time of electroless Cu plating. Surface roughness was controlled by both the size of Cu nanoparticles and etching conditions. As-synthesized rough silicon surfaces showed water contact angles ranging from 93° to 149°. Moreover, the hierarchically rough silicon surfaces were chemically modified by spin-coating of a thin layer of Teflon precursor with low surface energy. And thus it exhibited nonsticky and enhanced hydrophobic properties with extremely high contact angle of nearly 180°.
Coupled Oscillator Model of the Business Cycle withFluctuating Goods Markets
Ikeda, Y.; Aoyama, H.; Fujiwara, Y.; Iyetomi, H.; Ogimoto, K.; Souma, W.; Yoshikawa, H.
The sectoral synchronization observed for the Japanese business cycle in the Indices of Industrial Production data is an example of synchronization. The stability of this synchronization under a shock, e.g., fluctuation of supply or demand, is a matter of interest in physics and economics. We consider an economic system made up of industry sectors and goods markets in order to analyze the sectoral synchronization observed for the Japanese business cycle. A coupled oscillator model that exhibits synchronization is developed based on the Kuramoto model with inertia by adding goods markets, and analytic solutions of the stationary state and the coupling strength are obtained. We simulate the effects on synchronization of a sectoral shock for systems with different price elasticities and the coupling strengths. Synchronization is reproduced as an equilibrium solution in a nearest neighbor graph. Analysis of the order parameters shows that the synchronization is stable for a finite elasticity, whereas the synchronization is broken and the oscillators behave like a giant oscillator with a certain frequency additional to the common frequency for zero elasticity.
Mobile Technologies in Museum Exhibitions
Directory of Open Access Journals (Sweden)
Sandra Medić
2014-10-01
Full Text Available In order to be up–to–date and give visitors a memorable and unique experience, museums are including usage of digital technologies in their exhibitions. Even though museums in Serbia are very important part of tourism offer, they still have traditional settings that are poorly interpreted. The majority of them have a scientific and historical review which is unattractive for various target groups of visitors and for museums it’s important to continually try out new ways in interpretation of their settings. Because technology continues to rapidly change the way we communicate, cultural institutions should adapt to new ways of communication with their visitors. This paper examines mobile technologies that can be used in museums to give visitors a different experience and transfer the knowledge innovatively. In that way it will be presented the modern concept of presentation of museum exhibitions, focusing on usage of mobile devices through mobile applications and QR codes. The paper provides the broad understanding of usage mobile technologies in museum exhibitions with its advantages and limitations. The research results can help the museums management to improve interpretation and communication with visitors and enrich the visitor experience.
Entropic Repulsion Between Fluctuating Surfaces
Janke, W.
The statistical mechanics of fluctuating surfaces plays an important role in a variety of physical systems, ranging from biological membranes to world sheets of strings in theories of fundamental interactions. In many applications it is a good approximation to assume that the surfaces possess no tension. Their statistical properties are then governed by curvature energies only, which allow for gigantic out-of-plane undulations. These fluctuations are the “entropic” origin of long-range repulsive forces in layered surface systems. Theoretical estimates of these forces for simple model surfaces are surveyed and compared with recent Monte Carlo simulations.
Csikszentmihalyi, Mihaly
2003-01-01
Examines the working lives of geneticists and journalists to place into perspective what lies behind personal ethics and success. Defines "good work" as productive activity that is valued socially and loved by people engaged in it. Asserts that certain cultural values, social controls, and personal standards are necessary to maintain good work and…
Ahn, Hyun S; Bard, Allen J
2015-12-15
In surface interrogation scanning electrochemical microscopy (SI-SECM), fine and accurate control of the delay time between substrate generation and tip interrogation (tdelay) is crucial because tdelay defines the decay time of the reactive intermediate. In previous applications of the SI-SECM, the resolution in the control of tdelay has been limited to several hundreds of milliseconds due to the slow switching of the bipotentiostat. In this work, we have improved the time resolution of tdelay control up to ca. 1 μs, enhancing the SI-SECM to be competitive in the time domain with the decay of many reactive intermediates. The rapid switching SI-SECM has been implemented in a substrate generation-tip collection time-of-flight (SG-TC TOF) experiment of a solution redox mediator, and the results obtained from the experiment exhibited good agreement with that obtained from digital simulation. The reaction rate constant of surface Co(IV) on oxygen-evolving catalyst film, which was inaccessible thus far due to the lack of tdelay control, has been measured by the rapid switching SI-SECM.
Alternative surfacing materials for weed control at BC Hydro substations
International Nuclear Information System (INIS)
Wells, T.C.; Shrimpton, G.M.
1997-01-01
A two year study was conducted by BC Hydro in which a variety of surfacing materials were tested for their suitability for use in substations. Ideally, surfacing materials should have the following characteristics: high electrical resistivity in both dry and wet conditions, resistance to invasion by weeds, good driveability, good drainage, non-flammable, reasonably priced, no dust to foul conductors, and be aesthetically pleasing. Trials at Vernon Koksilah, and Ingledow substations were conducted to test the materials. A qualitative estimate of the amount of weed control provided by each material was recorded. The trials were meant to provide operational recommendations and screening information to allow for future testing of promising materials or combination of materials. Results showed that no single material meets all the desired criteria. The surfaces that best combined good weed control, electrical resistance and surface stability was a 15 cm deep layer of crushed gravel, especially if underlain by a layer of geotextile. 4 refs., 3 tabs., 1 fig
Bi, Jiajie; Fan, Genrui; Wu, Suli; Su, Xin; Xia, Hongbo; Zhang, Shu-Fen
2017-10-01
Herein, we developed a method to prepare monodisperse poly(styrene-co-maleic anhydride)@Ag (PSMA@Ag) core-shell microspheres with high surface charge intensity by using an in situ reduction method. In this method, ethylenediamine tetraacetic acid tetrasodium salt (Na 4 EDTA) was used as a reducing agent to promote the growth of Ag, and at the same time endowed the PSMA@Ag spheres with a surface charge. The monodispersity of PSMA and PSMA@Ag and the ordered array of the photonic crystal films were characterized by using SEM. The formation of Ag nanoparticles was confirmed by using TEM, HR-TEM, and XRD characterizations. Due to the existence of surface charges, the obtained PSMA@Ag microspheres easily self-assembled to form photonic crystal structures. In addition, the surface-enhanced Raman scattering (SERS) activity of the PSMA@Ag photonic crystal films was evaluated by detecting the signal from Raman probe molecules, 4-aminothiophenol (4-ATP). The PSMA@Ag photonic crystal films exhibited a high SERS effect, a low detection limit of up to 10 -8 for 4-ATP, good uniformity, and reproducibility.
Papillary Thyroid Cancer: The Good and Bad of the "Good Cancer".
Randle, Reese W; Bushman, Norah M; Orne, Jason; Balentine, Courtney J; Wendt, Elizabeth; Saucke, Megan; Pitt, Susan C; Macdonald, Cameron L; Connor, Nadine P; Sippel, Rebecca S
2017-07-01
Papillary thyroid cancer is often described as the "good cancer" because of its treatability and relatively favorable survival rates. This study sought to characterize the thoughts of papillary thyroid cancer patients as they relate to having the "good cancer." This qualitative study included 31 papillary thyroid cancer patients enrolled in an ongoing randomized trial. Semi-structured interviews were conducted with participants at the preoperative visit and two weeks, six weeks, six months, and one year after thyroidectomy. Grounded theory was used, inductively coding the first 113 interview transcripts with NVivo 11. The concept of thyroid cancer as "good cancer" emerged unprompted from 94% (n = 29) of participants, mostly concentrated around the time of diagnosis. Patients encountered this perception from healthcare providers, Internet research, friends, and preconceived ideas about other cancers. While patients generally appreciated optimism, this perspective also generated negative feelings. It eased the diagnosis of cancer but created confusion when individual experiences varied from expectations. Despite initially feeling reassured, participants described feeling the "good cancer" characterization invalidated their fears of having cancer. Thyroid cancer patients expressed that they did not want to hear that it's "only thyroid cancer" and that it's "no big deal," because "cancer is cancer," and it is significant. Patients with papillary thyroid cancer commonly confront the perception that their malignancy is "good," but the favorable prognosis and treatability of the disease do not comprehensively represent their cancer fight. The "good cancer" perception is at the root of many mixed and confusing emotions. Clinicians emphasize optimistic outcomes, hoping to comfort, but they might inadvertently invalidate the impact thyroid cancer has on patients' lives.
High Quality Virtual Reality for Architectural Exhibitions
DEFF Research Database (Denmark)
Kreutzberg, Anette
2016-01-01
This paper will summarise the findings from creating and implementing a visually high quality Virtual Reality (VR) experiment as part of an international architecture exhibition. It was the aim to represent the architectural spatial qualities as well as the atmosphere created from combining natural...... and artificial lighting in a prominent not yet built project. The outcome is twofold: Findings concerning the integration of VR in an exhibition space and findings concerning the experience of the virtual space itself. In the exhibition, an important aspect was the unmanned exhibition space, requiring the VR...... experience to be self-explanatory. Observations of different visitor reactions to the unmanned VR experience compared with visitor reactions at guided tours with personal instructions are evaluated. Data on perception of realism, spatial quality and light in the VR model were collected with qualitative...
A Salamander Tale: Effective Exhibits and Attitude Change
Rollins, Jeffrey; Watson, Sunnie Lee
2017-01-01
Little information exists regarding intention behind the design and development of Extension outreach and educational exhibits. An evaluation of response to the exhibit "A Salamander Tale" indicates that the methods used to develop the exhibit resulted in an effective way to present information to an adult audience. Survey questions were…
Manisekaran, T.; Kamaraj, M.; Sharrif, S. M.; Joshi, S. V.
2007-10-01
Hydroturbine steels, such as 13Cr-4Ni martensitic steels, are generally subjected to heavy-erosive wear and loss of efficiency due to solid particulate entrainment in the water. Surface-modified steels have proven to give better performance in terms of erosive wear resistance. In the present study, an attempt is made to investigate the effect of angle of impingement and particle size on slurry-jet erosion behavior of pulsed plasma nitrided and laser hardened 13Cr-4Ni steels. Laser hardening process has shown good performance at all angles of impingement due to martensitic transformation of retained austenite. Plastic deformation mode of material removal was also an evident feature of all laser-hardened surface damage locations. However, pulsed-plasma nitrided steels have exhibited chip formation and micro-cutting mode of erosive wear. Erosion with 150-300 μm size was twice compared to 150 μm size slurry particulates.
Knowledge Generation in Technology-Enhanced Health Exhibitions
DEFF Research Database (Denmark)
Magnussen, Rikke; Kharlamov, Nikita; Zachariasssen, Maria
2016-01-01
This paper presents results from eye-tracking studies of audience interaction and knowledge generation in the technology-enhanced health promotion exhibition PULSE at a science centre in Copenhagen, Denmark. The main purpose of the study was to understand what types of knowledge audiences build...... in health promotion exhibitions designed to include direct physical interaction. The current study is part of the larger PULSE project, which aims to develop innovative health promotion activities that include a science museum exhibition as a key setting. The primary target group is families with children...
[Corrosion resistant properties of different anodized microtopographies on titanium surfaces].
Fangjun, Huo; Li, Xie; Xingye, Tong; Yueting, Wang; Weihua, Guo; Weidong, Tian
2015-12-01
To investigate the corrosion resistant properties of titanium samples prepared by anodic oxidation with different surface morphologies. Pure titanium substrates were treated by anodic oxidation to obtain porous titanium films in micron, submicron, and micron-submicron scales. The surface morphologies, coating cross-sectional morphologies, crystalline structures, and surface roughness of these samples were characterized. Electrochemical technique was used to measure the corrosion potential (Ecorr), current density of corrosion (Icorr), and polarization resistance (Rp) of these samples in a simulated body fluid. Pure titanium could be modified to exhibit different surface morphologies by the anodic oxidation technique. The Tafel curve results showed that the technique can improve the corrosion resistance of pure titanium. Furthermore, the corrosion resistance varied with different surface morphologies. The submicron porous surface sample demonstrated the best corrosion resistance, with maximal Ecorr and Rp and minimal Icorr. Anodic oxidation technology can improve the corrosion resistance of pure titanium in a simulated body fluid. The submicron porous surface sample exhibited the best corrosion resistance because of its small surface area and thick barrier layer.
International Nuclear Information System (INIS)
Dooley, J.S.G.; Trust, T.J.
1988-01-01
The surface protein composition of members of a serogroup of Aeromonas hydrophila was examined. Immunoblotting with antiserum raised against formalinized whole cells of A. hydrophila TF7 showed a 52K S-layer protein to be the major surface protein antigen, and impermeant Sulfo-NHS-Biotin cell surface labeling showed that the 52K S-layer protein was the only protein accessible to the Sulfo-NHS-Biotin label and effectively masked underlying outer membrane (OM) proteins. In its native surface conformation the 52K S-layer protein was only weakly reactive with a lactoperoxidase 125 I surface iodination procedure. A UV-induced rough lipopolysaccharide (LPS) mutant of TF7 was found to produce an intact S layer, but a deep rough LPS mutant was unable to maintain an array on the cell surface and excreted the S-layer protein into the growth medium, indicating that a minimum LPS oligosaccharide size required for A. hydrophila S-layer anchoring. The native S layer was permeable to 125 I in the lactoperoxidase radiolabeling procedure, and two major OM proteins of molecular weights 30,000 and 48,000 were iodinated. The 48K species was a peptidoglycan-associated, transmembrane protein which exhibited heat-modifiable SDS solubilization behavior characteristic of a porin protein. A 50K major peptidoglycan-associated OM protein which was not radiolabeled exhibited similar SDS heat modification characteristics and possibly represents a second porin protein
Yuan, S J; Liu, C K; Pehkonen, S O; Bai, R B; Neoh, K G; Ting, Y P; Kang, E T
2009-01-01
A novel surface modification technique was developed to provide a copper nickel alloy (M) surface with bactericidal and anticorrosion properties for inhibiting biocorrosion. 4-(chloromethyl)-phenyl tricholorosilane (CTS) was first coupled to the hydroxylated alloy surface to form a compact silane layer, as well as to confer the surface with chloromethyl functional groups. The latter allowed the coupling of 4-vinylpyridine (4VP) to generate the M-CTS-4VP surface with biocidal functionality. Subsequent surface graft polymerization of 4VP, in the presence of benzoyl peroxide (BPO) initiator, from the M-CTS-4VP surface produced the poly(4-vinylpyridine) (P(4VP)) grafted surface, or the M-CTS-P(4VP) surface. The pyridine nitrogen moieties on the M-CTS-P(4VP) surface were quaternized with hexylbromide to produce a high concentration of quaternary ammonium groups. Each surface functionalization step was ascertained by X-ray photoelectron spectroscopy (XPS) and static water contact angle measurements. The alloy with surface-quaternized pyridinium cation groups (N+) exhibited good bactericidal efficiency in a Desulfovibrio desulfuricans-inoculated seawater-based modified Barr's medium, as indicated by viable cell counts and fluorescence microscopy (FM) images of the surface. The anticorrosion capability of the organic layers was verified by the polarization curve and electrochemical impedance spectroscopy (EIS) measurements. In comparison, the pristine (surface hydroxylated) Cu-Ni alloy was found to be readily susceptible to biocorrosion under the same environment.
Multiwalled Carbon Nanotube Deposition on Model Environmental Surfaces
Deposition of multiwalled carbon nanotubes (MWNTs) on model environmental surfaces was investigated using a quartz crystal microbalance with dissipation monitoring (QCM-D). Deposition behaviors of MWNTs on positively and negatively charged surfaces were in good agreement with Der...
Directory of Open Access Journals (Sweden)
Alexander V. Baryshev
2014-12-01
Full Text Available A one-dimensional photonic crystal (PhC with termination by a metal film—a plasmonic photonic-crystal slab—has been theoretically analyzed for its optical response at a variation of the dielectric permittivity of an analyte and at a condition simulating the molecular binding event. Visualization of the Bloch surface wave resonance (SWR was done with the aid of plasmon absorption in a dielectric/metal/dielectric sandwich terminating a PhC. An SWR peak in spectra of such a plasmonic photonic crystal (PPhC slab comprising a noble or base metal layer was shown to be sensitive to a negligible variation of refractive index of a medium adjoining to the slab. As a consequence, the considered PPhC-based optical sensors exhibited an enhanced sensitivity and a good robustness in comparison with the conventional surface-plasmon and Bloch surface wave sensors. The PPhC biosensors can be of practical importance because the metal layer is protected by a capping dielectric layer from contact with analytes and, consequently, from deterioration.
Bioinspired surface functionalization of metallic biomaterials.
Su, Yingchao; Luo, Cheng; Zhang, Zhihui; Hermawan, Hendra; Zhu, Donghui; Huang, Jubin; Liang, Yunhong; Li, Guangyu; Ren, Luquan
2018-01-01
Metallic biomaterials are widely used for clinical applications because of their excellent mechanical properties and good durability. In order to provide essential biofunctionalities, surface functionalization is of particular interest and requirement in the development of high-performance metallic implants. Inspired by the functional surface of natural biological systems, many new designs and conceptions have recently emerged to create multifunctional surfaces with great potential for biomedical applications. This review firstly introduces the metallic biomaterials, important surface properties, and then elaborates some strategies on achieving the bioinspired surface functionalization for metallic biomaterials. Copyright © 2017 Elsevier Ltd. All rights reserved.
Tuning surface porosity on vanadium surface by low energy He{sup +} ion irradiation
Energy Technology Data Exchange (ETDEWEB)
Tripathi, J.K., E-mail: jtripat@purdue.edu; Novakowski, T.J.; Hassanein, A.
2016-08-15
Highlights: • Surface nanostructuring on vanadium surface using novel He{sup +} ion irradiation process. • Tuning surface-porosity using high-flux, low-energy He{sup +} ion irradiation at constant elevated sample temperature (823–173 K). • Presented top-down approach guarantees good contact between different crystallites. • Sequential significant enhancement in surface-pore edge size (and corresponding reduction in surface-pore density) with increasing sample temperature. - Abstract: In the present study, we report on tuning the surface porosity on vanadium surfaces using high-flux, low-energy He{sup +} ion irradiation as function of sample temperature. Polished, mirror-finished vanadium samples were irradiated with 100 eV He{sup +} ions at a constant ion-flux of 7.2 × 10{sup 20} ions m{sup −2} s{sup −1} for 1 h duration at constant sample temperatures in the wide range of 823–1173 K. Our results show that the surface porosity of V{sub 2}O{sub 5} (naturally oxidized vanadium porous structure, after taking out from UHV) is strongly correlated to the sample temperature and is highly tunable. In fact, the surface porosity significantly increases with reducing sample temperature and reaches up to ∼87%. Optical reflectivity on these highly porous V{sub 2}O{sub 5} surfaces show ∼0% optical reflectivity at 670 nm wavelength, which is very similar to that of “black metal”. Combined with the naturally high melting point of V{sub 2}O{sub 5}, this very low optical reflectivity suggests potential application in solar power concentration technology. Additionally, this top-down approach guarantees relatively good contact between the different crystallites and avoids electrical conductivity limitations (if required). Since V{sub 2}O{sub 5} is naturally a potential photocatalytic material, the resulting sub-micron-sized cube-shaped porous structures could be used in solar water splitting for hydrogen production in energy applications.
Ye, Lijun; Guan, Jipeng; Li, Zhixiang; Zhao, Jingxin; Ye, Cuicui; You, Jichun; Li, Yongjin
2017-02-14
A facile and versatile strategy for fabricating superhydrophobic surfaces with controllable electrical conductivity and water adhesion is reported. "Vine-on-fence"-structured and cerebral cortex-like superhydrophobic surfaces are constructed by filtering a suspension of multiwalled carbon nanotubes (MWCNTs), using polyoxymethylene nonwovens as the filter paper. The nonwovens with micro- and nanoporous two-tier structures act as the skeleton, introducing a microscale structure. The MWCNTs act as nanoscale structures, creating hierarchical surface roughness. The surface topography and the electrical conductivity of the superhydrophobic surfaces are controlled by varying the MWCNT loading. The vine-on-fence-structured surfaces exhibit "sticky" superhydrophobicity with high water adhesion. The cerebral cortex-like surfaces exhibit self-cleaning properties with low water adhesion. The as-prepared superhydrophobic surfaces are chemically resistant to acidic and alkaline environments of pH 2-12. They therefore have potential in applications such as droplet-based microreactors and thin-film microextraction. These findings aid our understanding of the role that surface topography plays in the design and fabrication of superhydrophobic surfaces with different water-adhesion properties.
Surface-enhanced Raman scattering biosensor for DNA detection on nanoparticle island substrates
DEFF Research Database (Denmark)
Yuan, Scott Wu; Ho, Ho Pui; Lee, Rebecca K.Y.
2009-01-01
We present a study on the surface-enhanced Raman scattering (SERS) properties of Ag nanoparticle island substrates (NIS) and their applications for target oligonucleotide (OND) detection. It has been found that the surface nanostructure of NIS samples can be controlled with a good degree of repro......We present a study on the surface-enhanced Raman scattering (SERS) properties of Ag nanoparticle island substrates (NIS) and their applications for target oligonucleotide (OND) detection. It has been found that the surface nanostructure of NIS samples can be controlled with a good degree...
77 FR 31909 - Culturally Significant Objects Imported for Exhibition
2012-05-30
... exhibition ``50th Anniversary Remembrance of the Tragedy at Orly,'' imported from abroad by the High Museum of Art for temporary exhibition within the United States, is of cultural significance. The object is... exhibition or display of the exhibit object at the High Museum of Art in Atlanta, Georgia from on or about...
Veracity in big data: How good is good enough.
Reimer, Andrew P; Madigan, Elizabeth A
2018-01-01
Veracity, one of the five V's used to describe big data, has received attention when it comes to using electronic medical record data for research purposes. In this perspective article, we discuss the idea of data veracity and associated concepts as it relates to the use of electronic medical record data and administrative data in research. We discuss the idea that electronic medical record data are "good enough" for clinical practice and, as such, are "good enough" for certain applications. We then propose three primary issues to attend to when establishing data veracity: data provenance, cross validation, and context.
Covalent Attachment of Bent-Core Mesogens to Silicon Surfaces
Scheres, L.; Achten, R.; Giesbers, M.; Smet, de L.; Arafat, A.; Sudhölter, E.J.R.; Marcelis, A.T.M.; Zuilhof, H.
2009-01-01
Two vinyl-terminated bent core-shaped liquid crystalline molecules that exhibit thermotropic antiferroelectric SmCPA phases have been covalently attached onto a hydrogen-terminated silicon(111) surface. The surface attachment was achieved via a mild procedure from a mesitylene solution, using
Surface modification for interaction study with bacteria and preosteoblast cells
Song, Qing
Surface modification plays a pivotal role in bioengineering. Polymer coatings can provide biocompatibility and biofunctionalities to biomaterials through surface modification. In this dissertation, initiated chemical vapor deposition (iCVD) was utilized to coat two-dimensional (2D) and three-dimensional (3D) substrates with differently charged polyelectrolytes in order to generate antimicrobial and osteocompatible biomaterials. ICVD is a modified CVD technique that enables surface modification in an all-dry condition without substrate damage and solvent contamination. The free-radical polymerization allows the vinyl polymers to conformally coat on various micro- and nano-structured substrates and maintains the delicate structure of the functional groups. The vapor deposition of polycations provided antimicrobial activity to planar and porous substrates through destroying the negatively charged bacterial membrane and brought about high contact-killing efficiency (99.99%) against Gram-positive Bacillus subtilis and Gram-negative Escherichia coli. Additionally, the polyampholytes synthesized by iCVD exhibited excellent antifouling performance against the adhesion of Gram-positive Listeria innocua and Gram-negative E. coli in phosphate buffered saline (PBS). Their antifouling activities were attributed to the electrostatic interaction and hydration layers that served as physical and energetic barriers to prevent bacterial adhesion. The contact-killing and antifouling polymers synthesized by iCVD can be applied to surface modification of food processing equipment and medical devices with the aim of reducing foodborne diseases and medical infections. Moreover, the charged polyelectrolyte modified 2D polystyrene surfaces displayed good osteocompatibility and enhanced osteogenesis of preosteoblast cells than the un-modified polystyrene surface. In order to promote osteoinduction of hydroxyapatite (HA) scaffolds, bioinspired polymer-controlled mineralization was conducted
Directory of Open Access Journals (Sweden)
Ana Isabel Silva-Dias
2015-03-01
Full Text Available We have performed the characterization of the adhesion profile, biofilm formation, cell surface hydrophobicity (CSH and antifungal susceptibility of 184 Candida clinical isolates obtained from different human reservoirs. Adhesion was quantified using a flow cytometric assay and biofilm formation was evaluated using two methodologies: XTT and crystal violet assay. CSH was quantified with the microbial adhesion to hydrocarbons test while planktonic susceptibility was assessed accordingly the CLSI protocol for yeast M27-A3 S4.Yeast cells of non-albicans species exhibit increased ability to adhere and form biofilm. However the correlation between adhesion and biofilm formation varied according to species and also with the methodology used for biofilm assessment. No association was found between strain´s site of isolation or planktonic antifungal susceptibility and adhesion or biofilm formation. Finally CSH seemed to be a good predictor for biofilm formation but not for adhesion.Despite the marked variability registered intra and inter species, C. tropicalis and C. parapsilosis were the species exhibiting high adhesion profile. C. tropicalis, C. guilliermondii and C. krusei revealed higher biofilm formation values in terms of biomass. C. parapsilosis was the species with lower biofilm metabolic activity.
Silva-Dias, Ana; Miranda, Isabel M; Branco, Joana; Monteiro-Soares, Matilde; Pina-Vaz, Cidália; Rodrigues, Acácio G
2015-01-01
We have performed the characterization of the adhesion profile, biofilm formation, cell surface hydrophobicity (CSH) and antifungal susceptibility of 184 Candida clinical isolates obtained from different human reservoirs. Adhesion was quantified using a flow cytometric assay and biofilm formation was evaluated using two methodologies: XTT and crystal violet assay. CSH was quantified with the microbial adhesion to hydrocarbons test while planktonic susceptibility was assessed accordingly the CLSI protocol for yeast M27-A3 S4. Yeast cells of non-albicans species exhibit increased ability to adhere and form biofilm. However, the correlation between adhesion and biofilm formation varied according to species and also with the methodology used for biofilm assessment. No association was found between strain's site of isolation or planktonic antifungal susceptibility and adhesion or biofilm formation. Finally CSH seemed to be a good predictor for biofilm formation but not for adhesion. Despite the marked variability registered intra and inter species, C. tropicalis and C. parapsilosis were the species exhibiting high adhesion profile. C. tropicalis, C. guilliermondii, and C. krusei revealed higher biofilm formation values in terms of biomass. C. parapsilosis was the species with lower biofilm metabolic activity.
Education or business? - exhibition of human corpses
Directory of Open Access Journals (Sweden)
Grzegorz Wróbel
2017-09-01
Full Text Available Exhibition "BODY WORLDS" which are presented exhibits of human remains are presented all over the world and are a major problem for the modern man, as presented on the preparations of the human not only serve scientific research, are not transferred to the medical schools to educate future doctors, but they were made available to the general public in the form of commercial and ambiguous. The aim of this study was to assess the ethical commercialization of human corpses "BODY WORLDS" exhibitions. Individual approach to the problems presented the dignity and value of human remains after death, of course, strongly related to the professed worldview. In the exhibits can be seen in both the scientific interest anatomical structures, as well as desecrated human remains or beautiful by its functional perfection of the body, understood also in terms of art. The question of ethics determines the right to decide for themselves, on the other hand, allows you to protect bodily integrity even after death. "BODY WORLDS" exhibition goes for the moral and ethical boundaries. In terms of people Gunther von Hagens for plastination of human remains which became a very profitable business, and its current activities defined as "plastination business" should be firmly said about the lack of moral principles.
A Good Suit Beats a Good Idea.
Machiavelli, Nick
1992-01-01
Inspired by Niccolo Machiavelli, this column offers beleaguered school executives advice on looking good, dressing well, losing weight, beating the proper enemy, and saying nothing. Administrators who follow these simple rules should have an easier life, jealous colleagues, well-tended gardens, and respectful board members. (MLH)
Medan Convention & Exhibition Center (Arsitektur Ekspresionisme)
Iskandar, Nurul Auni
2015-01-01
Medan is one of the third largest city in Indonesia, which is currently being developed, and a city with lots of activities. In the city of Medan has a high investment opportunities for a convention, because of its strategic position in Southeast Asia and also supported by the facility and the potential for tourism in North Sumatra, Medan city has the potential for industrial MICE (Meeting, Incentive, Conference, Exhibition). The construction of Medan Convention & Exhibition Cente...
Sheth-Shah, Radhika; Vernon, Amanda J; Seetharaman, Shankar; Neale, Michael H; Daniels, Julie T
2016-04-01
In the past decade, stem cell therapy has been increasingly employed for the treatment of various diseases. Subsequently, there has been a great interest in the manufacture of stem cells under good manufacturing practice, which is required by law for their use in humans. The cells for sight Stem Cell Therapy Research Unit, based at UCL Institute of Ophthalmology, delivers somatic cell-based and tissue-engineered therapies to patients suffering from blinding eye diseases at Moorfields Eye Hospital (London, UK). The following article is based on our experience in the conception, design, construction, validation and manufacturing within a good manufacturing practice manufacturing facility based in the UK. As such the regulations can be extrapolated to the 28 members stated within the EU. However, the principles may have a broad relevance outside the EU.
International Nuclear Information System (INIS)
Mashazi, Philani N.; Westbroek, Philippe; Ozoemena, Kenneth I.; Nyokong, Tebello
2007-01-01
Surface chemistry and electrocatalytic properties of self-assembled monolayers of metal tetra-carboxylic acid phthalocyanine complexes with cobalt (Co), iron (Fe) and manganese (Mn) as central metal ions have been studied. These phthalocyanine molecules are immobilized on gold electrode via the coupling reaction between the ring substituents and pre-formed mercaptoethanol self-assembled monolayer (Au-ME SAM). X-ray photoelectron spectroscopy (XPS) and Raman spectroscopy confirmed chemisorption of mercaptoethanol via sulfur group on gold electrode and also coupling reaction between phthalocyanines and Au-ME SAM. Electrochemical parameters of the immobilized molecules show that these molecules are densely packed with a perpendicular orientation. The potential applications of the gold modified electrodes were investigated towards L-cysteine detection and the analysis at phthalocyanine SAMs. Cobalt and iron tetra-carboxylic acid phthalocyanine monolayers showed good oxidation peak for L-cysteine at potentials where metal oxidation (M III /M II ) takes place and this metal oxidation mediates the catalytic oxidation of L-cysteine. Manganese tetra-carboxylic acid phthalocyanine monolayer also exhibited a good catalytic oxidation peak towards L-cysteine at potentials where Mn IV /Mn III redox peak occurs and this redox peak mediates L-cysteine oxidation. The analysis of cysteine at phthalocyanine monolayers displayed good analytical parameters with good detection limits of the orders of 10 -7 mol L -1 and good linearity for a studied concentration range up to 60 μmol L -1
A Heuristic for Improving Transmedia Exhibition Experience
DEFF Research Database (Denmark)
Selvadurai, Vashanth; Rosenstand, Claus Andreas Foss
2017-01-01
in the scientific field of designing transmedia experience in an exhibition context that links the pre- and post-activities to the actual visit (during-activities). The result of this study is a preliminary heuristic for establishing a relation between the platform and content complexity in transmedia exhibitions....
Friction surfaced Stellite6 coatings
International Nuclear Information System (INIS)
Rao, K. Prasad; Damodaram, R.; Rafi, H. Khalid; Ram, G.D. Janaki; Reddy, G. Madhusudhan; Nagalakshmi, R.
2012-01-01
Solid state Stellite6 coatings were deposited on steel substrate by friction surfacing and compared with Stellite6 cast rod and coatings deposited by gas tungsten arc and plasma transferred arc welding processes. Friction surfaced coatings exhibited finer and uniformly distributed carbides and were characterized by the absence of solidification structure and compositional homogeneity compared to cast rod, gas tungsten arc and plasma transferred coatings. Friction surfaced coating showed relatively higher hardness. X-ray diffraction of samples showed only face centered cubic Co peaks while cold worked coating showed hexagonally close packed Co also. - Highlights: ► Stellite6 used as coating material for friction surfacing. ► Friction surfaced (FS) coatings compared with casting, GTA and PTA processes. ► Finer and uniformly distributed carbides in friction surfaced coatings. ► Absence of melting results compositional homogeneity in FS Stellite6 coatings.
