Plasma diffusion in systems with disrupted magnetic surfaces

International Nuclear Information System (INIS)

Morozov, D.K.; Pogutse, O.P.

1982-01-01

Plasma diffusion is analyzed in the case in which the system of magnetic surfaces is disrupted by a stochastic perturbation of the magnetic field. The diffusion coefficient is related to the statistical properties of the field. The statistical characteristics of the field are found when the magnetic surfaces near the separatrix are disrupted by an external perturbation. The diffusion coefficient is evaluated in the region in which the magnetic surfaces are disrupted. In this region the diffusion coefficient is of the Bohm form

Reactive solid surface morphology variation via ionic diffusion.

Science.gov (United States)

Sun, Zhenchao; Zhou, Qiang; Fan, Liang-Shih

2012-08-14

In gas-solid reactions, one of the most important factors that determine the overall reaction rate is the solid morphology, which can be characterized by a combination of smooth, convex and concave structures. Generally, the solid surface structure varies in the course of reactions, which is classically noted as being attributed to one or more of the following three mechanisms: mechanical interaction, molar volume change, and sintering. Here we show that if a gas-solid reaction involves the outward ionic diffusion of a solid-phase reactant then this outward ionic diffusion could eventually smooth the surface with an initial concave and/or convex structure. Specifically, the concave surface is filled via a larger outward diffusing surface pointing to the concave valley, whereas the height of the convex surface decreases via a lower outward diffusion flux in the vertical direction. A quantitative 2-D continuum diffusion model is established to analyze these two morphological variation processes, which shows consistent results with the experiments. This surface morphology variation by solid-phase ionic diffusion serves to provide a fourth mechanism that supplements the traditionally acknowledged solid morphology variation or, in general, porosity variation mechanisms in gas-solid reactions.

SOUND FIELD DIFFUSIVITY AT THE TOP SURFACE OF SCHROEDER DIFFUSER BARRIERS

OpenAIRE

M. R. Monazzam

2006-01-01

Reactive barriers are one of the most promising and novel environmental noise barriers. In this case using Schroeder diffusers (e.g. quadratic residue diffusers) on the top surface of the T-shape barrier was shown to significantly improve the performance of absorbent T-shape barriers. The reasons behind the high performance of diffuser barriers are considered in this investigation. A question about the diffusivity behavior of Schroeder diffusers when they are utilized on the top of barrier wa...

Effect of strain on surface diffusion and nucleation

DEFF Research Database (Denmark)

Brune, Harald; Bromann, Karsten; Röder, Holger

1995-01-01

The influence of strain on diffusion and nucleation has been studied by means of scanning tunneling microscopy and effective-medium theory for Ag self-diffusion on strained and unstrained (111) surfaces. Experimentally, the diffusion barrier is observed to be substantially lower on a pseudomorphic...... effect on surface diffusion and nucleation in heteroepitaxy and are thus of significance for the film morphology in the kinetic growth regime....

Polymer diffusion in the interphase between surface and solution.

Science.gov (United States)

Weger, Lukas; Weidmann, Monika; Ali, Wael; Hildebrandt, Marcus; Gutmann, Jochen Stefan; Hoffmann-Jacobsen, Kerstin

2018-05-22

Total internal reflection fluorescence correlation spectroscopy (TIR-FCS) is applied to study the self-diffusion of polyethylene glycol solutions in the presence of weakly attractive interfaces. Glass coverslips modified with aminopropyl- and propyl-terminated silanes are used to study the influence of solid surfaces on polymer diffusion. A model of three phases of polymer diffusion allows to describe the experimental fluorescence autocorrelation functions. Besides the two-dimensional diffusion of adsorbed polymer on the substrate and three-dimensional free diffusion in bulk solution, a third diffusion time scale is observed with intermediate diffusion times. This retarded three-dimensional diffusion in solution is assigned to long range effects of solid surfaces on diffusional dynamics of polymers. The respective diffusion constants show Rouse scaling (D~N -1 ) indicating a screening of hydrodynamic interactions by the presence of the surface. Hence, the presented TIR-FCS method proves to be a valuable tool to investigate the effect of surfaces on polymer diffusion beyond the first adsorbed polymer layer on the 100 nm length scale.

Chemical diffusion on solid surfaces. Final report

International Nuclear Information System (INIS)

Hudson, J.B.

1980-12-01

The techniques of surface science have been applied to the problem of the measurement of the surface diffusion rate of an adsorbed species over the surface of a chemically dissimilar material. Studies were carried out for hydrogen and nitrogen adatoms on a Ni(100) surface and for silver adatoms on a sapphire surface. Positive results were obtained only for the case of nitrogen on Ni(100). In this system the diffusivity is characterized by the expression D = D 0 exp (/sup -ΔH//RT), with D 0 = 0.25 cm 2 /sec and ΔH = 28kcal/mol

Oxidative Corrosion of the UO ₂ (001) Surface by Nonclassical Diffusion

Energy Technology Data Exchange (ETDEWEB)

Stubbs, Joanne E.; Biwer, Craig A.; Chaka, Anne M. [Pacific Northwest; Ilton, Eugene S. [Pacific Northwest; Du, Yingge [Pacific Northwest; Bargar, John R. [Stanford Synchrotron; Eng, Peter J.

2017-11-07

Uranium oxide is central to every stage of the nuclear fuel cycle, from mining through fuel fabrication and use, to waste disposal and environmental cleanup. Its chemical and mechanical stability are intricately linked to the concentration of interstitial O atoms within the structure and the oxidation state of U. We have previously shown that during corrosion of the UO2 (111) surface under either 1 atm O2 gas or oxygenated water at room temperature, oxygen interstitials diffuse into the substrate to form a superlattice with three-layer periodicity. In the current study, we present results from surface x-ray scattering that reveal the structure of the oxygen diffusion profile beneath the (001) surface. The first few layers below the surface oscillate strongly in their surface-normal lattice parameters, suggesting preferential interstitial occupation of every other layer below the surface, which is geometrically consistent with the interstitial network that forms below the oxidized (111) surface. Deeper layers are heavily contracted and indicate that the oxidation front penetrates ~52 Å below the (001) surface after 21 days of dry O2 gas exposure at ambient pressure and temperature. X-ray photoelectron spectroscopy indicates U is present as U(IV), U(V), and U(VI).

Nuclear Quantum Effects in H(+) and OH(-) Diffusion along Confined Water Wires.

Science.gov (United States)

Rossi, Mariana; Ceriotti, Michele; Manolopoulos, David E

2016-08-04

The diffusion of protons and hydroxide ions along water wires provides an efficient mechanism for charge transport that is exploited by biological membrane channels and shows promise for technological applications such as fuel cells. However, what is lacking for a better control and design of these systems is a thorough theoretical understanding of the diffusion process at the atomic scale. Here we focus on two aspects of this process that are often disregarded because of their high computational cost: the use of first-principles potential energy surfaces and the treatment of the nuclei as quantum particles. We consider proton and hydroxide ions in finite water wires using density functional theory augmented with an apolar cylindrical confining potential. We employ machine learning techniques to identify the charged species, thus obtaining an agnostic definition that takes explicitly into account the delocalization of the charge in the Grotthus-like mechanism. We include nuclear quantum effects (NQEs) through the thermostated ring polymer molecular dynamics method and model finite system size effects by considering Langevin dynamics on the potential of mean force of the charged species, allowing us to extract the same "universal" diffusion coefficient from simulations with different wire sizes. In the classical case, diffusion coefficients depend significantly on the potential energy surface, in particular on how dispersion forces modulate water-water distances. NQEs, however, make the diffusion less sensitive to the underlying potential and geometry of the wire.

Pore and surface diffusion in multicomponent adsorption and liquid chromatography systems

International Nuclear Information System (INIS)

Ma, Z.; Whitley, R.D.; Wang, N.H.L.

1996-01-01

A generalized parallel pore and surface diffusion model for multicomponent adsorption and liquid chromatography is formulated and solved numerically. Analytical solution for first- and second-order central moments for a pulse on a plateau input is used as benchmarks for the numerical solutions. Theoretical predictions are compared with experimental data for two systems: ion-exchange of strontium, sodium, and calcium in a zeolite and competitive adsorption of two organics on activated carbon. In a linear isotherm region of single-component systems, both surface and pore diffusion cause symmetric spreading in breakthrough curves. In a highly nonlinear isotherm region, however, surface diffusion causes pronounced tailing in breakthrough curves; the larger the step change in concentration, the more pronounced tailing, in contrast to relatively symmetric breakthroughs due to pore diffusion. If only a single diffusion mechanism is assumed in analyzing the data of parallel diffusion systems, a concentration-dependent apparent surface diffusivity or pore diffusivity results; for a convex isotherm, the apparent surface diffusivity increases, whereas the apparent pore diffusivity decreases with increasing concentration. For a multicomponent nonlinear system, elution order can change if pore diffusion dominates for a low-affinity solute, whereas surface diffusion dominates for a high-affinity solute

Materials for nuclear diffusion-bonded compact heat exchangers

International Nuclear Information System (INIS)

Li, Xiuqing; Smith, Tim; Kininmont, David; Dewson, Stephen John

2009-01-01

This paper discusses the characteristics of materials used in the manufacture of diffusion bonded compact heat exchangers. Heatric have successfully developed a wide range of alloys tailored to meet process and customer requirements. This paper will focus on two materials of interest to the nuclear industry: dual certified SS316/316L stainless steel and nickel-based alloy Inconel 617. Dual certified SS316/316L is the alloy used most widely in the manufacture of Heatric's compact heat exchangers. Its excellent mechanical and corrosion resistance properties make it a good choice for use with many heat transfer media, including water, carbon dioxide, liquid sodium, and helium. As part of Heatric's continuing product development programme, work has been done to investigate strengthening mechanisms of the alloy; this paper will focus in particular on the effects of nitrogen addition. Another area of Heatric's programme is Alloy 617. This alloy has recently been developed for diffusion bonded compact heat exchanger for high temperature nuclear applications, such as the intermediate heat exchanger (IHX) for the very high temperature nuclear reactors for production of electricity, hydrogen and process heat. This paper will focus on the effects of diffusion bonding process and cooling rate on the properties of alloy 617. This paper also compares the properties and discusses the applications of these two alloys to compact heat exchangers for various nuclear processes. (author)

Friction and diffusion dynamics of adsorbates at surfaces

NARCIS (Netherlands)

Fusco, C.

2005-01-01

A theoretical study of the motion of adsorbates (e. g. atoms, molecules or clusters) on solid surfaces is presented, with a focus on surface diffusion and atomic-scale friction. These two phenomena are inextricably linked, because when an atomic or molecular adsorbate diffuses, or is pulled, it

Diffusion processes in bombardment-induced surface topography

International Nuclear Information System (INIS)

Robinson, R.S.

1984-01-01

The bombardment of surfaces with moderate energy ions can lead to the development of various micron-sized surface structures. These structures include ridges, ledges, flat planes, pits and cones. The causal phenomena in the production of these features are sputtering, ion reflection, redeposition of sputtered material, and surface diffusion of both impurity and target-atom species. The authors concentrate on the formation of ion bombardment-induced surface topography wherein surface diffusion is a dominant process. The most thoroughly understood aspect of this topography development is the generation of cone-like structures during sputtering. The formation of cones during sputtering has been attributed to three effects. These are: (1) the presence of asperities, defects, or micro-inclusions in the surface layers, (2) the presence of impurities on the surfaces, and (3) particular crystal orientations. (Auth.)

A desk study of surface diffusion and mass transport in clay

International Nuclear Information System (INIS)

Cook, A.J.

1989-01-01

Research into the properties of clays as barrier materials for nuclear waste disposal has led to the realization that they have important transport properties which are relatively insignificant in most other geological materials. Sorption has always been regarded as a purely retarding mechanism, but laboratory experiments over the past decade have indicated that surface diffusion of sorbed cations is a potentially significant transport mechanism in both compacted montmorillonite, and biotite gneiss. The present desk study about these issues was part of the CEC coordinated project Mirage-Second phase, research area Natural analogues

A diffuse radar scattering model from Martian surface rocks

Science.gov (United States)

Calvin, W. M.; Jakosky, B. M.; Christensen, P. R.

1987-01-01

Remote sensing of Mars has been done with a variety of instrumentation at various wavelengths. Many of these data sets can be reconciled with a surface model of bonded fines (or duricrust) which varies widely across the surface and a surface rock distribution which varies less so. A surface rock distribution map from -60 to +60 deg latitude has been generated by Christensen. Our objective is to model the diffuse component of radar reflection based on this surface distribution of rocks. The diffuse, rather than specular, scattering is modeled because the diffuse component arises due to scattering from rocks with sizes on the order of the wavelength of the radar beam. Scattering for radio waves of 12.5 cm is then indicative of the meter scale and smaller structure of the surface. The specular term is indicative of large scale surface undulations and should not be causally related to other surface physical properties. A simplified model of diffuse scattering is described along with two rock distribution models. The results of applying the models to a planet of uniform fractional rock coverage with values ranging from 5 to 20% are discussed.

Direct measurement of Cu surface self-diffusion on a checked surface

International Nuclear Information System (INIS)

Cousty, Jacques; Peix, Roger; Perraillon, Bernard.

1976-01-01

A radiotracer technique ( 64 Cu) was developed to measure surface diffusion on copper surfaces of total impurity concentration not exceeding some 10 -3 monolayers. The apparatus used consists of a slow electron diffraction device, an Auger analysis spectrometer (CMA), an ion gun and an evaporation device assembled in an ultra-vacuum chamber holding a residual pressure below 10 -10 Torr. A sample handler enables the surface studied to be positioned in front of each of these instruments. During the diffusion treatment the chemical composition of the surface is checked intermittently, and afterwards the spread of the deposit is measured outside the ultravacuum chamber. Slices several microns thick are removed and dissolved separately in dishes containing HNO 3 . The activity is then measured with a flow counter [fr

Laser-induced desorption determinations of surface diffusion on Rh(111)

International Nuclear Information System (INIS)

Seebauer, E.G.; Schmidt, L.D.

1987-01-01

Surface diffusion of hydrogen, deuterium and CO on Rh(111) has been investigated by laser-induced thermal desorption (LITD) and compared with previous results for these species on Pt(111) and on other metals. For deuterium in the coverage range 0.02 0 - 8 x 10 -2 cm 2 /s, with a diffusion activation energy 3.7 0 rises from 10 -3 to 10 -2 cm 2 /s between θ = 0.01 and 0.40. Values of E/sub diff/ on different surfaces appear to correlate with differences in heats of adsorption in different binding states which form saddle point configurations in surface diffusion. In addition, oxidation reactions on Rh and on several other transition metal surfaces may be limited to CO or H surface diffusion. 30 refs., 3 figs., 1 tab

Influence of the atomic structure of crystal surfaces on the surface diffusion in medium temperature range

International Nuclear Information System (INIS)

Cousty, J.P.

1981-12-01

In this work, we have studied the influence of atomic structure of crystal surface on surface self-diffusion in the medium temperature range. Two ways are followed. First, we have measured, using a radiotracer method, the self-diffusion coefficient at 820 K (0.6 T melting) on copper surfaces both the structure and the cleanliness of which were stable during the experiment. We have shown that the interaction between mobile surface defects and steps can be studied through measurements of the anisotropy of surface self diffusion. Second, the behavior of an adatom and a surface vacancy is simulated via a molecular dynamics method, on several surfaces of a Lennard Jones crystal. An inventory of possible migration mechanisms of these surface defects has been drawn between 0.35 and 0.45 Tsub(m). The results obtained with both the methods point out the influence of the surface atomic structure in surface self-diffusion in the medium temperature range [fr

Stochastic models for surface diffusion of molecules

Energy Technology Data Exchange (ETDEWEB)

Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

2014-07-28

We derive a stochastic model for the surface diffusion of molecules, starting from the classical equations of motion for an N-atom molecule on a surface. The equation of motion becomes a generalized Langevin equation for the center of mass of the molecule, with a non-Markovian friction kernel. In the Markov approximation, a standard Langevin equation is recovered, and the effect of the molecular vibrations on the diffusion is seen to lead to an increase in the friction for center of mass motion. This effective friction has a simple form that depends on the curvature of the lowest energy diffusion path in the 3N-dimensional coordinate space. We also find that so long as the intramolecular forces are sufficiently strong, memory effects are usually not significant and the Markov approximation can be employed, resulting in a simple one-dimensional model that can account for the effect of the dynamics of the molecular vibrations on the diffusive motion.

Nonthermal Effects of Photon Illumination on Surface Diffusion

International Nuclear Information System (INIS)

Ditchfield, R.; Llera-Rodriguez, D.; Seebauer, E.G.

1998-01-01

Nonthermal influences of photon illumination on surface diffusion at high temperatures have been measured experimentally for the first time. Activation energies and preexponential factors for diffusion of germanium and indium on silicon change substantially in response to illumination by photons having energies greater than the substrate band gap. Results depend on doping type. Ionization of surface vacancies by photogenerated charge carriers seems to play a key role. The results have significant implications for aspects of microelectronics fabrication governed by surface mobility. copyright 1998 The American Physical Society

Thin polycrystalline diamond films protecting zirconium alloys surfaces: From technology to layer analysis and application in nuclear facilities

Energy Technology Data Exchange (ETDEWEB)

Ashcheulov, P. [Institute of Physics, Academy of Sciences Czech Republic v.v.i, Na Slovance 2, CZ-182 21, Prague 8 (Czech Republic); Škoda, R.; Škarohlíd, J. [Czech Technical University in Prague, Faculty of Mechanical Engineering, Technická 4, Prague 6, CZ-160 07 (Czech Republic); Taylor, A.; Fekete, L.; Fendrych, F. [Institute of Physics, Academy of Sciences Czech Republic v.v.i, Na Slovance 2, CZ-182 21, Prague 8 (Czech Republic); Vega, R.; Shao, L. [Texas A& M University, Department of Nuclear Engineering TAMU-3133, College Station, TX TX 77843 (United States); Kalvoda, L.; Vratislav, S. [Faculty of Nuclear Science and Physical Engineering, Czech Technical University in Prague, Brehova 7, CZ-115 19, Prague 1 (Czech Republic); Cháb, V.; Horáková, K.; Kůsová, K.; Klimša, L.; Kopeček, J. [Institute of Physics, Academy of Sciences Czech Republic v.v.i, Na Slovance 2, CZ-182 21, Prague 8 (Czech Republic); Sajdl, P.; Macák, J. [University of Chemistry and Technology, Power Engineering Department, Technická 3, Prague 6, CZ-166 28 (Czech Republic); Johnson, S. [Nuclear Fuel Division, Westinghouse Electric Company, 5801 Bluff Road, Hopkins, SC 29209 (United States); Kratochvílová, I., E-mail: krat@fzu.cz [Institute of Physics, Academy of Sciences Czech Republic v.v.i, Na Slovance 2, CZ-182 21, Prague 8 (Czech Republic); Faculty of Nuclear Science and Physical Engineering, Czech Technical University in Prague, Brehova 7, CZ-115 19, Prague 1 (Czech Republic)

2015-12-30

Graphical abstract: - Highlights: • In this work we showed that films prepared by MW-LA-PECVD technology can be used as anticorrosion protective layer for Zircaloy2 nuclear fuel claddings at elevated temperatures (950 °C) when α phase of zirconium changes to β phase (more opened for oxygen/hydrogen diffusion). Quality of PCD films was examined by Raman spectroscopy, XPS, SEM, AFM and SIMS analysis. • The polycrystalline diamond films were of high quality - without defects and contaminations. After hot steam oxidation (950 °C) a high level of structural integrity of PCD layer was observed. Both sp{sup 2} and sp{sup 3} C phases were present in the protective PCD layer. Higher resistance and a lower degree of impedance dispersion was found in the hot steam oxidized PCD coated Zircaloy2 samples, which may suggest better protection of the Zircaloy2 surface. The PCD layer blocks the hydrogen diffusion into the Zircaloy2 surface thus protecting the material from degradation. • Hot steam oxidation tests confirmed that PCD coated Zircaloy2 surfaces were effectively protected against corrosion. Presented results demonstrate that the PCD anticorrosion protection can significantly prolong service life of Zircaloy2 nuclear fuel claddings in nuclear reactors even at elevated temperatures. - Abstract: Zirconium alloys can be effectively protected against corrosion by polycrystalline diamond (PCD) layers grown in microwave plasma enhanced linear antenna chemical vapor deposition apparatus. Standard and hot steam oxidized PCD layers grown on Zircaloy2 surfaces were examined and the specific impact of polycrystalline Zr substrate surface on PCD layer properties was investigated. It was found that the presence of the PCD coating blocks hydrogen diffusion into the Zircaloy2 surface and protects Zircaloy2 material from degradation. PCD anticorrosion protection of Zircaloy2 can significantly prolong life of Zircaloy2 material in nuclear reactors even at temperatures above Zr

Linear response theory of activated surface diffusion with interacting adsorbates

Energy Technology Data Exchange (ETDEWEB)

Marti' nez-Casado, R. [Department of Chemistry, Imperial College London, South Kensington, London SW7 2AZ (United Kingdom); Sanz, A.S.; Vega, J.L. [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cientificas, Serrano 123, 28006 Madrid (Spain); Rojas-Lorenzo, G. [Instituto Superior de Tecnologi' as y Ciencias Aplicadas, Ave. Salvador Allende, esq. Luaces, 10400 La Habana (Cuba); Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain); Miret-Artes, S., E-mail: s.miret@imaff.cfmac.csic.es [Instituto de Fi' sica Fundamental, Consejo Superior de Investigaciones Cienti' ficas, Serrano 123, 28006 Madrid (Spain)

2010-05-12

Graphical abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed. - Abstract: Activated surface diffusion with interacting adsorbates is analyzed within the Linear Response Theory framework. The so-called interacting single adsorbate model is justified by means of a two-bath model, where one harmonic bath takes into account the interaction with the surface phonons, while the other one describes the surface coverage, this leading to defining a collisional friction. Here, the corresponding theory is applied to simple systems, such as diffusion on flat surfaces and the frustrated translational motion in a harmonic potential. Classical and quantum closed formulas are obtained. Furthermore, a more realistic problem, such as atomic Na diffusion on the corrugated Cu(0 0 1) surface, is presented and discussed within the classical context as well as within the framework of Kramer's theory. Quantum corrections to the classical results are also analyzed and discussed.

Radiation induced diffusion as a method to protect surface

International Nuclear Information System (INIS)

Baumvol, I.J.R.

1980-01-01

Radiation induced diffusion forms a coating adeherent and without interface on the surface of metalic substrates. This coating improves the behaviour of metal to corrosion and abrasion. The effect of radiation induced diffusion of tin and calcium on pure iron surface is described and analyzed in this work. (author) [pt

Diffusion accessibility as a method for visualizing macromolecular surface geometry.

Science.gov (United States)

Tsai, Yingssu; Holton, Thomas; Yeates, Todd O

2015-10-01

Important three-dimensional spatial features such as depth and surface concavity can be difficult to convey clearly in the context of two-dimensional images. In the area of macromolecular visualization, the computer graphics technique of ray-tracing can be helpful, but further techniques for emphasizing surface concavity can give clearer perceptions of depth. The notion of diffusion accessibility is well-suited for emphasizing such features of macromolecular surfaces, but a method for calculating diffusion accessibility has not been made widely available. Here we make available a web-based platform that performs the necessary calculation by solving the Laplace equation for steady state diffusion, and produces scripts for visualization that emphasize surface depth by coloring according to diffusion accessibility. The URL is http://services.mbi.ucla.edu/DiffAcc/. © 2015 The Protein Society.

Electrolyte diffusion in compacted montmorillonite engineered barriers

International Nuclear Information System (INIS)

Jahnke, F.M.; Radke, C.J.

1985-09-01

The bentonite-based engineered barrier or packing is a proposed component of several designs conceived to dispose of high-level nuclear waste in geologic repositories. Once radionuclides escape the waste package, they must first diffuse through the highly impermeable clay-rich barrier before they reach the host repository. To determine the effectiveness of the packing as a sorption barrier in the transient release period and as a mass-transfer barrier in the steady release period over the geologic time scales involved in nuclear waste disposal, a fundamental understanding of the diffusion of electrolytes in compacted clays is required. We present, and compare with laboratory data, a model quantifying the diffusion rates of cationic cesium and uncharged tritium in compacted montmorillonite clay. Neutral tritium characterizes the geometry (i.e., tortuosity) of the particulate gel. After accounting for cation exchange, we find that surface diffusion is the dominant mechanism of cation transport, with an approximate surface diffusion coefficient of 2 x 10 -6 cm 2 /s for cesium. This value increases slightly with increasing background ionic strength. The implications of this work for the packing as a migration barrier are twofold. During the transient release period, K/sub d/ values are of little importance in retarding ion migration. This is because sorption also gives rise to a surface diffusion path, and it is surface diffusion which controls the diffusion rate of highly sorbing cations in compacted montmorillonite. During the steady release period, the presence of surface diffusion leads to a flux through the packing which is greatly enhanced. In either case, if surface diffusion is neglected, the appropriate diffusion coefficient of ions in compacted packing will be in considerable error relative to current design recommendations. 11 refs., 4 figs., 1 tab

Gallium surface diffusion on GaAs (001) surfaces measured by crystallization dynamics of Ga droplets

International Nuclear Information System (INIS)

Bietti, Sergio; Somaschini, Claudio; Esposito, Luca; Sanguinetti, Stefano; Fedorov, Alexey

2014-01-01

We present accurate measurements of Ga cation surface diffusion on GaAs surfaces. The measurement method relies on atomic force microscopy measurement of the morphology of nano–disks that evolve, under group V supply, from nanoscale group III droplets, earlier deposited on the substrate surface. The dependence of the radius of such nano-droplets on crystallization conditions gives direct access to Ga diffusion length. We found an activation energy for Ga on GaAs(001) diffusion E A =1.31±0.15 eV, a diffusivity prefactor of D 0  = 0.53(×2.1±1) cm 2 s −1 that we compare with the values present in literature. The obtained results permit to better understand the fundamental physics governing the motion of group III ad–atoms on III–V crystal surfaces and the fabrication of designable nanostructures.

Stimulated nuclear spin echos and spectral diffusion in glasses

International Nuclear Information System (INIS)

Borges, N.M.; Engelsberg, M.

1984-01-01

Experimental results of stimulated nuclear spin echos decay in glasses are presented. The measurements were performed in B 2 O 3 glasses, at the 23Na and 11 B resonance lines. The data analysis allows the study of Spectral diffusion at an inhomogeneous nuclear magnetic (NMR) resonance line, broadened for a desordered system of nuclear spins. A model is proposed to explain the time constants, and the particular form of the decay. (A.C.A.S.) [pt

Diffusion of information about the nuclear industry

International Nuclear Information System (INIS)

Galvan, C.G.

1983-01-01

The diffusion of nuclear technology means a development of a large network of activities (e.g. capital goods, construction, metallurgical and chemical industries) than a path for solving energy problems. Its ties with the arms race cause specific non-proliferation problems. A close state-capital articulation emerges, which strengthens the subsumption of labour and introduces new processes of social control. Already fulfilled investments give impulse to this tendency. The Tlatelolco regime, banishing nuclear weapons from Latin America, seems to establish a pre-condition for a regional solution to the problems thus arising. But, besides the imperfect adhesion to the Treaty, technical and political reasons obstruct a regional integration of the nuclear fuel cycle. Among other things, a lack of regional integration in other industries makes nuclear expansion more dependent on extra-regional technological ties. (Author) [pt

Nonlinear mean field theory for nuclear matter and surface properties

International Nuclear Information System (INIS)

Boguta, J.; Moszkowski, S.A.

1983-01-01

Nuclear matter properties are studied in a nonlinear relativistic mean field theory. We determine the parameters of the model from bulk properties of symmetric nuclear matter and a reasonable value of the effective mass. In this work, we stress the nonrelativistic limit of the theory which is essentially equivalent to a Skyrme hamiltonian, and we show that most of the results can be obtained, to a good approximation, analytically. The strength of the required parameters is determined from the binding energy and density of nuclear matter and the effective nucleon mass. For realistic values of the parameters, the nonrelativistic approximation turns out to be quite satisfactory. Using reasonable values of the parameters, we can account for other key properties of nuclei, such as the spin-orbit coupling, surface energy, and diffuseness of the nuclear surface. Also the energy dependence of the nucleon-nucleus optical model is accounted for reasonably well except near the Fermi surface. It is found, in agreement with empirical results, that the Landau parameter F 0 is quite small in normal nuclear matter. Both density dependence and momentum dependence of the NN interaction, but especially the former, are important for nuclear saturation. The required scalar and vector coupling constants agree fairly well with those obtained from analyses of NN scattering phase shifts with one-boson-exchange models. The mean field theory provides a semiquantitative justification for the weak Skyrme interaction in odd states. The strength of the required nonlinear term is roughly consistent with that derived using a new version of the chiral mean field theory in which the vector mass as well as the nucleon mass is generated by the sigma-field. (orig.)

Information diffused by the operator on the nuclear risk: which answer to stakeholders expectations?

International Nuclear Information System (INIS)

Plot-Vicard, Emmanuelle

2010-01-01

This research thesis addresses the practices of environmental information diffusion, and aims at identifying the possible discrepancies between information diffused by a company and the expectations of stakeholders, more particularly in the case of the nuclear risk. The first part presents the theoretical framework (notably the legitimacy theory) and determines the expectations of stakeholders as far as information on the nuclear risk is concerned. The second part describes and discusses information on nuclear risk diffused by operators in their annual reports, proposes an assessment of this information, and relates this assessment with the previous theoretical framework

Controlled surface diffusion in plasma-enhanced chemical vapor deposition of GaN nanowires

International Nuclear Information System (INIS)

Hou, W C; Hong, Franklin Chau-Nan

2009-01-01

This study investigates the growth of GaN nanowires by controlling the surface diffusion of Ga species on sapphire in a plasma-enhanced chemical vapor deposition (CVD) system. Under nitrogen-rich growth conditions, Ga has a tendency to adsorb on the substrate surface diffusing to nanowires to contribute to their growth. The significance of surface diffusion on the growth of nanowires is dependent on the environment of the nanowire on the substrate surface as well as the gas phase species and compositions. Under nitrogen-rich growth conditions, the growth rate is strongly dependent on the surface diffusion of gallium, but the addition of 5% hydrogen in nitrogen plasma instantly diminishes the surface diffusion effect. Gallium desorbs easily from the surface by reaction with hydrogen. On the other hand, under gallium-rich growth conditions, nanowire growth is shown to be dominated by the gas phase deposition, with negligible contribution from surface diffusion. This is the first study reporting the inhibition of surface diffusion effects by hydrogen addition, which can be useful in tailoring the growth and characteristics of nanowires. Without any evidence of direct deposition on the nanowire surface, gallium and nitrogen are shown to dissolve into the catalyst for growing the nanowires at 900 deg. C.

Measuring methods of matrix diffusion

International Nuclear Information System (INIS)

Muurinen, A.; Valkiainen, M.

1988-03-01

In Finland the spent nuclear fuel is planned to be disposed of at large depths in crystalline bedrock. The radionuclides which are dissolved in the groundwater may be able to diffuse into the micropores of the porous rock matrix and thus be withdrawn from the flowing water in the fractures. This phenomenon is called matrix diffusion. A review over matrix diffusion is presented in the study. The main interest is directed to the diffusion of non-sorbing species. The review covers diffusion experiments and measurements of porosity, pore size, specific surface area and water permeability

Average nuclear surface properties

International Nuclear Information System (INIS)

Groote, H. von.

1979-01-01

The definition of the nuclear surface energy is discussed for semi-infinite matter. This definition is extended also for the case that there is a neutron gas instead of vacuum on the one side of the plane surface. The calculations were performed with the Thomas-Fermi Model of Syler and Blanchard. The parameters of the interaction of this model were determined by a least squares fit to experimental masses. The quality of this fit is discussed with respect to nuclear masses and density distributions. The average surface properties were calculated for different particle asymmetry of the nucleon-matter ranging from symmetry beyond the neutron-drip line until the system no longer can maintain the surface boundary and becomes homogeneous. The results of the calculations are incorporated in the nuclear Droplet Model which then was fitted to experimental masses. (orig.)

Palladium diffusion into bulk copper via the (100) surface

Energy Technology Data Exchange (ETDEWEB)

Bussmann, E; Kellogg, G L [Sandia National Laboratories, Albuquerque, NM 87185 (United States); Sun, J; Pohl, K [Department of Physics and Materials Science Program, University of New Hampshire, Durham, NH 03824 (United States)

2009-08-05

Using low-energy electron microscopy, we measure the diffusion of Pd into bulk Cu at the Cu(100) surface. Interdiffusion is tracked by measuring the dissolution of the Cu(100)-c(2 x 2)-Pd surface alloy during annealing (T>240 deg. C). The activation barrier for Pd diffusion from the surface alloy into the bulk is determined to be (1.8 +- 0.6) eV. During annealing, we observe the growth of a new layer of Cu near step edges. Under this new Cu layer, dilute Pd remaining near the surface develops a layered structure similar to the Cu{sub 3}Pd L 1{sub 2} bulk alloy phase.

A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

Energy Technology Data Exchange (ETDEWEB)

Naderi, Ebadollah, E-mail: enaderi42@gmail.com [Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Ghaisas, S. V. [Department of Electronic Science, Savitribai Phule Pune University (SPPU), Pune-411007 (India)

2016-08-15

In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

Science.gov (United States)

Naderi, Ebadollah; Ghaisas, S. V.

2016-08-01

In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

A computational ab initio study of surface diffusion of sulfur on the CdTe (111) surface

International Nuclear Information System (INIS)

Naderi, Ebadollah; Ghaisas, S. V.

2016-01-01

In order to discern the formation of epitaxial growth of CdS shell over CdTe nanocrystals, kinetics related to the initial stages of the growth of CdS on CdTe is investigated using ab-initio methods. We report diffusion of sulfur adatom on the CdTe (111) A-type (Cd-terminated) and B-type (Te-terminated) surfaces within the density functional theory (DFT). The barriers are computed by applying the climbing Nudge Elastic Band (c-NEB) method. From the results surface hopping emerges as the major mode of diffusion. In addition, there is a distinct contribution from kick-out type diffusion in which a CdTe surface atom is kicked out from its position and is replaced by the diffusing sulfur atom. Also, surface vacancy substitution contributes to the concomitant dynamics. There are sites on the B- type surface that are competitively close in terms of the binding energy to the lowest energy site of epitaxy on the surface. The kick-out process is more likely for B-type surface where a Te atom of the surface is displaced by a sulfur adatom. Further, on the B-type surface, subsurface migration of sulfur is indicated. Furthermore, the binding energies of S on CdTe reveal that on the A-type surface, epitaxial sites provide relatively higher binding energies and barriers than on B-type.

Diffusion of particles adsorbed on reconstructive surface

Czech Academy of Sciences Publication Activity Database

Tarasenko A., Nataliya; Tarasenko, Alexander; Jastrabík, Lubomír

2005-01-01

Roč. 11, č. 1 (2005), s. 485-489 ISSN 0929-5607 R&D Projects: GA MŠk LN00A015 Institutional research plan: CEZ:AV0Z10100522 Keywords : lattice gas * surface reconstruction * surface diffusion * phase transitions Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.323, year: 2005

A method to investigate the diffusion properties of nuclear calcium.

Science.gov (United States)

Queisser, Gillian; Wittum, Gabriel

2011-10-01

Modeling biophysical processes in general requires knowledge about underlying biological parameters. The quality of simulation results is strongly influenced by the accuracy of these parameters, hence the identification of parameter values that the model includes is a major part of simulating biophysical processes. In many cases, secondary data can be gathered by experimental setups, which are exploitable by mathematical inverse modeling techniques. Here we describe a method for parameter identification of diffusion properties of calcium in the nuclei of rat hippocampal neurons. The method is based on a Gauss-Newton method for solving a least-squares minimization problem and was formulated in such a way that it is ideally implementable in the simulation platform uG. Making use of independently published space- and time-dependent calcium imaging data, generated from laser-assisted calcium uncaging experiments, here we could identify the diffusion properties of nuclear calcium and were able to validate a previously published model that describes nuclear calcium dynamics as a diffusion process.

Transient Convection, Diffusion, and Adsorption in Surface-Based Biosensors

DEFF Research Database (Denmark)

Hansen, Rasmus; Bruus, Henrik; Callisen, Thomas H.

2012-01-01

This paper presents a theoretical and computational investigation of convection, diffusion, and adsorption in surface-based biosensors. In particular, we study the transport dynamics in a model geometry of a surface plasmon resonance (SPR) sensor. The work, however, is equally relevant for other...... microfluidic surface-based biosensors, operating under flow conditions. A widely adopted approximate quasi-steady theory to capture convective and diffusive mass transport is reviewed, and an analytical solution is presented. An expression of the Damköhler number is derived in terms of the nondimensional...... concentration to the maximum surface capacity is critical for reliable use of the quasi-steady theory. Finally, our results provide users of surface-based biosensors with a tool for correcting experimentally obtained adsorption rate constants....

Analytical mass formula and nuclear surface properties in the ETF approximation. Part II: asymmetric nuclei

Science.gov (United States)

Aymard, François; Gulminelli, Francesca; Margueron, Jérôme

2016-08-01

We have recently addressed the problem of the determination of the nuclear surface energy for symmetric nuclei in the framework of the extended Thomas-Fermi (ETF) approximation using Skyrme functionals. We presently extend this formalism to the case of asymmetric nuclei and the question of the surface symmetry energy. We propose an approximate expression for the diffuseness and the surface energy. These quantities are analytically related to the parameters of the energy functional. In particular, the influence of the different equation of state parameters can be explicitly quantified. Detailed analyses of the different energy components (local/non-local, isoscalar/isovector, surface/curvature and higher order) are also performed. Our analytical solution of the ETF integral improves previous models and leads to a precision of better than 200 keV per nucleon in the determination of the nuclear binding energy for dripline nuclei.

Semiconductor surface diffusion: Nonthermal effects of photon illumination

International Nuclear Information System (INIS)

Ditchfield, R.; Llera-Rodriguez, D.; Seebauer, E. G.

2000-01-01

Nonthermal influences of photon illumination on surface diffusion at high temperatures have been measured experimentally. Activation energies and pre-exponential factors for diffusion of germanium, indium, and antimony on silicon change by up to 0.3 eV and two orders of magnitude, respectively, in response to illumination by photons having energies greater than the substrate band gap. The parameters decrease for n-type material and increase for p-type material. Aided by results from photoreflectance spectroscopy, we suggest that motion of the surface quasi-Fermi-level for minority carriers accounts for much of the effect by changing the charge states of surface vacancies. An additional adatom-vacancy complexation mechanism appears to operate on p-type substrates. The results have significant implications for aspects of microelectronics fabrication by rapid thermal processing that are governed by surface mobility. (c) 2000 The American Physical Society

Development of a 3D-Multigroup program to simulate anomalous diffusion phenomena in the nuclear reactors

International Nuclear Information System (INIS)

Maleki Moghaddam, Nader; Afarideh, Hossein; Espinosa-Paredes, Gilberto

2015-01-01

Highlights: • The new version of neutron diffusion equation for simulating anomalous diffusion is presented. • Application of fractional calculus in the nuclear reactor is revealed. • A 3D-Multigroup program is developed based on the fractional operators. • The super-diffusion and sub-diffusion phenomena are modeled in the nuclear reactors core. - Abstract: The diffusion process is categorized in three parts, normal diffusion, super-diffusion and sub-diffusion. The classical neutron diffusion equation is used to model normal diffusion. A new scheme of derivatives is required to model anomalous diffusion phenomena. The fractional space derivatives are employed to model anomalous diffusion processes where a plume of particles spreads at an inconsistent rate with the classical Brownian motion model. In the fractional diffusion equation, the fractional Laplacians are used; therefore the statistical jump length of neutrons is unrestricted. It is clear that the fractional Laplacians are capable to model the anomalous phenomena in nuclear reactors. We have developed a NFDE-3D (neutron fractional diffusion equation) as a core calculation code to model normal and anomalous diffusion phenomena. The NFDE-3D is validated against the LMW-LWR reactor. The results demonstrate that reactors exhibit complex behavior versus order of the fractional derivatives which depends on the competition between neutron absorption and super-diffusion phenomenon

Novel surface diffusion characteristics for a robust pentacene derivative on Au(1 1 1) surfaces

Science.gov (United States)

Miller, Ryan A.; Larson, Amanda; Pohl, Karsten

2017-06-01

Molecular dynamics simulations have been performed in both the ab initio and classical mechanics frameworks of 5,6,7-trithiapentacene-13-one (TTPO) molecules on flat Au(1 1 1) surfaces. Results show new surface diffusion characteristics including a strong preference for the molecule to align its long axis parallel to the sixfold Au(1 1 1) symmetry directions and subsequently diffuse along these close-packed directions, and a calculated activation energy for diffusion of 0.142 eV, about four times larger than that for pure pentacene on Au. The temperature-dependent diffusion coefficients were calculated to help quantify the molecular mobility during the experimentally observed process of forming self-assembled monolayers on gold electrodes.

A desk study of surface diffusion and mass transport in clay

International Nuclear Information System (INIS)

Cook, A.J.

1988-09-01

The concept of a geological barrier to radionuclide migration from theoretical radioactive waste repositories has drawn attention to the physico-chemical properties of clays, which are traditionally regarded as retarding media. This report addresses the different mechanisms of transport of radionuclides through clay and in particular focuses on the surface diffusion movement of sorbed cations. The relative contributory importance of the different transport mechanisms is governed by the pore size distributions and interconnections within the clay fabric. Surface diffusion data in the literature have been from experiments using compacted montmorillonite and biotite gneiss. A possible programme of laboratory work is outlined, based on diffusion experiments, which describes the way of measuring the effect of surface diffusion more accurately in clays, mudstones and shales. (author)

Inclusion of the diffuseness in the schematic model of heavy ion collisions

International Nuclear Information System (INIS)

Marta, H.D.

1989-01-01

The schematic model of central heavy ion collisions developed by Swiatecki includes the Coulomb and surface contributions to the potential energy of the system and one-body dissipation. This model is extended by considering the diffuseness of the nuclear surface; this has the implication that we must consider the proximity forces in the dynamics of the collisions. For the sake of simplicity we work with symmetrical systems. The results of the model studied are compared with experimental data and with other theoretical calculations. We conclude that the detailed consideration of the diffuseness of the nuclear surfaces does not substantially change the results of the schematic model for sharp surfaces in which the diffuseness is considered only through the parameters. (author) [pt

Atomic diffusion in laser surface modified AISI H13 steel

Science.gov (United States)

Aqida, S. N.; Brabazon, D.; Naher, S.

2013-07-01

This paper presents a laser surface modification process of AISI H13 steel using 0.09 and 0.4 mm of laser spot sizes with an aim to increase surface hardness and investigate elements diffusion in laser modified surface. A Rofin DC-015 diffusion-cooled CO2 slab laser was used to process AISI H13 steel samples. Samples of 10 mm diameter were sectioned to 100 mm length in order to process a predefined circumferential area. The parameters selected for examination were laser peak power, pulse repetition frequency (PRF), and overlap percentage. The hardness properties were tested at 981 mN force. Metallographic study and energy dispersive X-ray spectroscopy (EDXS) were performed to observe presence of elements and their distribution in the sample surface. Maximum hardness achieved in the modified surface was 1017 HV0.1. Change of elements composition in the modified layer region was detected in the laser modified samples. Diffusion possibly occurred for C, Cr, Cu, Ni, and S elements. The potential found for increase in surface hardness represents an important method to sustain tooling life. The EDXS findings signify understanding of processing parameters effect on the modified surface composition.

Bulk-mediated surface diffusion: non-Markovian desorption dynamics

International Nuclear Information System (INIS)

Revelli, Jorge A; Budde, Carlos E; Prato, Domingo; Wio, Horacio S

2005-01-01

Here we analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework, when the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption as well as its motion in the bulk is governed by Markovian dynamics. We study the diffusion of particles in both semi-infinite and finite cubic lattices, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The results are compared with known Markovian cases showing the differences that can be exploited to distinguish between Markovian and non-Markovian desorption mechanisms in experimental situations

Nox diffusion-simulation in an urban area in using the vertical diffusion diagram including a surface roughness parameter

Energy Technology Data Exchange (ETDEWEB)

Kono, Hitoshi; Fujimoto, Akira; Nakano, Hiroshi

1988-03-31

In recent years, in order to attain a total quantity regulation of air pollution and to prepare a local air-control program, a diffusion simulation is often made using a Gaussian plume model. NOx diffusion simulation of the urban area was carried out using a vertical diffusion width by taking a parameter of ground-surface roughness using Smith's correction to the Gaussian model. For the diffusion of car exhaust gas, comparison was made for the estimate and the measurement by jointly using the values of ground-surface roughness and the initial diffusion width. As a result, change in the diffusion width of the car exhaust gas due to the urban buildings was expressed at a necessary practical level by giving the height of the point of calculation, 1 - 3 m in the central part and 30 cm at the peripheral part, and giving the initial diffusion width of roughly half to equal size of initial diffusion width to the average height of the buildings. (2 figs, 8 tabs, 20 refs)

Diffusion of N adatoms on the Fe(100) surface

DEFF Research Database (Denmark)

Pedersen, M. Ø.; Österlund, L.; Mortensen, Jens Jørgen

2000-01-01

The diffusion of individual N adatoms on Fe(100) has been studied using scanning tunneling microscopy and ab initio density functional theory (DFT) calculations. The measured diffusion barrier for isolated N adatoms is E-d = (0.92 +/- 0.04) eV, with a prefactor of nu(0) = 4.3 x 10(12) s(-1), which...... is in quantitative agreement with the DFT calculations. Thr; diffusion is strongly coupled to lattice distortions. and. as a consequence, the presence of other N adatoms introduces an anisotropy in the diffusion. Based on experimentally determined values of the diffusion barriers and adsorbate......-adsorbate: interactions, the potential energy surface experienced by a N adatom is determined....

Molecular dynamics simulation of nanoscale surface diffusion of heterogeneous adatoms clusters

International Nuclear Information System (INIS)

Imran, Muhammad; Hussain, Fayyaz; Ullah, Hafeez; Ahmad, Ejaz; Rashid, Muhammad; Ismail, Muhammad; Cai, Yongqing; Javid, M Arshad; Ahmad, S A

2016-01-01

Molecular dynamics simulation employing the embedded atom method potential is utilized to investigate nanoscale surface diffusion mechanisms of binary heterogeneous adatoms clusters at 300 K, 500 K, and 700 K. Surface diffusion of heterogeneous adatoms clusters can be vital for the binary island growth on the surface and can be useful for the formation of alloy-based thin film surface through atomic exchange process. The results of the diffusion process show that at 300 K, the diffusion of small adatoms clusters shows hopping, sliding, and shear motion; whereas for large adatoms clusters (hexamer and above), the diffusion is negligible. At 500 K, small adatoms clusters, i.e., dimer, show almost all possible diffusion mechanisms including the atomic exchange process; however no such exchange is observed for adatoms clusters greater than dimer. At 700 K, the exchange mechanism dominates for all types of clusters, where Zr adatoms show maximum tendency and Ag adatoms show minimum or no tendency toward the exchange process. Separation and recombination of one or more adatoms are also observed at 500 K and 700 K. The Ag adatoms also occupy pop-up positions over the adatoms clusters for short intervals. At 700 K, the vacancies are also generated in the vicinity of the adatoms cluster, vacancy formation, filling, and shifting can be observed from the results. (paper)

Nuclear interaction potential in a folded-Yukawa model with diffuse densities

International Nuclear Information System (INIS)

Randrup, J.

1975-09-01

The folded-Yukawa model for the nuclear interaction potential is generalized to diffuse density distributions which are generated by folding a Yukawa function into sharp generating distributions. The effect of a finite density diffuseness or of a finite interaction range is studied. The Proximity Formula corresponding to the generalized model is derived and numerical comparison is made with the exact results. (8 figures)

Shukla-Spatschek diffusion effects on surface plasma waves in astrophysical turbulent plasmas

Science.gov (United States)

Lee, Myoung-Jae; Jung, Young-Dae

2017-02-01

The effects of Shukla-Spatschek turbulent diffusion on a temporal mode of surface waves propagating at the interface of an astrophysical turbulent plasma are investigated. The damping rates for high and low modes of surface wave are kinetically derived by employing the Vlasov-Poisson equation and the specular reflection boundary condition. We found that the diffusion caused by the fluctuating electric fields leads to damping for both high and low modes of surface waves. The high-mode damping is enhanced with an increase of the wavenumber and the diffusion coefficient, but suppressed by an increase of electron thermal energy. By contrast, the low-mode damping is suppressed as the wavenumber and the thermal energy increase although it is enhanced as the diffusion increases. The variation of the damping rate due to the Shukla-Spatschek turbulent diffusion is also discussed.

A theoretical study of hydrogen atoms adsorption and diffusion on PuO_2 (110) surface

International Nuclear Information System (INIS)

Yu, H.L.; Tang, T.; Zheng, S.T.; Shi, Y.; Qiu, R.Z.; Luo, W.H.; Meng, D.Q.