CERN exhibition wins yet another design prize
Joannah Caborn Wengler
2012-01-01
The “Universe of Particles” exhibition in CERN’s Globe wins the silver design prize from the German direct business communications association FAMAB. Not only do tens of thousands of people visit the “Universe of Particles” exhibition each year, but juries for design prizes are crossing its threshold more and more frequently too. In 2011 alone it claimed 8 awards, including winning outright the 2011 Annual Multimedia award, the iF Communication Design for Corporate Architecture award and the Modern Decoration Media award (the Bulletin already reported on some of these in July 2011). The FAMAB award is the latest to join the prestigious list. The jury of FAMAB’s “ADAM 2011” award was particularly impressed by the hands-on nature of the exhibition, which encourages visitors to get interested in science. They also appreciated the way that the space in the Globe is not just a container for the exhibits, but itself ...
Dutch hi-tech companies exhibit at CERN
Roberto Cantoni
2010-01-01
Twenty-seven Dutch companies will present the state of the art of their technological developments at the industrial exhibition Holland @ CERN from 8 to 11 November. The exhibition is designed to help strengthen the ties between fundamental science and Dutch industry. The exhibition, supported by the Dutch Ministry of Economic Affairs and organised by the Netherlands National Institute for Subatomic Physics (Nikhef), in cooperation with the Foundation for Fundamental Research on Matter (FOM), the FOM Institute for Plasma Physics Rijnhuizen, and Dutch Scientific, an association of manufacturers of scientific equipment, will be held in the Main Building from 8 to11 November. “The last Holland @ CERN exhibition took place fifteen years ago”, says Robert Klöpping from Nikhef, Dutch Industrial Liaison Officer for CERN and Purchasing Advisor for Grenoble ESRF. “This kind of event is very important for Dutch industry as it allows us to show what Dutch companies c...
Liu, Yang; Wu, Yuanhao; Bian, Dong; Gao, Shuang; Leeflang, Sander; Guo, Hui; Zheng, Yufeng; Zhou, Jie
2017-10-15
Novel Mg-(3.5, 6.5wt%)Li-(0.5, 2, 4wt%)Zn ternary alloys were developed as new kinds of biodegradable metallic materials with potential for stent application. Their mechanical properties, degradation behavior, cytocompatibility and hemocompatibility were studied. These potential biomaterials showed higher ultimate tensile strength than previously reported binary Mg-Li alloys and ternary Mg-Li-X (X=Al, Y, Ce, Sc, Mn and Ag) alloys. Among the alloys studied, the Mg-3.5Li-2Zn and Mg-6.5Li-2Zn alloys exhibited comparable corrosion resistance in Hank's solution to pure magnesium and better corrosion resistance in a cell culture medium than pure magnesium. Corrosion products observed on the corroded surface were composed of Mg(OH) 2 , MgCO 3 and Ca-free Mg/P inorganics and Ca/P inorganics. In vitro cytotoxicity assay revealed different behaviors of Human Umbilical Vein Endothelial Cells (HUVECs) and Human Aorta Vascular Smooth Muscle Cells (VSMCs) to material extracts. HUVECs showed increasing nitric oxide (NO) release and tolerable toxicity, whereas VSMCs exhibited limited decreasing viability with time. Platelet adhesion, hemolysis and coagulation tests of these Mg-Li-Zn alloys showed different degrees of activation behavior, in which the hemolysis of the Mg-3.5Li-2Zn alloy was lower than 5%. These results indicated the potential of the Mg-Li-Zn alloys as good candidate materials for cardiovascular stent applications. Mg-Li alloys are promising as absorbable metallic biomaterials, which however have not received significant attention since the low strength, controversial corrosion performance and the doubts in Li toxicity. The Mg-Li-Zn alloy in the present study revealed much improved mechanical properties higher than most reported binary Mg-Li and ternary Mg-Li-X alloys, with superior corrosion resistance in cell culture media. Surprisingly, the addition of Li and Zn showed increased nitric oxide release. The present study indicates good potential of Mg-Li-Zn alloy as
A material based approach to creating wear resistant surfaces for hot forging
Babu, Sailesh
Tools and dies used in metal forming are characterized by extremely high temperatures at the interface, high local pressures and large metal to metal sliding. These harsh conditions result in accelerated wear of tooling. Lubrication of tools, done to improve metal flow drastically quenches the surface layers of the tools and compounds the tool failure problem. This phenomenon becomes a serious issue when parts forged at complex and are expected to meet tight tolerances. Unpredictable and hence uncontrolled wear and degradation of tooling result in poor part quality and premature tool failure that result in high scrap, shop downtime, poor efficiency and high cost. The objective of this dissertation is to develop a computer-based methodology for analyzing the requirements hot forging tooling to resist wear and plastic deformation and wear and predicting life cycle of forge tooling. Development of such is a system is complicated by the fact that wear and degradation of tooling is influenced by not only the die material used but also numerous process controls like lubricant, dilution ratio, forging temperature, equipment used, tool geometries among others. Phenomenological models available u1 the literature give us a good thumb rule to selecting materials but do not provide a way to evaluate pits performance in field. Once a material is chosen, there are no proven approaches to create surfaces out of these materials. Coating approaches like PVD and CVD cannot generate thick coatings necessary to withstand the conditions under hot forging. Welding cannot generate complex surfaces without several secondary operations like heat treating and machining. If careful procedures are not followed, welds crack and seldom survive forging loads. There is a strong need for an approach to selectively, reliably and precisely deposit material of choice reliably on an existing surface which exhibit not only good tribological properties but also good adhesion to the substrate
Electronic structure and optical properties of N vacancy and O filling on n-GaN (0001) surface
Lu, Feifei; Liu, Lei; Xia, Sihao; Diao, Yu; Feng, Shu
2018-06-01
In the X-ray photoelectron spectroscopy experiment, we observed that the valence band spectrum of the n-GaN (0001) surface appeared a bump near 1.9 eV after Ar etching and the N/Ga ratio became smaller, while the bump disappeared upon exposure to air. In order to analyze this phenomenon theoretically, we mainly study the electronic structure and optical properties of n-GaN (0001) surface with N vacancy and filled with O atom based on the first principles of density functional theory. The results suggest that the n-GaN (0001) surface exhibits semi-metallic property. The introduction of N vacancy reduces the n-type conductivity, whereas the filling of O atom enhances conductivity. The density of state near -1.9eV shows a good agreement between the clean n-type surface and the O-atom-filled surface, while the N vacancy surface has a higher density of states, which is similar to the experimentally observed phenomenon. It is also found that the existence of N vacancy reduces the photoemission properties of the n-GaN (0001) surface and the filling of O atom alleviates the defect caused by vacancy. This study shows that N vacancy increases the doping difficulty of n-type GaN films, however, the filling of O atom may compensate for the diminished photoelectric properties induced by N vacancy and be conducive to prepare high-performance optoelectronic devices with the contact of n-GaN and metal.
Metrology of nanosize biopowders using porous silicon surface
International Nuclear Information System (INIS)
Zhuravel', L.V.; Latukhina, N.V.; Pisareva, E.V.; Vlasov, M.Yu.; Volkov, A.V.; Volodkin, B.O.
2008-01-01
Powders of hydroxyapatite deposited on porous silicon surface were investigated by TEM and STM methods. Thickness of porous lay was 1-100 micrometers; porous diameter was 0.01-10 micrometers. Images of porous silicon surface with deposited particles give possibility to estimate particles size and induce that only proportionate porous diameter particles have good adhesion to porous silicon surface.
Energy Technology Data Exchange (ETDEWEB)
Cui, Wenfang [Key Laboratory for Anisotropy and Texture of Materials (Ministry of Education), School of Material Science and Engineering, Northeastern University, Shenyang 110819 (China); Qin, Gaowu, E-mail: qingw@smm.neu.edu.cn [Key Laboratory for Anisotropy and Texture of Materials (Ministry of Education), School of Material Science and Engineering, Northeastern University, Shenyang 110819 (China); Duan, Jingzhu; Wang, Huan [Spinal surgery, Shengjing Hospital, China Medical University, Shenyang 110004 (China)
2017-02-01
In order to solve wear resistance of Ti alloy biomaterials, the concept of a graded nano-TiN coating has been proposed. The coating was prepared on Ti-6Al-4V bio-alloy by DC reactive magnetron sputtering. The wear performance of the coated specimens was measured in Hank's solution under the load of 10 N, and the biocompatibility was evaluated according to ISO-10993-4 standard. The results show that the gradient coating exhibits a gradual change in compositions and microstructures along the direction of film growth. Nano-TiN with the size of several to dozens nanometers and Ti{sub 4}N{sub 3−x} transitional phase with variable composition form a graded composite structure, which significantly improves adhesion strength (L{sub c1} = 80 N, L{sub c2} = 120 N), hardness (21 GPa) and anti-wear performance (6.2 × 10{sup −7} mm{sup 3}/Nm). The excellent bonding and wear resistance result from a good match of mechanical properties at substrate/coating interface and the strengthening and toughening effects of the nanocrystalline composite. The nano-TiN coating has also been proved to have good biocompatibility through in-vitro cytotoxicity, hemocompatibility and general toxicity tests. And thus, the proposed graded nano-TiN coating is a good candidate improving wear resistance of many implant medical devices. - Highlights: • A graded nano-TiN coating was prepared on biomedical Ti alloy by PVD. • The combination of hard and soft phase increases hardness and toughness. • The coating exhibits high bonding, low coefficient of friction and wear rate. • The new coating has good bio-safety and great clinical application prospect.
Energy Technology Data Exchange (ETDEWEB)
Yang, Shih-Ping [Department of Materials Science and Engineering, National Cheng Kung University, Tainan, Taiwan (China); Lee, Tzer-Min, E-mail: tmlee@mail.ncku.edu.tw [Institute of Oral Medicine, National Cheng Kung University, Tainan, Taiwan (China); School of Dentistry, Kaohsiung Medical University, Kaohsiung, Taiwan (China); Lui, Truan-Sheng [Department of Materials Science and Engineering, National Cheng Kung University, Tainan, Taiwan (China)
2015-08-15
Graphical abstract: - Highlights: • Sr-containing coating prepared by plasma spraying and micro-arc oxidation process, respectively. • MAO coating stimulated high ECM-like structures of cells on early stage. • Sr-containing specimens had high cell responses on late stage. • Sr-MAO coating is a desirable implant surface treatment for clinical applications. - Abstract: An implant requires a suitable surface to trigger osteointegration. The surface characteristics and chemical composition are important factors in this process. Plasma spraying and micro-arc oxidation can be used to fabricate rough and porous structures for medical applications. Strontium (Sr) has been shown to prevent osteoporosis in vitro and in vivo. However, few scientists have evaluated the biological response of Sr-containing coatings on different surface treatments. In this study, a sand-blasted (SB) surface (as the control), plasma-sprayed hydroxyapatite (HA) and Sr-substituted HA coatings (HAPS and SrHAPS, respectively), calcium phosphate and Sr-containing calcium phosphate micro-arc oxidation surface (CPM and SrCPM, respectively) were analyzed in terms of human osteoblastic cell (MG63) response. Sr was confirmed to be incorporated into the surface. SrHAPS and SrCPM specimens had higher cell responses than those of the HAPS and CPM groups, respectively. The cells cultured on SrCPM and SrHAPS specimens exhibited high proliferation and differentiation. However, CPM and SrCPM specimens stimulated more ECM-like structures than other specimens. The results show that Sr-containing coatings have good characteristics that enhance cell response. The SrCPM coating is a suitable implant surface treatment for clinical applications.
International Nuclear Information System (INIS)
Yang, Shih-Ping; Lee, Tzer-Min; Lui, Truan-Sheng
2015-01-01
Graphical abstract: - Highlights: • Sr-containing coating prepared by plasma spraying and micro-arc oxidation process, respectively. • MAO coating stimulated high ECM-like structures of cells on early stage. • Sr-containing specimens had high cell responses on late stage. • Sr-MAO coating is a desirable implant surface treatment for clinical applications. - Abstract: An implant requires a suitable surface to trigger osteointegration. The surface characteristics and chemical composition are important factors in this process. Plasma spraying and micro-arc oxidation can be used to fabricate rough and porous structures for medical applications. Strontium (Sr) has been shown to prevent osteoporosis in vitro and in vivo. However, few scientists have evaluated the biological response of Sr-containing coatings on different surface treatments. In this study, a sand-blasted (SB) surface (as the control), plasma-sprayed hydroxyapatite (HA) and Sr-substituted HA coatings (HAPS and SrHAPS, respectively), calcium phosphate and Sr-containing calcium phosphate micro-arc oxidation surface (CPM and SrCPM, respectively) were analyzed in terms of human osteoblastic cell (MG63) response. Sr was confirmed to be incorporated into the surface. SrHAPS and SrCPM specimens had higher cell responses than those of the HAPS and CPM groups, respectively. The cells cultured on SrCPM and SrHAPS specimens exhibited high proliferation and differentiation. However, CPM and SrCPM specimens stimulated more ECM-like structures than other specimens. The results show that Sr-containing coatings have good characteristics that enhance cell response. The SrCPM coating is a suitable implant surface treatment for clinical applications
Directory of Open Access Journals (Sweden)
Nan-Fu Chiu
2013-12-01
Full Text Available We report a novel design wherein high-refractive-index zinc oxide (ZnO intermediary layers are used in anti-symmetrically structured surface plasmon resonance (SPR devices to enhance signal quality and improve the full width at half maximum (FWHM of the SPR reflectivity curve. The surface plasmon (SP modes of the ZnO intermediary layer were excited by irradiating both sides of the Au film, thus inducing a high electric field at the Au/ZnO interface. We demonstrated that an improvement in the ZnO (002 crystal orientation led to a decrease in the FWHM of the SPR reflectivity curves. We optimized the design of ZnO thin films using different parameters and performed analytical comparisons of the ZnO with conventional chromium (Cr and indium tin oxide (ITO intermediary layers. The present study is based on application of the Fresnel equation, which provides an explanation and verification for the observed narrow SPR reflectivity curve and optical transmittance spectra exhibited by (ZnO/Au, (Cr/Au, and (ITO/Au devices. On exposure to ethanol, the anti-symmetrically structured showed a huge electric field at the Au/ZnO interface and a 2-fold decrease in the FWHM value and a 1.3-fold larger shift in angle interrogation and a 4.5-fold high-sensitivity shift in intensity interrogation. The anti-symmetrically structured of ZnO intermediate layers exhibited a wider linearity range and much higher sensitivity. It also exhibited a good linear relationship between the incident angle and ethanol concentration in the tested range. Thus, we demonstrated a novel and simple method for fabricating high-sensitivity, high-resolution SPR biosensors that provide high accuracy and precision over relevant ranges of analyte measurement.
International Nuclear Information System (INIS)
Leong, Kah Hon; Gan, Bee Ling; Ibrahim, Shaliza; Saravanan, Pichiah
2014-01-01
Graphical abstract: - Highlights: • Ag/TiO 2 was synthesized with aid of natural photon stimulated photoreduction. • Deposited Ag prompted well the LSPRs, Schottky barrier for visible light utilization. • Photocatalytic activity was evaluated by degrading EDCs under visible light. • 3.0 wt% Ag/TiO 2 resulted with good photocatalytic efficiency over others. - Abstract: Surface deposition of silver nanoparticles (Ag NPs) onto the 100% anatase titania (Ag/TiO 2 ) for evolution of surface plasmon resonance (SPR) was achieved sustainably with the assistance of solar energy. The preparation resulted in Ag/TiO 2 photocatalyst with varied Ag depositions (0.5 wt%, 1.0 wt%, 3.0 wt% and 5.0 wt%). All obtained photocatalysts were characterized for the evolution of SPR via crystalline phase analysis, morphology, lattice fringes, surface area and pore size characteristics, chemical composition with chemical and electronic state, Raman scattering, optical and photoluminescence properties. The deposition of synthesized Ag NPs exhibited high uniformity and homogeneity and laid pathway for effective utilization of the visible region of electromagnetic spectrum through SPR. The depositions also lead for suppressing recombination rates of electron–hole. The photocatalytic evaluation was carried out by adopting two different class of endocrine disturbing compound (EDC) i.e., amoxicillin (pharmaceutical) and 2,4-dichlorophenol (pesticide) excited with artificial visible light source. Ag/TiO 2 with Ag > 0.5 wt% exhibited significant degradation efficiency for both amoxicillin and 2,4-dichlorophenol. Thus synthesized Ag/TiO 2 revealed the implication of plasmonics on TiO 2 for the enhanced visible light photocatalytic activity
Structure in a confined smectic liquid crystal with competing surface and sample elasticities
International Nuclear Information System (INIS)
Idziak, S.H.; Koltover, I.; Israelachvili, J.N.; Safinya, C.R.
1996-01-01
We report on studies using the x-ray surface forces apparatus (XSFA) to compare the structure of a liquid crystal confined between hard surfaces and, for the first time, between soft surfaces that can deform due to the stresses imposed by the confined fluid. We find that the alignment of smectic domains in confined films depends critically on both the shape and compliance of the confining walls or surfaces: open-quote open-quote Soft surfaces close-quote close-quote exhibit a critical gap thickness of 3.4 μm for the liquid crystal studied at which maximum alignment occurs, while open-quote open-quote hard surfaces close-quote close-quote do not exhibit gap-dependent alignment. copyright 1996 The American Physical Society
Durand, O.; Jaouen, S.; Soulard, L.; Heuzé, O.; Colombet, L.
2017-10-01
We compare, at similar scales, the processes of microjetting and ejecta production from shocked roughened metal surfaces by using atomistic and continuous approaches. The atomistic approach is based on very large scale molecular dynamics (MD) simulations with systems containing up to 700 × 106 atoms. The continuous approach is based on Eulerian hydrodynamics simulations with adaptive mesh refinement; the simulations take into account the effects of viscosity and surface tension, and the equation of state is calculated from the MD simulations. The microjetting is generated by shock-loading above its fusion point a three-dimensional tin crystal with an initial sinusoidal free surface perturbation, the crystal being set in contact with a vacuum. Several samples with homothetic wavelengths and amplitudes of defect are simulated in order to investigate the influence of viscosity and surface tension of the metal. The simulations show that the hydrodynamic code reproduces with very good agreement the profiles, calculated from the MD simulations, of the ejected mass and velocity along the jet. Both codes also exhibit a similar fragmentation phenomenology of the metallic liquid sheets ejected, although the fragmentation seed is different. We show in particular, that it depends on the mesh size in the continuous approach.
Antibacterial Au nanostructured surfaces.
Wu, Songmei; Zuber, Flavia; Brugger, Juergen; Maniura-Weber, Katharina; Ren, Qun
2016-02-07
We present here a technological platform for engineering Au nanotopographies by templated electrodeposition on antibacterial surfaces. Three different types of nanostructures were fabricated: nanopillars, nanorings and nanonuggets. The nanopillars are the basic structures and are 50 nm in diameter and 100 nm in height. Particular arrangement of the nanopillars in various geometries formed nanorings and nanonuggets. Flat surfaces, rough substrate surfaces, and various nanostructured surfaces were compared for their abilities to attach and kill bacterial cells. Methicillin-resistant Staphylococcus aureus, a Gram-positive bacterial strain responsible for many infections in health care system, was used as the model bacterial strain. It was found that all the Au nanostructures, regardless their shapes, exhibited similar excellent antibacterial properties. A comparison of live cells attached to nanotopographic surfaces showed that the number of live S. aureus cells was flat and rough reference surfaces. Our micro/nanofabrication process is a scalable approach based on cost-efficient self-organization and provides potential for further developing functional surfaces to study the behavior of microbes on nanoscale topographies.
International Nuclear Information System (INIS)
Ismail, R.; Tauviqirrahman, M.; Jamari; Schipper, D. J.
2009-01-01
This paper reviews the development of new material and surface technology in tribology and its contribution to energy efficiency. Two examples of the economic benefits, resulted from the optimum tribology in the transportation sector and the manufacturing industry are discussed. The new materials are proposed to modify the surface property by laminating the bulk material with thin layer/coating. Under a suitable condition, the thin layer on a surface can provide a combination of good wear, a low friction and corrosion resistance for the mechanical components. The innovation in layer technology results molybdenum disulfide (MoS2), diamond like carbon (DLC), cubic boron nitride (CBN) and diamond which perform satisfactory outcome. The application of the metallic coatings to carbon fibre reinforced polymer matrix composites (CFRP) has the capacity to provide considerable weight and power savings for many engineering components. The green material for lubricant and additives such as the use of sunflower oil which possesses good oxidation resistance and the use of mallee leaves as bio‐degradable solvent are used to answer the demand of the environmentally friendly material with good performance. The tribology research implementation for energy efficiency also touches the simple things around us such as: erasing the laser‐print in a paper with different abrasion techniques. For the technology in the engineering surface, the consideration for generating the suitable surface of the components in running‐in period has been discussed in order to prolong the components life and reduce the machine downtime. The conclusion, tribology can result in reducing manufacturing time, reducing the maintenance requirements, prolonging the service interval, improving durability, reliability and mechanical components life, and reducing harmful exhaust emission and waste. All of these advantages will increase the energy efficiency and the economic benefits.
Ismail, R.; Tauviqirrahman, M.; Jamari, Jamari; Schipper, D. J.
2009-09-01
This paper reviews the development of new material and surface technology in tribology and its contribution to energy efficiency. Two examples of the economic benefits, resulted from the optimum tribology in the transportation sector and the manufacturing industry are discussed. The new materials are proposed to modify the surface property by laminating the bulk material with thin layer/coating. Under a suitable condition, the thin layer on a surface can provide a combination of good wear, a low friction and corrosion resistance for the mechanical components. The innovation in layer technology results molybdenum disulfide (MoS2), diamond like carbon (DLC), cubic boron nitride (CBN) and diamond which perform satisfactory outcome. The application of the metallic coatings to carbon fibre reinforced polymer matrix composites (CFRP) has the capacity to provide considerable weight and power savings for many engineering components. The green material for lubricant and additives such as the use of sunflower oil which possesses good oxidation resistance and the use of mallee leaves as bio-degradable solvent are used to answer the demand of the environmentally friendly material with good performance. The tribology research implementation for energy efficiency also touches the simple things around us such as: erasing the laser-print in a paper with different abrasion techniques. For the technology in the engineering surface, the consideration for generating the suitable surface of the components in running-in period has been discussed in order to prolong the components life and reduce the machine downtime. The conclusion, tribology can result in reducing manufacturing time, reducing the maintenance requirements, prolonging the service interval, improving durability, reliability and mechanical components life, and reducing harmful exhaust emission and waste. All of these advantages will increase the energy efficiency and the economic benefits.
International Nuclear Information System (INIS)
Chatzikyriakou, Dafni; Krins, Natacha; Gilbert, Bernard; Colson, Pierre; Dewalque, Jennifer; Denayer, Jessica; Cloots, Rudi; Henrist, Catherine
2014-01-01
Graphical abstract: - Highlights: • Mesoporous films exhibit better electrochemical kinetics compared to the dense films. • Mesoporous films exhibit better reversibility compared to the dense films. • Li + cations disrupt WO 3 network in a reversible way in the mesoporous film. • Li + irreversibly intercalate in the voids of crystallites in the dense film. - Abstract: The intercalation and de-intercalation of lithium cations in electrochromic tungsten oxide thin films are significantly influenced by their structural and surface characteristics. In this study, we prepared two types of amorphous films via the sol-gel technique: one dense and one mesoporous in order to compare their response upon lithium intercalation and de-intercalation. According to chronoamperometric measurements, Li + intercalates/de-intercalates faster in the mesoporous film (24s/6s) than in the dense film (48s/10s). The electrochemical measurements (cyclic voltammetry and chronoamperometry) also showed worse reversibility for the dense film compared to the mesoporous film, giving rise to important Li + trapping and remaining coloration of the film. Raman analysis showed that the mesoporous film provides more accessible and various W-O surface bonds for Li + intercalation. On the contrary, in the first electrochemical insertion and de-insertion in the dense film, Li + selectively reacts with a few surface W-O bonds and preferentially intercalates into pre-existing crystallites to form stable irreversible Li x WO 3 bronze
Nanoporous Ni with High Surface Area for Potential Hydrogen Storage Application.
Zhou, Xiaocao; Zhao, Haibo; Fu, Zhibing; Qu, Jing; Zhong, Minglong; Yang, Xi; Yi, Yong; Wang, Chaoyang
2018-06-01
Nanoporous metals with considerable specific surface areas and hierarchical pore structures exhibit promising applications in the field of hydrogen storage, electrocatalysis, and fuel cells. In this manuscript, a facile method is demonstrated for fabricating nanoporous Ni with a high surface area by using SiO₂ aerogel as a template, i.e., electroless plating of Ni into an SiO₂ aerogel template followed by removal of the template at moderate conditions. The effects of the prepared conditions, including the electroless plating time, temperature of the structure, and the magnetism of nanoporous Ni are investigated in detail. The resultant optimum nanoporous Ni with a special 3D flower-like structure exhibited a high specific surface area of about 120.5 m²/g. The special nanoporous Ni exhibited a promising prospect in the field of hydrogen storage, with a hydrogen capacity of 0.45 wt % on 4.5 MPa at room temperature.
19 CFR 212.11 - Net worth exhibit.
2010-04-01
... 19 Customs Duties 3 2010-04-01 2010-04-01 false Net worth exhibit. 212.11 Section 212.11 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION INVESTIGATIONS OF UNFAIR PRACTICES IN IMPORT TRADE IMPLEMENTATION OF THE EQUAL ACCESS TO JUSTICE ACT Information Required From Applicants § 212.11 Net worth exhibit...
Directory of Open Access Journals (Sweden)
Lan Ching Sim
2017-01-01
Full Text Available The visible-light-driven photocatalytic degradation of Bisphenol A (BPA was investigated using the binary composite of alkaline treated g-C3N4 (HT-g-C3N4 deposited over commercial TiO2 (Evonik Degussa GmbH, Essen, Germany. The existence and contribution of both TiO2 and g-C3N4/HT-g-C3N4 in the composite was confirmed through various analytical techniques including powder X-ray diffraction (XRD, high-resolution transmission electron microscopy (HRTEM, field emission scanning electron microscopy (FESEM, Fourier transform infrared spectroscopy (FTIR, X-ray photoelectron spectroscopy (XPS, ultraviolet-visible diffuse reflectance spectra (UV-vis-DRS, and photoluminescence (PL analysis. The results showed that the titania in the binary composite exhibited both pure rutile and anatase phases. The morphological analysis indicated that the spongy “morel-like” structure of g-C3N4 turned to nanotube form after alkaline hydrothermal treatment and thereby decreased the specific surface area of HT-g-C3N4. The low surface area of HT-g-C3N4 dominates its promising optical property and effective charge transfer, resulting in a deprived degradation efficiency of BPA two times lower than pure g-C3N4. The binary composite of HT-g-C3N4/TiO2 exhibited excellent degradation efficiency of BPA with 2.16 times higher than the pure HT-g-C3N4. The enhanced photocatalytic activity was mainly due to the promising optical band gap structure with heterojunction interface, favorable specific surface area, and good charge separation.
Sim, Lan Ching; Tan, Wei Han; Leong, Kah Hon; Bashir, Mohammed J. K.; Saravanan, Pichiah; Surib, Nur Atiqah
2017-01-01
The visible-light-driven photocatalytic degradation of Bisphenol A (BPA) was investigated using the binary composite of alkaline treated g-C3N4 (HT-g-C3N4) deposited over commercial TiO2 (Evonik Degussa GmbH, Essen, Germany). The existence and contribution of both TiO2 and g-C3N4/HT-g-C3N4 in the composite was confirmed through various analytical techniques including powder X-ray diffraction (XRD), high-resolution transmission electron microscopy (HRTEM), field emission scanning electron microscopy (FESEM), Fourier transform infrared spectroscopy (FTIR), X-ray photoelectron spectroscopy (XPS), ultraviolet-visible diffuse reflectance spectra (UV-vis-DRS), and photoluminescence (PL) analysis. The results showed that the titania in the binary composite exhibited both pure rutile and anatase phases. The morphological analysis indicated that the spongy “morel-like” structure of g-C3N4 turned to nanotube form after alkaline hydrothermal treatment and thereby decreased the specific surface area of HT-g-C3N4. The low surface area of HT-g-C3N4 dominates its promising optical property and effective charge transfer, resulting in a deprived degradation efficiency of BPA two times lower than pure g-C3N4. The binary composite of HT-g-C3N4/TiO2 exhibited excellent degradation efficiency of BPA with 2.16 times higher than the pure HT-g-C3N4. The enhanced photocatalytic activity was mainly due to the promising optical band gap structure with heterojunction interface, favorable specific surface area, and good charge separation. PMID:28772387
77 FR 31420 - Culturally Significant Objects Imported for Exhibition
2012-05-25
... also determine that the exhibition or display of the exhibit objects at The Museum of Modern Art, New...: Game Plan'' imported from abroad for temporary exhibition within the United States, are of cultural...
Surface segregation of the metal impurity to the (1 0 0) surface of fcc ...
Indian Academy of Sciences (India)
good relation to the differences in surface energy between the impurity and host crystals ΔQ ..... mobile impurity are treated as movable discrete particles. ..... [64] J Siera, van Delft FCMJM, A D van Langeveld and B E Nieuwenhuys, Surf. Sci.
Turning energy around: an interactive exhibition experience
Directory of Open Access Journals (Sweden)
Sarah Kellberg
2018-05-01
Full Text Available A transition from the fossil-fuel driven to a sustainable energy system is an enormous global challenge: climate change and finite resources require countries all over the world to change their way of producing, transporting and using energy. The Energiewende (energy transition will require major changes in the current energy supply system in Germany – but also worldwide. These changes will not only affect the technical sector but will also include ecological questions, social issues and political matters. Whether any transition is going to favour large scale solutions or decentralised technologies depends on local situations and global interconnections, and above all on a democratic process. Hence energy transition succeeds or fails with the acceptance and participation of society. To deal with this overwhelmingly complex topic and its multi-layered dependencies, the Deutsches Museum has designed an exhibition providing visitors with background knowledge about the necessities and challenges of energy transition, unpicking the links between the different technical, economic and social challenges. The exhibition accomplishes the task with an engaging and facilitating approach while taking into account the highly emotive aspects of energy transition as a societal issue. This paper presents the concept of the travelling exhibition energie.wenden, relating it to the Deutsches Museum´s tradition of exhibitions as well as to the challenge of how to deal with socio-scientific topics in scientific exhibitions.
Let's play game exhibitions : A curator's perspective
de Vos, Jesse; Glas, M.A.J.|info:eu-repo/dai/nl/330981447; van Vught, J.F.|info:eu-repo/dai/nl/413532682
2017-01-01
The Netherlands Institute for Sound and Vision is home to The Experience, a museum exhibiting the history of media in the Netherlands. For ten months in 2016 and 2017, The Experience hosted a temporary exhibition entitled Let’s YouTube . During the Let’s YouTube game month, we programmed a ten-day
Bakhshi, Nafiseh; Soleimanian-Zad, Sabihe; Sheikh-Zeinoddin, Mahmoud
2017-06-01
Currently, screening of microbial biosurfactants (BSs) is based on their equilibrium surface tension values obtained using static surface tension measurement. However, a good surfactant should not only have a low equilibrium surface tension, but its dynamic surface tension (DST) should also decrease rapidly with time. In this study, screening of BSs produced by Lactobacillus plantarum subsp. plantarum PTCC 1896 (probiotic) was performed based on their DST values measured by Wilhelmy plate tensiometry. The relationship between DST and structural and functional properties (anti-adhesive activity) of the BSs was investigated. The results showed that the changes in the yield, productivity and structure of the BSs were growth medium and incubation time dependent (p<0.05). Structurally different BSs produced exhibited identical equilibrium surface tension values. However, differences among the structure/yield of the BSs were observed through the measurement of their DST. The considerable dependence of DST on the concentration and composition of the BS proteins was observed (p<0.05). Moreover, the anti-adhesive activity of the BS was found to be positively correlated with its DST. The results suggest that the DST measurement could serve as an efficient method for the clever screening of BSs producer/production condition, and consequently, for the investigation of probiotic features of bacteria, since the anti-adhesive activity is an important criterion of probiotics. Copyright © 2017 Elsevier Inc. All rights reserved.
Good Concrete Activity Is Good Mental Activity
McDonough, Andrea
2016-01-01
Early years mathematics classrooms can be colourful, exciting, and challenging places of learning. Andrea McDonough and fellow teachers have noticed that some students make good decisions about using materials to assist their problem solving, but this is not always the case. These experiences lead her to ask the following questions: (1) Are…
Effect of the depreciation of public goods in spatial public goods games
Shi, Dong-Mei; Zhuang, Yong; Wang, Bing-Hong
2012-02-01
In this work, the depreciation effect of public goods is considered in the public goods games, which is realized by rescaling the multiplication factor r of each group as r‧=r( (β≥0). It is assumed that each individual enjoys the full profit r of the public goods if all the players of this group are cooperators. Otherwise, the value of public goods is reduced to r‧. It is found that compared with the original version (β=0), the emergence of cooperation is remarkably promoted for β>0, and there exist intermediate values of β inducing the best cooperation. Particularly, there exists a range of β inducing the highest cooperative level, and this range of β broadens as r increases. It is further presented that the variation of cooperator density with noise has close relations with the values of β and r, and cooperation at an intermediate value of β=1.0 is most tolerant to noise.
VIRTUAL EXHIBITION AND FRUITION OF ARCHAEOLOGICAL FINDS
Directory of Open Access Journals (Sweden)
A. M. Manferdini
2012-09-01
Full Text Available During the last two decades, since digital technologies have become more sophisticated in acquiring real data and building faithful copies of them, their improvements have suggested interesting applications in the field of valorisation of Historical, Cultural and Artistic Heritage, with significant consequences in the share and widespread of knowledge. But although several technologies and methodologies for 3d digitization have recently been developed and improved, the lack of a standard procedure and the costs connected to their use still doesn't encourage the systematic digital acquisition of wide collections and heritage. The aim of this paper is to show the state of the art of a project whose aim is to provide a methodology and a procedure to create digital reproductions of artefacts for Institutions called to preserve, manage and enhance the fruition of archaeological finds inside museums or through digital exhibitions. Our project’s aim is to find the most suitable procedure to digitally acquire archaeo logical artefacts that usually have small dimensions and have very complex and detailed surfaces. Within our methodology, particular attention has been paid to the use of widely shared and open-source visualization systems that enhance the involvement of the user by emphasizing three-dimensional characteristics of artefacts through virtual reality.
Directory of Open Access Journals (Sweden)
Tamas Bereczkei
2015-06-01
Full Text Available The present study aims to understand how Machiavellians switch from one kind of response to another in different circumstances to maximize their profit. We set up a specific experimental paradigm that involved both a cooperative and competitive version of a public goods game. We found that Machiavellianism accounts for the total amount of money paid by the players (N = 144 across five rounds in the cooperative but not in the competitive game. Compared with the others, individuals with higher scores on Mach scale contributed less to the public goods in the cooperative condition, but no difference was found in the competitive condition. Finally, this relationship was influenced by the sequence of the games. These results indicate that Machiavellians skillfully evaluate social environments and strive to exploit those with abundant contributions to public goods.
Presentation and exhibition activities for promoting theexportof transport services
Directory of Open Access Journals (Sweden)
Darya Vladimirovna Nesterova
2012-03-01
Full Text Available Development of presentation and exhibition activities is considered as an important factor in providing new competitive advantages at the strategic markets for exporting of transportation services. A specific role for exhibition activities as a factor to overcome market failures arose from imperfect information and incomplete markets is displayed. Exhibitions are considered as a true reflection of most market parameters, as a means to get correct information concerning market capacity and its borders, as an instrument to access to new markets. At the firm level presentation and branding activities should be considered as a modern technology (especially it concerns Russian companies which provide to hold up already existed markets and to conquer new ones. Presentation and branding activities are an effective technology to promote company trade-mark, competitive advantages for market demand increasing. Comparative analysis of the main exhibitions on transport and logistics issues is fulfilled on the data basecollected by authors. Data observes geographical distribution of transport exhibition and exhibition facilities development at several regions for the last years. The analyses allow to revealing a geographical structure of the exhibitions and its distribution by type of transport. The most promising and economically favorable exhibition areas for the promotion of Russian transport services are shown.
Chemically immobilised carbon nanotubes on silicon: Stable surfaces for aqueous electrochemistry
Energy Technology Data Exchange (ETDEWEB)
Flavel, Benjamin S., E-mail: ben.flavel@flinders.edu.a [Department of Chemistry, University of Canterbury, Private Bag 4800, Christchurch 8140 (New Zealand); School of Chemistry, Physics and Earth Sciences, Flinders University, Sturt Road, Bedford Park, Adelaide, South Australia 5001 (Australia); Garrett, David J.; Lehr, Joshua [Department of Chemistry, University of Canterbury, Private Bag 4800, Christchurch 8140 (New Zealand); MacDiarmid Institute for Advanced Materials and Nanotechnology, Private Bag 4800, Christchurch 8140 (New Zealand); Shapter, Joseph G. [School of Chemistry, Physics and Earth Sciences, Flinders University, Sturt Road, Bedford Park, Adelaide, South Australia 5001 (Australia); Downard, Alison J., E-mail: alison.downard@canterbury.ac.n [Department of Chemistry, University of Canterbury, Private Bag 4800, Christchurch 8140 (New Zealand); MacDiarmid Institute for Advanced Materials and Nanotechnology, Private Bag 4800, Christchurch 8140 (New Zealand)
2010-04-30
Diazonium ion chemistry has been used to electrochemically graft aminophenyl layers onto p-type silicon (1 0 0) substrates. A condensation reaction was used to immobilise single-walled carbon nanotubes with high carboxylic acid functionality directly to this layer. Electrochemical monitoring of the aminophenyl groups confirmed the formation of an amide linkage between the single-walled carbon nanotubes and the aminophenyl layer. The carbon nanotube electrode showed high stability and good electrochemical performance in aqueous solution. At moderate scan rates the Ru(NH{sub 3}){sub 6}{sup +3/+2} couple exhibited quasi-reversible electron transfer kinetics with a standard heterogenous rate constant of 1.2 x 10{sup -3} cm s{sup -1} at the covalently-linked carbon nanotube surface. The electrode thus combines the advantages of a silicon substrate for easy integration into sophisticated electrical and electronic devices, carbon nanotubes for desirable electrochemical properties, and stability in aqueous medium for future applications in environmental sensing.
Chemically immobilised carbon nanotubes on silicon: Stable surfaces for aqueous electrochemistry
International Nuclear Information System (INIS)
Flavel, Benjamin S.; Garrett, David J.; Lehr, Joshua; Shapter, Joseph G.; Downard, Alison J.
2010-01-01
Diazonium ion chemistry has been used to electrochemically graft aminophenyl layers onto p-type silicon (1 0 0) substrates. A condensation reaction was used to immobilise single-walled carbon nanotubes with high carboxylic acid functionality directly to this layer. Electrochemical monitoring of the aminophenyl groups confirmed the formation of an amide linkage between the single-walled carbon nanotubes and the aminophenyl layer. The carbon nanotube electrode showed high stability and good electrochemical performance in aqueous solution. At moderate scan rates the Ru(NH 3 ) 6 +3/+2 couple exhibited quasi-reversible electron transfer kinetics with a standard heterogenous rate constant of 1.2 x 10 -3 cm s -1 at the covalently-linked carbon nanotube surface. The electrode thus combines the advantages of a silicon substrate for easy integration into sophisticated electrical and electronic devices, carbon nanotubes for desirable electrochemical properties, and stability in aqueous medium for future applications in environmental sensing.
The Eugenides Foundation Interactive Exhibition of Science and Technology
Kontogiannis, Ioannis
2010-01-01
The Interactive Exhibition of Science and Technology is installed in an area of 1200 m2 at the Eugenides Foundation. 65 interactive exhibits, designed by the "Cites des Science et de l' Industrie" are organised in themes, stimulate the visitors' mind and provoke scientific thinking. Parallel activities take place inside the exhibition, such as live science demonstrations, performed by young scientists. Extra material such as news bulletins (short news, science comics and portraits), educational paths and treasure-hunting based games, all available online as well, are prepared on a monthly basis and provided along with the visit to the exhibition. Through these exhibits and activities, scientific facts are made simple and easy to comprehend using modern presentation tools. We present details on how this exhibition acts complementary to the science education provided by schools, making it a highly sophisticated educational tool.
Yuan, S J; Pehkonen, S O; Ting, Y P; Neoh, K G; Kang, E T
2010-05-04
To enhance the corrosion resistance of stainless steel (SS) and to impart its surface with antibacterial functionality for inhibiting biofilm formation and biocorrosion, well-defined inorganic-organic hybrid coatings, consisting of a polysilsesquioxane inner layer and quaternized poly(2-(dimethyamino)ethyl methacrylate) (P(DMAEMA)) outer blocks, were prepared via successive surface-initiated atom transfer radical polymerization (ATRP) of 3-(trimethoxysilyl)propyl methacrylate (TMSPMA) and 2-(dimethylamino)ethyl methacrylate (DMAEMA). The cross-linked P(TMASPMA), or polysilsesquioxane, inner layer provided a durable and resistant coating to electrolytes. The pendant tertiary amino groups of the P(DMAEMA) outer block were quaternized with alkyl halide to produce a high concentration of quaternary ammonium groups with biocidal functionality. The so-synthesized inorganic-organic hybrid coatings on the SS substrates exhibited good anticorrosion and antibacterial effects and inhibited biocorrosion induced by sulfate-reducing bacteria (SRB) in seawater media, as revealed by antibacterial assay and electrochemical analyses, and they are potentially useful to steel-based equipment under harsh industrial and marine environments.
International Nuclear Information System (INIS)
Goeckner, M J; Nelson, C T; Sant, S P; Jindal, A K; Joseph, E A; Zhou, B S; Padron-Wells, G; Jarvis, B; Pierce, R; Overzet, L J
2008-01-01
Materials processing is at a crossroads. Currently a large fraction of industrially viable materials processing is via plasmas. Until recently it has been economical to just examine the influence the plasma properties on the desired surface processes and through this ultimately optimize manufacturing. For example, it is well known that the surface processes (etch or deposition), occur in the top few mono-layers of the surface. Thus, in film growth one requires that molecules from the gas-phase land and bond on the surface. However as processing has reached the nano-scale, development of viable processes has become more and more difficult. In part, this is because of all of the free parameters that exist in plasmas. To overcome this economic issue, tool vendors and semiconductor companies have turned to complex computational models of processing plasmas. For those models to work, one requires a through understanding of all of the gas-phase and surface-phase processes that are exhibited in plasmas. Unfortunately, these processes, particularly those at the surface, are not well understood. In this article we describe a viable model of the surface-phase based on cross sections for processes that occur. While originally developed of fluorocarbon systems, the model also appears to be applicable to hydrocarbon systems.
Energy Technology Data Exchange (ETDEWEB)
Goeckner, M J; Nelson, C T; Sant, S P; Jindal, A K; Joseph, E A; Zhou, B S; Padron-Wells, G; Jarvis, B; Pierce, R; Overzet, L J [Department of Electrical Engineering, University of Texas at Dallas (United States)], E-mail: goeckner@utdallas.edu
2008-10-01
Materials processing is at a crossroads. Currently a large fraction of industrially viable materials processing is via plasmas. Until recently it has been economical to just examine the influence the plasma properties on the desired surface processes and through this ultimately optimize manufacturing. For example, it is well known that the surface processes (etch or deposition), occur in the top few mono-layers of the surface. Thus, in film growth one requires that molecules from the gas-phase land and bond on the surface. However as processing has reached the nano-scale, development of viable processes has become more and more difficult. In part, this is because of all of the free parameters that exist in plasmas. To overcome this economic issue, tool vendors and semiconductor companies have turned to complex computational models of processing plasmas. For those models to work, one requires a through understanding of all of the gas-phase and surface-phase processes that are exhibited in plasmas. Unfortunately, these processes, particularly those at the surface, are not well understood. In this article we describe a viable model of the surface-phase based on cross sections for processes that occur. While originally developed of fluorocarbon systems, the model also appears to be applicable to hydrocarbon systems.
Theoretical studies of structural and electronic properties of overlayers on semiconductor surfaces
International Nuclear Information System (INIS)
Cakmak, M.
1999-06-01
In this thesis we report the results of ab initio density functional calculations of equilibrium atomic geometry, electronic states and chemical bonding for the adsorption of elemental S and H 2 S on chosen semiconductor surfaces. The results are in good agreement with the available experimental results and indicate the need for further experimental work. In Chapter 2 of this thesis, I describe the formalism of the ab initio pseudopotential theory and the computational procedures which are used in this thesis. In the following chapter, a few experimental techniques are discussed, which we subsequently use their results to compare with our theoretical calculated results. In Chapter 4 the passivation of S on InP(110) is investigated. Two sets of geometries are used; non-reacted geometries and reacted geometries. For non-reacted full-monolayer coverage, the epitaxially continued layer structure is found to be the most energetically favourable and it exhibits a good semiconducting nature. For an ordered reacted model with the adsorbate S atoms exchanged with their neighbouring P atoms, the average vertical distance between the top two layers is in agreement with x-ray standing wave analysis, but is characterized by a small band gap. In Chapter 5 adsorption of the H 2 S molecule on the InP(110), GaAs(110) and GaP(110) surfaces is investigated within a dissociative adsorption model. In general the adsorption of H 2 S on the three semiconductors shows similar behaviour. In Chapter 6 the adsorption of elemental S on Si(001) is investigated using three adsorption models; hemisulfide-(2 x 1) structure, monosulfide-(1 x 1) structure, and disulfide-(1 x 1) structure. An analysis of the surface free energy suggests that the monosulfide structure is more stable than the hemisulfide and disulfide structures. This result is also used to investigate the adsorption of elemental S on the Ge(001) surface. In Chapter 7, the adsorption of the H 2 S molecule on the Si(001) and Ge(001
Surface enhanced Raman scattering
Furtak, Thomas
1982-01-01
In the course of the development of surface science, advances have been identified with the introduction of new diagnostic probes for analytical characterization of the adsorbates and microscopic structure of surfaces and interfaces. Among the most recently de veloped techniques, and one around which a storm of controversy has developed, is what has now been earmarked as surface enhanced Raman scattering (SERS). Within this phenomenon, molecules adsorbed onto metal surfaces under certain conditions exhibit an anomalously large interaction cross section for the Raman effect. This makes it possible to observe the detailed vibrational signature of the adsorbate in the ambient phase with an energy resolution much higher than that which is presently available in electron energy loss spectroscopy and when the surface is in contact with a much larger amount of material than that which can be tolerated in infrared absorption experiments. The ability to perform vibrational spectroscopy under these conditions would l...
Drag reduction in reservoir rock surface: Hydrophobic modification by SiO_2 nanofluids
International Nuclear Information System (INIS)
Yan, Yong-Li; Cui, Ming-Yue; Jiang, Wei-Dong; He, An-Le; Liang, Chong
2017-01-01
Graphical abstract: The micro-nanoscale hierarchical structures at the sandstone core surface are constructed by adsorption of the modified silica nanoparticles, which leads to the effect of drag reduction to improve the low injection rate in ultra-low permeability reservoirs. - Highlights: • A micro-nanoscale hierarchical structure is formed at the reservoir rock surface. • An inversion has happened from hydrophilic into hydrophobic modified by nanofluids. • The effect of drag reduction to improve the low injection rate is realized. • The mechanism of drag reduction induced from the modified core surface was unclosed. - Abstract: Based on the adsorption behavior of modified silica nanoparticles in the sandstone core surface, the hydrophobic surface was constructed, which consists of micro-nanoscale hierarchical structure. This modified core surface presents a property of drag reduction and meets the challenge of high injection pressure and low injection rate in low or ultra-low permeability reservoir. The modification effects on the surface of silica nanoparticles and reservoir cores, mainly concerning hydrophobicity and fine structure, were determined by measurements of contact angle and scanning electron microscopy. Experimental results indicate that after successful modification, the contact angle of silica nanoparticles varies from 19.5° to 141.7°, exhibiting remarkable hydrophobic properties. These modified hydrophobic silica nanoparticles display a good adsorption behavior at the core surface to form micro-nanobinary structure. As for the wettability of these modified core surfaces, a reversal has happened from hydrophilic into hydrophobic and its contact angle increases from 59.1° to 105.9°. The core displacement experiments show that the relative permeability for water has significantly increased by an average of 40.3% via core surface modification, with the effects of reducing injection pressure and improving injection performance of water
Global Public Goods and The Role of Emerging Power: Considering the Concept of Impure Public Goods
Directory of Open Access Journals (Sweden)
Liu Rieshøj Yi
2016-12-01
Full Text Available The existing analysis of global public goods over-emphasizes the significance of public. Great power as a main provider has played an active role in these strategic initiatives, which may be ignored. In fact, main power has thought about the possible free-riders when providing public goods and making its foreign strategic plan. China’s announcement to “welcome the neighbouring countries to be a free-rider and benefit from China’s rise” is a good example. It is necessary to think about the theory of public goods and take another look at the free-riding phenomenon. The concept of impure public goods may be useful and effective when we understand the reason why global public goods are being provided and are relatively efficient. As an emerging power, China should have a clear strategy on global public goods with a possible “marketing” viewpoint, including more initiatives and specific measures, so that the global public goods provision may be more diverse and well-planned.
Energy Technology Data Exchange (ETDEWEB)
Mukherji, Debashish; Stuehn, Torsten; Kremer, Kurt [Max-Planck Institut für Polymerforschung, Ackermannweg 10, 55128 Mainz (Germany); Marques, Carlos M. [Max-Planck Institut für Polymerforschung, Ackermannweg 10, 55128 Mainz (Germany); Institut Charles Sadron, Université de Strasbourg, CNRS, Strasbourg (France)
2015-03-21
Smart polymers are a modern class of polymeric materials that often exhibit unpredictable behavior in mixtures of solvents. One such phenomenon is co-non-solvency. Co-non-solvency occurs when two (perfectly) miscible and competing good solvents, for a given polymer, are mixed together. As a result, the same polymer collapses into a compact globule within intermediate mixing ratios. More interestingly, polymer collapses when the solvent quality remains good and even gets increasingly better by the addition of the better cosolvent. This is a puzzling phenomenon that is driven by strong local concentration fluctuations. Because of the discrete particle based nature of the interactions, Flory-Huggins type mean field arguments become unsuitable. In this work, we extend the analysis of the co-non-solvency effect presented earlier [D. Mukherji et al., Nat. Commun. 5, 4882 (2014)]. We explain why co-non-solvency is a generic phenomenon, which can only be understood by the thermodynamic treatment of the competitive displacement of (co)solvent components. This competition can result in a polymer collapse upon improvement of the solvent quality. Specific chemical details are not required to understand these complex conformational transitions. Therefore, a broad range of polymers are expected to exhibit similar reentrant coil-globule-coil transitions in competing good solvents.
International Nuclear Information System (INIS)
Mukherji, Debashish; Stuehn, Torsten; Kremer, Kurt; Marques, Carlos M.
2015-01-01
Smart polymers are a modern class of polymeric materials that often exhibit unpredictable behavior in mixtures of solvents. One such phenomenon is co-non-solvency. Co-non-solvency occurs when two (perfectly) miscible and competing good solvents, for a given polymer, are mixed together. As a result, the same polymer collapses into a compact globule within intermediate mixing ratios. More interestingly, polymer collapses when the solvent quality remains good and even gets increasingly better by the addition of the better cosolvent. This is a puzzling phenomenon that is driven by strong local concentration fluctuations. Because of the discrete particle based nature of the interactions, Flory-Huggins type mean field arguments become unsuitable. In this work, we extend the analysis of the co-non-solvency effect presented earlier [D. Mukherji et al., Nat. Commun. 5, 4882 (2014)]. We explain why co-non-solvency is a generic phenomenon, which can only be understood by the thermodynamic treatment of the competitive displacement of (co)solvent components. This competition can result in a polymer collapse upon improvement of the solvent quality. Specific chemical details are not required to understand these complex conformational transitions. Therefore, a broad range of polymers are expected to exhibit similar reentrant coil-globule-coil transitions in competing good solvents
Surface Morphology and Hardness Analysis of TiCN Coated AA7075 Aluminium Alloy
Srinath, M. K.; Ganesha Prasad, M. S.
2017-12-01
Successful titanium carbonitride (TiCN) coating on AA7075 plates using the PVD technique depends upon many variables, including temperature, pressure, incident angle and energy of the reactive ions. Coated specimens have shown an increase in their surface hardness of 2.566 GPa. In this work, an attempt to further augment the surface hardness and understand its effects on the surface morphology was performed through heat treatments at 500°C for different duration of times. Specimen's heat treated at 500°C for 1 h exhibited a maximum surface hardness of 6.433 GPa, corresponding to an increase of 92.07%. The XRD results showed the presence of Al2Ti and AlTi3N and indicate the bond created between them. Unit cell lattice parameters in the XRD data are calculated using Bragg's law. The SEM images exhibit increasing crack sizes as the heat treatment time is increased. From the studies, the heat treatment duration can be optimized to 1 h, which exhibited an augmented surface hardness, as further increases in durations caused a drop in the surface hardness. The heat treatment effectively modified the surface hardness. Equations providing the relationships that temperature and time have with the reaction parameters are presented.
Energy Technology Data Exchange (ETDEWEB)
Rahmani, Farzin; Nouranian, Sasan, E-mail: sasan@olemiss.edu; Mahdavi, Mina [University of Mississippi, Department of Chemical Engineering (United States); Al-Ostaz, Ahmed [University of Mississippi, Department of Civil Engineering (United States)
2016-11-15
In this fundamental study, a series of molecular dynamics simulations were performed in vacuo to investigate the energetics and select geometries of 20 standard amino acids (AAs) on pristine graphene (PG) and graphene oxide (GO) surfaces as a function of graphene surface oxygen density. These interactions are of key interest to graphene/biomolecular systems. Our results indicate that aromatic AAs exhibit the strongest total interactions with the PG surfaces due to π-π stacking. Tryptophan (Trp) has the highest aromaticity due to its indole side chain and, hence, has the strongest interaction among all AAs (−16.66 kcal/mol). Aliphatic, polar, and charged AAs show various levels of affinity to the PG sheets depending on the strength of their side chain hydrophobic interactions. For example, arginine (Arg) with its guanidinium side chain exhibits the strongest interaction with the PG sheets (−13.81 kcal/mol) following aromatic AAs. Also, glycine (Gly; a polar AA) has the weakest interaction with the PG sheets (−7.29 kcal/mol). When oxygen-containing functional groups are added to the graphene sheets, the π-π stacking in aromatic AAs becomes disrupted and perfect parallelism of the aromatic rings is lost. Moreover, hydrogen bonding and/or electrostatic interactions become more pronounced. Charged AAs exhibit the strongest interactions with the GO surfaces. In general, the AA-GO interactions increase with increasing surface oxygen density, and the effect is more pronounced at higher O/C ratios. This study provides a quantitative measure of AA-graphene interactions for the design and tuning of biomolecular systems suitable for biosensing, drug delivery, and gene delivery applications.
Benchmark Two-Good Utility Functions
de Jaegher, K.
Benchmark two-good utility functions involving a good with zero income elasticity and unit income elasticity are well known. This paper derives utility functions for the additional benchmark cases where one good has zero cross-price elasticity, unit own-price elasticity, and zero own price
Camilleri, Emily T; Gustafson, Michael P; Dudakovic, Amel; Riester, Scott M; Garces, Catalina Galeano; Paradise, Christopher R; Takai, Hideki; Karperien, Marcel; Cool, Simon; Sampen, Hee-Jeong Im; Larson, A Noelle; Qu, Wenchun; Smith, Jay; Dietz, Allan B; van Wijnen, Andre J
2016-08-11
Clinical translation of mesenchymal stromal cells (MSCs) necessitates basic characterization of the cell product since variability in biological source and processing of MSCs may impact therapeutic outcomes. Although expression of classical cell surface markers (e.g., CD90, CD73, CD105, and CD44) is used to define MSCs, identification of functionally relevant cell surface markers would provide more robust release criteria and options for quality control. In addition, cell surface expression may distinguish between MSCs from different sources, including bone marrow-derived MSCs and clinical-grade adipose-derived MSCs (AMSCs) grown in human platelet lysate (hPL). In this work we utilized quantitative PCR, flow cytometry, and RNA-sequencing to characterize AMSCs grown in hPL and validated non-classical markers in 15 clinical-grade donors. We characterized the surface marker transcriptome of AMSCs, validated the expression of classical markers, and identified nine non-classical markers (i.e., CD36, CD163, CD271, CD200, CD273, CD274, CD146, CD248, and CD140B) that may potentially discriminate AMSCs from other cell types. More importantly, these markers exhibit variability in cell surface expression among different cell isolates from a diverse cohort of donors, including freshly prepared, previously frozen, or proliferative state AMSCs and may be informative when manufacturing cells. Our study establishes that clinical-grade AMSCs expanded in hPL represent a homogeneous cell culture population according to classical markers,. Additionally, we validated new biomarkers for further AMSC characterization that may provide novel information guiding the development of new release criteria. Use of Autologous Bone Marrow Aspirate Concentrate in Painful Knee Osteoarthritis (BMAC): Clinicaltrials.gov NCT01931007 . Registered August 26, 2013. MSC for Occlusive Disease of the Kidney: Clinicaltrials.gov NCT01840540 . Registered April 23, 2013. Mesenchymal Stem Cell Therapy in Multiple
DEFF Research Database (Denmark)
Sharma, Devika
2017-01-01
For decades humanitarianism has captured and shaped the dreams of the populations of the global North, dreams of a better world, of a common humanity, of goodness, of solidarity, and of global healing. In this article I argue that when taking art and cultural objects into account humanitarian......, Danmarks Indsamling [Denmark Collects], and the second is from Norwegian playwright Arne Lygre’s 2011 play, I Disappear. What is at stake in both of these scenes is the status of humanitarianism as a good-enough fantasy and promise of doing good....
Fermi surfaces in Kondo insulators
Liu, Hsu; Hartstein, Máté; Wallace, Gregory J.; Davies, Alexander J.; Ciomaga Hatnean, Monica; Johannes, Michelle D.; Shitsevalova, Natalya; Balakrishnan, Geetha; Sebastian, Suchitra E.
2018-04-01
We report magnetic quantum oscillations measured using torque magnetisation in the Kondo insulator YbB12 and discuss the potential origin of the underlying Fermi surface. Observed quantum oscillations as well as complementary quantities such as a finite linear specific heat capacity in YbB12 exhibit similarities with the Kondo insulator SmB6, yet also crucial differences. Small heavy Fermi sections are observed in YbB12 with similarities to the neighbouring heavy fermion semimetallic Fermi surface, in contrast to large light Fermi surface sections in SmB6 which are more similar to the conduction electron Fermi surface. A rich spectrum of theoretical models is suggested to explain the origin across different Kondo insulating families of a bulk Fermi surface potentially from novel itinerant quasiparticles that couple to magnetic fields, yet do not couple to weak DC electric fields.
Yang, Yi; Wang, Zhongwu; Xu, Zeyang; Wu, Kunjie; Yu, Xiaoqin; Chen, Xiaosong; Meng, Yancheng; Li, Hongwei; Qiu, Song; Jin, Hehua; Li, Liqiang; Li, Qingwen
2017-04-26
Electrical hysteresis in carbon nanotube thin-film transistor (CNTTFT) due to surface adsorption of H 2 O/O 2 is a severe obstacle for practical applications. The conventional encapsulation methods based on vacuum-deposited inorganic materials or wet-coated organic materials have some limitations. In this work, we develop a general and highly efficient dry-laminating encapsulation method to reduce the hysteresis of CNTTFTs, which may simultaneously realize the construction and encapsulation of CNTTFT. Furthermore, by virtue of dry procedure and wide compatibility of PMMA, this method is suitable for the construction of CNTTFT on diverse surface including both inorganic and organic dielectric materials. Significantly, the dry-encapsulated CNTTFT exhibits very low or even negligible hysteresis with good repeatability and air stability, which is greatly superior to the nonencapsulated and wet-encapsulated CNTTFT with spin-coated PMMA. The dry-laminating encapsulation strategy, a kind of technological innovation, resolves a significant problem of CNTTFT and therefore will be promising in facile transferring and packaging the CNT films for high-performance optoelectronic devices.
Cai, Qiran
2015-01-01
Atomically thin boron nitride (BN) nanosheets have been found to be excellent substrates for noble metal particles enabled surface enhanced Raman spectroscopy (SERS), thanks to their good adsorption of aromatic molecules, high thermal stability and weak Raman scattering. Faceted gold (Au) nanoparticles have been synthesized on BN nanosheets using a simple but controllable and reproducible sputtering and annealing method. The size and density of the Au particles can be controlled by sputtering time, current and annealing temperature etc. Under the same sputtering and annealing conditions, the Au particles on BN of different thicknesses show various sizes because the surface diffusion coefficients of Au depend on the thickness of BN. Intriguingly, decorated with similar morphology and distribution of Au particles, BN nanosheets exhibit better Raman enhancements than silicon substrates as well as bulk BN crystals. Additionally, BN nanosheets show no noticeable SERS signal and hence cause no interference to the Raman signal of the analyte. The Au/BN substrates can be reused by heating in air to remove the adsorbed analyte without loss of SERS enhancement. This journal is © the Owner Societies 2015.
Topological surface states scattering in antimony
Narayan, Awadhesh
2012-11-05
In this work we study the topologically protected states of the Sb(111) surface by using ab initio transport theory. In the presence of a strong surface perturbation we obtain standing-wave states resulting from the superposition of spin-polarized surface states. By Fourier analysis, we identify the underlying two dimensional scattering processes and the spin texture. We find evidence of resonant transmission across surface barriers at quantum well state energies and evaluate their lifetimes. Our results are in excellent agreement with experimental findings. We also show that despite the presence of a step edge along a different high-symmetry direction, the surface states exhibit unperturbed transmission around the Fermi energy for states with near to normal incidence. © 2012 American Physical Society.
Topological surface states scattering in antimony
Narayan, Awadhesh; Rungger, Ivan; Sanvito, Stefano
2012-01-01
In this work we study the topologically protected states of the Sb(111) surface by using ab initio transport theory. In the presence of a strong surface perturbation we obtain standing-wave states resulting from the superposition of spin-polarized surface states. By Fourier analysis, we identify the underlying two dimensional scattering processes and the spin texture. We find evidence of resonant transmission across surface barriers at quantum well state energies and evaluate their lifetimes. Our results are in excellent agreement with experimental findings. We also show that despite the presence of a step edge along a different high-symmetry direction, the surface states exhibit unperturbed transmission around the Fermi energy for states with near to normal incidence. © 2012 American Physical Society.
Travelling CERN Exhibition ''When Energy Becomes Matter''
International Nuclear Information System (INIS)
2001-01-01
Full text: The European Laboratory for Nuclear Research (CERN) and the H. Niewodniczanski Institute of Nuclear Physics together with the Institute of Physics of the Jagiellonian University and the University of Mining and Metallurgy, and under the auspices of the Polish National Atomic Energy Agency organized in the Museum of Nature in Cracow from October 16 till December 16, 2000 the exhibition ''When Energy Becomes Matter''. The Office of the ''Festival Cracow 2000'' was the main sponsor of that event. The exhibition was a part of the F estival Cracow 2000'' called ''Festival of Youngsters Cracow 2000''. Invitations, posters and information leaflets were sent to more than 3000 schools in southern Poland. The exhibition was divided into four specially designed quadrants. In the first the visitor was informed what kind of scales are in use to describe the Universe and the atom. The second introduced elementary particles via the cosmic ray demonstrations. Particle acceleration was demonstrated with the help of a TV set. The third segment was devoted to the Large Hadron Collider and its experiments: CMS, ATLAS, ALICE and LHCb. The last segment was an attempt to explain what are quarks, leptons and intermediate bosons. In addition it was also explained what is antimatter and why symmetry is broken in Nature. In one of the rooms we arranged the cinema where five movies was continuously presented. Thanks to the Cracow TV it was possible to prepare Polish translations of the films: B ack to creation , P owers of ten , L HC - time machine , S tars underground , and G eneva event . Another attraction of the exhibition was the Internet room equipped with the help of Polish Telecommunication. The exhibition was open seven days per week from 10 to 17 h. During the working days every 20 minutes a new group of about 25-30 people was visiting the exhibition. Each group was guided by students and PhD students from our Institute, Jagiellonian University and University of Mining
Energy Technology Data Exchange (ETDEWEB)
Gladys, M.J.; Ermanoski, I.; Jackson, G.; Quinton, J.S.; Rowe, J.E.; Madey, T.E. E-mail: madey@physics.rutgers.edu
2004-04-01
High resolution soft X-ray photoemission electron spectroscopy (SXPS), using synchrotron radiation, is employed to investigate 4f core-level features of four differently-prepared Ir(2 1 0) surfaces: clean planar, oxygen-covered planar, oxygen-induced faceted, and clean faceted surfaces. Surface and bulk peak identifications are supported by measurements at different photon energies (thus probing different electron escape depths) and variable emission angles. Iridium 4f{sub 7/2} photoemission spectra are fitted with Doniach-Sunjic lineshapes. The surface components are identified with core levels positioned at lower binding energies than the bulk components, in contrast to previous reports of binding energy inversion on Ir(1 0 0) (1x1) and (5x1) surfaces. For clean planar Ir(2 1 0) three surface Ir 4f{sub 7/2} features are observed with core-level shifts of -765, -529, and -281 meV, with respect to the bulk; these are associated with the first, second and third layers of atoms, respectively, for atomically rough Ir(2 1 0). Adsorption of oxygen onto the planar Ir(2 1 0) surface is found to cause a suppression and shift of the surface features to higher binding energies. Annealing at T{>=}600 K in oxygen produces a faceted surface as verified by low energy electron diffraction (LEED). A comparison of planar and faceted oxygen-covered surfaces reveals minor differences in the normal emission SXPS spectra, while grazing emission spectra exhibit differences. The SXPS spectrum of the clean, faceted Ir(2 1 0) exhibits small differences in comparison to the clean planar case, with surface features having binding energy shifts of -710, -450, and -230 meV.