2016-01-01

The mechanisms of adsorption and diffusion of hydrogen atoms on the PuO_2 (110) surface are investigated by density functional theory corrected for onsite Coulombic interactions (GGA + U). In order to find out the energetically more favorable adsorption site and optimum diffusion path, adsorption energy of atomic H on various sites and the diffusion energy barrier are derived and compared. Our results show that both chemisorption and physisorption exist for H atoms adsorption configurations on PuO_2 (110) surface. Two processes for H diffusion are investigated using the climbing nudged-elastic-band (cNEB) approach. We have identified two diffusion mechanisms, leading to migration of atomic H on the surface and diffusion from surface to subsurface. The energy barriers indicate that it is energetically more favorable for H atom to be on the surface. Hydrogen permeation through purity PuO_2 surface is mainly inhibited from hydrogen atom diffusion from surface to subsurface. - Highlights: • H atoms adsorption on PuO_2 (110) surface are investigated by GGA + U. • Both chemisorption and physisorption exist for H atoms adsorption configurations. • H atoms migration into PuO_2 (100) surface are inhibited with the barrier of 2.15 eV. • H atoms diffusion on PuO_2 (110) surface are difficult at room temperature.

Temperature dependence of nuclear surface properties

International Nuclear Information System (INIS)

Campi, X.; Stringari, S.

1982-01-01

Thermal properties of nuclear surface are investigated in a semi-infinite medium. Explicit analytical expression are given for the temperature dependence of surface thickness, surface energy and surface free energy. In this model the temperature effects depend critically on the nuclear incompressibility and on the shape of the effective mass at the surface. To illustrate the relevance of these effects we made an estimate of the temperature dependence of the fission barrier height. (orig.)

Study on neutron diffusion and time dependence heat ina fluidized bed nuclear reactor

International Nuclear Information System (INIS)

Vilhena, M.T. de.

1988-01-01

The purpose of this work is to model the neutron diffusion and heat transfer for a Fluidized Bed Nuclear Reactor and its solution by Laplace Transform Technique with numerical inversion using Fourier Series. Also Gaussian quadrature and residues techniques were applied for numerical inversion. The neutron transport, diffusion, and point Kinetic equation for this nuclear reactor concept are developed. A matricial and Taylor Series methods are proposed for the solution of the point Kinetic equation which is a time scale problem of Stiff type

Diffusion processes in tumors: A nuclear medicine approach

International Nuclear Information System (INIS)

Amaya, Helman

2016-01-01

The number of counts used in nuclear medicine imaging techniques, only provides physical information about the desintegration of the nucleus present in the the radiotracer molecules that were uptaken in a particular anatomical region, but that information is not a real metabolic information. For this reason a mathematical method was used to find a correlation between number of counts and "1"8F-FDG mass concentration. This correlation allows a better interpretation of the results obtained in the study of diffusive processes in an agar phantom, and based on it, an image from the PETCETIX DICOM sample image set from OsiriX-viewer software was processed. PET-CT gradient magnitude and Laplacian images could show direct information on diffusive processes for radiopharmaceuticals that enter into the cells by simple diffusion. In the case of the radiopharmaceutical "1"8F-FDG is necessary to include pharmacokinetic models, to make a correct interpretation of the gradient magnitude and Laplacian of counts images.

Diffusion processes in tumors: A nuclear medicine approach

Energy Technology Data Exchange (ETDEWEB)

Amaya, Helman, E-mail: haamayae@unal.edu.co [Grupo de Física Nuclear, Universidad Nacional de Colombia (Colombia)

2016-07-07

The number of counts used in nuclear medicine imaging techniques, only provides physical information about the desintegration of the nucleus present in the the radiotracer molecules that were uptaken in a particular anatomical region, but that information is not a real metabolic information. For this reason a mathematical method was used to find a correlation between number of counts and {sup 18}F-FDG mass concentration. This correlation allows a better interpretation of the results obtained in the study of diffusive processes in an agar phantom, and based on it, an image from the PETCETIX DICOM sample image set from OsiriX-viewer software was processed. PET-CT gradient magnitude and Laplacian images could show direct information on diffusive processes for radiopharmaceuticals that enter into the cells by simple diffusion. In the case of the radiopharmaceutical {sup 18}F-FDG is necessary to include pharmacokinetic models, to make a correct interpretation of the gradient magnitude and Laplacian of counts images.

Cleaning of niobium surface by plasma of diffuse discharge at atmospheric pressure

Science.gov (United States)

Tarasenko, V. F.; Erofeev, M. V.; Shulepov, M. A.; Ripenko, V. S.

2017-07-01

Elements composition of niobium surface before and after plasma treatment by runaway electron preionized diffuse discharge was investigated in atmospheric pressure nitrogen flow by means of an Auger electron spectroscopy. Surface characterizations obtained from Auger spectra show that plasma treatment by diffuse discharge after exposure of 120000 pulses provides ultrafine surface cleaning from carbon contamination. Moreover, the surface free energy of the treated specimens increased up to 3 times, that improve its adhesion property.

Classically exact surface diffusion constants at arbitrary temperature

International Nuclear Information System (INIS)

Voter, A.F.; Cohen, J.M.

1989-01-01

An expression is presented for computing the classical diffusion constant of a point defect (e.g., an adatom) in an infinite lattice of binding sites at arbitrary temperature. The transition state theory diffusion constant is simply multiplied by a dynamical correction factor that is computed from short-time classical trajectories initiated at the site boundaries. The time scale limitations of direct molecular dynamics are thus avoided in the low- and middle-temperature regimes. The expression results from taking the time derivative of the particle mean-square displacement in the lattice-discretized coordinate system. Applications are presented for surface diffusion on fcc(100) and fcc(111) Lennard-Jones crystal faces

Combined measurement of surface, grain boundary and lattice diffusion coefficients on olivine bi-crystals

Science.gov (United States)

Marquardt, Katharina; Dohmen, Ralf; Wagner, Johannes

2014-05-01

Diffusion along interface and grain boundaries provides an efficient pathway and may control chemical transport in rocks as well as their mechanical strength. Besides the significant relevance of these diffusion processes for various geologic processes, experimental data are still very limited (e.g., Dohmen & Milke, 2010). Most of these data were measured using polycrystalline materials and the formalism of LeClaire (1951) to fit integrated concentration depth profiles. To correctly apply this formalism, certain boundary conditions of the diffusion problem need to be fulfilled, e.g., surface diffusion is ignored, and furthermore the lattice diffusion coefficient has to be known from other studies or is an additional fitting parameter, which produces some ambiguity in the derived grain boundary diffusion coefficients. We developed an experimental setup where we can measure the lattice and grain boundary diffusion coefficients simultaneously but independent and demonstrate the relevance of surface diffusion for typical grain boundary diffusion experiments. We performed Mg2SiO4 bicrystal diffusion experiments, where a single grain boundary is covered by a thin-film of pure Ni2SiO4 acting as diffusant source, produced by pulsed laser deposition. The investigated grain boundary is a 60° (011)/[100]. This specific grain boundary configuration was modeled using molecular dynamics for comparison with the experimental observations in the transmission electron microscope (TEM). Both, experiment and model are in good agreement regarding the misorientation, whereas there are still some disagreements regarding the strain fields along the grain boundary that are of outmost importance for the strengths of the material. The subsequent diffusion experiments were carried out in the temperature range between 800° and 1450° C. The inter diffusion profiles were measured using the TEMs energy dispersive x-ray spectrometer standardized using the Cliff-Lorimer equation and EMPA

Method for manufacturing nuclear radiation detector with deep diffused junction

International Nuclear Information System (INIS)

Hall, R.N.

1977-01-01

Germanium radiation detectors are manufactured by diffusing lithium into high purity p-type germanium. The diffusion is most readily accomplished from a lithium-lead-bismuth alloy at approximately 430 0 C and is monitored by a quartz half cell containing a standard composition of this alloy. Detectors having n-type cores may be constructed by converting high purity p-type germanium to n-type by a lithium diffusion and subsequently diffusing some of the lithium back out through the surface to create a deep p-n junction. Production of coaxial germanium detectors comprising deep p-n junctions by the lithium diffusion process is described

The Role of Lattice Vibrations in Adatom Diffusion at Metal Stepped Surfaces

International Nuclear Information System (INIS)

Durakanoglu, S.

2004-01-01

Diffusion of a single atom on metal surfaces remains a subject of continuing interest in the surface science community because of the important role it plays in several technologically important phenomena such as thin-film and eptaxial growth, catalysis and chemical reactions. Except for a few studies, most of theoretical works, ranging from molecular dynamic simulations to first principle electronic structure calculations, are devoted to determination of the characteristics of the diffusion processes and the energy barriers, neglecting the contribution of lattice vibrations in adatom diffusion. However, in a series of theoretical works on self-diffusion on the flat surfaces of Cu(100), Ag(100) and Ni(100), Ulrike et al.[1-3], showed that the vibrational contributions are important and should be included in any complete description of the temperature dependence of the diffusion coefficient. In this work, it is our aim to examine the role of lattice vibrations in adatom diffusion at stepped surfaces of Cu(100) and Ni(100) within the framework of transition state theory. Ehrlich-Shwoebel energy barriers for an adatom diffusing over a step-edge are calculated through the inclusion of vibrational internal energy. Local vibrational density of states, main ingredient to the vibrational thermodynamic functions, are calculated in the harmonic approximation, using real space Green's function method with the force constants derived from interaction potentials based on the embedded atom method. We emphasize the sensitivity of the local vibrational density of states to the local atomic environment. We, furthermore, discuss the contribution of thermodynamic functions calculated from local vibrational density of states to the prefactors in diffusion coefficient

Stochastic Description of Activated Surface Diffusion with Interacting Adsorbates

Science.gov (United States)

Martínez-Casado, Ruth; Vega, José Luis; Sanz, Ángel S.; Miret-Artés, Salvador

Activated surface diffusion on metal surfaces is receiving much attention both experimentally and theoretically. One of the main theoretical problems in this field is to explain the line-shape broadening observed when the surface coverage is increased. Recently, we have proposed a fully stochastic model, the interacting single adsorbate (ISA) model, aimed at explaining and understanding this type of experiments, which essentially consists of considering the classical Langevin formulation with two types of noise forces: (i) a Gaussian white noise accounting for the substrate friction, and (ii) a shot noise simulating the interacting adsorbates at different coverages. No interaction potential between adsorbates is included because any trace of microscopic interaction seems to be wiped out in a Markovian regime. This model describes in a good approximation, and at a very low computational cost, the line-shape broadening observed experimentally. Furthermore, its mathematical simplicity also allows to derive some analytical expressions which are of much help in the interpretation of the physics underlying surface diffusion processes.

Extracting surface diffusion coefficients from batch adsorption measurement data: application of the classic Langmuir kinetics model.

Science.gov (United States)

Chu, Khim Hoong

2017-11-09

Surface diffusion coefficients may be estimated by fitting solutions of a diffusion model to batch kinetic data. For non-linear systems, a numerical solution of the diffusion model's governing equations is generally required. We report here the application of the classic Langmuir kinetics model to extract surface diffusion coefficients from batch kinetic data. The use of the Langmuir kinetics model in lieu of the conventional surface diffusion model allows derivation of an analytical expression. The parameter estimation procedure requires determining the Langmuir rate coefficient from which the pertinent surface diffusion coefficient is calculated. Surface diffusion coefficients within the 10 -9 to 10 -6  cm 2 /s range obtained by fitting the Langmuir kinetics model to experimental kinetic data taken from the literature are found to be consistent with the corresponding values obtained from the traditional surface diffusion model. The virtue of this simplified parameter estimation method is that it reduces the computational complexity as the analytical expression involves only an algebraic equation in closed form which is easily evaluated by spreadsheet computation.

Surface diffusion of carbon atom and carbon dimer on Si(0 0 1) surface

International Nuclear Information System (INIS)

Zhu, J.; Pan, Z.Y.; Wang, Y.X.; Wei, Q.; Zang, L.K.; Zhou, L.; Liu, T.J.; Jiang, X.M.

2007-01-01

Carbon (C) atom and carbon dimer (C2) are known to be the main projectiles in the deposition of diamond-like carbon (DLC) films. The adsorption and diffusion of the C adatom and addimer (C2) on the fully relaxed Si(0 0 1)-(2 x 1) surface was studied by a combination of the molecular dynamics (MD) and Monte Carlo (MC) simulation. The adsorption sites of the C and C2 on the surface and the potential barriers between these sites were first determined using the semi-empirical many-body Brenner and Tersoff potential. We then estimated their hopping rates and traced their pathways. It is found that the diffusion of both C and C2 is strongly anisotropic in nature. In addition, the C adatom can diffuse a long distance on the surface while the adsorbed C2 is more likely to be confined in a local region. Thus we can expect that smoother films will be formed on the Si(0 0 1) surface with single C atoms as projectile at moderate temperature, while with C2 the films will grow in two-dimensional islands. In addition, relatively higher kinetic energy of the projectile, say, a few tens of eV, is needed to grow DLC films of higher quality. This is consistent with experimental findings

Jump rates for surface diffusion of large molecules from first principles

Energy Technology Data Exchange (ETDEWEB)

Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

2015-04-21

We apply a recently developed stochastic model for the surface diffusion of large molecules to calculate jump rates for 9,10-dithioanthracene on a Cu(111) surface. The necessary input parameters for the stochastic model are calculated from first principles using density functional theory (DFT). We find that the inclusion of van der Waals corrections to the DFT energies is critical to obtain good agreement with experimental results for the adsorption geometry and energy barrier for diffusion. The predictions for jump rates in our model are in excellent agreement with measured values and show a marked improvement over transition state theory (TST). We find that the jump rate prefactor is reduced by an order of magnitude from the TST estimate due to frictional damping resulting from energy exchange with surface phonons, as well as a rotational mode of the diffusing molecule.

Effect of zero-point oscillations of nuclear surface on observable properties of nuclei

International Nuclear Information System (INIS)

Masterov, V.S.; Rabotnov, N.S.

1982-01-01

Possible effect of zero-point oscillations of nuclear surface on such observable nucleus characteristics as the mass of ground state, edge diffusion and height of fission barrier is considered. Within the framework of a drop model the calculation of binding energy per nucleon for even-even nuclei with a mass number 8 <= A <= 60 depending on A is given. It is shown that consideration of even quadrupole and octupole oscillations results in marked effects which are necessary to consider when comparing results of model calculations with experiment

New sensitive micro-measurements of dynamic surface tension and diffusion coefficients

DEFF Research Database (Denmark)

Kinoshita, Koji; Ortiz, Elisa Parra; Needham, David

2017-01-01

Currently available dynamic surface tension (DST) measurement methods, such as Wilhelmy plate, droplet- or bubble-based methods, still have various experimental limitations such as the large size of the interface, convection in the solution, or a certain “dead time” at initial measurement....... These limitations create inconsistencies for the kinetic analysis of surfactant adsorption/desorption, especially significant for ionic surfactants. Here, the “micropipette interfacial area-expansion method” was introduced and validated as a new DST measurement having a high enough sensitivity to detect diffusion...... for surface excess concentration. We found that the measured diffusion coefficient of 1-Octanol, 7.2 ± 0.8 × 10−6 cm2/s, showed excellent agreement with the result from an alternative method, “single microdroplet catching method”, to measure the diffusion coefficient from diffusion-controlled microdroplet...

A surface diffuse scattering model for the mobility of electrons in surface charge coupled devices

International Nuclear Information System (INIS)

Ionescu, M.

1977-01-01

An analytical model for the mobility of electrons in surface charge coupled devices is studied on the basis of the results previously obtained, considering a surface diffuse scattering; the importance of the results obtained for a better understanding of the influence of the fringing field in surface charge coupled devices is discussed. (author)

Diffuse Surface Scattering in the Plasmonic Resonances of Ultralow Electron Density Nanospheres.

Science.gov (United States)

Monreal, R Carmina; Antosiewicz, Tomasz J; Apell, S Peter

2015-05-21

Localized surface plasmon resonances (LSPRs) have recently been identified in extremely diluted electron systems obtained by doping semiconductor quantum dots. Here, we investigate the role that different surface effects, namely, electronic spill-out and diffuse surface scattering, play in the optical properties of these ultralow electron density nanosystems. Diffuse scattering originates from imperfections or roughness at a microscopic scale on the surface. Using an electromagnetic theory that describes this mechanism in conjunction with a dielectric function including the quantum size effect, we find that the LSPRs show an oscillatory behavior in both position and width for large particles and a strong blue shift in energy and an increased width for smaller radii, consistent with recent experimental results for photodoped ZnO nanocrystals. We thus show that the commonly ignored process of diffuse surface scattering is a more important mechanism affecting the plasmonic properties of ultralow electron density nanoparticles than the spill-out effect.

Coupling between diffusion and orientation of pentacene molecules on an organic surface.

Science.gov (United States)

Rotter, Paul; Lechner, Barbara A J; Morherr, Antonia; Chisnall, David M; Ward, David J; Jardine, Andrew P; Ellis, John; Allison, William; Eckhardt, Bruno; Witte, Gregor

2016-04-01

The realization of efficient organic electronic devices requires the controlled preparation of molecular thin films and heterostructures. As top-down structuring methods such as lithography cannot be applied to van der Waals bound materials, surface diffusion becomes a structure-determining factor that requires microscopic understanding. Scanning probe techniques provide atomic resolution, but are limited to observations of slow movements, and therefore constrained to low temperatures. In contrast, the helium-3 spin-echo (HeSE) technique achieves spatial and time resolution on the nm and ps scale, respectively, thus enabling measurements at elevated temperatures. Here we use HeSE to unveil the intricate motion of pentacene admolecules diffusing on a chemisorbed monolayer of pentacene on Cu(110) that serves as a stable, well-ordered organic model surface. We find that pentacene moves along rails parallel and perpendicular to the surface molecules. The experimental data are explained by admolecule rotation that enables a switching between diffusion directions, which extends our molecular level understanding of diffusion in complex organic systems.

Investigation of ion diffusion towards plasmonic surfaces

International Nuclear Information System (INIS)

Gmucova, K.; Nadazdy, V.; Vojtko, A.; Majkova, E.; Kotlar, M.

2013-01-01

Plasmonic sensors have recently attracted much attention. The past few decades have seen a massive and continued interest in studying electrochemical processes at artificially structured electrodes. Such electrochemical sensors provide sensitive, selective, and easy to use approaches to the detection of many chemical species, e.g. environmental pollutants, biomolecules, drugs etc. The issue raised in this paper is to study the kinetic of the diffusion towards plasmonic surfaces in dark and under illumination with white LED diode. The possibility to use anomalous charge transfer towards plasmonic surfaces in electrochemical sensorics will be discussed, too. (authors)

Near-surface and bulk behavior of Ag in SiC

International Nuclear Information System (INIS)

Xiao, H.Y.; Zhang, Y.; Snead, L.L.; Shutthanandan, V.; Xue, H.Z.; Weber, W.J.

2012-01-01

Highlights: ► Ag release from SiC poses problems in safe operation of nuclear reactors. ► Near-surface and bulk behavior of Ag are studied by ab initio and ion beam methods. ► Ag prefers to adsorb on the surface rather than in the bulk SiC. ► At high temperature Ag desorbs from the surface instead of diffusion into bulk SiC. ► Surface diffusion may be a dominating mechanism accounting for Ag release from SiC. - Abstract: The diffusive release of fission products, such as Ag, from TRISO particles at high temperatures has raised concerns regarding safe and economic operation of advanced nuclear reactors. Understanding the mechanisms of Ag diffusion is thus of crucial importance for effective retention of fission products. Two mechanisms, i.e., grain boundary diffusion and vapor or surface diffusion through macroscopic structures such as nano-pores or nano-cracks, remain in debate. In the present work, an integrated computational and experimental study of the near-surface and bulk behavior of Ag in silicon carbide (SiC) has been carried out. The ab initio calculations show that Ag prefers to adsorb on the SiC surface rather than in the bulk, and the mobility of Ag on the surface is high. The energy barrier for Ag desorption from the surface is calculated to be 0.85–1.68 eV, and Ag migration into bulk SiC through equilibrium diffusion process is not favorable. Experimentally, Ag ions are implanted into SiC to produce Ag profiles buried in the bulk and peaked at the surface. High-temperature annealing leads to Ag release from the surface region instead of diffusion into the interior of SiC. It is suggested that surface diffusion through mechanical structural imperfection, such as vapor transport through cracks in SiC coatings, may be a dominating mechanism accounting for Ag release from the SiC in the nuclear reactor.

On the diffusion and self-trapping of surface dimers

Science.gov (United States)

Kappus, W.

1982-03-01

The theory of elastic interactions between surface atoms which are caused by substrate strains is applied to the interaction of dimers on the (211) surface of tungsten. From the comparison of theoretical and experimental interactions which were derived from the diffusion behaviour of dimers, conclusions are drawn on the nature of the adatom-substrate bond.

Diffusion of I{sup -}, Cs{sup +}, and Sr{sup 2+} in compacted bentonite - Anion exclusion and surface diffusion

Energy Technology Data Exchange (ETDEWEB)

Eriksen, T.E.; Jansson, Mats [Royal Inst. of Tech., Stockholm (Sweden). Dept. of Nuclear Chemistry

1996-11-01

The diffusion of I, Cs and Sr ions in bentonite compacted to a dry density of 1.8 gr/cm{sup 3} and saturated with two groundwaters of different ionic strength have been studied experimentally using the through diffusion technique. The I{sup -} diffusivity and diffusion porosity were found to be concentration independent in the concentration range exp(-8) to exp(-2) mol/dm{sup 3}. The diffusion porosity, being only a fraction of the water porosity for normal groundwaters, is strongly ionic strength dependent due to anion exclusion. The dependence of the diffusion of Cs{sup +} and Sr{sup 2+} on the sorption intensity is accommodated by a model encompassing diffusion of the sorbed cations within the electrical double layer next to the mineral surface in addition to diffusion in the pore water. 18 refs, 12 figs.

Surface diffusion of long chainlike molecules: The role of memory effects and stiffness on effective diffusion barriers

DEFF Research Database (Denmark)

Hjelt, T.; Vattulainen, Ilpo Tapio

2000-01-01

stiffness. Our primary aim is to consider the role played by chain stiffness and the resulting memory effects in tracer diffusion, and in particular their role in the effective tracer diffusion barrier E-A(T) extracted from the well-known Arrhenius form. We show that the memory effects in tracer diffusion......, for a single diffusing chain, about 20% of E-A(T) arises from temperature variations in the memory effects, while only the remaining part comes from thermally activated chain segment movements. At a finite coverage, the memory contribution in E-A(T) is even larger and is typically about 20%-40%. Further...... of recent experimental work as regards surface diffusion of long DNA molecules on a biological interface. (C) 2000 American Institute of Physics....

Convergence of surface diffusion parameters with model crystal size

Science.gov (United States)

Cohen, Jennifer M.; Voter, Arthur F.

1994-07-01

A study of the variation in the calculated quantities for adatom diffusion with respect to the size of the model crystal is presented. The reported quantities include surface diffusion barrier heights, pre-exponential factors, and dynamical correction factors. Embedded atom method (EAM) potentials were used throughout this effort. Both the layer size and the depth of the crystal were found to influence the values of the Arrhenius factors significantly. In particular, exchange type mechanisms required a significantly larger model than standard hopping mechanisms to determine adatom diffusion barriers of equivalent accuracy. The dynamical events that govern the corrections to transition state theory (TST) did not appear to be as sensitive to crystal depth. Suitable criteria for the convergence of the diffusion parameters with regard to the rate properties are illustrated.

Diffusion of particles on a fluctuating surface

Czech Academy of Sciences Publication Activity Database

Tarasenko, Alexander; Jastrabík, Lubomír

2011-01-01

Roč. 29, č. 5 (2011), s. 487-494 ISSN 0263-6174 R&D Projects: GA AV ČR KAN301370701; GA MŠk(CZ) 1M06002 Institutional research plan: CEZ:AV0Z10100522 Keywords : kinetic Monte Carlo simulations * diffusion on a fluctuating surface Subject RIV: BH - Optics, Masers, Lasers Impact factor: 0.606, year: 2011

Collisional diffusion in a torus with imperfect magnetic surfaces

International Nuclear Information System (INIS)

White, R.B.

1983-03-01

A Hamiltonian forumlation of the guiding-center drift equations is used to investigate the modification of neoclassical diffusion for low collisonality in a toroidal magnetic field with partially destroyed magnetic surfaces. The magnetic field is assumed to be given by the small perturbation of an axisymmetric system. The results are applicable to particle diffusion in realistic confinement systems, midway between axisymmetric and purely stochastic ones. Significant enhancement of electron diffusion over neoclassical rates is found. This increase can be accounted for by the contributions due to the first few island chains in the Fibonacci sequence generated by the zero-order islands, and by associated stochastic domains

Plateau diffusion coefficient for arbitrary flux surface geometry

International Nuclear Information System (INIS)

Meier, H.K.; Hirshman, S.P.; Sigmar, D.J.; Lao, L.L.

1981-03-01

A relatively simple but accurate representation has been developed for magnetic flux surfaces; it is valid for finite β and it describes configurations with both ellipticity and D-shape. This representation has been applied to the computation of the diffusion coefficient in the plateau regime

A new approach to the problem of bulk-mediated surface diffusion.

Science.gov (United States)

Berezhkovskii, Alexander M; Dagdug, Leonardo; Bezrukov, Sergey M

2015-08-28

This paper is devoted to bulk-mediated surface diffusion of a particle which can diffuse both on a flat surface and in the bulk layer above the surface. It is assumed that the particle is on the surface initially (at t = 0) and at time t, while in between it may escape from the surface and come back any number of times. We propose a new approach to the problem, which reduces its solution to that of a two-state problem of the particle transitions between the surface and the bulk layer, focusing on the cumulative residence times spent by the particle in the two states. These times are random variables, the sum of which is equal to the total observation time t. The advantage of the proposed approach is that it allows for a simple exact analytical solution for the double Laplace transform of the conditional probability density of the cumulative residence time spent on the surface by the particle observed for time t. This solution is used to find the Laplace transform of the particle mean square displacement and to analyze the peculiarities of its time behavior over the entire range of time. We also establish a relation between the double Laplace transform of the conditional probability density and the Fourier-Laplace transform of the particle propagator over the surface. The proposed approach treats the cases of both finite and infinite bulk layer thicknesses (where bulk-mediated surface diffusion is normal and anomalous at asymptotically long times, respectively) on equal footing.

Surface self-diffusion behavior of individual tungsten adatoms on rhombohedral clusters

International Nuclear Information System (INIS)

Yang Jianyu; Hu Wangyu; Tang Jianfeng

2011-01-01

The diffusion of single tungsten adatoms on the surfaces of rhombohedral clusters is studied by means of molecular dynamics and the embedded atom method. The energy barriers for the adatom diffusing across and along the step edge between a {110} facet and a neighboring {110} facet are calculated using the nudged elastic band method. We notice that the tungsten adatom diffusion across the step edge has a much higher barrier than that for face-centered cubic metal clusters. The result shows that diffusion from the {110} facet to a neighboring {110} facet could not take place at low temperatures. In addition, the calculated energy barrier for an adatom diffusing along the step edge is lower than that for an adatom on the flat (110) surface. The results show that the adatom could diffuse easily along the step edge, and could be trapped by the facet corner. Taking all of this evidence together, we infer that the {110} facet starts to grow from the facet corner, and then along the step edge, and finally toward the {110} facet center. So the tungsten rhombohedron can grow epitaxially along the {110} facet one facet at a time and the rhombohedron should be the stable structure for both large and small tungsten clusters. (paper)

NTERACTION BETWEEN SURFACE CHARGE PHENOMENA AND MULTI-SPECIES DIFFUSION IN CEMENT BASED MATERIALS

DEFF Research Database (Denmark)

Johannesson, Björn

2008-01-01

Measurements strongly indicate that the ‘inner’ surface of the microscopic structure of cement based materials has a fixed negative charge. This charge contributes to the formation of so-called electrical double layers. In the case of cement based materials the ionic species located in such layers...... are typically potassium -, sodium - and calcium ions. Due to the high specific surface area of hydrated cement, a large amount of ions can be located in theses double layers even if the surface charge is relatively low. The attraction force, caused by the fixed surface charge on ions located close to surfaces......, is one possible explanation for the observed low global diffusion rates in the pore system of positively charged ions compared to the negatively charged ones. Here it is of interest to simulate the multi ionic diffusion behavior when assigning positively charged ions a comparably lower diffusion constant...

Surface effects of underground nuclear explosions

Energy Technology Data Exchange (ETDEWEB)

Allen, B.M.; Drellack, S.L. Jr.; Townsend, M.J.

1997-06-01

The effects of nuclear explosions have been observed and studied since the first nuclear test (code named Trinity) on July 16, 1945. Since that first detonation, 1,053 nuclear tests have been conducted by the US, most of which were sited underground at the Nevada Test Site (NTS). The effects of underground nuclear explosions (UNEs) on their surroundings have long been the object of much interest and study, especially for containment, engineering, and treaty verification purposes. One aspect of these explosion-induced phenomena is the disruption or alteration of the near-surface environment, also known as surface effects. This report was prepared at the request of the Los Alamos National Laboratory (LANL), to bring together, correlate, and preserve information and techniques used in the recognition and documentation of surface effects of UNEs. This report has several main sections, including pertinent background information (Section 2.0), descriptions of the different types of surface effects (Section 3.0), discussion of their application and limitations (Section 4.0), an extensive bibliography and glossary (Section 6.0 and Appendix A), and procedures used to document geologic surface effects at the NTS (Appendix C). Because a majority of US surface-effects experience is from the NTS, an overview of pertinent NTS-specific information also is provided in Appendix B. It is not within the scope of this report to explore new relationships among test parameters, physiographic setting, and the types or degree of manifestation of surface effects, but rather to compile, summarize, and capture surface-effects observations and interpretations, as well as documentation procedures and the rationale behind them.

Molecular exchange of n-hexane in zeolite sieves studied by diffusion-diffusion and T{sub 1}-diffusion nuclear magnetic resonance exchange spectroscopy

Energy Technology Data Exchange (ETDEWEB)

Neudert, Oliver; Stapf, Siegfried; Mattea, Carlos, E-mail: carlos.mattea@tu-ilmenau.de [Fachgebiet Technische Physik II/Polymerphysik, Institute of Physics, Technische Universitaet Ilmenau, PO Box 100 565, 98684 Ilmenau (Germany)

2011-03-15

Molecular exchange properties and diffusion of n-hexane embedded in a bimodal pore structure with characteristic length scales in the order of nano and micrometres, respectively, formed by packing of zeolite particles, are studied. Two-dimensional (2D) nuclear magnetic resonance (NMR) diffusion correlation experiments together with relaxation-diffusion correlation experiments are performed at low magnetic field using a single-sided NMR scanner. The exchange time covers a range from 10{sup -3} to 10{sup -1} s. The molecular exchange properties are modulated by transport inside the zeolite particles. Different exchange regimes are observed for molecules starting from different positions inside the porous sample. The influence of the spin-lattice relaxation properties of the fluid molecules inside the zeolite particles on the signal intensity is also studied. A Monte Carlo simulation of the exchange process is performed and is used to support the analysis of the experimental data.

Lateral diffusion study of the Pt-Al system using the NAC nuclear microprobe.

Science.gov (United States)

de Waal, H.; Pretorius, R.

1999-10-01

In this study a nuclear microprobe (NMP) was used to analyse phase formation during reaction in Pt-Al lateral diffusion couples. Phase identification was done by Rutherford backscattering spectroscopy. These results were compared with phase formation during conventional thin film Pt-Al interactions. The co-existence of multiple phases in lateral diffusion couples is discussed with reference to the effective heat of formation (EHF) model.

Lateral diffusion study of the Pt-Al system using the NAC nuclear microprobe

Energy Technology Data Exchange (ETDEWEB)

Waal, H. de E-mail: dewalla@nac.ac.za; Pretorius, R

1999-09-02

In this study a nuclear microprobe (NMP) was used to analyse phase formation during reaction in Pt-Al lateral diffusion couples. Phase identification was done by Rutherford backscattering spectroscopy. These results were compared with phase formation during conventional thin film Pt-Al interactions. The co-existence of multiple phases in lateral diffusion couples is discussed with reference to the effective heat of formation (EHF) model.

Enhanced diffusion under alpha self-irradiation in spent nuclear fuel: Theoretical approaches

International Nuclear Information System (INIS)

Ferry, Cecile; Lovera, Patrick; Poinssot, Christophe; Garcia, Philippe

2005-01-01

Various theoretical approaches have been developed in order to estimate the enhanced diffusion coefficient of fission products under alpha self-irradiation in spent nuclear fuel. These simplified models calculate the effects of alpha particles and recoil atoms on mobility of uranium atoms in UO 2 . They lead to a diffusion coefficient which is proportional to the volume alpha activity with a proportionality factor of about 10 -44 (m 5 ). However, the same models applied for fission lead to a radiation-enhanced diffusion coefficient which is approximately two orders of magnitude lower than values reported in literature for U and Pu. Other models are based on an extrapolation of radiation-enhanced diffusion measured either in reactors or under heavy ion bombardment. These models lead to a proportionality factor between the alpha self-irradiation enhanced diffusion coefficient and the volume alpha activity of 2 x 10 -41 (m 5 )

The surface diffusion coefficient for an arbitrarily curved fluid-fluid interface. (I). General expression

Science.gov (United States)

M. C. Sagis, Leonard

2001-03-01

In this paper, we develop a theory for the calculation of the surface diffusion coefficient for an arbitrarily curved fluid-fluid interface. The theory is valid for systems in hydrodynamic equilibrium, with zero mass-averaged velocities in the bulk and interfacial regions. We restrict our attention to systems with isotropic bulk phases, and an interfacial region that is isotropic in the plane parallel to the dividing surface. The dividing surface is assumed to be a simple interface, without memory effects or yield stresses. We derive an expression for the surface diffusion coefficient in terms of two parameters of the interfacial region: the coefficient for plane-parallel diffusion D (AB)aa(ξ) , and the driving force d(B)I||(ξ) . This driving force is the parallel component of the driving force for diffusion in the interfacial region. We derive an expression for this driving force using the entropy balance.

Dimer-flipping-assisted diffusion on a Si(001) surface

International Nuclear Information System (INIS)

Zi, J.; Min, B. J.; Lu, Y.; Wang, C. Z.; Ho, K. M.

2000-01-01

The binding sites and diffusion pathways of Si adatoms on a c(4x2) reconstructed Si(001) surface are investigated by a tight-binding method with an environment-dependent silicon potential in conjunction with ab initio calculations using the Car--Parrinello method. A new diffusion pathway along the trough edge driven by dimer flipping is found with a barrier of 0.74 eV, comparable to that of 0.68 eV along the top of the dimer rows

Analytical mass formula and nuclear surface properties in the ETF approximation. Part I: symmetric nuclei

Science.gov (United States)

Aymard, François; Gulminelli, Francesca; Margueron, Jérôme

2016-08-01

The problem of determination of nuclear surface energy is addressed within the framework of the extended Thomas Fermi (ETF) approximation using Skyrme functionals. We propose an analytical model for the density profiles with variationally determined diffuseness parameters. In this first paper, we consider the case of symmetric nuclei. In this situation, the ETF functional can be exactly integrated, leading to an analytical formula expressing the surface energy as a function of the couplings of the energy functional. The importance of non-local terms is stressed and it is shown that they cannot be deduced simply from the local part of the functional, as it was suggested in previous works.

Surface sensitivity of nuclear-knock-out form factors

International Nuclear Information System (INIS)

Fratamico, G.

1984-01-01

A numerical calculation has been performed to investigate the sensitivity of nuclear-knock-out form factors to nuclear-surface behaviour of bound-state wave functions. The result of our investigation suggests that one can extract the bound-state behaviour at the surface from experimental information on nuclear-knock-out form factors

Effect of surface characteristics on diffuse reflection radiation at lambda=0. 40. mu. m

Energy Technology Data Exchange (ETDEWEB)

Takashima, T [Atmospheric Environment Service, Downsview, Ontario (Canada)

1976-08-01

The diffuse radiation in the upward direction at the top and at an internal level of an inhomogeneous atmosphere is computed at lambda=0.40 ..mu..m. The surface is assumed to reflect light in accordance with a hybrid mode of a diffuse and specular reflector. The objective is to estimate the effect of underlying surface characteristics in terms of the diffuse radiation field. By making use of these results, accuracy in monitoring the atmospheric aerosols would be increased for the use of remote sensing satellite techniques. Junge power law (..gamma..*=3) is adopted for the size distribution of aerosols (1963), while the data given by McClatchy et al. (1971) is used for the number density of aerosols with height distribution. It is noted from the computations that the diffuse reflection radiation is affected by the surface characteristics, even if the albedo of the surface is a fixed constant and very small.

Diffusion tensor analysis with nuclear magnetic resonance in human central nervous system

International Nuclear Information System (INIS)

Nakayama, Naoki

1998-01-01

Nuclear magnetic resonance has been used to measure the diffusivity of water molecules. In central nervous system, anisotropic diffusion, which is characterized by apparent diffusion tensor D app ξ , is thought to be related to neuronal fiber tract orientation. For precise observation of anisotropic diffusion, it is needed to determine the diagonal and off-diagonal elements of D app ξ . Once D app ξ is estimated from a series of diffusion weighted images, a tissue's orthotropic principal axes and diffusivity of each direction are determined from eigenvalues and eigenvectors of D app ξ . There are several methods to represent anisotropic diffusion with D app ξ . Examples are diffusion ellipsoids constructed in each voxel depicting both these principal axes and the mean diffusion length in these directions, trace invariant values and its mapping image, largest eigenvalue, and ratio of largest eigenvalue to the other eigenvalue. In this study, the author investigated practical procedure to analyze diffusion tensor D app ξ using both of spin-echo end echo-planer diffusion weighted imagings with 3-tesla magnetic resonance machine in human brain. The ellipsoid representation provided particularly useful information about microanatomy including neuronal fiber tract orientation and molecular mobility reflective of microstructure. Furthermore, in the lesion of Wallerian degeneration, the loss of anisotropy of local apparent diffusion was observed. It is suggested that the function of axons can be observed via degree of anisotropy of apparent diffusion. Consequently, diffusion tensor analysis is expected to be a powerful, noninvasive method capable of quantitative and functional evaluation of the central nervous system. (author)

Nitrogen diffusion in near-surface range of ion doped molybdenum

CERN Document Server

Zamalin, E Y

2001-01-01

The dynamics of change in nitrogen near-the-surface concentration in the Mo ion-alloyed monocrystalline foil is studied through the Auger-electron spectroscopy and the secondary ion mass spectrometry. The implantation dose constituted 5 x 10 sup 1 sup 7 ion/cm sup 2 and the implantation energy equaled 50 and 100 keV. The samples diffusion annealing was performed at the temperature of 800-900 deg C. The evaluation of the nitrogen diffusion coefficient indicates the values by 3-5 orders lesser than the diffusion coefficient in the nitrogen solid-state solution in the molybdenum. At the same time the molybdenum self-diffusion coefficient value is by 3-5 orders lesser as compared to the obtained value. The supposition is made, the the surplus nitrogen relative to the solubility limit is deposited on the radiation defects and in the process of the diffusion annealing it nitrates together with them

Impurity diffusion, point defect engineering, and surface/interface passivation in germanium

KAUST Repository

Chroneos, Alexander I.

2012-01-26

In recent years germanium has been emerging as a mainstream material that could have important applications in the microelectronics industry. The principle aim of this study is to review investigations of the diffusion of technologically important p- and n-type dopants as well as surface and interface passivation issues in germanium. The diffusion of impurities in germanium is interrelated to the formation of clusters whenever possible, and possibilities for point defect engineering are discussed in view of recent results. The importance of electrically active defects on the Ge surface and interfaces is addressed considering strategies to suppress them and to passivate the surfaces/interfaces, bearing in mind their importance for advanced devices. © 2012 by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

An emergency computation model for the wind field and diffusion during accidental nuclear pollutants releases

International Nuclear Information System (INIS)

Yoshikawa, T.; Kimura, F.; Koide, T.; Kurita, S.

1990-01-01

Since 1986, a simple computation model for a nuclear accident has been operating in the emergency information center of Japan Agency for Science and Technology. It was developed by introducing the variation method for wind and a random walk particle model for diffusion in 50-100 km scale. Furthermore, we developed a new model with dynamic equations and a diffusion equation to predict more accurately the wind and diffusion, including local thermal convection. The momentum equation and the continuity equation are solved numerically in nonhydrostatic and incompressible conditions, using a finite difference technique. Then, the equation of thermal energy preservation is solved for potential temperature in the predicted wind field of every time step. The diffusion of nuclear pollutants is computed numerically in the predicted wind field, using diffusion coefficients obtained from the predictive dynamic equations. These computations were verified with meteorological surveys and gas tracer diffusion experiments over flat land, along a sea shore and over a mountainous area. Horizontal circulations and vertical convections can be computed in any mesh size from several tens of meters to several kilometers, while small vertical convections less than 1 km or so cannot be represented with the former hydrostatic circulation models. (author)

A high-order boundary integral method for surface diffusions on elastically stressed axisymmetric rods

OpenAIRE

Li, Xiaofan; Nie, Qing

2009-01-01

Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratu...

Transient enhanced diffusion in preamorphized silicon: the role of the surface

Science.gov (United States)

Cowern, N. E. B.; Alquier, D.; Omri, M.; Claverie, A.; Nejim, A.

1999-01-01

Experiments on the depth dependence of transient enhanced diffusion (TED) of boron during rapid thermal annealing of Ge-preamorphized layers reveal a linear decrease in the diffusion enhancement between the end-of-range (EOR) defect band and the surface. This behavior, which indicates a quasi-steady-state distribution of excess interstitials, emitted from the EOR band and absorbed at the surface, is observed for annealing times as short as 1 s at 900°C. Using an etching procedure we vary the distance xEOR from the EOR band to the surface in the range 80-175 nm, and observe how this influences the interstitial supersaturation, s( x). The supersaturations at the EOR band and the surface remain unchanged, while the gradient d s/d x, and thus the flux to the surface, varies inversely with xEOR. This confirms the validity of earlier modelling of EOR defect evolution in terms of Ostwald ripening, and provides conclusive evidence that the surface is the dominant sink for interstitials during TED.

Diffusion of zinc into an unpassivated surface of indium phosphide

International Nuclear Information System (INIS)

Budko, T.O.; Gushchinskaya, E.V.; Emelyanenko, Yu.S.; Malyshev, S.A.

1989-01-01

Peculiarities are studied of the diffusion of Zn into an unpassivated surface of InP in an open gasflow system. In the region where the carrier concentration profile is described by an erfc (error function compliment), the diffusion coefficient and activation energy are determined. It is shown that thermal processes cause changes in the charge state of Zn in InP which result in a variation of the carrier profile in the semiconductor. (author)

Symmetry energy in nuclear surface

International Nuclear Information System (INIS)

Danielewicz, P.; Lee, Jenny

2009-01-01

Interplay between the dependence of symmetry energy on density and the variation of nucleonic densities across nuclear surface is discussed. That interplay gives rise to the mass dependence of the symmetry coefficient in an energy formula. Charge symmetry of the nuclear interactions allows to introduce isoscalar and isovector densities that are approximately independent of the magnitude of neutron-proton asymmetry. (author)

Inward Cationic Diffusion and Formation of Silica-Rich Surface Nanolayer of Glass

DEFF Research Database (Denmark)

Smedskjær, Morten Mattrup; Deubener, Joachim; Yue, Yuanzheng

2009-01-01

form and are incorporated into the glass structure. Both the V4+ and the hydroxyl contents increase with increasing ta and hydrogen partial pressure. The inward diffusion enhances the hardness of the glass surface. The mechanism of the inward diffusion is suggested on the basis of a model describing...

Polyphase diffusion of fission products in graphite

International Nuclear Information System (INIS)

Dannert, V.

1989-05-01

The report attempts to give an introduction into the subject of fission product transport in nuclear graphite and results in an extended proposal of a transport-model. Beginning with a rough description of the graphite in question, an idea about the physical transport-phenomena in graphite is developed. Some of the basic experimental methods, especially techniques of porosimetry, determination of sorption-isotherms and of course several transport-experiments, are briefly described and their results are discussed. Some of the most frequent transport models are introduced and assessed with the criteria emphasized in this report. An extended model is proposed including the following main ideas: The transport of the fission-products is regarded as a two-phase-diffusion process through the open pores of the graphite. The two phases are: surface-diffusion and gas-diffusion. A time-dependent coupling of the two diffusion-phases by sorption-isotherms and a concentration-dependence of the surface diffusion coefficient, also related to the physical behaviour of the sorption-isotherms, are the basic properties of the proposed model. (orig./HP) [de

Diffusion of C and Cr During Creation of Surface Layer on Cast Steel Casting

Directory of Open Access Journals (Sweden)

Szajnar J.

2014-10-01

Full Text Available In paper a method of improvement in utility properties of unalloyed cast steel casting in result of diffusion of C and Cr in process of creation of surface layer is presented. The aim of paper was determination of diffusion range of basic elements of alloyed surface layer. Moreover a quantitative analysis of carbides phase strengthens alloyed surface layer of casting was carried out. The results of studies shown that important factors of surface layer creation are maximal temperature Tmax on granular insert – cast steel boundary dependent of pouring temperature, granularity Zw of Fe-Cr-C alloy insert and thickness of casting wall gśo. On the basis of obtained results was affirmed that with increase of thickness of casting wall increases range of diffusion in solid state in Fe-Cr-C grains and in liquid state. Moreover the range of Tmax = 13001500oC favours creation of the proper alloyed surface layers on cast steel.

Numerical calculation of the tensor of diffusion in the nuclear reactor cells by Monte-Carlo method

International Nuclear Information System (INIS)

Gorodkov, S.S.; Kalugin, M.A.

2009-01-01

New algorithm based on the sequential application of the RMS path method has been proposed for the diffusion constants calculation. The offered algorithm conforms to the diffusion constants calculation in arbitrary segments of nuclear reactors without detail description of geometry, dependence of cross-sections from energy or neutron scattering anisotropy by kernel medium. The proposed algorithm is used for the diffusion constants calculation in uranium-graphite reactor sells

Surface modifications by field induced diffusion.

Directory of Open Access Journals (Sweden)

Martin Olsen

Full Text Available By applying a voltage pulse to a scanning tunneling microscope tip the surface under the tip will be modified. We have in this paper taken a closer look at the model of electric field induced surface diffusion of adatoms including the van der Waals force as a contribution in formations of a mound on a surface. The dipole moment of an adatom is the sum of the surface induced dipole moment (which is constant and the dipole moment due to electric field polarisation which depends on the strength and polarity of the electric field. The electric field is analytically modelled by a point charge over an infinite conducting flat surface. From this we calculate the force that cause adatoms to migrate. The calculated force is small for voltage used, typical 1 pN, but due to thermal vibration adatoms are hopping on the surface and even a small net force can be significant in the drift of adatoms. In this way we obtain a novel formula for a polarity dependent threshold voltage for mound formation on the surface for positive tip. Knowing the voltage of the pulse we then can calculate the radius of the formed mound. A threshold electric field for mound formation of about 2 V/nm is calculated. In addition, we found that van der Waals force is of importance for shorter distances and its contribution to the radial force on the adatoms has to be considered for distances smaller than 1.5 nm for commonly used voltages.

Suppression of Lateral Diffusion and Surface Leakage Currents in nBn Photodetectors Using an Inverted Design

Science.gov (United States)

Du, X.; Savich, G. R.; Marozas, B. T.; Wicks, G. W.

2018-02-01

Surface leakage and lateral diffusion currents in InAs-based nBn photodetectors have been investigated. Devices fabricated using a shallow etch processing scheme that etches through the top contact and stops at the barrier exhibited large lateral diffusion current but undetectably low surface leakage. Such large lateral diffusion current significantly increased the dark current, especially in small devices, and causes pixel-to-pixel crosstalk in detector arrays. To eliminate the lateral diffusion current, two different approaches were examined. The conventional solution utilized a deep etch process, which etches through the top contact, barrier, and absorber. This deep etch processing scheme eliminated lateral diffusion, but introduced high surface current along the device mesa sidewalls, increasing the dark current. High device failure rate was also observed in deep-etched nBn structures. An alternative approach to limit lateral diffusion used an inverted nBn structure that has its absorber grown above the barrier. Like the shallow etch process on conventional nBn structures, the inverted nBn devices were fabricated with a processing scheme that only etches the top layer (the absorber, in this case) but avoids etching through the barrier. The results show that inverted nBn devices have the advantage of eliminating the lateral diffusion current without introducing elevated surface current.

Dynamics of an optically confined nanoparticle diffusing normal to a surface.

Science.gov (United States)

Schein, Perry; O'Dell, Dakota; Erickson, David

2016-06-01

Here we measure the hindered diffusion of an optically confined nanoparticle in the direction normal to a surface, and we use this to determine the particle-surface interaction profile in terms of the absolute height. These studies are performed using the evanescent field of an optically excited single-mode silicon nitride waveguide, where the particle is confined in a height-dependent potential energy well generated from the balance of optical gradient and surface forces. Using a high-speed cmos camera, we demonstrate the ability to capture the short time-scale diffusion dominated motion for 800-nm-diam polystyrene particles, with measurement times of only a few seconds per particle. Using established theory, we show how this information can be used to estimate the equilibrium separation of the particle from the surface. As this measurement can be made simultaneously with equilibrium statistical mechanical measurements of the particle-surface interaction energy landscape, we demonstrate the ability to determine these in terms of the absolute rather than relative separation height. This enables the comparison of potential energy landscapes of particle-surface interactions measured under different experimental conditions, enhancing the utility of this technique.

Detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural components

Energy Technology Data Exchange (ETDEWEB)

Zhang, C. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Laboratoire de Mecanique des Contacts et des Structures (LaMCoS), INSA Lyon, 20 Avenue des Sciences, F-69621 Villeurbanne Cedex (France); Li, H. [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China); Li, M.Q., E-mail: zc9997242256@126.com [School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an 710072 (China)

2016-05-15

Graphical abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in diffusion bonding of steel hollow structural component. A special surface with regular patterns was processed to be joined so as to observe the extent of surface asperity deformation under different applied bonding pressures. Fracture surface characteristic combined with surface roughness profiles distinctly revealed the enhanced surface asperity deformation as the applied pressure increases. The influence of surface asperity deformation mechanism on joint formation was analyzed: (a) surface asperity deformation not only directly expanded the interfacial contact areas, but also released deformation heat and caused defects, indirectly accelerating atomic diffusion, then benefits to void shrinkage; (b) surface asperity deformation readily introduced stored energy difference between two opposite sides of interface grain boundary, resulting in strain induced interface grain boundary migration. In addition, the influence of void on interface grain boundary migration was analyzed in detail. - Highlights: • A high quality hollow structural component has been fabricated by diffusion bonding. • Surface asperity deformation not only expands the interfacial contact areas, but also causes deformation heat and defects to improve the atomic diffusion. • Surface asperity deformation introduces the stored energy difference between the two opposite sides of interface grain boundary, leading to strain induced interface grain boundary migration. • The void exerts a dragging force on the interface grain boundary to retard or stop interface grain boundary migration. - Abstract: This study focused on the detailed analysis of surface asperity deformation mechanism in similar diffusion bonding as well as on the fabrication of high quality martensitic stainless steel hollow structural components. A special surface with regular patterns was processed to be joined so as to

Kinetic evaluation of propyne surface diffusivity on silica-alumina-supported chromium(VI) using positron annihilation surface detection

International Nuclear Information System (INIS)

Ferrieri, R.A.; Wolf, A.P.

1984-01-01

A study has been performed on the rate of the translational surface diffusivity of propyne on a silica-alumina-supported Cr(VI) catalyst. This rate was measured via nonchemical acetylene-propyne sorbate interactions coupled with positron annihilation surface detection (PASD). The surface displacement rate of [ 11 C]acetylene by propyne was measured in a transient experiment as a function of the adjacent Cr-site distance and correlated to propyne surface diffusivity, D/sub s/. Results indicated that D/sub s/ increased linearly when the adjacent site distance was decreased for catalysts loaded with between 0.08 and 0.8 wt % of chromium. However, D/sub s/ fell off drastically to nearly zero when greater Cr-site dispersion was achieved at support loadings below 0.08 wt % of chromium. Catalytic selectivity for p-xylene production was also measured as a function of D/sub s/ and was shown to have a strong dependence of its rate. 25 references, 4 figures

Study of the oxidation mechanisms between impurities and surfaces applied to the future gas-cooled nuclear reactors

International Nuclear Information System (INIS)

Duval, A.

2010-01-01

Inconel 617, main candidate for the heat exchangers of the gas-cooled next generation of nuclear reactors has been investigated. Two different problems occurring in the cooling system splits the study into two parts. Oxidizing impurities contained in the coolant can cause severe corrosion at 850 C. Radioactive impurities, coming from the fission reaction of the core can, in another hand contaminate the cooling loop and cause radioprotection problem for the maintenance and dismantling operations. Firstly, oxidizing gas partial pressure influence on oxidation of IN 617 at 850 C was investigated varying oxygen and water vapour partial pressure between 1.10 -5 mbar and 200 mbar. Oxide layers were characterized using XPS, SEM, EDX, GD-OES, XRD. Influence of partial pressure on layers structure and composition was determined. Effect of water vapour and partial pressure on growth mechanisms were also investigated. The second part of this study is focused on diffusion of Ag, stable isotope of Ag-110m in IN617 alloy and in the oxide layer forming at its surface at 850 C. Concentration profiles were obtained by GD-OES calibrated analysis. Diffusion coefficient could be obtained from these diffusion profiles: volume diffusion and grain boundary diffusion coefficients for the diffusion in the alloy, and an apparent diffusion coefficient for the diffusion in the oxide, due to the porosity of the structure. (author) [fr

The Complete Solution of Fick's Second Law of Diffusion with Time-dependent Diffusion Coefficient and Surface Concentration

DEFF Research Database (Denmark)

Mejlbro, Leif

1996-01-01

Fick's Second Law of Diffusion with time-dependent diffusioncoefficient and surface concentration is solved. Mimicking the classicalsolution, special time-dependent surface concentration functions areconsidered. These models are used in giving estimates of the lifetimeof the structure, when...... the concrete cover is given, as well as estimatesof the thickness of the concrete cover, when the expected lifetime is given.*Note: Book tilte: Durability of Concrete in Saline Environment...

Load-dependent surface diffusion model for analyzing the kinetics of protein adsorption onto mesoporous materials.

Science.gov (United States)

Marbán, Gregorio; Ramírez-Montoya, Luis A; García, Héctor; Menéndez, J Ángel; Arenillas, Ana; Montes-Morán, Miguel A

2018-02-01

The adsorption of cytochrome c in water onto organic and carbon xerogels with narrow pore size distributions has been studied by carrying out transient and equilibrium batch adsorption experiments. It was found that equilibrium adsorption exhibits a quasi-Langmuirian behavior (a g coefficient in the Redlich-Peterson isotherms of over 0.95) involving the formation of a monolayer of cyt c with a depth of ∼4nm on the surface of all xerogels for a packing density of the protein inside the pores of 0.29gcm -3 . A load-dependent surface diffusion model (LDSDM) has been developed and numerically solved to fit the experimental kinetic adsorption curves. The results of the LDSDM show better fittings than the standard homogeneous surface diffusion model. The value of the external mass transfer coefficient obtained by numerical optimization confirms that the process is controlled by the intraparticle surface diffusion of cyt c. The surface diffusion coefficients decrease with increasing protein load down to zero for the maximum possible load. The decrease is steeper in the case of the xerogels with the smallest average pore diameter (∼15nm), the limit at which the zero-load diffusion coefficient of cyt c also begins to be negatively affected by interactions with the opposite wall of the pore. Copyright © 2017 Elsevier Inc. All rights reserved.

Morphological, Chemical Surface, and Diffusive Transport Characterizations of a Nanoporous Alumina Membrane

Directory of Open Access Journals (Sweden)

María I. Vázquez

2015-12-01

Full Text Available Synthesis of a nanoporous alumina membrane (NPAM by the two-step anodization method and its morphological and chemical surface characterization by analyzing Scanning Electron Microscopy (SEM micrographs and X-Ray Photoelectron Spectroscopy (XPS spectra is reported. Influence of electrical and diffusive effects on the NaCl transport across the membrane nanopores is determined from salt diffusion measurements performed with a wide range of NaCl concentrations, which allows the estimation of characteristic electrochemical membrane parameters such as the NaCl diffusion coefficient and the concentration of fixed charges in the membrane, by using an appropriated model and the membrane geometrical parameters (porosity and pore length. These results indicate a reduction of ~70% in the value of the NaCl diffusion coefficient through the membrane pores with respect to solution. The transport number of ions in the membrane pores (Na+ and Cl−, respectively were determined from concentration potential measurements, and the effect of concentration-polarization at the membrane surfaces was also considered by comparing concentration potential values obtained with stirred solutions (550 rpm and without stirring. From both kinds of results, a value higher than 0.05 M NaCl for the feed solution seems to be necessary to neglect the contribution of electrical interactions in the diffusive transport.

Development of an atmospheric diffusion numerical model for a nuclear facility. Numerical calculation method incorporating building effects

International Nuclear Information System (INIS)

Sada, Koichi; Michioka, Takenobu; Ichikawa, Yoichi

2002-01-01

Because effluent gas is sometimes released from low positions, viz., near the ground surface and around buildings, the effects caused by buildings within the site area are not negligible for gas diffusion predictions. For these reasons, the effects caused by buildings for gas diffusion are considered under the terrain following calculation coordinate system in this report. Numerical calculation meshes on the ground surface are treated as the building with the adaptation of wall function techniques of turbulent quantities in the flow calculations using a turbulence closure model. The reflection conditions of released particles on building surfaces are taken into consideration in the diffusion calculation using the Lagrangian particle model. Obtained flow and diffusion calculation results are compared with those of wind tunnel experiments around the building. It was apparent that features observed in a wind tunnel, viz., the formation of cavity regions behind the building and the gas diffusion to the ground surface behind the building, are also obtained by numerical calculation. (author)

Dissociation and diffusion of hydrogen on defect-free and vacancy defective Mg (0001) surfaces: A density functional theory study

Energy Technology Data Exchange (ETDEWEB)

Han, Zongying [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Union Research Center of Fuel Cell, School of Chemical and Environmental Engineering, China University of Mining and Technology, Beijing 100083 (China); Chen, Haipeng [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); Zhou, Shixue, E-mail: zhoushixue66@163.com [College of Chemical and Environmental Engineering, Shandong University of Science and Technology, Qingdao 266590 (China); College of Mechanical and Electronic Engineering, Shandong University of Science and Technology, Qingdao 266590 (China)

2017-02-01

Highlights: • Clarify the effect of vacancy defect on H{sub 2} dissociation on Mg (0001) surface. • Demonstrate the effects of vacancy defect on H atom diffusion. • Reveal the minimum energy diffusion path of H atom from magnesium surface into bulk. - Abstract: First-principles calculations with the density functional theory (DFT) have been carried out to study dissociation and diffusion of hydrogen on defect-free and vacancy defective Mg (0001) surfaces. Results show that energy barriers of 1.42 eV and 1.28 eV require to be overcome for H{sub 2} dissociation on defect-free and vacancy defective Mg (0001) surfaces respectively, indicating that reactivity of Mg (0001) surface is moderately increased due to vacancy defect. Besides, the existence of vacancy defect changes the preferential H atom diffusion entrance to the subsurface and reduces the diffusion energy barrier. An interesting remark is that the minimum energy diffusion path of H atom from magnesium surface into bulk is a spiral channel formed by staggered octahedral and tetrahedral interstitials. The diffusion barriers computed for H atom penetration from the surface into inner-layers are all less than 0.70 eV, which is much smaller than the activation energy for H{sub 2} dissociation on the Mg (0001) surface. This suggests that H{sub 2} dissociation is more likely than H diffusion to be rate-limiting step for magnesium hydrogenation.

Trapping of diffusing particles by striped cylindrical surfaces. Boundary homogenization approach

Science.gov (United States)

Dagdug, Leonardo; Berezhkovskii, Alexander M.; Skvortsov, Alexei T.

2015-01-01

We study trapping of diffusing particles by a cylindrical surface formed by rolling a flat surface, containing alternating absorbing and reflecting stripes, into a tube. For an arbitrary stripe orientation with respect to the tube axis, this problem is intractable analytically because it requires dealing with non-uniform boundary conditions. To bypass this difficulty, we use a boundary homogenization approach which replaces non-uniform boundary conditions on the tube wall by an effective uniform partially absorbing boundary condition with properly chosen effective trapping rate. We demonstrate that the exact solution for the effective trapping rate, known for a flat, striped surface, works very well when this surface is rolled into a cylindrical tube. This is shown for both internal and external problems, where the particles diffuse inside and outside the striped tube, at three orientations of the stripe direction with respect to the tube axis: (a) perpendicular to the axis, (b) parallel to the axis, and (c) at the angle of π/4 to the axis. PMID:26093574

Heat Transfer and Mass Diffusion in Nanofluids over a Moving Permeable Convective Surface

Directory of Open Access Journals (Sweden)

Muhammad Qasim

2013-01-01

Full Text Available Heat transfer and mass diffusion in nanofluid over a permeable moving surface are investigated. The surface exhibits convective boundary conditions and constant mass diffusion. Effects of Brownian motion and thermophoresis are considered. The resulting partial differential equations are reduced into coupled nonlinear ordinary differential equations using suitable transformations. Shooting technique is implemented for the numerical solution. Velocity, temperature, and concentration profiles are analyzed for different key parameters entering into the problem. Performed comparative study shows an excellent agreement with the previous analysis.

Modified polarimetric bidirectional reflectance distribution function with diffuse scattering: surface parameter estimation

Science.gov (United States)

Zhan, Hanyu; Voelz, David G.

2016-12-01

The polarimetric bidirectional reflectance distribution function (pBRDF) describes the relationships between incident and scattered Stokes parameters, but the familiar surface-only microfacet pBRDF cannot capture diffuse scattering contributions and depolarization phenomena. We propose a modified pBRDF model with a diffuse scattering component developed from the Kubelka-Munk and Le Hors et al. theories, and apply it in the development of a method to jointly estimate refractive index, slope variance, and diffuse scattering parameters from a series of Stokes parameter measurements of a surface. An application of the model and estimation approach to experimental data published by Priest and Meier shows improved correspondence with measurements of normalized Mueller matrix elements. By converting the Stokes/Mueller calculus formulation of the model to a degree of polarization (DOP) description, the estimation results of the parameters from measured DOP values are found to be consistent with a previous DOP model and results.

Reduction-induced inward diffusion and crystal growth on the surfaces of iron-bearing silicate glasses

DEFF Research Database (Denmark)

Liu, S.J.; Tao, H.Z.; Zhang, Y.F.

2015-01-01

We investigate the sodium inward diffusion (i.e., sodium diffusion from surface toward interior) in iron containing alkaline earth silicate glasses under reducing conditions around Tg and the induced surface crystallization. The surface crystallization is caused by formation of a silicate-gel lay......+ ions have stronger bonds to oxygen and lower coordination number (4~5) than Ca2+, Sr2+ and Ba2+ ions. In contrast, a cristobalite layer forms in Ca-, Sr- and Ba-containing glasses....

Diffusion in reactor materials

International Nuclear Information System (INIS)

Fedorov, G.B.; Smirnov, E.A.

1984-01-01

The monograph contains a brief description of the principles underlying the theory of diffusion, as well as modern methods of studying diffusion. Data on self-diffusion and diffusion of impurities in a nuclear fuel and fissionable materials (uranium, plutonium, thorium, zirconium, titanium, hafnium, niobium, molybdenum, tungsten, beryllium, etc.) is presented. Anomalous diffusion, diffusion of components, and interdiffusion in binary and ternary alloys were examined. The monograph presents the most recent reference material on diffusion. It is intended for a wide range of researchers working in the field of diffusion in metals and alloys and attempting to discover new materials for application in nuclear engineering. It will also be useful for teachers, research scholars and students of physical metallurgy

Matrix diffusion in crystalline rocks: coupling of anion exclusion, surface diffusion and surface complexation

International Nuclear Information System (INIS)

Olin, M.; Valkiainen, M.; Aalto, H.

1997-12-01

This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments

Matrix diffusion in crystalline rocks: coupling of anion exclusion, surface diffusion and surface complexation

Energy Technology Data Exchange (ETDEWEB)

Olin, M.; Valkiainen, M.; Aalto, H. [VTT Chemical Technology, Espoo (Finland)

1997-12-01

This report includes both experimental and modelling parts. Also, a novel approach to the diffusion experiments is introduced, where ions of the same electric charge diffuse in opposite directions through the same rock sample. Six rock-types from Olkiluoto radioactive waste disposal investigation site were used in the experiments: granite, weathered granite, mica gneiss, weathered mica gneiss, tonalite and altered mica gneiss/migmatite. The experiments consisted of the determination of the effective diffusion coefficient and the rock capacity factor for tritium, chloride (Cl-36) and sodium (Na-22). The modelling consisted of a chemical model for small pores (< 100 nm), a model for counter ion diffusion and models for the laboratory experiments. 21 refs.

Study of aerosol diffusion behaviors in dismantling nuclear facilities. Contract research

International Nuclear Information System (INIS)

Shimada, Taro; Tachibana, Mitsuo; Yanagihara, Satoshi

2001-09-01

To evaluate aerosol diffusion behaviors under dismantling of nuclear facilities, plasma arc cuttings were conducted in the enclosure. The flow of air and high temperature gas in the enclosure were visualized, and the temperature distributions in the enclosure and the number density and size distribution of aerosol and the temperature in air of outlet flow were measured in the experiments. As a result, it was confirmed that ascending high temperature gas flow produced by the plasma arc is corresponded with aerosol diffusion behavior during cutting. It was also confirmed that after completing the cuttings the aerosol tends to fall due to decreasing of flow velocity of high temperature gas and the aerosol which reaches near the floor is resuspended by relatively high velocity exhaust flow. (author)

Atmospheric diffusion of large clouds

Energy Technology Data Exchange (ETDEWEB)

Crawford, T. V. [Univ. of California, Lawrence Radiation Lab., Livermore, California (United States)

1967-07-01

Clouds of pollutants travel within a coordinate system that is fixed to the earth's surface, and they diffuse and grow within a coordinate system fixed to the cloud's center. This paper discusses an approach to predicting the cloud's properties, within the latter coordinate system, on space scales of a few hundred meters to a few hundred kilometers and for time periods of a few days. A numerical cloud diffusion model is presented which starts with a cloud placed arbitrarily within the troposphere. Similarity theories of atmospheric turbulence are used to predict the horizontal diffusivity as a function of initial cloud size, turbulent atmospheric dissipation, and time. Vertical diffusivity is input as a function of time and height. Therefore, diurnal variations of turbulent diffusion in the boundary layer and effects of temperature inversions, etc. can be modeled. Nondiffusive cloud depletion mechanisms, such as dry deposition, washout, and radioactive decay, are also a part of this numerical model. An effluent cloud, produced by a reactor run at the Nuclear Rocket Development Station, Nevada, is discussed in this paper. Measurements on this cloud, for a period of two days, are compared to calculations with the above numerical cloud diffusion model. In general, there is agreement. within a factor of two, for airborne concentrations, cloud horizontal area, surface air concentrations, and dry deposition as airborne concentration decreased by seven orders of magnitude during the two-day period. (author)

The effect of step thickness on the surface diffusion of a Pt adatom

International Nuclear Information System (INIS)

Yang, Jianyu; Deng, Yonghe; Xiao, Gang; Hu, Wangyu; Chen, Shuguang

2009-01-01

The diffusion of a single Pt adatom on the Pt(1 1 1) surface with {1 1 1}-faceted steps is studied using a combination of molecular dynamics and the nudged elastic band method. The interatomic interactions are described with the analytic embedded atom method. The simulation indicates that before diffusion across the descending step, the adatom becomes trapped at the step edge, and has to overcome an energy barrier to return the plane's center. The energy barrier for adatom migration to the step edge is almost independent of step thickness. In addition, the step thickness dependence of the diffusion energy barrier for the adatom over descending and ascending steps edge is obtained. For a monolayer step, the upward diffusion of the adatom to the {1 1 1}-faceted steps is very rare as compared with the downward diffusion. However, the probability of the adatom to ascend the {1 1 1}-faceted steps increases with increasing step thickness. The calculated character temperatures indicate the three-dimensional pyramidal island on the clean Pt(1 1 1) surface can be formed at higher temperature

Verification of the effect of surface preparation on Hot Isostatic Pressing diffusion bonding joints of CLAM steel

Energy Technology Data Exchange (ETDEWEB)

Zhao, Yanyun [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Li, Chunjing, E-mail: chunjing.li@fds.org.cn [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Huang, Bo; Liu, Shaojun [Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China); Huang, Qunying [University of Science and Technology of China, Hefei, Anhui 230027 (China); Institute of Nuclear Energy Safety Technology, Chinese Academy of Sciences, Hefei, Anhui 230031 (China)

2014-12-15

Hot Isostatic Pressing (HIP) diffusion bonding with CLAM steel is the primary candidate fabrication technique for the first wall (FW) of DFLL-TBM. Surface state is one of the key factors for the joints quality. The effect of surface state prepared with grinder and miller on HIP diffusion bonding joints of CLAM steel was investigated. HIP diffusion bonding was performed at 140 MPa and 1373 K within 3 h. The mechanical properties of the joints were investigated with instrumented Charpy V-notch impact tests and the microstructures of the joints were analyzed with scanning electron microscopy (SEM). The results showed that the milled samples with fine surface roughness were more suitable for CLAM steel HIP diffusion bonding.

Binding Preferences, Surface Attachment, Diffusivity, and Orientation of a Family 1 Carbohydrate-Binding Module on Cellulose

Energy Technology Data Exchange (ETDEWEB)

Nimlos, M. R.; Beckham, G. T.; Matthews, J. F.; Bu, L.; Himmel, M. E.; Crowley, M. F.

2012-06-08

Cellulase enzymes often contain carbohydrate-binding modules (CBMs) for binding to cellulose. The mechanisms by which CBMs recognize specific surfaces of cellulose and aid in deconstruction are essential to understand cellulase action. The Family 1 CBM from the Trichoderma reesei Family 7 cellobiohydrolase, Cel7A, is known to selectively bind to hydrophobic surfaces of native cellulose. It is most commonly suggested that three aromatic residues identify the planar binding face of this CBM, but several recent studies have challenged this hypothesis. Here, we use molecular simulation to study the CBM binding orientation and affinity on hydrophilic and hydrophobic cellulose surfaces. Roughly 43 {mu}s of molecular dynamics simulations were conducted, which enables statistically significant observations. We quantify the fractions of the CBMs that detach from crystal surfaces or diffuse to other surfaces, the diffusivity along the hydrophobic surface, and the overall orientation of the CBM on both hydrophobic and hydrophilic faces. The simulations demonstrate that there is a thermodynamic driving force for the Cel7A CBM to bind preferentially to the hydrophobic surface of cellulose relative to hydrophilic surfaces. In addition, the simulations demonstrate that the CBM can diffuse from hydrophilic surfaces to the hydrophobic surface, whereas the reverse transition is not observed. Lastly, our simulations suggest that the flat faces of Family 1 CBMs are the preferred binding surfaces. These results enhance our understanding of how Family 1 CBMs interact with and recognize specific cellulose surfaces and provide insights into the initial events of cellulase adsorption and diffusion on cellulose.

Centrifugal Compressor Surge Margin Improved With Diffuser Hub Surface Air Injection

Science.gov (United States)

Skoch, Gary J.

2002-01-01

Aerodynamic stability is an important parameter in the design of compressors for aircraft gas turbine engines. Compression system instabilities can cause compressor surge, which may lead to the loss of an aircraft. As a result, engine designers include a margin of safety between the operating line of the engine and the stability limit line of the compressor. The margin of safety is typically referred to as "surge margin." Achieving the highest possible level of surge margin while meeting design point performance objectives is the goal of the compressor designer. However, performance goals often must be compromised in order to achieve adequate levels of surge margin. Techniques to improve surge margin will permit more aggressive compressor designs. Centrifugal compressor surge margin improvement was demonstrated at the NASA Glenn Research Center by injecting air into the vaned diffuser of a 4:1-pressure-ratio centrifugal compressor. Tests were performed using injector nozzles located on the diffuser hub surface of a vane-island diffuser in the vaneless region between the impeller trailing edge and the diffuser-vane leading edge. The nozzle flow path and discharge shape were designed to produce an air stream that remained tangent to the hub surface as it traveled into the diffuser passage. Injector nozzles were located near the leading edge of 23 of the 24 diffuser vanes. One passage did not contain an injector so that instrumentation located in that passage would be preserved. Several orientations of the injected stream relative to the diffuser vane leading edge were tested over a range of injected flow rates. Only steady flow (nonpulsed) air injection was tested. At 100 percent of the design speed, a 15-percent improvement in the baseline surge margin was achieved with a nozzle orientation that produced a jet that was bisected by the diffuser vane leading edge. Other orientations also improved the baseline surge margin. Tests were conducted at speeds below the

Interaction dynamics of two diffusing particles: contact times and influence of nearby surfaces.

Science.gov (United States)

Tränkle, B; Ruh, D; Rohrbach, A

2016-03-14

Interactions of diffusing particles are governed by hydrodynamics on different length and timescales. The local hydrodynamics can be influenced substantially by simple interfaces. Here, we investigate the interaction dynamics of two micron-sized spheres close to plane interfaces to mimic more complex biological systems or microfluidic environments. Using scanned line optical tweezers and fast 3D interferometric particle tracking, we are able to track the motion of each bead with precisions of a few nanometers and at a rate of 10 kilohertz. From the recorded trajectories, all spatial and temporal information is accessible. This way, we measure diffusion coefficients for two coupling particles at varying distances h to one or two glass interfaces. We analyze their coupling strength and length by cross-correlation analysis relative to h and find a significant decrease in the coupling length when a second particle diffuses nearby. By analysing the times the particles are in close contact, we find that the influence of nearby surfaces and interaction potentials reduce the diffusivity strongly, although we found that the diffusivity hardly affects the contact times and the binding probability between the particles. All experimental results are compared to a theoretical model, which is based on the number of possible diffusion paths following the Catalan numbers and a diffusion probability, which is biased by the spheres' surface potential. The theoretical and experimental results agree very well and therefore enable a better understanding of hydrodynamically coupled interaction processes.

Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure

International Nuclear Information System (INIS)

Yang Jianyu; Hu Wangyu; Chen Shuguang

2010-01-01

Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {111} and {100} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {111} to neighboring {111} facet. Owing to the small barrier of adatom diffusion across the step edge between {111} and {100} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {100} microfacet and the Pt clusters can have only {111} facets in epitaxial growth.

Quantum Nuclear Extension of Electron Nuclear Dynamics on Folded Effective-Potential Surfaces

DEFF Research Database (Denmark)

Hall, B.; Deumens, E.; Ohrn, Y.

2014-01-01

A perennial problem in quantum scattering calculations is accurate theoretical treatment of low energy collisions. We propose a method of extracting a folded, nonadiabatic, effective potential energy surface from electron nuclear dynamics (END) trajectories; we then perform nuclear wave packet...

Growth and decay of surface voltage on silver diffused polyimide exposed to 3-15 keV electrons

Energy Technology Data Exchange (ETDEWEB)

Mahapatra, S K; Dhole, S D; Bhoraskar, V N [Department of Physics, University of Pune, Pune-411007 (India)

2007-02-21

During electron irradiation, the growth in the surface voltage on virgin and silver diffused polyimide sample was studied by varying electron energy from 3 to 15 keV and beam diameter from 3 to 15 mm. At a constant beam current, the surface voltage increased nonlinearly with electron energy but decreased slowly with beam diameter at fixed electron energy. At a surface voltage around saturation or beyond 3 kV, the electron beam was switched off and the decay in the surface voltage was studied for a period of 9 x 10{sup 4} s. The surface analysis revealed that the relative concentrations of carbon increased and that of the oxygen and the nitrogen decreased in the electron irradiated virgin and silver diffused polyimide sample, however in different proportions. Under the identical conditions of electron irradiation, the growth rate of the surface voltage, the post irradiated surface resistivity and the voltage decay constant of the silver diffused polyimide were lower than that of the virgin polyimide. The results of the present study reveal that the resistance of the silver diffused polyimide to keV electrons is higher than that of the virgin polyimide.

Extra metal adatom surface diffusion simulation on 1/3 ML Si(111) √3×√3 metal-induced surfaces

International Nuclear Information System (INIS)

Luniakov, Yu V

2013-01-01

A first-principle simulation of the surface diffusion of an extra metal (Me) adatom has been performed on the corresponding 1/3 monolayer (ML) Si(111) √3×√3 Me-induced surfaces. Using the nudged elastic band (NEB) optimization method, the minimum energy paths and the activation energy barrier profiles for all known Me-inducing √3×√3 reconstruction on an Si(111) surface at the 1/3 ML coverage have been obtained and compared with the available experimental data. The activation barrier is shown to depend on the atomic size of the diffusing adatom: the barrier has the highest value for the largest Me adatom, Pb (0.44 eV); lower values for the smaller Me adatoms, Sn (0.36 eV), In (0.22 eV) and Ga (0.13 eV); and the lowest value for the smallest Me adatom, Al (0.08 eV). The Arrhenius pre-exponential factors that were obtained in the harmonic approximation are as large as ∼10 11−13 Hz for all of the investigated surfaces, which supports the single-adatom diffusion model considered here. (paper)

Relation between acid back-diffusion and luminal surface hydrophobicity in canine gastric mucosa: Effects of salicylate and prostaglandin

International Nuclear Information System (INIS)

Goddard, P.J.

1989-01-01

The stomach is thought to be protected from luminal acid by a gastric mucosal barrier that restricts the diffusion of acid into tissue. This study tested the hypothesis that the hydrophobic luminal surface of canine gastric mucosa incubated in Ussing chambers, impedes the back-diffusion of luminal acid into the tissue. Isolated sheets of mucosa were treated with cimetidine to inhibit spontaneous acid secretion, and incubated under conditions that prevented significant secretion of luminal bicarbonate. By measuring acid loss from the luminal compartment using the pH-stat technique, acid back-diffusion was continuously monitored; potential difference (PD) was measured as an index of tissue viability. Tissue luminal surface hydrophobicity was estimated by contact angle analysis at the end of each experiment. Addition of 16,16-dimethyl prostaglandin E 2 to the nutrient compartment enhanced luminal surface hydrophobicity, but did not reduce acid back-diffusion in tissues that maintained a constant PD. 10 mM salicylate at pH 4.00 in the luminal compartment reduced surface hydrophobicity, but this decrease did not occur if 1 ug/ml prostaglandin was present in the nutrient solution. Despite possessing relatively hydrophilic and relatively hydrophobic surface properties, respectively, acid back-diffusion in the absence of salicylate was not significantly different between these two groups. Neither group maintained a PD after incubation with salicylate. Lastly, radiolabeled salicylate was used to calculate the free (non-salicylate associated) acid loss in tissues incubated with salicylate and/or prostaglandin. No significant correlation was found between free acid back-diffusion and luminal surface hydrophobicity. These data do not support the hypothesis that acid back-diffusion in impeded by the hydrophobic surface presented by isolated canine gastric mucosa

Diffusion Experiments in Opalinus Clay: Laboratory, Large-Scale Diffusion Experiments and Microscale Analysis by RBS.

Energy Technology Data Exchange (ETDEWEB)

Garcia-Gutierrez, M.; Alonso de los Rios, U.; Missana, T.; Cormenzana, J.L.; Mingarro, M.; Morejon, J.; Gil, P.

2008-08-06

The Opalinus Clay (OPA) formation in the Zurcher Weiland (Switzerland) is a potential host rock for a repository for high-level radioactive waste. Samples collected in the Mont Terri Underground Rock Laboratory (URL), where the OPA formation is located at a depth between -200 and -300 m below the surface, were used to study the radionuclide diffusion in clay materials. Classical laboratory essays and a novel experimental set-up for large-scale diffusion experiments were performed together to a novel application of the nuclear ion beam technique Rutherford Backscattering Spectrometry (RBS), to understand the transport properties of the OPA and to enhance the methodologies used for in situ diffusion experiments. Through-Diffusion and In-Diffusion conventional laboratory diffusion experiments were carried out with HTO, 36{sup C}l-, I-, 22{sup N}a, 75{sup S}e, 85{sup S}r, 233{sup U}, 137{sup C}s, 60{sup C}o and 152{sup E}u. Large-scale diffusion experiments were performed with HTO, 36{sup C}l, and 85{sup S}r, and new experiments with 60{sup C}o, 137{sup C}s and 152{sup E}u are ongoing. Diffusion experiments with RBS technique were done with Sr, Re, U and Eu. (Author) 38 refs.

'Thermal ghosts': apparent decay of fixed surfaces caused by heat diffusion

International Nuclear Information System (INIS)

Livadiotis, George

2007-01-01

The behaviour concerning classical heat diffusion on fixed thermal surfaces, studied by observations, still holds surprises. As soon as convective and radiative processes are negligible within the medium, this is considered to be free from energy sources and sinks. Then, the heat diffusion equation is conveniently solved using standard Fourier methods. Some considerations about the contrast effect suggest that the surface boundary would rather be observed to follow specific area decay dynamics than remaining fixed and static. Here it is shown that the apparent boundary lies on a specific isothermal spatiotemporal curve, which depends on the observing device. This is characterized by a slight, though determinative, difference between its radiance and that of the ambient background. Thereafter, the heat diffusion yields apparent boundary shrinkage with the passing of time. This phenomenon is particularly notable for two reasons: its lifetime and final decay rate depend only on the medium thermal properties, while being independent of the apparent boundary spatiotemporal curve. Thus, the former provides a suitable method for measuring the medium thermal properties via the observational data. The latter strongly reveal a kind of universality of some characteristic properties of the phenomenon, common to all observers

Mapping the Diffusion Potential of a Reconstructed Au(111) Surface at Nanometer Scale with 2D Molecular Gas

International Nuclear Information System (INIS)

Yan Shi-Chao; Xie Nan; Gong Hui-Qi; Guo Yang; Shan Xin-Yan; Lu Xing-Hua; Sun Qian

2012-01-01

The adsorption and diffusion behaviors of benzene molecules on an Au(111) surface are investigated by low-temperature scanning tunneling microscopy. A herringbone surface reconstruction of the Au(111) surface is imaged with atomic resolution, and significantly different behaviors are observed for benzene molecules adsorbed on step edges and terraces. The electric field induced modification in the molecular diffusion potential is revealed with a 2D molecular gas model, and a new method is developed to map the diffusion potential over the reconstructed Au(111) surface at the nanometer scale. (condensed matter: structure, mechanical and thermal properties)

Bulk-mediated surface diffusion: non-Markovian desorption and biased behaviour in an infinite system

International Nuclear Information System (INIS)

Revelli, Jorge A; Budde, Carlos E; Wio, Horacio S

2005-01-01

We analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework. We consider that the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption and its motion in the bulk are governed by Markovian dynamics, and include the effect of an external field in the form of a bias in the normal motion to the surface. We study this system for the diffusion of particles in a semi-infinite lattice, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The agreement between numerical and analytical asymptotic results is discussed

Diffusion and sorption properties of radionuclides in compacted bentonite

Energy Technology Data Exchange (ETDEWEB)

Yu Ji-Wei; Neretnieks, I. [Royal Inst. of Tech., Stockholm (Sweden). Dept. of Chemical Engineering and Technology

1997-07-01

In this report, recent studies on sorption and diffusion of radionuclides in compacted bentonite have been reviewed. The sorption distribution coefficient and diffusion coefficient data obtained from experiments in the literature have been compiled. Based on these experimental data and the report SKB-TR--91-16 (Brandberg and Skagius, 1991), this report proposes a set of sorption distribution coefficient and diffusion coefficient values for modelling purpose for safety analysis of nuclear waste repositories. The variability and uncertainty of the diffusivity data span somewhat more than an order or magnitude up and down. Most of the nuclides have an effective diffusivity in around 10{sup -10} m{sup 2}/s. Ion exclusion effects are observed for C, Cl and for Tc in oxidizing waters. Effective diffusivities are nearly tow orders of magnitude lower for these elements and of the order of 10{sup -12} m{sup 2}/s. Surface diffusion effects are found for Cs, Ni, Pa, Pb, Ra, Sn, Sr and Zr. Effective diffusivities for these elements are of the order of 10{sup -8} m{sup 2}/s. The surface diffusion effect should decrease in saline waters which is seen for Cs and Sr where there are data available. It is also deemed that Ra will have this effect because of its similarity with Sr. The other nuclides should also show this decrease but no data is available. Sorption and diffusion mechanisms in compacted bentonite are discussed in the report. In highly compacted bentonite, sorption and hence its distribution coefficient is not well defined, and a pore diffusion coefficient or a surface diffusion coefficient is not well defined either. Therefore, an apparent diffusion coefficient and a total concentration gradient should be more relevant in describing the diffusion process in compacted bentonite. 99 refs.

Effects of microwave electric fields on the translational diffusion of dipolar molecules in surface potential: A simulation study

Science.gov (United States)

Kapranov, Sergey V.; Kouzaev, Guennadi A.

2018-01-01

Variations of effective diffusion coefficient of polar molecules exposed to microwave electric fields in a surface potential are studied by solving coupled stochastic differential equations of motion with a deterministic component of the surface force. Being an essential tool for the simulation interpretation, a theoretical approach to effective diffusion in surface potential is first developed. The effective diffusion coefficient is represented as the product of the normal diffusion coefficient and potential-dependent correction function, whose temperature dependence is close to the Arrhenius form. The analytically found zero-diffusion condition defines the state of thermal equilibrium at the surface. The diffusion of a water-like dipole molecule in the potential of graphite surface is simulated in the field-free conditions and in the presence of the alternating electric fields of various magnitude intensities and frequencies. Temperature dependence of the correction function exhibits field-induced variations of the effective Lennard-Jones energy parameter. It demonstrates maximum departure from the zero-field value at certain frequencies and intensities, which is associated with variations in the rotational dynamics. A concept of the amplitude-frequency resonance put forward to interpret the simulation results is explained using a heuristic reasoning and is corroborated by semi-quantitative considerations in terms of the Dissado-Hill cluster theory of dielectric relaxation.

Ion-exchange equilibria and diffusion in engineered backfill

International Nuclear Information System (INIS)

Soudek, A.; Jahnke, F.M.; Radke, C.J.

1984-01-01

Engineered backfill can add confidence to confinement times of high-level nuclear waste stored in geologic media. This paper discusses the design and operation of a unique radial-flow diffusion cell to determine ion migration rates in backfill material under realistic repository conditions. New experimental results were reported for diffusion of CsCl in a background of NaCl into compacted bentonite and bentonite/quartz mixtures. Representation of the measured diffusion rates by the traditional, homogeneous porous-medium model significantly underestimates cesium penetration distances into the backfill. Surface diffusion is suggested as an additional mechanism by which cations transport in swollen montmorillonite; the surface diffusion coefficients for cesium is determined to be approximately 10 -7 cm 2 /s. An electrostatic site-binding model is developed for ion-exchange equilibria on montmorillonite clay. The effect of pH, ionic strength, and specific adsorption are evaluated and compared favorably to new, experimental exchange isotherms measured on disaggregated clay. The electrostatic site-binding model permits a prediction of the influence of backfill compaction on K/sub d/ values. We find that for strongly adsorbing cations, compactions has little effect. However, anions exhibit significant Donnan exclusion with clay compaction. 40 references, 12 figures

Fractional Diffusion Equations and Anomalous Diffusion

Science.gov (United States)

Evangelista, Luiz Roberto; Kaminski Lenzi, Ervin

2018-01-01

Preface; 1. Mathematical preliminaries; 2. A survey of the fractional calculus; 3. From normal to anomalous diffusion; 4. Fractional diffusion equations: elementary applications; 5. Fractional diffusion equations: surface effects; 6. Fractional nonlinear diffusion equation; 7. Anomalous diffusion: anisotropic case; 8. Fractional Schrödinger equations; 9. Anomalous diffusion and impedance spectroscopy; 10. The Poisson–Nernst–Planck anomalous (PNPA) models; References; Index.

Planarization of the diamond film surface by using the hydrogen plasma etching with carbon diffusion process

International Nuclear Information System (INIS)

Kim, Sung Hoon

2001-01-01

Planarization of the free-standing diamond film surface as smooth as possible could be obtained by using the hydrogen plasma etching with the diffusion of the carbon species into the metal alloy (Fe, Cr, Ni). For this process, we placed the free-standing diamond film between the metal alloy and the Mo substrate like a metal-diamond-molybdenum (MDM) sandwich. We set the sandwich-type MDM in a microwave-plasma-enhanced chemical vapor deposition (MPECVD) system. The sandwich-type MDM was heated over ca. 1000 .deg. C by using the hydrogen plasma. We call this process as the hydrogen plasma etching with carbon diffusion process. After etching the free-standing diamond film surface, we investigated surface roughness, morphologies, and the incorporated impurities on the etched diamond film surface. Finally, we suggest that the hydrogen plasma etching with carbon diffusion process is an adequate etching technique for the fabrication of the diamond film surface applicable to electronic devices

Gold Cluster Diffusion Kinetics on Stoichiometric and Reduced Surfaces of Rutile TiO ₂ (110)

Energy Technology Data Exchange (ETDEWEB)

Goldman, Nir; Browning, Nigel D.

2011-06-16

Gold clusters on rutile TiO₂ are known to serve as efficient oxidation catalysts for pollutants and environmental contaminants. However, the mechanism by which highly mobile small clusters migrate and aggregate into larger species relevant to gold’s catalytic activity remains unresolved. We report herein on ab initio simulations of the diffusion of atomic gold clusters up to the trimer on rutile TiO₂(110) surfaces. We show that, on the stoichiometric surface, both the dimer and the trimer can exhibit relatively low surface mobility due to high energetic barriers for diffusion out of their energetic minima coupled with low barriers for the reverse motion. On the reduced surface, these clusters can diffuse relatively quickly between energetic minima within the oxygen vacancy site due to the large degree of vibrational entropy in their transition states. Our computed diffusion times provide a point of comparison for future experiments and will aid in development of models of gold cluster island sintering.

Vertical eddy diffusion as a key mechanism for removing perfluorooctanoic acid (PFOA) from the global surface oceans

International Nuclear Information System (INIS)

Lohmann, Rainer; Jurado, Elena; Dijkstra, Henk A.; Dachs, Jordi

2013-01-01

Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole cause for the transport of PFOA to depth. The global oceanic sink due to eddy diffusion for PFOA is high, with accumulated removal fluxes over the last 40 years of 660 t, with the Atlantic Ocean accounting for 70% of the global oceanic sink. The global oceans have removed 13% of all PFOA produced to a depth greater than 100 m via vertical eddy diffusion; an additional 4% has been removed via deep water formation. The top 100 m of the surface oceans store another 21% of all PFOA produced (∼1100 t). Highlights: •Eddy diffusion has removed ∼660 t of PFOA from surface oceans over the last 40 years. •Atlantic Ocean accounts for 70% of the global oceanic sink of PFOA. •Vertical eddy diffusion has moved ∼13% of PFOA to oceans deeper than 100 m. •Around 4% of PFOA has been removed via deep water formation. •The top 100 m of global oceans contain ∼21% of historical PFOA production. -- Vertical eddy diffusion is an important removal process for hydrophilic organic pollutants such as PFOA from the surface ocean

Novel exchange mechanisms in the surface diffusion of oxides

International Nuclear Information System (INIS)

Harris, Duncan J; Lavrentiev, Mikhail Yu; Harding, John H; Allan, Neil L; Purton, John A

2004-01-01

We use temperature-accelerated dynamics to show the importance of exchange mechanisms in surface diffusion and growth of simple oxides. Such mechanisms can dominate transport processes both on terraces and steps for both homoepitaxial and heteroepitaxial growth. We suggest that the mixing inevitable when an exchange mechanism is present must be considered when attempts are made to grow sharp interfaces in oxide nanostructures. (letter to the editor)

Nuclear spin relaxation by translational diffusion in solids

International Nuclear Information System (INIS)

Barton, W.A.; Sholl, C.A.

1978-01-01

The theory of nuclear spin relaxation by translational diffusion in solids developed in previous papers is applied to two-spin systems and third-nearest-neighbour jump models in FCC crystals. The two-spin systems describe the dipole-dipole interactions between stationary host spins and spins migrating amongst either the tetrahedral or the octahedral interstitial sites. The tetrahedral sites in a FCC crystal form a SC lattice and two models, the symmetric and asymmetric jump models, are considered for third-nearest-neighbour jumps on this lattice. Numerical results for the correlation function relevant for single crystals and polycrystals are presented over the entire temperature range. It is found that the simpler, but unphysical, symmetric jump model is a good approximation to the more complicated asymmetric jump model. (author)

The breathing mode and the nuclear surface

International Nuclear Information System (INIS)

Blaizot, J.P.; Grammaticos, B.

1981-01-01

The role of nuclear surface in the breathing mode of nuclei is analyzed. We discuss a simple model in which the density varies according to a scaling of the coordinates. We show that this model reproduces accurately the results of microscopic calculations in heavy nuclei, and we use it to estimate the contribution of the surface to the effective compression modulus of semi-infinite nuclear matter. The calculation is performed in the framework of an extended Thomas-Fermi approximation and using several effective interactions. It is shown that the surface energy is maximum with respect to variations of the density around saturation density. The reduction of the effective compression modulus due to the surface turns to be proportional to the bulk compression modulus. The magnitude of the effect is compared with results of RPA calculations. Other contributions to the effective compressions modulus of finite nuclei are also discussed. (orig.)

Study of self-diffusion of Fe in nanocrystalline FeNZr alloys using nuclear resonance reflectivity from isotopic multilayers

International Nuclear Information System (INIS)

Gupta, Ajay; Chakravarty, Sajoy; Gupta, Mukul; Horisberger, M.; Rueffer, Rudolf; Wille, Hans-Christian; Leupold, Olaf

2005-01-01

It is demonstrated that nuclear resonance reflectivity from isotopic multilayers can be used to do accurate measurements of self diffusion of iron in thin film samples. Diffusion lengths down to ∼ 1A 0 can be measured. The technique has been used to measure the self-diffusion of iron in FeNZr nanocrystalline alloys. The activation energy for self-diffusion of iron is found to be 0.8% ± 0.01 eV while the pre-exponential factor is 3.54 x 10 13 m 2 /s. (author)

The mutual diffusion coefficient for (meth)acrylate monomers as determined with a nuclear microprobe

International Nuclear Information System (INIS)

Leewis, Christian M.; Mutsaers, Peter H.A.; Jong, Arthur M. de; Ijzendoorn, Leo J. van; Voigt, Martien J.A. de; Ren, Min Q.; Watt, Frank; Broer, Dirk J.

2004-01-01

The value of the mutual diffusion coefficient D V of two acrylic monomers is determined with nuclear microprobe measurements on a set of polymer films. These films have been prepared by allowing the monomers to diffuse into each other for a certain time and subsequently applying fast ultraviolet photo-polymerization, which freezes the concentration profile. The monomer diffusion profiles are studied with a scanning 2.1 MeV proton microprobe. Each monomer contains a marker element, e.g., Cl and Si, which are easily detected with proton induced x-ray emission. From the diffusion profiles, it is possible to determine the mutual diffusion coefficient. The mutual diffusion coefficient is dependent of concentration, which is concluded from the asymmetry in the Cl- and Si-profiles. A linear dependence of the mutual diffusion coefficient on the composition is used as a first order approximation. The best fits are obtained for a value of b=(0.38±0.15), which is the ratio of the diffusion coefficient of 1,3-bis(3-methacryloxypropyl)-1, 1,3,3-tetramethyldisiloxane in pure 2-chloroethyl acrylate and the diffusion coefficient of 2-chloroethyl acrylate in pure 1,3-bis(3-methacryloxypropyl)-1,1,3,3-tetramethyldisiloxane. Under the assumption of a linear dependence of the mutual diffusion coefficient D V on monomer composition, it follows that D V =(2.9±0.6)·10 -10 m 2 /s at a 1:1 monomer ratio. With Flory-Huggins expressions for the monomer chemical potentials, one can derive approximate values for the individual monomer diffusion coefficients

II. Inhibited Diffusion Driven Surface Transmutations

Science.gov (United States)

Chubb, Talbot A.

2006-02-01

This paper is the second of a set of three papers dealing with the role of coherent partitioning as a common element in Low Energy Nuclear Reactions (LENR), by which is meant cold-fusion related processes. This paper discusses the first step in a sequence of four steps that seem to be necessary to explain Iwamura 2-α-addition surface transmutations. Three concepts are examined: salt-metal interface states, sequential tunneling that transitions D+ ions from localized interstitial to Bloch form, and the general applicability of 2-dimensional vs. 3-dimensional symmetry hosting networks.

II. Inhibited diffusion driven surface transmutations

International Nuclear Information System (INIS)

Cubb, Talbot A.

2006-01-01

This paper is the second of a set of three papers dealing with the role of coherent partitioning as a common element in Low Energy Nuclear Reactions (LENR), by which is meant cold-fusion related processes. This paper discusses the first step in a sequence of four steps that seem to be necessary to explain lwamura 2-α-addition surface transmutations. Three concepts are examined: salt metal interface states, sequential tunneling that transitions D + ions from localized interstitial to Bloch form, and the general applicability of 2-dimensional vs. 3-dimensional symmetry hosting networks. (author)

A study on the ocean circulation and thermal diffusion near a nuclear power plant

International Nuclear Information System (INIS)

Shu, Kyung Suk; Han, Moon Hee; Kim, Eun Han; Hwang, Won Tae

1994-08-01

The thermal discharge used with cooling water at nuclear power plant is released to a neighbour sea and it is influenced on marine environment. The thermal discharge released from power plant is mainly transported and diffused by ocean circulation of neighbour sea. So the evaluation for characteristics of ocean circulation around neighbour sea is firstly performed. The purpose of this research is primarily analyzed the thermal diffusion in sea around Yongkwang nuclear power plant. For this viewpoint, fundamental oceanographic data sets are collected and analyzed in Yellow sea, west sea of Korea, sea around Yongkwang. The ocean circulation and the effects of temperature increase by thermal discharge are evaluated using these data. The characteristics of tide is interpreted by the analysis of observed tidal elevation and tidal currents. The characteristics of temperature and salinity is investigated by the long-term observation of Korea Fisheries Research and Development Agency and the short-term observation around Yongkwang. (Author)

Comparison of diffusion charging and mobility-based methods for measurement of aerosol agglomerate surface area.