Exhibition: Dialogue between Science and religion
2001-01-01
Can the theory of the Big Bang reached by physicists and the concept of creation beloved of religion ever be reconciled? The two approaches have at least one point in common: they do not provide a final answer to the mysteries of the birth of the Universe. And this means that dialogue is alays possible between the two. It is to show the potential of such an exchange that Geneva's Société Evangélique organization is opening an exhibition under the title 'Big Bang and Creation', at the Planète Charmilles shopping centre, to run from 19 to 30 March. View of the 'Big Bang and Creation' exhibition. The exhibition is divided into three sections, showing the views of the scientist and those of the believer without setting them up in opposition to one another. In the first section, under a representation of the vault of heaven, the visitor will discover the different ideas explaining the birth of the Universe: Genesis and the Big Bang, and the different dominant theories ...
Energy Technology Data Exchange (ETDEWEB)
NONE
1960-04-15
Since January this year, a mobile atomic energy exhibition has been touring the principal cities of Mexico. In organizing this exhibition, the National Nuclear Energy Commission of Mexico was assisted by the International Atomic Energy Agency which has placed its second mobile radioisotope laboratory at the disposal of the Mexican authorities. In many States of the Republic, the visit of the mobile laboratory has given a powerful impetus to atomic training and research. Universities have made use of the laboratory for the training of young scientists in the basic isotope techniques. As a sequel to the work initiated with its aid, some universities are planning to start regular training courses in this field. The laboratory, which is a gift to the Agency from the United States, has been put to its first assignment in Mexico. It will shortly be sent to Argentina for a period of six months for use in training courses. IAEA's first mobile radioisotope unit, also donated by the United States, has been used for training purposes in Austria, the Federal Republic of Germany, Greece and Yugoslavia, and has now been sent to the Far East
International Nuclear Information System (INIS)
1960-01-01
Since January this year, a mobile atomic energy exhibition has been touring the principal cities of Mexico. In organizing this exhibition, the National Nuclear Energy Commission of Mexico was assisted by the International Atomic Energy Agency which has placed its second mobile radioisotope laboratory at the disposal of the Mexican authorities. In many States of the Republic, the visit of the mobile laboratory has given a powerful impetus to atomic training and research. Universities have made use of the laboratory for the training of young scientists in the basic isotope techniques. As a sequel to the work initiated with its aid, some universities are planning to start regular training courses in this field. The laboratory, which is a gift to the Agency from the United States, has been put to its first assignment in Mexico. It will shortly be sent to Argentina for a period of six months for use in training courses. IAEA's first mobile radioisotope unit, also donated by the United States, has been used for training purposes in Austria, the Federal Republic of Germany, Greece and Yugoslavia, and has now been sent to the Far East
Enhanced protein retention on poly(caprolactone) via surface initiated polymerization of acrylamide
International Nuclear Information System (INIS)
Ma, Yuhao; Cai, Mengtan; He, Liu; Luo, Xianglin
2016-01-01
Graphical abstract: - Highlights: • Dense package of poly(acrylamide) on poly(caprolactone) surface was achieved by surface-initiated atom transfer radical polymerization. • Poly(acrylamide) grafted surface exhibited high protein retention ability. • Loaded protein was resistant to detachment and maintained its structure without denaturation. - Abstract: To enhance the biocompatibility or extend the biomedical application of poly(caprolactone) (PCL), protein retention on PCL surface is often required. In this study, poly(acrylamide) (PAAm) brushes were grown from PCL surface via surface-initiated atom transfer radical polymerization (SI-ATRP) and served as a protein-capturing platform. Grafted PAAm was densely packed on surface and exhibited superior protein retention ability. Captured protein was found to be resistant to washing under detergent environment. Furthermore, protein structure after being captured was investigated by circular dichroism (CD) spectroscopy, and the CD spectra verified that secondary structure of captured proteins was maintained, indicating no denaturation of protein happened for retention process.
Surface rheology of saponin adsorption layers.
Stanimirova, R; Marinova, K; Tcholakova, S; Denkov, N D; Stoyanov, S; Pelan, E
2011-10-18
Extracts of the Quillaja saponaria tree contain natural surfactant molecules called saponins that very efficiently stabilize foams and emulsions. Therefore, such extracts are widely used in several technologies. In addition, saponins have demonstrated nontrivial bioactivity and are currently used as essential ingredients in vaccines, food supplements, and other health products. Previous preliminary studies showed that saponins have some peculiar surface properties, such as a very high surface modulus, that may have an important impact on the mechanisms of foam and emulsion stabilization. Here we present a detailed characterization of the main surface properties of highly purified aqueous extracts of Quillaja saponins. Surface tension isotherms showed that the purified Quillaja saponins behave as nonionic surfactants with a relatively high cmc (0.025 wt %). The saponin adsorption isotherm is described well by the Volmer equation, with an area per molecule of close to 1 nm(2). By comparing this area to the molecular dimensions, we deduce that the hydrophobic triterpenoid rings of the saponin molecules lie parallel to the air-water interface, with the hydrophilic glucoside tails protruding into the aqueous phase. Upon small deformation, the saponin adsorption layers exhibit a very high surface dilatational elasticity (280 ± 30 mN/m), a much lower shear elasticity (26 ± 15 mN/m), and a negligible true dilatational surface viscosity. The measured dilatational elasticity is in very good agreement with the theoretical predictions of the Volmer adsorption model (260 mN/m). The measured characteristic adsorption time of the saponin molecules is 4 to 5 orders of magnitude longer than that predicted theoretically for diffusion-controlled adsorption, which means that the saponin adsorption is barrier-controlled around and above the cmc. The perturbed saponin layers relax toward equilibrium in a complex manner, with several relaxation times, the longest of them being around 3
CERN exhibition attracts over 100,000 visitors in Belgrade
Antonella Del Rosso
2012-01-01
“This must be an 'all-time record',” says Ray Lewis, CERN travelling exhibition manager. “In all my time with the various permanent and travelling exhibitions that have taken place locally and within our Member States I have never experienced such figures.” Zarko Obradovic (left), Serbian Minister of Education, Science and Technology, and Rolf Heuer (right), CERN Director-General, at the CERN travelling exhibition in Belgrade. Indeed, in approximately 20 days of exhibition time about 120,000 people, mainly school visiters and the general public, visited the 100 m2 CERN mini-exhibition. It was set up in the centre of Belgrade in October, in association with the meeting of the Restricted European Committee for Future Accelerators (RECFA). After attending the RECFA meeting, CERN's Director-General Rofl Heuer opened the CERN exhibition on the evening of 19 October. Lectures about CERN were held every afternoon, and two public de...
Designing museum exhibits that facilitate visitor reflection and discussion
DEFF Research Database (Denmark)
Skydsgaard, Morten Arnika; Andersen, Hanne Møller; King, Heather
2016-01-01
This paper explores how four design principles (curiosity, challenge, narratives and participation) facilitate reflection and discussion among young visitors in the issues-based exhibition Dear, Difficult Body. The investigation is based on a mixed-method approach combining questionnaire and inte......This paper explores how four design principles (curiosity, challenge, narratives and participation) facilitate reflection and discussion among young visitors in the issues-based exhibition Dear, Difficult Body. The investigation is based on a mixed-method approach combining questionnaire...... and interview data. The implementation of design principles resulted in a variety of exhibits which variously prompted reflection and discussion on the part of visitors. Exhibits with narratives, for example, here defined as both personal and expert narratives, were found to be effective in facilitating...... personal reflection but also prompted discussion. Participation, defined as including both physical interaction with exhibits, and dialogic interaction between visitors, facilitated the sharing of ideas and feelings between visitors. Exhibits with elements of curiosity and challenge were found to attract...
Tingey, Carol
1987-01-01
Suggestions are presented from parents on how to help children with disabilities (with particular focus on Downs Syndrome) learn good grooming habits in such areas as good health, exercise, cleanliness, teeth and hair care, skin care, glasses and other devices, and social behavior. (CB)
Exhibits in libraries a practical guide
Brown, Mary E
2005-01-01
"Ccomprehensive...detailed"--Booklist; "thoroughly reseached...highly recommended"--Journal of Access Services. Library exhibits are more than entertainment for patrons. They can inspire and educate, stimulate an interest that can be explored in a book, or attract visitors who otherwise wouldn't stop by. Displays are also an opportunity for a library to put its creative foot forward or help patrons navigate the facility itself. This comprehensive "how-to" includes everything a librarian or staff member needs to know to put on an exhibit, from hatching ideas to evaluating the end result. Illustrations and photographs show practical methods of planning, labeling and displaying.
Directory of Open Access Journals (Sweden)
Mentor Gashi
2015-11-01
Full Text Available Customs control, is regulated by law in different countries. Different countries define through the law, the control of goods.. Main purpose of this paper is to analyze two types of customs controls, and their effect in reducing avoidance of duty or tax evasion which may be caused by the import of goods of certain companies. For this reason we researched which model is implemented in developing countries and what results were reached through questionnaires. In this sense the next research question, consists in defining the moment of customs control pre or post-clearance control of goods.
TRANSPORT OF COUNTERFEIT GOODS
Directory of Open Access Journals (Sweden)
Dagmar Babčanová
2014-09-01
Full Text Available The paper is focused on a current problem of transport of counterfeit goods in the European Union. Counterfeiting has a strong influence on the distribution organizations worldwide because most of counterfeit goods threaten the health and safety of consumers. Counterfeiting is a serious problem in the world economy today. The purpose of this paper is to point out the danger of counterfeiting in connection with the transport of Intellectual Property (IP rights - infringing goods. Background of the paper’s content is based on secondary data research of publicly available sources - international statistics and world reports.
Estimation of bare soil surface temperature from air temperature and ...
African Journals Online (AJOL)
Soil surface temperature has critical influence on climate, agricultural and hydrological activities since it serves as a good indicator of the energy budget of the earth's surface. Two empirical models for estimating soil surface temperature from air temperature and soil depth temperature were developed. The coefficient of ...
Gao, Ang; Hang, Ruiqiang; Li, Wan; Zhang, Wei; Li, Penghui; Wang, Guomin; Bai, Long; Yu, Xue-Feng; Wang, Huaiyu; Tong, Liping; Chu, Paul K
2017-09-01
Small-diameter vascular grafts made of biomedical polytetrafluoroethylene (PTFE) suffer from the poor long-term patency rate originating from thrombosis and intimal hyperplasia, which can be ascribed to the insufficient endothelialization and chronic inflammation of the materials. Hence, bio-functionalization of PTFE grafts is highly desirable to circumvent these disadvantages. In this study, a versatile "implantation-incubation" approach in which the biomedical PTFE is initially modified by plasma immersion ion implantation (PIII) is described. After the N 2 PIII treatment, the surface of biomedical PTFE is roughened with nanostructures and more importantly, the abundant free radicals generated underneath the surface continuously migrate to the surface and react with environmental molecules. Taking advantage of this mechanism, various biomolecules with different functions can be steadily immobilized on the surface of PTFE by simple solution immersion. As examples, three typical biomolecules, heparin, SDF-1α, and CD47, are covalently grafted onto the PTFE. In addition to retaining the bioactivity, the surface-functionalized PTFE exhibits reduced thrombogenicity, facilitates the recruitment of endothelial progenitor cells, and even alleviates the inflammatory immune responses of monocytes-macrophages and is thus promising to the development of small-diameter prosthetic vascular grafts with good long-term patency. Copyright © 2017 Elsevier Ltd. All rights reserved.
Reconstructions of the sulfur-passivated InSb (100) surface
Energy Technology Data Exchange (ETDEWEB)
Ciochoń, Piotr, E-mail: piotr.ciochon@doctoral.uj.edu.pl; Olszowska, Natalia; Wróbel, Sonia; Kołodziej, Jacek
2017-04-01
Highlights: • Two new surface reconstructions of a S-passivated InSb (001) surface are reported. • The reconstructions are obtained through partial loss of surface sulfur. • They are characterized by the thickness of ∼4 Å and good crystallographic ordering. • The reconstructions provide adequate electronic passivation of the surface. - Abstract: We have studied the properties of the InSb (100) surface passivated with sulfur dimers emitted by the solid-state electrochemical cell in ultra-high vacuum. Annealing the passivated surface in the temperature equal to T = 326 °C led to the formation of the c(4 × 8) surface reconstruction, while increasing the temperature to T = 348 °C resulted in the transition to c(4 × 12) reconstruction. To the best of our knowledge these reconstructions have not been reported to date and are characterized by the exceptionally good crystallographic order. XPS studies revealed that there are at least 4 different chemical species of sulfur present on the surface and the estimated thickness of the sulfur layers is equal to around 4 Å. The surface reconstructions are characterized by the lowered intensity of the surface electronic states and resonances near the Fermi level, compared to the clean InSb surface, making them potentially very useful for the fabrication of InSb-based electronic and optoelectronic devices.
DEFF Research Database (Denmark)
Saeed, H.; Abdallah, B. M.; Ditzel, N.
2011-01-01
Telomere shortening owing to telomerase deficiency leads to accelerated senescence of human skeletal (mesenchymal) stem cells (MSCs) in vitro, whereas overexpression leads to telomere elongation, extended life span, and enhanced bone formation. To study the role of telomere shortening in vivo, we...... studied the phenotype of telomerase-deficient mice (Terc(-/-)).Terc(-/-) mice exhibited accelerated age-related bone loss starting at 3 months of age and during 12 months of follow-up revealed by dual-energy X-ray absorptiometric (DXA) scanning and by micro-computed tomography (mu CT). Bone...... histomorphometry revealed decreased mineralized surface and bone-formation rate as well as increased osteoclast number and size in Terc(-/-) mice. Also, serum total deoxypyridinoline (tDPD) was increased in Terc(-/-) mice. MSCs and osteoprogenitors isolated from Terc(-l-) mice exhibited intrinsic defects...
Directory of Open Access Journals (Sweden)
Osękowska Małgorzata
2015-09-01
Full Text Available In this work the physicochemical and biological properties of nanocrystalline TiO2 thin films were investigated. Thin films were prepared by magnetron sputtering method. Their properties were examined by X-ray diffraction, photoelectron spectroscopy, atomic force microscopy, optical transmission method and optical profiler. Moreover, surface wettability and scratch resistance were determined. It was found that as-deposited coatings were nanocrystalline and had TiO2-anatase structure, built from crystallites in size of 24 nm. The surface of the films was homogenous, composed of closely packed grains and hydrophilic. Due to nanocrystalline structure thin films exhibited good scratch resistance. The results were correlated to the biological activity (in vitro of thin films. Morphological changes of mouse fibroblasts (L929 cell line after contact with the surface of TiO2 films were evaluated with the use of a contrast-phase microscope, while their viability was tested by MTT colorimetric assay. The viability of cell line upon contact with the surface of nanocrystalline TiO2 film was comparable to the control sample. L929 cells had homogenous cytoplasm and were forming a confluent monofilm, while lysis and inhibition of cell growth was not observed. Moreover, the viability in contact with surface of examined films was high. This confirms non-cytotoxic effect of TiO2 film surface on mouse fibroblasts.
Aligned gold nanoneedle arrays for surface-enhanced Raman scattering
International Nuclear Information System (INIS)
Yang Yong; Huang Zhengren; Jiang Dongliang; Tanemura, Masaki; Yamaguchi, Kohei; Li Zhiyuan; Huang Yingping; Kawamura, Go; Nogami, Masayuki
2010-01-01
A simple Ar + -ion irradiation route has been developed to prepare gold nanoneedle arrays on glass substrates for surface-enhanced Raman scattering (SERS)-active substrates. The nanoneedles exhibited very sharp tips with an apex diameter of 20 nm. These arrays were evaluated as potential SERS substrates using malachite green molecules and exhibited a SERS enhancement factor of greater than 10 8 , which is attributed to the localized electron field enhancement around the apex of the needle and the surface plasmon coupling originating from the periodic structure. This work demonstrates a new technique for producing controllable and reproducible SERS substrates potentially applicable for chemical and biological assays.
International Nuclear Information System (INIS)
Yin, Hongyao; Xiao, Haibo; Ding, Lei; Zhang, Chun; Ren, Aiming; Li, Bo
2015-01-01
A spirobifluorene-bridged donor/donor chromophore, 2,7-bis-(4-(N,N-diphenylamino)phen-1-yl)-9,9′-spirobifluorene (SPF-TP), was found to combine excellent transparency in the near UV–visible region (λ cut-off ≤ 420 nm), large two-photon absorption cross-section (4.5 × 10 3 GM) and high thermal stability (T d = 501 °C). In comparison to the reported two-photon absorption molecules, SPF-TP represents the best thermal stability so far described in the literature. The main electronic factors explaining the high two-photon absorption activities of SPF-TP were analyzed by theoretical calculations. Cyclic voltammograms were employed to explore the causes of the excellent transparency of SPF-TP. It was found that the spiroconjugation effect is responsible for the excellent nonlinearity/transparency/thermal stability trade-off in SPF-TP. In addition, SPF-TP is also a good two-photon induced blue fluorescent material with high fluorescence quantum yield (Φ = 0.90, in THF). - Highlights: • We report a molecule exhibiting excellent transparency. • The two-photon absorption cross-section is as large as 4.5 × 10 3 GM. • The molecule exhibits excellent thermal stability. • The molecule is a good two-photon induced blue fluorescent material. • The spiroconjugation effect explains the excellent properties
Energy Technology Data Exchange (ETDEWEB)
Yin, Hongyao [Department of Chemistry, Shanghai Normal University, Shanghai 200234 (China); Xiao, Haibo, E-mail: xiaohb@shnu.edu.cn [Department of Chemistry, Shanghai Normal University, Shanghai 200234 (China); Ding, Lei [Department of Chemistry, Shanghai Normal University, Shanghai 200234 (China); Zhang, Chun; Ren, Aiming [State Key Laboratory of Theoretical and Computational Chemistry, Institute of Theoretical Chemistry, Jilin University, Changchun 130023 (China); Li, Bo [Key Laboratory of Polar Materials and Devices, Ministry of Education, East China Normal University, Shanghai 200241 (China)
2015-02-01
A spirobifluorene-bridged donor/donor chromophore, 2,7-bis-(4-(N,N-diphenylamino)phen-1-yl)-9,9′-spirobifluorene (SPF-TP), was found to combine excellent transparency in the near UV–visible region (λ{sub cut-off} ≤ 420 nm), large two-photon absorption cross-section (4.5 × 10{sup 3}GM) and high thermal stability (T{sub d} = 501 °C). In comparison to the reported two-photon absorption molecules, SPF-TP represents the best thermal stability so far described in the literature. The main electronic factors explaining the high two-photon absorption activities of SPF-TP were analyzed by theoretical calculations. Cyclic voltammograms were employed to explore the causes of the excellent transparency of SPF-TP. It was found that the spiroconjugation effect is responsible for the excellent nonlinearity/transparency/thermal stability trade-off in SPF-TP. In addition, SPF-TP is also a good two-photon induced blue fluorescent material with high fluorescence quantum yield (Φ = 0.90, in THF). - Highlights: • We report a molecule exhibiting excellent transparency. • The two-photon absorption cross-section is as large as 4.5 × 10{sup 3}GM. • The molecule exhibits excellent thermal stability. • The molecule is a good two-photon induced blue fluorescent material. • The spiroconjugation effect explains the excellent properties.
Bio-Inspired Polymer Membrane Surface Cleaning
Directory of Open Access Journals (Sweden)
Agnes Schulze
2017-03-01
Full Text Available To generate polyethersulfone membranes with a biocatalytically active surface, pancreatin was covalently immobilized. Pancreatin is a mixture of digestive enzymes such as protease, lipase, and amylase. The resulting membranes exhibit self-cleaning properties after “switching on” the respective enzyme by adjusting pH and temperature. Thus, the membrane surface can actively degrade a fouling layer on its surface and regain initial permeability. Fouling tests with solutions of protein, oil, and mixtures of both, were performed, and the membrane’s ability to self-clean the fouled surface was characterized. Membrane characterization was conducted by investigation of the immobilized enzyme concentration, enzyme activity, water permeation flux, fouling tests, porosimetry, X-ray photoelectron spectroscopy, and scanning electron microscopy.
78 FR 7849 - Culturally Significant Objects Imported for Exhibition
2013-02-04
... Century,'' imported from abroad for temporary exhibition within the United States, are of cultural... also determine that the exhibition or display of the exhibit objects at The Yale Center for British Art..., Bureau of Educational and Cultural Affairs, Department of State. [FR Doc. 2013-02401 Filed 2-1-13; 8:45...
Paredaens, J.; Van den Bussche, J.; Andries, M.; Gemis, M.; Gyssens, M.; Thyssens, I.; Van Gucht, D.; Sarathy, V.; Saxton, L.V.
1992-01-01
GOOD is an acronym, standing for Graph-Oriented Object Database. GOOD is being developed as a joint research effort of Indiana University and the University of Antwerp. The main thrust behind the project is to indicate general concepts that are fundamental to any graph-oriented database
DEFF Research Database (Denmark)
Rose, Caspar
2016-01-01
This article shows how game theory can be applied to model good faith mathematically using an example of a classic legal dispute related to rei vindicato. The issue is whether an owner has a legal right to his good if a person has bought it in good faith by using updated probabilities. The article...
Vignesh; Nayar, Sanjna; Bhuminathan; Mahadevan; Santhosh, S
2015-04-01
The surface area of the titanium dental implant materials can be increased by surface treatments without altering their shape and form, thereby increasing the biologic properties of the biomaterial. A good biomaterial helps in early cell adhesion and cell signaling. In this study, the commercially pure titanium surfaces were prepared to enable machined surfaces to form a control material and to be compared with sandblasted and acid-etched surfaces, laser treated surfaces and titanium dioxide (20 nm) Nano-particle coated surfaces. The surface elements were characterized. The biocompatibility was evaluated by cell culture in vitro using L929 fibroblasts. The results suggested that the titanium dioxide Nano-particle coated surfaces had good osteoconductivity and can be used as a potential method for coating the biomaterial.
Surface-Assisted Dynamic Search Processes.
Shin, Jaeoh; Kolomeisky, Anatoly B
2018-03-01
Many chemical and biological systems exhibit intermittent search phenomena when participating particles alternate between dynamic regimes with different dimensionalities. Here we investigate theoretically a dynamic search process of finding a small target on a two-dimensional surface starting from a bulk solution, which is an example of such an intermittent search process. Both continuum and discrete-state stochastic descriptions are developed. It is found that depending on the scanning length λ, which describes the area visited by the reacting molecule during one search cycle, the system can exhibit three different search regimes: (i) For small λ values, the reactant finds the target mostly via three-dimensional bulk diffusion; (ii) for large λ values, the reactant molecule associates to the target mostly via surface diffusion; and (iii) for intermediate λ values, the reactant reaches the target via a combination of three-dimensional and two-dimensional search cycles. Our analysis also shows that the mean search times have different scalings as a function of the size of the surface segment depending on the nature of the dynamic search regime. Search dynamics are also sensitive to the position of the target for large scanning lengths. In addition, it is argued that the continuum description underestimates mean search times and does not always correctly describe the most optimal conditions for the surface-assisted dynamic processes. The importance of our findings for real natural systems is discussed.
DEFF Research Database (Denmark)
This edited collection shows that good parenthood is neither fixed nor stable. The contributors show how parenthood is equally done by men, women and children, in and through practices involving different normative guidelines. The book explores how normative layers of parenthood are constituted...... by notions such as good childhood, family ideals, national public health and educational strategies. The authors illustrate how different versions of parenthood coexist and how complex sets of actions are demanded to fulfil today’s expectations of parenthood in Western societies. This interdisciplinary book...
Environment construction and bottleneck breakthrough in the improvement of wisdom exhibition
Zhang, Jiankang
2017-08-01
Wisdom exhibition is an inexorable trend in convention and exhibition industry in China. Information technology must be utilized by exhibition industry to achieve intelligent application and wisdom management, breaking the limitation of time as well as space, which raise the quality of exhibition service and level of operation to a totally new standard. Accordingly, exhibition industry should optimize mobile internet, a fundamental technology platform, during the advancing process of wisdom exhibition and consummate the combination among three plates including wisdom connection of information, wisdom exhibition environment and wisdom application of technology. Besides, the industry should realize the wisdom of external environment including wisdom of exhibition city, exhibition place, exhibition resource deal etc and break through bottle-neck in construction of wisdom exhibition industry, which includes construction of big data center, development of Mobile Internet application platform, promotion of information construction, innovative design of application scenarios.
76 FR 68808 - Culturally Significant Objects Imported for Exhibition
2011-11-07
... also determine that the exhibition or display of the exhibit objects at the Onassis Cultural Center... Century AD,'' imported from abroad for temporary exhibition within the United States, are of cultural... Cultural Affairs, Department of State. [FR Doc. 2011-28805 Filed 11-4-11; 8:45 am] BILLING CODE 4710-05-P ...
Symmetric and asymmetric capillary bridges between a rough surface and a parallel surface.
Wang, Yongxin; Michielsen, Stephen; Lee, Hoon Joo
2013-09-03
Although the formation of a capillary bridge between two parallel surfaces has been extensively studied, the majority of research has described only symmetric capillary bridges between two smooth surfaces. In this work, an instrument was built to form a capillary bridge by squeezing a liquid drop on one surface with another surface. An analytical solution that describes the shape of symmetric capillary bridges joining two smooth surfaces has been extended to bridges that are asymmetric about the midplane and to rough surfaces. The solution, given by elliptical integrals of the first and second kind, is consistent with a constant Laplace pressure over the entire surface and has been verified for water, Kaydol, and dodecane drops forming symmetric and asymmetric bridges between parallel smooth surfaces. This solution has been applied to asymmetric capillary bridges between a smooth surface and a rough fabric surface as well as symmetric bridges between two rough surfaces. These solutions have been experimentally verified, and good agreement has been found between predicted and experimental profiles for small drops where the effect of gravity is negligible. Finally, a protocol for determining the profile from the volume and height of the capillary bridge has been developed and experimentally verified.
Drag reduction in reservoir rock surface: Hydrophobic modification by SiO{sub 2} nanofluids
Energy Technology Data Exchange (ETDEWEB)
Yan, Yong-Li, E-mail: yylhill@163.com [College of Chemistry & Chemical Engineering, Xi’an Shiyou University, Xi’an 710065 (China); Cui, Ming-Yue; Jiang, Wei-Dong; He, An-Le; Liang, Chong [Langfang Branch of Research Institute of Petroleum Exploration & Development, Langfang 065007 (China)
2017-02-28
Graphical abstract: The micro-nanoscale hierarchical structures at the sandstone core surface are constructed by adsorption of the modified silica nanoparticles, which leads to the effect of drag reduction to improve the low injection rate in ultra-low permeability reservoirs. - Highlights: • A micro-nanoscale hierarchical structure is formed at the reservoir rock surface. • An inversion has happened from hydrophilic into hydrophobic modified by nanofluids. • The effect of drag reduction to improve the low injection rate is realized. • The mechanism of drag reduction induced from the modified core surface was unclosed. - Abstract: Based on the adsorption behavior of modified silica nanoparticles in the sandstone core surface, the hydrophobic surface was constructed, which consists of micro-nanoscale hierarchical structure. This modified core surface presents a property of drag reduction and meets the challenge of high injection pressure and low injection rate in low or ultra-low permeability reservoir. The modification effects on the surface of silica nanoparticles and reservoir cores, mainly concerning hydrophobicity and fine structure, were determined by measurements of contact angle and scanning electron microscopy. Experimental results indicate that after successful modification, the contact angle of silica nanoparticles varies from 19.5° to 141.7°, exhibiting remarkable hydrophobic properties. These modified hydrophobic silica nanoparticles display a good adsorption behavior at the core surface to form micro-nanobinary structure. As for the wettability of these modified core surfaces, a reversal has happened from hydrophilic into hydrophobic and its contact angle increases from 59.1° to 105.9°. The core displacement experiments show that the relative permeability for water has significantly increased by an average of 40.3% via core surface modification, with the effects of reducing injection pressure and improving injection performance of water
Transportation of hazardous goods
TS Department
2008-01-01
A general reminder: any transportation of hazardous goods by road is subject to the European ADR rules. The goods concerned are essentially the following: Explosive substances and objects; Gases (including aerosols and non-flammable gases such as helium and nitrogen); Flammable substances and liquids (inks, paints, resins, petroleum products, alcohols, acetone, thinners); Toxic substances (acids, thinners); Radioactive substances; Corrosive substances (paints, acids, caustic products, disinfectants, electrical batteries). Any requests for the transport of hazardous goods must be executed in compliance with the instructions given at this URL: http://ts-dep.web.cern.ch/ts-dep/groups/he/HH/adr.pdf Heavy Handling Section TS-HE-HH 73793 - 160364
Case study of virtual reality in CNC machine tool exhibition
Directory of Open Access Journals (Sweden)
Kao Yung-Chou
2017-01-01
Full Text Available Exhibition and demonstration are generally used in the promotion and sale-assistance of manufactured products. However, the transportation cost of the real goods from the vender factory to the exposition venue is generally expensive for huge and heavy commodity. With the advancement of computing, graphics, mobile apps, and mobile hardware the 3D visibility technology is getting more and more popular to be adopted in visual-assisted communication such as amusement games. Virtual reality (VR technology has therefore being paid great attention in emulating expensive small and/or huge and heavy equipment. Virtual reality can be characterized as 3D extension with Immersion, Interaction and Imagination. This paper was then be focused on the study of virtual reality in the assistance of CNC machine tool demonstration and exhibition. A commercial CNC machine tool was used in this study to illustrate the effectiveness and usability of using virtual reality for an exhibition. The adopted CNC machine tool is a large and heavy mill-turn machine with the width up to eleven meters and weighted about 35 tons. A head-mounted display (HMD was attached to the developed VR CNC machine tool for the immersion viewing. A user can see around the 3D scene of the large mill-turn machine and the operation of the virtual CNC machine can be actuated by bare hand. Coolant was added to demonstrate more realistic operation while collision detection function was also added to remind the operator. The developed VR demonstration system has been presented in the 2017 Taipei International Machine Tool Show (TIMTOS 2017. This case study has shown that young engineers and/or students are very impressed by the VR-based demonstration while elder persons could not adapt themselves easily to the VR-based scene because of eyesight issues. However, virtual reality has successfully being adopted and integrated with the CNC machine tool in an international show. Another machine tool on
Directory of Open Access Journals (Sweden)
Yang Zhang
2017-10-01
Full Text Available We proposed and demonstrated a novel tilted fiber Bragg grating (TFBG-based surface plasmon resonance (SPR label-free biosensor via a special boronic acid derivative to detect glycoprotein with high sensitivity and selectivity. TFBG, as an effective sensing element for optical sensing in near-infrared wavelengths, possess the unique capability of easily exciting the SPR effect on fiber surface which coated with a nano-scale metal layer. SPR properties can be accurately detected by measuring the variation of transmitted spectra at optical communication wavelengths. In our experiment, a 10° TFBG coated with a 50 nm gold film was manufactured to stimulate SPR on a sensor surface. To detect glycoprotein selectively, the sensor was immobilized using designed phenylboronic acid as the recognition molecule, which can covalently bond with 1,2- or 1,3-diols to form five- or six-membered cyclic complexes for attaching diol-containing biomolecules and proteins. The phenylboronic acid was synthetized with long alkyl groups offering more flexible space, which was able to improve the capability of binding glycoprotein. The proposed TFBG-SPR sensors exhibit good selectivity and repeatability with a protein concentration sensitivity up to 2.867 dB/ (mg/mL and a limit of detection (LOD of 15.56 nM.
Art exhibit focuses on African astronomy
Showstack, Randy
2012-07-01
Connections between Africans and astronomy are the focus of a new exhibition in the National Museum of African Art in Washington, D. C. "African Cosmos: Stellar Arts," which includes artwork, cultural items, and scientific displays from ancient to contemporary times, is the first major exhibit "that brings together arts and science focused on Africa's contribution to keen observations of the heavens over time," curator Christine Mullen Kreamer said at a 20 June news briefing. Among the exhibit's nearly 100 objects are an ancient Egyptian mummy board that includes a representation of the sky goddess Nut, sculptures by the Dogon people of Mali depicting figures in relation to the cosmos, a video that uses data from two square degrees of the Hubble Space Telescope Cosmic Evolution Survey, and a nearly floor-to-ceiling "Rainbow Serpent" constructed of plastic containers by Benin artist Hazoume. An untitled acrylic painting (Figure 1) by South African Gavin Jantjes evokes a myth of the Khoi San people of southern Africa, as it portrays a girl throwing evening fire embers into the night sky, where they remained as the Milky Way.
Cell surface hydrophobicity of dental plaque microorganisms in situ.
Rosenberg, M; Judes, H; Weiss, E
1983-01-01
The cell surface hydrophobicity of bacteria obtained directly from human tooth surfaces was assayed by measuring their adherence to liquid hydrocarbons. Fresh samples of supragingival dental plaque were washed and dispersed in buffer. Adherence of the plaque microorganisms to hexadecane, octane, and xylene was tested turbidimetrically and by direct microscopic observation. The results clearly show that the vast majority of bacteria comprising dental plaque exhibit pronounced cell surface hydr...
Li, Gui-yin; Zhou, Zhi-de; Li, Yuan-jian; Huang, Ke-long; Zhong, Ming
2010-12-01
A novel and efficient immobilization of yeast alcohol dehydrogenase (YADH, EC1.1.1.1) from Saccharomyces cerevisiae has been developed by using the surface functionalization of chitosan-coated magnetic nanoparticles (Fe 3O 4/KCTS) as support. The magnetic Fe 3O 4/KCTS nanoparticles were prepared by binding chitosan alpha-ketoglutaric acid (KCTS) onto the surface of magnetic Fe 3O 4 nanoparticles. Later, covalent immobilization of YADH was attempted onto the Fe 3O 4/KCTS nanoparticles. The effect of various preparation conditions on the immobilized YADH process such as immobilization time, enzyme concentration and pH was investigated. The influence of pH and temperature on the activity of the free and immobilized YADH using phenylglyoxylic acid as substrate has also been studied. The optimum reaction temperature and pH value for the enzymatic conversion catalyzed by the immobilized YADH were 30 °C and 7.4, respectively. Compared to the free enzyme, the immobilized YADH retained 65% of its original activity and exhibited significant thermal stability and good durability.
Health-promoting properties exhibited by Lactobacillus helveticus strains.
Skrzypczak, Katarzyna; Gustaw, Waldemar; Waśko, Adam
2015-01-01
Many strains belonging to lactobacilli exert a variety of beneficial health effects in humans and some of the bacteria are regarded as probiotic microorganisms. Adherence and capabilities of colonization by Lactobacillus strains of the intestinal tract is a prerequisite for probiotic strains to exhibit desired functional properties. The analysis conducted here aimed at screening strains of Lactobacillus helveticus possessing a health-promoting potential. The molecular analysis performed, revealed the presence of a slpA gene encoding the surface S-layer protein SlpA (contributing to the immunostimulatory activity of L. helveticus M 92 probiotic strain) in all B734, DSM, T80, and T105 strains. The product of gene amplification was also identified in a Bifidobacterium animalis ssp. lactis BB12 probiotic strain. SDS-PAGE of a surface protein extract demonstrated the presence of a protein with a mass of about 50 kDa in all strains, which refers to the mass of the S-layer proteins. These results are confirmed by observations carried with transmission electron microscopy, where a clearly visible S-layer was registered in all the strains analyzed. The in vitro study results obtained indicate that the strongest adhesion capacity to epithelial cells (HT-29) was demonstrated by L. helveticus B734, while coaggregation with pathogens was highly diverse among the tested strains. The percentage degree of coaggregation was increasing with the incubation time. After 5 h of incubation, the strongest ability to coaggregate with Escherichia coli was expressed by T104. The T80 strain demonstrated a significant ability to co-aggregate with Staphylococcus aureus, while DSM with Bacillus subtilis. For B734, the highest values of co-aggregation coefficient was noted in samples with Salmonella. The capability of autoaggregation, antibiotic susceptibility, resistance to increasing salt concentrations, and strain survival in simulated small intestinal juice were also analyzed.
Energy Technology Data Exchange (ETDEWEB)
Li Qian; Bi Qiuyan; Zhou Bo [Membrane Technology and Engineering Research Center, Department of Chemical Engineering, Tsinghua University, Beijing 100084 (China); Wang Xiaolin, E-mail: xl-wang@tsinghua.edu.cn [Membrane Technology and Engineering Research Center, Department of Chemical Engineering, Tsinghua University, Beijing 100084 (China)
2012-03-01
A zwitterionic polymer, poly(3-(methacryloylamino) propyl-dimethyl-(3-sulfopropyl) ammonium hydroxide) (poly(MPDSAH)) was successfully grafted in high density from the surface of poly(vinylidene fluoride) (PVDF) hollow fiber membrane via a two-step polymerization. Poly(2-hydroxyethyl methacrylate) (poly(HEMA)) chains were firstly grafted from outside surface of PVDF membrane through atom transfer radical polymerization (ATRP) to provide the initiation sites for subsequent cerium (Ce (IV))-induced graft copolymerization of polyMPDSAH in the presence of N,N Prime -ethylene bisacrylamide (EBAA) as a cross-linking agent. Attenuated total reflectance-Fourier transform infrared (ATR-FTIR) spectroscopy, X-ray photoelectron spectroscopy (XPS) confirmed that the EBAA could stimulate zwitterionic polymers grafting onto the membrane surface. The dense poly(MPDSAH) layers on the PVDF membrane surface were revealed by the scanning electron microscope (SEM). The mechanical property of PVDF membrane was improved by the zwitterionic surface layers. The gravimetry results indicated the grafting amount increased to 520 {mu}g/cm{sup 2} for a copolymerization time of more than 3 h. Static and dynamic water contact angle measurements showed that the surface hydrophilicity of the PVDF membranes was significantly enhanced. As the grafting amount reached 513 {mu}g cm{sup -2}, the value of contact angle dropped to 22.1 Degree-Sign and the amount of protein adsorption decreased to zero. The cyclic experiments for BSA solution filtration demonstrated that the extent of protein fouling was significantly reduced and most of the fouling was reversible. The grafted polymer layer on the PVDF membrane showed a good stability during the membrane cleaning process. The experimental results concluded a good prospect in obtaining the sulfobetaine-modified PVDF membranes with high mechanical strength, good anti-protein-fouling performance, and long-term stability via the two-step polymerization.
International Nuclear Information System (INIS)
Li Qian; Bi Qiuyan; Zhou Bo; Wang Xiaolin
2012-01-01
A zwitterionic polymer, poly(3-(methacryloylamino) propyl-dimethyl-(3-sulfopropyl) ammonium hydroxide) (poly(MPDSAH)) was successfully grafted in high density from the surface of poly(vinylidene fluoride) (PVDF) hollow fiber membrane via a two-step polymerization. Poly(2-hydroxyethyl methacrylate) (poly(HEMA)) chains were firstly grafted from outside surface of PVDF membrane through atom transfer radical polymerization (ATRP) to provide the initiation sites for subsequent cerium (Ce (IV))-induced graft copolymerization of polyMPDSAH in the presence of N,N′-ethylene bisacrylamide (EBAA) as a cross-linking agent. Attenuated total reflectance-Fourier transform infrared (ATR-FTIR) spectroscopy, X-ray photoelectron spectroscopy (XPS) confirmed that the EBAA could stimulate zwitterionic polymers grafting onto the membrane surface. The dense poly(MPDSAH) layers on the PVDF membrane surface were revealed by the scanning electron microscope (SEM). The mechanical property of PVDF membrane was improved by the zwitterionic surface layers. The gravimetry results indicated the grafting amount increased to 520 μg/cm 2 for a copolymerization time of more than 3 h. Static and dynamic water contact angle measurements showed that the surface hydrophilicity of the PVDF membranes was significantly enhanced. As the grafting amount reached 513 μg cm -2 , the value of contact angle dropped to 22.1° and the amount of protein adsorption decreased to zero. The cyclic experiments for BSA solution filtration demonstrated that the extent of protein fouling was significantly reduced and most of the fouling was reversible. The grafted polymer layer on the PVDF membrane showed a good stability during the membrane cleaning process. The experimental results concluded a good prospect in obtaining the sulfobetaine-modified PVDF membranes with high mechanical strength, good anti-protein-fouling performance, and long-term stability via the two-step polymerization.
The global public good concept: a means of promoting good veterinary governance.
Eloit, M
2012-08-01
At the outset, the concept of a 'public good' was associated with economic policies. However, it has now evolved not only from a national to a global concept (global public good), but also from a concept applying solely to the production of goods to one encompassing societal issues (education, environment, etc.) and fundamental rights, including the right to health and food. Through their actions, Veterinary Services, as defined by the Terrestrial Animal Health Code (Terrestrial Code) of the World Organisation for Animal Health (OIE), help to improve animal health and reduce production losses. In this way they contribute directly and indirectly to food security and to safeguarding human health and economic resources. The organisation and operating procedures of Veterinary Services are therefore key to the efficient governance required to achieve these objectives. The OIE is a major player in global cooperation and governance in the fields of animal and public health through the implementation of its strategic standardisation mission and other programmes for the benefit of Veterinary Services and OIE Member Countries. Thus, the actions of Veterinary Services and the OIE deserve to be recognised as a global public good, backed by public investment to ensure that all Veterinary Services are in a position to apply the principles of good governance and to comply with the international standards for the quality of Veterinary Services set out in the OIE Terrestrial Code (Section 3 on Quality of Veterinary Services) and Aquatic Animal Health Code (Section 3 on Quality of Aquatic Animal Health Services).
International Nuclear Information System (INIS)
Hanyu, Naohiro; Nishio, Kosuke; Hatakeyama, Mamoru; Yasuno, Hiroshi; Tanaka, Toshiyuki; Tada, Masaru; Nakagawa, Takashi; Sandhu, Adarsh; Abe, Masanori; Handa, Hiroshi
2009-01-01
For affinity purification of drug target protein we have developed magnetic carriers, narrow in size distribution (184±9 nm), which exhibit minimal non-specific binding of unwanted proteins. The carriers were highly dispersed in aqueous solutions and highly resistant to organic solvents, which enabled immobilization of various hydrophobic chemicals as probes on the carrier surfaces. Utilizing the carriers we have automated the process of separation and purification of the target proteins that had been done by manual operation previously.
Energy Technology Data Exchange (ETDEWEB)
Tsai, Ming-Hung [Department of Mechanical Engineering and Graduate Institute of Mechanical and Precision Engineering, National Kaoshiung University of Applied Sciences, Kaoshiung 807, Taiwan (China); School of Dentistry, College of Oral Medicine, Taipei Medical University, Taipei 110, Taiwan (China); Haung, Chiung-Fang [School of Dental Technology, College of Oral Medicine, Taipei Medical University, Taipei 110, Taiwan (China); Division of Family and Operative Dentistry, Department of Dentistry, Taipei Medical University Hospital, Taipei 110, Taiwan (China); Research Center for Biomedical Devices and Prototyping Production, Taipei Medical University, Taipei 110, Taiwan (China); Shyu, Shih-Shiun [Department of Dentistry, Taipei Tzu Chi Hospital, Buddhist Tzu Chi Medical Foundation, New Taipei City 231, Taiwan (China); Chou, Yen-Ru [Research Center for Biomedical Devices and Prototyping Production, Taipei Medical University, Taipei 110, Taiwan (China); Graduate Institute of Biomedical Materials and Tissue Engineering, College of Oral Medicine, Taipei Medical University, Taipei 110, Taiwan (China); Research Center for Biomedical Implants and Microsurgery Devices, Taipei Medical University, Taipei 110, Taiwan (China); Lin, Ming-Hong [Department of Mechanical Engineering and Graduate Institute of Mechanical and Precision Engineering, National Kaoshiung University of Applied Sciences, Kaoshiung 807, Taiwan (China); Peng, Pei-Wen, E-mail: apon@tmu.edu.tw [School of Dental Technology, College of Oral Medicine, Taipei Medical University, Taipei 110, Taiwan (China); and others
2015-08-15
In this study, neodymium-doped yttrium orthovanadate (Nd:YVO{sub 4}) as a laser source with different scanning speeds was used on biomedical Ti surface. The microstructural and biological properties of laser-modified samples were investigated by means of optical microscope, electron microscope, X-ray diffraction, surface roughness instrument, contact angle and cell cytotoxicity assay. After laser modification, the rough volcano-like recast layer with micro-/nanoporous structure and wave-like recast layer with nanoporous structure were generated on the surfaces of laser-modified samples, respectively. It was also found out that, an α → (α + rutile-TiO{sub 2}) phase transition occurred on the recast layers of laser-modified samples. The Ti surface becomes hydrophilic at a high speed laser scanning. Moreover, the cell cytotoxicity assay demonstrated that laser-modified samples did not influence the cell adhesion and proliferation behaviors of osteoblast (MG-63) cell. The laser with 50 mm/s scanning speed induced formation of rough volcano-like recast layer accompanied with micro-/nanoporous structure, which can promote cell adhesion and proliferation of MG-63 cell on Ti surface. The results indicated that the laser treatment was a potential technology to enhance the biocompatibility for titanium. - Highlights: • Laser induced the formation of recast layer with micro-/nanoporous structure on Ti. • An α → (α + rutile-TiO{sub 2}) phase transition was observed within the recast layer. • The Ti surface becomes hydrophilic at a high speed laser scanning. • Laser-modified samples exhibit good biocompatibility to osteoblast (MG-63) cell.
Preserving half-metallic surface states in Cr O2 : Insights into surface reconstruction rules
Deng, Bei; Shi, X. Q.; Chen, L.; Tong, S. Y.
2018-04-01
The issue of whether the half-metallic (HM) nature of Cr O2 could be retained at its surface has been a standing problem under debate for a few decades, but until now is still controversial. Here, based on the density functional theory calculations we show, in startling contrast to the previous theoretical understandings, that the surfaces of Cr O2 favorably exhibit a half-metallic-semiconducting (SmC) transition driven by means of a surface electronic reconstruction largely attributed to the participation of the unexpected local charge carriers (LCCs), which convert the HM double exchange surface state into a SmC superexchange state and in turn, stabilize the surface as well. On the basis of the LCCs model, a new insight into the surface reconstruction rules is attained. Our novel finding not only provided an evident interpretation for the widely observed SmC character of Cr O2 surface, but also offered a novel means to improve the HM surface states for a variety of applications in spintronics and superconductors, and promote the experimental realization of the quantum anomalous Hall effect in half-metal based systems.
Energy Technology Data Exchange (ETDEWEB)
Rožić, L.J., E-mail: ljrozic@nanosys.ihtmbg.ac.rs [University of Belgrade, IChTM-Department of Catalysis and Chemical Engineering, Njegoševa 12, Belgrade (Serbia); Petrović, S.; Radić, N. [University of Belgrade, IChTM-Department of Catalysis and Chemical Engineering, Njegoševa 12, Belgrade (Serbia); Stojadinović, S. [University of Belgrade, Faculty of Physics, Studentski trg 12-16, Belgrade (Serbia); Vasilić, R. [Faculty of Environmental Governance and Corporate Responsibility, Educons University, Vojvode Putnika 87, Sremska Kamenica (Serbia); Stefanov, P. [Institute of General and Inorganic Chemistry, Bulgarian Academy of Sciences, Sofia 1113 (Bulgaria); Grbić, B. [University of Belgrade, IChTM-Department of Catalysis and Chemical Engineering, Njegoševa 12, Belgrade (Serbia)
2013-07-31
In this study, we have shown that atomic force microscopy is a powerful technique to study the fractal parameters of TiO{sub 2}/WO{sub 3} coatings prepared by plasma electrolytic oxidation (PEO) process. Since the surface roughness of obtained oxide coatings affects their physical properties, an accurate description of roughness parameters is highly desirable. The surface roughness, described by root mean squared and arithmetic average values, is analyzed considering the scans of a series of atomic force micrographs. The results show that the oxide coatings exhibit lower surface roughness in initial stage of PEO process. Also, the surfaces of TiO{sub 2}/WO{sub 3} coatings exhibit fractal behavior. Positive correlation between the fractal dimension and surface roughness of the surfaces of TiO{sub 2}/WO{sub 3} coatings in initial stage of PEO process was found. - Highlights: • TiO{sub 2}/WO{sub 3} coatings were obtained by plasma electrolytic oxidation. • Oxide coatings exhibit lower surface roughness in initial stage of process. • The surfaces of TiO{sub 2}/WO{sub 3} coatings exhibit fractal behavior.
Science Museum Exhibits' Summative Evaluation with Knowledge Hierarchy Method
Yasar, Erkan; Gurel, Cem
2016-01-01
It is aimed in this research to measure via knowledge hierarchy the things regarding exhibit themes learned by the visitors of the exhibits and compare them with the purpose that the exhibits are designed for, thereby realizing a summative evaluation of the exhibits by knowledge hierarchy method. The research has been conducted in a children's…
Self-Assembly of 3D Fennel-Like Co3O4 with Thirty-Six Surfaces for High Performance Supercapacitor
Directory of Open Access Journals (Sweden)
Yanfang Li
2017-01-01
Full Text Available Three-dimensional (3D fennel-like cobalt oxide (II, III (Co3O4 particles with thirty-six surfaces on nickel foams were prepared via a simple hydrothermal synthesis method and its growth process was also researched. The crystalline structure and morphology were investigated by X-ray diffraction (XRD, scanning electron microscopy (SEM, and Raman spectroscopy. The Brunauer-Emmett-Teller (BET analysis revealed that 3D fennel-like Co3O4 particles have high specific surface area. Therefore, the special structure with thirty-six surfaces indicates the good electrochemical performance of the micron-nanometer material as electrode material for supercapacitors. The cyclic voltammetry (CV, galvanostatic charge-discharge, and electrochemical impedance spectroscopy (EIS were conducted to evaluate the electrochemical performances. Compared with other morphological materials of the similar sizes, the Co3O4 particles on nickel foam exhibit a high specific capacitance of 384.375 F·g−1 at the current density of 3 A·g−1 and excellent cycling stability of a capacitance retention of 96.54% after 1500 galvanostatic charge-discharge cycles in 6 M potassium hydroxide (KOH electrolyte.
Displaying lives: the narrative of objects in biographical exhibitions
Directory of Open Access Journals (Sweden)
Caterina Albano
2007-03-01
Full Text Available Biographical exhibitions are a museum practice that asks for critical consideration. Grounding the argument in critical theory, social studies and museum theory, the article explores the narrative function of objects in biographical exhibitions by addressing the social significance of objects in relation to biography and their relevance when presented into an exhibition display. Central is the concept of objects as ‘biographical relics’ that are culturally fetishized in biographical narratives. This raises questions about biographical reliability and the cultural role that such objects plays in exhibition narratives as bearers of reality and as metonymical icons of the biographical subject. The article considers examples of biographical exhibitions of diverse figures such as Gregor Mendel, Madame de Pompadour and Roland Barthes, and the role that personal items, but also portraits and photographs, play in them.
Switchable directional excitation surface plasmon polaritons with dielectric nanoantennas
DEFF Research Database (Denmark)
Sinev, I.; Komissarenko, F.; Bogdanov, A.
2017-01-01
We demonstrate directional launching of surface plasmon polaritons on thin goldfilm with a single silicon nanosphere. The directivity pattern of the excited surface waves exhibits rapid switching from forward to backward excitation, which is driven by the mutual interference of magnetic and elect...... and electric dipole moments supported by the dielectric nanoantenna....
Differential topology of complex surfaces elliptic surfaces with p g=1 smooth classification
Morgan, John W
1993-01-01
This book is about the smooth classification of a certain class of algebraicsurfaces, namely regular elliptic surfaces of geometric genus one, i.e. elliptic surfaces with b1 = 0 and b2+ = 3. The authors give a complete classification of these surfaces up to diffeomorphism. They achieve this result by partially computing one of Donalson's polynomial invariants. The computation is carried out using techniques from algebraic geometry. In these computations both thebasic facts about the Donaldson invariants and the relationship of the moduli space of ASD connections with the moduli space of stable bundles are assumed known. Some familiarity with the basic facts of the theory of moduliof sheaves and bundles on a surface is also assumed. This work gives a good and fairly comprehensive indication of how the methods of algebraic geometry can be used to compute Donaldson invariants.
Radiative Transfer Model for Contaminated Rough Surfaces
2013-02-01
reflectance of potassium chlorate and ammonium nitrate contaminated surfaces in mid-wavelength and long-wavelength infrared for detection. Our framework...obtained excellent or good results for lab measurements of potassium chlorate on most aluminum surfaces; however, ammonium nitrate on painted aluminum...misidentify potassium chlorate as ammonium nitrate and vice versa). We also observed moderate success on field data. 15. SUBJECT TERMS radiative
Scattering of surface plasmons on graphene by a discontinuity in surface conductivity
International Nuclear Information System (INIS)
Rejaei, Behzad; Khavasi, Amin
2015-01-01
The scattering of graphene surface plasmons from an arbitrary, one-dimensional discontinuity in graphene surface conductivity is treated analytically by an exact solution of the quasi-static integral equation for surface current density in the spectral domain. It is found that the reflection and transmission coefficients are not governed by the Fresnel formulas obtained by means of the effective medium approach. Furthermore, the reflection coefficient generally exhibits an anomalous reflection phase, which has so far only been reported for the particular case of reflection from abrupt edges. This anomalous phase becomes frequency-independent in the regime where the effect of inter-band transitions on graphene conductivity is negligible. The results are in excellent agreement with full-wave electromagnetic simulations, and can serve as a basis for the analysis of inhomogeneous graphene layers with a piecewise-constant conductivity profile. (paper)
An Astrobiology Microbes Exhibit and Education Module
Lindstrom, Marilyn M.; Allen, Jaclyn S.; Stocco, Karen; Tobola, Kay; Olendzenski, Lorraine
2001-01-01
Telling the story of NASA-sponsored scientific research to the public in exhibits is best done by partnerships of scientists and museum professionals. Likewise, preparing classroom activities and training teachers to use them should be done by teams of teachers and scientists. Here we describe how we used such partnerships to develop a new astrobiology augmentation to the Microbes! traveling exhibit and a companion education module. "Additional information is contained in the original extended abstract."
International Space Station exhibit
2000-01-01
The International Space Station (ISS) exhibit in StenniSphere at John C. Stennis Space Center in Hancock County, Miss., gives visitors an up-close look at the largest international peacetime project in history. Step inside a module of the ISS and glimpse how astronauts will live and work in space. Currently, 16 countries contribute resources and hardware to the ISS. When complete, the orbiting research facility will be larger than a football field.
Zhang, Zhengwei; Yan, Kun; Yang, Qiulian; Liu, Yanhua; Yan, Zhengyu; Chen, Jianqiu
2017-12-01
Here we report an easy and economical hydrothermal carbonization approach to synthesize the fluorescent nitrogen-doped carbon dots (N-CDs) that was developed using citric acid and triethanolamine as the precursors. The synthesis conditions were optimized to obtain the N-CDs with superior fluorescence performances. The as-prepared N-CDs are monodispersed sphere nanoparticles with good water solubility, and exhibited strong fluorescence, favourable photostability and excitation wavelength-dependent behavior. Furthermore, the in vitro cytotoxicity and cellular labeling of N-CDs were investigated using the rat glomerular mesangial cells. The results showed the N-CDs have more inconspicuous cytotoxicity and better biosafety in comparison with ZnSe quantum dots, although both targeted the cells successfully. Considering their admirable photostability, low toxicity and good compatibility, the as-obtained N-CDs could have potential applications in biosensors, cellular imaging, and other fields. Copyright © 2017 John Wiley & Sons, Ltd.
The Signatures of the Invisible exhibition in Geneva
Patrice Loïez
2002-01-01
The artist Paola Pivi with her work at the Signatures of the Invisible exhibition in Geneva during February 2002. This piece with needles suspended on nylon thread 'detects' people as they approach. The exhibition was for art inspired by research carried out at CERN.
Fabrication of Self-Cleaning and Anti-Icing Durable Surface on Glass.
Zuo, Zhiping; Liao, Ruijin; Guo, Chao; Zhao, Xuetong; Zhuang, Aoyun; Yuan, Yuan
2017-01-01
Ice accumulation on insulators affected the safety of power system and may inflict serious consequences such as insulator flashover accidents and power failure. This article reported a simple method to prepare anti-icing polydimethylsiloxane superhydrophobic surface on glass by utilizing nano-particle filling method. The effect of concentration of silica nanoparticles on superhydrophobicity of the samples was investigated. The wettability, surface morphology and anti-icing property of the as-prepared superhydrophobic surface were characterized by corresponding methods. Results show that the as-prepared surface with addition amount of 7 g silica nanoparticles exhibited self-cleaning property and excellent superhydrophobicity with a contact angle of 165.7 ± 2.4° and a sliding angle of 3.8°. It was found that the ice formation was delayed for 29 min at −5 °C. Moreover, the as-prepared superhydrophobic surface showed superhydrophobicity in the pH range of 1–13 and exhibited excellent drop impact stability. The as-prepared superhydrophobic surface may be suitable for applications in cold regions owing to its flexibility, durability and anti-icing property.
Paradoxes around good governance
A.G. Dijkstra (Geske)
2013-01-01
textabstract Good governance is not a new concept Ambrogio Lorenzetti made his frescoes on good and bad governance already in the years 1338-1340 They can be viewed in the Palazzo Publicco on one of the most beautiful squares of the world, the Piazza del Campo in Siena, Italy I assume many of you
McKay, Robert B.
1979-01-01
It is argued that the Supreme Court's Bakke decision overturning the University of California's minority admissions program is good for those who favor affirmative action programs in higher education. The Supreme Court gives wide latitude for devising programs that take race and ethnic background into account if colleges are acting in good faith.…
Modulating Protein Adsorption on Oxygen Plasma Modified Polysiloxane Surfaces
International Nuclear Information System (INIS)
Marletta, G.
2006-01-01
In the present paper we report the study on the adsorption behaviour of three model globular proteins, Human Serum Albumin, Lactoferrin and Egg Chicken Lysozyme onto both unmodified surfaces of a silicon-based polymer and the corresponding plasma treated surfaces. In particular, thin films of hydrophobic polysiloxane (about 90 degree of static water contact angle, WCA) were converted by oxygen plasma treatment at reduced pressure into very hydrophilic phases of SiOx (WCA less than 5 degree). The kinetics of protein adsorption processes were investigated by QCM-D technique, while the chemical structure and topography of the protein adlayer have been studied by Angular resolved-XPS and AFM respectively. It turned out that Albumin and Lysozyme exhibited the opposite preferential adsorption respectively onto the hydrophobic and hydrophilic surfaces, while Lactoferrin did not exhibit significant differences. The observed protein behaviour are discussed both in terms of surface-dependent parameters, including surface free energy and chemical structure, and in terms of protein-dependent parameters, including charge as well as the average molecular orientation in the adlayers. Finally, some examples of differential adsorption behaviour of the investigated proteins are reported onto nanopatterned polysiloxane surfaces consisting of hydrophobic nanopores surrounded by hydrophilic (plasma-treated) matrix and the reverse
2010-10-01
... 42 Public Health 1 2010-10-01 2010-10-01 false Good faith. 93.210 Section 93.210 Public Health... MISCONDUCT Definitions § 93.210 Good faith. Good faith as applied to a complainant or witness, means having a... allegation or cooperation with a research misconduct proceeding is not in good faith if made with knowing or...
Learning from Exhibitions: Chuck Close.
Johnson, Mark M.
1998-01-01
Discusses the artwork of Chuck Close, who is well known for his over-sized portraits of fellow artists and anonymous sitters, and the exhibition of his work that premiered at New York's Museum of Modern Art before traveling to other cities in the United States. (CMK)
Exhibition at CERN's Globe of Science and Innovation
Claudia Marcelloni
2006-01-01
Here we see pictures of displays at one of the exhibitions held at the Globe of Science and Innovation taken in September 2006. Located opposite the main CERN site, the Globe houses many public exhibitions throughout the year covering many topics from astronomy to particle physics.
The AAAI 2006 Mobile Robot Competition and Exhibition
Rybski, Paul E.; Forbes, Jeffrey; Burhans, Debra; Dodds, Zach; Oh, Paul; Scheutz, Matthias; Avanzato, Bob
2007-01-01
The Fifteenth Annual AAAI Robot Competition and Exhibition was held at the Twenty-First National Conference on Artificial Intelligence in Boston, Massachusetts, in July 2006. This article describes the events that were held at the conference, including the Scavenger Hunt, Human Robot Interaction, and Robot Exhibition.
The Particular Aspects of Science Museum Exhibits That Encourage Students' Engagement
Shaby, Neta; Assaraf, Orit Ben-Zvi; Tal, Tali
2017-06-01
This research explores learning in science museums through the most common activity in a science museum—interaction with exhibits. The goal of this study was to characterize the learning behaviors exhibited by students as they engage with interactive exhibits in order to draw insight regarding the design of the exhibits. In order to do so, we used a qualitative method of observation as well as the Visitor Engagement Framework (VEF) model, a visitor-based framework for assessing visitors' learning experiences with exhibits in a science center setting. The combined method produced a framework of nine learning behaviors exhibited during the visitors' interaction with the exhibits, grouped into three categories that reflect increasing levels of engagement and depth of the learning experience. Our research participants consisted of a total 1800 students aged 10-12 (4th, 5th, and 6th graders) who came to the museum with their class for a day visit. We observed nine exhibits, each visited by 200 students. Our observations revealed several design elements that contribute to engagement with exhibits in science museums. For example, exhibits that have familiar activation encourage visitors' interaction, exhibits that facilitate social interaction are more likely to increase engagement, and the highest levels of engagement can be found in exhibits that support large groups.
2010-04-01
... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Good faith requests for transmission services and good faith responses by transmitting utilities. 2.20 Section 2.20 Conservation of... Power Act § 2.20 Good faith requests for transmission services and good faith responses by transmitting...
DEFF Research Database (Denmark)
Xiong, Xiaofeng; Wörgötter, Florentin; Manoonpong, Poramate
2014-01-01
The neuromechanical control principles of animal locomotion provide good insights for the development of bio-inspired legged robots for walking on challenging surfaces. Based on such principles, we developed a neuromechanical controller consisting of a modular neural network (MNN) and of virtual...... agonist–antagonist muscle mechanisms (VAAMs). The controller allows for variable compliant leg motions of a hexapod robot, thereby leading to energy-efficient walking on different surfaces. Without any passive mechanisms or torque and position feedback at each joint, the variable compliant leg motions...... are achieved by only changing the stiffness parameters of the VAAMs. In addition, six surfaces can be also classified by observing the motor signals generated by the controller. The performance of the controller is tested on a physical hexapod robot. Experimental results show that it can effectively walk...
A Facile in Situ and UV Printing Process for Bioinspired Self-Cleaning Surfaces
Directory of Open Access Journals (Sweden)
Marina A. González Lazo
2016-08-01
Full Text Available A facile in situ and UV printing process was demonstrated to create self-cleaning synthetic replica of natural petals and leaves. The process relied on the spontaneous migration of a fluorinated acrylate surfactant (PFUA within a low-shrinkage acrylated hyperbranched polymer (HBP and its chemical immobilization at the polymer-air interface. Dilute concentrations of 1 wt. % PFUA saturated the polymer-air interface within 30 min, leading to a ten-fold increase of fluorine concentration at the surface compared with the initial bulk concentration and a water contact angle (WCA of 108°. A 200 ms flash of UV light was used to chemically crosslink the PFUA at the HBP surface prior to UV printing with a polydimethylsiloxane (PDMS negative template of red and yellow rose petals and lotus leaves. This flash immobilization hindered the reverse migration of PFUA within the bulk HBP upon contacting the PDMS template, and enabled to produce texturized surfaces with WCA well above 108°. The synthetic red rose petal was hydrophobic (WCA of 125° and exhibited the adhesive petal effect. It was not superhydrophobic due to insufficient concentration of fluorine at its surface, a result of the very large increase of the surface of the printed texture. The synthetic yellow rose petal was quasi-superhydrophobic (WCA of 143°, roll-off angle of 10° and its self-cleaning ability was not good also due to lack of fluorine. The synthetic lotus leaf did not accurately replicate the intricate nanotubular crystal structures of the plant. In spite of this, the fluorine concentration at the surface was high enough and the leaf was superhydrophobic (WCA of 151°, roll-off angle below 5° and also featured self-cleaning properties.
Conceptions of Good Teaching by Good Teachers: Case Studies from an Australian University
Duarte, Fernanda P.
2013-01-01
This paper contributes to the debate on what constitutes good teaching in early 21st Century higher education, through an examination of the experience of five outstanding lecturers from a business school in an Australian university. It is based on a qualitative study that explored their perceptions on what constitutes "good teaching".…
Understanding Surface Adhesion in Nature: A Peeling Model.
Gu, Zhen; Li, Siheng; Zhang, Feilong; Wang, Shutao
2016-07-01
Nature often exhibits various interesting and unique adhesive surfaces. The attempt to understand the natural adhesion phenomena can continuously guide the design of artificial adhesive surfaces by proposing simplified models of surface adhesion. Among those models, a peeling model can often effectively reflect the adhesive property between two surfaces during their attachment and detachment processes. In the context, this review summarizes the recent advances about the peeling model in understanding unique adhesive properties on natural and artificial surfaces. It mainly includes four parts: a brief introduction to natural surface adhesion, the theoretical basis and progress of the peeling model, application of the peeling model, and finally, conclusions. It is believed that this review is helpful to various fields, such as surface engineering, biomedicine, microelectronics, and so on.