Science.gov (United States)

Ku, Bon Ki; Kulkarni, Pramod

2012-05-01

We compare different approaches to measure surface area of aerosol agglomerates. The objective was to compare field methods, such as mobility and diffusion charging based approaches, with laboratory approach, such as Brunauer, Emmett, Teller (BET) method used for bulk powder samples. To allow intercomparison of various surface area measurements, we defined 'geometric surface area' of agglomerates (assuming agglomerates are made up of ideal spheres), and compared various surface area measurements to the geometric surface area. Four different approaches for measuring surface area of agglomerate particles in the size range of 60-350 nm were compared using (i) diffusion charging-based sensors from three different manufacturers, (ii) mobility diameter of an agglomerate, (iii) mobility diameter of an agglomerate assuming a linear chain morphology with uniform primary particle size, and (iv) surface area estimation based on tandem mobility-mass measurement and microscopy. Our results indicate that the tandem mobility-mass measurement, which can be applied directly to airborne particles unlike the BET method, agrees well with the BET method. It was also shown that the three diffusion charging-based surface area measurements of silver agglomerates were similar within a factor of 2 and were lower than those obtained from the tandem mobility-mass and microscopy method by a factor of 3-10 in the size range studied. Surface area estimated using the mobility diameter depended on the structure or morphology of the agglomerate with significant underestimation at high fractal dimensions approaching 3.

Nuclear criticality safety aspects of gaseous uranium hexafluoride (UF6) in the diffusion cascade

International Nuclear Information System (INIS)

Huffer, J.E.

1997-04-01

This paper determines the nuclear safety of gaseous UF 6 in the current Gaseous Diffusion Cascade and auxiliary systems. The actual plant safety system settings for pressure trip points are used to determine the maximum amount of HF moderation in the process gas, as well as the corresponding atomic number densities. These inputs are used in KENO V.a criticality safety models which are sized to the actual plant equipment. The ENO V.a calculation results confirm nuclear safety of gaseous UF 6 in plant operations

Nuclear relaxation induced by diffusion in confined media; the case of inverted micelles

International Nuclear Information System (INIS)

Llor, Antoine

1983-01-01

This work emphasizes the specificities of molecular motions in restricted media observed by NMR. The observation of proton nuclear relaxation of small water pools in AOT reversed micelles has led to separation of dipolar contributions using substitution by deuterium. The water-water contributions to relaxation are easily explained by well-known models and show that water rotational movements are, at most, five times slower than in pure water. The other contributions display a strong frequency dependence with spectrometer frequency and, in order to explain them, a specific dipolar relaxation model was developed between two particles whose movements are restricted to the surface of a sphere and in a concentric sphere respectively. This model was generalized to all cases of diffusion movements of particles in a spherical symmetry environment. In the case of AOT micelles, this model can not explain the experimental results. An elementary discussion taking into account the polar heads specificities and their interactions with water lead to a qualitative interpretation of the experimental data. (author) [fr

Speckle noise reduction for computer generated holograms of objects with diffuse surfaces

Science.gov (United States)

Symeonidou, Athanasia; Blinder, David; Ahar, Ayyoub; Schretter, Colas; Munteanu, Adrian; Schelkens, Peter

2016-04-01

Digital holography is mainly used today for metrology and microscopic imaging and is emerging as an important potential technology for future holographic television. To generate the holographic content, computer-generated holography (CGH) techniques convert geometric descriptions of a 3D scene content. To model different surface types, an accurate model of light propagation has to be considered, including for example, specular and diffuse reflection. In previous work, we proposed a fast CGH method for point cloud data using multiple wavefront recording planes, look-up tables (LUTs) and occlusion processing. This work extends our method to account for diffuse reflections, enabling rendering of deep 3D scenes in high resolution with wide viewing angle support. This is achieved by modifying the spectral response of the light propagation kernels contained by the look-up tables. However, holograms encoding diffuse reflective surfaces depict significant amounts of speckle noise, a problem inherent to holography. Hence, techniques to improve the reduce speckle noise are evaluated in this paper. Moreover, we propose as well a technique to suppress the aperture diffraction during numerical, viewdependent rendering by apodizing the hologram. Results are compared visually and in terms of their respective computational efficiency. The experiments show that by modelling diffuse reflection in the LUTs, a more realistic yet computationally efficient framework for generating high-resolution CGH is achieved.

Effect of Aging and Surface Interactions on the Diffusion of Endogenous Compounds in Latent Fingerprints Studied by Mass Spectrometry Imaging.

Science.gov (United States)

O'Neill, Kelly C; Lee, Young Jin

2018-05-01

The ability to determine the age of fingerprints would be immeasurably beneficial in criminal investigations. We explore the possibility of determining the age of fingerprints by analyzing various compounds as they diffuse from the ridges to the valleys of fingerprints using matrix-assisted laser desorption/ionization mass spectrometry imaging. The diffusion of two classes of endogenous fingerprint compounds, fatty acids and triacylglycerols (TGs), was studied in fresh and aged fingerprints on four surfaces. We expected higher molecular weight TGs would diffuse slower than fatty acids and allow us to determine the age of older fingerprints. However, we found interactions between endogenous compounds and the surface have a much stronger impact on diffusion than molecular weight. For example, diffusion of TGs is faster on hydrophilic plain glass or partially hydrophilic stainless steel surfaces, than on a hydrophobic Rain-x treated surface. This result further complicates utilizing a diffusion model to age fingerprints. © 2017 American Academy of Forensic Sciences.

Dynamical chaos and induced nuclear fission

Energy Technology Data Exchange (ETDEWEB)

Bolotin, Yu L; Krivoshej, I V

1985-01-01

It is shown that the exponential instability of trajectories, which arises at negative curvature of the potential energy surface, leads to diffusion of the image point through the barrier and determines real time delays in induced nuclear fission.

Cleaning of diffusion bonding surface by argon ion bombardment treatment

International Nuclear Information System (INIS)

Wang, Airu; Ohashi, Osamu; Yamaguchi, Norio; Aoki, Masanori; Higashi, Yasuo; Hitomi, Nobuteru

2003-01-01

The specimens of oxygen-free high conductivity copper, SUS304L stainless steel and pure iron were treated by argon ion bombardment and then were bonded by diffusion bonding method. The effects of argon ion bombardment treatment on faying surface morphology, tensile strength of bonding joints and inclusions at the fracture surface were investigated. The results showed that argon ion bombardment treatment was effective to remove the oxide film and contamination at the faying surface and improve the quality of joints. The tensile strength of the bonded joints was improved, and minimum bonding temperature to make the metallic bonding at the interface was lowered by argon ion bombardment treatment. At the joints with argon ion bombardment treatment, ductile fractured surface was seen and the amount of inclusions was obviously decreased

Nuclear criticality safety evaluation of Spray Booth Operations in X-705, Portsmouth Gaseous Diffusion Plant

International Nuclear Information System (INIS)

Sheaffer, M.K.; Keeton, S.C.

1993-01-01

This report evaluates nuclear criticality safety for Spray Booth Operations in the Decontamination and Recovery Facility, X-705, at the Portsmouth Gaseous Diffusion Plant. A general description of current procedures and related hardware/equipment is presented. Control parameters relevant to nuclear criticality safety are explained, and a consolidated listing of administrative controls and safety systems is developed. Based on compliance with DOE Orders and MMES practices, the overall operation is evaluated, and recommendations for enhanced safety are suggested

Effects of angular dependence of surface diffuseness in deformed nuclei on Coulomb barrier

International Nuclear Information System (INIS)

Adamian, G.G.; Antonenko, N.V.; Malov, L.A.; Scamps, G.; Lacroix, D.

2014-01-01

The angular dependence of surface diffuseness is further discussed. The results of self-consistent calculations are compared with those obtained with the phenomenological mean-field potential. The rather simple parametrizations are suggested. The effects of surface polarization and hexadecapole deformation on the height of the Coulomb barrier are revealed. (authors)

Surface self-diffusion of adatom on Pt cluster with truncated octahedron structure

Energy Technology Data Exchange (ETDEWEB)

Yang Jianyu, E-mail: wuliyangjianyu@yahoo.com.c [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China); Hu Wangyu, E-mail: wangyuhu2001@yahoo.com.c [Department of Applied Physics, Hunan University, Changsha 410082 (China); Chen Shuguang [Department of Applied Physics, Hunan University, Changsha 410082 (China)

2010-05-03

Surface diffusion of single Pt adatom on Pt cluster with truncated octahedron structure is investigated through a combination of molecular dynamics and nudged elastic band method. Using an embedded atom method to describe the atomic interactions, the minimum energy paths are determined and the energy barriers for adatom diffusion across and along step are evaluated. The diffusion of adatom crossing step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets has a surprisingly low barrier of 0.03 eV, which is 0.12 eV lower than the barrier for adatom diffusion from {l_brace}111{r_brace} to neighboring {l_brace}111{r_brace} facet. Owing to the small barrier of adatom diffusion across the step edge between {l_brace}111{r_brace} and {l_brace}100{r_brace} facets, the diffusion of adatom along the step edge cannot occur. The molecular dynamics simulations at low temperatures also support these results. Our results show that mass transport will prefer step with {l_brace}100{r_brace} microfacet and the Pt clusters can have only {l_brace}111{r_brace} facets in epitaxial growth.

Non-Contact Measurement of Thermal Diffusivity in Ion-Implanted Nuclear Materials

Science.gov (United States)

Hofmann, F.; Mason, D. R.; Eliason, J. K.; Maznev, A. A.; Nelson, K. A.; Dudarev, S. L.

2015-11-01

Knowledge of mechanical and physical property evolution due to irradiation damage is essential for the development of future fission and fusion reactors. Ion-irradiation provides an excellent proxy for studying irradiation damage, allowing high damage doses without sample activation. Limited ion-penetration-depth means that only few-micron-thick damaged layers are produced. Substantial effort has been devoted to probing the mechanical properties of these thin implanted layers. Yet, whilst key to reactor design, their thermal transport properties remain largely unexplored due to a lack of suitable measurement techniques. Here we demonstrate non-contact thermal diffusivity measurements in ion-implanted tungsten for nuclear fusion armour. Alloying with transmutation elements and the interaction of retained gas with implantation-induced defects both lead to dramatic reductions in thermal diffusivity. These changes are well captured by our modelling approaches. Our observations have important implications for the design of future fusion power plants.

Non-Contact Measurement of Thermal Diffusivity in Ion-Implanted Nuclear Materials

International Nuclear Information System (INIS)

Hofmann, F.; Mason, D. R.; Eliason, J. K.; Maznev, A. A.; Nelson, K. A.; Dudarev, S. L.

2015-01-01

Knowledge of mechanical and physical property evolution due to irradiation damage is essential for the development of future fission and fusion reactors. Ion-irradiation provides an excellent proxy for studying irradiation damage, allowing high damage doses without sample activation. Limited ion-penetration-depth means that only few-micron-thick damaged layers are produced. Substantial effort has been devoted to probing the mechanical properties of these thin implanted layers. Yet, whilst key to reactor design, their thermal transport properties remain largely unexplored due to a lack of suitable measurement techniques. Here we demonstrate non-contact thermal diffusivity measurements in ion-implanted tungsten for nuclear fusion armour. Alloying with transmutation elements and the interaction of retained gas with implantation-induced defects both lead to dramatic reductions in thermal diffusivity. These changes are well captured by our modelling approaches. Our observations have important implications for the design of future fusion power plants

Potential Energy Surface of NO on Pt(997: Adsorbed States and Surface Diffusion

Directory of Open Access Journals (Sweden)

N. Tsukahara

2012-01-01

Full Text Available The potential energy surface (PES of NO on Pt(997 has been elucidated: the adsorption states and diffusion processes of NO on Pt(997 at low coverage were investigated by using infrared reflection absorption spectroscopy (IRAS and scanning tunneling microscopy (STM. When NO molecules adsorb on a surface at a low temperature (11 K, each molecule transiently migrates on the surface from the first impact point to a possible adsorption site. We found that there are four stable adsorption sites for NO on Pt(997: a bridge site of the upper step, an fcc- (or hcp- hollow site of the terrace, an on-top site of the terrace, and an fcc-hollow site of the lower step. At higher temperatures above 45 K, NO molecules start to migrate thermally to more stable adsorption sites on a terrace, and they are finally trapped at the bridge sites of the step, which are the most stable among the four sites.

II. Inhibited diffusion driven surface transmutations

Energy Technology Data Exchange (ETDEWEB)

Cubb, Talbot A. [Greenwich Corp., 5023 N. 38th St., Arlington, VA 22207 (United States)

2006-07-01

This paper is the second of a set of three papers dealing with the role of coherent partitioning as a common element in Low Energy Nuclear Reactions (LENR), by which is meant cold-fusion related processes. This paper discusses the first step in a sequence of four steps that seem to be necessary to explain lwamura 2-{alpha}-addition surface transmutations. Three concepts are examined: salt metal interface states, sequential tunneling that transitions D{sup +} ions from localized interstitial to Bloch form, and the general applicability of 2-dimensional vs. 3-dimensional symmetry hosting networks. (author)

First-principles study on the interaction of nitrogen atom with α–uranium: From surface adsorption to bulk diffusion

International Nuclear Information System (INIS)

Su, Qiulei; Deng, Huiqiu; Xiao, Shifang; Li, Xiaofan; Hu, Wangyu; Ao, Bingyun; Chen, Piheng

2014-01-01

Experimental studies of nitriding on uranium surfaces show that the modified layers provide considerable protection against air corrosion. The bimodal distribution of nitrogen is affected by both its implantation and diffusion, and the diffusion of nitrogen during implantation is also governed by vacancy trapping. In the present paper, nitrogen adsorption, absorption, diffusion, and vacancy trapping on the surface of and in the bulk of α–uranium are studied with a first-principles density functional theory approach and the climbing image nudged elastic band method. The calculated results indicate that, regardless of the nitrogen coverage, a nitrogen atom prefers to reside at the hollow1 site and octahedral (Oct) site on and below the surface, respectively. The lowest energy barriers for on-surface and penetration diffusion occur at a coverage of 1/2 monolayer. A nitrogen atom prefers to occupy the Oct site in bulk α–uranium. High energy barriers are observed during the diffusion between neighboring Oct sites. A vacancy can capture its nearby interstitial nitrogen atom with a low energy barrier, providing a significant attractive nitrogen-vacancy interaction at the trapping center site. This study provides a reference for understanding the nitriding process on uranium surfaces

Self-diffusion on copper surfaces

DEFF Research Database (Denmark)

Hansen, L.; Stoltze, Per; Jacobsen, Karsten Wedel

1991-01-01

The diffusion paths and activation energies of a Cu adatom on Cu(100), Cu(111), and Cu(110) are studied using the effective-medium theory to calculate the energetics. For the (100) and (110) faces, diffusion via an exchange mechanism is found to be important. The transition state for these paths ...

Effect of Surface Diffusion on Transfer Processes in Heterogeneous Systems

Czech Academy of Sciences Publication Activity Database

Levdansky, V.V.; Smolík, Jiří; Moravec, Pavel

2008-01-01

Roč. 51, 9-10 (2008), s. 2471-2481 ISSN 0017-9310 R&D Projects: GA ČR GA101/05/2214; GA ČR(CZ) GA101/05/2524; GA ČR GA104/07/1093 Institutional research plan: CEZ:AV0Z40720504 Keywords : adsorption * gas flow * surface diffusion Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.894, year: 2008

Non-rigid registration of breast surfaces using the laplace and diffusion equations

Directory of Open Access Journals (Sweden)

Ou Jao J

2010-02-01

Full Text Available Abstract A semi-automated, non-rigid breast surface registration method is presented that involves solving the Laplace or diffusion equations over undeformed and deformed breast surfaces. The resulting potential energy fields and isocontours are used to establish surface correspondence. This novel surface-based method, which does not require intensity images, anatomical landmarks, or fiducials, is compared to a gold standard of thin-plate spline (TPS interpolation. Realistic finite element simulations of breast compression and further testing against a tissue-mimicking phantom demonstrate that this method is capable of registering surfaces experiencing 6 - 36 mm compression to within a mean error of 0.5 - 5.7 mm.

Computer simulation of nuclear pollutant diffusion from Shimane nuclear power plants and development of an evacuation strategy in the event of a nuclear incident

International Nuclear Information System (INIS)

Yakura, Haruna; Kurimasa, Akihiro

2012-01-01

Beginning from Tohoku (northeastern) Earthquake on March 11, an accident at the Fukushima Dai-ichi Nuclear Power Plant resulted in a substantial release of radioactivity to the environment. The accident forced a large number of residents to evacuate from surrounding areas. Moreover, the nuclear incident was life-threatening for the elderly and for people with serious illnesses who were confined in hospital or nursing homes. Strikingly, the causes of death were not directly attributed to radiation exposure but to problems encountered during evacuation. Using nuclear diffusion data from the Fukushima incident, we simulated nuclear pollutant dispersion using computer software A2C in an area of Tottori and Shimane Prefectures surrounding the Shimane Nuclear Power Plant. We generated a model for the spread of nuclear pollutants around the Emergency Planning Zone, id est (i.e.) EPZ. From these findings, we proposed evacuation strategies for residents near the power plant to ensure a safe and reliable escape from nuclear pollutants. Our recommendations include: immediate evacuation from PAZ area (within 5 km), securing indoor shelter in the area of the UPZ (from 5 km to 30 km) and preparations to evacuate further outwards from the nuclear plant site, daytime evacuation within a 30 km area after considering wind direction and velocity, and preparation of a planned evacuation strategy that identifies secure facilities for weaker people in the event of a disaster. (author)

Free surface modelling with two-fluid model and reduced numerical diffusion of the interface

International Nuclear Information System (INIS)

Strubelj, Luka; Tiselj, Izrok

2008-01-01

Full text of publication follows: The free surface flows are successfully modelled with one of existing free surface models, such as: level set method, volume of fluid method (with/without surface reconstruction), front tracking, two-fluid model (two momentum equations) with modified interphase force and others. The main disadvantage of two-fluid model used for simulations of free surface flows is numerical diffusion of the interface, which can be significantly reduced using the method presented in this paper. Several techniques for reduction of numerical diffusion of the interface have been implemented in the volume of fluid model and are based on modified numerical schemes for advection of volume fraction near the interface. The same approach could be used also for two-fluid method, but according to our experience more successful reduction of numerical diffusion of the interface can be achieved with conservative level set method. Within the conservative level set method, continuity equation for volume fraction is solved and after that the numerical diffusion of the interface is reduced in such a way that the thickness of the interface is kept constant during the simulation. Reduction of the interface diffusion can be also called interface sharpening. In present paper the two-fluid model with interface sharpening is validated on Rayleigh-Taylor instability. Under assumptions of isothermal and incompressible flow of two immiscible fluids, we simulated a system with the fluid of higher density located above the fluid of smaller density in two dimensions. Due to gravity in the system, fluid with higher density moves below the fluid with smaller density. Initial condition is not a flat interface between the fluids, but a sine wave with small amplitude, which develops into a mushroom-like structure. Mushroom-like structure in simulation of Rayleigh-Taylor instability later develops to small droplets as result of numerical dispersion of interface (interface sharpening

Living on the edge : STM studies of the creation, diffusion and annihilation of surface vacancies

NARCIS (Netherlands)

Schoots, Koen

2007-01-01

This thesis describes an STM study of the creation, diffusion and annihilation of missing atoms, so-called surface vacancies, in the Cu(100) surface. Because of the extremely high mobility of surface vacancies in combination with their extremely low density, we have been forced to use tracer

A model for diffuse and global irradiation on horizontal surface

International Nuclear Information System (INIS)

Jain, P.C.

1984-01-01

The intensity of the direct radiation and the diffuse radiation at any time on a horizontal surface are each expressed as fractions of the intensity of the extraterrestrial radiation. Using these and assuming a random distribution of the bright sunshine hours and not too wide variations in the values of the transmission coefficients, a number of relations for estimating the global and the diffuse irradiation are derived. Two of the relations derived are already known empirically. The formulation lends more confidence in the use of the already empirically known relations providing them a theoretical basis, and affords more flexibility to the estimation techniques by supplying new equations. The study identifies three independent basic parameters and the constants appearing in the various equations as simple functions of these three basic parameters. Experimental data for the diffuse irradiation, the global irradiation and the bright sunshine duration for Macerata (Italy), Salisbury and Bulawayo (Zimbabwe) is found to show good correlation for the linear equations, and the nature and the interrelationships of the constants are found to be as predicted by the theory

Objective and Subjective Evaluation of Reflecting and Diffusing Surfaces in Auditoria

Science.gov (United States)

Cox, Trevor John

Available from UMI in association with The British Library. Requires signed TDF. The performance of reflectors and diffusers used in auditoria have been evaluated both objectively and subjectively. Two accurate systems have been developed to measure the scattering from surfaces via the cross correlation function. These have been used to measure the scattering from plane panels, curved panels and quadratic residue diffusers (QRDs). The scattering measurements have been used to test theoretical prediction methods based on the Helmholtz-Kirchhoff integral equation. Accurate prediction methods were found for all surfaces tested. The limitations of the more approximate methods have been defined. The assumptions behind Schroeder's design of the QRD have been tested and the local reacting admittance assumption found to be valid over a wide frequency range. It was found that the QRD only produces uniform scattering at low frequencies. For an on-axis source the scattering from a curved panel was as good as from a QRD. For an oblique source the QRD produced much more uniform scattering than the curved panel. The subjective measurements evaluated the smallest perceivable change in the early sound field, the part most influenced by reflectors and diffusers. A natural sounding simulation of a concert hall field within an anechoic chamber was used. Standard objective parameters were reasonable values when compared to values found in real halls and subjective preference measurements. A difference limen was measured for early lateral energy fraction (.048 +/-.005); inter aural cross correlation (.075 +/-.008); clarity index (.67 +/-.13 dB); and centre time (8.6 +/- 1.6 ms). It was found that: (i) when changes are made to diffusers and reflectors, changes in spatial impression will usually be larger than those in clarity; and (ii) acousticians can gain most by paying attention to lateral sound in auditoria. It was also found that: (i) diffuse reflections in the early sound field

Effects of quenched impurities on surface diffusion, spreading, and ordering of O/W(110)

DEFF Research Database (Denmark)

Nikunen, P.; Vattulainen, Ilpo Tapio; Ala-Nissila, T.

2002-01-01

We study how quenched impurities affect the surface diffusion and ordering of strongly interacting adsorbate atoms on surfaces. To this end, we carry out Monte Carlo simulations for a lattice-gas model of O/W(110), including small concentrations of immobile impurities which block their adsorption...

SURFACE SYMMETRY ENERGY OF NUCLEAR ENERGY DENSITY FUNCTIONALS

Energy Technology Data Exchange (ETDEWEB)

Nikolov, N; Schunck, N; Nazarewicz, W; Bender, M; Pei, J

2010-12-20

We study the bulk deformation properties of the Skyrme nuclear energy density functionals. Following simple arguments based on the leptodermous expansion and liquid drop model, we apply the nuclear density functional theory to assess the role of the surface symmetry energy in nuclei. To this end, we validate the commonly used functional parametrizations against the data on excitation energies of superdeformed band-heads in Hg and Pb isotopes, and fission isomers in actinide nuclei. After subtracting shell effects, the results of our self-consistent calculations are consistent with macroscopic arguments and indicate that experimental data on strongly deformed configurations in neutron-rich nuclei are essential for optimizing future nuclear energy density functionals. The resulting survey provides a useful benchmark for further theoretical improvements. Unlike in nuclei close to the stability valley, whose macroscopic deformability hangs on the balance of surface and Coulomb terms, the deformability of neutron-rich nuclei strongly depends on the surface-symmetry energy; hence, its proper determination is crucial for the stability of deformed phases of the neutron-rich matter and description of fission rates for r-process nucleosynthesis.

Experimental Methods and Development of Models on Diffusion of Nuclides onto Rocks

International Nuclear Information System (INIS)

Park, Chung-Kyun; Lee, Jae-Kwang; Baik, Min-Hoon

2007-01-01

In the context of nuclear waste repositories, the rock matrix can act as a barrier against radionuclide migration and matrix diffusion can be an important mechanism for delaying the arrival times to the biosphere. It takes a growing interest whether matrix diffusion is an important retarding and dispersing transport mechanism for solutes carried by groundwater in fractured porous media. It can retard solutes by spreading them from the flowing groundwater into the diluting reservoir of the interconnected pore space of the rock matrix, and providing an increased surface for sorption processes. Diffusion experiments has been carried in crystalline rocks to determine the diffusivities of some radionuclides either by through-diffusion cells or in-diffusion setups. We'd like to compare the experimental methods and their functions according to sorption properties of species

Cesium diffusion in Bure mud-rock: effect of cesium sorption and of the surface structure of the clay

International Nuclear Information System (INIS)

Melkior, T.; Motellier, S.; Yahiaoui, S.

2005-01-01

Full text of publication follows: This work is devoted to cesium diffusion through mud-rock samples from Bure (Meuse/Haute- Marne, France). This rock is mainly composed of interstratified illite/smectite, quartz and calcite. According to published data, positively charged solutes exhibit high diffusion coefficients in argillaceous media compared to neutral species. This effect was actually observed for cesium in Bure mud-rock samples: the effective diffusion coefficients (De) of tritiated water and cesium were found to be ca. 2 x 10 -11 m 2 s -1 and 2.5 x 10 -10 m 2 s -1 , respectively. Some authors assign this 'enhanced diffusion' of cations to the particular migration of ions within the electrical double layer, next to mineral surfaces (surface diffusion mechanism). To assess the role of sorbed ions in the diffusive transfer, cesium diffusion coefficients in Bure mud-rock were measured at different cesium concentrations. The distribution coefficient of cesium onto Bure mud-rock was measured in batch: it significantly varies over the concentration range investigated in the diffusion tests (between 2 x 10 -6 M and 2 x 10 -2 M). If sorbed ions contribute to the transfer, the effective diffusion coefficients deduced from these different tests should depend on cesium concentration. Nevertheless, the measured effective diffusion coefficients are found to be relatively unaffected by cesium concentration. It is thus concluded that ions at the sorbed state play a minor role in the diffusion. Following the assumption of an 'accelerated' transfer due to ions located in the diffuse double layer, the charge of the clay particles should affect the 'enhanced diffusion' of cesium. Therefore, a mud-rock sample was first crushed and contacted with a cationic surfactant at different solid/liquid ratios. The conditions were adjusted to obtain suspensions having positive, neutral and negative zeta potentials respectively. Three compact samples were then made with these different

An Analytical Model for Adsorption and Diffusion of Atoms/Ions on Graphene Surface

Directory of Open Access Journals (Sweden)

Yan-Zi Yu

2015-01-01

Full Text Available Theoretical investigations are made on adsorption and diffusion of atoms/ions on graphene surface based on an analytical continuous model. An atom/ion interacts with every carbon atom of graphene through a pairwise potential which can be approximated by the Lennard-Jones (L-J potential. Using the Fourier expansion of the interaction potential, the total interaction energy between the adsorption atom/ion and a monolayer graphene is derived. The energy-distance relationships in the normal and lateral directions for varied atoms/ions, including gold atom (Au, platinum atom (Pt, manganese ion (Mn2+, sodium ion (Na1+, and lithium-ion (Li1+, on monolayer graphene surface are analyzed. The equilibrium position and binding energy of the atoms/ions at three particular adsorption sites (hollow, bridge, and top are calculated, and the adsorption stability is discussed. The results show that H-site is the most stable adsorption site, which is in agreement with the results of other literatures. What is more, the periodic interaction energy and interaction forces of lithium-ion diffusing along specific paths on graphene surface are also obtained and analyzed. The minimum energy barrier for diffusion is calculated. The possible applications of present study include drug delivery system (DDS, atomic scale friction, rechargeable lithium-ion graphene battery, and energy storage in carbon materials.

Transport and diffusion on crystalline surfaces under external forces

International Nuclear Information System (INIS)

Lindenberg, Katja; Lacasta, A M; Sancho, J M; Romero, A H

2005-01-01

We present a numerical study of classical particles obeying a Langevin equation and moving on a solid crystalline surface under an external force that may either be constant or modulated by periodic oscillations. We focus on the particle drift velocity and diffusion. The roles of friction and equilibrium thermal fluctuations are studied for two nonlinear dynamical regimes corresponding to low and to high but finite friction. We identify a number of resonances and antiresonances, and provide phenomenological interpretations of the observed behaviour

Nuclear techniques for bulk and surface analysis of materials

International Nuclear Information System (INIS)

D'Agostino, M.D.; Kamykowski, E.A.; Kuehne, F.J.; Padawer, G.M.; Schneid, E.J.; Schulte, R.L.; Stauber, M.C.; Swanson, F.R.

1978-01-01

A review is presented summarizing several nondestructive bulk and surface analysis nuclear techniques developed in the Grumman Research Laboratories. Bulk analysis techniques include 14-MeV-neutron activation analysis and accelerator-based neutron radiography. The surface analysis techniques include resonant and non-resonant nuclear microprobes for the depth profile analysis of light elements (H, He, Li, Be, C, N, O and F) in the surface of materials. Emphasis is placed on the description and discussion of the unique nuclear microprobe analytical capacibilities of immediate importance to a number of current problems facing materials specialists. The resolution and contrast of neutron radiography was illustrated with an operating heat pipe system. The figure shows that the neutron radiograph has a resolution of better than 0.04 cm with sufficient contrast to indicate Freon 21 on the inner capillaries of the heat pipe and pooling of the liquid at the bottom. (T.G.)

Capacitor-based detection of nuclear magnetization: nuclear quadrupole resonance of surfaces.

Science.gov (United States)

Gregorovič, Alan; Apih, Tomaž; Kvasić, Ivan; Lužnik, Janko; Pirnat, Janez; Trontelj, Zvonko; Strle, Drago; Muševič, Igor

2011-03-01

We demonstrate excitation and detection of nuclear magnetization in a nuclear quadrupole resonance (NQR) experiment with a parallel plate capacitor, where the sample is located between the two capacitor plates and not in a coil as usually. While the sensitivity of this capacitor-based detection is found lower compared to an optimal coil-based detection of the same amount of sample, it becomes comparable in the case of very thin samples and even advantageous in the proximity of conducting bodies. This capacitor-based setup may find its application in acquisition of NQR signals from the surface layers on conducting bodies or in a portable tightly integrated nuclear magnetic resonance sensor. Copyright © 2010 Elsevier Inc. All rights reserved.

Diffusion of MMPs on the surface of collagen fibrils: the mobile cell surface-collagen substratum interface.

Directory of Open Access Journals (Sweden)

Ivan E Collier

Full Text Available Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 can initiate (MT1-MMP and complete (MMP-2 degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP(2/TIMP-2/MMP-2 represents a Mobile Cell Surface-Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions.

Dynamics and diffusive-conformational coupling in polymer bulk samples and surfaces: a molecular dynamics study

International Nuclear Information System (INIS)

Vree, C; Mayr, S G

2010-01-01

The impact of free surfaces on the mobility and conformational fluctuations of model polymer chains is investigated with the help of classical molecular dynamics simulations over a broad temperature range. Below a critical temperature, T*, similar to the critical temperature of the mode coupling theory, the center-of-mass displacements and temporal fluctuations of the radius of gyration of individual chains-as a fingerprint of structural reconfigurations-reveal a strong enhancement close to surfaces, while this effect diminishes with increasing temperature and observation time. Interpreting conformational fluctuations as a random walk in conformational space, identical activation enthalpies for structural reconfigurations and diffusion are obtained within the error bars in the bulk and at the surfaces, thus indicating a coupling of diffusive and conformational dynamics.

Bank of models of hydrogen diffusion in irradiated materials for nuclear and thermonuclear installation

International Nuclear Information System (INIS)

Chikhraj, E.V.; Tazhibaeva, I.L.; Shestakov, V.P.; Romanenko, O.G.; Klepikov, A.Kh.

1996-01-01

The programs for calculation of one-dimensional hydrogen distribution in diffusion media with traps are proposed. The programs have been described by the differential equations in partial derivatives, taking into account presence of convertible chemical reaction of the first order (model by Hurst-Gauss), presence of convertible chemical reaction of the second order (model by MacNabb and Forster) or presence of two different interchanging diffusion channels with traps under boundary conditions of first, second and third kinds. Programs allows to calculate and to show dynamic distribution and its flow in diffusion media and traps along the sample (both uniform and consisting of several different layers, distinguished by media structure and phase composition) in experiment on hydrogen permeability and thermodesorption. Conditions of flow continuity takes place on the borders of section layers. Code for resolving of inversive problem - extraction of diffusion parameters from an experimental curve of a gas permeation flow for specified above tree models of diffusion is developed also. The programs a written in Pascal in variants for DOS and for Windows-95. The programs could be applied for the analysis of gas release results being obtained from the structural materials samples of nuclear-power installation. 6 refs

Diffusion of radionuclide chains through an adsorbing medium

International Nuclear Information System (INIS)

Burkholder, H.C.; DeFigh-Price, C.

1977-01-01

The diffusion of radionuclide chains from an underground nuclear waste disposal site through the surrounding geologic medium to the surface is investigated for impulse and band releases. Numerical calculation of the analytical solutions shows that differences in adsorption characteristics among chain members and radioactive decay during transit reduce radionuclide discharges to the biosphere. Results suggest that molecular diffusion is unlikely to be an important transfer mechanism from geologic isolation, and that disposal of radionuclides in deep geologic formations and in the seabed under conditions of very low or nonexistent water flow is likely to be very effective in preventing radioactivity releases to the biosphere

Nuclear criticality safety aspects of gaseous uranium hexafluoride (UF{sub 6}) in the diffusion cascade

Energy Technology Data Exchange (ETDEWEB)

Huffer, J.E. [Parallax, Inc., Atlanta, GA (United States)

1997-04-01

This paper determines the nuclear safety of gaseous UF{sub 6} in the current Gaseous Diffusion Cascade and auxiliary systems. The actual plant safety system settings for pressure trip points are used to determine the maximum amount of HF moderation in the process gas, as well as the corresponding atomic number densities. These inputs are used in KENO V.a criticality safety models which are sized to the actual plant equipment. The ENO V.a calculation results confirm nuclear safety of gaseous UF{sub 6} in plant operations..

Nuclear physics: Macroscopic aspects

International Nuclear Information System (INIS)

Swiatecki, W.J.

1993-12-01

A systematic macroscopic, leptodermous approach to nuclear statics and dynamics is described, based formally on the assumptions ℎ → 0 and b/R << 1, where b is the surface diffuseness and R the nuclear radius. The resulting static model of shell-corrected nuclear binding energies and deformabilities is accurate to better than 1 part in a thousand and yields a firm determination of the principal properties of the nuclear fluid. As regards dynamics, the above approach suggests that nuclear shape evolutions will often be dominated by dissipation, but quantitative comparisons with experimental data are more difficult than in the case of statics. In its simplest liquid drop version the model exhibits interesting formal connections to the classic astronomical problem of rotating gravitating masses

Analytic treatment of nuclear spin-lattice relaxation for diffusion in a cone model

Science.gov (United States)

Sitnitsky, A. E.

2011-12-01

We consider nuclear spin-lattice relaxation rate resulted from a diffusion equation for rotational wobbling in a cone. We show that the widespread point of view that there are no analytical expressions for correlation functions for wobbling in a cone model is invalid and prove that nuclear spin-lattice relaxation in this model is exactly tractable and amenable to full analytical description. The mechanism of relaxation is assumed to be due to dipole-dipole interaction of nuclear spins and is treated within the framework of the standard Bloemberger, Purcell, Pound-Solomon scheme. We consider the general case of arbitrary orientation of the cone axis relative the magnetic field. The BPP-Solomon scheme is shown to remain valid for systems with the distribution of the cone axes depending only on the tilt relative the magnetic field but otherwise being isotropic. We consider the case of random isotropic orientation of cone axes relative the magnetic field taking place in powders. Also we consider the cases of their predominant orientation along or opposite the magnetic field and that of their predominant orientation transverse to the magnetic field which may be relevant for, e.g., liquid crystals. Besides we treat in details the model case of the cone axis directed along the magnetic field. The latter provides direct comparison of the limiting case of our formulas with the textbook formulas for free isotropic rotational diffusion. The dependence of the spin-lattice relaxation rate on the cone half-width yields results similar to those predicted by the model-free approach.

The modeling method of diffusion of radio activated materials in clay waste disposals

International Nuclear Information System (INIS)

Saberi, Reza; Sepanloo, Kamran; Alinejad, Majid; Mozaffari, Ali

2017-01-01

New nuclear power plants are necessary to meet today's and future challenges of energy supply. Nuclear power is the only large-scale energy source that takes full responsibility for all its wastes. Nuclear wastes are particularly hazardous and hard to manage relative to different toxic industrial wastes. Three methods are presented and analysed to model the diffusion of the waste from the waste disposal to the bottom surface. For this purpose three software programmes such as ABAQUS, Matlab coding, Geostudio and ArcGIS have been applied.

Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

Energy Technology Data Exchange (ETDEWEB)

Naderi, Ebadollah, E-mail: enaderi42@gmail.com [Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Nanavati, Sachin [Center for Development of Advanced Computing (C-DAC), SPPU campus, Pune 411007 (India); Majumder, Chiranjib [Chemistry Division, Bhabha Atomic Research Center, Mumbai, 400085 (India); Ghaisas, S. V. [Department of Electronic Science, Savitribai Phule Pune University (SPPU), Pune-411007 (India); Department of Physics, Savitribai Phule Pune University (SPPU), Pune-411007 (India)

2015-01-15

CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A{sub a} site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A{sub a} (occupied) to A{sub a} (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.

Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

Science.gov (United States)

Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.

2015-01-01

CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as Aa site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from Aa (occupied) to Aa (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth.

Diffusion of Cd and Te adatoms on CdTe(111) surfaces: A computational study using density functional theory

International Nuclear Information System (INIS)

Naderi, Ebadollah; Nanavati, Sachin; Majumder, Chiranjib; Ghaisas, S. V.

2015-01-01

CdTe is one of the most promising semiconductor for thin-film based solar cells. Here we report a computational study of Cd and Te adatom diffusion on the CdTe (111) A-type (Cd terminated) and B-type (Te terminated) surfaces and their migration paths. The atomic and electronic structure calculations are performed under the DFT formalism and climbing Nudge Elastic Band (cNEB) method has been applied to evaluate the potential barrier of the Te and Cd diffusion. In general the minimum energy site on the surface is labeled as A a site. In case of Te and Cd on B-type surface, the sub-surface site (a site just below the top surface) is very close in energy to the A site. This is responsible for the subsurface accumulation of adatoms and therefore, expected to influence the defect formation during growth. The diffusion process of adatoms is considered from A a (occupied) to A a (empty) site at the nearest distance. We have explored three possible migration paths for the adatom diffusion. The adatom surface interaction is highly dependent on the type of the surface. Typically, Te interaction with both type (5.2 eV for A-type and 3.8 eV for B-type) is stronger than Cd interactions(2.4 eV for B-type and 0.39 eV for A-type). Cd interaction with the A-type surface is very weak. The distinct behavior of the A-type and B-type surfaces perceived in our study explain the need of maintaining the A-type surface during growth for smooth and stoichiometric growth

Molecular dynamics simulation of self-diffusion processes in titanium in bulk material, on grain junctions and on surface.

Science.gov (United States)

Sushko, Gennady B; Verkhovtsev, Alexey V; Yakubovich, Alexander V; Schramm, Stefan; Solov'yov, Andrey V

2014-08-21

The process of self-diffusion of titanium atoms in a bulk material, on grain junctions and on surface is explored numerically in a broad temperature range by means of classical molecular dynamics simulation. The analysis is carried out for a nanoscale cylindrical sample consisting of three adjacent sectors and various junctions between nanocrystals. The calculated diffusion coefficient varies by several orders of magnitude for different regions of the sample. The calculated values of the bulk diffusion coefficient correspond reasonably well to the experimental data obtained for solid and molten states of titanium. Investigation of diffusion in the nanocrystalline titanium is of a significant importance because of its numerous technological applications. This paper aims to reduce the lack of data on diffusion in titanium and describe the processes occurring in bulk, at different interfaces and on surface of the crystalline titanium.

Measurement of grain-boundary diffusion at low temperature by the surface-accumulation method. II. Results for gold-silver system

International Nuclear Information System (INIS)

Hwang, J.C.M.; Pan, J.D.; Balluffi, R.W.

1979-01-01

Grain-boundary diffusion rates in the gold-silver system were measured at relatively low temperatures by the surface-accumulation method which was analyzed in Paper I. The specimen was a polycrystalline gold film possessing columnar grains on which a silver layer was initially deposited epitaxially on one surface. During subsequent low-temperature annealing lattice diffusion was frozen out, and diffusion then occurred along the grain boundary and free-surface short circuits. The silver, therefore, diffused into the film from the silver layer along the boundaries, eventually reaching the opposite surface where it accumulated and was measured by Auger spectroscopy. The silver layer acted as an effective constant silver source, and grain-boundary diffusivities were calculated from the accumulation data. However, the exact location of the effective constant source in the silver layer could not be determined and this led to an uncertainty in the values of the grain-boundary diffusivities of a factor of 10. Lower- and upper-bound values were therefore described by D/sub b/(lower bound) =7.8 x 10 -6 exp(-0.62eV/kT) and D/sub b/(upper bound) =7.8 x 10 -5 exp(-0.62eV/kT) cm 2 /s in the temperature range 30--269 0 C. An examination of available grain-boundary diffusion data (including the present) suggests a tendency for the observed activation energy to decrease with decreasing temperature, and this was ascribed to a spectrum of activated jumps in the grain boundary and/or a spectrum of grain-boundary types in the specimen employed. The constant source behavior was tentatively ascribed, at least in part, to a grain-boundary ''Kirkendall effect'' resulting from the faster diffusion of silver than gold. The work indicates a need for increased understanding of the details of grain-boundary diffusion in alloys

Modelisation de la diffusion sur les surfaces metalliques: De l'adatome aux processus de croissance

Science.gov (United States)

Boisvert, Ghyslain

Cette these est consacree a l'etude des processus de diffusion en surface dans le but ultime de comprendre, et de modeliser, la croissance d'une couche mince. L'importance de bien mai triser la croissance est primordiale compte tenu de son role dans la miniaturisation des circuits electroniques. Nous etudions ici les surface des metaux nobles et de ceux de la fin de la serie de transition. Dans un premier temps, nous nous interessons a la diffusion d'un simple adatome sur une surface metallique. Nous avons, entre autres, mis en evidence l'apparition d'une correlation entre evenements successifs lorsque la temperature est comparable a la barriere de diffusion, i.e., la diffusion ne peut pas etre associee a une marche aleatoire. Nous proposons un modele phenomenologique simple qui reproduit bien les resultats des simulations. Ces calculs nous ont aussi permis de montrer que la diffusion obeit a la loi de Meyer-Neldel. Cette loi stipule que, pour un processus active, le prefacteur augmente exponentiellement avec la barriere. En plus, ce travail permet de clarifier l'origine physique de cette loi. En comparant les resultats dynamiques aux resultats statiques, on se rend compte que la barriere extraite des calculs dynamiques est essentiellement la meme que celle obtenue par une approche statique, beaucoup plus simple. On peut donc obtenir cette barriere a l'aide de methodes plus precises, i.e., ab initio, comme la theorie de la fonctionnelle de la densite, qui sont aussi malheureusement beaucoup plus lourdes. C'est ce que nous avons fait pour plusieurs systemes metalliques. Nos resultats avec cette derniere approche se comparent tres bien aux resultats experimentaux. Nous nous sommes attardes plus longuement a la surface (111) du platine. Cette surface regorge de particularites interessantes, comme la forme d'equilibre non-hexagonale des i lots et deux sites d'adsorption differents pour l'adatome. De plus, des calculs ab initio precedents n'ont pas reussi a confirmer la

Effects of diffusion and surface interactions on the line shape of electron paramagnetic resonances in the presence of a magnetic field gradient

International Nuclear Information System (INIS)

Schaden, M.; Zhao, K. F.; Wu, Z.

2007-01-01

In an evanescent wave magnetometer the Zeeman polarization is probed at micrometer to submicrometer distances from the cell surface. The electron paramagnetic resonance lines of an evanescent wave magnetometer in the presence of a magnetic field gradient exhibit edge enhancement seen previously in nuclear magnetic resonance lines. We present a theoretical model that describes quantitatively the shape of the magnetic resonance lines of an evanescent wave magnetometer under a wide range of experimental conditions. It accounts for diffusion broadening in the presence of a magnetic field gradient as well as interactions of spin polarized Rb atoms with the coated Pyrex glass surfaces. Depending on the field gradient, cell thickness, and buffer gas pressure, the resonance line may have the form of a single asymmetric peak or two peaks localized near the front and back surfaces in frequency space. The double-peaked response depends on average characteristics of the surface interactions. Its shape is sensitive to the dwell time, relaxation probability, and average phase shift of adsorbed spin polarized Rb atoms

Tin-phthalocyanine adsorption and diffusion on Cu and Au (111) surfaces: A density functional theory study

Science.gov (United States)

Qin, Dan; Ge, Xu-Jin; Lü, Jing-Tao

2018-05-01

Through density functional theory based calculations, we study the adsorption and diffusion of tin phthalocyanine (SnPc) molecule on Au(111) and Cu(111) surfaces. SnPc has two conformers with Sn pointing to the vacuum (Sn-up) and substrate (Sn-down), respectively. The binding energies of the two conformers with different adsorption sites on the two surfaces, including top, bridge, fcc, hcp, are calculated and compared. It is found that the SnPc molecule binds stronger on Cu(111) surface, with binding energy about 1 eV larger than that on Au(111). Only the bridge and top adsorption sites are stable on Cu(111), while all the four adsorption sites are stable on Au(111), with small diffusion barriers between them. Moreover, the flipping barrier from Sn-up to Sn-down conformer is of the same magnitude on the two metal surfaces. These results are consistent with a recent experiment [Zhang, et al., Angew. Chem., 56, 11769 (2017)], which shows that conformation change from Sn-up to Sn-down on Cu(111) surface can be induced by a C60-functionalized STM tip, while similar change is difficult to realize on Au(111), due to smaller diffusion barrier on Au(111).

A study of surface diffusion with the scanning tunneling microscope from fluctuations of the tunneling current

Energy Technology Data Exchange (ETDEWEB)

Manuel, Lozano [Iowa State Univ., Ames, IA (United States)

1996-01-12

The transport of atoms or molecules over surfaces has been an important area of study for several decades now, with its progress generally limited by the available experimental techniques to characterize the phenomena. A number of methods have been developed over the years to measure surface diffusion yet only very few systems have been characterized to this day mainly due to the physical limitations inherent in these available methods. Even the STM with its astonishing atomically-resolved images of the surface has been limited in terms of its capability to determine mass transport properties. This is because the STM is inherently a ``slow`` instrument, i.e., a finite time is needed for signal averaging in order to produce the image. A need exists for additional surface diffusion measurement techniques, ideally ones which are able to study varied systems and measure a wide range of diffusion rates. The STM (especially because of its highly local nature) presents itself as a promising tool to conduct dynamical studies if its poor time resolution during ``normal operation`` can somehow be overcome. The purpose of this dissertation is to introduce a new technique of using the STM to measure adatom mobility on surfaces -- one with a capacity to achieve excellent time resolution.

Diffusion of gases in solids: rare gas diffusion in solids; tritium diffusion in fission and fusion reactor metals. Final report

International Nuclear Information System (INIS)

Abraham, P.M.; Chandra, D.; Mintz, J.M.; Elleman, T.S.; Verghese, K.

1976-01-01

Major results of tritium and rare gas diffusion research conducted under the contract are summarized. The materials studied were austenitic stainless steels, Zircaloy, and niobium. In all three of the metal systems investigated, tritium release rates were found to be inhibited by surface oxide films. The effective diffusion coefficients that control tritium release from surface films on Zircaloy and niobium were determined to be eight to ten orders of magnitude lower than the bulk diffusion coefficients. A rapid component of diffusion due to grain boundaries was identified in stainless steels. The grain boundary diffusion coefficient was determined to be about six orders of magnitude greater than the bulk diffusion coefficient for tritium in stainless steel. In Zircaloy clad fuel pins, the permeation rate of tritium through the cladding is rate-limited by the extremely slow diffusion rate in the surface films. Tritium diffusion rates through surface oxide films on niobium appear to be controlled by cracks in the surface films at temperatures up to 600 0 C. Beyond 600 0 C, the cracks appear to heal, thereby increasing the activation energy for diffusion through the oxide film. The steady-state diffusion of tritium in a fusion reactor blanket has been evaluated in order to calculate the equilibrium tritium transport rate, approximate time to equilibrium, and tritium inventory in various regions of the reactor blanket as a function of selected blanket parameters. Values for these quantities have been tabulated

Effect of TiO2 additive on the sintering of nuclear fuel (U,Pu)O2. Contribution of surface diffusion to plutonium distribution

International Nuclear Information System (INIS)

Bremier, Stephane

1997-01-01

This thesis has as objective the study of the effect of TiO 2 additive on the development of MOX fuel microstructure during sintering in reducing atmosphere. To understand better the mechanisms governing the evolution of microstructure, the behavior of UO 2 in the presence of TiO 2 has been established and the influence of the PuO 2 distribution in the initial state of the material was taken into account. The chapter II is devoted to the bibliographic study of the transport mechanisms responsible of the sintering in the ceramics UO 2 and UO 2 -PuO 2 . The results concerning the influence of TiO 2 upon density, grain size and homogenization are discussed. The following chapter describes the characteristics of initial powder, the procedures and installations of heat treatment, as well as the techniques of characterization used. Then the sintering features of UO 2 alone or in the presence of TiO 2 are presented. It appears that in the last case the surface diffusion becomes sufficient fast so that the distribution of the additive occurs naturally during a slow temperature increase. The fifth chapter treats the effect of UO 2 -PuO 2 preparation upon the initial microstructure of the materials and the role played by the PuO 2 grains in sintering. The potentiality of surface diffusion as a means of PuO 2 spreading in the UO 2 is evaluated and correlated with the reduced capacity of sintering the UO 2 ceramics containing PuO 2 . The last chapter deals with the influence of TiO 2 on the development of microstructure in UO 2 -PuO 2 ceramics. While at temperatures below 1500 deg.C the TiO 2 additive affects the surface diffusion and so the plutonium distribution, at values T≥ 1600 deg.C the additive gives rise to a dissolution-reprecipitation process taking place in a intergranular liquid phase appeared between UO 2 , PuO 2 and titanium oxide. Thus the objective is the optimizing the temperature conditions, the oxygen potential as sintering gas and the additive

Surface Nuclear Magnetic Resonance Imaging of Large Systems

International Nuclear Information System (INIS)

Weichman, P.B.; Lavely, E.M.; Ritzwoller, M.H.