International Nuclear Information System (INIS)
Le Kim Long; Phung Manh Quan; Tran Thi Thanh Van
2012-01-01
Density functional theory (DFT) is used to investigate properties of TiO 2 (110) surface with defects and metal-doped TiO 2 . The results of our calculations of structure of TiO 2 surface have been shown in good agreement with those of experiments and other ab-initio calculations. The differences of band structure between TiO 2 (110) and TiO 2 surface defected show that visible light can excite surface with defects easily. We also investigate density of states (DOS) of metal-doped surface (Li, Ca, Sc, V, Mo, Mn, Fe, Co, Ni) and find that the Mo-doped surface has very small band gap (∼ 0 eV). This surface may have higher photo-chemical activity in visible light. (author)
Asymmetric News Effects on Volatility: Good vs. Bad News in Good vs. Bad Times
Laakkonen, Helinä; Lanne, Markku
2008-01-01
We study the impact of positive and negative macroeconomic US and European news announcements in different phases of the business cycle on the highfrequency volatility of the EUR/USD exchange rate. The results suggest that in general bad news increases volatility more than good news. The news effects also depend on the state of the economy: bad news increases volatility more in good times than in bad times, while there is no difference between the volatility effects of good news in bad and go...
The exhibition Lumiere d'Atomes (Atoms light)
International Nuclear Information System (INIS)
Foos, Jacques
1995-01-01
Full text: This exhibition has been conceived in order to show for everybody, whatever his scientific level, the peaceful uses of transformations (natural or made by Man) and energetic possibilities of the atomic nucleus. The key-ideas of this exhibition were-: - nuclear applications a world of high technology; - nuclear industry men as the others; - nuclear energy an energetic independence. 6 themes were proposed: 1- Atoms and radioactivity; 2- The nuclear power stations; 3- The nuclear fuel cycle; 4- Surety and environment; 5- The other uses of radioactivity; 6- The French choice: The world nuclear data. This exhibition that comprises information posters, paintings, demonstration models, films and video games, was shown for the first time in Paris in april 1991. From this time, it was shown in many regional cities, with the help of SFEN members. 'Lumiere d'Atomes' received in 1991 the SFEN prize for its information on nuclear energy. (author)
'She sort of shines': midwives' accounts of 'good' midwifery and 'good' leadership.
Byrom, Sheena; Downe, Soo
2010-02-01
to explore midwives' accounts of the characteristics of 'good' leadership and 'good' midwifery. a phenomenological interview survey. Participants were asked about what made both good and poor midwives and leaders. two maternity departments within National Health Service trusts in the North West of England. qualified midwives, selected by random sampling stratified to encompass senior and junior grades. thematic analysis, carried out manually. ten midwives were interviewed. Sixteen codes and six sub-themes were generated. Across the responses, two clear dimensions (themes) were identified, relating on the one hand to aspects of knowledge, skill and competence (termed 'skilled competence'), and on the other hand to specific personality characteristics (termed 'emotional intelligence'). This study suggests that the ability to act knowledgeably, safely and competently was seen as a basic requirement for both clinical midwives and midwife leaders. The added element which made both the midwife and the leader 'good' was the extent of their emotional capability. this small-scale in-depth study could form the basis for hypothesis generation for larger scale work in this area in future. The findings offer some reinforcement for the potential applicability of theories of transformational leadership to midwifery management and practice. Copyright 2008 Elsevier Ltd. All rights reserved.
Song, Lei; Sjollema, Jelmer; Norde, Willem; Busscher, Henk J; van der Mei, Henny C
2015-09-29
Bacteria adhering to surfaces exhibit nanoscopic vibrations that depend on the viscoelasticity of the bond. The quantification of the nanoscopic vibrations of bacteria adhering to surfaces provides new opportunities to better understand the properties of the bond through which bacteria adhere and the mechanisms by which they resist detachment. Often, however, bacteria do not adhere to bare surfaces but to adsorbed protein films, on which adhesion involves highly specific ligand-receptor binding next to nonspecific DLVO interaction forces. Here we determine the contribution of adsorbed salivary protein and fibronectin films to vibrations exhibited by adhering streptococci and staphylococci, respectively. The streptococcal strain used has the ability to adhere to adsorbed salivary proteins films through antigen I/II ligand-receptor binding, while the staphylococcal strain used adheres to adsorbed fibronectin films through a proteinaceous ligand-receptor bond. In the absence of ligand-receptor binding, electrostatic interactions had a large impact on vibration amplitudes of adhering bacteria on glass. On an adsorbed salivary protein film, vibration amplitudes of adhering streptococci depended on the film softness as determined by QCM-D and were reduced after film fixation using glutaraldehyde. On a relatively stiff fibronectin film, cross-linking the film in glutaraldehyde hardly reduced its softness, and accordingly fibronectin film softness did not contribute to vibration amplitudes of adhering staphylococci. However, fixation of the staphylococcus-fibronectin bond further decreased vibration amplitudes, while fixation of the streptococcus bond hardly impacted vibration amplitudes. Summarizing, this study shows that both the softness of adsorbed protein films and the properties of the bond between an adhering bacterium and an adsorbed protein film play an important role in bacterial vibration amplitudes. These nanoscopic vibrations reflect the viscoelasticity of the
Characterization of technical surfaces by structure function analysis
Kalms, Michael; Kreis, Thomas; Bergmann, Ralf B.
2018-03-01
The structure function is a tool for characterizing technical surfaces that exhibits a number of advantages over Fourierbased analysis methods. So it is optimally suited for analyzing the height distributions of surfaces measured by full-field non-contacting methods. The structure function is thus a useful method to extract global or local criteria like e. g. periodicities, waviness, lay, or roughness to analyze and evaluate technical surfaces. After the definition of line- and area-structure function and offering effective procedures for their calculation this paper presents examples using simulated and measured data of technical surfaces including aircraft parts.
Designing Art Exhibitions in an Educational Virtual World
Julian, June; Crooks, Julian
2011-01-01
Demonstrating the multiple features of the Cerulean Gallery in Second Life, this research report showcases several exemplar exhibits created by students, artists, and museums. Located in The Educational Media Center, a Second Life teaching and social space, the Cerulean Gallery exhibits functioned as case studies that tested its effectiveness as…
A novel method to prepare superhydrophobic, UV resistance and anti-corrosion steel surface
Isimjan, Tayirjan T.
2012-11-01
Both TiO 2 and SiO 2 coated steel surfaces containing micro- and nanoscale binary structures with different surface roughness were successfully fabricated by means of a facile layer by layer deposition process followed by heat treatment. The resulting surfaces were modified by the low free energy chemical PTES (1H,1H,2H,2H-Perfluorodecyltriethoxysilane). The experimental results of wettability exhibit that such modified surfaces have a strong repulsive force to water droplets, their static contact angles exceed 165°, receding angle>160°, advanced angles>170° and slide angle<1°. The resulting surfaces not only exhibit superhydrophobic properties but also show strong UV resistance (after coating SiO 2 on top of TiO 2) and strong stability to various solvents including 0.01% HCl solution. © 2012 Elsevier B.V.
The presentation of energy topics at exhibitions
International Nuclear Information System (INIS)
Moergeli, H.P.
1984-01-01
The author examines the problems confronting an electricity supply company when trying to communicate its energy policy to the general public at exhibitions and fairs. The company has to convey a message of reliable power supplies, increasing demand, the advantages of nuclear energy, the safe storage of radioactive waste and the need for new generating plants. The author describes some of the displays being used to attract the public to the Bern Power Stations stand at the Bern Exhibition 1984. (R.S.)
The Inability to Screen Exhibition Swine for Influenza A Virus Using Body Temperature.
Bowman, A S; Nolting, J M; Workman, J D; Cooper, M; Fisher, A E; Marsh, B; Forshey, T
2016-02-01
Agricultural fairs create an unconventional animal-human interface that has been associated with swine-to-human transmission of influenza A virus (IAV) in recent years. Early detection of IAV-infected pigs at agricultural fairs would allow veterinarians to better protect swine and human health during these swine exhibitions. This study assessed the use of swine body temperature measurement, recorded by infrared and rectal thermometers, as a practical method to detect IAV-infected swine at agricultural fairs. In our first objective, infrared thermometers were used to record the body surface temperature of 1,092 pigs at the time of IAV nasal swab collection at the end of the exhibition period of 55 agricultural fairs. IAV was recovered from 212 (19.4%) pigs, and the difference in mean infrared body temperature measurement of IAV-positive and IAV-negative pigs was 0.83°C. In a second objective, snout wipes were collected from 1,948 pigs immediately prior to the unloading of the animals at a single large swine exhibition. Concurrent to the snout wipe collection, owners took the rectal temperatures of his/her pigs. In this case, 47 (2.4%) pigs tested positive for IAV before they entered the swine barn. The mean rectal temperatures differed by only 0.19°C between IAV-positive and IAV-negative pigs. The low prevalence of IAV among the pigs upon entry to the fair in the second objective provides evidence that limiting intraspecies spread of IAV during the fairs will likely have significant impacts on the zoonotic transmission. However, in both objectives, the high degree of similarity in the body temperature measurements between the IAV-positive and IAV-negative pigs made it impossible to set a diagnostically meaningful cut point to differentiate IAV status of the individual animals. Unfortunately, body temperature measurement cannot be used to accurately screen exhibition swine for IAV. © 2015 Blackwell Verlag GmbH.
DEFF Research Database (Denmark)
Fomcenco, Alex
2017-01-01
This article outlines the current state of law in Canada in respect to good faith in contratial relations. The topic is highly relevant due to expected growth in the numbers of contracts concluded between European and Canadian enterprises in the wake of adoption of the Comprehensive Economic...
Directory of Open Access Journals (Sweden)
Li Wan
2014-03-01
Full Text Available In this work, we treat the Poisson-Nernst-Planck (PNP equations as the basis for a consistent framework of the electrokinetic effects. The static limit of the PNP equations is shown to be the charge-conserving Poisson-Boltzmann (CCPB equation, with guaranteed charge neutrality within the computational domain. We propose a surface potential trap model that attributes an energy cost to the interfacial charge dissociation. In conjunction with the CCPB, the surface potential trap can cause a surface-specific adsorbed charge layer σ. By defining a chemical potential μ that arises from the charge neutrality constraint, a reformulated CCPB can be reduced to the form of the Poisson-Boltzmann equation, whose prediction of the Debye screening layer profile is in excellent agreement with that of the Poisson-Boltzmann equation when the channel width is much larger than the Debye length. However, important differences emerge when the channel width is small, so the Debye screening layers from the opposite sides of the channel overlap with each other. In particular, the theory automatically yields a variation of σ that is generally known as the “charge regulation” behavior, attendant with predictions of force variation as a function of nanoscale separation between two charged surfaces that are in good agreement with the experiments, with no adjustable or additional parameters. We give a generalized definition of the ζ potential that reflects the strength of the electrokinetic effect; its variations with the concentration of surface-specific and surface-nonspecific salt ions are shown to be in good agreement with the experiments. To delineate the behavior of the electro-osmotic (EO effect, the coupled PNP and Navier-Stokes equations are solved numerically under an applied electric field tangential to the fluid-solid interface. The EO effect is shown to exhibit an intrinsic time dependence that is noninertial in its origin. Under a step-function applied
PREFACE: Atom-surface scattering Atom-surface scattering
Miret-Artés, Salvador
2010-08-01
It has been a privilege and a real pleasure to organize this special issue or festschrift in the general field of atom-surface scattering (and its interaction) in honor of J R Manson. This is a good opportunity and an ideal place to express our deep gratitude to one of the leaders in this field for his fundamental and outstanding scientific contributions. J R Manson, or Dick to his friends and colleagues, is one of the founding fathers, together with N Cabrera and V Celli, of the 'Theory of surface scattering and detection of surface phonons'. This is the title of the very well-known first theoretical paper by Dick published in Physical Review Letters in 1969. My first meeting with Dick was around twenty years ago in Saclay. J Lapujoulade organized a small group seminar about selective adsorption resonances in metal vicinal surfaces. We discussed this important issue in surface physics and many other things as if we had always known each other. This familiarity and warm welcome struck me from the very beginning. During the coming years, I found this to be a very attractive aspect of his personality. During my stays in Göttingen, we had the opportunity to talk widely about science and life at lunch or dinner time, walking or cycling. During these nice meetings, he showed, with humility, an impressive cultural background. It is quite clear that his personal opinions about history, religion, politics, music, etc, come from considering and analyzing them as 'open dynamical systems'. In particular, with good food and better wine in a restaurant or at home, a happy cheerful soirée is guaranteed with him, or even with only a good beer or espresso, and an interesting conversation arises naturally. He likes to listen before speaking. Probably not many people know his interest in tractors. He has an incredible collection of very old tractors at home. In one of my visits to Clemson, he showed me the collection, explaining to me in great detail, their technical properties
Switchable Hydrophobic-Hydrophilic Surfaces
Bunker, B C; Huber, D L; Kent, M S; Kushmerick, J G; Lopez, G P; Manginell, R P; Méndez, S E; Yim, H
2002-01-01
Tethered films of poly n-isopropylacrylamide (PNIPAM) films have been developed as materials that can be used to switch the chemistry of a surface in response to thermal activation. In water, PNIPAM exhibits a thermally-activated phase transition that is accompanied by significant changes in polymer volume, water contact angle, and protein adsorption characteristics. New synthesis routes have been developed to prepare PNIPAM films via in-situ polymerization on self-assembled monolayers. Swelling transitions in tethered films have been characterized using a wide range of techniques including surface plasmon resonance, attenuated total reflectance infrared spectroscopy, interfacial force microscopy, neutron reflectivity, and theoretical modeling. PNIPAM films have been deployed in integrated microfluidic systems. Switchable PNIPAM films have been investigated for a range of fluidic applications including fluid pumping via surface energy switching and switchable protein traps for pre-concentrating and separating...
Exhibition: Linus Pauling and the Twentieth Century
2003-01-01
On April 28 the exhibit Linus Pauling and the Twentieth Century organised by UNIDIR (United Nations Institute for Disarmament Research) and SGI (Soka Gakkai International) as well as with the contributions of CERN and the University of Geneva, opened at the United Nations Office of Geneva. Linus Pauling is the only person to date to have won two unshared Nobel Prizes: Chemistry in 1954 and Peace in 1962. The first was awarded for his landmark research on the nature of the chemical bond and its application in understanding the structure of complex substances. The second one acknowledged his courageous protest against atmospheric nuclear testing and his championship of international peace. The exhibit, for audience of all ages, traces seven decades of Linus Pauling's life and influence on the 20th century. Before starting its European tour at the UNESCO headquarters in Paris, the exhibit opened in 1998 in San Francisco and then travelled within the United-States and to Japan with an attendance of more than one...
Exhibition: Linus Pauling and the Twentieth Century
2003-01-01
On April 28 the exhibit Linus Pauling and the Twentieth Century organised by UNIDIR (United Nations Institute for Disarmament Research) and SGI (Soka Gakkai International) as well as with the contributions of CERN and the University of Geneva, opens at the United Nations Office of Geneva. Linus Pauling is the only person to date to have won two unshared Nobel Prizes: Chemistry in 1954 and Peace in 1962. The first was awarded for his landmark research on the nature of the chemical bond and its application in understanding the structure of complex substances. The second one acknowledged his courageous protest against atmospheric nuclear testing and his championship of international peace. The exhibit, for all ages' audiences, traces seven decades of Linus Pauling's life and influence on the 20th century. Before starting its European tour at the UNESCO headquarters in Paris, the exhibit opened in 1998 in San Francisco and then travelled within the United-States and to Japan with an attendance of more than one m...
“Draw me a physicist” exhibition opens
CERN Bulletin
2010-01-01
From 12 to 23 June, the Globe of Science and Innovation will be hosting the “Draw me a physicist” exhibition: over 160 drawings and definitions that illustrate how children see the world of research. In a child’s imagination, scientists are colourful, slightly eccentric figures with unusual powers. This is what emerges from the exhibition on the second floor of the Globe of Science and Innovation, opening on 12 June. “Draw me a physicist” brings together 160 drawings and definitions by children about the profession of research scientist. The exhibition is the result of a six-month project by CERN and 20 primary school classes from the Pays de Gex and the communes of Meyrin, Satigny and Vernier. Some 400 schoolchildren aged 9 to 11 were asked in class to make drawings and come up with definitions of a physicist. Subsequently they came to CERN, visited one of the Laboratory’s sites, and met and interviewed some physicists. They used t...
GOOD GOVERNANCE AND TRANSFORMATION
Directory of Open Access Journals (Sweden)
Hans-Jürgen WAGENER
2005-12-01
Full Text Available Transformation of a totalitarian, basically administratively coordinated system into a democratic one that is coordinated predominantly by markets and competition has been triggered by, among others, the perception of a serious deficit in welfare and happiness. Public policy has a special task transforming the economic order by liberalisation, privatisation, stabilisation and the installation of institutions that are supportive for competition. After 15 years since transformation began, there are sufficiently differentiated success stories to test the hypothesis: it was good governance that is responsible for success and bad governance for failure. The empirical results support the “Lorenzetti hypothesis”: where freedom, security and trust prevail, the economy flourishes, where they are lacking, the costs of long-term investment are too high. The initial conditions of transition countries seem to be quite similar, nevertheless, even there one can discern good and bad governance. The extent of socialist lawfulness, planning security, cronyism and corruption differed widely between East Berlin and Tashkent. And a good deal of such variations can be found in the pre-socialist history of these countries. However, the main conclusion is that the co-evolution hypothesis states that both, welfare and good governance, go together.
TENDENCIES OF REGIONAL ELITE GOODS MARKET DEVELOPMENT
Directory of Open Access Journals (Sweden)
A.I. Tatarkin
2008-03-01
Full Text Available During the period of planned economy only a limited section of society with high social status had an access to elite goods in our country. At present an access to these goods is not regulated, and elite goods trade market in Russia is developing rapidly. In the article the essence of "elite good" and "regional elite goods market" concepts is defined, the classification of elite goods markets is given, also the main factors and tendencies of elite goods market development in the Ural Region is analyzed.
Analysis of surface contaminants on beryllium and aluminum windows
International Nuclear Information System (INIS)
Gmur, N.F.
1987-06-01
An effort has been made to document the types of contamination which form on beryllium window surfaces due to interaction with a synchrotron radiation beam. Beryllium windows contaminated in a variety of ways (exposure to water and air) exhibited surface powders, gels, crystals and liquid droplets. These contaminants were analyzed by electron diffraction, electron energy loss spectroscopy, energy dispersive x-ray spectroscopy and wet chemical methods. Materials found on window surfaces include beryllium oxide, amorphous carbon, cuprous oxide, metallic copper and nitric acid. Aluminum window surface contaminants were also examined
Laminar boundary layer response to rotation of a finite diameter surface patch
International Nuclear Information System (INIS)
Klewicki, J.C.; Hill, R.B.
2003-01-01
The responses of the flat plate laminar boundary layer to perturbations generated by rotating a finite patch of the bounding surface are explored experimentally. The size of the surface patch was of the same order as the boundary layer thickness. The displacement thickness Reynolds number range of the boundary layers explored was 72-527. The rotation rates of the surface patch ranged from 2.14 to 62.8 s-1. Qualitative flow visualizations and quantitative molecular tagging velocimetry measurements revealed that rotation of a finite surface patch generates an asymmetric loop-like vortex. Significant features of this vortex include that, (i) the sign of the vorticity in the vortex head is opposite that of the boundary layer vorticity regardless of the sign of the input rotation, (ii) one leg of the vortex exhibits motion akin to solid body rotation while the other leg is best characterized as a spanwise shear layer, (iii) the vortex leg exhibiting near solid body rotation lifts more rapidly from the surface than the leg more like a shear layer, and (iv) the vortex leg exhibiting near solid body rotation always occurs on the side of the surface patch experiencing downstream motion. These asymmetries switch sides depending on the sign of the input rotation. The present results are interpreted and discussed relative to analytical solutions for infinite geometries. By way of analogy, plausible connections are drawn between the present results and the influences of wall normal vortices in turbulent boundary layer flows
Exhibition: Fibre optics, the future is at hand
Anaïs Schaeffer
2012-01-01
Until 20 June, the Pont de la Machine in Geneva will host an exhibition on fibre optics, sponsored by SIG. CERN, a major user of this technology, was invited to take part with a presentation of some of its scintillating fibre detectors. The CERN module, designed for the SIG's fibre optics exhibition. Visitors can discover a cosmic ray detector (on the right) and its oscilloscope (on the left), as well as one of the ALFA detector modules (at the back). The Services industriels genevois (SIG), who are in the process of deploying an optical fibre network in Geneva, have decided to showcase this technology with an exhibition entitled “Fibre optique – Le futur à portée de main.” The exhibition, which will be open to the public from 26 April to 20 June, is being held at the Espace ExpoSIG, at the Pont de la Machine in the centre of Geneva. “CERN’s Physics Department was approached by SIG at the start of this year to ...
Surface dependency in thermodynamics of ideal gases
International Nuclear Information System (INIS)
Sisman, Altug
2004-01-01
The Casimir-like size effect rises in ideal gases confined in a finite domain due to the wave character of atoms. By considering this effect, thermodynamic properties of an ideal gas confined in spherical and cylindrical geometries are derived and compared with those in rectangular geometry. It is seen that an ideal gas exhibits an unavoidable quantum surface free energy and surface over volume ratio becomes a control variable on thermodynamic state functions in microscale. Thermodynamics turns into non-extensive thermodynamics and geometry difference becomes a driving force since the surface over volume ratio depends on the geometry
75 FR 3862 - Photography in Public Exhibit Space
2010-01-25
...NARA has revised its regulations on the use of film, photographic and videotape equipment inside the National Archives Building in Washington, DC. Filming, photographing, and videotaping for personal use will be prohibited in exhibits of the National Archives Experience (NAE) in Washington, DC, including the Declaration of Independence, the Constitution and the Bill of Rights (known as the Charters of Freedom) in the Rotunda of the National Archives Building. In 2003 NARA installed exhibit cases for displaying the Charters and other NAE documents to provide better clarity for viewing the exhibits. NARA seeks to ensure the necessary protection for the documents from the cumulative effects of photographic flash and to enhance the overall visitor experience.
Conspicuous Public Goods and Leadership Selection
Jennings, C.; Roelfsema, H.J.
If voters care for the relative supply of public goods compared to otherjurisdictions, decentralized provision of public goods will be too high.Potentially, centralization internalizes the negative externalities fromthe production of these `conspicuous' public goods. However, in amodel of strategic
A new guidance law for a tactical surface-to-surface missile
Directory of Open Access Journals (Sweden)
Danilo V. Ćuk
2012-01-01
Full Text Available Modern tactical surface-to-surface missiles, equipped with strapdown inertial navigation systems, achieve very good accuracy compared with free-flight rockets. The probable range dispersion mainly depends on instruments errors and longitudinal disturbances such as rocket motor total-impulse deviation as well as differences between the estimated and actual values of the axial force and head wind. This paper gives an extension of the correlated velocity concept for surface-to-surface missiles without a thrust-terminating mechanism. The calculated parameters of the correlated velocity are stored into the memory of an onboard guidance computer. On the basis of the correlated velocity concept, the modified proportional navigation with the adjustment of the time-to-go of the missile to the target was proposed. It is shown that the new guidance law can compensate for the longitudinal disturbances of different levels successfully. The effectiveness of the proposed guidance method was confirmed by means of the calculated probable range and lateral dispersion for the anticipated disturbances in the guidance system.
Design of textured surfaces for super-hydrophobicity
Indian Academy of Sciences (India)
Prithvi Raj Jelia
2017-11-11
Nov 11, 2017 ... as silicon wafer [1, 10, 11]. Yoon et al [12] used a modified ... The explanation for the increase in the contact angle or hydrophobicity on the ... water droplets on super-hydrophobic surfaces that exhibit large contact angles are ...
Lewis basicity, adhesion thermodynamic work and coordinating ability on aminated silicon surfaces
International Nuclear Information System (INIS)
Sánchez, M. Alejandra; Paniagua, Sergio A.; Borge, Ignacio; Viales, Christian; Montero, Mavis L.
2014-01-01
Highlights: • Silicon(1 0 0) surfaces with diamines followed by anchoring of copper complexes over the diamine layer, an approach that could be used for advanced functionalization of semiconducting surfaces. • Lewis basicity (using Fowkes–van Oss–Chaudhury–Good surface tension model) and adhesion thermodynamic work (using chemical force microscopy) were determined. • Higher basicity and thermodynamic work correlate with selective copper acetate monolayer grow. The cyclic voltammetry studies confirm the confined copper redox activity. - Abstract: Silicon(1 0 0) surfaces have been modified with three different amines (aniline, benzylamine and dodecylamine) and diamines (4-aminopyridine, 4-aminomethylpyridine, 1,12-dodecyldiamine). The surface energy was measured by contact angle technique. For Si-diamine surfaces, Lewis basicity (using Fowkes–van Oss–Chaudhury–Good surface tension model) and adhesion thermodynamic work (using chemical force microscopy) were determined. We related these data, the amine/diamine nature and their geometry on the surface (via DFT calculations) with the consequent ability to coordinate copper(II) acetate. Finally, copper(II) acetate monolayers behavior was studied by cyclic voltammetry
Good governance as perceived by Dabawenyos
Directory of Open Access Journals (Sweden)
Adrian M. Tamayo
2016-12-01
Full Text Available The debate on good governance had shaped public policies of many governments. This study was conducted to obtain latent perspectives of good governance. A survey was conducted using two-stage cluster sampling in the first congressional district of Davao City involving 351 respondents. Findings reveal that the notion of good governance of Dabawenyos is primarily a government to implement the rule of law; peace and order is a necessity to facilitate market efficiency. Also, it was found that political leadership creates notions of good governance; public bestowed power to its political leaders as a matter of trust. On the other hand, leaders incorporate soft and hard forms of power in delegating powers without losing control, causing a widespread and significant impact on the formation and development of Davao’s perspectives of good governance. This is the rubber band effect of good governance leadership.
Fabrication and surface transformation of FePt nanoparticle monolayer
International Nuclear Information System (INIS)
Wang Ying; Ding Baojun; Li Hua; Zhang Xiaoyan; Cai Bingchu; Zhang Yafei
2007-01-01
The monolayer of FePt nanoparticles with the mean size of ∼4 nm was fabricated on a glass substrate by the Langmuir--Blodgett (LB) technology. The monolayer of FePt nanoparticles has a smooth surface and a high density structure as shown by the AFM image. The array structure of FePt nanoparticles on the surface of the film is clearly with a cubic symmetry in appropriate condition. Small-angle X-ray diffraction (SXRD) measurement of multilayer structure for the FePt nanoparticles has indicated that the superlattices consist of well-defined smooth layers. The transfer of nanoparticle layers onto a solid substrate surface was quite efficient for the first few layers, exhibiting a proportional increase of optical absorption in the UV-vis range. This results potentially opens up a new approach to the long-range ordered array of FePt nanoparticles capped by organic molecules on substrate and provide a promising thin film, which may exhibit the excellent ultra-high density magnetic recording properties
Near-surface eddy dynamics in the Southern Ocean
Directory of Open Access Journals (Sweden)
Marilisa Trani
2011-12-01
Full Text Available The Antarctic Circumpolar Current (ACC is a crucial component of the global ocean conveyor belt, acting as a zonal link among the major ocean basins but, to some extent, limiting meridional exchange and tending to isolate the ocean south of it from momentum and heat income. In this work we investigate one of the most important mechanisms contributing to the poleward transfer of properties in the Southern Ocean, that is the eddy component of the dynamics. For this particular purpose, observations obtained from near-surface drifters have been used: they represent a very useful data set to analyse the eddy field because of their ability to catch a large number of scales of motion while providing a quasi-synoptic coverage of the investigated area. Estimates of the eddy heat and momentum fluxes are carried out using data taken from the Global Drifter Program databank; they refer to Surface Velocity Program drifter trajectories collected in the area south of 35°S between 1995 and 2006. Eddy kinetic energies, variance ellipses, momentum and heat fluxes have been calculated using the pseudo-Eulerian method, showing patterns in good agreement with those present in the literature based on observational and model data, although there are some quantitative differences. The eddy fluxes have been separated into their rotational and divergent portions, the latter being responsible for the meridional transports. The associated zonal and depth-exponentially integrated meridional heat transport exhibits values spanning over a range between -0.4 PW and –1.1 PW in the ACC region, consistent with previous estimates.
Bumblebees exhibit the memory spacing effect
Toda, Nicholas R. T.; Song, Jeremy; Nieh, James C.
2009-10-01
Associative learning is key to how bees recognize and return to rewarding floral resources. It thus plays a major role in pollinator floral constancy and plant gene flow. Honeybees are the primary model for pollinator associative learning, but bumblebees play an important ecological role in a wider range of habitats, and their associative learning abilities are less well understood. We assayed learning with the proboscis extension reflex (PER), using a novel method for restraining bees (capsules) designed to improve bumblebee learning. We present the first results demonstrating that bumblebees exhibit the memory spacing effect. They improve their associative learning of odor and nectar reward by exhibiting increased memory acquisition, a component of long-term memory formation, when the time interval between rewarding trials is increased. Bombus impatiens forager memory acquisition (average discrimination index values) improved by 129% and 65% at inter-trial intervals (ITI) of 5 and 3 min, respectively, as compared to an ITI of 1 min. Memory acquisition rate also increased with increasing ITI. Encapsulation significantly increases olfactory memory acquisition. Ten times more foragers exhibited at least one PER response during training in capsules as compared to traditional PER harnesses. Thus, a novel conditioning assay, encapsulation, enabled us to improve bumblebee-learning acquisition and demonstrate that spaced learning results in better memory consolidation. Such spaced learning likely plays a role in forming long-term memories of rewarding floral resources.
Surface active properties of lipid nanocapsules.
Directory of Open Access Journals (Sweden)
Celia R A Mouzouvi
Full Text Available Lipid nanocapsules (LNCs are biomimetic nanocarriers used for the encapsulation of a broad variety of active ingredients. Similar to surface active compounds, LNCs contain both hydrophilic and hydrophobic parts in their structure. Moreover, the components of LNCs, macrogol 15 hydroxystearate (MHS and lecithin, are known for their surface active properties. Therefore, the aim of this paper was to investigate the capability of the LNCs to decrease surface tension using two techniques: drop tensiometry and the Wilhelmy plate method. LNCs with diameters ranging from 30 to 100 nm were successfully obtained using a phase inversion technique. The LNCs' properties, such as size and zeta potential, depend on the composition. LNCs exhibit a lower limiting surface tension compared to MHS (34.8-35.0 mN/m and 37.7-38.8 mN/m, respectively, as confirmed by both drop tensiometry and the Wilhelmy plate method. LNCs have exhibited a saturated interfacial concentration (SIC that was 10-fold higher than the critical micellar concentration (CMC of MHS or the SIC of binary and ternary mixtures of LNC ingredients. The SIC of the LNC formulations depended on the mass mixing ratio of the MHS/triglycerides but not on the presence of lecithin. The CMC/SIC values measured by the Wilhelmy plate method were higher than those obtained using drop tensiometry because of the longer duration of the tensiometry measurement. In conclusion, the surfactant-like properties of the LNCs offer new possibilities for medical and pharmaceutical applications.
Lee, Kwang Sik; Kim, Bo Yeon; Yoon, Hyung Joo; Choi, Yong Soo; Jin, Byung Rae
2016-10-01
Bee venom contains a variety of peptide constituents that have various biological, toxicological, and pharmacological actions. However, the biological actions of secapin, a venom peptide in bee venom, remain largely unknown. Here, we provide the evidence that Asiatic honeybee (Apis cerana) secapin (AcSecapin-1) exhibits anti-fibrinolytic, anti-elastolytic, and anti-microbial activities. The recombinant mature AcSecapin-1 peptide was expressed in baculovirus-infected insect cells. AcSecapin-1 functions as a serine protease inhibitor-like peptide that has inhibitory effects against plasmin, elastases, microbial serine proteases, trypsin, and chymotrypsin. Consistent with these functions, AcSecapin-1 inhibited the plasmin-mediated degradation of fibrin to fibrin degradation products, thus indicating the role of AcSecapin-1 as an anti-fibrinolytic agent. AcSecapin-1 also inhibited both human neutrophil and porcine pancreatic elastases. Furthermore, AcSecapin-1 bound to bacterial and fungal surfaces and exhibited anti-microbial activity against fungi and gram-positive and gram-negative bacteria. Taken together, our data demonstrated that the bee venom peptide secapin has multifunctional roles as an anti-fibrinolytic agent during fibrinolysis and an anti-microbial agent in the innate immune response. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Alexander Matul
2017-10-01
Full Text Available An objective of the study is to get new biogeographic information on the modern polycystine radiolarians from the high-latitude North Atlantic. The quantitative radiolarian dataset was compiled from publications and own micropaleontological counts from samples of the bottom surface sediments of the North Atlantic north of 40°N and Nordic Seas. Standard statistical treatment of micropaleontological data by factor analysis reveals five radiolarian assemblages which have their highest load at the specific temperature range in agreement with the oceanographic setting. An occurrence of radiolarian assemblages reflects extension and interaction of the warm North Atlantic and cold Polar/Arctic waters. Radiolarian distribution exhibits good correlation with the climatically averaged summer sea temperature on depth level of 200 m.