1999-01-01

The general theory of surface NMR imaging of large electromagnetically active systems is considered, motivated by geophysical applications. A general imaging equation is derived for the NMR voltage response, valid for arbitrary transmitter and receiver loop geometry and arbitrary conductivity structure of the sample. When the conductivity grows to the point where the electromagnetic skin depth becomes comparable to the sample size, significant diffusive retardation effects occur that strongly affect the signal. Accounting for these now allows more accurate imaging than previously possible. It is shown that the time constant T 1 may in principle be inferred directly from the diffusive tail of the signal. copyright 1999 The American Physical Society

Nuclear stimulated desorption as a potential tool for surface study

International Nuclear Information System (INIS)

Nir, Dror.

1993-03-01

The described research work constitutes a base for an experimental method to be implemented in the study of solid surfaces. Nuclear Stimulated Desorption (NSD) is a new mode of experimentation in thin film and surface physics. It Is based on the interplay between nuclear phenomena (reactions and spontaneous decays), and atomic - scale induced effects on surfaces and very thin films. One may distinguish between two generically different relationships between the two. First, the dynamics of the nuclear reaction -primarily the recoil of the nucleus - may effect the position of the atom or molecule containing it. Second, the nuclear reaction (or decay) may serve as an analytical indicator of the whereabouts of the atom, or molecule, in question. In nuclear stimulated desorption, both thee aspects combine in an essential way. Namely, one employs a series of two consecutive decays (normally weak decays or isomeric transition) . The first of these decays causes the nucleus to desorb from a surface onto which it had been placed; the second serves to determine the position of the daughter and thereby the characteristics of the primary desorption . The essential feature in NSD is that it occurs almost exclusively from the outermost surface layer. This is because we choose to work with nuclei whose recoil energy Is of the same order of magnitude of the binding energy of the atom to the surface . Furthermore, the desorption probability and its angular (and temporal) characteristics, depend on the features (topology, morphology) of its immediate neighborhood. This work describes experiments which were designed to give relevant, phenomenological information about the outgoing flux of the radioactive daughters (for specifically chosen nuclear species) , and in particular the magnitude of the flux, its time dependence and its charged state. In addition. the basic phenomena itself is being distinguished from competing processes (thermal desorption, in particular). We will now

Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium

International Nuclear Information System (INIS)

R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein

2004-01-01

FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were ∼ 4 x 10 -7 cm 2 /s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10 -5 to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form

Retention/Diffusivity Studies in Free-Surface Flowing Liquid Lithium

Energy Technology Data Exchange (ETDEWEB)

R.A. Stubbers; G.H. Miley; M. Nieto; W. Olczak; D.N. Ruzic; A. Hassanein

2004-12-14

FLIRE was designed to measure the hydrogen and helium retention and diffusivity in a flowing stream of liquid lithium, and it has accomplished these goals. Retention coefficients for helium in the flowing liquid stream were 0.1-2% for flow speeds of 44 cm/s and implantation energies between 500 and 2000 eV. The energy dependence of retention is linear for the energy range considered, as expected, and the dependence of retention on flow velocity fits the expected square-root of flow speed dependence. Estimates of the helium diffusion coefficient in the flowing lithium stream were {approx} 4 x 10{sup -7} cm{sup 2}/s, and are independent of implantation energy. This value is much lower than expected, which could be due to several factors, such as mixing, bubble formation or surface film formation. In the case of hydrogen, long term retention and release mechanisms are of greatest importance, since this relates to tritium inventory in flowing lithium PFCs for fusion applications. The amount of hydride formation was measured for flowing lithium exposed to neutral deuterium gas. Thermal desorption spectroscopy (TDS) measurements indicate that the hydride concentration was between 0.1 and 0.2% over a wide range of pressures (6.5 x 10{sup -5} to 1 Torr). This result implies that the deuterium absorption rate is limited by the surface dissociation rate, since deuterium (hydrogen/tritium) is absorbed in its atomic form, not its molecular form.

Diffusion of insoluble carbon in zirconium oxides

CERN Document Server

Vykhodets, V B; Koester, U; Kondrat'ev, V V; Kesarev, A G; Hulsen, C; Kurennykh, T E

2011-01-01

The diffusion coefficient of insoluble carbon in zirconium oxides has been obtained for the temperature range of 900-1000A degrees C. There are no published data on the diffusion of insoluble impurities; these data are of current interest for the diffusion theory and nuclear technologies. Tracer atoms 13C have been introduced into oxides by means of ion implantation and the kinetics of their emission from the samples in the process of annealing in air has been analyzed. The measurements have been performed using the methods of nuclear microanalysis and X-ray photoelectron spectroscopy. The diffusion activation energy is 2.7 eV and the carbon diffusion coefficient is about six orders of magnitude smaller than that for oxygen self-diffusion in the same systems. This result indicates the strong anomaly of the diffusion properties of carbon in oxides. As a result, zirconium oxides cannot be used in some nuclear technologies, in particular, as a material of sources for accelerators of short-lived carbon isotopes.

Progress Report for Diffusion Welding of the NGNP Process Application Heat Exchangers

Energy Technology Data Exchange (ETDEWEB)

R.E. Mizia; D.E. Clark; M.V. Glazoff; T.E. Lister; T.L. Trowbridge

2011-12-01

The U.S. Department of Energy selected the high temperature gas-cooled reactor as the basis for the Next Generation Nuclear Plant (NGNP). The NGNP will demonstrate the use of nuclear power for electricity, hydrogen production, and process heat applications. The NGNP Project is currently investigating the use of metallic, diffusion welded, compact heat exchangers to transfer heat from the primary (reactor side) heat transport system to the secondary heat transport system. An intermediate heat exchanger will transfer this heat to downstream applications such as hydrogen production, process heat, and electricity generation. The channeled plates that make up the heat transfer surfaces of the intermediate heat exchanger will have to be assembled into an array by diffusion welding. This report describes the preliminary results of a scoping study that evaluated the diffusion welding process parameters and the resultant mechanical properties of diffusion welded joints using Alloy 800H. The long-term goal of the program is to progress towards demonstration of small heat exchanger unit cells fabricated with diffusion welds. Demonstration through mechanical testing of the unit cells will support American Society of Mechanical Engineers rules and standards development, reduce technical risk, and provide proof of concept for heat exchanger fabrication methods needed to deploy heat exchangers in several potential NGNP configurations.1 Researchers also evaluated the usefulness of modern thermodynamic and diffusion computational tools (Thermo-Calc and Dictra) in optimizing the parameters for diffusion welding of Alloy 800H. The modeling efforts suggested a temperature of 1150 C for 1 hour with an applied pressure of 5 MPa using 15 {micro}m nickel foil as joint filler to reduce chromium oxidation on the welded surfaces. Good agreement between modeled and experimentally determined concentration gradients was achieved

Adsorption and diffusion of hydrogen in Zircaloy-4

International Nuclear Information System (INIS)

Torres, E.; Desquines, J.; Baietto, M.C.; Coret, M.; Wehling, F.; Blat-Yrieix, M.; Ambard, A.

2015-01-01

Hydrogen in zirconium alloys is considered in many nuclear safety issues. Below 500 Celsius degrees, rather limited knowledge is available on the combined hydrogen adsorption at the sample surface and diffusion in the metal. A modeling of hydrogen gaseous charging has been established starting with a set of relevant laws and parameters derived from open literature. Simulating the hydrogen charging process requires simultaneous analysis of gaseous surface adsorption, hydrogen solid-solution diffusion and precipitation, when exceeding the material solubility limit. The modeling has been extended to reproduce the solid-gas exchange. Gaseous charging experiments have been performed at 420 C. degrees on Stress Relieved Annealed (SRA) Zircaloy-4 cladding samples to validate the model. The sample hydrogen content has been systematically measured after charging and compared to the calculated value thus providing a validation of the adsorption modeling. Complementary tests have been carried out on Recrystallized Annealed (RXA) Zircaloy-4 rods to characterize the combined diffusion and adsorption process. The hydrogen concentration distribution has been characterized using an inverse technique based on destructive analyses of the samples. This additional set of data was relevant for the validation of the hydrogen combined adsorption/diffusion modeling up to 420 C. degrees. (authors)

Thermal Diffusion Processes in Metal-Tip-Surface Interactions: Contact Formation and Adatom Mobility

DEFF Research Database (Denmark)

Sørensen, Mads Reinholdt; Jacobsen, Karsten Wedel; Jonsson, Hannes

1996-01-01

and the surface can occur by a sequence of atomic hop and exchange processes which become active on a millisecond time scale when the tip is about 3-5 Angstrom from the surface. Adatoms on the surface are stabilized by the presence of the tip and energy barriers for diffusion processes in the region under the tip......We have carried out computer simulations to identify and characterize various thermally activated atomic scale processes that can play an important role in room temperature experiments where a metal tip is brought close to a metal surface. We find that contact formation between the tip...

The modeling method of diffusion of radio activated materials in clay waste disposals

Energy Technology Data Exchange (ETDEWEB)

Saberi, Reza; Sepanloo, Kamran [NSTRI, Tehran (Iran, Islamic Republic of); Alinejad, Majid [Engineering Research Institute of Natural Hazard, Isfahan (Iran, Islamic Republic of); Mozaffari, Ali [KNT Univ. of Technology, Tehran (Iran, Islamic Republic of)

2017-02-15

New nuclear power plants are necessary to meet today's and future challenges of energy supply. Nuclear power is the only large-scale energy source that takes full responsibility for all its wastes. Nuclear wastes are particularly hazardous and hard to manage relative to different toxic industrial wastes. Three methods are presented and analysed to model the diffusion of the waste from the waste disposal to the bottom surface. For this purpose three software programmes such as ABAQUS, Matlab coding, Geostudio and ArcGIS have been applied.

Multimodal surface-based morphometry reveals diffuse cortical atrophy in traumatic brain injury.

Directory of Open Access Journals (Sweden)

Sorenson Donna J

2009-12-01

Full Text Available Abstract Background Patients with traumatic brain injury (TBI often present with significant cognitive deficits without corresponding evidence of cortical damage on neuroradiological examinations. One explanation for this puzzling observation is that the diffuse cortical abnormalities that characterize TBI are difficult to detect with standard imaging procedures. Here we investigated a patient with severe TBI-related cognitive impairments whose scan was interpreted as normal by a board-certified radiologist in order to determine if quantitative neuroimaging could detect cortical abnormalities not evident with standard neuroimaging procedures. Methods Cortical abnormalities were quantified using multimodal surfaced-based morphometry (MSBM that statistically combined information from high-resolution structural MRI and diffusion tensor imaging (DTI. Normal values of cortical anatomy and cortical and pericortical DTI properties were quantified in a population of 43 healthy control subjects. Corresponding measures from the patient were obtained in two independent imaging sessions. These data were quantified using both the average values for each lobe and the measurements from each point on the cortical surface. The results were statistically analyzed as z-scores from the mean with a p Results The TBI patient showed significant regional abnormalities in cortical thickness, gray matter diffusivity and pericortical white matter integrity that replicated across imaging sessions. Consistent with the patient's impaired performance on neuropsychological tests of executive function, cortical abnormalities were most pronounced in the frontal lobes. Conclusions MSBM is a promising tool for detecting subtle cortical abnormalities with high sensitivity and selectivity. MSBM may be particularly useful in evaluating cortical structure in TBI and other neurological conditions that produce diffuse abnormalities in both cortical structure and tissue properties.

Diffusion of anions and cations in compacted sodium bentonite

International Nuclear Information System (INIS)

Muurinen, A.

1994-02-01

The thesis presents the results of studies on the diffusion mechanisms of anions and cations in compacted sodium bentonite, which is planned to be used as a buffer material in nuclear waste disposal in Finland. The diffusivities and sorption factors were determined by tracer experiments. The pore volume accessible to chloride, here defined as effective porosity, was determined as a function of bentonite density and electrolyte concentration in water, and the Stern-Gouy double-layer model was used to explain the observed anion exclusion. The sorption of Cs + and Sr 2+ was studied in loose and compacted bentonite samples as a function of the electrolyte concentration in solution. In order to obtain evidence of the diffusion of exchangeable cations, defined as surface diffusion, the diffusivities of Cs + and Sr 2+ in compacted bentonite were studied as a function of the sorption factor, which was varied by electrolyte concentration in solution. The measurements were performed both by a non-steady state method and by a through-diffusion method. (89 refs., 35 fig., 4 tab.)

Diffuse Anterior Retinoblastoma with Sarcoidosis-Like Nodule

Directory of Open Access Journals (Sweden)

Koji Kitazawa

2015-12-01

Full Text Available Background: Retinoblastomas account for 4% of malignancies in children, 1-2% of which are diffuse infiltrating retinoblastomas. Diffuse anterior retinoblastoma is rare and does not involve the retina. Here, we report on a diffuse anterior retinoblastoma with large sarcoidosis-like nodules on the iris that were responsive to anti-inflammatory therapy. Case: We present a 6-year-old girl who had anterior uveitis with white nodules on the iris and posterior surface of the cornea in her right eye. The nodules initially responded well to anti-inflammatory treatment. However, anterior segment optical coherence tomography (AS-OCT showed that the nodules gradually grew, shrinking the iris. We then collected the aqueous humor for diagnosis. A biopsy revealed clusters of small cells with a high nuclear-to-cytoplasm ratio with partial rosette formation. Therefore, we diagnosed diffuse anterior retinoblastoma without retinal involvement and performed enucleation of the right eye. The histopathology demonstrated undifferentiated cells similar to those seen on the biopsy, and tumor cells invaded the iris stroma, posterior surface of the cornea, ciliary body, and sclera. After the enucleation, she underwent chemotherapy and remains alive. Conclusion: A differential diagnosis of retinoblastoma should be considered when white nodules refractory to anti-inflammatory therapy occur in the eye, even in the absence of obvious retinal masses. AS-OCT findings are useful in assessing retinoblastoma.

Anisotropic Rotational Diffusion Studied by Nuclear Spin Relaxation and Molecular Dynamics Simulation: An Undergraduate Physical Chemistry Laboratory

Science.gov (United States)

Fuson, Michael M.

2017-01-01

Laboratories studying the anisotropic rotational diffusion of bromobenzene using nuclear spin relaxation and molecular dynamics simulations are described. For many undergraduates, visualizing molecular motion is challenging. Undergraduates rarely encounter laboratories that directly assess molecular motion, and so the concept remains an…

Passive Frequency Selective Surface Array as a Diffuser for Destroying Millimeter Wave Coherence

Directory of Open Access Journals (Sweden)

Saiful Islam

2008-01-01

Full Text Available This paper presents the design, construction, and testing of grounded frequency selective surface (FSS array as a diffuser for destroying millimeter wave coherence which is used to eliminate speckle in active millimeter wave imaging. To create stochastically independent illumination patterns, we proposed a diffuser based on random-phase distributions obtained by changing the incident frequency. The random-phase diffuser was obtained by mixing up the phase relations between the cells of a deterministic function (e.g., beam splitter. The slot length of FSS is the main design parameter used to optimize the phase shifting properties of the array. The critical parameters of the diffuser array design, such as phase relation with slot lengths, losses, and bandwidth, are discussed. We designed the FSS arrays with finite integral technique (FIT, fabricated by etching technique, and characterized the S-parameters with a free-space MVNA, and measured the radiation patterns with a BWO in motorized setup.

Surface-based brain morphometry and diffusion tensor imaging in schizoaffective disorder.

Science.gov (United States)

Landin-Romero, Ramón; Canales-Rodríguez, Erick J; Kumfor, Fiona; Moreno-Alcázar, Ana; Madre, Mercè; Maristany, Teresa; Pomarol-Clotet, Edith; Amann, Benedikt L

2017-01-01

The profile of grey matter abnormalities and related white-matter pathology in schizoaffective disorder has only been studied to a limited extent. The aim of this study was to identify grey- and white-matter abnormalities in patients with schizoaffective disorder using complementary structural imaging techniques. Forty-five patients meeting Diagnostic and Statistical Manual of Mental Disorders-Fourth Edition criteria and Research Diagnostic Criteria for schizoaffective disorder and 45 matched healthy controls underwent structural-T1 and diffusion magnetic resonance imaging to enable surface-based brain morphometry and diffusion tensor imaging analyses. Analyses were conducted to determine group differences in cortical volume, cortical thickness and surface area, as well as in fractional anisotropy and mean diffusivity. At a threshold of p = 0.05 corrected, all measures revealed significant differences between patients and controls at the group level. Spatial overlap of abnormalities was observed across the various structural neuroimaging measures. In grey matter, patients with schizoaffective disorder showed abnormalities in the frontal and temporal lobes, striatum, fusiform, cuneus, precuneus, lingual and limbic regions. White-matter abnormalities were identified in tracts connecting these areas, including the corpus callosum, superior and inferior longitudinal fasciculi, anterior thalamic radiation, uncinate fasciculus and cingulum bundle. The spatial overlap of abnormalities across the different imaging techniques suggests widespread and consistent brain pathology in schizoaffective disorder. The abnormalities were mainly detected in areas that have commonly been reported to be abnormal in schizophrenia, and to some extent in bipolar disorder, which may explain the clinical and aetiological overlap in these disorders.

Diffusion of MMPs on the Surface of Collagen Fibrils: The Mobile Cell Surface – Collagen Substratum Interface

Science.gov (United States)

Collier, Ivan E.; Legant, Wesley; Marmer, Barry; Lubman, Olga; Saffarian, Saveez; Wakatsuki, Tetsuro; Elson, Elliot; Goldberg, Gregory I.

2011-01-01

Remodeling of the extracellular matrix catalyzed by MMPs is central to morphogenetic phenomena during development and wound healing as well as in numerous pathologic conditions such as fibrosis and cancer. We have previously demonstrated that secreted MMP-2 is tethered to the cell surface and activated by MT1-MMP/TIMP-2-dependent mechanism. The resulting cell-surface collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 can initiate (MT1-MMP) and complete (MMP-2) degradation of an underlying collagen fibril. The following question remained: What is the mechanism of substrate recognition involving the two structures of relatively restricted mobility, the cell surface enzymatic complex and a collagen fibril embedded in the ECM? Here we demonstrate that all the components of the complex are capable of processive movement on a surface of the collagen fibril. The mechanism of MT1-MMP movement is a biased diffusion with the bias component dependent on the proteolysis of its substrate, not adenosine triphosphate (ATP) hydrolysis. It is similar to that of the MMP-1 Brownian ratchet we described earlier. In addition, both MMP-2 and MMP-9 as well as their respective complexes with TIMP-1 and -2 are capable of Brownian diffusion on the surface of native collagen fibrils without noticeable dissociation while the dimerization of MMP-9 renders the enzyme immobile. Most instructive is the finding that the inactivation of the enzymatic activity of MT1-MMP has a detectable negative effect on the cell force developed in miniaturized 3D tissue constructs. We propose that the collagenolytic complex (MT1-MMP)2/TIMP-2/MMP-2 represents a Mobile Cell Surface – Collagen Substratum Interface. The biological implications of MT1-MMP acting as a molecular ratchet tethered to the cell surface in complex with MMP-2 suggest a new mechanism for the role of spatially regulated peri-cellular proteolysis in cell-matrix interactions. PMID:21912660

Plasma surface treatment of Cu by nanosecond-pulse diffuse discharges in atmospheric air

Science.gov (United States)

Cheng, ZHANG; Jintao, QIU; Fei, KONG; Xingmin, HOU; Zhi, FANG; Yu, YIN; Tao, SHAO

2018-01-01

Nanosecond-pulse diffuse discharges could provide high-density plasma and high-energy electrons at atmospheric pressure. In this paper, the surface treatment of Cu by nanosecond-pulse diffuse discharges is conducted in atmospheric air. Factors influencing the water contact angle (WCA), chemical composition and microhardness, such as the gap spacing and treatment time, are investigated. The results show that after the plasma surface treatment, the WCA considerably decreases from 87° to 42.3°, and the surface energy increases from 20.46 mJ m-2 to 66.28 mJ m-2. Results of energy dispersive x-ray analysis show that the concentration of carbon decreases, but the concentrations of oxygen and nitrogen increase significantly. Moreover, the microhardness increases by approximately 30% after the plasma treatment. The aforementioned changes on the Cu surface indicate the plasma surface treatment enhances the hydrophilicity and microhardness, and it cleans the carbon and achieves oxidization on the Cu surface. Furthermore, by increasing the gap spacing and treatment time, better treatment effects can be obtained. The microhardness in the case of a 2.5 cm gap is higher than that in the case of a 3 cm gap. More oxygen and nitrogen species appear on the Cu surface for the 2.5 cm gap treatment than for the 3 cm gap treatment. The WCA significantly decreases with the treatment time when it is no longer than 90 s, and then it reaches saturation. In addition, more oxygen-containing and nitrogen-containing groups appear after extended plasma treatment time. They contribute to the improvement of the hydrophilicity and oxidation on the Cu surface.

Nuclear criticality safety evaluation of large cylinder cleaning operations in X-705, Portsmouth Gaseous diffusion Plant

International Nuclear Information System (INIS)

Sheaffer, M.K.; Keeton, S.C.; Lutz, H.F.

1995-06-01

This report evaluates nuclear criticality safety for large cylinder cleaning operations in the Decontamination and Recovery Facility, X-705, at the Portsmouth Gaseous Diffusion Plant. A general description of current cleaning procedures and required hardware/equipment is presented, and documentation for large cylinder cleaning operations is identified and described. Control parameters, design features, administrative controls, and safety systems relevant to nuclear criticality are discussed individually, followed by an overall assessment based on the Double Contingency Principle. Recommendations for enhanced safety are suggested, and issues for increased efficiency are presented

Diffusion profiles of fluorine in archaeological bones and teeth

International Nuclear Information System (INIS)

Nelson, P.H.

1984-06-01

Measurements of radial fluorine profiles in bone and teeth sections with a nuclear microprobe show that the distribution is due to diffusion of fluoride ions inward from any exposed surface. Assuming simple diffusion and constant environment, the profile shape depends only on the parameter Dt/a 2 (D=diffusion constant, t=time, a=radius of bone/teeth). Three computer programs have been written to allow visual comparison of data with theoretical diffusion curves. Use of these programs has shown that experimental profiles follow closely the predictions of simple diffusion theory. (Although the diffusion constant may depend on concentration and species to a lesser extent). A preliminary value of D (2.74 +- 0.4) x 10 - 4/ sq. mm/y was deduced from radiocarbon dated Moa bones (age 400-16,200 yr B.P.). Preliminary investigations indicate that the diffusion constant in tooth dentine is approximately the same as in bone. These results indicate that a dating method using the computer programs should be possible for bones ranging in age from a few years to perhaps millions of years and that dating teeth should also be possible

Diffuse Reflectance Spectroscopy for Surface Measurement of Liver Pathology.

Science.gov (United States)

Nilsson, Jan H; Reistad, Nina; Brange, Hannes; Öberg, Carl-Fredrik; Sturesson, Christian

2017-01-01

Liver parenchymal injuries such as steatosis, steatohepatitis, fibrosis, and sinusoidal obstruction syndrome can lead to increased morbidity and liver failure after liver resection. Diffuse reflectance spectroscopy (DRS) is an optical measuring method that is fast, convenient, and established. DRS has previously been used on the liver with an invasive technique consisting of a needle that is inserted into the parenchyma. We developed a DRS system with a hand-held probe that is applied to the liver surface. In this study, we investigated the impact of the liver capsule on DRS measurements and whether liver surface measurements are representative of the whole liver. We also wanted to confirm that we could discriminate between tumor and liver parenchyma by DRS. The instrumentation setup consisted of a light source, a fiber-optic contact probe, and two spectrometers connected to a computer. Patients scheduled for liver resection due to hepatic malignancy were included, and DRS measurements were performed on the excised liver part with and without the liver capsule and alongside a newly cut surface. To estimate the scattering parameters and tissue chromophore volume fractions, including blood, bile, and fat, the measured diffuse reflectance spectra were applied to an analytical model. In total, 960 DRS spectra from the excised liver tissue of 18 patients were analyzed. All factors analyzed regarding tumor versus liver tissue were significantly different. When measuring through the capsule, the blood volume fraction was found to be 8.4 ± 3.5%, the lipid volume fraction was 9.9 ± 4.7%, and the bile volume fraction was 8.2 ± 4.6%. No differences could be found between surface measurements and cross-sectional measurements. In measurements with/without the liver capsule, the differences in volume fraction were 1.63% (0.75-2.77), -0.54% (-2.97 to 0.32), and -0.15% (-1.06 to 1.24) for blood, lipid, and bile, respectively. This study shows that it is possible to manage DRS

Diffusion of implanted sodium in iron and AISI 316 Ti stainless steel

International Nuclear Information System (INIS)

Kehrel, A.; Lieb, K.P.; Scapellato, N.; Uhrmacher, M.

1990-01-01

Samples of polycrystalline iron and austenitic stainless steel were implanted with 250 keV Na + ions to a dose of 1.5x10 17 ions/cm 2 . The Na content was depth-profiled with the resonant nuclear reaction 23 Na(p,γ) 24 Mg, after the samples had been isochronally annealed between room temperature and 1060deg C. In both matrices a diffusion process of Na atoms towards the surface was observed which is discussed in the light of results on Na diffusion in other metals (Cr, Ni and Mo). (orig.)

Surface strengthening using a self-protective diffusion paste and its application for ballistic protection of steel plates

International Nuclear Information System (INIS)

Lou, D.C.; Solberg, J.K.; Borvik, T.

2009-01-01

This paper deals with surface strengthening of steel plates using a self-protective diffusion paste. During the surface strengthening process, a paste containing carbon, boron or similar is applied on the steel surface. In addition to serving as a source for the various diffusion ingredients, the paste protects the steel against contact with the environment, so no packing or gas protection is necessary. Thus, the handling is in general very simple, and the surface strengthening process can be performed in a conventional air furnace. The method provides the same type of surface strengthening that is obtained by more conventional methods. In this work, the main focus will be surface strengthening by carburizing, but also boronizing and boronizing followed by carburizing have been tested out. The methods have been applied to increase the ballistic resistance of the low-strength carbon steel NVE36 (with nominal yield stress of 355 MPa) against impacts from small-arms bullets. An empirical model combining diffusion depth, heat-treatment temperature and soaking time was established on the basis of a series of experimental data. By means of this equation, the various heat-treatment parameters can be predicted when others are chosen. Ballistic perforation tests using 7.62 mm APM2 bullets showed that the low-strength carbon steel after surface strengthening obtained a ballistic limit higher than that of Hardox 400, which is a wear steel with a yield stress of about 1200 MPa.

Surface contamination technology in decommissioning of nuclear fuel cycle

International Nuclear Information System (INIS)

Ishiguro, Hideharu

2012-01-01

Surface contamination measurement is the most basic technology in radiation control of the nuclear and radiation facilities. Loose surface contamination causes internal exposure through airborne contamination. Surface contamination measurement is recently more important in the waste management such as confirmation of decontamination factor, contamination survey of carried-out materials from radioactive control area, and application of clearance level. This report describes the base of surface contamination standards, meaning of contamination in decommissioning, relationship between clearance level and surface contamination, and current technology of surface contamination measurement. (author)

Vertical eddy diffusion as a key mechanism for removing perfluorooctanoic acid (PFOA) from the global surface oceans

NARCIS (Netherlands)

Lohmann, R.; Jurado Cojo, E.|info:eu-repo/dai/nl/325788227; Dijkstra, H.A.|info:eu-repo/dai/nl/073504467; Dachs, J.

2013-01-01

Here we estimate the importance of vertical eddy diffusion in removing perfluorooctanoic acid (PFOA) from the surface Ocean and assess its importance as a global sink. Measured water column profiles of PFOA were reproduced by assuming that vertical eddy diffusion in a 3-layer ocean model is the sole

Strain effect on the adsorption, diffusion, and molecular dissociation of hydrogen on Mg (0001) surface

Energy Technology Data Exchange (ETDEWEB)

Lei, Huaping; Wang, Caizhuang; Yao, Yongxin; Hupalo, Myron [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Wang, Yangang [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Supercomputing Center of Computer Network Information Center, CAS, Beijing 100190 (China); McDougall, Dan; Tringides, Michael; Ho, Kaiming [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Department of Physics and Astronomy, Iowa State University, Ames, Iowa 50011 (United States)

2013-12-14

The adsorption, diffusion, and molecular dissociation of hydrogen on the biaxially strained Mg (0001) surface have been systematically investigated by the first principle calculations based on density functional theory. When the strain changes from the compressive to tensile state, the adsorption energy of H atom linearly increases while its diffusion barrier linearly decreases oppositely. The dissociation barrier of H{sub 2} molecule linearly reduces in the tensile strain region. Through the chemical bonding analysis including the charge density difference, the projected density of states and the Mulliken population, the mechanism of the strain effect on the adsorption of H atom and the dissociation of H{sub 2} molecule has been elucidated by an s-p charge transfer model. With the reduction of the orbital overlap between the surface Mg atoms upon the lattice expansion, the charge transfers from p to s states of Mg atoms, which enhances the hybridization of H s and Mg s orbitals. Therefore, the bonding interaction of H with Mg surface is strengthened and then the atomic diffusion and molecular dissociation barriers of hydrogen decrease accordingly. Our works will be helpful to understand and to estimate the influence of the lattice deformation on the performance of Mg-containing hydrogen storage materials.

Passivation of phosphorus diffused silicon surfaces with Al2O3: Influence of surface doping concentration and thermal activation treatments

International Nuclear Information System (INIS)

Richter, Armin; Benick, Jan; Kimmerle, Achim; Hermle, Martin; Glunz, Stefan W.

2014-01-01

Thin layers of Al 2 O 3 are well known for the excellent passivation of p-type c-Si surfaces including highly doped p + emitters, due to a high density of fixed negative charges. Recent results indicate that Al 2 O 3 can also provide a good passivation of certain phosphorus-diffused n + c-Si surfaces. In this work, we studied the recombination at Al 2 O 3 passivated n + surfaces theoretically with device simulations and experimentally for Al 2 O 3 deposited with atomic layer deposition. The simulation results indicate that there is a certain surface doping concentration, where the recombination is maximal due to depletion or weak inversion of the charge carriers at the c-Si/Al 2 O 3 interface. This pronounced maximum was also observed experimentally for n + surfaces passivated either with Al 2 O 3 single layers or stacks of Al 2 O 3 capped by SiN x , when activated with a low temperature anneal (425 °C). In contrast, for Al 2 O 3 /SiN x stacks activated with a short high-temperature firing process (800 °C) a significant lower surface recombination was observed for most n + diffusion profiles without such a pronounced maximum. Based on experimentally determined interface properties and simulation results, we attribute this superior passivation quality after firing to a better chemical surface passivation, quantified by a lower interface defect density, in combination with a lower density of negative fixed charges. These experimental results reveal that Al 2 O 3 /SiN x stacks can provide not only excellent passivation on p + surfaces but also on n + surfaces for a wide range of surface doping concentrations when activated with short high-temperature treatments

Effective thermal conductivity and diffusivity of containment wall for nuclear power plant OPR1000

Energy Technology Data Exchange (ETDEWEB)

Noh, Hyung Gyun; Park, Hyun Sun [Div. of Advanced Nuclear Engineering (DANE), Pohang University of Science and Technology (POSTECH), Pohang (Korea, Republic of); Lee, Jong Hwi; Kang, Hie Chan [Mechanical Engineering Div., Kunsan National University (KNU), Gunsan (Korea, Republic of)

2017-04-15

The goal of this study is to evaluate the effective thermal conductivity and diffusivity of containment walls as heat sinks or passive cooling systems during nuclear power plant (NPP) accidents. Containment walls consist of steel reinforced concrete, steel liners, and tendons, and provide the main thermal resistance of the heat sinks, which varies with the volume fraction and geometric alignment of the rebar and tendons, as well as the temperature and chemical composition. The target geometry for the containment walls of this work is the standard Korean NPP OPR1000. Sample tests and numerical simulations are conducted to verify the correlations for models with different densities of concrete, volume fractions, and alignments of steel. Estimation of the effective thermal conductivity and diffusivity of the containment wall models is proposed. The Maxwell model and modified Rayleigh volume fraction model employed in the present work predict the experiment and finite volume method (FVM) results well. The effective thermal conductivity and diffusivity of the containment walls are summarized as functions of density, temperature, and the volume fraction of steel for the analysis of the NPP accidents.

Experimental data of global and diffuse luminous efficacy on vertical surfaces at Arcavacata di Rende and comparisons with calculation models

International Nuclear Information System (INIS)

Cucumo, M.; De Rosa, A.; Ferraro, V.; Kaliakatsos, D.; Marinelli, V.

2009-01-01

Measurements of natural global and diffuse illuminance on four vertical surfaces exposed to north, east, south and west have been carried out at Arcavacata di Rende (Italy). In the work the mean hourly values of the global and diffuse luminous efficacy measured in the period of a year are presented. The hourly data have been compared with the predictions of many calculation models. The comparisons show that, for global efficacy, the differences among the various models are not significant, and the use of a model with a constant value of efficacy gives good predictions of global illuminance. For the prediction of diffuse illuminance the different models behave in a similar way if their coefficients are recalculated and, again, the use of a constant diffuse efficacy provides a good estimate of diffuse illuminance on vertical surfaces

Memory Effects and Coverage Dependence of Surface Diffusion in a Model Adsorption System

DEFF Research Database (Denmark)

Vattulainen, Ilpo Tapio; Ying, S. C.; Ala-Nissila, T.

1999-01-01

in tracer and collective diffusion. We show that memory effects can be very pronounced deep inside the ordered phases and in regions close to first and second order phase transition boundaries. Particular attention is paid to the details of the time dependence of memory effects. The memory effect in tracer......We study the coverage dependence of surface diffusion coefficients for a strongly interacting adsorption system O/W(110) via Monte Carlo simulations of a lattice-gas model. In particular, we consider the nature and emergence of memory effects as contained in the corresponding correlation factors...... diffusion is found to decay following a power law after an initial transient period. This behavior persists until the hydrodynamic regime is reached, after which the memory effect decays exponentially. The time required to reach the hydrodynamical regime and the related exponential decay is strongly...

Modeling diffuse sources of surface water contamination with plant protection products

Science.gov (United States)

Wendland, Sandra; Bock, Michael; Böhner, Jürgen; Lembrich, David

2015-04-01

Entries of chemical pollutants in surface waters are a serious environmental problem. Among water pollutants plant protection products (ppp) from farming practice are of major concern not only for water suppliers and environmental agencies, but also for farmers and industrial manufacturers. Lost chemicals no longer fulfill their original purpose on the field, but lead to severe damage of the environment and surface waters. Besides point-source inputs of chemical pollutants, the diffuse-source inputs from agricultural procedures play an important and not yet sufficiently studied role concerning water quality. The two most important factors for diffuse inputs are erosion and runoff. The latter usually occurs before erosion begins, and is thus often not visible in hindsight. Only if it has come to erosion, it is obvious to expect runoff in foresight at this area, too. In addition to numerous erosion models, there are also few applications to model runoff processes available. However, these conventional models utilize approximations of catchment parameters based on long-term average values or theoretically calculated concentration peaks which can only provide indications to relative amounts. Our study aims to develop and validate a simplified spatially-explicit dynamic model with high spatiotemporal resolution that enables to measure current and forecast runoff potential not only at catchment scale but field-differentiated. This method allows very precise estimations of runoff risks and supports risk reduction measures to be targeted before fields are treated. By focusing on water pathways occurring on arable land, targeted risk reduction measures like buffer strips at certain points and adapted ppp use can be taken early and pollution of rivers and other surface waters through transported pesticides, fertilizers and their products could be nearly avoided or largely minimized. Using a SAGA-based physical-parametric modeling approach, major factors influencing runoff

Theme day: corrosion and surface treatments in nuclear facilities. Proceedings

International Nuclear Information System (INIS)

2012-02-01

This document brings together the available presentations given at the theme day organized by the Bourgogne Nuclear Pole on the topic of corrosion and surface treatments in nuclear facilities. Eleven presentations (slides) are compiled in this document: 1 - Introduction - PNB centre of competitiveness and R and D activities (A. Mantovan, PNB); 2 - Corrosion damage (M. Foucault, Areva NP - Centre Technique Le Creusot); 3 - Corrosion mechanisms (R. Oltra, UB-ICB); 4 - Examples of expertise management (C. Duret-Thual, Institut de la corrosion/Corrosion Institute); 5 - General framework of surface treatments (C. Nouveau, ENSAM Cluny Paris Tech); 6 - Surfaces et interfaces characterisation - Part A (C. Langlade, Y. Gachon, UTBM and HEF); 7 - Surfaces et interfaces characterisation - Part B (C. Langlade, Y. Gachon, UTBM and HEF); 8 - Ion beam surface treatment (Y. Le Guellec, Quertech Ingenierie); 9 - Impact surface treatment (G. Saout, Sonats); 10 - Metal oxides Characterisation by US laser (R. Oltra, UB-ICB); 11 - Detection and Characterisation of intergranular corrosion (Y. Kernin, Stephane Bourgois, Areva Intercontrole)

Surface Disturbances at the Punggye-ri Nuclear Test Site: Another Indicator of Nuclear Testing?

Energy Technology Data Exchange (ETDEWEB)

Pabian, Frank V. [Los Alamos National Laboratory; Coblentz, David [Los Alamos National Laboratory

2017-02-03

A review of available very high-resolution commercial satellite imagery (bracketing the time of North Korea’s most recent underground nuclear test on 9 September 2016 at the Punggye-ri Underground Nuclear Test Site) has led to the detection and identification of several minor surface disturbances on the southern flank of Mt. Mantap. These surface disturbances occur in the form of small landslides, either alone or together with small zones of disturbed bare rock that appear to have been vertically lofted (“spalled”) as a result of the most recent underground explosion. Typically, spall can be uniquely attributed to underground nuclear testing and is not a result of natural processes. However, given the time gap of up to three months between images (pre- and post-event), which was coincident with a period of heavy typhoon flooding in the area1, it is not possible to determine whether the small landslides were exclusively explosion induced, the consequence of heavy rainfall erosion, or some combination of the two.

Comparison of field-measured radon diffusion coefficients with laboratory-measured coefficients

International Nuclear Information System (INIS)

Lepel, E.A.; Silker, W.B.; Thomas, V.W.; Kalkwarf, D.R.

1983-04-01

Experiments were conducted to compare radon diffusion coefficients determined for 0.1-m depths of soils by a steady-state method in the laboratory and diffusion coefficients evaluated from radon fluxes through several-fold greater depths of the same soils covering uranium-mill tailings. The coefficients referred to diffusion in the total pore volume of the soils and are equivalent to values for the quantity, D/P, in the Generic Environmental Impact Statement on Uranium Milling prepared by the US Nuclear Regulatory Commission. Two soils were tested: a well-graded sand and an inorganic clay of low plasticity. For the flux evaluations, radon was collected by adsorption on charcoal following passive diffusion from the soil surface and also from air recirculating through an aluminum tent over the soil surface. An analysis of variance in the flux evaluations showed no significant difference between these two collection methods. Radon diffusion coefficients evaluated from field data were statistically indistinguishable, at the 95% confidence level, from those measured in the laboratory; however, the low precision of the field data prevented a sensitive validation of the laboratory measurements. From the field data, the coefficients were calculated to be 0.03 +- 0.03 cm 2 /s for the sand cover and 0.0036 +- 0.0004 cm 2 /s for the clay cover. The low precision in the coefficients evaluated from field data was attributed to high variation in radon flux with time and surface location at the field site

A multiscale MD-FE model of diffusion in composite media with internal surface interaction based on numerical homogenization procedure.

Science.gov (United States)

Kojic, M; Milosevic, M; Kojic, N; Kim, K; Ferrari, M; Ziemys, A

2014-02-01

Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts.

First-principles investigation of the electronic and Li-ion diffusion properties of LiFePO4 by sulfur surface modification

International Nuclear Information System (INIS)

Xu, Guigui; Zhong, Kehua; Zhang, Jian-Min; Huang, Zhigao

2014-01-01

We present a first-principles calculation for the electronic and Li-ion diffusion properties of the LiFePO 4 (010) surface modified by sulfur. The calculated formation energy indicates that the sulfur adsorption on the (010) surface of the LiFePO 4 is energetically favored. Sulfur is found to form Fe-S bond with iron. A much narrower band gap (0.67 eV) of the sulfur surface-modified LiFePO 4 [S-LiFePO 4 (010)] is obtained, indicating the better electronic conductive properties. By the nudged elastic band method, our calculations show that the activation energy of Li ions diffusion along the one-dimensional channel on the surface can be effectively reduced by sulfur surface modification. In addition, the surface diffusion coefficient of S-LiFePO 4 (010) is estimated to be about 10 −11 (cm 2 /s) at room temperature, which implies that sulfur modification will give rise to a higher Li ion carrier mobility and enhanced electrochemical performance

Effects of radiation and thermal diffusivity on heat transfer over a stretching surface with variable heat flux

International Nuclear Information System (INIS)

Seddeek, M.A.; Abdelmeguid, M.S.

2006-01-01

The effect of radiation and thermal diffusivity on heat transfer over a stretching surface with variable heat flux has been studied. The thermal diffusivity is assumed to vary as a linear function of temperature. The governing partial differential equations have been transformed to ordinary differential equations. The exact analytical solution for the velocity and the numerical solution for the temperature field are given. Numerical solutions are obtained for different values of variable thermal diffusivity, radiation, temperature parameter and Prandtl number

Diffusion Influenced Adsorption Kinetics.

Science.gov (United States)

Miura, Toshiaki; Seki, Kazuhiko

2015-08-27

When the kinetics of adsorption is influenced by the diffusive flow of solutes, the solute concentration at the surface is influenced by the surface coverage of solutes, which is given by the Langmuir-Hinshelwood adsorption equation. The diffusion equation with the boundary condition given by the Langmuir-Hinshelwood adsorption equation leads to the nonlinear integro-differential equation for the surface coverage. In this paper, we solved the nonlinear integro-differential equation using the Grünwald-Letnikov formula developed to solve fractional kinetics. Guided by the numerical results, analytical expressions for the upper and lower bounds of the exact numerical results were obtained. The upper and lower bounds were close to the exact numerical results in the diffusion- and reaction-controlled limits, respectively. We examined the validity of the two simple analytical expressions obtained in the diffusion-controlled limit. The results were generalized to include the effect of dispersive diffusion. We also investigated the effect of molecular rearrangement of anisotropic molecules on surface coverage.

Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

International Nuclear Information System (INIS)

Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

2005-01-01

We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

Production of a diffuse very high reflectivity material for light collection in nuclear detectors

CERN Document Server

Pichler, B J; Mirzoyan, R; Weiss, L; Ziegler, S I

2000-01-01

A diffuse very high reflectivity material, based on polytetrafluorethylene (PTFE) for optimization of light-collection efficiency has been developed. PTFE powder was used to produce reflector block material. The powder was pressed with 525 kPa in a form and sintered at 375 deg. C. The reflectivity was above 98% within the spectral range from 350 to 1000 nm. The blocks of this material are machinable with saws, drilling and milling machines. The reflector is used as a housing for scintillating crystals in a nuclear medicine application (small animal positron emission tomograph). It is also used as a light collector in very high-energy gamma-ray astrophysicas experiments, HEGRA and MAGIC. The application of this inexpensive, easy to make diffuse reflector may allow the optimization of light collection in a wide range of low-level light-detector configurations.

A general advection-diffusion model for radioactive substance dispersion released from nuclear power plants

International Nuclear Information System (INIS)

Buske, D.

2011-01-01

The present contribution focuses on the question of radioactive material dispersion after discharge from a nuclear power plant in the context of micro-meteorology, i.e. an atmospheric dispersion model. The advection-diffusion equation with Fickian closure for the turbulence is solved for the atmospheric boundary layer where the eddy diffusivity coefficients and the wind profile are assumed to be space dependent. The model is solved in closed form using integral transform and spectral theory. Convergence of the solution is discussed in terms of a convergence criterion using a new interpretation of the Cardinal Theorem of Interpolation theory and Parseval's theorem. The solution is compared to other methods and model adequacy is analyzed. Model validation is performed against experimental data from a controlled release of radioactive material at the Itaorna Beach (Angra dos Reis, Rio de Janeiro state, Brazil, 1985). (author)

Effect on the annual atmospheric dispersion factor of different diffusion parameters and meteorological data at nuclear power plant

International Nuclear Information System (INIS)

Hu Erbang; Yan Jiangyu; Wang Han; Xin Cuntian

2003-01-01

Based on the hourly metrological observing data of 100 m high tower during 1997-1999 at Tianwan Nuclear Power Plant (NPP) site and 1995-1997 in Fujian Huian NPP site, the effect on the annual atmospheric dispersion factor (AADF) of four different diffusion parameters (on-site measuring values, IAEA's, Briggs's and Pasquill's) are estimated. The analysis shows that the deviation between the results from IAEA's, Briggs's and on-site measured diffusion parameters is less than 20%. The effect on the AADF from different years' meteorological data also is estimated. (authors)

Surface diffusion coefficient of Au atoms on single layer graphene grown on Cu

Energy Technology Data Exchange (ETDEWEB)

Ruffino, F., E-mail: francesco.ruffino@ct.infn.it; Cacciato, G.; Grimaldi, M. G. [Dipartimento di Fisica ed Astronomia-Universitá di Catania, via S. Sofia 64, 95123 Catania, Italy and MATIS IMM-CNR, via S. Sofia 64, 95123 Catania (Italy)

2014-02-28

A 5 nm thick Au film was deposited on single layer graphene sheets grown on Cu. By thermal processes, the dewetting phenomenon of the Au film on the graphene was induced so to form Au nanoparticles. The mean radius, surface-to-surface distance, and surface density evolution of the nanoparticles on the graphene sheets as a function of the annealing temperature were quantified by scanning electron microscopy analyses. These quantitative data were analyzed within the classical mean-field nucleation theory so to obtain the temperature-dependent Au atoms surface diffusion coefficient on graphene: D{sub S}(T)=[(8.2±0.6)×10{sup −8}]exp[−(0.31±0.02(eV)/(at) )/kT] cm{sup 2}/s.

Diffraction and diffusion in room acoustics

DEFF Research Database (Denmark)

Rindel, Jens Holger; Rasmussen, Birgit

1996-01-01

Diffraction and diffusion are two phenomena that are both related to the wave nature of sound. Diffraction due to the finite size of reflecting surfaces and the design of single reflectors and reflector arrays are discussed. Diffusion is the result of scattering of sound reflected from surfaces...... that are not plane but curved or irregular. The importance of diffusion has been demonstrated in concert halls. Methods for the design of diffusing surfaces and the development of new types of diffusers are reviewed. Finally, the importance of diffraction and diffusion in room acoustic computer models is discussed....

Diffusion in building wakes

International Nuclear Information System (INIS)

Ramsdell, J.V.

1988-03-01

Straight-line Gaussian models adequately describe atmospheric diffusion for many applications. They have been modified for use in estimating diffusion in building wakes by adding terms that include projected building area and by redefining the diffusion coefficients so that the coefficients have minimum values that are related to building dimensions. In a recent study, Ramsdell reviewed the building-wake dispersion models used by the Nuclear Regulatory Commission (NRC) in its control room habitability assessments. The review included comparison of model estimates of centerline concentrations with concentrations observed in experiments at seven nuclear reactors. In general, the models are conservative in that they tend to predict concentrations that are greater than those actually observed. However, the models show little skill in accounting for variations in the observed concentrations. Subsequently, the experimental data and multiples linear regression techniques have been used to develop a new building wake diffusion model. This paper describes the new building wake model and compares it with other models. 8 refs., 2 figs

Global, direct and diffuse solar radiation on horizontal and tilted surfaces in Jeddah, Saudi Arabia

International Nuclear Information System (INIS)

El-Sebaii, A.A.; Al-Hazmi, F.S.; Al-Ghamdi, A.A.; Yaghmour, S.J.

2010-01-01

The measured data of global and diffuse solar radiation on a horizontal surface, the number of bright sunshine hours, mean daily ambient temperature, maximum and minimum ambient temperatures, relative humidity and amount of cloud cover for Jeddah (lat. 21 o 42'37''N, long. 39 o 11'12''E), Saudi Arabia, during the period (1996-2007) are analyzed. The monthly averages of daily values for these meteorological variables have been calculated. The data are then divided into two sets. The sub-data set I (1996-2004) are employed to develop empirical correlations between the monthly average of daily global solar radiation fraction (H/H 0 ) and the various weather parameters. The sub-data set II (2005-2007) are then used to evaluate the derived correlations. Furthermore, the total solar radiation on horizontal surfaces is separated into the beam and diffuses components. Empirical correlations for estimating the diffuse solar radiation incident on horizontal surfaces have been proposed. The total solar radiation incident on a tilted surface facing south H t with different tilt angles is then calculated using both Liu and Jordan isotropic model and Klucher's anisotropic model. It is inferred that the isotropic model is able to estimate H t more accurate than the anisotropic one. At the optimum tilt angle, the maximum value of H t is obtained as ∼36 (MJ/m 2 day) during January. Comparisons with 22 years average data of NASA SSE Model showed that the proposed correlations are able to predict the total annual energy on horizontal and tilted surfaces in Jeddah with a reasonable accuracy. It is also found that at Jeddah, the solar energy devices have to be tilted to face south with a tilt angle equals the latitude of the place in order to achieve the best performance all year round.

Effects of Surface Structure and of Embedded-Atom Pair Functionals on Adatom Diffusion on FCC Metallic Surfaces

Science.gov (United States)

1992-11-01

is more compact relative to that in the [001] direction. Detailed MD studies (De Lorenzi, Jacucci, and Pontikis 1982), using Lennard-Jones...Jacucci, and Pontikis 1982) have shown that the predominance of the adatom exchange mechanism results in nearly isotropic diffusion which is further...G., G. Jacucci, and V. Pontikis . Surface Science, vol. 116, p. 391, 1982. Doll, J. D., and A. F. Voter. Ann. Rev. Phys. Chem., vol. 38, p. 413, 1987

A multiscale MD–FE model of diffusion in composite media with internal surface interaction based on numerical homogenization procedure

Science.gov (United States)

Kojic, M.; Milosevic, M.; Kojic, N.; Kim, K.; Ferrari, M.; Ziemys, A.

2014-01-01

Mass transport by diffusion within composite materials may depend not only on internal microstructural geometry, but also on the chemical interactions between the transported substance and the material of the microstructure. Retrospectively, there is a gap in methods and theory to connect material microstructure properties with macroscale continuum diffusion characteristics. Here we present a new hierarchical multiscale model for diffusion within composite materials that couples material microstructural geometry and interactions between diffusing particles and the material matrix. This model, which bridges molecular dynamics (MD) and the finite element (FE) method, is employed to construct a continuum diffusion model based on a novel numerical homogenization procedure. The procedure is general and robust for evaluating constitutive material parameters of the continuum model. These parameters include the traditional bulk diffusion coefficients and, additionally, the distances from the solid surface accounting for surface interaction effects. We implemented our models to glucose diffusion through the following two geometrical/material configurations: tightly packed silica nanospheres, and a complex fibrous structure surrounding nanospheres. Then, rhodamine 6G diffusion analysis through an aga-rose gel network was performed, followed by a model validation using our experimental results. The microstructural model, numerical homogenization and continuum model offer a new platform for modeling and predicting mass diffusion through complex biological environment and within composite materials that are used in a wide range of applications, like drug delivery and nanoporous catalysts. PMID:24578582

Effective Thermal Conductivity and Diffusivity of Containment Wall for Nuclear Power Plant OPR1000

Directory of Open Access Journals (Sweden)

Hyung Gyun Noh

2017-04-01

Full Text Available The goal of this study is to evaluate the effective thermal conductivity and diffusivity of containment walls as heat sinks or passive cooling systems during nuclear power plant (NPP accidents. Containment walls consist of steel reinforced concrete, steel liners, and tendons, and provide the main thermal resistance of the heat sinks, which varies with the volume fraction and geometric alignment of the rebar and tendons, as well as the temperature and chemical composition. The target geometry for the containment walls of this work is the standard Korean NPP OPR1000. Sample tests and numerical simulations are conducted to verify the correlations for models with different densities of concrete, volume fractions, and alignments of steel. Estimation of the effective thermal conductivity and diffusivity of the containment wall models is proposed. The Maxwell model and modified Rayleigh volume fraction model employed in the present work predict the experiment and finite volume method (FVM results well. The effective thermal conductivity and diffusivity of the containment walls are summarized as functions of density, temperature, and the volume fraction of steel for the analysis of the NPP accidents.

Concrete decontamination: two innovative processes in response to surface or deep contamination

International Nuclear Information System (INIS)

CUER, F.; Nadai, A. de; Faure, S.

2008-01-01

To meet the future needs in the nuclear industry as regards dismantling and decommissioning, the LPAD (Laboratoire des Procedes Avances de Decontamination) develops new specific techniques to decontaminate concretes: the drying gel process adapted to surface contamination and the electrokinetics process to treat deep contamination. Indeed, because the concrete constitute a porous medium, two types of contamination can be met according to the environment to which is subjected the material. In the case of an accidental or dry contamination, radio elements do not penetrate beyond the first millimeters of the material. The contamination is then considered as surface. On the contrary, the contamination is considered as 'deep' when radioactive ions have diffused deeply under the effects of the natural diffusion. This is the case in fuel storage pond or other many nuclear infrastructures. (authors)

Nuclear magnetic resonance study of diffusion and relaxation in hydrating white cement pastes of different water content

International Nuclear Information System (INIS)

Nestle, Nikolaus; Galvosas, Petrik; Geier, Oliver; Zimmermann, Christian; Dakkouri, Marwan; Karger, Jorg

2001-01-01

While the nuclear spin relaxation time changes in hydrating cement materials have been widely studied by various groups during the last 20 years, data on the self-diffusion behavior of the pore water during hydration of a cement paste are much scarcer. Taking advantage of improved spectrometer hardware for pulsed field gradient diffusometry and a specialized pulse sequence which is designed to compensate the detrimental effects of inner magnetic field gradients in the sample we have studied the water self-diffusion behavior in pastes prepared from white cement at various water/cement ratios. For the same mixtures, studies of the transverse spin relaxation behavior were also conducted. A comparison of the results from both techniques shows that the diffusion coefficient starts to decrease only much later than the relaxation times for all pastes studied. [copyright] 2001 American Institute of Physics

Time-resolved measurements of laser-induced diffusion of CO molecules on stepped Pt(111)-surfaces; Zeitaufgeloeste Untersuchung der laser-induzierten Diffusion von CO-Molekuelen auf gestuften Pt(111)-Oberflaechen

Energy Technology Data Exchange (ETDEWEB)

Lawrenz, M.

2007-10-30

In the present work the dynamics of CO-molecules on a stepped Pt(111)-surface induced by fs-laser pulses at low temperatures was studied by using laser spectroscopy. In the first part of the work, the laser-induced diffusion for the CO/Pt(111)-system could be demonstrated and modelled successfully for step diffusion. At first, the diffusion of CO-molecules from the step sites to the terrace sites on the surface was traced. The experimentally discovered energy transfer time of 500 fs for this process confirms the assumption of an electronically induced process. In the following it was explained how the experimental results were modelled. A friction coefficient which depends on the electron temperature yields a consistent model, whereas for the understanding of the fluence dependence and time-resolved measurements parallel the same set of parameters was used. Furthermore, the analysis was extended to the CO-terrace diffusion. Small coverages of CO were adsorbed to the terraces and the diffusion was detected as the temporal evolution of the occupation of the step sites acting as traps for the diffusing molecules. The additional performed two-pulse correlation measurements also indicate an electronically induced process. At the substrate temperature of 40 K the cross-correlation - where an energy transfer time of 1.8 ps was extracted - suggests also an electronically induced energy transfer mechanism. Diffusion experiments were performed for different substrate temperatures. (orig.)

The nuclear Thomas-Fermi model

International Nuclear Information System (INIS)

Myers, W.D.; Swiatecki, W.J.

1994-08-01

The statistical Thomas-Fermi model is applied to a comprehensive survey of macroscopic nuclear properties. The model uses a Seyler-Blanchard effective nucleon-nucleon interaction, generalized by the addition of one momentum-dependent and one density-dependent term. The adjustable parameters of the interaction were fitted to shell-corrected masses of 1654 nuclei, to the diffuseness of the nuclear surface and to the measured depths of the optical model potential. With these parameters nuclear sizes are well reproduced, and only relatively minor deviations between measured and calculated fission barriers of 36 nuclei are found. The model determines the principal bulk and surface properties of nuclear matter and provides estimates for the more subtle, Droplet Model, properties. The predicted energy vs density relation for neutron matter is in striking correspondence with the 1981 theoretical estimate of Friedman and Pandharipande. Other extreme situations to which the model is applied are a study of Sn isotopes from 82 Sn to 170 Sn, and the rupture into a bubble configuration of a nucleus (constrained to spherical symmetry) which takes place when Z 2 /A exceeds about 100

Self-learning kinetic Monte Carlo simulations of self-diffusion of small Ag islands on the Ag(111) surface

International Nuclear Information System (INIS)

Shah, Syed Islamuddin; Nandipati, Giridhar; Rahman, Talat S; Karim, Altaf

2016-01-01

We studied self-diffusion of small two-dimensional Ag islands, containing up to ten atoms, on the Ag(111) surface using self-learning kinetic Monte Carlo (SLKMC) simulations. Activation barriers are calculated using the semi-empirical embedded atom method (EAM) potential. We find that two- to seven-atom islands primarily diffuse via concerted translation processes with small contributions from multi-atom and single-atom processes, while eight- to ten-atom islands diffuse via single-atom processes, especially edge diffusion, corner rounding and kink detachment, along with a minimal contribution from concerted processes. For each island size, we give a detailed description of the important processes, and their activation barriers, responsible for its diffusion. (paper)

A high-order boundary integral method for surface diffusions on elastically stressed axisymmetric rods.

Science.gov (United States)

Li, Xiaofan; Nie, Qing

2009-07-01

Many applications in materials involve surface diffusion of elastically stressed solids. Study of singularity formation and long-time behavior of such solid surfaces requires accurate simulations in both space and time. Here we present a high-order boundary integral method for an elastically stressed solid with axi-symmetry due to surface diffusions. In this method, the boundary integrals for isotropic elasticity in axi-symmetric geometry are approximated through modified alternating quadratures along with an extrapolation technique, leading to an arbitrarily high-order quadrature; in addition, a high-order (temporal) integration factor method, based on explicit representation of the mean curvature, is used to reduce the stability constraint on time-step. To apply this method to a periodic (in axial direction) and axi-symmetric elastically stressed cylinder, we also present a fast and accurate summation method for the periodic Green's functions of isotropic elasticity. Using the high-order boundary integral method, we demonstrate that in absence of elasticity the cylinder surface pinches in finite time at the axis of the symmetry and the universal cone angle of the pinching is found to be consistent with the previous studies based on a self-similar assumption. In the presence of elastic stress, we show that a finite time, geometrical singularity occurs well before the cylindrical solid collapses onto the axis of symmetry, and the angle of the corner singularity on the cylinder surface is also estimated.

Nuclear fuel element and container

International Nuclear Information System (INIS)

Grubb, W.T.; King, L.H.

1981-01-01

The invention is based on the discovery that a substantial reduction in metal embrittlement or stress corrosion cracking from fuel pellet-cladding interaction can be achieved by the use of a copper layer or liner in proximity to the nuclear fuel, and an intermediate zirconium oxide barrier layer between the copper layer and the zirconium cladding substrate. The intermediate zirconia layer is a good copper diffusion barrier; also, if the zirconium cladding surface is modified prior to oxidation, copper can be deposited by electroless plating. A nuclear fuel element is described which comprises a central core of fuel material and an elongated container using the system outlined above. The method for making the container is again described. It comprises roughening or etching the surface of the zirconium or zirconium alloy container, oxidizing the resulting container, activating the oxidized surface to allow for the metallic coating of such surfaces by electroless deposition and further coating the activated-oxidized surface of the zirconium or zirconium alloy container with copper, iron or nickel or an alloy thereof. (U.K.)

Introduction to the nuclear criticality safety evaluation of facility X-705, Portsmouth Gaseous Diffusion Plant

International Nuclear Information System (INIS)

Sheaffer, M.K.; Keeton, S.C.

1993-01-01

This report is the first in a series of documents that will evaluate nuclear criticality safety in the Decontamination and Recovery Facility, X-705, Portsmouth Gaseous Diffusion Plant. It provides an overview of the facility, categorizes its functions for future analysis, reviews existing NCS documentation, and explains the follow-on effort planned for X-705. A detailed breakdown of systems, subsystems, and operational areas is presented and cross-referenced to existing NCS documentation

First-principles study of hydrogen dissociation and diffusion on transition metal-doped Mg(0 0 0 1) surfaces

International Nuclear Information System (INIS)

Wang, Zhiwen; Guo, Xinjun; Wu, Mingyi; Sun, Qiang; Jia, Yu

2014-01-01

First-principles calculations within the density functional theory (DFT) have been carried out to study hydrogen molecules dissociation and diffusion on clean and transition metals (TMs) doped Mg(0 0 0 1) surfaces following Pozzo et al. work. Firstly, the stability of Mg(0 0 0 1) surface doped with transition metals atom has been studied. The results showed that transition metals on the left of the table tend to substitute Mg in the second layer, while the other transition metals prefer to substitute Mg in the first layer. Secondly, we studied hydrogen molecules dissociation and diffusion on clean and Mg(0 0 0 1) surfaces which the transition metal atoms substituted both in the first layer and second layer. When transition metal atoms substitute in the first layer, the results agree with the Pozzo et al. result; when transition metal atoms substitute in the second layer, the results showed that the transition metals on the left of the periodic table impact on the dissociation barriers is less. However, for the transition metals (Mn, Fe, Co, Ni) on the right, there is a great impact on the barriers. The transition metals doped surfaces bind the dissociated H atoms loosely, making them easily diffused. The results further reveal that the Fe dopant on the Mg surface is the best choice for H 2 dissociation and hydrogen storage.

Effect of lead species on the durability of simulated nuclear waste glass

International Nuclear Information System (INIS)

Kuchinski, F.A.

1987-01-01

It has been shown that the incorporation of lead metal into the corrosion environment reduces the leaching rate of nuclear waste glasses. The present study evaluated the effects of lead metal, oxides, alloys, glasses and soluble species on the corrosion rate of a waste glass. The inherent durability of nuclear waste glasses comes from the about due to the insoluble surface film developed during corrosion. This surface film, enriched with iron, aluminum and calcium acts as a diffusion barrier to further corrosion. Except for PbO 2 , all lead species inhibited glass corrosion due to the formation of a surface film enriched in lead. No corroded glass layer was observed below the lead surface layer. Also, no glass corrosion products were found on the lead surface, except for small amounts of silicon. The transport and deposition of lead on the glass surface appears to be the key factors in preventing glass corrosion. At high glass surface area to volume ratios, the glass corroded considerably at short times since the dissolved lead source could not coat the entire glass surface rapidly enough to prevent continued corrosion. Also, experimental solution values did not agree with thermodynamics model predictions. This suggests that kinetic factors, namely diffusion barriers, are controlling the glass corrosion rate

Thermal conductivity thermal diffusivity of UO{sub 2}-BeO nuclear fuel pellets

Energy Technology Data Exchange (ETDEWEB)

Mansur, Fábio A.; Camarano, Denise M.; Santos, Ana M. M.; Ferraz, Wilmar B.; Silva, Mayra A.; Ferreira, Ricardo A.N., E-mail: fam@cdtn.br, E-mail: dmc@cdtn.br, E-mail: amms@cdtn.br, E-mail: ferrazw@cdtn.br, E-mail: mayra.silva@cdtn.br, E-mail: ricardoanf@yahoo.com.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)

2017-07-01

The temperature distribution in nuclear fuel pellets is of vital importance for the performance of the reactor, as it affects the heat transfer, the mechanical behavior and the release of fission gas during irradiation, reducing safety margins in possible accident scenarios. One of the main limitation for the current uranium dioxide nuclear fuel (UO{sub 2}) is its low thermal conductivity, responsible for the higher temperature of the pellet center and, consequently, for a higher radial temperature gradient. Thus, the addition of another material to increase the UO{sub 2} fuel thermal conductivity has been considered. Among the additives that are being investigated, beryllium oxide (BeO) has been chosen due to its high thermal conductivity, with potential to optimize power generation in pressurized light water reactors (PWR). In this work, UO{sub 2}-BeO pellets were obtained by the physical mixing of the powders with additions of 2wt% and 3wt% of BeO. The thermal diffusivity and conductivity of the pellets were determined from room temperature up to 500 °C. The results were normalized to 95% of the theoretical density (TD) of the pellets and varied according to the BeO content. The range of the values of thermal diffusivity and conductivity were 1.22 mm{sup 2}∙s{sup -1} to 3.69 mm{sup 2}∙s{sup -1} and 3.80 W∙m{sup -}'1∙K{sup -1} to 9.36 W∙m{sup -1}∙K{sup -1}, respectively. (author)

Dose Prediction for surface nuclear explosions: case studies for Semipalatinsk and Lop Nur tests

International Nuclear Information System (INIS)

Takada, Jun

2008-01-01

Dose prediction method RAPS after surface nuclear explosion has been developed by using the empirical dose function of USA nuclear test. This method which provides us external total dose, dose rate at any distant, at any time for any yield of nuclear explosion, is useful for radiation protection in case of nuclear events such as terrorism and nuclear war. The validity of RAPS has been confirmed by application to historical surface nuclear test explosions. The first test case study which was done for the first test explosion of the former USSR at the Semipalatinsk Nuclear Test Site on August 29th 1949, shows a good agreement with luminescence dosimetry on a brick. This dose prediction method was applied nuclear tests in Lop Nur. The results indicate dangerous nuclear radiation influences including fatal risk in the wide Uygur area. (author)

Contribution of diffuser surfaces to efficiency of tilted T shape parallel highway noise barriers

Directory of Open Access Journals (Sweden)

N. Javid Rouzi

2009-04-01

Full Text Available Background and aimsThe paper presents the results of an investigation on the acoustic  performance of tilted profile parallel barriers with quadratic residue diffuser tops and faces.MethodsA2D boundary element method (BEM is used to predict the barrier insertion loss. The results of rigid and with absorptive coverage are also calculated for comparisons. Using QRD on the top surface and faces of all tilted profile parallel barrier models introduced here is found to  improve the efficiency of barriers compared with rigid equivalent parallel barrier at the examined  receiver positions.Results Applying a QRD with frequency design of 400 Hz on 5 degrees tilted parallel barrier  improves the overall performance of its equivalent rigid barrier by 1.8 dB(A. Increase the treated surfaces with reactive elements shifts the effective performance toward lower frequencies. It is  found that by tilting the barriers from 0 to 10 degrees in parallel set up, the degradation effects in  parallel barriers is reduced but the absorption effect of fibrous materials and also diffusivity of thequadratic residue diffuser is reduced significantly. In this case all the designed barriers have better  performance with 10 degrees tilting in parallel set up.ConclusionThe most economic traffic noise parallel barrier, which produces significantly  high performance, is achieved by covering the top surface of the barrier closed to the receiver by  just a QRD with frequency design of 400 Hz and tilting angle of 10 degrees. The average Aweighted  insertion loss in this barrier is predicted to be 16.3 dB (A.

Radon diffusion in polymer vessels using CR-39 solid state nuclear track detector

Energy Technology Data Exchange (ETDEWEB)

Carneiro, Andre Cavalcanti; Menezes, Maria Angela de B.C.; Rocha, Zildete; Pereira, Marcio Tadeu, E-mail: andreccarneiro@gmail.com, E-mail: menezes@cdtn.br, E-mail: zildete@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Santos, Talita de Oliveira; Lara, Evelise Gomes; Braga, Mario Roberto Martins S.S., E-mail: mariomartins@gmail.com, E-mail: evelise.lara@gmail.com, E-mail: talitaolsantos@yahoo.com.br [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil)

2015-07-01

At CDTN/CNEN, the method to determine {sup 226}Ra in several matrices by gamma spectrometry is already established; however, the method should be improved. This paper is about the first step of this improvement. Several polymer vessels were studied verifying the effect of radiolysis on the walls of the vessel. A test about the diffusion of {sup 222}Rn through the walls was carried out using the CR-39 solid state nuclear track detector. The results pointed out that the vessel made up by acrylic material is the best candidate to replace the vessel actually used. (author)

Diffusion bonding

International Nuclear Information System (INIS)

Anderson, R.C.

1976-01-01

A method is described for joining beryllium to beryllium by diffusion bonding. At least one surface portion of at least two beryllium pieces is coated with nickel. A coated surface portion is positioned in a contiguous relationship with another surface portion and subjected to an environment having an atmosphere at a pressure lower than ambient pressure. A force is applied on the beryllium pieces for causing the contiguous surface portions to abut against each other. The contiguous surface portions are heated to a maximum temperature less than the melting temperature of the beryllium, and the applied force is decreased while increasing the temperature after attaining a temperature substantially above room temperature. A portion of the applied force is maintained at a temperature corresponding to about maximum temperature for a duration sufficient to effect the diffusion bond between the contiguous surface portions

Advection and diffusion in random media implications for sea surface temperature anomalies

CERN Document Server

Piterbarg, Leonid I

1997-01-01

The book presents the foundations of the theory of turbulent transport within the context of stochastic partial differential equations. It serves to establish a firm connection between rigorous and non-rigorous results concerning turbulent diffusion. Mathematically all of the issues addressed in this book are concentrated around a single linear equation: stochastic advection-diffusion (transport) equation. There is no attempt made to derive universal statistics for turbulent flow. Instead emphasis is placed on a statistical description of a passive scalar (tracer) under given velocity statistics. An application concerning transport of sea surface temperature anomalies reconciles the developed theory and a highly practical issue of modern physical oceanography by using the newly designed inversion techniques which take advantage of powerful maximum likelihood and autoregressive estimators. Audience: Graduate students and researchers in mathematics, fluid dynamics, and physical oceanography.

Size dependent diffusive parameters and tensorial diffusion equations in neutronic models for optically small nuclear systems

International Nuclear Information System (INIS)

Premuda, F.

1983-01-01

Two lines in improved neutron diffusion theory extending the efficiency of finite-difference diffusion codes to the field of optically small systems, are here reviewed. The firs involves the nodal solution for tensorial diffusion equation in slab geometry and tensorial formulation in parallelepiped and cylindrical gemometry; the dependence of critical eigenvalue from small slab thicknesses is also analitically investigated and finally a regularized tensorial diffusion equation is derived for slab. The other line refer to diffusion models formally unchanged with respect to the classical one, but where new size-dependent RTGB definitions for diffusion parameters are adopted, requiring that they allow to reproduce, in diffusion approach, the terms of neutron transport global balance; the trascendental equation for the buckling, arising in slab, sphere and parallelepiped geometry from the above requirement, are reported and the sizedependence of the new diffusion coefficient and extrapolated end point is investigated

Adsorption and diffusion of fluorine on Cr-doped Ni(111) surface: Fluorine-induced initial corrosion of non-passivated Ni-based alloy

Energy Technology Data Exchange (ETDEWEB)

Ren, Cui-Lan, E-mail: rencuilan@sinap.ac.cn [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China); Han, Han [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Gong, Wen-Bin [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Suzhou Institute of Nano-Tech and Nano-Bionics, Chinese Academy of Sciences, Shanghai 215123 (China); Wang, Cheng-Bin; Zhang, Wei [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China); Cheng, Cheng [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Huai, Ping, E-mail: huaiping@sinap.ac.cn [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Zhu, Zhi-Yuan [Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Laboratory of Interfacial Physics and Technology, Chinese Academy of Sciences, Shanghai 201800 (China)

2016-09-15

Adsorption and diffusion behaviors of fluorine on Cr-doped Ni(111) surface are investigated by using first-principles simulation. It shows that the Cr in the Cr-doped Ni(111) surface serve a trap site for fluorine with adsorption energy 3.52 eV, which is 1.04 eV higher than that on Ni(111) surface. Moreover, the Cr atom is pulled out the surface for 0.41 Å after the fluorine adsorption, much higher than that on Ni(111) surface. Further diffusion behaviors analysis confirms the conclusion because the fluorine diffusion from neighbored sites onto the Cr top site is an energy barrierless process. Detailed electronic structure analysis shows that a deeper hybrid state of F 2 p-Cr 3 d indicates a strong F−Cr interaction. The Ni−Cr bond is elongated and weakened due to the new formed F−Cr bonding. Our results help to understanding the basic fluorine-induced initial corrosion mechanism for Ni-based alloy in molten salt environment.

Nanoporous, Metal Carbide, Surface Diffusion Membranes for High Temperature Hydrogen Separations

Energy Technology Data Exchange (ETDEWEB)

Way, J. Douglas [Colorado School of Mines, Golden, CO (United States). Dept. of Chemical and Biological Engineering; Wolden, Colin A. [Colorado School of Mines, Golden, CO (United States)

2013-09-30

Colorado School of Mines (CSM) developed high temperature, hydrogen permeable membranes that contain no platinum group metals with the goal of separating hydrogen from gas mixtures representative of gasification of carbon feedstocks such as coal or biomass in order to meet DOE NETL 2015 hydrogen membrane performance targets. We employed a dual synthesis strategy centered on transition metal carbides. In the first approach, novel, high temperature, surface diffusion membranes based on nanoporous Mo₂C were fabricated on ceramic supports. These were produced in a two step process that consisted of molybdenum oxide deposition followed by thermal carburization. Our best Mo₂C surface diffusion membrane achieved a pure hydrogen flux of 367 SCFH/ft² at a feed pressure of only 20 psig. The highest H₂/N₂ selectivity obtained with this approach was 4.9. A transport model using “dusty gas” theory was derived to describe the hydrogen transport in the Mo₂C coated, surface diffusion membranes. The second class of membranes developed were dense metal foils of BCC metals such as vanadium coated with thin (< 60 nm) Mo₂C catalyst layers. We have fabricated a Mo₂C/V composite membrane that in pure gas testing delivered a H₂ flux of 238 SCFH/ft² at 600 °C and 100 psig, with no detectable He permeance. This exceeds the 2010 DOE Target flux. This flux is 2.8 times that of pure Pd at the same membrane thickness and test conditions and over 79% of the 2015 flux target. In mixed gas testing we achieved a permeate purity of ≥99.99%, satisfying the permeate purity milestone, but the hydrogen permeance was low, ~0.2 SCFH/ft².psi. However, during testing of a Mo₂C coated Pd alloy membrane with DOE 1 feed gas mixture a hydrogen permeance of >2 SCFH/ft².psi was obtained which was stable during the entire test, meeting the permeance associated with

First-principles simulations of iron with nitrogen: from surface adsorption to bulk diffusion

International Nuclear Information System (INIS)

Wu, M H; Liu, X H; Gu, J F; Jin, Z H

2013-01-01

Adsorption, absorption and diffusion pathways of nitrogen are studied for ferromagnetic body-centered cubic iron via spin-polarized density functional theory in combination with the climbing image nudged elastic band method. The computed data suggest that, depending on the coverage of N atoms, N prefers to stay on particular surface sites. Once pinned down well below the surface, N prefers to move into octahedral interstices rather than tetrahedral interstices. However, the tetrahedral interstices are crucial because they act as transition states and yield the saddle point energies of the corresponding minimum energy pathways. In comparison with carbon, we found that nitrogen prefers a different pathway from the (1 0 0) surface to the subsurface due to its strong repulsive interaction with Fe ions. (paper)

Permeability estimation from NMR diffusion measurements in reservoir rocks.

Science.gov (United States)

Balzarini, M; Brancolini, A; Gossenberg, P

1998-01-01

It is well known that in restricted geometries, such as in porous media, the apparent diffusion coefficient (D) of the fluid depends on the observation time. From the time dependence of D, interesting information can be derived to characterise geometrical features of the porous media that are relevant in oil industry applications. In particular, the permeability can be related to the surface-to-volume ratio (S/V), estimated from the short time behaviour of D(t), and to the connectivity of the pore space, which is probed by the long time behaviour of D(t). The stimulated spin-echo pulse sequence, with pulsed magnetic field gradients, has been used to measure the diffusion coefficients on various homogeneous and heterogeneous sandstone samples. It is shown that the petrophysical parameters obtained by our measurements are in good agreement with those yielded by conventional laboratory techniques (gas permeability and electrical conductivity). Although the diffusing time is limited by T1, eventually preventing an observation of the real asymptotic behaviour, and the surface-to-volume ratio measured by nuclear magnetic resonance is different from the value obtained by BET because of the different length scales probed, the measurement remains reliable and low-time consuming.

Models of diffuse solar radiation

Energy Technology Data Exchange (ETDEWEB)

Boland, John; Ridley, Barbara [Centre for Industrial and Applied Mathematics, University of South Australia, Mawson Lakes Boulevard, Mawson Lakes, SA 5095 (Australia); Brown, Bruce [Department of Statistics and Applied Probability, National University of Singapore, Singapore 117546 (Singapore)

2008-04-15

For some locations both global and diffuse solar radiation are measured. However, for many locations, only global is measured, or inferred from satellite data. For modelling solar energy applications, the amount of radiation on a tilted surface is needed. Since only the direct component on a tilted surface can be calculated from trigonometry, we need to have diffuse on the horizontal available. There are regression relationships for estimating the diffuse on a tilted surface from diffuse on the horizontal. Models for estimating the diffuse radiation on the horizontal from horizontal global that have been developed in Europe or North America have proved to be inadequate for Australia [Spencer JW. A comparison of methods for estimating hourly diffuse solar radiation from global solar radiation. Sol Energy 1982; 29(1): 19-32]. Boland et al. [Modelling the diffuse fraction of global solar radiation on a horizontal surface. Environmetrics 2001; 12: 103-16] developed a validated model for Australian conditions. We detail our recent advances in developing the theoretical framework for the approach reported therein, particularly the use of the logistic function instead of piecewise linear or simple nonlinear functions. Additionally, we have also constructed a method, using quadratic programming, for identifying values that are likely to be erroneous. This allows us to eliminate outliers in diffuse radiation values, the data most prone to errors in measurement. (author)

Self-diffusion dynamic behavior of atomic clusters on Re(0 0 0 1) surface

Energy Technology Data Exchange (ETDEWEB)

Liu Fusheng [Department of Applied Physics, Hunan University, Changsha 410082 (China); Hu Wangyu, E-mail: wangyuhu2001cn@yahoo.com.cn [Department of Applied Physics, Hunan University, Changsha 410082 (China); Deng Huiqiu; Luo Wenhua; Xiao Shifang [Department of Applied Physics, Hunan University, Changsha 410082 (China); Yang Jianyu [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China)

2009-08-15

Using molecular dynamics simulations and a modified analytic embedded atom potential, the self-diffusion dynamics of rhenium atomic clusters up to seven atoms on Re(0 0 0 1) surface have been studied in the temperature ranges from 600 K to 1900 K. The simulation time varies from 20 ns to 200 ns according to the cluster sizes and the temperature. The heptamer and trimer are more stable comparing to other neighboring non-compact clusters. The diffusion coefficients of clusters are derived from the mean square displacement of cluster's mass-center, and diffusion prefactors D{sub 0} and activation energies E{sub a} are derived from the Arrhenius relation. It is found that the Arrhenius relation of the adatom can be divided into two parts at different temperature range. The activation energy of clusters increases with the increasing of the atom number in clusters. The prefactor of the heptamer is 2-3 orders of magnitude higher than a usual prefactor because of a large number of nonequivalent diffusion processes. The trimer and heptamer are the nuclei at different temperature range according to the nucleation theory.

A mechanistic model for long-term nuclear waste glass dissolution integrating chemical affinity and interfacial diffusion barrier

Energy Technology Data Exchange (ETDEWEB)

Ma, Teqi [Northwest Institute of Nuclear Technology, No.28 Pingyu Road, Baqiao District, Xi' an,Shaanxi, 710024 (China); Mechanics and Physics of Solids Research Group, Modelling and Simulation Centre, The University of Manchester, Oxford Road, Manchester, M13 9PL (United Kingdom); Jivkov, Andrey P., E-mail: andrey.jivkov@manchester.ac.uk [Mechanics and Physics of Solids Research Group, Modelling and Simulation Centre, The University of Manchester, Oxford Road, Manchester, M13 9PL (United Kingdom); Li, Weiping; Liang, Wei; Wang, Yu; Xu, Hui [Northwest Institute of Nuclear Technology, No.28 Pingyu Road, Baqiao District, Xi' an,Shaanxi, 710024 (China); Han, Xiaoyuan, E-mail: xyhan_nint@sina.cn [Northwest Institute of Nuclear Technology, No.28 Pingyu Road, Baqiao District, Xi' an,Shaanxi, 710024 (China)

2017-04-01

Understanding the alteration of nuclear waste glass in geological repository conditions is critical element of the analysis of repository retention function. Experimental observations of glass alterations provide a general agreement on the following regimes: inter-diffusion, hydrolysis process, rate drop, residual rate and, under very particular conditions, resumption of alteration. Of these, the mechanisms controlling the rate drop and the residual rate remain a subject of dispute. This paper offers a critical review of the two most competitive models related to these regimes: affinity–limited dissolution and diffusion barrier. The limitations of these models are highlighted by comparison of their predictions with available experimental evidence. Based on the comprehensive discussion of the existing models, a new mechanistic model is proposed as a combination of the chemical affinity and diffusion barrier concepts. It is demonstrated how the model can explain experimental phenomena and data, for which the existing models are shown to be not fully adequate.

Investigation of the electrochemically active surface area and lithium diffusion in graphite anodes by a novel OsO4 staining method

Science.gov (United States)

Pfaffmann, Lukas; Birkenmaier, Claudia; Müller, Marcus; Bauer, Werner; Mitsch, Tim; Feinauer, Julian; Krämer, Yvonne; Scheiba, Frieder; Hintennach, Andreas; Schleid, Thomas; Schmidt, Volker; Ehrenberg, Helmut

2016-03-01

Negative electrodes of lithium-ion batteries generally consist of graphite-based active materials. In order to realize batteries with a high current density and therefore accelerated charging processes, the intercalation of lithium and the diffusion processes of these carbonaceous materials must be understood. In this paper, we visualized the electrochemical active surface area for three different anode materials using a novel OsO4 staining method in combination with scanning electron microscopy techniques. The diffusion behavior of these three anode materials is investigated by potentiostatic intermittent titration technique measurements. From those we determine the diffusion coefficient with and without consideration of the electrochemical active surface area.

Design of an analytical aggregation of rules of a diffuse controller and its application in the model of a nuclear research reactor

International Nuclear Information System (INIS)

Najera H, M.C.

2003-01-01

As they have gone being managed complex systems that fulfill tasks inside industrial or nuclear processes, it becomes necessary the development of technical novel of control, in which can incorporate heuristic knowledge of operation without to necessarily use the theories of classic control based mainly in mathematical models. One of the control techniques that allows to carry out this is the control based on diffuse logic. For the case of a model of the nuclear research reactor Triga Mark III of the National Institute of Nuclear Research have been developed diverse algorithms of diffuse control that have as objective the regulation of the neutron power in the nucleus. The aggregation stages and desdifussification in these algorithms discretize the universe of values of the control variable, being required a high number of operations for their execution. With the purpose of reducing this number of operations and to obtain results more exact in the generation of the aggregated group in each cycle of control and in the determination of the center of gravity of this added group, it is presented the development of an analytical method for these calculations. The main objectives outlined in this entitled thesis D esign of an analytical aggregate of a diffuse controller rules and their application in the pattern of a nuclear research reactor , they are: to improve the behavior of control systems in closed knot based on diffuse logic by means of the development of an analytical method that determines an aggregated group resultant of the activation of rules in the diffuse controller and the obtaining of the exit variable using an exact solution of the technique of the center of gravity; and to compare the operation of these methods with those traditionally used ones that consider the discretization of the universe of the exit variable so much for the aggregation like for the desdiffusification. The chapters 1 and 2 present an introduction at two fundamental themes of the

Computational modelling for diffusion of neutrons problems inside nuclear multiplying medium on bidimensional cartesian rectangular geometry

International Nuclear Information System (INIS)

Couto, Nozimar do

2003-01-01

Diffusion theory is traditionally applied to nuclear reactor global calculations. Based on the good results generated by the one-dimensional spectral nodal diffusion (SND) method for benchmark problems, we offer the SND method for nuclear reactor global calculations in X,Y geometry. In this method, the continuity equation and Flick law are transverse integrated in each spatial direction leading to a system of two 'one-dimensional' equations coupled by the transverse leakage terms. We then apply the SND method to numerically solve this system with constant approximations for the transverse leakage terms. We perform a spectral analysis to determine the local general solution of each 'one-dimensional' nodal equation with flat approximation for the transverse leakages. We used special auxiliary equations with parameters that are to be determined in order to preserve the analytical general solutions in the numerical algorithm. By considering continuity conditions at the node interfaces and appropriate boundary conditions, we obtain a solvable system of discretized equations involving the node-edge average scalar fluxes at each estimate of the dominant eigenvalue (k eff ) in the outer power iterations. As we considered approximations to the transverse leakages, the SND method is not free of spatial truncation errors. Nevertheless, it generated good results for the typical model problems that we considered. (author)

Surface diffusion driven morphological instability in free-standing nickel nanorod arrays

Energy Technology Data Exchange (ETDEWEB)

Alrashid, Ebtihaj; Ye, Dexian [Department of Physics, Virginia Commonwealth University, PO Box 842000, Richmond, Virginia 23284-2000 (United States)

2014-07-28

Metallic nanostructures are thermodynamically unstable due to the excess of energy of large numbers of surface atoms. Morphological instability, such as Rayleigh breakup, sintering, and coalescence, can be observed at a temperature much lower than the bulk melting point of the metal. We study the morphological and crystalline evolution of well-aligned free-standing nickel nanorod arrays at elevated temperatures up to 600 °C. The as-deposited nickel nanorods are faceted with sharp nanotips, which are deformed at annealing temperatures higher than 400 °C due to strong surface diffusion. A mud-crack like pattern is formed in the samples annealed above 400 °C, leading to the generation of interconnected porous structure. Meanwhile, the X-ray diffraction reveals the recrystallization of nickel nanocrystals when annealed from 300 to 600 °C.

The Nuclear Thomas-Fermi Model

Science.gov (United States)

Myers, W. D.; Swiatecki, W. J.

1994-08-01

The statistical Thomas-Fermi model is applied to a comprehensive survey of macroscopic nuclear properties. The model uses a Seyler-Blanchard effective nucleon-nucleon interaction, generalized by the addition of one momentum-dependent and one density-dependent term. The adjustable parameters of the interaction were fitted to shell-corrected masses of 1654 nuclei, to the diffuseness of the nuclear surface and to the measured depths of the optical model potential. With these parameters nuclear sizes are well reproduced, and only relatively minor deviations between measured and calculated fission barriers of 36 nuclei are found. The model determines the principal bulk and surface properties of nuclear matter and provides estimates for the more subtle, Droplet Model, properties. The predicted energy vs density relation for neutron matter is in striking correspondence with the 1981 theoretical estimate of Friedman and Pandharipande. Other extreme situations to which the model is applied are a study of Sn isotopes from {sup 82}Sn to {sup 170}Sn, and the rupture into a bubble configuration of a nucleus (constrained to spherical symmetry) which takes place when Z{sup 2}/A exceeds about 100.

Low energy quasi free scattering on nuclear surface

Energy Technology Data Exchange (ETDEWEB)

Shiyuan, S.

1983-05-01

The result of RGM calculation of low energy /sup 3/He(n, n)/sup 3/ He total elastic cross section does not agree well with experimental data for E/sub n/<1 MeV. This discrepancy can be improved by assuming lwo energy quasi-free scattering of particles beyond the nuclear surface.

Dynamics diffusion behaviors of Pd small clusters on a Pd(1 1 1) surface

International Nuclear Information System (INIS)

Liu, Fusheng; Hu, Wangyu; Deng, Huiqiu; He, Rensheng; Yang, Xiyuan; Lu, Kuilin; Deng, Lei; Luo, Wenhua

2010-01-01

Using molecular dynamics, nudged elastic band and modified analytic embedded atom methods, the self-diffusion dynamics properties of palladium atomic clusters up to seven atoms on the Pd (1 1 1) surface have been studied at temperatures ranging from 300 to 1000 K. The simulation time varies from 20 to 75 ns according to the cluster sizes and the temperature ranges. The heptamer and trimer are more stable than the other neighboring clusters. The diffusion coefficients of the clusters are derived from the mean square displacement of the cluster's mass-center, and the diffusion prefactors D 0 and activation energies E a are derived from the Arrhenius relation. The activation energy of the clusters increases with the increasing atom number in the clusters, especially for Pd 6 to Pd 7 . The analysis of trajectories shows the noncompact clusters diffuse by the local diffusion mechanism but the compact clusters diffuse mainly by the whole gliding mechanism, and some static energy barriers of the diffusion modes are calculated. From Pd 2 to Pd 6 , the prefactors are in the range of the standard value 10 −3  cm 2  s −1 , and the prefactor of Pd 7 cluster is 2 orders of magnitude greater than that of the single Pd adatom because of a large number of nonequivalent diffusion processes. The heptamer can be the nucleus in the room temperature range according to nucleation theory

Nuclear-deformation energies according to a liquid-drop model with a sharp surface

International Nuclear Information System (INIS)

Blocki, J.; Swiatecki, W.J.

1982-05-01

We present an atlas of 665 deformation-energy maps and 150 maps of other properties of interest, relevant for nuclear systems idealized as uniformly charged drops endowed with a surface tension. The nuclear shapes are parametrized in terms of two spheres modified by a smoothly fitted quadratic surface of revolution and are specified by three variables: asymmetry, sphere separation, and a neck variable (that goes over into a fragment-deformation variable after scission). The maps and related tables should be useful for the study of macroscopic aspects of nuclear fission and of collisions between any two nuclei in the periodic table

Diffusion-controlled regime of surface-wave-produced plasmas in helium gas

International Nuclear Information System (INIS)

Berndt, J; Makasheva, K; Schlueter, H; Shivarova, A

2002-01-01

The study presents a numerical fluid-plasma model of diffusion-controlled surface-wave-sustained discharges in helium gas. The self-consistent behaviour of the discharge based on the interrelation between plasma density and Θ, the power absorbed on average by one electron, is described. The nonlinear process of step ionization in the charged particle balance equation is the main factor, which ensures the self-consistency. However, it is shown that in helium discharges, the ionization frequencies enter the dependence of Θ on the plasma density also through the ambipolar-diffusion coefficient. Results at two different values of the gas pressure and of the wave frequency are discussed. The lower value of the gas pressure is chosen according to the condition to have a pure diffusion-controlled regime without interference with a transition to the free-fall regime. The boundary condition for the ion flux at the wall sheath is used for determination of the value of μ, the quantity denoting the degree of the radial plasma-density inhomogeneity which, together with the electron-neutral elastic collision frequency, influences the wave propagation characteristics. The two values of the wave frequency chosen provide descriptions of high-frequency and microwave discharges. The model results in the self-consistent structure of the discharge: interrelated variations along the discharge length of wavenumber, space damping rate, Θ, plasma density and electron temperature. The power necessary for sustaining discharges of a given length is also calculated. Comparisons with argon discharges are shown

Ambient-temperature diffusion and gettering of Pt atoms in GaN with surface defect region under 60Co gamma or MeV electron irradiation

Science.gov (United States)

Hou, Ruixiang; Li, Lei; Fang, Xin; Xie, Ziang; Li, Shuti; Song, Weidong; Huang, Rong; Zhang, Jicai; Huang, Zengli; Li, Qiangjie; Xu, Wanjing; Fu, Engang; Qin, G. G.

2018-01-01

Generally, the diffusion and gettering of impurities in GaN needs high temperature. Calculated with the ambient-temperature extrapolation value of the high temperature diffusivity of Pt atoms in GaN reported in literature, the time required for Pt atoms diffusing 1 nm in GaN at ambient temperature is about 19 years. Therefore, the ambient-temperature diffusion and gettering of Pt atoms in GaN can hardly be observed. In this work, the ambient-temperature diffusion and gettering of Pt atoms in GaN is reported for the first time. It is demonstrated by use of secondary ion mass spectroscopy that in the condition of introducing a defect region on the GaN film surface by plasma, and subsequently, irradiated by 60Co gamma-ray or 3 MeV electrons, the ambient-temperature diffusion and gettering of Pt atoms in GaN can be detected. It is more obvious with larger irradiation dose and higher plasma power. With a similar surface defect region, the ambient-temperature diffusion and gettering of Pt atoms in GaN stimulated by 3 MeV electron irradiation is more marked than that stimulated by gamma irradiation. The physical mechanism of ambient-temperature diffusion and gettering of Pt atoms in a GaN film with a surface defect region stimulated by gamma or MeV electron irradiation is discussed.

Dynamic and structural characterisation of micellar solutions of surfactants by spin relaxation and translational diffusion

International Nuclear Information System (INIS)

Mahieu, Nathalie

1992-01-01

The work reported in this research thesis aimed at characterizing micellar phases formed by some surfactants (sodium carboxylates) in aqueous solution. After some recalls on nuclear magnetic resonance dealing with spin relaxation (longitudinal relaxation, transverse relaxation, relaxation in the rotating coordinate system, and crossed relaxation), and comments on the dipolar mechanism responsible of relaxation phenomena, the author presents the methods used for relaxation parameter measurement and the data processing software issued from experiments. He presents experiments which allowed the self-diffusion coefficient to be measured, reports data processing, and addresses problems of special diffusion and of coherence transfers during diffusion measurements. Results of proton relaxation measurements are then presented and discussed. They are used to determine the micellar state of the studied carboxylates. The case of the oleate is also addressed. Measurements of carbon-13 relaxation times are reported, and exploited in terms of structural parameters by using the Relaxator software. An original method of the hetero-nuclear Overhauser method is presented, and used to assess the average distance between water molecules and micelle surface [fr

Reactive surface organometallic complexes observed using dynamic nuclear polarization surface enhanced NMR spectroscopy

KAUST Repository

Pump, Eva; Viger-Gravel, Jasmine; Abou-Hamad, Edy; Samantaray, Manoja; Hamzaoui, Bilel; Gurinov, Andrei; Anjum, Dalaver H.; Gajan, David; Lesage, Anne; Bendjeriou-Sedjerari, Anissa; Emsley, Lyndon; Basset, Jean-Marie

2016-01-01

Dynamic Nuclear Polarization Surface Enhanced NMR Spectroscopy (DNP SENS) is an emerging technique that allows access to high-sensitivity NMR spectra from surfaces. However, DNP SENS usually requires the use of radicals as an exogenous source of polarization, which has so far limited applications for organometallic surface species to those that do not react with the radicals. Here we show that reactive surface species can be studied if they are immobilized inside porous materials with suitably small windows, and if bulky nitroxide bi-radicals (here TEKPol) are used as the polarization source and which cannot enter the pores. The method is demonstrated by obtaining significant DNP enhancements from highly reactive complelxes [(equivalent to Si-O-)W(Me)(5)] supported on MCM-41, and effects of pore size (6.0, 3.0 and 2.5 nm) on the performance are discussed.

Reactive surface organometallic complexes observed using dynamic nuclear polarization surface enhanced NMR spectroscopy

KAUST Repository

Pump, Eva

2016-08-15

Dynamic Nuclear Polarization Surface Enhanced NMR Spectroscopy (DNP SENS) is an emerging technique that allows access to high-sensitivity NMR spectra from surfaces. However, DNP SENS usually requires the use of radicals as an exogenous source of polarization, which has so far limited applications for organometallic surface species to those that do not react with the radicals. Here we show that reactive surface species can be studied if they are immobilized inside porous materials with suitably small windows, and if bulky nitroxide bi-radicals (here TEKPol) are used as the polarization source and which cannot enter the pores. The method is demonstrated by obtaining significant DNP enhancements from highly reactive complelxes [(equivalent to Si-O-)W(Me)(5)] supported on MCM-41, and effects of pore size (6.0, 3.0 and 2.5 nm) on the performance are discussed.

Communication: Surface-to-bulk diffusion of isolated versus interacting C atoms in Ni(111) and Cu(111) substrates: A first principle investigation

Energy Technology Data Exchange (ETDEWEB)

Harpale, Abhilash; Panesi, Marco; Chew, Huck Beng, E-mail: hbchew@illinois.edu [Department of Aerospace Engineering, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States)

2015-02-14

Using first principle calculations, we study the surface-to-bulk diffusion of C atoms in Ni(111) and Cu(111) substrates, and compare the barrier energies associated with the diffusion of an isolated C atom versus multiple interacting C atoms. We find that the preferential Ni-C bonding over C–C bonding induces a repulsive interaction between C atoms located at diagonal octahedral voids in Ni substrates. This C–C interaction accelerates C atom diffusion in Ni with a reduced barrier energy of ∼1 eV, compared to ∼1.4-1.6 eV for the diffusion of isolated C atoms. The diffusion barrier energy of isolated C atoms in Cu is lower than in Ni. However, bulk diffusion of interacting C atoms in Cu is not possible due to the preferential C–C bonding over C–Cu bonding, which results in C–C dimer pair formation near the surface. The dramatically different C–C interaction effects within the different substrates explain the contrasting growth mechanisms of graphene on Ni(111) and Cu(111) during chemical vapor deposition.