Maintaining students’ Speaking Fluency through Exhibition Examination in Sociolinguistic Studies
Directory of Open Access Journals (Sweden)
Khusnul Qhotimah Yuliatuty
2013-07-01
Full Text Available Using exhibition for the final project in Sociolinguistic study is really interesting for Universitas Siswa Bangsa Internasional students, especially for 2011 English Department students. Exhibition becomes interesting because this is the new thing to conduct the final project for English Department students’ cohort 2011 at Universitas Siswa Bangsa Internasional. The lecturer divides the students into pairs and each pairs should master one content or topic in Sociolinguistic study. The students will do the exhibition about the topic that they get in a pairs. The lecturer also gives the students rubric sheet to fill by the visitors. The exhibition will make the students prepare themselves well because they will face many questions about the content which will be delivered by them. Beside, this exhibition also maintains students’ fluency in speaking English because they will explain and answer the questions from visitors with English. This paper tries to focus on how exhibition examination can maintain students’ fluency in speaking English.
Electrostatic attraction between overall neutral surfaces.
Adar, Ram M; Andelman, David; Diamant, Haim
2016-08-01
Two overall neutral surfaces with positively and negatively charged domains ("patches") have been shown in recent experiments to exhibit long-range attraction when immersed in an ionic solution. Motivated by the experiments, we calculate analytically the osmotic pressure between such surfaces within the Poisson-Boltzmann framework, using a variational principle for the surface-averaged free energy. The electrostatic potential, calculated beyond the linear Debye-Hückel theory, yields an overall attraction at large intersurface separations, over a wide range of the system's controlled length scales. In particular, the attraction is stronger and occurs at smaller separations for surface patches of larger size and charge density. In this large patch limit, we find that the attraction-repulsion crossover separation is inversely proportional to the square of the patch-charge density and to the Debye screening length.
Secondary electron emission from textured surfaces
Huerta, C. E.; Patino, M. I.; Wirz, R. E.
2018-04-01
In this work, a Monte Carlo model is used to investigate electron induced secondary electron emission for varying effects of complex surfaces by using simple geometric constructs. Geometries used in the model include: vertical fibers for velvet-like surfaces, tapered pillars for carpet-like surfaces, and a cage-like configuration of interlaced horizontal and vertical fibers for nano-structured fuzz. The model accurately captures the secondary electron emission yield dependence on incidence angle. The model shows that unlike other structured surfaces previously studied, tungsten fuzz exhibits secondary electron emission yield that is independent of primary electron incidence angle, due to the prevalence of horizontally-oriented fibers in the fuzz geometry. This is confirmed with new data presented herein of the secondary electron emission yield of tungsten fuzz at incidence angles from 0-60°.
Water at surfaces with tunable surface chemistries
Sanders, Stephanie E.; Vanselous, Heather; Petersen, Poul B.
2018-03-01
Aqueous interfaces are ubiquitous in natural environments, spanning atmospheric, geological, oceanographic, and biological systems, as well as in technical applications, such as fuel cells and membrane filtration. Where liquid water terminates at a surface, an interfacial region is formed, which exhibits distinct properties from the bulk aqueous phase. The unique properties of water are governed by the hydrogen-bonded network. The chemical and physical properties of the surface dictate the boundary conditions of the bulk hydrogen-bonded network and thus the interfacial properties of the water and any molecules in that region. Understanding the properties of interfacial water requires systematically characterizing the structure and dynamics of interfacial water as a function of the surface chemistry. In this review, we focus on the use of experimental surface-specific spectroscopic methods to understand the properties of interfacial water as a function of surface chemistry. Investigations of the air-water interface, as well as efforts in tuning the properties of the air-water interface by adding solutes or surfactants, are briefly discussed. Buried aqueous interfaces can be accessed with careful selection of spectroscopic technique and sample configuration, further expanding the range of chemical environments that can be probed, including solid inorganic materials, polymers, and water immiscible liquids. Solid substrates can be finely tuned by functionalization with self-assembled monolayers, polymers, or biomolecules. These variables provide a platform for systematically tuning the chemical nature of the interface and examining the resulting water structure. Finally, time-resolved methods to probe the dynamics of interfacial water are briefly summarized before discussing the current status and future directions in studying the structure and dynamics of interfacial water.
Surface properties of functional polymer systems
Wong, Derek
Polymer surface modification typically involves blending with other polymers or chemical modification of the parent polymer. Such strategies inevitably result in polymer systems that are spatially and chemically heterogeneous, and which exhibit the phenomenon of surface segregation. This work investigates the effects of chain architecture on the surface segregation behavior of such functionally modified polymers using a series of end- and center-fluorinated poly(D,L-lactide). Surface segregation of the fluorinated functional groups was observed in both chain architectures via AMPS and water contact angle. Higher surface segregation was noted for functional groups located at the chain end as opposed to those in the middle of the chain. A self-consistent mean-field lattice theory was used to model the composition depth profiles of functional groups and excellent agreement was found between the model predictions and the experimental AMPS data in both chain architectures. Polymer properties are also in general dependent on both time and temperature, and exhibit a range of relaxation times in response to environmental stimuli. This behavior arises from the characteristic frequencies of molecular motions of the polymer chain and the interrelationship between time and temperature has been widely established for polymer bulk properties. There is evidence that surface properties also respond in a manner that is time and temperature dependent and that this dependence may not be the same as that observed for bulk properties. AMPS and water contact angle experiments were used to investigate the surface reorganization behavior of functional groups using a series of anionically synthesized end-fluorinated and end-carboxylated poly(styrene). It was found that both types of functional end-groups reorganized upon a change in the polarity of the surface environment in order to minimize the surface free energy. ADXPS and contact angle results suggest that the reorganization depth was
The Relational Nature of the Good
Korsgaard, Christine M.
2013-01-01
This chapter argues that the relation of being good-for someone is prior to the property of being good. After discussing the views of Moore, Geach, Foot, and Rawls, the author argues that there are final goods because there are conscious animals. Hedonists also believe this, but think of goodness as an intrinsic property of certain conscious states—pleasant ones. This is because they mistake pleasure for sensation and so for an object of experience. After advancing an alternative conception o...
Mixed quantum-classical equilibrium in global flux surface hopping
International Nuclear Information System (INIS)
Sifain, Andrew E.; Wang, Linjun; Prezhdo, Oleg V.
2015-01-01
Global flux surface hopping (GFSH) generalizes fewest switches surface hopping (FSSH)—one of the most popular approaches to nonadiabatic molecular dynamics—for processes exhibiting superexchange. We show that GFSH satisfies detailed balance and leads to thermodynamic equilibrium with accuracy similar to FSSH. This feature is particularly important when studying electron-vibrational relaxation and phonon-assisted transport. By studying the dynamics in a three-level quantum system coupled to a classical atom in contact with a classical bath, we demonstrate that both FSSH and GFSH achieve the Boltzmann state populations. Thermal equilibrium is attained significantly faster with GFSH, since it accurately represents the superexchange process. GFSH converges closer to the Boltzmann averages than FSSH and exhibits significantly smaller statistical errors
Cobalt oxide films for solar selective surfaces, obtained by spray pyrolisis
Energy Technology Data Exchange (ETDEWEB)
Avila G, A. [Departmento de Ingenieria Electrica, Seccion de Electronica del Estado Solido, CINVESTAV del I.P.N., Av. I.P.N. no. 2508, Ap. Postal 14-740, Mexico D. F., 07360 (Mexico); Barrera C, E. [Departamento de IPH, Area de Ingenieria en Recursos Energeticos, Universidad Autonoma Metropolitana-Iztapalapa, Ap. Postal 55-5340, Mexico, D. F. (Mexico); Huerta A, L.; Muhl, S. [Instituto de Investigaciones en Materiales, UNAM, Mexico, D.F. 04510 (Mexico)
2004-05-01
Cobalt oxide films upon stainless steel substrates were deposited by using the pneumatic spray pyrolisis technique, starting from an inorganic salt (CoNO{sub 3}{center_dot}3H{sub 2}O) dissolved in a water-alcohol mixture. Stainless steel and nickeled stainless steel substrates were used. Absorptance and emittance, for selective surface applications, were evaluated from reflectance measurements in the UV-Vis and infrared ranges. X-ray diffraction, XPS and AFM measurements were done. The predominant cobalt phase is Co{sub 3}O{sub 4}, but also CoO and Co{sub 2}O{sub 3} phases, besides metallic cobalt, were detected. Films upon nickeled steel substrates at 400C exhibit high absorptances (0.86), but also the emittance is high (0.43), yielding a selectivity of 2.0. A similar film on steel substrate reaches only a figure of 0.77 absorptance, but the thermal emittance remains low (0.20), giving a selectivity of 3.85. These films are good prospects for selective solar absorption coatings.
Energy Technology Data Exchange (ETDEWEB)
Lundberg, Mattias, E-mail: mattias.lundberg@liu.se; Saarimäki, Jonas; Moverare, Johan J.; Calmunger, Mattias
2017-02-15
Machining of austenitic stainless steels can result in different surface integrities and different machining process parameters will have a great impact on the component fatigue life. Understanding how machining processes affect the cyclic behaviour and microstructure are of outmost importance in order to improve existing and new life estimation models. Milling and electrical discharge machining (EDM) have been used to manufacture rectangular four-point bend fatigue test samples; subjected to high cycle fatigue. Before fatigue testing, surface integrity characterisation of the two surface conditions was conducted using scanning electron microscopy, surface roughness, residual stress profiles, and hardness profiles. Differences in cyclic behaviour were observed between the two surface conditions by the fatigue testing. The milled samples exhibited a fatigue limit. EDM samples did not show the same behaviour due to ratcheting. Recrystallized nano sized grains were identified at the severely plastically deformed surface of the milled samples. Large amounts of bent mechanical twins were observed ~ 5 μm below the surface. Grain shearing and subsequent grain rotation from milling bent the mechanical twins. EDM samples showed much less plastic deformation at the surface. Surface tensile residual stresses of ~ 500 MPa and ~ 200 MPa for the milled and EDM samples respectively were measured. - Highlights: •Milled samples exhibit fatigue behaviour, but not EDM samples. •Four-point bending is not suitable for materials exhibiting pronounced ratcheting. •LAGB density can be used to quantitatively measure plastic deformation. •Grain shearing and rotation result in bent mechanical twins. •Nano sized grains evolve due to the heat of the operation.
Specularity of longitudinal acoustic phonons at rough surfaces
Gelda, Dhruv; Ghossoub, Marc G.; Valavala, Krishna; Ma, Jun; Rajagopal, Manjunath C.; Sinha, Sanjiv
2018-01-01
The specularity of phonons at crystal surfaces is of direct importance to thermal transport in nanostructures and to dissipation in nanomechanical resonators. Wave scattering theory provides a framework for estimating wavelength-dependent specularity, but experimental validation remains elusive. Widely available thermal conductivity data presents poor validation since the involvement of the infinitude of phonon wavelengths in thermal transport presents an underconstrained test for specularity theory. Here, we report phonon specularity by measuring the lifetimes of individual coherent longitudinal acoustic phonon modes excited in ultrathin (36-205 nm) suspended silicon membranes at room temperature over the frequency range ˜20 -118 GHz. Phonon surface scattering dominates intrinsic Akhiezer damping at frequencies ≳60 GHz, enabling measurements of phonon boundary scattering time over wavelengths ˜72 -140 nm . We obtain detailed statistics of the surface roughness at the top and bottom surfaces of membranes using HRTEM imaging. We find that the specularity of the excited modes are in good agreement with solutions of wave scattering only when the TEM statistics are corrected for projection errors. The often-cited Ziman formula for phonon specularity also appears in good agreement with the data, contradicting previous results. This work helps to advance the fundamental understanding of phonon scattering at the surfaces of nanostructures.
Energy Technology Data Exchange (ETDEWEB)
Wang, Gang; Wang, Yu; Wang, Junzhuan; Pan, Lijia; Yu, Linwei; Zheng, Youdou; Shi, Yi, E-mail: yshi@nju.edu.cn
2017-08-31
Highlights: • The KMC method is adopted to investigate the relationships between surface evolution and hydrogen thermal treatment conditions. • The reduction in surface roughness is divided into two stages at relatively low temperatures, both exhibiting exponential dependence on the time. • The optimized surface structure can be obtained by precisely adjusting thermal treatment temperatures and hydrogen pressures. - Abstract: The evolution of a two-dimensional silicon surface under hydrogen thermal treatment is studied by kinetic Monte Carlo simulations, focusing on the dependence of the migration behaviors of surface atoms on both the temperature and hydrogen pressure. We adopt different activation energies to analyze the influence of hydrogen pressure on the evolution of surface morphology at high temperatures. The reduction in surface roughness is divided into two stages, both exhibiting exponential dependence on the equilibrium time. Our results indicate that a high hydrogen pressure is conducive to obtaining optimized surfaces, as a strategy in the applications of three-dimensional devices.
Topological surface states in nodal superconductors.
Schnyder, Andreas P; Brydon, Philip M R
2015-06-24
Topological superconductors have become a subject of intense research due to their potential use for technical applications in device fabrication and quantum information. Besides fully gapped superconductors, unconventional superconductors with point or line nodes in their order parameter can also exhibit nontrivial topological characteristics. This article reviews recent progress in the theoretical understanding of nodal topological superconductors, with a focus on Weyl and noncentrosymmetric superconductors and their protected surface states. Using selected examples, we review the bulk topological properties of these systems, study different types of topological surface states, and examine their unusual properties. Furthermore, we survey some candidate materials for topological superconductivity and discuss different experimental signatures of topological surface states.
Topological surface states in nodal superconductors
International Nuclear Information System (INIS)
Schnyder, Andreas P; Brydon, Philip M R
2015-01-01
Topological superconductors have become a subject of intense research due to their potential use for technical applications in device fabrication and quantum information. Besides fully gapped superconductors, unconventional superconductors with point or line nodes in their order parameter can also exhibit nontrivial topological characteristics. This article reviews recent progress in the theoretical understanding of nodal topological superconductors, with a focus on Weyl and noncentrosymmetric superconductors and their protected surface states. Using selected examples, we review the bulk topological properties of these systems, study different types of topological surface states, and examine their unusual properties. Furthermore, we survey some candidate materials for topological superconductivity and discuss different experimental signatures of topological surface states. (topical review)
Xiao, Ke; Cui, Can; Wang, Peng; Lin, Ping; Qiang, Yaping; Xu, Lingbo; Xie, Jiangsheng; Yang, Zhengrui; Zhu, Xiaodong; Yu, Xuegong; Yang, Deren
2018-02-01
In the fabrication of high efficiency organic-inorganic metal halide perovskite solar cells (PSCs), an additional interface modifier is usually applied for enhancing the interface passivation and carrier transport. In this paper, we develop an innovative method with in-situ growth of one-dimensional perovskite nanowire (1D PNW) network triggered by Lewis amine over the perovskite films. To our knowledge, this is the first time to fabricate PSCs with shape-controlled perovskite surface morphology, which improved power conversion efficiency (PCE) from 14.32% to 16.66% with negligible hysteresis. The amine molecule can passivate the trap states on the polycrystalline perovskite surface to reduce trap-state density. Meanwhile, as a fast channel, the 1D PNWs would promote carrier transport from the bulk perovskite film to the electron transport layer. The PSCs with 1D PNW modification not only exhibit excellent photovoltaic performances, but also show good stability with only 4% PCE loss within 30 days in the ambient air without encapsulation. Our results strongly suggest that in-situ grown 1D PNW network provides a feasible and effective strategy for nanostructured optoelectronic devices such as PSCs to achieve superior performances.
Energy Technology Data Exchange (ETDEWEB)
Gravielle, M.S. [Instituto de Astronomia y Fisica del Espacio, CONICET, Casilla de Correo 67, Sucursal 28, 1428 Buenos Aires (Argentina); Dpto. de Fisica, FCEN, Universidad de Buenos Aires, Buenos Aires (Argentina)], E-mail: msilvia@iafe.uba.ar; Miraglia, J.E. [Instituto de Astronomia y Fisica del Espacio, CONICET, Casilla de Correo 67, Sucursal 28, 1428 Buenos Aires (Argentina); Dpto. de Fisica, FCEN, Universidad de Buenos Aires, Buenos Aires (Argentina)
2009-02-15
This work deals with the interference effects recently observed in grazing collisions of few-keV atoms with insulator surfaces. The process is studied within a distorted-wave method, the surface eikonal approximation, based on the use of the eikonal wave function and involving axial channeled trajectories with different initial conditions. The theory is applied to helium atoms impinging on a LiF(0 0 1) surface along the <1 1 0> direction. The role played by the projectile polarization and the surface rumpling is investigated. We found that when both effects are included, the proposed eikonal approach provides angular projectile spectra in good agreement with the experimental findings.
International Nuclear Information System (INIS)
Gravielle, M.S.; Miraglia, J.E.
2009-01-01
This work deals with the interference effects recently observed in grazing collisions of few-keV atoms with insulator surfaces. The process is studied within a distorted-wave method, the surface eikonal approximation, based on the use of the eikonal wave function and involving axial channeled trajectories with different initial conditions. The theory is applied to helium atoms impinging on a LiF(0 0 1) surface along the direction. The role played by the projectile polarization and the surface rumpling is investigated. We found that when both effects are included, the proposed eikonal approach provides angular projectile spectra in good agreement with the experimental findings.
Energy Technology Data Exchange (ETDEWEB)
Kim, H.; Greene, J.E. [Materials Science Department, the Coordinated Science Laboratory and the Materials Research Laboratory, University of Illinois, Urbana, Illinois 61801 (United States)
1999-03-01
Ultrahigh B-doped Ge(001) layers, with concentrations C{sub B} up to 8{times}10{sup 21} cm{sup {minus}3}, were grown by gas-source molecular beam epitaxy from Ge{sub 2}H{sub 6} and B{sub 2}H{sub 6} at temperatures T{sub s}=325{degree}C (in the surface-reaction-limited regime) and 600{degree}C (in the flux-limited regime). The samples were quenched, D site exchanged for H, and D{sub 2} temperature-programed desorption (TPD) used to determine B coverages {theta}{sub B} as a function of C{sub B} and T{sub s} by comparison with B-adsorbed Ge(001) reference samples with known {theta}{sub B} values. During Ge(001):B film growth, strong surface B segregation to the second layer was observed with surface-to-bulk B concentration ratios ranging up to 6000. The TPD spectra exhibited {alpha}{sub 2} and {alpha}{sub 1} peaks associated with dideuteride and monodeuteride desorption as well as lower-temperature B-induced {alpha}{sub 2}{sup {asterisk}} and {alpha}{sub 1}{sup {asterisk}} peaks associated with deuterium desorption from Ge{sup {asterisk}} surface atoms with B backbonds. Increasing {theta}{sub B} expanded the area under {alpha}{sub 2}{sup {asterisk}} and {alpha}{sub 1}{sup {asterisk}} at the expense of {alpha}{sub 2} and {alpha}{sub 1} and decreased the total D coverage {theta}{sub D}. The TPD results were used to determine the B segregation enthalpy, {minus}0.64 eV, and to explain and model the effects of high B coverages on Ge(001) growth kinetics. At T{sub s}=325{degree}C, where B segregation is kinetically hindered, film deposition rates R{sub Ge} are not a strong function of C{sub B}, exhibiting only a small decrease at C{sub B}{approx_gt}5{times}10{sup 18} cm{sup {minus}3}. However, at T{sub s}=600{degree}C, R{sub Ge} decreases by up to 40{percent} with increasing C{sub B}{approx_gt}1{times}10{sup 18} cm{sup {minus}3}. This is due primarily to the combination of B-induced Ge dimer vacancies and the deactivation of surface dangling bonds caused by charge transfer
Cellulose nanocrystals with tunable surface charge for nanomedicine
Hosseinidoust, Zeinab; Alam, Md Nur; Sim, Goeun; Tufenkji, Nathalie; van de Ven, Theo G. M.
2015-10-01
Crystalline nanoparticles of cellulose exhibit attractive properties as nanoscale carriers for bioactive molecules in nanobiotechnology and nanomedicine. For applications in imaging and drug delivery, surface charge is one of the most important factors affecting the performance of nanocarriers. However, current methods of preparation offer little flexibility for controlling the surface charge of cellulose nanocrystals, leading to compromised colloidal stability under physiological conditions. We report a synthesis method that results in nanocrystals with remarkably high carboxyl content (6.6 mmol g-1) and offers continuous control over surface charge without any adjustment to the reaction conditions. Six fractions of nanocrystals with various surface carboxyl contents were synthesized from a single sample of softwood pulp with carboxyl contents varying from 6.6 to 1.7 mmol g-1 and were fully characterized. The proposed method resulted in highly stable colloidal nanocrystals that did not aggregate when exposed to high salt concentrations or serum-containing media. Interactions of these fractions with four different tissue cell lines were investigated over a wide range of concentrations (50-300 μg mL-1). Darkfield hyperspectral imaging and confocal microscopy confirmed the uptake of nanocrystals by selected cell lines without any evidence of membrane damage or change in cell density; however a charge-dependent decrease in mitochondrial activity was observed for charge contents higher than 3.9 mmol g-1. A high surface carboxyl content allowed for facile conjugation of fluorophores to the nanocrystals without compromising colloidal stability. The cellular uptake of fluoresceinamine-conjugated nanocrystals exhibited a time-dose dependent relationship and increased significantly with doubling of the surface charge.Crystalline nanoparticles of cellulose exhibit attractive properties as nanoscale carriers for bioactive molecules in nanobiotechnology and nanomedicine. For
Water surface modeling from a single viewpoint video.
Li, Chuan; Pickup, David; Saunders, Thomas; Cosker, Darren; Marshall, David; Hall, Peter; Willis, Philip
2013-07-01
We introduce a video-based approach for producing water surface models. Recent advances in this field output high-quality results but require dedicated capturing devices and only work in limited conditions. In contrast, our method achieves a good tradeoff between the visual quality and the production cost: It automatically produces a visually plausible animation using a single viewpoint video as the input. Our approach is based on two discoveries: first, shape from shading (SFS) is adequate to capture the appearance and dynamic behavior of the example water; second, shallow water model can be used to estimate a velocity field that produces complex surface dynamics. We will provide qualitative evaluation of our method and demonstrate its good performance across a wide range of scenes.
Surface states in thin versus thick organic quantum wells
International Nuclear Information System (INIS)
Nguyen Ba An; Hanamura, E.
1995-08-01
Surface states are studied in dependence on thickness or organic quantum wells within the nearest layer approximation. It is shown that there is a material-dependent critical thickness. Structures, that have thickness thinner or thicker than the critical one, exhibit qualitatively different characteristics of surface states. Criteria for existence and sign rules for location of energy levels of surface states are established which are general and contain the results of the previous works as particular cases. (author). 18 refs, 3 figs
Isotropic and anisotropic surface wave cloaking techniques
International Nuclear Information System (INIS)
McManus, T M; Spada, L La; Hao, Y
2016-01-01
In this paper we compare two different approaches for surface waves cloaking. The first technique is a unique application of Fermat’s principle and requires isotropic material properties, but owing to its derivation is limited in its applicability. The second technique utilises a geometrical optics approximation for dealing with rays bound to a two dimensional surface and requires anisotropic material properties, though it can be used to cloak any smooth surface. We analytically derive the surface wave scattering behaviour for both cloak techniques when applied to a rotationally symmetric surface deformation. Furthermore, we simulate both using a commercially available full-wave electromagnetic solver and demonstrate a good level of agreement with their analytically derived solutions. Our analytical solutions and simulations provide a complete and concise overview of two different surface wave cloaking techniques. (paper)
Isotropic and anisotropic surface wave cloaking techniques
McManus, T. M.; La Spada, L.; Hao, Y.
2016-04-01
In this paper we compare two different approaches for surface waves cloaking. The first technique is a unique application of Fermat’s principle and requires isotropic material properties, but owing to its derivation is limited in its applicability. The second technique utilises a geometrical optics approximation for dealing with rays bound to a two dimensional surface and requires anisotropic material properties, though it can be used to cloak any smooth surface. We analytically derive the surface wave scattering behaviour for both cloak techniques when applied to a rotationally symmetric surface deformation. Furthermore, we simulate both using a commercially available full-wave electromagnetic solver and demonstrate a good level of agreement with their analytically derived solutions. Our analytical solutions and simulations provide a complete and concise overview of two different surface wave cloaking techniques.
Functional properties of bio-inspired surfaces: characterization and technological applications
National Research Council Canada - National Science Library
Favret, Eduardo A; Fuentes, Néstor O
2009-01-01
... technological materials. It analyses how such surfaces can be described and characterized using microscopic techniques and thus reproduced, encompassing the important areas of current surface replication techniques and the associated acquisition of good master structures. It is well known that biological systems have the ability to sense, ...
International Nuclear Information System (INIS)
Pransilp, Porntapin; Pruettiphap, Meshaya; Bhanthumnavin, Worawan; Paosawatyanyong, Boonchoat; Kiatkamjornwong, Suda
2016-01-01
Graphical abstract: - Highlights: • Both O_2 and N_2 plasma increased cotton surface wettability and higher K/S. • SF6 plasma gave hydrophobicity on cotton surface and increased contact angle to 138°. • Plasma treatment on cotton fabric produced surface roughness. • XPS confirmed the generation of new functional groups on cotton fabric. • Wettability and surface roughness controlled K/S and good ink adhesion. - Abstract: Surface properties of cotton fabric were modified by three types of gas plasma pretreatment, namely, oxygen (O_2), nitrogen (N_2) and sulfur hexafluoride (SF_6), to improve ink absorption of water-based pigmented inkjet inks and color reproduction of the treated surfaces. Effects of gas plasma exposure parameters of power, exposure time and gas pressure on surface physical and chemical properties of the treated fabrics were investigated. XPS (X-ray photoelectron spectroscopy) was used to identify changes in functional groups on the fabric surface while AFM (atomic force microscopy) and SEM (scanning electron microscopy) were used to reveal surface topography of the fabric. Color spectroscopic technique was used to investigate changes in color strength caused by different absorptions of the printed fabrics. The O_2 plasma treatments produced new functional groups, −O−C−O/C=O and O−C=O while N_2 plasma treatments produced additionally new functional groups, C−N and O=C−NH, onto the fabric surface which increased hydrophilic properties and surface energy of the fabric. For cotton fabric treated with SF_6 plasma, the fluorine functionalization was additionally found on the surface. Color strength values (K/S) increased when compared with those of the untreated fabrics. SF_6 plasma-treated fabrics were hydrophobic and caused less ink absorption. Fabric surface roughness caused by plasma etching increased fabric surface areas, captured more ink, and enhanced a larger ink color gamut and ink adhesion. Cotton fabrics exhibited higher
Surface noble metal modified PdM/C (M = Ru, Pt, Au) as anode catalysts for direct ethanol fuel cells
International Nuclear Information System (INIS)
Mao, Han; Huang, Tao; Yu, Aishui
2016-01-01
In this article, we studied the surface noble metal modification on Pd nanoparticles, other than the homogeneous or core-shell structure. The surface modification will lead to the uneven constitution within the nanoparticles and thus more obvious optimization effect toward the catalyst brought by the lattice deformation. The surface of the as-prepared Pd nanoparticles was modified with Ru, Pt or Au by a moderate and green approach, respectively. XPS results confirm the interactive electron effects between Pd and the modified noble metal. Electrochemical measurements show that the surface noble metal modified catalysts not only show higher catalytic activity, but also better stability and durability. The PdM/C catalysts all exhibit good dispersion and very little agglomeration after long-term potential cycles toward ethanol oxidation. With only 10% metallic atomic ratio of Au, PdAu/C catalyst shows extraordinary catalytic activity and stability, the peak current reaches 1700 mA mg"−"1 Pd, about 2.5 times that of Pd/C. Moreover, the PdAu/C maintains 40% of the catalytic activity after 4500 potential cycles. - Highlights: • Pd-based catalysts with complicated exposed facets. • Much enhanced electrocatalytic activity and stability with about 10% noble metal M (M = Ru, Pt, Au) on Pd nanoparticles. • The outstanding electrocatalytic performance of PdAu/C towards ethanol oxidation after the Au modification.
Surface noble metal modified PdM/C (M = Ru, Pt, Au) as anode catalysts for direct ethanol fuel cells
Energy Technology Data Exchange (ETDEWEB)
Mao, Han; Huang, Tao, E-mail: huangt@fudan.edu.cn; Yu, Aishui, E-mail: asyu@fudan.edu.cn
2016-08-15
In this article, we studied the surface noble metal modification on Pd nanoparticles, other than the homogeneous or core-shell structure. The surface modification will lead to the uneven constitution within the nanoparticles and thus more obvious optimization effect toward the catalyst brought by the lattice deformation. The surface of the as-prepared Pd nanoparticles was modified with Ru, Pt or Au by a moderate and green approach, respectively. XPS results confirm the interactive electron effects between Pd and the modified noble metal. Electrochemical measurements show that the surface noble metal modified catalysts not only show higher catalytic activity, but also better stability and durability. The PdM/C catalysts all exhibit good dispersion and very little agglomeration after long-term potential cycles toward ethanol oxidation. With only 10% metallic atomic ratio of Au, PdAu/C catalyst shows extraordinary catalytic activity and stability, the peak current reaches 1700 mA mg{sup −1} Pd, about 2.5 times that of Pd/C. Moreover, the PdAu/C maintains 40% of the catalytic activity after 4500 potential cycles. - Highlights: • Pd-based catalysts with complicated exposed facets. • Much enhanced electrocatalytic activity and stability with about 10% noble metal M (M = Ru, Pt, Au) on Pd nanoparticles. • The outstanding electrocatalytic performance of PdAu/C towards ethanol oxidation after the Au modification.
The 1997 AAAI Mobile Robot Competition and Exhibition
Arkin, Ronald C.
1998-01-01
In July 1997, the Sixth Annual Association for the Advancement of Artificial Intelligence (AAAI) Mobile Robot Competition and Exhibition was held. The competition consisted of four new events: (1) Find Life on Mars; (2) Find the Remote; (3) Home Vacuum; and (4) Hors d'Oeuvres, Anyone? The robot exhibition was the largest in AAAI history. This article presents the history, motivation, and contributions for the event.
Surface and Core Electronic Structure of Oxidized Silicon Nanocrystals
Directory of Open Access Journals (Sweden)
Noor A. Nama
2010-01-01
Full Text Available Ab initio restricted Hartree-Fock method within the framework of large unit cell formalism is used to simulate silicon nanocrystals between 216 and 1000 atoms (1.6–2.65 nm in diameter that include Bravais and primitive cell multiples. The investigated properties include core and oxidized surface properties. Results revealed that electronic properties converge to some limit as the size of the nanocrystal increases. Increasing the size of the core of a nanocrystal resulted in an increase of the energy gap, valence band width, and cohesive energy. The lattice constant of the core and oxidized surface parts shows a decreasing trend as the nanocrystal increases in a size that converges to 5.28 Ǻ in a good agreement with the experiment. Surface and core convergence to the same lattice constant reflects good adherence of oxide layer at the surface. The core density of states shows highly degenerate states that split at the oxygenated (001-(1×1 surface due to symmetry breaking. The nanocrystal surface shows smaller gap and higher valence and conduction bands when compared to the core part, due to oxygen surface atoms and reduced structural symmetry. The smaller surface energy gap shows that energy gap of the nanocrystal is controlled by the surface part. Unlike the core part, the surface part shows a descending energy gap that proves its obedience to quantum confinement effects. Nanocrystal geometry proved to have some influence on all electronic properties including the energy gap.
Evaluating Education and Science in the KSC Visitor Complex Exhibits
Erickson, Lance K.
2000-01-01
The continuing development of exhibits at the Kennedy Space Center's Visitor Complex is an excellent opportunity for NASA personnel to promote science and provide insight into NASA programs and projects for the approximately 3 million visitors that come to KSC annually. Stated goals for the Visitor Complex, in fact, emphasize science awareness and recommend broadening the appeal of the displays and exhibits for all age groups. To this end, this summer project seeks to evaluate the science content of planned exhibits/displays in relation to these developing opportunities and identify specific areas for enhancement of existing or planned exhibits and displays. To help expand the educational and science content within the developing exhibits at the Visitor Complex, this project was structured to implement the goals of the Visitor Center Director. To accomplish this, the exhibits and displays planned for completion within the year underwent review and evaluation for science content and educational direction. Planning emphasis for the individual displays was directed at combining the elements of effective education with fundamental scientific integrity, within an appealing format.