Communication: Surface-to-bulk diffusion of isolated versus interacting C atoms in Ni(111) and Cu(111) substrates: A first principle investigation.

Science.gov (United States)

Harpale, Abhilash; Panesi, Marco; Chew, Huck Beng

2015-02-14

Using first principle calculations, we study the surface-to-bulk diffusion of C atoms in Ni(111) and Cu(111) substrates, and compare the barrier energies associated with the diffusion of an isolated C atom versus multiple interacting C atoms. We find that the preferential Ni-C bonding over C-C bonding induces a repulsive interaction between C atoms located at diagonal octahedral voids in Ni substrates. This C-C interaction accelerates C atom diffusion in Ni with a reduced barrier energy of ∼1 eV, compared to ∼1.4-1.6 eV for the diffusion of isolated C atoms. The diffusion barrier energy of isolated C atoms in Cu is lower than in Ni. However, bulk diffusion of interacting C atoms in Cu is not possible due to the preferential C-C bonding over C-Cu bonding, which results in C-C dimer pair formation near the surface. The dramatically different C-C interaction effects within the different substrates explain the contrasting growth mechanisms of graphene on Ni(111) and Cu(111) during chemical vapor deposition.

Evaluation of empirical atmospheric diffusion data

International Nuclear Information System (INIS)

Horst, T.W.; Doran, J.C.; Nickola, P.W.

1979-10-01

A study has been made of atmospheric diffusion over level, homogeneous terrain of contaminants released from non-buoyant point sources up to 100 m in height. Current theories of diffusion are compared to empirical diffusion data, and specific dispersion estimation techniques are recommended which can be implemented with the on-site meteorological instrumentation required by the Nuclear Regulatory Commission. A comparison of both the recommended diffusion model and the NRC diffusion model with the empirical data demonstrates that the predictions of the recommended model have both smaller scatter and less bias, particularly for groundlevel sources

Hard Surface Layers by Pack Boriding and Gaseous Thermo-Reactive Deposition and Diffusion Treatments

DEFF Research Database (Denmark)

Christiansen, Thomas Lundin; Bottoli, Federico; Dahl, Kristian Vinter

2017-01-01

) layers with hardnesses up to 1800 HV. Titanizing of ARNE tool steel results in a surface layer consisting of TiC with a hardness of approximately 4000 HV. Duplex treatments, where boriding is combined with subsequent (TRD) titanizing, result in formation of hard TiB2 on top of a thick layer of Fe......Thermo-reactive deposition and diffusion (TRD) and boriding are thermochemical processes that result in very high surface hardness by conversion of the surface into carbides/nitrides and borides, respectively. These treatments offer significant advantages in terms of hardness, adhesion, tribo...... subjected to TRD (chromizing and titanizing) and boriding treatments. For the steels with low carbon content, chromizing results in surface alloying with chromium, i.e., formation of a (soft) “stainless” surface zone. Steels containing higher levels of carbon form chromium carbide (viz. Cr23C6, Cr7C3...

The magnetic diffusion of neutrons; La diffusion magnetique des neutrons

Energy Technology Data Exchange (ETDEWEB)

Koehler, W C [Commissariat a l' Energie Atomique, Saclay (France).Centre d' Etudes Nucleaires

1959-07-01

The purpose of this report is to examine briefly the diffusion of neutrons by substances, particularly by crystals containing permanent atomic or ionic magnetic moments. In other words we shall deal with ferromagnetic, antiferromagnetic, ferrimagnetic or paramagnetic crystals, but first it is necessary to touch on nuclear diffusion of neutrons. We shall start with the interaction of the neutron with a single diffusion centre; the results will then be applied to the magnetic interactions of the neutron with the satellite electrons of the atom; finally we shall discuss the diffusion of neutrons by crystals. (author) [French] Le but de ce rapport est d'examiner, brievement, la diffusion des neutrons par les substances, et surtout, par des cristaux qui contiennent des moments magnetiques atomiques ou ioniques permanents. C'est-a-dire que nous nous interesserons aux cristaux ferromagnetiques, antiferromagnetiques, ferrimagnetiques ou paramagnetiques; il nous faut cependant rappeler d'abord la diffusion nucleaire des neutrons. Nous commencerons par l'interaction du neutron avec un seul centre diffuseur; puis les resultats seront appliques aux interactions magnetiques du neutron avec les electrons satellites de l'atome; enfin nous discuterons la diffusion des neutrons par les cristaux. (auteur)

Large size self-assembled quantum rings: quantum size effect and modulation on the surface diffusion.

Science.gov (United States)

Tong, Cunzhu; Yoon, Soon Fatt; Wang, Lijun

2012-09-24

We demonstrate experimentally the submicron size self-assembled (SA) GaAs quantum rings (QRs) by quantum size effect (QSE). An ultrathin In0.1 Ga0.9As layer with different thickness is deposited on the GaAs to modulate the surface nucleus diffusion barrier, and then the SA QRs are grown. It is found that the density of QRs is affected significantly by the thickness of inserted In0.1 Ga0.9As, and the diffusion barrier modulation reflects mainly on the first five monolayer . The physical mechanism behind is discussed. The further analysis shows that about 160 meV decrease in diffusion barrier can be achieved, which allows the SA QRs with density of as low as one QR per 6 μm2. Finally, the QRs with diameters of 438 nm and outer diameters of 736 nm are fabricated using QSE.

Fractional diffusion equations and anomalous diffusion

CERN Document Server

Evangelista, Luiz Roberto

2018-01-01

Anomalous diffusion has been detected in a wide variety of scenarios, from fractal media, systems with memory, transport processes in porous media, to fluctuations of financial markets, tumour growth, and complex fluids. Providing a contemporary treatment of this process, this book examines the recent literature on anomalous diffusion and covers a rich class of problems in which surface effects are important, offering detailed mathematical tools of usual and fractional calculus for a wide audience of scientists and graduate students in physics, mathematics, chemistry and engineering. Including the basic mathematical tools needed to understand the rules for operating with the fractional derivatives and fractional differential equations, this self-contained text presents the possibility of using fractional diffusion equations with anomalous diffusion phenomena to propose powerful mathematical models for a large variety of fundamental and practical problems in a fast-growing field of research.

Carbon out-diffusion mechanism for direct graphene growth on a silicon surface

International Nuclear Information System (INIS)

Kim, Byung-Sung; Lee, Jong Woon; Jang, Yamujin; Choi, Soon Hyung; Cha, Seung Nam; Sohn, Jung Inn; Kim, Jong Min; Joo, Won-Jae; Hwang, Sungwoo; Whang, Dongmok

2015-01-01

Direct growth of graphene on silicon (Si) through chemical vapor deposition has predominantly focused on surface-mediated processes due to the low carbon (C) solubility in Si. However, a considerable quantity of C atoms was incorporated in Si and formed Si 1−x C x alloy with a reduced lattice dimension even in the initial stage of direct graphene growth. Subsequent high temperature annealing promoted active C out-diffusion, resulting in the formation of a graphitic layer on the Si surface. Furthermore, the significantly low thermal conductivity of the Si 1−x C x alloy shows that the incorporated C atoms affect the properties of a semiconductor adjacent to the graphene. These findings provide a key guideline for controlling desirable properties of graphene and designing hybrid semiconductor/graphene architectures for various applications

Protection of uranium by electrodeposition of nickel and diffusion

International Nuclear Information System (INIS)

Chauvin, G.; Coriou, H.; Hure, J.

1959-01-01

This work forms part of the overall scheme for investigating uranium canning for nuclear reactors. It is necessary to: - Protect the fuel (uranium) against corrosion by the cooling medium (heavy water, CO 2 , etc.), in the case of a rupture of the can; - Avoid dangerous U-Al diffusion (when it is question of an aluminium can) by using an intermediate layer of a metal whose rate of diffusion in uranium is very much less than that of aluminium under the same conditions. In the present work based on the use of an intermediate layer of nickel the following points are apparent: 1) After having treated the uranium surface it is possible to electroplate nickel on it in such a way that after annealing without the application of any pressure these deposits give a very good intermetallic U-Ni diffusion. Though this diffusion is inferior to that of the UAl system, it enables the protection to be reinforced and thus the corrosion resistance to be increased. 2) When no other factor varies, the experiments show that the quality of the diffusion zones obtained depends on the nature of the electrolytic nickel bath. 3) The classical nickel baths used previously for this type of work contain 20 to 40 g/l of boric acid acting as an electrolytic buffer. As a result of this, the deposits are highly contaminated by boron (400 to 500 ppm of boron). We shall show that with a bath which does not contain nuclear poisons, a very clean U-Ni diffusion zone can be obtained. 4) After annealing for 100 hours at 700 deg. C, microscopic examination of the diffusion front reveals the existence of five layers under bright field illumination and six Layers in polarised light: at least four of these layers are well crystallised. 5) Important irregularities in the interface between uranium and the first intermetallic compound U 6 Ni seem to be result of barriers to the diffusion caused by certain impurities in the uranium. 6) Of the seven definite compounds which can be formed during the diffusion, that

Molecular Dynamics-based Simulations of Bulk/Interfacial Structures and Diffusion Behaviors in Nuclear Waste Glasses

Energy Technology Data Exchange (ETDEWEB)

Du, Jincheng

2018-03-16

This NEUP Project aimed to generate accurate atomic structural models of nuclear waste glasses by using large-scale molecular dynamics-based computer simulations and to use these models to investigate self-diffusion behaviors, interfacial structures, and hydrated gel structures formed during dissolution of these glasses. The goal was to obtain realistic and accurate short and medium range structures of these complex oxide glasses, to provide a mechanistic understanding of the dissolution behaviors, and to generate reliable information with predictive power in designing nuclear waste glasses for long-term geological storage. Looking back of the research accomplishments of this project, most of the scientific goals initially proposed have been achieved through intensive research in the three and a half year period of the project. This project has also generated a wealth of scientific data and vibrant discussions with various groups through collaborations within and outside of this project. Throughout the project one book chapter and 14 peer reviewed journal publications have been generated (including one under review) and 16 presentations (including 8 invited talks) have been made to disseminate the results of this project in national and international conference. Furthermore, this project has trained several outstanding graduate students and young researchers for future workforce in nuclear related field, especially on nuclear waste immobilization. One postdoc and four PhD students have been fully or partially supported through the project with intensive training in the field material science and engineering with expertise on glass science and nuclear waste disposal

Indications of quantum diffusion of H in Pd

International Nuclear Information System (INIS)

Behar, M; Weiser, M.; Kalbitzer, S.

1989-01-01

Low temperature diffusion measurements of hydrogen in palladium using the nuclear reaction technique have shown indications of H quantum diffusion behaviour. For temperatures higher than 100 K the experimental diffusion coefficients follow an Arrhenius type behaviour. However, for lower temperatures (30 K 2 behaviour. (Author) [es

Evaluation of the performance of three diffuse hourly irradiation models on tilted surfaces according to the utilizability concept

International Nuclear Information System (INIS)

Posadillo, R.; Lopez Luque, R.

2009-01-01

The performance of three diffuse hourly irradiation models on tilted surfaces was evaluated by making a database of hourly global and diffuse solar irradiation on a horizontal surface, as well as global solar irradiation on a tilted surface, recorded in a solar radiation station located at Cordoba University (Spain). The method for a comparison of the performance of these models was developed from a study of the 'utilizable energy' statistics, a value representing, for a specific period of time, the mean monthly radiation that exceeded a critical level of radiation. This model comparison method seemed to us to be highly suitable since it provides a way of comparing the capacity of these models to estimate, however, much energy is incident on a tilted surface above a critical radiation level. Estimated and measured values were compared using the normalized RMBE and RRMSE statistics. According to the results of the method let us verify that, of the three models evaluated, one isotropic and two anisotropic, the Reindl et al. anisotropic model was the one giving the best results.

Effects of diluents on soot surface temperature and volume fraction in diluted ethylene diffusion flames at pressure

KAUST Repository

Kailasanathan, Ranjith Kumar Abhinavam; Zhang, Ji; Fang, Tiegang; Roberts, William L.

2014-01-01

Soot surface temperature and volume fraction are measured in ethylene/air coflowing laminar diffusion flames at high pressures, diluted with one of four diluents (argon, helium, nitrogen, and carbon dioxide) using a two-color technique. Both

Finite difference applied to the reconstruction method of the nuclear power density distribution

International Nuclear Information System (INIS)

Pessoa, Paulo O.; Silva, Fernando C.; Martinez, Aquilino S.

2016-01-01

Highlights: • A method for reconstruction of the power density distribution is presented. • The method uses discretization by finite differences of 2D neutrons diffusion equation. • The discretization is performed homogeneous meshes with dimensions of a fuel cell. • The discretization is combined with flux distributions on the four node surfaces. • The maximum errors in reconstruction occur in the peripheral water region. - Abstract: In this reconstruction method the two-dimensional (2D) neutron diffusion equation is discretized by finite differences, employed to two energy groups (2G) and meshes with fuel-pin cell dimensions. The Nodal Expansion Method (NEM) makes use of surface discontinuity factors of the node and provides for reconstruction method the effective multiplication factor of the problem and the four surface average fluxes in homogeneous nodes with size of a fuel assembly (FA). The reconstruction process combines the discretized 2D diffusion equation by finite differences with fluxes distribution on four surfaces of the nodes. These distributions are obtained for each surfaces from a fourth order one-dimensional (1D) polynomial expansion with five coefficients to be determined. The conditions necessary for coefficients determination are three average fluxes on consecutive surfaces of the three nodes and two fluxes in corners between these three surface fluxes. Corner fluxes of the node are determined using a third order 1D polynomial expansion with four coefficients. This reconstruction method uses heterogeneous nuclear parameters directly providing the heterogeneous neutron flux distribution and the detailed nuclear power density distribution within the FAs. The results obtained with this method has good accuracy and efficiency when compared with reference values.

Energetics and self-diffusion behavior of Zr atomic clusters on a Zr(0 0 0 1) surface

Energy Technology Data Exchange (ETDEWEB)

Liu Fusheng [Department of Applied Physics, Hunan University, Changsha 410082 (China); Hu Wangyu [Department of Applied Physics, Hunan University, Changsha 410082 (China)], E-mail: wangyuhu2001cn@yahoo.com.cn; Deng Huiqiu; Luo Wenhua; Xiao Shifang [Department of Applied Physics, Hunan University, Changsha 410082 (China); Yang Jianyu [Department of Maths and Physics, Hunan Institute of Engineering, Xiangtan 411104 (China)

2009-09-15

Using a molecular dynamics method and a modified analytic embedded atom potential, the energetic and the self-diffusion dynamics of Zr atomic clusters up to eight atoms on {alpha}-Zr(0 0 0 1) surface have been studied. The simulation temperature ranges from 300 to 1100 K and the simulation time varies from 20 to 40 ns. It's found that the heptamer and trimer are more stable comparing to other neighboring non-compact clusters. The diffusion coefficients of clusters are derived from the mean square displacement of cluster's mass-center and the present diffusion coefficients for clusters exhibit an Arrhenius behavior. The Arrhenius relation of the single adatom can be divided into two parts in different temperature range because of their different diffusion mechanisms. The migration energies of clusters increase with increasing the number of atoms in cluster. The differences of the prefactors also come from the diverse diffusion mechanisms. On the facet of 60 nm, the heptamer can be the nuclei in the crystal growth below 370 K.

Surface mobilities on solid materials

International Nuclear Information System (INIS)

Binh, V.T.

1983-01-01

This book constitutes the proceedings of the NATO Advanced Study Institute on Surface Mobilities on Solid Materials held in France in 1981. The goal of the two-week meeting was to review up-to-date knowledge on surface diffusion, both theoretical and experimental, and to highlight those areas in which much more knowledge needs to be accumulated. Topics include theoretical aspects of surface diffusion (e.g., microscopic theories of D at zero coverage; statistical mechanical models and surface diffusion); surface diffusion at the atomic level (e.g., FIM studies of surface migration of single adatoms and diatomic clusters; field emission studies of surface diffusion of adsorbates); foreign adsorbate mass transport; self-diffusion mass transport (e.g., different driving forces for the matter transport along surfaces; measurements of the morphological evolution of tips); the role of surface diffusion in some fundamental and applied sciences (e.g. adatomadatom pair interactions and adlayer superstructure formation; surface mobility in chemical reactions and catalysis); and recent works on surface diffusion (e.g., preliminary results on surface self-diffusion measurements on nickel and chromium tips)

Ferromagnetic nuclear resonance investigation of the surface magnetization in iron sheets

International Nuclear Information System (INIS)

Varga, L.; Tompa, K.

1977-09-01

The role of the domain structure and domain properties in ferromagnetic nuclear resonance (FNR) experiments is reconsidered. Using the FNR signal intensity as a measure of surface domain wall volume, it is found that the behaviour of the surface magnetization differs from that of the bulk magnetization of iron sheets. Namely, a critical field below which the FNR signal remains unchanqed is observed in the surface magnetization. This lag of surface domain wall annihilation is sensitive to the given surface conditions and in particular to the rolling deformation. Considering the small skin depth, FNR as a surface testing method is discussed. (D.P.)

Evaluation of empirical atmospheric diffusion data

Energy Technology Data Exchange (ETDEWEB)

Horst, T.W.; Doran, J.C.; Nickola, P.W.

1979-10-01

A study has been made of atmospheric diffusion over level, homogeneous terrain of contaminants released from non-buoyant point sources up to 100 m in height. Current theories of diffusion are compared to empirical diffusion data, and specific dispersion estimation techniques are recommended which can be implemented with the on-site meteorological instrumentation required by the Nuclear Regulatory Commission. A comparison of both the recommended diffusion model and the NRC diffusion model with the empirical data demonstrates that the predictions of the recommended model have both smaller scatter and less bias, particularly for ground-level sources.

Low-temperature hydrogenation of diamond nanoparticles using diffuse coplanar surface barrier discharge at atmospheric pressure

Czech Academy of Sciences Publication Activity Database

Kromka, Alexander; Čech, J.; Kozak, Halyna; Artemenko, Anna; Ižák, Tibor; Čermák, Jan; Rezek, Bohuslav; Černák, M.

2015-01-01

Roč. 252, č. 11 (2015), s. 2602-2607 ISSN 0370-1972 R&D Projects: GA ČR(CZ) GBP108/12/G108 Institutional support: RVO:68378271 Keywords : atmospheric plasma * diamond nanoparticles * diffuse coplanar surface barrier discharge * FTIR * XPS Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 1.522, year: 2015

Atmospheric diffusion study and its application to nuclear energy

International Nuclear Information System (INIS)

Chino, Masamichi

1990-01-01

The report reviews studies on atmospheric diffusion of radioactive substances released from a smokestack. Smoke containing radioactive substances, or radioactive plume, diffuses into air while being affected by atmospheric turbulent flows in various ways depending on the scale of the plume. The diffusion of a radioactive plume released from a smokestack is discussed first, focusing on the diffusion process in the vicinity of the smokestack, in the atmospheric boundary layer and in the troposphere. Many theoretical studies have been conducted by using the Gaussian plume model, though it is too simple to take into account the topographic effects and unstationary atmospheric conditions. Various numerical calculation models (designed for numerical calculation by a computer) have recently been developed, particularly for the implementation of environmental impact evaluation. Diagnostic and forecast type models are available for atmospheric air flow calculation. Other models available for diffusion analysis include the puff model, segment model, PIC (particle in cell)model, and random walk model. (N.K.)

Diffusion rates for elevated releases

International Nuclear Information System (INIS)

Ramsdell, J.V.

1983-11-01

A search of the literature related to diffusion from elevated sources has determined that an adequate data base exists for use in developing parameterizations for estimating diffusion rates for material released from free standing stacks at nuclear power plants. A review of published data analyses indicates that a new parameterization of horizontal diffusion rates specifically for elevated releases is not likely to significantly change the magnitudes of horizontal diffusion coefficients on the average. However, the uncertainties associated with horizontal diffusion coefficient estimates under any given set of atmospheric conditions could be reduced by a new parameterization. Similarly, a new parameterization of vertical diffusion rates would be unlikely to significantly alter the magnitudes of diffusion coefficients for unstable atmospheric conditons. However, for neutral and stable atmospheric conditions, a new parameterization of vertical diffusion rates might increase vertical diffusion coefficients significantly. The increase would move ground-level time-integrated concentration maxima closer to the plant and would increase the maxima. 55 references, 2 figures, 4 tables

Report on swelling of MX-type fuels 1973/76: Self-diffusion in MX-type nuclear fuels out-of-pile and in-pile

International Nuclear Information System (INIS)

Matzke, H.; Bradbury, M.H.

1978-01-01

Self-diffusion measurements of Pu-238 and U-233 have been carried out in a wide range of advanced nuclear fuels in the temperature region from 1200 to 2300 0 C. The materials studied varied in composition from carbides through carbonitrides to nitrides. In particular the effect on self-diffusion rates of factors such as non-metal/metal ratio, oxygen content increasing nitrogen contents, metallic impurity additions, the presence of second phases and fission products simulating 16, 10 and 3 a /o burn up has been established. Grain boundary diffusion rates were evaluated where possible. Carbon diffusion in stoichiometric and off-stoichiometric UC and in a series of uranium carbonitride samples was also measured. The RADIF experiments (radiation induced diffusion) have provided results upon the effect of irradiation on the self-diffusion rates in the temperature range 150 to 1300 0 C. Each of the factors mentioned above is discussed in detail with special attention being given to the effects of non-metal/metal ratio, impurities and increasing the nitrogen content in carbonitride materials

Detection of surface deformation and ionospheric perturbation by the North Korea nuclear test

Science.gov (United States)

Park, S. C.; Lee, W. J.; Sohn, D. H.; Lee, D. K.; Jung, H. S.

2017-12-01

We used remote sensing data to detect the changes on surface and ionosphere due to the North Korea nuclear test. To analyze the surface deformation before and after the 6th North Korea (NK) nuclear test, we used Satellite Aperture Radar (SAR) images. It was reported that there were some surface deformation with about 10 cm by the 4th test (Wei, 2017) and the 5th test (Jo, 2017) using Interferometric SAR (InSAR) technique. However we could not obtain surface deformation by the 6th test using InSAR with Advanced Land Observation Satellite 2 (ALOS-2) data because of low coherence in the area close to the epicenter. Although the low coherence can be occurred due to several reasons, the main reason may be large deformation in this particular case. Therefore we applied pixel offset method to measure the amount of surface deformation in the area with low coherence. Pixel offset method calculates the deformation in the directions along track and Line-of-Sight (LOS) using cross correlation of intensity of two SAR images before and after the event for a pixel and is used frequently to obtain large deformation of glacier (e.g. Lee et al., 2015). Applying pixel offset method to the area of the 6th NK nuclear test, we obtained about 3 m surface deformation in maximum. It seems that the larger deformation occurs as the mountain slope is steeper.We then analyzed ionospheric perturbation using Global Navigation Satellite System (GNSS) data. If acoustic wave by a nuclear test goes up to the ionosphere and disturbs electron density, then the changes in slant total electron content (STEC) may be detected by GNSS satellites. STEC perturbation has been reported in the previous NK nuclear tests (e.g. Park et al., 2011). We analyzed the third order derivatives of STEC for 51 GNSS stations in South Korea and found that some perturbation were appeared at 4 stations about 20 40 minutes after the test.

Hardness optimization of boride diffusion layer on Astm F-75 alloy using response surface methodology

Energy Technology Data Exchange (ETDEWEB)

Arguelles O, J. L.; Corona R, M. A. [Universidad Autonoma de San Luis Potosi, Doctorado Institucional en Ingenieria y Ciencia de Materiales, San Luis Potosi 78000, SLP (Mexico); Marquez H, A.; Saldana R, A. L.; Saldana R, A. [Universidad de Guanajuato, Ingenieria Mecanica Agricola DICIVA, Irapuato, Guanajuato 36500 (Mexico); Moreno P, J., E-mail: amarquez@ugto.mx [Universidad de Guanajuato, Departamento de Minas, Metalurgia y Geologia, Ex-Hacienda San Matias s/n, Guanajuato, Guanajuato 36020 (Mexico)

2017-11-01

In this study, the Response Surface Methodology (Rsm) and Central Composite Design (Ccd) were used to optimize the hardness of boride diffusion layer on Astm F-75 alloy (also called Haynes alloy). A boronizing thermochemical treatment was carried out at different temperatures and for different time periods. Hardness tests were conducted. The boride diffusion layer was verified by the X-ray diffraction (XRD) analysis indicating the formation of Co B, Co{sub 2}B, Cr B and Mo{sub 2}B phases. An optimal hardness of 3139.7 Hv was obtained for the samples subjected to the boriding process for a duration of 6.86 h at 802.4 degrees Celsius. (Author)

Extending and refining the nuclear mass surface with ISOLTRAP and MISTRAL

CERN Document Server

Lunney, M D

2000-01-01

Through the nuclear binding energy the atomic mass gives us important information about nuclear structure. Viewing the ensemble of mass data over the nuclear chart, we can examine the hills and valleys that form this surface and make hypotheses about the effects of certain nuclear configurations. To unveil these effects, mass measurements of very high precision (10$^{-6}$) are required. Two experiments at ISOLDE pursue this effort of nuclear cartography the tandem Penning trap spectrometer ISOLTRAP and the radiofrequency transmission spectrometer MISTRAL. Between them, the masses of almost 150 nuclides have been measured from stable isotopes to those with half-lives as short as 30 ms. Both experiments rely on good optical properties of a low energy ion beam and are thus well suited to the ISOLDE facility. (30 refs).

Diffusion and adsorption of dimers on reconstructed Pt(1 1 0) surfaces: First principle and EAM studies

Science.gov (United States)

Matrane, I.; Mazroui, M.; Sbiaai, K.

2018-03-01

We present a density functional theory (DFT) and embedded atom method (EAM) studies of Pt2 , Au2 and AuPt dimers adsorption and diffusion on the clean Pt (1 1 0) (1 × 1) surface and (1 × 2) (1 × 3) and (1 × 4) missing row reconstructed geometries. As a first step, adsorption energies are calculated for all considered dimers, and their stability is checked by computing the binding energies. Furthermore, the energy barriers for the elementary diffusion mechanisms (concerted jump, dissociation-reassociation and leapfrog) are calculated for dimers diffusion on all considered geometries. The potential energy profile for the leapfrog mechanism is provided for dimers diffusion on the (1 × 2) (1 × 3) and (1 × 4) missing row reconstructed geometries. Our results show that each of the three dimers exhibits a qualitatively different behaviours. In addition, the obtained results provide interesting atomistic information about dimers stability and mobility, which is required for understanding the macroscopic kinetics of crystal growth.

Results on positron diffusion in Si

International Nuclear Information System (INIS)

Nielsen, B.; Lynn, K.G.; Vehanen, A.; Schultz, P.J.

1984-10-01

Positron diffusion in Si(100) and Si(111) has been measured using a variable energy positron beam. The diffusion related parameter, E 0 is found to be 4.2 +- 0.2 keV, significantly longer than previously reported values. The positron diffusion coefficient is estimated at D/sub +/ = 2.3 +- 0.4 cm 2 /sec, the uncertainty arising mainly from the characteristics of the assumed positron implantation profile. A drastic reduction in E 0 is found after heating the sample to 1300 0 K, showing that previously reported low values of E 0 are associated with the thermal history of the sample. A high sensitivity to defects introduced by low energy ion bombardment is found, and the defect recovery was followed during heat treatments. Reconstruction of the Si(111) surface into the so-called 7 x 7 structure had no detectable influence on the positron diffusion behavior. No changes in the positron diffusion was observed after covering the surface with atomic hydrogen. However the yield of positronium formation at the surface was enhanced, attributed to an increased density of states at the surface

Surface-structure dependence of healing radiation-damage mechanism in nanoporous tungsten

Science.gov (United States)

Duan, Guohua; Li, Xiangyan; Sun, Jingjing; Hao, Congyu; Xu, Yichun; Zhang, Yange; Liu, Wei; Liu, C. S.

2018-01-01

Under nuclear fusion environments, displacement damage in tungsten (W) is usually caused by neutrons irradiation through producing large quantities of vacancies (Vs) and self-interstitial atoms (SIAs). These defects not only affect the mechanical properties of W, but also act as the trap sites for implanted hydrogen isotopes and helium. Nano-porous (NP) W with a high fraction of free surfaces has been developed to mitigate the radiation damage. However, the mechanism of the surface reducing defects accumulation is not well understood. By using multi-scale simulation methods, we investigated the interaction of the SIA and V with different surfaces on across length and time scales. We found that, at a typical operation temperature of 1000 K, surface (1 1 0) preferentially heals radiation damage of W compared with surface (1 0 0) and boundary (3 1 0). On surface (1 1 0), the diffusion barrier for the SIA is only 0.68 eV. The annihilation of the SIA-V happens via the coupled motion of the V segregation towards the surface from the bulk and the two-dimensional diffusion of the SIA on the surface. Such mechanism makes the surface (1 1 0) owe better healing capability. On surface (1 0 0), the diffusion energy barrier for the SIA is 2.48 eV, higher than the diffusion energy barrier of the V in bulk. The annihilation of the SIA-V occurs via the V segregation and recombination. The SIA was found to migrate one-dimensionally along a boundary (3 1 0) with a barrier of 0.21 eV, leading to a lower healing efficiency in the boundary. This study suggested that the on-surface process plays an important role in healing radiation damage of NP W in addition to surface-enhanced diffusion and annihilation near the surface. A certain surface structure renders nano-structured W more radiation-tolerant.

Deposition of RuO 4 on various surfaces in a nuclear reactor containment

Science.gov (United States)

Holm, Joachim; Glänneskog, Henrik; Ekberg, Christian

2009-07-01

During a severe nuclear reactor accident with air ingress, ruthenium can be released from the nuclear fuel in the form of ruthenium tetroxide. Hence, it is important to investigate how the reactor containment is able to reduce the source term of ruthenium. The aim of this work was to investigate the deposition of gaseous ruthenium tetroxide on aluminium, copper and zinc, which all appear in relatively large amounts in reactor containment. The experiments show that ruthenium tetroxide is deposited on all the metal surfaces, especially on the copper and zinc surfaces. A large deposition of ruthenium tetroxide also appeared on the relatively inert glass surfaces in the experimental set-ups. The analyses of the different surfaces, with several analytical methods, showed that the form of deposited ruthenium was mainly ruthenium dioxide.

Nuclear or conventional power for surface combatant ships: Department of the Navy. Report to the Congress

International Nuclear Information System (INIS)

1977-01-01

GAO reviewed the controversy over whether the Navy's major surface combatant ships should be all nuclear powered, all conventionally powered, or a mix of both. Nuclear ships are more capable but cost more and their relative cost-effectiveness cannot be measured because Navy analysts cannot quantify many benefits of nuclear power. The Congress, in reviewing Navy shipbuilding plans for surface combatant ships, should be cognizant that buying only conventional ships will maximize naval firepower; buying only nuclear ships will provide mobility and greater freedom from logistics support; and buying a mix is a third option providing, to varying degrees, the advantages and disadvantages of the all-nuclear and all-conventional options

Optimization in the nuclear fuel cycle II: Surface contamination

International Nuclear Information System (INIS)

Pereira, W.S.; Silva, A.X.; Lopes, J.M.; Carmo, A.S.; Fernandes, T.S.; Mello, C.R.; Kelecom, A.

2017-01-01

Optimization is one of the bases of radioprotection and aims to move doses away from the dose limit that is the borderline of acceptable radiological risk. This work aims to use the monitoring of surface contamination as a tool of the optimization process. 53 surface contamination points were analyzed at a nuclear fuel cycle facility. Three sampling points were identified with monthly mean values of contamination higher than 1 Bq ∙ cm -2 , points 28, 42 and 47. These points were indicated for the beginning of the optimization process

Measurements of cesium and strontium diffusion in biotite gneiss

International Nuclear Information System (INIS)

Skagius, K.; Neretnieks, I.

1988-01-01

A significant retardation of radionuclides transported by flowing water from an underground repository can be expected if the nuclides are able to diffuse into the water filled micropores in the rock. This diffusion into the pores will also increase the surface available to interactions between the nuclides in the ground water and the rock material, such as sorption. To calculate the retardation, it is necessary to know the sorption properties and the diffusivities in the rock matrix for the radionuclides. Diffusion experiments with cesium and strontium in biotite gneiss samples have been performed. Both the transport of strontium and cesium through rock samples and the concentration profiles of cesium and strontium inside rock samples have been determined. The result shows that diffusion of cesium and strontium occurs in the rock material. A diffusion model has been used to evaluate the diffusivity. Both pore diffusion and surface diffusion had to be included in the model to give good agreement with the experimental data. If surface diffusion is not included in the model, the effective pore diffusivity that gives the best fit to the experimental data is found to be higher than expected from earlier measurement of iodide diffusion in the same type of rock material. This indicates that the diffusion of cesium and strontium (sorbing components) in rock material is caused by both pore diffusion and surface diffusion acting in parallel

Diffusion measurements of cesium and strontium in biotite gneiss

International Nuclear Information System (INIS)

Skagius, K.; Neretnieks, I.

1985-01-01

A significant retardation of radionuclides transported by flowing water from an underground repository can be expected if the nuclides are able to diffuse into the water filled micropores in the rock. This diffusion into the pores will also increase the surface available to interaction between the nuclides in the groundwater and the rock material, such as sorption. To calculate the retardation it is necessary to know the sorption properties and the diffusivities in the rock matrix for the radionuclides. Diffusion experiments with cesium and strontium in biotite gneiss samples have been performed. Both the transport of strontium and cesium through rock samples and the concentration profiles of cesium and strontium inside rock samples have been determined. The result show that diffusion of cesium and strontium occurs in the rock material. A diffusion model has been used to evaluate the diffusivity. Both pore diffusion and surface diffusion had to be included in the model to give good agreement with the experimental data. If surface diffusion is not included in the model, the effective pore diffusivity that gives the best fit to the experimental data is found to be higher than expected from earlier measurements of iodide diffusion in the same type of rock material. This indicates that the diffusion of cesium and strontium (sorbing components) in rock material is caused by both pore diffusion and surface diffusion acting in parallel. (author)

Nuclear magnetic resonance and electrical conductivity measurements of diffusion and disorder in LiBr

International Nuclear Information System (INIS)

Hamann, H.; Reininghaus, J.; Richtering, H.

1980-01-01

Electrical conductivity and nuclear magnetic relaxation rates were measured with pure and doped LiBr between 400 K and the melting point (824 K). Prevalent intrinsic disorder was observed down to 470 K. The degree of thermal disorder is 5 X 10 -7 at 470 K and 5 X 10 -3 at the melting point. From the relaxation rates of 7 Li, which are caused by Li-diffusion and nuclear dipole interaction, mean jump frequencies of the cations are derived. Conductivities calculated from these frequencies for a jump process via neighbouring cation vacancies are in perfect agreement with directly measured conductivities. From relaxation rates of 81 Br with MgBr 2 -doped crystals jump frequencies of vacancies were obtained which are again in good agreement with those derived from the conductivity data. From motional narrowing of the 81 Br absorption line the jump frequency of the anions is obtained, which is much smaller than for the cations. Since this motional narrowing is not influenced by any doping, it is concluded that anion transport mainly occurs via pairs of cation and anion vacancies. (Auth.)

The Role of Diffusion Media in Nitriding Process on Surface Layers Characteristics of AISI 4140 with and without Hard Chrome Coatings

Directory of Open Access Journals (Sweden)

K.A. Widi

2016-09-01

Full Text Available The surface layer characteristics of the AISI 4140 tool steel treated by nitriding gas before and after hard chrome plating utilizing pure nitrogen diffusion media (fluidized bed reactor and the without gas (muffle reactor has been studied experimentally. The result shows that nitriding substrate with hard chrome layers has nitrogen atoms concentration almost twice greater than that without hard chrome layers. After being given a hard chrome plating, nitriding on AISI 4140 steel generally has a nitrogen concentration of up to 4 times more than the substrate without hard chrome coating. Almost the entire specimen showed the highest concentration of N atoms in the area below the surface (hardening depth of 200 to 450 µm. N atoms diffusion depth profile has a correlation with hardening depth profile, especially on the specimens layered with hard chromium. The substrate without hard chrome plating tends to have higher surface hardness than the sub-surface. The results show that the effectiveness and efficiency of the gas nitriding diffusion process can be produced without the use of gas in the muffle reactor but the specimens must be hard chromium coated first. This phenomenon can be explained by the role of the passive layer formation that works as a barrier to keeps the spreading of N atoms concentrated in sub-surface areas.

Back-exchange: a novel approach to quantifying oxygen diffusion and surface exchange in ambient atmospheres.

Science.gov (United States)

Cooper, Samuel J; Niania, Mathew; Hoffmann, Franca; Kilner, John A

2017-05-17

A novel two-step Isotopic Exchange (IE) technique has been developed to investigate the influence of oxygen containing components of ambient air (such as H 2 O and CO 2 ) on the effective surface exchange coefficient (k*) of a common mixed ionic electronic conductor material. The two step 'back-exchange' technique was used to introduce a tracer diffusion profile, which was subsequently measured using Time-of-Flight Secondary Ion Mass Spectrometry (ToF-SIMS). The isotopic fraction of oxygen in a dense sample as a function of distance from the surface, before and after the second exchange step, could then be used to determine the surface exchange coefficient in each atmosphere. A new analytical solution was found to the diffusion equation in a semi-infinite domain with a variable surface exchange boundary, for the special case where D* and k* are constant for all exchange steps. This solution validated the results of a numerical, Crank-Nicolson type finite-difference simulation, which was used to extract the parameters from the experimental data. When modelling electrodes, D* and k* are important input parameters, which significantly impact performance. In this study La 0.6 Sr 0.4 Co 0.2 Fe 0.8 O 3-δ (LSCF6428) was investigated and it was found that the rate of exchange was increased by around 250% in ambient air compared to high purity oxygen at the same pO 2 . The three experiments performed in this study were used to validate the back-exchange approach and show its utility.

The role of diffusive architectural surfaces on auditory spatial discrimination in performance venues.

Science.gov (United States)

Robinson, Philip W; Pätynen, Jukka; Lokki, Tapio; Jang, Hyung Suk; Jeon, Jin Yong; Xiang, Ning

2013-06-01

In musical or theatrical performance, some venues allow listeners to individually localize and segregate individual performers, while others produce a well blended ensemble sound. The room acoustic conditions that make this possible, and the psycho-acoustic effects at work are not fully understood. This research utilizes auralizations from measured and simulated performance venues to investigate spatial discrimination of multiple acoustic sources in rooms. Signals were generated from measurements taken in a small theater, and listeners in the audience area were asked to distinguish pairs of speech sources on stage with various spatial separations. This experiment was repeated with the proscenium splay walls treated to be flat, diffusive, or absorptive. Similar experiments were conducted in a simulated hall, utilizing 11 early reflections with various characteristics, and measured late reverberation. The experiments reveal that discriminating the lateral arrangement of two sources is possible at narrower separation angles when reflections come from flat or absorptive rather than diffusive surfaces.

Sorption and diffusion of cobalt, strontium, cesium and americium in natural fissure surfaces and drill core cups studied by autoradiography, 1

International Nuclear Information System (INIS)

Pinnioja, S.; Kaemaeraeinen, E.L.; Jaakkola, T.; Siitari, M.; Muuronen, S.; Lindberg, A.

1985-06-01

A method based on autoradiography was developed to determine the diffusion of radionuclides into the rock matrix. To investigate the diffusion the samples, which has been in contact with radioactive tracer solution up to 6 months, were splitted by sawing. From the autoradiograms of the cross sections the penetration depths of radionuclides were determined and the apparent diffusion coefficient Dsup(a) calculated. The filled and unfilled natural fissure surfaces chosen to this study were bars of drilling cores and drill core cups of tonalite, mica gneiss and rapakivi granite. After contact time of 3 months the highest penetration depths of cesium were observed for natural fissure surface sample of rapakivi granite up to 2.5 mm and of mica gneiss up to 3.7 mm. For strontium the penetration depths of 6 mm and 11 mm for unfilled and filled natural fissure samples of rapakivi granite were found. Dsup(a)-values for cesium varied between 1.5 x 10 -15 and 3.2 x 10 -14 , for strontium between 3.5 x 10 -14 and 2.1 x 10 -13 m 2 /s. D-value obtained for cobalt (drill core cup sample, tonalite) was 5.4 x 10 -17 m 2 /s. 241 Am was only sorbed on the surface of the sample and thus no apparent diffusion coefficient could be calculated. Filling materials, chlorite and secondary minerals in tonalite and rapakivi granite increased diffusion into the mother rock. Radionuclides were sorbed both into the filling material and through fillers into the rock matrix. Cs and Sr penetrated though calcite filling material in mica gneiss into the mother rock. Calcite didn't influence on diffusion of radionuclides. Penetration depths of Cs and Sr were about the same for filled and unfilled samples

Simple computation of reaction–diffusion processes on point clouds

KAUST Repository

Macdonald, Colin B.

2013-05-20

The study of reaction-diffusion processes is much more complicated on general curved surfaces than on standard Cartesian coordinate spaces. Here we show how to formulate and solve systems of reaction-diffusion equations on surfaces in an extremely simple way, using only the standard Cartesian form of differential operators, and a discrete unorganized point set to represent the surface. Our method decouples surface geometry from the underlying differential operators. As a consequence, it becomes possible to formulate and solve rather general reaction-diffusion equations on general surfaces without having to consider the complexities of differential geometry or sophisticated numerical analysis. To illustrate the generality of the method, computations for surface diffusion, pattern formation, excitable media, and bulk-surface coupling are provided for a variety of complex point cloud surfaces.

Simple computation of reaction–diffusion processes on point clouds

KAUST Repository

Macdonald, Colin B.; Merriman, Barry; Ruuth, Steven J.

2013-01-01

The study of reaction-diffusion processes is much more complicated on general curved surfaces than on standard Cartesian coordinate spaces. Here we show how to formulate and solve systems of reaction-diffusion equations on surfaces in an extremely simple way, using only the standard Cartesian form of differential operators, and a discrete unorganized point set to represent the surface. Our method decouples surface geometry from the underlying differential operators. As a consequence, it becomes possible to formulate and solve rather general reaction-diffusion equations on general surfaces without having to consider the complexities of differential geometry or sophisticated numerical analysis. To illustrate the generality of the method, computations for surface diffusion, pattern formation, excitable media, and bulk-surface coupling are provided for a variety of complex point cloud surfaces.

Nuclear Quantum Effects in H+ and OH- Diffusion Along Confined Water Wires from Ab Initio Path Integral Molecular Dyanmics

Science.gov (United States)

Rossi, Mariana; Ceriotti, Michele; Manolopoulos, David

Diffusion of H+ and OH- along water wires provides an efficient mechanism for charge transport that is exploited by biological systems and shows promise in technological applications. However, what is lacking for a better control and design of these systems is a thorough theoretical understanding of the diffusion process at the atomic scale. Here we consider H+ and OH- in finite water wires using density functional theory. We employ machine learning techniques to identify the charged species, thus obtaining an agnostic definition of the charge. We employ thermostated ring polymer molecular dynamics and extract a ``universal'' diffusion coefficient from simulations with different wire sizes by considering Langevin dynamics on the potential of mean force of the charged species. In the classical case, diffusion coefficients depend significantly on the potential energy surface, in particular on how dispersion forces modulate O-O distances. NQEs, however, make the diffusion less sensitive to the underlying potential and geometry of the wire, presumably making them more robust to environment fluctuations.

Diffusion Under Geometrical Constraint

OpenAIRE

Ogawa, Naohisa

2014-01-01

Here we discus the diffusion of particles in a curved tube. This kind of transport phenomenon is observed in biological cells and porous media. To solve such a problem, we discuss the three dimensional diffusion equation with a confining wall forming a thinner tube. We find that the curvature appears in a effective diffusion coefficient for such a quasi-one-dimensional system. As an application to higher dimensional case, we discuss the diffusion in a curved surface with ...

Near-surface analysis with nuclear reactions and scattering

International Nuclear Information System (INIS)

Dunning, K.L.; Hirvonen, J.K.

1974-01-01

Very useful information about the elemental composition of solids in the surface and near-surface regions can be obtained with small accelerators and suitable auxiliary apparatus. Two methods which produce data from which quantitative concentration depth profiles can be constructed and which have been used extensively at this laboratory are: nuclear resonance profiling and Rutherford backscattering. The first method is described in detail. Data are given on profiles of Al and Al + Na films implanted on silicon substrates. Rutherford backscattering spectra for chromium implanted into silicon dioxide are used to illustrate the improved depth sensitivity that can be obtained with a magnetic spectrometer in depth concentration profiles of heavy impurities relative to that obtainable with a conventional semiconductor detector

Thermal diffusion of chlorine in uranium dioxide

International Nuclear Information System (INIS)

Pipon, Y.; Toulhoat, N.; Moncoffre, N.; Jaffrezic, H.; Gavarini, S.; Martin, P.; Raimbault, L.; Scheidegger, A.M.

2006-01-01

In a nuclear reactor, isotopes such as 35 Cl present as impurities in the nuclear fuel are activated by thermal neutron capture. During interim storage or geological disposal of nuclear fuel, the activation products such as 36 Cl may be released from the fuel to the geo/biosphere and contribute to the ''instant release fraction'' as they are likely to migrate in defects and grain boundaries. In order to differentiate diffusion mechanisms due to ''athermal'' processes during irradiation from thermally activated diffusion, both irradiation and thermal effects must be assessed. This work concerns the measurement of the thermal diffusion coefficient of chlorine in UO 2 . 37 Cl was implanted at a 10 13 at/cm 2 fluence in depleted UO 2 samples which were then annealed in the 900-1200 C temperature range and finally analyzed by secondary ion mass spectrometry (SIMS) to obtain 37 Cl depth profiles. The migration process appears to be rather complex, involving mechanisms such as atomic, grain boundary, directed diffusion along preferential patterns as well as trapping into sinks before successive effusion. However, using a diffusion model based on general equation of transport, apparent diffusion coefficients could be calculated for 1000 and 1100 C and a mean activation energy of 4.3 eV is proposed. This value is one of the lowest values compared to those found in literature for other radionuclides pointing out a great ability of chlorine to migrate in UO 2 at relatively low temperatures. In order to unequivocally determine the diffusion behaviour of both implanted and pristine chlorine before and after thermal annealing, the structural environment of chlorine in UO 2 was examined using micro X-ray fluorescence (micro-XRF) and micro X-ray absorption spectroscopy (micro-XAS). (orig.)

Diffusion of lactate and ammonium in relation to growth of Geotrichum candidum at the surface of solid media.

Science.gov (United States)

Aldarf, M; Fourcade, F; Amrane, A; Prigent, Y

2004-07-05

Geotrichum candidum was cultivated at the surface of solid model media containing peptone to simulate the composition of Camembert cheese. The surface growth of G. candidum induced the diffusion of substrates from the core to the rind and the diffusion of produced metabolites from the rind to the core. In the range of pH measured during G. candidum growth, constant diffusion coefficients were found for lactate and ammonium, 0.4 and 0.8 cm(2) day(-1), respectively, determined in sterile culture medium. Growth kinetics are described using the Verlhust model and both lactate consumption and ammonium production are considered as partially linked to growth. The experimental diffusion gradients of lactate and ammonium recorded during G. candidum growth have been fitted. The diffusion/reaction model was found to match with experimental data until the end of growth, except with regard to ammonium concentration gradients in the presence of lactate in the medium. Indeed, G. candidum preferentially assimilated peptone over lactate as a carbon source, resulting in an almost cessation of ammonium release before the end of growth. On peptone, it was found that the proton transfer did not account for the ammonium concentration gradients. Indeed, amino acids, being positively charged, are involved in the proton transfer at the beginning of growth. This effect can be neglected in the presence of lactate within the medium, and the sum of both lactate consumption and ammonium release gradients corresponded well to the proton transfer gradients, confirming that both components are responsible for the pH increase observed during the ripening of soft Camembert cheese. Copyright 2004 Wiley Periodicals, Inc.

Speciation of plutonium during sorption and diffusion in Opalinus clay

International Nuclear Information System (INIS)

Kaplan, Ugras

2013-01-01

The presented work was carried out in the framework of the BMWi-project ''Interaction and migration of actinides in natural clay rocks taking into account humic substances and clay organic matter - Interactions of neptunium and plutonium with natural clay rocks''. For the long-term safety assessments of nuclear repositories, the possible migration of the radiotoxic wastes into the environment must be considered. Due to its long half-life (T 1/2 = 24000 y) 239 Pu has a significant contribution to the radiotoxicity of spent nuclear fuel in a repository after long periods of storage. The redox-sensitive plutonium has a very complicated chemical behavior. In aqueous solution under environmental relevant conditions Pu can exist in oxidation states +III to +VI and it can exist in up to four oxidation states simultaneously in a solution. Clays are considered as a possible host rock formation for of high-level radioactive waste disposal. Therefore, detailed information on the mobilization and immobilization of plutonium through / into the groundwater from a repository are of special interest. In this work new insights into the interaction between Pu and natural Opalinus clay (OPA, Mont Terri, Switzerland) are obtained with regard to the disposal of heat-generating radioactive waste in a deep geological repository.rnThe focus of this work was on the determination of the speciation of Pu on the mineral surface after sorption and diffusion process by different synchrotron based techniques (μ-XRF, μ-XANES/-EXAFS, μ-XRD, and EXAFS/XANES). The interaction between Pu and OPA was studied in batch sorption and diffusion experiments in dependence of various experimental parameters (e.g. pH, Pu oxidation state). Sorption experiments showed that some experimental parameters (e.g. temperature, humic acid) have a significant impact on the sorption of Pu on OPA. Speciation studies were performed as a function of various chemical parameters on powder samples form batch experiments as

Development of new Z-factors for the evaluation of the circumferential surface crack in nuclear pipes

International Nuclear Information System (INIS)

Choi, Y.H.; Chung, Y.K.; Park, Y.W.; Lee, J.B.

1997-01-01

The purpose of this study is to develop new Z-factors to evaluate the behavior of a circumferential surface crack in nuclear pipe. Z-factor is a load multiplier used in the Z-factor method, which is one of the ASME Code Sec. XI's recommendations for the estimation of a surface crack in nuclear pipe. It has been reported that the load carrying capacities predicted from the current ASME Code Z-factors, are not well in agreement with the experimental results for nuclear pipes with a surface crack. In this study, new Z-factors for ferritic base metal, ferritic submerged arc welding (SAW) weld metal, austenitic base metal, and austenitic SAW weld metal are obtained by use of the surface crack for thin pipe (SC.TNP) method based on GE/EPRI method. The desirability of both the SC.TNP method and the new Z-factors is examined using the results from 48 pipe fracture experiments for nuclear pipes with a circumferential surface crack. The results show that the SC.TNP method is good for describing the circumferential surface crack behavior and the new Z-factors are well in agreement with the measured Z-factors for both ferritic and austenitic pipes. (orig.)

Heat, mass, and momentum transport model for hydrogen diffusion flames in nuclear reactor containments

International Nuclear Information System (INIS)

Travis, J.R.

1985-01-01

It is now possible to analyze the time-dependent, fully three-dimensional behavior of hydrogen diffusion flames in nuclear reactor containments. This analysis involves coupling the full Navier-Stokes equations with multi-species transport to the global chemical kinetics of hydrogen combustion. A transport equation for the subgrid scale turbulent kinetic energy density is solved to produce the time and space dependent turbulent transport coefficients. The heat transfer coefficient governing the exchange of heat between fluid computational cells adjacent to wall cells is calculated by a modified Reynolds analogy formulation. The analysis of a MARK-III containment indicates very complex flow patterns that greatly influence fluid and wall temperatures and heat fluxes. 18 refs., 24 figs

Surface diffuse discharge mechanism of well-aligned atmospheric pressure microplasma arrays

International Nuclear Information System (INIS)

Zhou Ren-Wu; Li Jiang-Wei; Chen Mao-Dong; Zhang Xian-Hui; Liu Dong-Ping; Yang Si-Ze; Zhou Ru-Sen; Zhuang Jin-Xing; Ostrikov, Kostya

2016-01-01

A stable and homogeneous well-aligned air microplasma device for application at atmospheric pressure is designed and its electrical and optical characteristics are investigated. Current-voltage measurements and intensified charge coupled device (ICCD) images show that the well-aligned air microplasma device is able to generate a large-area and homogeneous discharge at the applied voltages ranging from 12 kV to 14 kV, with a repetition frequency of 5 kHz, which is attributed to the diffusion effect of plasma on dielectric surface. Moreover, this well-aligned microplasma device may result in the uniform and large-area surface modification of heat-sensitive PET polymers without damage, such as optimization in hydrophobicity and biocompatibility. In the biomedical field, the utility of this well-aligned microplasma device is further testified. It proves to be very efficient for the large-area and uniform inactivation of E. coli cells with a density of 10 3 /cm 2 on LB agar plate culture medium, and inactivation efficiency can reach up to 99% for 2-min treatment. (paper)

Microstructural characteristics of HIP-bonded monolithic nuclear fuels with a diffusion barrier

Science.gov (United States)

Jue, Jan-Fong; Keiser, Dennis D.; Breckenridge, Cynthia R.; Moore, Glenn A.; Meyer, Mitchell K.

2014-05-01

Due to the limitation of maximum uranium load achievable by dispersion fuel type, the Global Threat Reduction Initiative is developing an advanced monolithic fuel to convert US high-performance research reactors to low-enriched uranium. Hot-isostatic-press (HIP) bonding was the single process down-selected to bond monolithic U-Mo fuel meat to aluminum alloy cladding. A diffusion barrier was applied to the U-Mo fuel meat by roll-bonding process to prevent extensive interaction between fuel meat and aluminum-alloy cladding. Microstructural characterization was performed on fresh fuel plates fabricated at Idaho National Laboratory. Interfaces between the fuel meat, the cladding, and the diffusion barrier, as well as between the U-10Mo fuel meat and the Al-6061 cladding, were characterized by scanning electron microscopy. Preliminary results indicate that the interfaces contain many different phases while decomposition, second phases, and chemical banding were also observed in the fuel meat. The important attributes of the HIP-bonded monolithic fuel are: line. Some of these attributes might be critical to the irradiation performance of monolithic U-10Mo nuclear fuel. There are several issues or concerns that warrant more detailed study, such as precipitation along the cladding-to-cladding bond line, chemical banding, uncovered fuel-zone edge, and the interaction layer between the U-Mo fuel meat and zirconium. Future post-irradiation examination results will focus, among other things, on identifying in-reactor failure mechanisms and, eventually, directing further fresh fuel characterization efforts.

Thomas-Fermi treatment of nuclear masses, deformations and density distributions

International Nuclear Information System (INIS)

Myers, W.D.; Swiatecki, W.J.

1994-08-01

A recently completed Thomas-Fermi model of nuclei is described. Six adjustable parameters of the effective nucleon-nucleon interaction were fitted to the shell-corrected binding energies of 1654 nuclei and to the diffuseness of the nuclear surface. The model is then successful in reproducing nuclear sizes, and only small deviations are found between calculated and measured fission barriers of 36 nuclei. The model is applied to the prediction of fission barriers of light elements, to drip-line nuclei like 82 Sn and 170 Sn, to the properties of nuclear and neutron matter and to nuclear bubble configurations with Z 2 /A ∼ 100. The relation of a Thomas-Fermi theory to the Droplet and Liquid Drop models is illustrated

The role of spin-orbit potential in nuclear prolate-shape dominance

Energy Technology Data Exchange (ETDEWEB)

Takahara, Satoshi, E-mail: staka@ks.kyorin-u.ac.jp [Kyorin University, School of Medicine, Mitaka, Tokyo 181-8611 (Japan); Onishi, Naoki [University of Tokyo (Japan); University of Yamanashi (Japan); Shimizu, Yoshifumi R. [Department of Physics, Graduate School of Science, Kyushu University, Fukuoka 812-8581 (Japan); Tajima, Naoki [Department of Applied Physics, University of Fukui, 3-9-1 Bunkyo, Fukui 910-8507 (Japan)

2011-08-26

It is confirmed, in terms of the Woods-Saxon-Strutinsky method, that the spin-orbit potential plays a decisive role in the predominance of prolate deformation, which has been a long standing problem in nuclear physics. It is originated from the combined effects of the spin-orbit coupling and the diffused surface of the potential, in agreement with the previous work based on a more schematic Nilsson-Strutinsky method. The degree of prolate-shape dominance exhibits an oscillatory behavior with respect to the strength of spin-orbit potential and, the prolate-shape dominance is realized at the proper strength of the spin-orbit potential together with the standard surface diffuseness; this oscillatory behavior disappears in case of small diffuseness corresponding to ellipsoidal cavity. The calculated energy differences between oblate and prolate minima in this Letter are consistent with those of our extensive self-consistent calculations of the Hartree-Fock + BCS method with the Skyrme interaction.

The role of spin-orbit potential in nuclear prolate-shape dominance

International Nuclear Information System (INIS)

Takahara, Satoshi; Onishi, Naoki; Shimizu, Yoshifumi R.; Tajima, Naoki

2011-01-01

It is confirmed, in terms of the Woods-Saxon-Strutinsky method, that the spin-orbit potential plays a decisive role in the predominance of prolate deformation, which has been a long standing problem in nuclear physics. It is originated from the combined effects of the spin-orbit coupling and the diffused surface of the potential, in agreement with the previous work based on a more schematic Nilsson-Strutinsky method. The degree of prolate-shape dominance exhibits an oscillatory behavior with respect to the strength of spin-orbit potential and, the prolate-shape dominance is realized at the proper strength of the spin-orbit potential together with the standard surface diffuseness; this oscillatory behavior disappears in case of small diffuseness corresponding to ellipsoidal cavity. The calculated energy differences between oblate and prolate minima in this Letter are consistent with those of our extensive self-consistent calculations of the Hartree-Fock + BCS method with the Skyrme interaction.

Sulphate solubility and sulphate diffusion in oxide glasses: implications for the containment of sulphate-bearing nuclear wastes

International Nuclear Information System (INIS)

Lenoir, M.

2009-09-01

The thesis deals with sulphate solubility and sulphate diffusion in oxide glasses, in order to control sulphate incorporation and sulphate volatilization in nuclear waste glasses. It was conducted on simplified compositions, in the SiO 2 -B 2 O 3 -R 2 O (R = Li, Na, K, Cs), SiO 2 -B 2 O 3 -BaO and V 2 O 5 -B 2 O 3 -BaO systems. These compositions allowed us to study the influence of the nature of network-modifying ions (Li + , Na + , K + , Cs + or Ba 2+ ) and also of former elements (Si, B, V), on structure and properties of glasses. Sulphate volatility is studied in sodium borosilicate melts using an innovative technique of sulphate quantitation with Raman spectroscopy. This technique is useful to obtain kinetic curves of sulphate volatilization. The establishment of a model to fit these curves leads to the determination of diffusion coefficients of sulphate. These diffusion coefficients can thus be compared to diffusion coefficients of other species, determined by other techniques and presented in the literature. They are also linked to diffusion coefficients in relation with the viscosity of the melts. Concerning sulphate solubility in glasses, it depends on glass composition and on the nature of sulphate incorporated. Sulphate incorporation in alkali borosilicate glasses leads to the formation of a sulphate layer floating on top of the melt. Sulphate incorporation in barium borosilicate and boro-vanadate glasses leads to the crystallization of sulphate species inside the vitreous matrix. Moreover, sulphate solubility is higher in these glasses than in alkali borosilicates. Finally, exchanges between cations present in glasses and cations present in the sulphate phase are also studied. (author)

Surface coating Zr or Zr alloy nuclear fuel elements

International Nuclear Information System (INIS)

Donaghy, R.E.; Sherman, A.H.

1980-01-01

A method is disclosed for preventing stress corrosion cracking or metal embrittlement of a zirconium or zirconium alloy container that is to be coated on the inside surface with a layer of a metal such as copper, a copper alloy, nickel, or iron and used for holding nuclear fuel material as a nuclear fuel element. The zirconium material is etched in an etchant solution, desmutted mechanically or ultrasonically, oxidized to form an oxide coating on the zirconium, cleaned in an aqueous alkaline cleaning solution, activated for electroless deposition of a metal layer and contacted with an electroless metal plating solution. This method provides a boundary layer of zirconium oxide between the zirconium container and the metal layer. (author)

Interactions of RuO4(g) with different surfaces in nuclear reactor containments

International Nuclear Information System (INIS)

Holm, J.; Glaenneskog, H.; Ekberg, C.

2008-07-01

During a severe nuclear reactor accident with air ingress, ruthenium in the form of RuO4 can be released from the nuclear fuel. Hence, it is important to investigate how the reactor containment is able to reduce the source term of ruthenium. This work has investigated the distribution of RuO4 between an aqueous and gaseous phase in the temperature interval of 20-50 deg. C by on-line measurements with an experimental set-up made of glass. The experiments showed that RuO4 is almost immediately distributed in the aqueous phase after its introduction in the set-up in the entire temperature interval. However, the deposition of ruthenium on the glass surfaces in the system was significant. The speciation of the ruthenium on the glass surfaces was studied by SEM-EDX and ESCA and was determined to be the expected RuO2. Experiments of interactions between gaseous ruthenium tetroxide and the metals aluminium, copper and zinc have been investigated. The metals were treated by RuO4 (g) at room temperature and analyzed with ESCA, SEM and XRD. The analyses show that the black ruthenium deposits on the metal surfaces were RuO2, i.e. the RuO4 (g) has been transformed on the metal surfaces to RuO2(s). The analyses showed also that there was a significant deposition of ruthenium tetroxide especially on the copper and zinc samples. Aluminium has a lower ability to deposit gaseous ruthenium tetroxide than the other metals. The conclusion that can be made from the results is that surfaces in nuclear reactor containments will likely reduce the source term in the case of a severe accident in a nuclear power plant. (au)

Au nanowire junction breakup through surface atom diffusion

Science.gov (United States)

Vigonski, Simon; Jansson, Ville; Vlassov, Sergei; Polyakov, Boris; Baibuz, Ekaterina; Oras, Sven; Aabloo, Alvo; Djurabekova, Flyura; Zadin, Vahur

2018-01-01

Metallic nanowires are known to break into shorter fragments due to the Rayleigh instability mechanism. This process is strongly accelerated at elevated temperatures and can completely hinder the functioning of nanowire-based devices like e.g. transparent conductive and flexible coatings. At the same time, arranged gold nanodots have important applications in electrochemical sensors. In this paper we perform a series of annealing experiments of gold and silver nanowires and nanowire junctions at fixed temperatures 473, 673, 873 and 973 K (200 °C, 400 °C, 600 °C and 700 °C) during a time period of 10 min. We show that nanowires are especially prone to fragmentation around junctions and crossing points even at comparatively low temperatures. The fragmentation process is highly temperature dependent and the junction region breaks up at a lower temperature than a single nanowire. We develop a gold parametrization for kinetic Monte Carlo simulations and demonstrate the surface diffusion origin of the nanowire junction fragmentation. We show that nanowire fragmentation starts at the junctions with high reliability and propose that aligning nanowires in a regular grid could be used as a technique for fabricating arrays of nanodots.

Determination of Optimal Parameters for Diffusion Bonding of Semi-Solid Casting Aluminium Alloy by Response Surface Methodology

Directory of Open Access Journals (Sweden)

Kaewploy Somsak

2015-01-01

Full Text Available Liquid state welding techniques available are prone to gas porosity problems. To avoid this solid state bonding is usually an alternative of preference. Among solid state bonding techniques, diffusion bonding is often employed in aluminium alloy automotive parts welding in order to enhance their mechanical properties. However, there has been no standard procedure nor has there been any definitive criterion for judicious welding parameters setting. It is thus a matter of importance to find the set of optimal parameters for effective diffusion bonding. This work proposes the use of response surface methodology in determining such a set of optimal parameters. Response surface methodology is more efficient in dealing with complex process compared with other techniques available. There are two variations of response surface methodology. The one adopted in this work is the central composite design approach. This is because when the initial upper and lower bounds of the desired parameters are exceeded the central composite design approach is still capable of yielding the optimal values of the parameters that appear to be out of the initially preset range. Results from the experiments show that the pressing pressure and the holding time affect the tensile strength of jointing. The data obtained from the experiment fits well to a quadratic equation with high coefficient of determination (R2 = 94.21%. It is found that the optimal parameters in the process of jointing semi-solid casting aluminium alloy by using diffusion bonding are the pressing pressure of 2.06 MPa and 214 minutes of the holding time in order to achieve the highest tensile strength of 142.65 MPa

Human Mars Surface Mission Nuclear Power Considerations

Science.gov (United States)

Rucker, Michelle A.

2018-01-01

A key decision facing Mars mission designers is how to power a crewed surface field station. Unlike the solar-powered Mars Exploration Rovers (MER) that could retreat to a very low power state during a Martian dust storm, human Mars surface missions are estimated to need at least 15 kilowatts of electrical (kWe) power simply to maintain critical life support and spacecraft functions. 'Hotel' loads alone for a pressurized crew rover approach two kWe; driving requires another five kWe-well beyond what the Curiosity rover’s Radioisotope Power System (RPS) was designed to deliver. Full operation of a four-crew Mars field station is estimated at about 40 kWe. Clearly, a crewed Mars field station will require a substantial and reliable power source, beyond the scale of robotic mission experience. This paper explores the applications for both fission and RPS nuclear options for Mars.

Adsorption and diffusion of Ga and N adatoms on GaN surfaces: Comparing the effects of Ga coverage and electronic excitation

Science.gov (United States)

Takeuchi, Noboru; Selloni, Annabella; Myers, T. H.; Doolittle, A.

2005-09-01

We present density-functional-theory calculations of the binding and diffusion of Ga and N adatoms on GaN (0001) and (000-1) surfaces under different conditions, including stoichiometric and Ga-rich surfaces, as well as in the presence of electron-hole (e-h) pairs induced by light- or electron-beam irradiation. We find that both Ga-rich conditions and electronic excitations cause a significant reduction of the adatom diffusion barriers, as required to improve the quality of the material. However, the two effects are nonadditive, as the influence of e-h pairs are found to be less important for the more metallic situations.

Strengthening of the nuclear valve sealing surface by laser cladding technology

International Nuclear Information System (INIS)

Shi Shihong; Huang Guodong

1998-07-01

A 5 kW laser with CO 2 flow transverse for cladding Co-base alloy or Ni-base alloy coat on the austenite matrix of the nuclear valve sealing surface is introduced. The results show that, after the sealing surface of valve is processed by the laser cladding, the coat of 3.0 mm thick can be made with smooth surface. The test and comparison analysis indicate that the structure and all performance have obvious advantages over that of the plasma spurt welding, bead welding and flame welding processing

Deposition of RuO{sub 4} on various surfaces in a nuclear reactor containment

Energy Technology Data Exchange (ETDEWEB)

Holm, Joachim, E-mail: joachim.holm@chalmers.s [Department of Nuclear Chemistry, Chalmers University of Technology, Se-412 96 Gothenburg (Sweden); Glaenneskog, Henrik [Ringhals AB, SE-430 22, Vaeroebacka (Sweden); Ekberg, Christian [Department of Nuclear Chemistry, Chalmers University of Technology, Se-412 96 Gothenburg (Sweden)

2009-07-01

During a severe nuclear reactor accident with air ingress, ruthenium can be released from the nuclear fuel in the form of ruthenium tetroxide. Hence, it is important to investigate how the reactor containment is able to reduce the source term of ruthenium. The aim of this work was to investigate the deposition of gaseous ruthenium tetroxide on aluminium, copper and zinc, which all appear in relatively large amounts in reactor containment. The experiments show that ruthenium tetroxide is deposited on all the metal surfaces, especially on the copper and zinc surfaces. A large deposition of ruthenium tetroxide also appeared on the relatively inert glass surfaces in the experimental set-ups. The analyses of the different surfaces, with several analytical methods, showed that the form of deposited ruthenium was mainly ruthenium dioxide.

The effects of size, shape, and surface composition on the diffusive behaviors of nanoparticles at/across water–oil interfaces via molecular dynamics simulations

Energy Technology Data Exchange (ETDEWEB)

Gao, Wei; Jiao, Yang; Dai, Lenore L., E-mail: Lenore.Dai@asu.edu [Arizona State University, School of Engineering of Matter, Transport, and Energy (United States)

2016-04-15

We have employed molecular dynamics simulations to systematically investigate the effects of nanoparticles’ structural and chemical properties on their diffusive behaviors at/across the water–benzene interface. Four different nanoparticles were studied: modified hydrocarbon nanoparticles with a mean diameter of 1.2 nm (1.2HCPs), modified hydrocarbon nanoparticles with a mean diameter of 0.6 nm (0.6HCPs), single-walled carbon nanotubes (SWCNTs), and buckyballs. We found that the diffusion coefficients of 0.6 and 1.2HCP were larger than the corresponding values predicted using the Stokes–Einstein (SE) equation and attributed this deviation to the small particle size and the anisotropy of the interface system. In addition, the observed directional diffusive behaviors for various particles were well-correlated with the derivative of the potential of mean force (PMF), which might indicate an effective driving force for the particles along the direction perpendicular to the interface. We also found that nanoparticles with isotropic shape and uniform surface, e.g., buckyballs, tend to have smaller diffusion coefficients than those of nanoparticles with comparable dimensions but anisotropic shapes and non-uniform surface composition, e.g., SWCNT and 0.6HCP. One possible hypothesis for this behavior is that the “perfect” isotropic shape and uniform surface of buckyballs result in a better-defined “solvation shell” (i.e., a shell of solution molecules), which leads to a larger “effective radius” of the particle, and thus, a reduced diffusion coefficient.

Diffusion induced nuclear reactions in metals: a possible source of heat in the core

International Nuclear Information System (INIS)

Hamza, V.M.; Iyer, S.S.S.

1989-01-01

It has recently been proposed that diffusion of light nuclei in metals can give rise to unusual electrical charge distributions in their lattice structures, inducing thereby certain nuclear reactions that are otherwise uncommon. In the light of these results we advance the hypothesis that such nuclear reactions take place in the metal rich core of the earth, based on following observations: 1 - The solubility of hydrogen in metals is relatively high compared to that in silicates. 2 - Studies of rare gas samples in intraplate volcanos and diamonds show that 3 He/ He ratio increases with depth in the mantle. 3 - There are indications that He is positively correlated with enrichment of metals in lavas. We propose that hydrogen incorporated into metallic phases at the time of planetary accretion was carried to the core by downward migration of metal rich melts during the early states of proto-earth. Preliminary estimates suggest that cold fusion reactions can give rise to an average rate of heat generation of 8.2x10 12 W and may thus serve as a supplementary source of energy for the geomagnetic dynamo. (author)

Effects of the Distance from a Diffusive Surface on the Objective and Perceptual Evaluation of the Sound Field in a Small Simulated Variable-Acoustics Hall

Directory of Open Access Journals (Sweden)

Louena Shtrepi

2017-02-01

Full Text Available Simulations of the acoustic effects that diffusive surfaces have on the objective acoustic parameters and on sound perception have not yet been fully understood. To this end, acoustic simulations have been performed in Odeon in the model of a variable-acoustic concert hall. This paper is presented as a follow-up study to a previous paper that dealt with in-field measurements only. As in measurements, a diffusive and a reflective condition of one of the lateral walls have been considered in the room models. Two modeling alternatives of the diffusive condition, that is, (a a flat surface with high scattering coefficient applied; and (b a triangular relief modeled including edge diffraction, have been investigated. Objective acoustic parameters, such as early decay time (EDT, reverberation time (T30, clarity (C80, definition (D50, and interaural cross correlation (IACC, have been compared between the two conditions. Moreover, an auditory experiment has been performed to determine the maximum distance from a diffusive surface at which the simulated acoustic scattering effects are still audible. Although the simulated objective results showed a good match with measured values, the subjective results showed that the differences between the diffuse and reflective conditions become significant when model (b is used.

The experimental study of pollution meteorology and diffusion feature in the site of Tianwan Nuclear Power Plant

International Nuclear Information System (INIS)

Hu Erbang; Yao Rentai; Xin Cuntian; Chen Jiayi

2003-01-01

The experimental observation and study of pollution meteorology and diffusion feature in site of Tianwan nuclear power plant is described. Four sets of (10, 30, 70, 100 m) sensors set on a 100-m-height tower to measure wind speed, wind direction and temperature were used to obtain hourly meteorological information during 1997-08 to 1999-08. The feature of middle scale wind field and the example and frequency of sea and land breezes are analyzed. The observation and formula of the internal boundary layer are completed. A simulation tests were done in a wind tunnel. In order to obtain the diffusion parameter the turbulence observation on two height of 100 m-height tower and 10 sets of SF 6 tracer experiments were done in summer, 1997. Based on above measured data the annual atmospheric dispersion factor and the accident probability dispersion factor at the boundary of an area of no residences were estimated. (authors)

Finite-volume scheme for anisotropic diffusion

Energy Technology Data Exchange (ETDEWEB)

Es, Bram van, E-mail: bramiozo@gmail.com [Centrum Wiskunde & Informatica, P.O. Box 94079, 1090GB Amsterdam (Netherlands); FOM Institute DIFFER, Dutch Institute for Fundamental Energy Research, The Netherlands" 1 (Netherlands); Koren, Barry [Eindhoven University of Technology (Netherlands); Blank, Hugo J. de [FOM Institute DIFFER, Dutch Institute for Fundamental Energy Research, The Netherlands" 1 (Netherlands)

2016-02-01

In this paper, we apply a special finite-volume scheme, limited to smooth temperature distributions and Cartesian grids, to test the importance of connectivity of the finite volumes. The area of application is nuclear fusion plasma with field line aligned temperature gradients and extreme anisotropy. We apply the scheme to the anisotropic heat-conduction equation, and compare its results with those of existing finite-volume schemes for anisotropic diffusion. Also, we introduce a general model adaptation of the steady diffusion equation for extremely anisotropic diffusion problems with closed field lines.

Spatial-temporal evolution of self-organized loop-patterns on a water surface and a diffuse discharge in the gap

Science.gov (United States)

Li, Xuechen; Geng, Jinling; Jia, Pengying; Zhang, Panpan; Zhang, Qi; Li, Yaru

2017-11-01

Excited by an alternating current voltage, a patterned discharge and a diffuse discharge are generated in a needle to liquid configuration. Using an intensified charge-coupled device (ICCD), temporal evolution of the discharge between the two electrodes is investigated for the diffuse mode and the patterned mode, respectively. For the diffuse mode, the positive discharge is in a glow regime, and the negative discharge is in a Townsend discharge regime. For the patterned mode, the discharge always belongs to the Townsend discharge regime. Moreover, in the patterned mode, various patterns including the single loop, single loop with the surrounding corona, triple loops, and concentric loops with a central spot are observed on the water surface with the increasing positive peak-value of the applied voltage (Upp). Temporally resolved images of the loop-patterns are captured on the water surface. From the electrical measurements and the ICCD imaging, it is found that the loop pattern emerges after the discharge bridges the two electrodes. Then, it begins to evolve and finally degenerates with the decrease in the discharge current. The pattern does not disappear until the discharge quenches. Formation of the loop-patterns is attributed to the role of negative ions.

Reduction of transient diffusion from 1 endash 5 keV Si+ ion implantation due to surface annihilation of interstitials

International Nuclear Information System (INIS)

Agarwal, A.; Gossmann, H.-.; Eaglesham, D.J.; Pelaz, L.; Jacobson, D.C.; Haynes, T.E.; Erokhin, Y.E.

1997-01-01

The reduction of transient enhanced diffusion (TED) with reduced implantation energy has been investigated and quantified. A fixed dose of 1x10 14 cm -2 Si + was implanted at energies ranging from 0.5 to 20 keV into boron doping superlattices and enhanced diffusion of the buried boron marker layers was measured for anneals at 810, 950, and 1050 degree C. A linearly decreasing dependence of diffusivity enhancement on decreasing Si + ion range is observed at all temperatures, extrapolating to ∼1 for 0 keV. This is consistent with our expectation that at zero implantation energy there would be no excess interstitials from the implantation and hence no TED. Monte Carlo modeling and continuum simulations are used to fit the experimental data. The results are consistent with a surface recombination length for interstitials of <10 nm. The data presented here demonstrate that in the range of annealing temperatures of interest for p-n junction formation, TED is reduced at smaller ion implantation energies and that this is due to increased interstitial annihilation at the surface. copyright 1997 American Institute of Physics

Nuclear Fusion Research Understanding Plasma-Surface Interactions

CERN Document Server

Clark, Robert E.H

2005-01-01

It became clear in the early days of fusion research that the effects of the containment vessel (erosion of "impurities") degrade the overall fusion plasma performance. Progress in controlled nuclear fusion research over the last decade has led to magnetically confined plasmas that, in turn, are sufficiently powerful to damage the vessel structures over its lifetime. This book reviews current understanding and concepts to deal with this remaining critical design issue for fusion reactors. It reviews both progress and open questions, largely in terms of available and sought-after plasma-surface interaction data and atomic/molecular data related to these "plasma edge" issues.

Exact Solution of Fractional Diffusion Model with Source Term used in Study of Concentration of Fission Product in Uranium Dioxide Particle

International Nuclear Information System (INIS)

Fang Chao; Cao Jianzhu; Sun Lifeng

2011-01-01

The exact solution of fractional diffusion model with a location-independent source term used in the study of the concentration of fission product in spherical uranium dioxide (UO 2 ) particle is built. The adsorption effect of the fission product on the surface of the UO 2 particle and the delayed decay effect are also considered. The solution is given in terms of Mittag-Leffler function with finite Hankel integral transformation and Laplace transformation. At last, the reduced forms of the solution under some special physical conditions, which is used in nuclear engineering, are obtained and corresponding remarks are given to provide significant exact results to the concentration analysis of nuclear fission products in nuclear reactor. (nuclear physics)

Nuclear industry will soon surface

International Nuclear Information System (INIS)

Anon.

1978-01-01

The Japan Atomic Industrial Forum has carried out the annual survey of nuclear industry from the very inception of the development of nuclear power in Japan. The aim is to research and analyze nuclear-related expenditures, sales and manpower, as well as the future prospect of mining and manufacturing industries, electric utilities, trading companies and other related industries. The 19th fact-finding survey investigated into the actual conditions of the nuclear industry from April, 1977, to March, 1978. The number of companies surveyed increased by 75 from the previous year to 1,244, of which 883 or 71% responded to the questions. 501 companies did the business in the field of nuclear power. The first thing to be pointed out about the economic conditions of the nuclear industry is that the nuclear related expenditures increased in electric utilities, mining and manufacturing industries and trading companies, and exceeded 1 trillion yen mark for the first time in the private sector. It is likely that the current nuclear-related activities of mining and manufacturing industries will soon increase, but it will not be easy to wipe off the cumulative deficit of the industries. The employees increased by more than 7% in the nuclear-related sectors of electric utilities and mining and manufacturing industries. The facilities of nuclear supply industry were operated at the average rate of 50%. (Kako, I.)

Symmetries and modelling functions for diffusion processes

International Nuclear Information System (INIS)

Nikitin, A G; Spichak, S V; Vedula, Yu S; Naumovets, A G

2009-01-01

A constructive approach to the theory of diffusion processes is proposed, which is based on application of both symmetry analysis and the method of modelling functions. An algorithm for construction of the modelling functions is suggested. This algorithm is based on the error function expansion (ERFEX) of experimental concentration profiles. The high-accuracy analytical description of the profiles provided by ERFEX approximation allows a convenient extraction of the concentration dependence of diffusivity from experimental data and prediction of the diffusion process. Our analysis is exemplified by its employment in experimental results obtained for surface diffusion of lithium on the molybdenum (1 1 2) surface precovered with dysprosium. The ERFEX approximation can be directly extended to many other diffusion systems.

Application of diffusion ordered-1H-nuclear magnetic resonance spectroscopy to quantify sucrose in beverages.

Science.gov (United States)

Cao, Ruge; Nonaka, Airi; Komura, Fusae; Matsui, Toshiro

2015-03-15

This work focuses on a quantitative analysis of sucrose using diffusion ordered-quantitative (1)H-nuclear magnetic resonance spectroscopy (DOSY-qNMR), where an analyte can be isolated from interference based on its characteristic diffusion coefficient (D) in gradient magnetic fields. The D value of sucrose in deuterium oxide at 30°C was 4.9 × 10(-10)m(2)/s at field gradient pulse from 5.0 × 10(-2) to 3.0 × 10(-1)T/m, separated from other carbohydrates (glucose and fructose). Good linearity (r(2)=0.9999) was obtained between sucrose (0.5-20.0 g/L) and the resonance area of target glucopyranosyl-α-C1 proton normalised to that of cellobiose C1 proton (100.0 g/L, as an internal standard) in 1D sliced DOSY spectrum. The DOSY-qNMR method was successfully applied to quantify sucrose in orange juice (36.1 ± 0.5 g/L), pineapple juice (53.5 ± 1.1g/L) and a sports drink (24.7 ± 0.6g/L), in good agreement with the results obtained by an F-kit method. Copyright © 2014 Elsevier Ltd. All rights reserved.

Electron paramagnetic resonance and dynamic nuclear polarization of char suspensions: surface science and oximetry

DEFF Research Database (Denmark)

Clarkson, R B; Odintsov, B M; Ceroke, P J

1998-01-01

; they can be calibrated and used for oximetry. Biological stability and low toxicity make chars good sensors for in vivo measurements. Scalar and dipolar interactions of water protons at the surfaces of chars may be utilized to produce dynamic nuclear polarization (DNP) of the nuclear spin population...

GIS surface effects archive of underground nuclear detonations conducted at Yucca Flat and Pahute Mesa, Nevada Test Site, Nevada

International Nuclear Information System (INIS)

Grasso, D.N.

2001-01-01

This report presents a new comprehensive, digital archive of more than 40 years of geologic surface effects maps produced at individual detonation sites throughout the Yucca Flat and Pahute Mesa nuclear testing areas of the Nevada Test Site, Nye County, Nevada. The Geographic Information System (GIS) surface effects map archive on CD-ROM (this report) comprehensively documents the surface effects of underground nuclear detonations conducted at two of the most extensively used testing areas of the Nevada Test Site. Between 1951 and 1992, numerous investigators of the U.S. Geological Survey, the Los Alamos National Laboratory, the Lawrence Livermore National Laboratory, and the Defense Threat Reduction Agency meticulously mapped the surface effects caused by underground nuclear testing. Their work documented the effects of more than seventy percent of the underground nuclear detonations conducted at Yucca Flat and all of the underground nuclear detonations conducted at Pahute Mesa

Understanding the apparent diffusivity of Sr-85 ion for MX-80 in different salinity condition at low dry density

International Nuclear Information System (INIS)

Ahmad Hasnulhadi Che Kamaruddin

2012-01-01

The apparent diffusivity of strontium-85 in the compacted MX-80 bentonite under different salinity conditions and dry densities was conducted were studied from the viewpoint of activation energy. Through in-diffusions experiments the effect of salinity on diffusion behavior of Sr-85 ions can also can be explained. As we know, Sr-90 is by product of the fission materials of nuclear wastes and should be manage properly. Sr-85 is radioactive isotope with the same chemical properties of Sr-90. Adsorption affects only non-steady-state diffusion while at the steady state (e.g., a constant concentration gradient between a constant source and a constant sink), there is no net uptake or release by adsorption, so adsorption has no effect on diffusion (Drever, James I., 1997). The changes in the basal spacing of bentonite as a function of salinity are needed to be observed by the X-ray diffraction method to understand the microstructure changes in diffusion pathways for Sr-85 in MX-80 bentonite. As we know, there could be three potential pathways for radionuclide diffusion in solution-saturated, compacted montmorillonite, i.e., pore water, external surfaces and the internal surface (interlayer spaces) of montmorillonite aggregates (Kozaki et al., 2008). So, it is important to understand the diffusion processes in term of apparent diffusivity of Sr-85 ions in different salinity concentration at low dry density of MX-80. Several parameters are needed in explaining the process such as dry density, activation energy, temperature dependence and concentration of the salinity solutions. (author)

Protection of uranium by electrodeposition of nickel and diffusion; Protection de l'uranium par nickelage electrolytique et diffusion

Energy Technology Data Exchange (ETDEWEB)

Chauvin, G; Coriou, H; Hure, J [Commissariat a l' Energie Atomique, Saclay (France).Centre d' Etudes Nucleaires

1959-07-01

This work forms part of the overall scheme for investigating uranium canning for nuclear reactors. It is necessary to: - Protect the fuel (uranium) against corrosion by the cooling medium (heavy water, CO{sub 2}, etc.), in the case of a rupture of the can; - Avoid dangerous U-Al diffusion (when it is question of an aluminium can) by using an intermediate layer of a metal whose rate of diffusion in uranium is very much less than that of aluminium under the same conditions. In the present work based on the use of an intermediate layer of nickel the following points are apparent: 1) After having treated the uranium surface it is possible to electroplate nickel on it in such a way that after annealing without the application of any pressure these deposits give a very good intermetallic U-Ni diffusion. Though this diffusion is inferior to that of the UAl system, it enables the protection to be reinforced and thus the corrosion resistance to be increased. 2) When no other factor varies, the experiments show that the quality of the diffusion zones obtained depends on the nature of the electrolytic nickel bath. 3) The classical nickel baths used previously for this type of work contain 20 to 40 g/l of boric acid acting as an electrolytic buffer. As a result of this, the deposits are highly contaminated by boron (400 to 500 ppm of boron). We shall show that with a bath which does not contain nuclear poisons, a very clean U-Ni diffusion zone can be obtained. 4) After annealing for 100 hours at 700 deg. C, microscopic examination of the diffusion front reveals the existence of five layers under bright field illumination and six Layers in polarised light: at least four of these layers are well crystallised. 5) Important irregularities in the interface between uranium and the first intermetallic compound U{sub 6}Ni seem to be result of barriers to the diffusion caused by certain impurities in the uranium. 6) Of the seven definite compounds which can be formed during the

Surface treatments for material protection in nuclear power plants

International Nuclear Information System (INIS)

De, P.K.; Gadiyar, H.S.

1987-01-01

The paper highlights some of the surface treatment methods used in nuclear power plants to improve their performance. The corrosion resistance of zirconium alloys results from the formation of an adherent and protective film of ZrO 2 . Graphite coating of zircaloy-2 cladding minimizes the susceptibility to environmental induced cracking. Magnetite formation during the hot conditioning operation improves the corrosion resistance of carbon steel as well as controls the spread of radioactivity. It has been illustrated how the surface treatment is helpful for redistributing residual stress to facilitate conversion of tensile stress to compressive stress to mitigate failures due to stress corrosion and fatigue corrosion. Inhibitors and passivators can modify the surface conditions (in situ) of condenser tubes and cooling water systems. These aspects have been dealt in the text of the paper. (author). 8 refs., 3 figures

Recent progress in surface science 3

CERN Document Server

Danielli, J F; Rosenberg, M D

2013-01-01

Recent Progress in Surface Science, Volume 3 covers topics on the structure and mechanisms of the cell membranes. The book discusses the incorporation of chemisorbed species; the recent developments in the study of epitaxy; and the ""diffusion"" or ""hydride"" component of overpotential at cathodes of the ""platinum metals"". The text also describes the mechanism of hydrogen exchange in proteins; the nuclear magnetic resonance studies of lipids, lipoproteins, and cell membranes; and the monolayers of synthetic phospholipids. The formation, electrical properties, transport, and excitability cha

Atmospheric turbulence and diffusion research

International Nuclear Information System (INIS)

Hosker, R.P. Jr.

1993-01-01

The Atmospheric Turbulence and Diffusion Division (well known in the atmospheric dispersion community as the Atmospheric Turbulence and Diffusion Laboratory, ATDL) is one of several field facilities of NOAAs Air Resources Laboratory, headquartered in Silver Spring, Maryland. The laboratory conducts research on matters of atmospheric diffusion and turbulent exchange, concerning air quality. ATDD focuses attention on the physics of the lower atmosphere, with special emphasis on the processes contributing to atmospheric transport, dispersion, deposition, and air-surface exchange, and on the development of predictive capabilities using the results of this research. Research is directed toward issues of national and global importance related to the missions of DOE, to DOE's Oak Ridge Field Office, and to NOAA. The program is divided into four major projects: plume transport and diffusion in the planetary boundary layer, complex topography, canopy micrometeorology, and air-surface exchange

Effect of diffusion from a lateral surface on the rate of GaN nanowire growth

International Nuclear Information System (INIS)

Sibirev, N. V.; Tchernycheva, M.; Cirlin, G. E.; Patriarche, G.; Harmand, J. C.; Dubrovskii, V. G.

2012-01-01

The kinetics of the growth of GaN crystalline nanowires on a Si (111) surface with no catalyst is studied experimentally and theoretically. Noncatalytic GaN nanowires were grown by molecular-beam epitaxy with AlN inserts, which makes it possible to determine the rate of the vertical growth of nanowires. A model for the formation of GaN nanowires is developed, and an expression for their rate of growth is derived. It is shown that, in the general case, the dependence of the rate of growth on the nanowire diameter has a minimum. The diameter corresponding to the experimentally observed minimum of the rate of growth steadily increases with increasing diffusion flux from the lateral surface.

Density functional theory prediction for diffusion of lithium on boron-doped graphene surface

International Nuclear Information System (INIS)

Gao Shuanghong; Ren Zhaoyu; Wan Lijuan; Zheng Jiming; Guo Ping; Zhou Yixuan

2011-01-01

The density functional theory (DFT) investigation shows that graphene has changed from semimetal to semiconductor with the increasing number of doped boron atoms. Lithium and boron atoms acted as charge contributors and recipients, which attracted to each other. Further investigations show that, the potential barrier for lithium diffusion on boron-doped graphene is higher than that of intrinsic graphene. The potential barrier is up to 0.22 eV when six boron atoms doped (B 6 C 26 ), which is the lowest potential barrier in all the doped graphene. The potential barrier is dramatically affected by the surface structure of graphene.

Nuclear matter with pseudo-particle model: static bulk and surface properties

Energy Technology Data Exchange (ETDEWEB)

Idier, D.; Benhassine, B.; Farine, M.; Remaud, B.; Sebille, F.

1993-12-31

Direct calculations of cold and hot nuclear matter (bulk and surface properties) are carried out within the frame of a pseudo-particle model using a Gaussian decomposition of the distribution function. Comparisons with Hartree-Fock calculations, for a large class of effective interactions, show that such a model is reliable to reproduce accurately the equation of state of nuclear matter for large ranges of densities and temperatures. The number of Gaussian per nucleon and the Gaussian widths are critical parameters in that semi-classical model. (author) 13 refs.; 9 figs.; 2 tabs.

Nuclear matter with pseudo-particle model: static bulk and surface properties

International Nuclear Information System (INIS)

Idier, D.; Benhassine, B.; Farine, M.; Remaud, B.; Sebille, F.

1993-01-01

Direct calculations of cold and hot nuclear matter (bulk and surface properties) are carried out within the frame of a pseudo-particle model using a Gaussian decomposition of the distribution function. Comparisons with Hartree-Fock calculations, for a large class of effective interactions, show that such a model is reliable to reproduce accurately the equation of state of nuclear matter for large ranges of densities and temperatures. The number of Gaussian per nucleon and the Gaussian widths are critical parameters in that semi-classical model. (author) 13 refs.; 9 figs.; 2 tabs

Second generation diffusion model of interacting gravity waves on the surface of deep fluid

Directory of Open Access Journals (Sweden)

A. Pushkarev

2004-01-01

Full Text Available We propose a second generation phenomenological model for nonlinear interaction of gravity waves on the surface of deep water. This model takes into account the effects of non-locality of the original Hasselmann diffusion equation still preserving important properties of the first generation model: physically consistent scaling, adherence to conservation laws and the existence of Kolmogorov-Zakharov solutions. Numerical comparison of both models with the original Hasselmann equation shows that the second generation models improves the angular distribution in the evolving wave energy spectrum.

The structure of horizontal hydrogen-steam diffusion flames

International Nuclear Information System (INIS)

Chan, C.K.; Guerrero, A.

1997-01-01

This paper summarizes a systematic study on the stability, peak temperature and flame length of various horizontal hydrogen-steam diffusion flames in air. Results from this study are discussed in terms of their impact on hydrogen management in a nuclear containment building after a nuclear reactor accident. They show that, for a certain range of emerging hydrogen-steam compositions, a stable diffusion flame can anchor itself at the break in the primary heat transport system. The length of this flame can be up to 100 times the break diameter. This implies that creation of a stable diffusion flame at the break is a possible outcome of the deliberate ignition mitigation scheme. The high temperature and heat flux from a diffusion flame can threaten nearby equipment. However, due to the presence of steam and turbulent mixing with surrounding air, the peak temperatures of these diffusion flames are much lower than the adiabatic constant pressure combustion temperature of a stoichiometric hydrogen-air mixture. These results suggest that the threat of a diffusion flame anchored at the break may be less severe than conservative analysis would indicate. Furthermore, such a flame can remove hydrogen at the source and minimize the possibility of a global gas explosion. (author)

Nuclear power plant in the Oslofjord district

International Nuclear Information System (INIS)

Moshagen, H.; Kjeldsen, P.; Tesaker, E.

1972-01-01

Calculations of the spreading of cooling water effluent from a nuclear power plant in the waters adjacent to prospective sites in the Oslofjord district are made on the basis of the available hydrological data. Such data has been primarily that presented in reports 1-4 in the report series 'Nuclear power plant in the Oslofjord district'. In addition data from the Laboratory's previous investigations at Slagentangen and meteorological data from Norsk Institutt for Luftforskning for release points Brenntangen, Son, Langangsfjorden, Ormefjorden, Vardeaasen and Slagentangen have been used. The calculations are concentrated on trapping in layers, current effects on horizontal spreading and heat transfer through the surface. The results are presented partly as tables showing to what extent the cooling water breaks through to the surface with deeply submerged discharge and use of a diffuser, partly as diagrams showing layer zones and salinity, and partly as temperature rise curves drawn on maps of the various recipient areas. (JIW)

Diffusion of condenser water discharge

International Nuclear Information System (INIS)

Iwakiri, Toshio

1977-01-01

Thermal and nuclear power stations in Japan are mostly located in coastal area, and the cooling water is discharged into sea as warm water. Recently, large interest is taken in this matter, and it is desirable to predict the diffusion of warm discharge accurately and to take effective measures for lowering the temperature. As for the methods of predicting the diffusion of warm discharge, simplified estimation, mathematical analysis and hydrographical model experiment are used corresponding to objects and conditions. As for the measures to lower temperature, the method of discharging warm water into deep sea bottom was confirmed to be very effective. In this paper, the phenomena of diffusion of warm discharge in sea, the methods of predicting the diffusion of warm discharge, and the deep sea discharge as the measure for lowering temperature are outlined. The factors concerning the diffusion of warm discharge in sea are the conditions of discharge, topography and sea state, and the diffusion is roughly divided into mixing diffusion in the vicinity of warm water outlet and eddy diffusion in distant region. It is difficult to change artificially the conditions of diffusion in distant region, and the measures of raising the rate of dilution in near region are effective, therefore the deep sea discharge is adopted. (Kako, I.)

Studies of ionic diffusion in crystalline rock

International Nuclear Information System (INIS)

Ohlsson, Yvonne

2001-01-01

Matrix diffusion is of great importance in delaying radionuclides escaping from a deep geologic repository, on their way to the biosphere. There are, however, poorly understood mechanisms related to transport in pores with charged pore surfaces. Ions are affected by this charge and may be repelled or attracted by it. The rate of transport may be reduced, or even enhanced, as a result of this. Transport of ions is studied by traditional diffusion experiments, but mainly by a faster electrical conductivity method. With this method the pore connectivity, the formation factor variability and its relation to the porosity, as well as the surface conductivity are investigated. The method is compared. with traditional diffusion experiments, and an in-situ application is suggested and qualitatively tested. Furthermore, surface diffusion is studied by evaluating literature data and recently developed diffusion models. The pore connectivity reached to a depth of at least 15 cm in the rocks studied. The formation factor did not generally decrease with increasing sample length. It was also found that not only cations in the free pore water add to the electrical conductivity, but also at least part of those sorbed to the pore surfaces of the minerals. This surface conductivity influences the determination of the formation factor in low ionic strength pore waters, and was also found to be a function of the formation factor. It was furthermore dependent on the type of ion at the surface, giving for example a higher conductivity for Na + than for Cs + . It is not fully understood which part of the sorbed ions that are mobile. A simple model was developed assigning the mobile ions to the diffuse layer, and this model explained experimental data for diffusion of Cs + in clay well. This is contradicted by surface conductivity measurements that have shown that most mobile ions are found behind the Stern layer. The in-situ formation factor determination method seems promising. The most

Diffusion of helium and estimated diffusion coefficients of hydrogen dissolved in water-saturated, compacted Ca-montmorillonite

International Nuclear Information System (INIS)

Higashihara, Tomohiro; Sato, Seichi; Ohashi, Hiroshi; Otsuka, Teppei

2001-01-01

The diffusion coefficients of hydrogen gas dissolved in water-saturated, compacted montmorillonite are required to estimate the performance of bentonite buffer materials for geological disposal of nuclear waste. As part of the effort to determine the diffusion coefficients, the diffusion coefficients of helium in water-saturated, compacted calcium montmorillonite (Ca-montmorillonite) were determined as a function of dry density, 0.78 to 1.37x10 3 kg m -3 , by a transient diffusion method. The diffusion coefficients were from 8.3x10 -10 m 2 s -1 at 0.78x10 3 kgm -3 to 2.8x10 -10 m 2 s -1 at 1.37x10 3 kgm -3 . The data obtained by this diffusion experiment of helium were highly reproducible. The diffusion coefficients of helium in Ca-montmorillonite were somewhat larger than those previously obtained for helium in sodium montmorillonite (Na-montmorillonite). The diffusion coefficients of hydrogen gas in the montmorillonites were roughly estimated using the diffusion coefficients of helium. These estimates were based on assumptions that both helium and hydrogen molecules are non-adsorptive and that the geometric factors in the compacted montmorillonites are approximately the same for diffusion of helium and diffusion of hydrogen. (author)