Surface correlations of hydrodynamic drag for transitionally rough engineering surfaces
Thakkar, Manan; Busse, Angela; Sandham, Neil
2017-02-01
Rough surfaces are usually characterised by a single equivalent sand-grain roughness height scale that typically needs to be determined from laboratory experiments. Recently, this method has been complemented by a direct numerical simulation approach, whereby representative surfaces can be scanned and the roughness effects computed over a range of Reynolds number. This development raises the prospect over the coming years of having enough data for different types of rough surfaces to be able to relate surface characteristics to roughness effects, such as the roughness function that quantifies the downward displacement of the logarithmic law of the wall. In the present contribution, we use simulation data for 17 irregular surfaces at the same friction Reynolds number, for which they are in the transitionally rough regime. All surfaces are scaled to the same physical roughness height. Mean streamwise velocity profiles show a wide range of roughness function values, while the velocity defect profiles show a good collapse. Profile peaks of the turbulent kinetic energy also vary depending on the surface. We then consider which surface properties are important and how new properties can be incorporated into an empirical model, the accuracy of which can then be tested. Optimised models with several roughness parameters are systematically developed for the roughness function and profile peak turbulent kinetic energy. In determining the roughness function, besides the known parameters of solidity (or frontal area ratio) and skewness, it is shown that the streamwise correlation length and the root-mean-square roughness height are also significant. The peak turbulent kinetic energy is determined by the skewness and root-mean-square roughness height, along with the mean forward-facing surface angle and spanwise effective slope. The results suggest feasibility of relating rough-wall flow properties (throughout the range from hydrodynamically smooth to fully rough) to surface
Simulated BRDF based on measured surface topography of metal
Yang, Haiyue; Haist, Tobias; Gronle, Marc; Osten, Wolfgang
2017-06-01
The radiative reflective properties of a calibration standard rough surface were simulated by ray tracing and the Finite-difference time-domain (FDTD) method. The simulation results have been used to compute the reflectance distribution functions (BRDF) of metal surfaces and have been compared with experimental measurements. The experimental and simulated results are in good agreement.
Do current sports nutrition guidelines conflict with good oral health?
Broad, Elizabeth M; Rye, Leslie A
2015-01-01
For optimal athletic performance, an athlete requires good oral health to reduce the risk of oral pain, inflammation, and infection and thereby minimize the use of analgesics and antimicrobial agents. Increased intake, frequency, and dental contact time of carbohydrate-rich foods, sports nutrition products, and acidic carbohydrate-containing sports and energy drinks may contribute to risks of dental erosion, caries, and inflammatory periodontal conditions in the athlete, especially when he or she also exhibits dehydration and poor oral hygiene habits. Examining the athlete before he or she begins participating in a sport allows the dental care provider to determine the patient's existing oral health, hygiene, and susceptibility to risk factors for erosion, caries, and inflammatory periodontal disease. This oral profile, in conjunction with the individual athlete's dietary needs, can be used to establish a treatment and preventive program, including oral health education. Good oral hygiene practices and application of topical fluoride, especially via fluoridated toothpastes and topical fluoride varnishes, must be available to the athlete. Rinsing with water or a neutral beverage after exposure to carbohydrates or acidic sports nutrition products may reduce carbohydrate contact time and bring oral pH levels back to neutral more quickly, reducing the risk of caries and erosion. Finally, the dentist should encourage the athlete to consult with an experienced sports dietitian to ensure that principles of sports nutrition are being appropriately applied for the type, frequency, and duration of exercise in consideration of the individual's oral health needs.
Energy Technology Data Exchange (ETDEWEB)
Hysen, T., E-mail: hysenthomas@gmail.com [Department of Physics, Cochin University of Science and Technology, Cochin 682022, Kerala (India); Al-Harthi, Salim; Al-Omari, I.A. [Department of Physics, Sultan Qaboos University, PC 123, Muscat, Sultanate of Oman (Oman); Geetha, P.; Lisha, R. [Department of Physics, Cochin University of Science and Technology, Cochin 682022, Kerala (India); Ramanujan, R.V. [School of Materials Engineering, Nanyang Technological University, Singapore 639798 (Singapore); Sakthikumar, D. [Graduate School of Interdisciplinary New Science, Toyo University, Kawagoe, Saitama (Japan); Anantharaman, M.R., E-mail: mra@cusat.ac.in [Department of Physics, Cochin University of Science and Technology, Cochin 682022, Kerala (India)
2013-09-15
Co–Fe–Si based films exhibit high magnetic moments and are highly sought after for applications like soft under layers in perpendicular recording media to magneto-electro-mechanical sensor applications. In this work the effect of annealing on structural, morphological and magnetic properties of Co–Fe–Si thin films was investigated. Compositional analysis using X-ray photoelectron spectroscopy and secondary ion mass spectroscopy revealed a native oxide surface layer consisting of oxides of Co, Fe and Si on the surface. The morphology of the as deposited films shows mound like structures conforming to the Volmer–Weber growth model. Nanocrystallisation of amorphous films upon annealing was observed by glancing angle X-ray diffraction and transmission electron microscopy. The evolution of magnetic properties with annealing is explained using the Herzer model. Vibrating sample magnetometry measurements carried out at various angles from 0° to 90° to the applied magnetic field were employed to study the angular variation of coercivity. The angular variation fits the modified Kondorsky model. Interestingly, the coercivity evolution with annealing deduced from magneto-optical Kerr effect studies indicates a reverse trend compared to magetisation observed in the bulk. This can be attributed to a domain wall pinning at native oxide layer on the surface of thin films. The evolution of surface magnetic properties is correlated with morphology evolution probed using atomic force microscopy. The morphology as well as the presence of the native oxide layer dictates the surface magnetic properties and this is corroborated by the apparent difference in the bulk and surface magnetic properties. - Highlights: • The relation between grain size and magnetic properties in Co–Fe–Si thin films obeys the Herzer model. • Angular variation of coercivity is found to obey the Kondorsky model. • The MOKE measurements provide further evidence for domain wall pinning.
Bio-Inspired Extreme Wetting Surfaces for Biomedical Applications
Shin, Sera; Seo, Jungmok; Han, Heetak; Kang, Subin; Kim, Hyunchul; Lee, Taeyoon
2016-01-01
Biological creatures with unique surface wettability have long served as a source of inspiration for scientists and engineers. More specifically, materials exhibiting extreme wetting properties, such as superhydrophilic and superhydrophobic surfaces, have attracted considerable attention because of their potential use in various applications, such as self-cleaning fabrics, anti-fog windows, anti-corrosive coatings, drag-reduction systems, and efficient water transportation. In particular, the engineering of surface wettability by manipulating chemical properties and structure opens emerging biomedical applications ranging from high-throughput cell culture platforms to biomedical devices. This review describes design and fabrication methods for artificial extreme wetting surfaces. Next, we introduce some of the newer and emerging biomedical applications using extreme wetting surfaces. Current challenges and future prospects of the surfaces for potential biomedical applications are also addressed. PMID:28787916
Guo, Shiguang; Zhang, Jianghua; Shao, Mingxue; Zhang, Xia; Liu, Yufeng; Xu, Junli; Meng, Hao; Han, Yide
2015-04-01
Surface functionalized nanoparticles are efficient adsorbents which have shown good potential for protein separation. In this work, we chose two different types of organic molecules, oleic acid (OA) and 3-glycidoxypropyltrimethoxy silane (GPTMS), to functionalize the surface of TiO2 nanoparticles, and we studied the effects of this modification on their surface physicochemical properties in correlation with their selective adsorption of proteins. The results showed that the surface zeta potential and the surface water wettability of the modified TiO2 were significantly changed in comparison with the original TiO2 nanoparticles. The adsorption activities of bovine hemoglobin (BHb) and bovine serum albumin (BSA) on these functionalized TiO2 samples were investigated under different conditions, including pH values, contact time, ion strength, and initial protein concentration. In comparison with the non-specific adsorption of original TiO2, however, both the OA-TiO2 and GPTMS-TiO2 exhibited increased BHb adsorption and decreased BSA adsorption at the same time. Using a binary protein mixture as the adsorption object, a higher separation factor (SF) was obtained for OA-TiO2 under optimum conditions. The different adsorption activities of BHb and BSA on the modified TiO2 were correlated with different interactions at the protein/solid interface, and the chemical force as well as the electrostatic force played an important role in the selective adsorption process.
Surface composition of Europa based on VLT observations
Ligier, N.; Poulet, F.; Carter, J.
2016-12-01
Jupiter's moon Europa may harbor a global salty ocean under an 80-170 km thick outer layer consisting of an icy crust (Anderson et al. 1998). Meanwhile, the 10-50 My old surface, dated by cratering rates (Pappalardo et al. 1999) implies rapid surface recycling and reprocessing that could result in tectonic activity (Kattenhorn et al. 2014) and plumes (Roth et al. 2014). The surface could thus exhibit fingerprints of chemical species, as minerals characteristics of an ocean-mantle interaction and/or organics of exobiological interest, directly originating from the subglacial ocean. In order to re-investigate the composition of Europa's surface, a global mapping campaign of the satellite was performed with the near-infrared integral field spectrograph SINFONI on the Very Large Telescope (VLT) in Chile. The high spectral binning of this instrument (0.5 nm) and large signal noise ratio in comparison to previous observations are adequate to detect sharp absorptions in the wavelength range 1.45-2.45 μm. In addition, the spatially resolved spectra we obtained over five epochs nearly cover the entire surface of Europa with a pixel scale of 12.5 by 25 m.a.s ( 35 by 70 km on Europa's surface), thus permitting a global scale study. Several icy and non-icy compounds were detected and mapped at <100 km resolution. They are unevenly distributed on the moon's surface. Amorphous and crystalline water ice are both present and, in spite of a particularly strong amorphization process likely engendered by the Io plasma torus, the crystalline form is found to be approximately twice as abundant as the amorphous ice based on the analysis of the 1.65 μm band. If the surface is dominated by small and mid-sized water ice grains (25-200 μm), crystalline water-ice grains exhibit spatial inhomogeneities in their distribution. The sulfuric acid hydrate distribution exhibits the typical "bullseye" feature on the trailing hemisphere. The presence of Mg-bearing chlorinated salts (chloride
Effect of Surface Hydration on Antifouling Properties of Mixed Charged Polymers.
Leng, Chuan; Huang, Hao; Zhang, Kexin; Hung, Hsiang-Chieh; Xu, Yao; Li, Yaoxin; Jiang, Shaoyi; Chen, Zhan
2018-05-07
Interfacial water structure on a polymer surface in water (or surface hydration) is related to the antifouling activity of the polymer. Zwitterionic polymer materials exhibit excellent antifouling activity due to their strong surface hydration. It was proposed to replace zwitterionic polymers using mixed charged polymers because it is much easier to prepare mixed charged polymer samples with much lower costs. In this study, using sum frequency generation (SFG) vibrational spectroscopy, we investigated interfacial water structures on mixed charged polymer surfaces in water, and how such structures change while exposing to salt solutions and protein solutions. The 1:1 mixed charged polymer exhibits excellent antifouling property while other mixed charged polymers with different ratios of the positive/negative charges do not. It was found that on the 1:1 mixed charged polymer surface, SFG water signal is dominated by the contribution of the strongly hydrogen bonded water molecules, indicating strong hydration of the polymer surface. The responses of the 1:1 mixed charged polymer surface to salt solutions are similar to those of zwitterionic polymers. Interestingly, exposure to high concentrations of salt solutions leads to stronger hydration of the 1:1 mixed charged polymer surface after replacing the salt solution with water. Protein molecules do not substantially perturb the interfacial water structure on the 1:1 mixed charged polymer surface and do not adsorb to the surface, showing that this mixed charged polymer is an excellent antifouling material.
Reconsidering the “Good Divorce”
Amato, Paul R.; Kane, Jennifer B.; James, Spencer
2011-01-01
This study attempted to assess the notion that a “good divorce” protects children from the potential negative consequences of marital dissolution. A cluster analysis of data on postdivorce parenting from 944 families resulted in three groups: cooperative coparenting, parallel parenting, and single parenting. Children in the cooperative coparenting (good divorce) cluster had the smallest number of behavior problems and the closest ties to their fathers. Nevertheless, children in this cluster did not score significantly better than other children on 10 additional outcomes. These findings provide only modest support for the good divorce hypothesis. PMID:22125355
Good Towers of Function Fields
DEFF Research Database (Denmark)
Bassa, Alp; Beelen, Peter; Nguyen, Nhut
2014-01-01
In this paper, we will give an overview of known and new techniques on how one can obtain explicit equations for candidates of good towers of function fields. The techniques are founded in modular theory (both the classical modular theory and the Drinfeld modular theory). In the classical modular...... setup, optimal towers can be obtained, while in the Drinfeld modular setup, good towers over any non-prime field may be found. We illustrate the theory with several examples, thus explaining some known towers as well as giving new examples of good explicitly defined towers of function fields....
Directory of Open Access Journals (Sweden)
Timothy G. Mattson
2003-01-01
Full Text Available The OpenMP standard defines an Application Programming Interface (API for shared memory computers. Since its introduction in 1997, it has grown to become one of the most commonly used API's for parallel programming. But success in the market doesn't necessarily imply successful computer science. Is OpenMP a "good" programming environment? What does it even mean to call a programming environment good? And finally, once we understand how good or bad OpenMP is; what can we do to make it even better? In this paper, we will address these questions.
Janicki, Damian
2018-01-05
TiC-reinforced composite surface layers (TRLs) on a ductile cast iron EN-GJS-700-2 grade (DCI) substrate were synthesized using a diode laser surface alloying with a direct injection of titanium powder into the molten pool. The experimental results were compared with thermodynamic calculations. The TRLs having a uniform distribution of the TiC particles and their fraction up to 15.4 vol % were achieved. With increasing titanium concentration in the molten pool, fractions of TiC and retained austenite increase and the shape of TiC particles changes from cubic to dendritic form. At the same time, the cementite fraction decreases, lowering the overall hardness of the TRL. A good agreement between experimental and calculated results was achieved. Comparative dry sliding wear tests between the as-received DCI, the TRLs and also laser surface melted layers (SMLs) have been performed following the ASTM G 99 standard test method under contact pressures of 2.12 and 4.25 MPa. For both the as-received DCI and the SMLs, the wear rates increased with increasing contact pressure. The TRLs exhibited a significantly higher wear resistance than the others, which was found to be load independent.
Quantum field theory near surfaces of discontinuity
International Nuclear Information System (INIS)
Onishi, H.T.
1981-01-01
This work deals with the problem of a quantized scalar field propagating near a surface of discontinuity. The proper time formalism is employed to express the Green's function and stress tensor as proper time integrals of a transformation function. The transformation function is calculated by a WKB approximation which exhibits the essential singularities generated by the high frequency behavior of waves propagating near the surface. Two singularities are present, the usual direct singularity and an additional reflected singularity generated by the high frequency behavior of waves reflected by the discontinuity. The stress tensor is calculated by dimensional continuation. The results are employed to analyze energy generated by the surface
A New Approach for Biologically-Inhibiting Surfaces
DEFF Research Database (Denmark)
Møller, Per; Hilbert, Lisbeth Rischel; Corfitzen, Charlotte B.
2007-01-01
in nanometers. Due to the difference in potentials, the biologically-inhibiting material will act as a galvanic element in contact with an electrolyte. The electrochemical processes taking place at the metal surface seem to exhibit a catalytic oxidation character more than an oligomeric effect from the silver....
Fracture surfaces of granular pastes.
Mohamed Abdelhaye, Y O; Chaouche, M; Van Damme, H
2013-11-01
Granular pastes are dense dispersions of non-colloidal grains in a simple or a complex fluid. Typical examples are the coating, gluing or sealing mortars used in building applications. We study the cohesive rupture of thick mortar layers in a simple pulling test where the paste is initially confined between two flat surfaces. After hardening, the morphology of the fracture surfaces was investigated, using either the box counting method to analyze fracture profiles perpendicular to the mean fracture plane, or the slit-island method to analyze the islands obtained by cutting the fracture surfaces at different heights, parallel to the mean fracture plane. The fracture surfaces were shown to exhibit scaling properties over several decades. However, contrary to what has been observed in the brittle or ductile fracture of solid materials, the islands were shown to be mass fractals. This was related to the extensive plastic flow involved in the fracture process.
Three-tier rough superhydrophobic surfaces
International Nuclear Information System (INIS)
Cao, Yuanzhi; Yuan, Longyan; Hu, Bin; Zhou, Jun
2015-01-01
A three-tier rough superhydrophobic surface was fabricated by growing hydrophobic modified (fluorinated silane) zinc oxide (ZnO)/copper oxide (CuO) hetero-hierarchical structures on silicon (Si) micro-pillar arrays. Compared with the other three control samples with a less rough tier, the three-tier surface exhibits the best water repellency with the largest contact angle 161° and the lowest sliding angle 0.5°. It also shows a robust Cassie state which enables the water to flow with a speed over 2 m s"−"1. In addition, it could prevent itself from being wetted by the droplet with low surface tension (mixed water and ethanol 1:1 in volume) which reveals a flow speed of 0.6 m s"−"1 (dropped from the height of 2 cm). All these features prove that adding another rough tier on a two-tier rough surface could futher improve its water-repellent properties. (paper)
The spectrum of hyperbolic surfaces
Bergeron, Nicolas
2016-01-01
This text is an introduction to the spectral theory of the Laplacian on compact or finite area hyperbolic surfaces. For some of these surfaces, called “arithmetic hyperbolic surfaces”, the eigenfunctions are of arithmetic nature, and one may use analytic tools as well as powerful methods in number theory to study them. After an introduction to the hyperbolic geometry of surfaces, with a special emphasis on those of arithmetic type, and then an introduction to spectral analytic methods on the Laplace operator on these surfaces, the author develops the analogy between geometry (closed geodesics) and arithmetic (prime numbers) in proving the Selberg trace formula. Along with important number theoretic applications, the author exhibits applications of these tools to the spectral statistics of the Laplacian and the quantum unique ergodicity property. The latter refers to the arithmetic quantum unique ergodicity theorem, recently proved by Elon Lindenstrauss. The fruit of several graduate level courses at Orsay...
Punishment in public goods games leads to meta-stable phase transitions and hysteresis
Hintze, Arend; Adami, Christoph
2015-07-01
The evolution of cooperation has been a perennial problem in evolutionary biology because cooperation can be undermined by selfish cheaters who gain an advantage in the short run, while compromising the long-term viability of the population. Evolutionary game theory has shown that under certain conditions, cooperation nonetheless evolves stably, for example if players have the opportunity to punish cheaters that benefit from a public good yet refuse to pay into the common pool. However, punishment has remained enigmatic because it is costly and difficult to maintain. On the other hand, cooperation emerges naturally in the public goods game if the synergy of the public good (the factor multiplying the public good investment) is sufficiently high. In terms of this synergy parameter, the transition from defection to cooperation can be viewed as a phase transition with the synergy as the critical parameter. We show here that punishment reduces the critical value at which cooperation occurs, but also creates the possibility of meta-stable phase transitions, where populations can ‘tunnel’ into the cooperating phase below the critical value. At the same time, cooperating populations are unstable even above the critical value, because a group of defectors that are large enough can ‘nucleate’ such a transition. We study the mean-field theoretical predictions via agent-based simulations of finite populations using an evolutionary approach where the decisions to cooperate or to punish are encoded genetically in terms of evolvable probabilities. We recover the theoretical predictions and demonstrate that the population shows hysteresis, as expected in systems that exhibit super-heating and super-cooling. We conclude that punishment can stabilize populations of cooperators below the critical point, but it is a two-edged sword: it can also stabilize defectors above the critical point.
Baumeister, R.F.; Bratslavsky, E.; Finkenauer, C.; Vohs, K.D.
2001-01-01
The greater power of bad events over good ones is found in everyday events, major life events (e.g., trauma), close relationship outcomes, social network patterns, interpersonal interactions, and learning processes. Bad emotions, bad parents, and bad feedback have more impact than good ones, and bad
Long-term stable surface modification of DLC coatings
Directory of Open Access Journals (Sweden)
Gotzmann Gaby
2017-09-01
Full Text Available The use of coatings based on diamond like carbon (DLC for medical applications was established during the last years. Main advantages of these coatings are its high hardness, good wear and friction behavior and its biocompatibility. Using low-energy electron-beam treatment, we addressed the surface modification of DLC coatings. The aim was to generate new biofunctional surface characteristics that are long-term stable.
Spontaneous formation of optically induced surface relief gratings
International Nuclear Information System (INIS)
Leblond, H; Barille, R; Ahmadi-Kandjani, S; Nunzi, J-M; Ortyl, E; Kucharski, S
2009-01-01
We develop a model based on Fick's law of diffusion as a phenomenological description of the molecular motion, and on the coupled mode theory, to describe single-beam surface relief grating formation in azopolymer thin films. The model allows us to explain the mechanism of spontaneous patterning, and self-organization. It allows us to compute the surface relief profile and its evolution, with good agreement with experiments.
Water droplet evaporation from sticky superhydrophobic surfaces
Lee, Moonchan; Kim, Wuseok; Lee, Sanghee; Baek, Seunghyeon; Yong, Kijung; Jeon, Sangmin
2017-07-01
The evaporation dynamics of water from sticky superhydrophobic surfaces was investigated using a quartz crystal microresonator and an optical microscope. Anodic aluminum oxide (AAO) layers with different pore sizes were directly fabricated onto quartz crystal substrates and hydrophobized via chemical modification. The resulting AAO layers exhibited hydrophobic or superhydrophobic characteristics with strong adhesion to water due to the presence of sealed air pockets inside the nanopores. After placing a water droplet on the AAO membranes, variations in the resonance frequency and Q-factor were measured throughout the evaporation process, which were related to changes in mass and viscous damping, respectively. It was found that droplet evaporation from a sticky superhydrophobic surface followed a constant contact radius (CCR) mode in the early stage of evaporation and a combination of CCR and constant contact angle modes without a Cassie-Wenzel transition in the final stage. Furthermore, AAO membranes with larger pore sizes exhibited longer evaporation times, which were attributed to evaporative cooling at the droplet interface.
Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO
International Nuclear Information System (INIS)
Pal, Subrata; Maiti, Prabal K; Bagchi, Biman
2005-01-01
We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics
Energy Technology Data Exchange (ETDEWEB)
Li, Min [State Key Laboratory of Explosion Science and Technology, Beijing Institute of Technology, Beijing 100081 (China); Feng, Changgen, E-mail: cgfeng@cast.org.cn [State Key Laboratory of Explosion Science and Technology, Beijing Institute of Technology, Beijing 100081 (China); Li, Mingyu; Zeng, Qingxuan; Gan, Qiang [State Key Laboratory of Explosion Science and Technology, Beijing Institute of Technology, Beijing 100081 (China); Yang, Haiyan [Research Institute of Tsinghua University in Shenzhen, Shenzhen 518057 (China)
2015-03-30
Highlights: • Cd(II) ion-imprinted polymer (Cd(II)-IIP) is prepared. • Cd(II)-IIP shows high stability, good selectivity and reusability. • Cd(II)-IIP can be used as a sorbent for selective removal of Cd(II) ion. - Abstract: A novel Cd(II) ion-imprinted polymer (Cd(II)-IIP) was prepared with surface imprinting technology by using cadmium chloride as a template and allyl thiourea (ATU) as a functional monomer for on-line solid-phase extraction of trace Cd(II) ion and selective separation Cd(II) ion in water samples. The Cd(II)-IIP exhibited good chemical performance and thermal stability. Kinetics studies showed that the equilibrium adsorption was achieved within 8.0 min and the adsorption process can be described by pseudo-second-order kinetic model. Compared to the Cd(II) non-imprinted polymer (Cd(II)-NIP), the Cd(II)-IIP had a higher adsorption capacity and selectivity for Cd(II) ion. The maximum adsorption capacities of the Cd(II)-IIP and Cd(II)-NIP for Cd(II) were 38.30 and 13.21 mg g{sup −1}, respectively. The relative selectivity coefficients of the adsorbent for Cd(II) in the presence of Cu{sup 2+}, Ni{sup 2+}, Co{sup 2+}, Pb{sup 2+} and Zn{sup 2+} were 2.86, 6.42, 11.50, 9.46 and 3.73, respectively. In addition, the Cd(II) ion adsorbed was easy to remove from sorbent and the Cd(II)-IIP exhibited good stability and reusability. The adsorption capacity had no obvious decrease after being used six times. The accuracy of this method was verified by the standard reference material, it was then applied for cadmium ion determination in different types of water samples.
Unoccupied Surface State on Ag(110) as Revealed by Inverse Photoemission
Reihl, B.; Schlittler, R. R.; Neff, H.
1984-05-01
By use of the new technique of k-resolved inverse photoemission spectroscopy, an unoccupied s-like surface state on Ag(110) has been detected, which lies within the projected L2'-->L1 gap of the bulk. At the X¯ point of the surface Brillouin zone, the energy of the surface state is 1.65 eV above the Fermi level EF, and exhibits a band dispersion E(k∥) towards higher energies. The surface-state emission is immediately quenched when the surface is exposed to very small amounts of oxygen or hydrogen.
Generating and exploring good building layouts
Bao, Fan
2013-07-16
Good building layouts are required to conform to regulatory guidelines, while meeting certain quality measures. While different methods can sample the space of such good layouts, there exists little support for a user to understand and systematically explore the samples. Starting from a discrete set of good layouts, we analytically characterize the local shape space of good layouts around each initial layout, compactly encode these spaces, and link them to support transitions across the different local spaces. We represent such transitions in the form of a portal graph. The user can then use the portal graph, along with the family of local shape spaces, to globally and locally explore the space of good building layouts. We use our framework on a variety of different test scenarios to showcase an intuitive design, navigation, and exploration interface. Copyright © ACM. Copyright © ACM 2013.
Agus, Marco
2018-01-29
We analyze use of an interactive system for the exploration of highly detailed three-dimensional (3D) models of a collection of protostoric Mediterranean sculptures. In this system, when the object of interest is selected, its detailed 3D model and associated information are presented at high resolution on a large display controlled by a touch-enabled horizontal surface at a suitable distance. The user interface combines an object-Aware interactive camera controller with an interactive point-ofinterest selector and is implemented within a scalable implementation based on multiresolution structures shared between the rendering and user interaction subsystems. The system was installed in several temporary and permanent exhibitions and was extensively used by tens of thousands of visitors. We provide a data-driven analysis of usage experience based on logs gathered during a 27-month period at four exhibitions in archeological museums for a total of more than 75K exploration sessions. We focus on discerning the main visitor behaviors during 3D exploration by employing tools for deriving interest measures on surfaces and tools for clustering and knowledge discovery from high-dimensional data. The results highlight the main trends in visitor behavior during the interactive sessions. These results provide useful insights for the design of 3D exploration user interfaces in future digital installations.© 2017 ACM 1556-4673/2017/12-ART2 $15.00.
Agus, Marco; Marton, Fabio; Bettio, Fabio; Hadwiger, Markus; Gobbetti, Enrico
2018-01-01
We analyze use of an interactive system for the exploration of highly detailed three-dimensional (3D) models of a collection of protostoric Mediterranean sculptures. In this system, when the object of interest is selected, its detailed 3D model and associated information are presented at high resolution on a large display controlled by a touch-enabled horizontal surface at a suitable distance. The user interface combines an object-Aware interactive camera controller with an interactive point-ofinterest selector and is implemented within a scalable implementation based on multiresolution structures shared between the rendering and user interaction subsystems. The system was installed in several temporary and permanent exhibitions and was extensively used by tens of thousands of visitors. We provide a data-driven analysis of usage experience based on logs gathered during a 27-month period at four exhibitions in archeological museums for a total of more than 75K exploration sessions. We focus on discerning the main visitor behaviors during 3D exploration by employing tools for deriving interest measures on surfaces and tools for clustering and knowledge discovery from high-dimensional data. The results highlight the main trends in visitor behavior during the interactive sessions. These results provide useful insights for the design of 3D exploration user interfaces in future digital installations.© 2017 ACM 1556-4673/2017/12-ART2 $15.00.
7 CFR 51.1011 - Good green color.
2010-01-01
... 7 Agriculture 2 2010-01-01 2010-01-01 false Good green color. 51.1011 Section 51.1011 Agriculture... Standards for Persian (Tahiti) Limes Definitions § 51.1011 Good green color. Good green color means that the skin of the lime is of a good green color characteristic of the Persian variety. ...
Pal, Arun; Chand, Santanu; Elahi, Syed Meheboob; Das, Madhab C
2017-11-14
A microporous MOF {[Zn(SDB)(L) 0.5 ]·S} n (IITKGP-5) with a polar pore surface has been constructed by the combination of a V-shaped -SO 2 functionalized organic linker (H 2 SDB = 4,4'-sulfonyldibenzoic acid) with an N-rich spacer (L = 2,5-bis(3-pyridyl)-3,4-diaza-2,4-hexadiene), forming a network with sql(2,6L1) topology. IITKGP-5 is characterized by TGA, PXRD and single crystal X-ray diffraction. The framework exhibits lozenge-shaped channels of an approximate size of 4.2 × 5.6 Å 2 along the crystallographic b axis with a potential solvent accessible volume of 26%. The activated IITKGP-5a revealed a CO 2 uptake capacity of 56.4 and 49 cm 3 g -1 at 273 K/1 atm and 295 K/1 atm, respectively. On the contrary, it takes up a much smaller amount of CH 4 (17 cm 3 g -1 at 273 K and 13.6 cm 3 g -1 at 295 K) and N 2 (5.5 cm 3 g -1 at 273 K; 4 cm 3 g -1 at 295 K) under 1 atm pressure exhibiting its potential for a highly selective adsorption of CO 2 from flue gas as well as a landfill gas mixture. Based on the ideal adsorbed solution theory (IAST), a CO 2 /N 2 selectivity of 435.5 and a CO 2 /CH 4 selectivity of 151.6 have been realized at 273 K/100 kPa. The values at 295 K are 147.8 for CO 2 /N 2 and 23.8 for CO 2 /CH 4 gas mixtures under 100 kPa. In addition, this MOF nearly approaches the target values proposed for PSA and TSA processes for practical utility exhibiting its prospect for flue gas separation with a CO 2 loading capacity of 2.04 mmol g -1 .
Hierarchical surfaces for enhanced self-cleaning applications
Fernández, Ariadna; Francone, Achille; Thamdrup, Lasse H.; Johansson, Alicia; Bilenberg, Brian; Nielsen, Theodor; Guttmann, Markus; Sotomayor Torres, Clivia M.; Kehagias, Nikolaos
2017-04-01
In this study we present a flexible and adaptable fabrication method to create complex hierarchical structures over inherently hydrophobic resist materials. We have tested these surfaces for their superhydrophobic behaviour and successfully verified their self-cleaning properties. The followed approach allow us to design and produce superhydrophobic surfaces in a reproducible manner. We have analysed different combination of hierarchical micro-nanostructures for their application to self-cleaning surfaces. A static contact angle value of 170° with a hysteresis of 4° was achieved without the need of any additional chemical treatment on the fabricated hierarchical structures. Dynamic effects were analysed on these surfaces, obtaining a remarkable self-cleaning effect as well as a good robustness over impacting droplets.
A phenomenological investigation of science center exhibition developers' expertise development
Young, Denise L.
The purpose of this study was to examine the exhibition developer role in the context of United States (U.S.) science centers, and more specifically, to investigate the way science center exhibition developers build their professional expertise. This research investigated how successfully practicing exhibition developers described their current practices, how they learned to be exhibition developers, and what factors were the most important to the developers in building their professional expertise. Qualitative data was gathered from 10 currently practicing exhibition developers from three science centers: the Exploratorium, San Francisco, California; the Field Museum, Chicago, Illinois; and the Science Museum of Minnesota, St. Paul, Minnesota. In-depth, semistructured interviews were used to collect the data. The study embraced aspects of the phenomenological tradition and sought to derive a holistic understanding of the position and how expertise was built for it. The data were methodically coded and organized into themes prior to analysis. The data analysis found that the position consisted of numerous and varied activities, but the developers' primary roles were advocating for the visitor, storytelling, and mediating information and ideas. They conducted these activities in the context of a team and relied on an established exhibition planning process to guide their work. Developers described a process of learning exhibition development that was experiential in nature. Learning through daily practice was key, though they also consulted with mentors and relied on visitor studies to gauge the effectiveness of their work. They were adept at integrating prior knowledge gained from many aspects of their lives into their practice. The developers described several internal factors that contributed to their expertise development including the desire to help others, a natural curiosity about the world, a commitment to learning, and the ability to accept critique. They